#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MMEL1	79258	hgsc.bcm.edu	37	1	2560862	2560862	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr1:2560862C>A	ENST00000378412.3	-	2	223	c.62G>T	c.(61-63)cGc>cTc	p.R21L	MMEL1_ENST00000502556.1_Missense_Mutation_p.R21L|MMEL1_ENST00000511099.1_5'Flank|MMEL1_ENST00000288709.6_Missense_Mutation_p.R12L			Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	21						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|urinary_tract(1)	27	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		GAACCCCGGGCGCTTCTGCCC	0.701																																					p.R21L		Atlas-SNP	.											.	MMEL1	64	.	0			c.G62T						PASS	.						11.0	12.0	12.0					1																	2560862		1892	3662	5554	SO:0001583	missense	79258	exon2			CCCGGGCGCTTCT	AF336981	CCDS30569.1, CCDS30569.2	1p36	2008-02-05			ENSG00000142606	ENSG00000142606			14668	protein-coding gene	gene with protein product			"""membrane metallo-endopeptidase-like 2"""	MMEL2			Standard	NM_033467		Approved	SEP, NL1, NL2, NEPII	uc001ajy.2	Q495T6	OTTHUMG00000000846	ENST00000378412.3:c.62G>T	chr1.hg19:g.2560862C>A	ENSP00000367668:p.Arg21Leu	260.0	0.0	.		156.0	62.0	.	NM_033467	B9DI79|Q495T7|Q495T8|Q5SZS6|Q96PH9	Missense_Mutation	SNP	ENST00000378412.3	hg19	CCDS30569.2	.	.	.	.	.	.	.	.	.	.	c	6.219	0.408527	0.11812	.	.	ENSG00000142606	ENST00000378411;ENST00000288709;ENST00000378412;ENST00000502556	D;D;D	0.85629	-1.58;-1.56;-2.01	3.25	-2.69	0.06022	.	1.614800	0.02734	N	0.115427	T	0.79522	0.4460	L	0.52011	1.625	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.61287	-0.7093	10	0.56958	D	0.05	-4.1883	4.0829	0.09934	0.0:0.363:0.3467:0.2902	.	21	Q495T6	MMEL1_HUMAN	L	21;12;21;21	ENSP00000288709:R12L;ENSP00000367668:R21L;ENSP00000422492:R21L	ENSP00000288709:R12L	R	-	2	0	MMEL1	2550722	0.024000	0.19004	0.001000	0.08648	0.220000	0.24768	-0.695000	0.05109	-0.301000	0.08882	0.455000	0.32223	CGC	.	.	.	none		0.701	MMEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002395.2	NM_033467	
CLSTN1	22883	hgsc.bcm.edu	37	1	9815300	9815300	+	Silent	SNP	G	G	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr1:9815300G>T	ENST00000377298.4	-	4	1104	c.312C>A	c.(310-312)tcC>tcA	p.S104S	CLSTN1_ENST00000377288.3_Silent_p.S104S|CLSTN1_ENST00000361311.4_Silent_p.S94S	NM_001009566.1	NP_001009566.1	O94985	CSTN1_HUMAN	calsyntenin 1	104	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)|calcium ion binding (GO:0005509)|kinesin binding (GO:0019894)|X11-like protein binding (GO:0042988)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(9)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	36	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		CCTCACCAGTGGATTTATCCA	0.468																																					p.S104S		Atlas-SNP	.											.	CLSTN1	88	.	0			c.C312A						PASS	.						208.0	195.0	199.0					1																	9815300		2203	4300	6503	SO:0001819	synonymous_variant	22883	exon4			ACCAGTGGATTTA	AB020718	CCDS105.1, CCDS30580.1	1p36.22	2011-07-01			ENSG00000171603	ENSG00000171603		"""Cadherins / Cadherin-related"""	17447	protein-coding gene	gene with protein product	"""cadherin-related family member 12"""	611321				10048485	Standard	XM_005263432		Approved	CSTN1, KIAA0911, CDHR12	uc001aqh.3	O94985	OTTHUMG00000001451	ENST00000377298.4:c.312C>A	chr1.hg19:g.9815300G>T		127.0	0.0	.		121.0	44.0	.	NM_001009566	A8K183|Q5SR52|Q5UE58|Q71MN0|Q8N4K9	Silent	SNP	ENST00000377298.4	hg19	CCDS30580.1																																																																																			.	.	.	none		0.468	CLSTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004239.1		
PRDM2	7799	hgsc.bcm.edu	37	1	14075886	14075886	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr1:14075886T>A	ENST00000235372.7	+	6	1271	c.415T>A	c.(415-417)Tgg>Agg	p.W139R	PRDM2_ENST00000503842.1_5'Flank|PRDM2_ENST00000343137.4_5'Flank|PRDM2_ENST00000413440.1_5'Flank|PRDM2_ENST00000311066.5_Missense_Mutation_p.W139R|PRDM2_ENST00000505823.1_5'Flank|PRDM2_ENST00000502727.1_3'UTR|PRDM2_ENST00000376048.5_Missense_Mutation_p.W139R	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	139	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		GCTCCTGGTCTGGTACAATGG	0.667																																					p.W139R		Atlas-SNP	.											.	PRDM2	147	.	0			c.T415A						PASS	.						16.0	18.0	17.0					1																	14075886		2195	4290	6485	SO:0001583	missense	7799	exon6			CTGGTCTGGTACA	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.415T>A	chr1.hg19:g.14075886T>A	ENSP00000235372:p.Trp139Arg	184.0	0.0	.		168.0	62.0	.	NM_015866	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	hg19	CCDS150.1	.	.	.	.	.	.	.	.	.	.	t	28.6	4.933126	0.92458	.	.	ENSG00000116731	ENST00000484063;ENST00000376048;ENST00000235372;ENST00000311066;ENST00000400800	D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43	3.69	3.69	0.42338	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.94178	0.8132	M	0.88512	2.96	0.52501	D	0.999955	D;D;D	0.64830	0.983;0.979;0.994	D;P;D	0.71184	0.91;0.854;0.972	D	0.94188	0.7438	10	0.56958	D	0.05	.	10.6381	0.45577	0.0:0.0:0.0:1.0	.	139;139;139	Q13029;Q13029-2;B1AJZ4	PRDM2_HUMAN;.;.	R	130;139;139;139;139	ENSP00000423010:W130R;ENSP00000365216:W139R;ENSP00000235372:W139R;ENSP00000312352:W139R	ENSP00000235372:W139R	W	+	1	0	PRDM2	13948473	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.486000	0.60286	1.661000	0.50771	0.524000	0.50904	TGG	.	.	.	none		0.667	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
MACF1	23499	hgsc.bcm.edu	37	1	39760763	39760763	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr1:39760763C>G	ENST00000372915.3	+	18	2302	c.2215C>G	c.(2215-2217)Cta>Gta	p.L739V	MACF1_ENST00000539005.1_Missense_Mutation_p.L739V|MACF1_ENST00000361689.2_Missense_Mutation_p.L739V|MACF1_ENST00000545844.1_Missense_Mutation_p.L739V|MACF1_ENST00000567887.1_Missense_Mutation_p.L771V|MACF1_ENST00000564288.1_Missense_Mutation_p.L734V|MACF1_ENST00000317713.7_Missense_Mutation_p.L739V			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	739					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GTTTCGTTCTCTACAAGATAC	0.458																																					p.L739V		Atlas-SNP	.											.	MACF1	909	.	0			c.C2215G						PASS	.						99.0	96.0	97.0					1																	39760763		2203	4300	6503	SO:0001583	missense	23499	exon20			CGTTCTCTACAAG	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.2215C>G	chr1.hg19:g.39760763C>G	ENSP00000362006:p.Leu739Val	107.0	0.0	.		89.0	31.0	.	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	hg19		.	.	.	.	.	.	.	.	.	.	C	12.77	2.038986	0.35989	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000530262;ENST00000372900	D;D;D;D;D;D;D	0.96136	-3.92;-3.92;-3.92;-3.92;-3.92;-3.92;-3.92	5.72	5.72	0.89469	.	.	.	.	.	D	0.94424	0.8206	N	0.13098	0.295	0.80722	D	1	D;B	0.69078	0.997;0.122	D;B	0.81914	0.995;0.113	D	0.89130	0.3509	9	0.02654	T	1	.	20.2441	0.98394	0.0:1.0:0.0:0.0	.	739;704	F8W8Q1;Q9UPN3-3	.;.	V	739;739;739;739;739;697;888;899	ENSP00000439537:L739V;ENSP00000362006:L739V;ENSP00000354573:L739V;ENSP00000313438:L739V;ENSP00000444364:L739V;ENSP00000435070:L697V;ENSP00000437059:L888V	ENSP00000313438:L739V	L	+	1	2	MACF1	39533350	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.906000	0.48735	2.865000	0.98341	0.655000	0.94253	CTA	.	.	.	none		0.458	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
ST6GALNAC5	81849	hgsc.bcm.edu	37	1	77528710	77528710	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr1:77528710C>T	ENST00000477717.1	+	5	1065	c.830C>T	c.(829-831)cCt>cTt	p.P277L		NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	277					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						CCTTTTGGACCTGATGAATGT	0.418																																					p.P277L		Atlas-SNP	.											.	ST6GALNAC5	59	.	0			c.C830T						PASS	.						129.0	126.0	127.0					1																	77528710		2203	4300	6503	SO:0001583	missense	81849	exon5			TTGGACCTGATGA		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.830C>T	chr1.hg19:g.77528710C>T	ENSP00000417583:p.Pro277Leu	133.0	0.0	.		102.0	34.0	.	NM_030965	B1AK82	Missense_Mutation	SNP	ENST00000477717.1	hg19	CCDS673.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.862062	0.51482	.	.	ENSG00000117069	ENST00000477717;ENST00000438953	T	0.29917	1.55	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.38957	0.1060	L	0.54323	1.7	0.80722	D	1	D	0.69078	0.997	D	0.72075	0.976	T	0.04767	-1.0928	10	0.08837	T	0.75	-18.842	20.3422	0.98769	0.0:1.0:0.0:0.0	.	277	Q9BVH7	SIA7E_HUMAN	L	277;187	ENSP00000417583:P277L	ENSP00000406658:P187L	P	+	2	0	ST6GALNAC5	77301298	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.440000	0.80464	2.810000	0.96702	0.655000	0.94253	CCT	.	.	.	none		0.418	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965	
CIART	148523	hgsc.bcm.edu	37	1	150259058	150259058	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr1:150259058T>G	ENST00000290363.5	+	5	1299	c.850T>G	c.(850-852)Tta>Gta	p.L284V	C1orf51_ENST00000369095.1_Missense_Mutation_p.L284V|C1orf51_ENST00000369094.1_Missense_Mutation_p.L196V	NM_144697.2	NP_653298.1	Q8N365	CIART_HUMAN		284					circadian regulation of gene expression (GO:0032922)|locomotor rhythm (GO:0045475)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|E-box binding (GO:0070888)			endometrium(3)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCATGGTCCTTTAGGCACTGG	0.557																																					p.L284V		Atlas-SNP	.											.	C1orf51	35	.	0			c.T850G						PASS	.						220.0	184.0	196.0					1																	150259058		2203	4300	6503	SO:0001583	missense	148523	exon5			GGTCCTTTAGGCA																												ENST00000290363.5:c.850T>G	chr1.hg19:g.150259058T>G	ENSP00000290363:p.Leu284Val	100.0	0.0	.		89.0	32.0	.	NM_144697	B2RD43|D3DV01|Q8N795|Q96MG6	Missense_Mutation	SNP	ENST00000290363.5	hg19	CCDS949.1	.	.	.	.	.	.	.	.	.	.	T	15.20	2.762504	0.49574	.	.	ENSG00000159208	ENST00000447007;ENST00000369095;ENST00000369094;ENST00000417398;ENST00000290363	.	.	.	5.65	0.569	0.17340	.	0.809409	0.10750	N	0.638487	T	0.14614	0.0353	L	0.54323	1.7	0.23168	N	0.998187	B	0.27351	0.176	B	0.27608	0.081	T	0.29640	-1.0005	9	0.42905	T	0.14	-1.9282	2.739	0.05248	0.1411:0.0757:0.2763:0.5069	.	284	Q8N365	CA051_HUMAN	V	196;284;196;196;284	.	ENSP00000290363:L284V	L	+	1	2	C1orf51	148525682	0.594000	0.26849	0.909000	0.35828	0.945000	0.59286	-0.213000	0.09305	-0.059000	0.13154	0.533000	0.62120	TTA	.	.	.	none		0.557	C1orf51-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035058.1		
GOLPH3L	55204	hgsc.bcm.edu	37	1	150621097	150621097	+	Silent	SNP	A	A	G			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr1:150621097A>G	ENST00000271732.3	-	5	602	c.558T>C	c.(556-558)acT>acC	p.T186T	GOLPH3L_ENST00000540514.1_Silent_p.T142T	NM_018178.5	NP_060648.2	Q9H4A5	GLP3L_HUMAN	golgi phosphoprotein 3-like	186	Beta-hairpin required for oligomerization. {ECO:0000250}.				Golgi organization (GO:0007030)|positive regulation of protein secretion (GO:0050714)	Golgi membrane (GO:0000139)|trans-Golgi network membrane (GO:0032588)	phosphatidylinositol-4-phosphate binding (GO:0070273)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8	all_cancers(9;3.09e-52)|all_epithelial(9;4.47e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000615)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;1.2e-23)|all cancers(9;4.81e-23)|OV - Ovarian serous cystadenocarcinoma(6;1.93e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			CTGGATGAGTAGTCATGTCAA	0.433																																					p.T186T		Atlas-SNP	.											.	GOLPH3L	20	.	0			c.T558C						PASS	.						90.0	83.0	85.0					1																	150621097		2203	4300	6503	SO:0001819	synonymous_variant	55204	exon5			ATGAGTAGTCATG	AJ296153	CCDS966.1	1q21	2008-02-05			ENSG00000143457	ENSG00000143457			24882	protein-coding gene	gene with protein product		612208					Standard	NM_018178		Approved	GPP34R	uc001evj.2	Q9H4A5	OTTHUMG00000035009	ENST00000271732.3:c.558T>C	chr1.hg19:g.150621097A>G		180.0	0.0	.		171.0	57.0	.	NM_018178	B1AN09|B7Z6N3|Q9NVK0	Silent	SNP	ENST00000271732.3	hg19	CCDS966.1																																																																																			.	.	.	none		0.433	GOLPH3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084734.1	NM_018178	
ARHGEF11	9826	hgsc.bcm.edu	37	1	156906702	156906702	+	Silent	SNP	A	A	C			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr1:156906702A>C	ENST00000361409.2	-	39	5158	c.4416T>G	c.(4414-4416)gcT>gcG	p.A1472A	ARHGEF11_ENST00000487682.1_5'UTR|ARHGEF11_ENST00000368194.3_Silent_p.A1512A|ARHGEF11_ENST00000315174.8_Silent_p.A888A|MIR765_ENST00000390226.1_RNA	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1472					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTGTCCATCTAGCTGCTTCTG	0.597																																					p.A1512A		Atlas-SNP	.											.	ARHGEF11	168	.	0			c.T4536G						PASS	.						125.0	125.0	125.0					1																	156906702		2203	4300	6503	SO:0001819	synonymous_variant	9826	exon40			CCATCTAGCTGCT	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.4416T>G	chr1.hg19:g.156906702A>C		119.0	0.0	.		95.0	33.0	.	NM_198236	D3DVD0|Q5VY40|Q6PFW2	Silent	SNP	ENST00000361409.2	hg19	CCDS1162.1																																																																																			.	.	.	none		0.597	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236	
ATP1A4	480	hgsc.bcm.edu	37	1	160144537	160144537	+	Splice_Site	SNP	G	G	C			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr1:160144537G>C	ENST00000368081.4	+	15	2782	c.2311G>C	c.(2311-2313)Ggc>Cgc	p.G771R	ATP1A4_ENST00000418334.1_3'UTR|ATP1A4_ENST00000470705.1_5'Flank	NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	771					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GGTGGAGGAGGGTGAGGAGGC	0.577																																					p.G771R		Atlas-SNP	.											.	ATP1A4	167	.	0			c.G2311C						PASS	.						78.0	62.0	67.0					1																	160144537		2203	4300	6503	SO:0001630	splice_region_variant	480	exon15			GAGGAGGGTGAGG	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.2311+1G>C	chr1.hg19:g.160144537G>C		97.0	0.0	.		94.0	39.0	.	NM_144699	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	ENST00000368081.4	hg19	CCDS1197.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.407652	0.83340	.	.	ENSG00000132681	ENST00000368081	D	0.98044	-4.68	4.27	4.27	0.50696	HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.99447	0.9804	H	0.99937	4.99	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97675	1.0169	10	0.87932	D	0	.	14.5908	0.68362	0.0:0.0:1.0:0.0	.	771	Q13733	AT1A4_HUMAN	R	771	ENSP00000357060:G771R	ENSP00000357060:G771R	G	+	1	0	ATP1A4	158411161	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	9.381000	0.97205	2.371000	0.80710	0.655000	0.94253	GGC	.	.	.	none		0.577	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699	Missense_Mutation
DNAH14	127602	hgsc.bcm.edu	37	1	225555578	225555578	+	Intron	SNP	G	G	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr1:225555578G>T	ENST00000445597.2	+	53	9205				DNAH14_ENST00000439375.2_Missense_Mutation_p.E3961D|DNAH14_ENST00000430092.1_Missense_Mutation_p.E3961D			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						GGAGTGGAGAGGTAACAGAAG	0.363																																					p.E3961D		Atlas-SNP	.											.	DNAH14	300	.	0			c.G11883T						PASS	.						174.0	151.0	158.0					1																	225555578		692	1591	2283	SO:0001627	intron_variant	127602	exon75			TGGAGAGGTAACA	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.9205+9224G>T	chr1.hg19:g.225555578G>T		168.0	0.0	.		166.0	57.0	.	NM_001373	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	hg19		.	.	.	.	.	.	.	.	.	.	G	9.256	1.042012	0.19748	.	.	ENSG00000185842	ENST00000430092;ENST00000439375	T;T	0.31510	1.49;1.49	5.03	-0.173	0.13322	.	.	.	.	.	T	0.18425	0.0442	.	.	.	0.80722	D	1	B	0.28713	0.22	B	0.32289	0.143	T	0.09357	-1.0678	8	0.14252	T	0.57	.	9.035	0.36282	0.3992:0.0:0.6008:0.0	.	3961	Q0VDD8-4	.	D	3961	ENSP00000414402:E3961D;ENSP00000392061:E3961D	ENSP00000414402:E3961D	E	+	3	2	DNAH14	223622201	0.102000	0.21896	0.969000	0.41365	0.983000	0.72400	-1.061000	0.03472	0.003000	0.14656	0.508000	0.49915	GAG	.	.	.	none		0.363	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
GREB1	9687	hgsc.bcm.edu	37	2	11706689	11706689	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr2:11706689G>C	ENST00000381486.2	+	4	661	c.361G>C	c.(361-363)Ggg>Cgg	p.G121R	GREB1_ENST00000381483.2_Missense_Mutation_p.G121R|GREB1_ENST00000263834.5_Missense_Mutation_p.G121R|GREB1_ENST00000234142.5_Missense_Mutation_p.G121R|GREB1_ENST00000389825.3_Missense_Mutation_p.G11R	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	121						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TCTCCTCGTGGGGGTCAAGTC	0.592																																					p.G121R	Ovarian(39;850 945 2785 23371 33093)	Atlas-SNP	.											.	GREB1	308	.	0			c.G361C						PASS	.						100.0	92.0	95.0					2																	11706689		2203	4300	6503	SO:0001583	missense	9687	exon4			CTCGTGGGGGTCA		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.361G>C	chr2.hg19:g.11706689G>C	ENSP00000370896:p.Gly121Arg	82.0	0.0	.		69.0	30.0	.	NM_148903	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	hg19	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	G	35	5.440620	0.96168	.	.	ENSG00000196208	ENST00000381486;ENST00000263834;ENST00000389825;ENST00000381483;ENST00000234142	T;T;T;T;T	0.77750	2.5;1.47;-1.12;1.54;2.5	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.88492	0.6451	M	0.73962	2.25	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;1.0;0.999	D	0.89301	0.3626	10	0.87932	D	0	-44.3346	19.4103	0.94670	0.0:0.0:1.0:0.0	.	121;11;121;121	Q4ZG55-2;F8W6E5;Q4ZG55-3;Q4ZG55	.;.;.;GREB1_HUMAN	R	121;121;11;121;121	ENSP00000370896:G121R;ENSP00000263834:G121R;ENSP00000374475:G11R;ENSP00000370892:G121R;ENSP00000234142:G121R	ENSP00000234142:G121R	G	+	1	0	GREB1	11624140	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.671000	0.98627	2.583000	0.87209	0.655000	0.94253	GGG	.	.	.	none		0.592	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
CCDC121	79635	hgsc.bcm.edu	37	2	27850108	27850108	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr2:27850108A>G	ENST00000324364.3	-	2	739	c.559T>C	c.(559-561)Ttt>Ctt	p.F187L	CCDC121_ENST00000394775.3_Missense_Mutation_p.F349L|GPN1_ENST00000424214.1_5'Flank|GPN1_ENST00000264718.3_5'Flank|GPN1_ENST00000458167.2_5'Flank|GPN1_ENST00000503738.1_5'Flank|GPN1_ENST00000610189.1_5'Flank|GPN1_ENST00000407583.3_5'Flank|ZNF512_ENST00000556601.1_Intron|RP11-158I13.2_ENST00000505973.1_RNA|GPN1_ENST00000515877.1_5'Flank	NM_024584.4	NP_078860.2	Q6ZUS5	CC121_HUMAN	coiled-coil domain containing 121	187										breast(1)|endometrium(3)|large_intestine(2)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(172;0.155)					TCAAAAATAAACCGCTTTGCT	0.463																																					p.F349L		Atlas-SNP	.											.	CCDC121	43	.	0			c.T1045C						PASS	.						63.0	67.0	65.0					2																	27850108		2203	4300	6503	SO:0001583	missense	79635	exon2			AAATAAACCGCTT	AK125354	CCDS1759.1, CCDS46247.1	2p23.2	2008-02-05			ENSG00000176714	ENSG00000176714			25833	protein-coding gene	gene with protein product							Standard	NM_024584		Approved	FLJ43364, FLJ13646	uc002rld.3	Q6ZUS5	OTTHUMG00000128427	ENST00000324364.3:c.559T>C	chr2.hg19:g.27850108A>G	ENSP00000339087:p.Phe187Leu	96.0	0.0	.		78.0	27.0	.	NM_001142683	B3KW66|J3KQZ8|Q9H8G6	Missense_Mutation	SNP	ENST00000324364.3	hg19	CCDS1759.1	.	.	.	.	.	.	.	.	.	.	A	8.696	0.908553	0.17833	.	.	ENSG00000176714	ENST00000324364;ENST00000394775	T;T	0.27890	1.64;1.64	5.36	-6.38	0.01957	.	3.036110	0.00839	N	0.001729	T	0.11836	0.0288	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.18871	0.023	T	0.14811	-1.0459	10	0.11794	T	0.64	-29.1841	2.0948	0.03665	0.2432:0.3863:0.2444:0.1261	.	187	Q6ZUS5	CC121_HUMAN	L	187;349	ENSP00000339087:F187L;ENSP00000412150:F349L	ENSP00000339087:F187L	F	-	1	0	CCDC121	27703612	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.256000	0.08757	-1.009000	0.03400	0.482000	0.46254	TTT	.	.	.	none		0.463	CCDC121-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250215.1	NM_024584	
SLC38A11	151258	hgsc.bcm.edu	37	2	165809229	165809229	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr2:165809229A>T	ENST00000409149.3	-	2	340	c.49T>A	c.(49-51)Tca>Aca	p.S17T	SLC38A11_ENST00000303735.4_Missense_Mutation_p.S17T|SLC38A11_ENST00000409058.1_Intron|SLC38A11_ENST00000409662.1_Missense_Mutation_p.S17T	NM_001199148.1	NP_001186077.1	Q08AI6	S38AB_HUMAN	solute carrier family 38, member 11	17					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)	15						GTAACATATGAAACCCAGAAT	0.358																																					p.S17T		Atlas-SNP	.											.	SLC38A11	41	.	0			c.T49A						PASS	.						57.0	61.0	60.0					2																	165809229		2203	4300	6503	SO:0001583	missense	151258	exon2			CATATGAAACCCA		CCDS2224.1, CCDS56142.1	2q24.3	2013-05-22			ENSG00000169507	ENSG00000169507		"""Solute carriers"""	26836	protein-coding gene	gene with protein product							Standard	NM_173512		Approved	FLJ39822, AVT2	uc002ucw.2	Q08AI6	OTTHUMG00000132144	ENST00000409149.3:c.49T>A	chr2.hg19:g.165809229A>T	ENSP00000386272:p.Ser17Thr	163.0	0.0	.		157.0	40.0	.	NM_173512	B4DF99|Q8N887	Missense_Mutation	SNP	ENST00000409149.3	hg19	CCDS56142.1	.	.	.	.	.	.	.	.	.	.	A	15.35	2.806168	0.50421	.	.	ENSG00000169507	ENST00000303735;ENST00000409149;ENST00000409662	T;T;T	0.02525	4.26;4.26;4.26	5.56	4.36	0.52297	.	0.161948	0.53938	D	0.000055	T	0.02304	0.0071	N	0.04705	-0.18	0.30984	N	0.722188	B;B	0.26809	0.16;0.132	B;B	0.36766	0.232;0.149	T	0.35574	-0.9783	10	0.31617	T	0.26	.	11.3997	0.49862	0.6358:0.3642:0.0:0.0	.	17;17	Q08AI6;Q08AI6-2	S38AB_HUMAN;.	T	17	ENSP00000306178:S17T;ENSP00000386272:S17T;ENSP00000386774:S17T	ENSP00000306178:S17T	S	-	1	0	SLC38A11	165517475	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.776000	0.55356	2.116000	0.64780	0.528000	0.53228	TCA	.	.	.	none		0.358	SLC38A11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333390.1	NM_173512	
MAGI1	9223	hgsc.bcm.edu	37	3	65350346	65350346	+	Silent	SNP	T	T	A			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr3:65350346T>A	ENST00000497477.2	-	19	3143	c.3144A>T	c.(3142-3144)gcA>gcT	p.A1048A	MAGI1_ENST00000483466.1_Silent_p.A1144A|MAGI1_ENST00000402939.2_Silent_p.A1115A|MAGI1_ENST00000330909.8_Silent_p.A1143A			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	1134	Interaction with FCHSD2.|PDZ 5. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		TCACCTGTGTTGCTTGGGGTG	0.383																																					p.A1144A		Atlas-SNP	.											.	MAGI1	481	.	0			c.A3432T						PASS	.						166.0	169.0	168.0					3																	65350346		2203	4300	6503	SO:0001819	synonymous_variant	9223	exon21			CTGTGTTGCTTGG	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.3144A>T	chr3.hg19:g.65350346T>A		212.0	0.0	.		166.0	69.0	.	NM_004742	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Silent	SNP	ENST00000497477.2	hg19		.	.	.	.	.	.	.	.	.	.	T	9.995	1.231942	0.22626	.	.	ENSG00000151276	ENST00000460329	.	.	.	6.17	-1.61	0.08399	.	.	.	.	.	T	0.51805	0.1696	.	.	.	0.58432	D	0.999993	.	.	.	.	.	.	T	0.45977	-0.9224	4	.	.	.	-4.4862	7.3714	0.26804	0.2789:0.0:0.328:0.3931	.	.	.	.	L	1024	.	.	Q	-	2	0	MAGI1	65325386	.	.	0.988000	0.46212	0.933000	0.57130	.	.	-0.057000	0.13199	0.533000	0.62120	CAA	.	.	.	none		0.383	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000349132.2	NM_004742	
LAMP3	27074	hgsc.bcm.edu	37	3	182871611	182871611	+	Silent	SNP	T	T	A	rs201353315		TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr3:182871611T>A	ENST00000265598.3	-	2	873	c.618A>T	c.(616-618)gcA>gcT	p.A206A	LAMP3_ENST00000466939.1_Silent_p.A182A	NM_014398.3	NP_055213.2	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	206	Thr-rich.				cell proliferation (GO:0008283)|immune system process (GO:0002376)	alveolar lamellar body membrane (GO:0097233)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(2)	28	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			TGGAGGCAGGTGCAGCTGTGC	0.552																																					p.A206A		Atlas-SNP	.											.	LAMP3	48	.	0			c.A618T						PASS	.						112.0	110.0	111.0					3																	182871611		2203	4300	6503	SO:0001819	synonymous_variant	27074	exon2			GGCAGGTGCAGCT	AB013924	CCDS3242.1	3q26.3-q27	2011-11-24			ENSG00000078081	ENSG00000078081		"""CD molecules"""	14582	protein-coding gene	gene with protein product		605883				9721848	Standard	NM_014398		Approved	LAMP, TSC403, DC-LAMP, DCLAMP, CD208	uc003flh.4	Q9UQV4	OTTHUMG00000158387	ENST00000265598.3:c.618A>T	chr3.hg19:g.182871611T>A		159.0	0.0	.		145.0	50.0	.	NM_014398	D3DNS4|O94781|Q8NEC8	Silent	SNP	ENST00000265598.3	hg19	CCDS3242.1																																																																																			.	G|0.001;T|0.999	.	weak		0.552	LAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350863.1		
AFP	174	hgsc.bcm.edu	37	4	74316462	74316462	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr4:74316462G>A	ENST00000395792.2	+	11	1520	c.1420G>A	c.(1420-1422)Gag>Aag	p.E474K	AFP_ENST00000226359.2_Missense_Mutation_p.E474K	NM_001134.1	NP_001125.1	P02771	FETA_HUMAN	alpha-fetoprotein	474	Albumin 3. {ECO:0000255|PROSITE- ProRule:PRU00769}.				ovulation from ovarian follicle (GO:0001542)|progesterone metabolic process (GO:0042448)|SMAD protein signal transduction (GO:0060395)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|urinary_tract(1)	22	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GGCCTGTGGCGAGGGAGCGGT	0.522									Alpha-Fetoprotein, Hereditary Persistence of																												p.E474K		Atlas-SNP	.											.	AFP	60	.	0			c.G1420A						PASS	.						160.0	138.0	145.0					4																	74316462		2203	4300	6503	SO:0001583	missense	174	exon11	Familial Cancer Database	HPAFP	TGTGGCGAGGGAG	V01514	CCDS3556.1	4q13.3	2012-05-16			ENSG00000081051	ENSG00000081051			317	protein-coding gene	gene with protein product		104150		HPAFP			Standard	NM_001134		Approved	FETA	uc003hgz.1	P02771	OTTHUMG00000130011	ENST00000395792.2:c.1420G>A	chr4.hg19:g.74316462G>A	ENSP00000379138:p.Glu474Lys	125.0	0.0	.		147.0	28.0	.	NM_001134	B2RBU3	Missense_Mutation	SNP	ENST00000395792.2	hg19	CCDS3556.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.015123	0.75161	.	.	ENSG00000081051	ENST00000395792;ENST00000226359	T;T	0.58358	0.34;0.34	4.93	4.93	0.64822	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.060634	0.64402	D	0.000004	T	0.75034	0.3795	M	0.86864	2.845	0.30067	N	0.810355	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.75528	-0.3286	10	0.87932	D	0	.	13.8287	0.63366	0.0:0.0:1.0:0.0	.	316;474	B4DMX4;P02771	.;FETA_HUMAN	K	474	ENSP00000379138:E474K;ENSP00000226359:E474K	ENSP00000226359:E474K	E	+	1	0	AFP	74535326	1.000000	0.71417	0.205000	0.23548	0.890000	0.51754	5.131000	0.64751	2.715000	0.92844	0.561000	0.74099	GAG	.	.	.	none		0.522	AFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252284.3		
KIAA1109	84162	hgsc.bcm.edu	37	4	123175369	123175369	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr4:123175369A>C	ENST00000264501.4	+	38	6315	c.5942A>C	c.(5941-5943)gAt>gCt	p.D1981A	KIAA1109_ENST00000388738.3_Missense_Mutation_p.D1981A|KIAA1109_ENST00000455637.1_Missense_Mutation_p.D1981A			Q2LD37	K1109_HUMAN	KIAA1109	1981					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						GTCGAATCTGATGATTTGAAA	0.373																																					p.D1981A		Atlas-SNP	.											.	KIAA1109	424	.	0			c.A5942C						PASS	.						119.0	107.0	111.0					4																	123175369		1849	4086	5935	SO:0001583	missense	84162	exon36			AATCTGATGATTT	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.5942A>C	chr4.hg19:g.123175369A>C	ENSP00000264501:p.Asp1981Ala	79.0	0.0	.		141.0	64.0	.	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	hg19	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.8|22.8	4.334620|4.334620	0.81801|0.81801	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000446180	T;T;T|.	0.23754|.	2.49;2.49;1.89|.	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	0.000000|.	0.51477|.	U|.	0.000082|.	T|T	0.55529|0.55529	0.1926|0.1926	L|L	0.31664|0.31664	0.95|0.95	0.54753|0.54753	D|D	0.999989|0.999989	D;D|.	0.76494|.	0.999;0.998|.	D;D|.	0.83275|.	0.996;0.991|.	T|T	0.52660|0.52660	-0.8546|-0.8546	10|5	0.29301|.	T|.	0.29|.	.|.	15.3548|15.3548	0.74418|0.74418	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1980;1981|.	Q2LD37-2;Q2LD37|.	.;K1109_HUMAN|.	A|L	1981|554	ENSP00000264501:D1981A;ENSP00000373390:D1981A;ENSP00000389925:D1981A|.	ENSP00000264501:D1981A|.	D|M	+|+	2|1	0|0	KIAA1109|KIAA1109	123394819|123394819	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.262000|9.262000	0.95591|0.95591	2.034000|2.034000	0.60081|0.60081	0.482000|0.482000	0.46254|0.46254	GAT|ATG	.	.	.	none		0.373	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
HMGCS1	3157	hgsc.bcm.edu	37	5	43294814	43294814	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr5:43294814G>C	ENST00000325110.6	-	7	1261	c.1055C>G	c.(1054-1056)tCc>tGc	p.S352C	HMGCS1_ENST00000433297.2_Missense_Mutation_p.S352C	NM_001098272.2	NP_001091742.1	Q01581	HMCS1_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)	352					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|lipid metabolic process (GO:0006629)|liver development (GO:0001889)|male gonad development (GO:0008584)|response to acid chemical (GO:0001101)|response to drug (GO:0042493)|response to lipoprotein particle (GO:0055094)|response to low light intensity stimulus (GO:0009645)|response to purine-containing compound (GO:0014074)|response to tellurium ion (GO:0046690)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hydroxymethylglutaryl-CoA synthase activity (GO:0004421)|isomerase activity (GO:0016853)|organic acid binding (GO:0043177)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|stomach(1)|urinary_tract(1)	15						AGATGCAAGGGAACCATATAC	0.353																																					p.S352C		Atlas-SNP	.											.	HMGCS1	33	.	0			c.C1055G						PASS	.						159.0	159.0	159.0					5																	43294814		2203	4300	6503	SO:0001583	missense	3157	exon7			GCAAGGGAACCAT		CCDS34154.1	5p14-p13	2012-10-02	2010-04-30			ENSG00000112972	2.3.3.10		5007	protein-coding gene	gene with protein product	"""3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase"""	142940	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)"""	HMGCS			Standard	NM_001098272		Approved		uc003jnq.5	Q01581		ENST00000325110.6:c.1055C>G	chr5.hg19:g.43294814G>C	ENSP00000322706:p.Ser352Cys	89.0	0.0	.		54.0	17.0	.	NM_001098272	B2RDL8	Missense_Mutation	SNP	ENST00000325110.6	hg19	CCDS34154.1	.	.	.	.	.	.	.	.	.	.	G	10.30	1.312009	0.23821	.	.	ENSG00000112972	ENST00000325110;ENST00000433297;ENST00000545275	T;T	0.78707	-1.2;-1.2	5.65	3.79	0.43588	Hydroxymethylglutaryl-coenzyme A synthase C-terminal (1);Thiolase-like (1);	0.043346	0.85682	D	0.000000	T	0.56702	0.2003	N	0.02334	-0.595	0.43512	D	0.995771	B	0.13594	0.008	B	0.23852	0.049	T	0.51236	-0.8731	10	0.24483	T	0.36	-9.5747	16.8813	0.86064	0.0:0.4758:0.5242:0.0	.	352	Q01581	HMCS1_HUMAN	C	352;352;341	ENSP00000322706:S352C;ENSP00000399402:S352C	ENSP00000322706:S352C	S	-	2	0	HMGCS1	43330571	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.702000	0.54800	1.370000	0.46153	0.460000	0.39030	TCC	.	.	.	none		0.353	HMGCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368022.1		
EDIL3	10085	hgsc.bcm.edu	37	5	83362406	83362406	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr5:83362406A>C	ENST00000296591.5	-	7	1089	c.671T>G	c.(670-672)aTg>aGg	p.M224R	EDIL3_ENST00000380138.3_Missense_Mutation_p.M214R|EDIL3_ENST00000510271.1_5'UTR	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	224	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		AGTAACTCTCATTTTCCTTTG	0.348																																					p.M224R		Atlas-SNP	.											.	EDIL3	94	.	0			c.T671G						PASS	.						101.0	108.0	106.0					5																	83362406		2203	4300	6503	SO:0001583	missense	10085	exon7			ACTCTCATTTTCC	U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.671T>G	chr5.hg19:g.83362406A>C	ENSP00000296591:p.Met224Arg	101.0	0.0	.		119.0	45.0	.	NM_005711	B2R763|O43855|Q5D094|Q8N610	Missense_Mutation	SNP	ENST00000296591.5	hg19	CCDS4062.1	.	.	.	.	.	.	.	.	.	.	A	17.86	3.491718	0.64074	.	.	ENSG00000164176	ENST00000296591;ENST00000380138	D;D	0.98060	-4.69;-4.69	5.93	5.93	0.95920	Coagulation factor 5/8 C-terminal type domain (4);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.97845	0.9292	L	0.45051	1.395	0.80722	D	1	D;D;D	0.65815	0.995;0.965;0.967	D;P;P	0.66351	0.943;0.884;0.897	D	0.99174	1.0865	10	0.87932	D	0	-29.0243	16.3756	0.83387	1.0:0.0:0.0:0.0	.	1;214;224	B7Z865;O43854-2;O43854	.;.;EDIL3_HUMAN	R	224;214	ENSP00000296591:M224R;ENSP00000369483:M214R	ENSP00000296591:M224R	M	-	2	0	EDIL3	83398162	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.962000	0.93254	2.270000	0.75569	0.460000	0.39030	ATG	.	.	.	none		0.348	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239258.1	NM_005711	
SLC35A4	113829	hgsc.bcm.edu	37	5	139947338	139947338	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr5:139947338A>T	ENST00000514199.1	+	2	2270	c.584A>T	c.(583-585)tAc>tTc	p.Y195F	SLC35A4_ENST00000323146.3_Missense_Mutation_p.Y195F|APBB3_ENST00000507279.1_Intron			Q96G79	S35A4_HUMAN	solute carrier family 35, member A4	195	Leu-rich.					Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sugar:proton symporter activity (GO:0005351)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCATTCTGTACTGCCTCATC	0.587																																					p.Y195F		Atlas-SNP	.											.	SLC35A4	25	.	0			c.A584T						PASS	.						103.0	98.0	100.0					5																	139947338		2203	4300	6503	SO:0001583	missense	113829	exon3			TTCTGTACTGCCT	AJ420598	CCDS4231.1	5q31.3	2013-05-22			ENSG00000176087	ENSG00000176087		"""Solute carriers"""	20753	protein-coding gene	gene with protein product							Standard	NM_080670		Approved		uc003lgg.1	Q96G79	OTTHUMG00000129495	ENST00000514199.1:c.584A>T	chr5.hg19:g.139947338A>T	ENSP00000424566:p.Tyr195Phe	69.0	0.0	.		57.0	20.0	.	NM_080670	A8K013	Missense_Mutation	SNP	ENST00000514199.1	hg19	CCDS4231.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.279959	0.80692	.	.	ENSG00000176087	ENST00000323146;ENST00000514199	T;T	0.41400	1.0;1.0	4.68	4.68	0.58851	.	0.000000	0.64402	D	0.000001	T	0.52869	0.1761	L	0.39085	1.19	0.58432	D	0.999991	D	0.76494	0.999	D	0.85130	0.997	T	0.49551	-0.8928	9	.	.	.	-10.1141	13.9451	0.64080	1.0:0.0:0.0:0.0	.	195	Q96G79	S35A4_HUMAN	F	195	ENSP00000327133:Y195F;ENSP00000424566:Y195F	.	Y	+	2	0	SLC35A4	139927522	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	8.714000	0.91412	1.961000	0.56991	0.379000	0.24179	TAC	.	.	.	none		0.587	SLC35A4-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372815.1	NM_080670	
DCTN4	51164	hgsc.bcm.edu	37	5	150111032	150111032	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr5:150111032G>A	ENST00000447998.2	-	6	672	c.557C>T	c.(556-558)aCc>aTc	p.T186I	DCTN4_ENST00000521093.1_5'Flank|DCTN4_ENST00000424236.1_Missense_Mutation_p.T129I|DCTN4_ENST00000446090.2_Missense_Mutation_p.T193I	NM_016221.3	NP_057305.1	Q9UJW0	DCTN4_HUMAN	dynactin 4 (p62)	186					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	10		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTGAAGCCTGGTTCCAAGACC	0.408																																					p.T193I		Atlas-SNP	.											.	DCTN4	35	.	0			c.C578T						PASS	.						62.0	60.0	61.0					5																	150111032		2203	4300	6503	SO:0001583	missense	51164	exon7			AGCCTGGTTCCAA	AF195120	CCDS4310.1, CCDS47310.1, CCDS47311.1	5q31-q32	2008-05-23			ENSG00000132912	ENSG00000132912			15518	protein-coding gene	gene with protein product		614758				10843801, 16554302	Standard	NM_016221		Approved		uc010jhi.3	Q9UJW0	OTTHUMG00000130079	ENST00000447998.2:c.557C>T	chr5.hg19:g.150111032G>A	ENSP00000416968:p.Thr186Ile	73.0	0.0	.		60.0	17.0	.	NM_001135643	B3KWW0|D3DQH0|E5RGT5|Q8TAN8	Missense_Mutation	SNP	ENST00000447998.2	hg19	CCDS4310.1	.	.	.	.	.	.	.	.	.	.	G	16.28	3.079487	0.55753	.	.	ENSG00000132912	ENST00000447998;ENST00000424236;ENST00000446090;ENST00000521728;ENST00000518015	T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92	5.53	4.64	0.57946	.	0.049705	0.85682	D	0.000000	T	0.24084	0.0583	L	0.44542	1.39	0.80722	D	1	B;P	0.35411	0.444;0.5	B;B	0.33042	0.097;0.157	T	0.02398	-1.1165	10	0.44086	T	0.13	-38.4966	15.5558	0.76192	0.0:0.0:0.8608:0.1391	.	193;186	Q9UJW0-3;Q9UJW0	.;DCTN4_HUMAN	I	186;129;193;43;129	ENSP00000416968:T186I;ENSP00000411251:T129I;ENSP00000414906:T193I;ENSP00000428987:T43I;ENSP00000430993:T129I	ENSP00000411251:T129I	T	-	2	0	DCTN4	150091225	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.062000	0.93920	1.287000	0.44583	0.563000	0.77884	ACC	.	.	.	none		0.408	DCTN4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252372.1		
CDHR2	54825	hgsc.bcm.edu	37	5	176019773	176019773	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr5:176019773G>A	ENST00000510636.1	+	31	4058	c.3784G>A	c.(3784-3786)Gaa>Aaa	p.E1262K	CDHR2_ENST00000261944.5_Missense_Mutation_p.E1262K|CDHR2_ENST00000506348.1_Missense_Mutation_p.E1262K	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	1262					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						GAACAGTCAGGAAATCAAGGC	0.542																																					p.E1262K		Atlas-SNP	.											CDHR2,NS,malignant_melanoma,0,1	CDHR2	152	.	0			c.G3784A						PASS	.						150.0	125.0	133.0					5																	176019773		2203	4300	6503	SO:0001583	missense	54825	exon31			AGTCAGGAAATCA	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.3784G>A	chr5.hg19:g.176019773G>A	ENSP00000424565:p.Glu1262Lys	143.0	0.0	.		84.0	29.0	.	NM_017675	A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	hg19	CCDS34297.1	.	.	.	.	.	.	.	.	.	.	g	0.051	-1.250934	0.01469	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.55052	0.54;0.54;0.54	3.63	0.234	0.15390	.	.	.	.	.	T	0.29524	0.0736	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24941	-1.0146	9	0.06891	T	0.86	-0.0319	5.9006	0.18964	0.5753:0.0:0.4247:0.0	.	1262	Q9BYE9	CDHR2_HUMAN	K	1262	ENSP00000424565:E1262K;ENSP00000261944:E1262K;ENSP00000421078:E1262K	ENSP00000261944:E1262K	E	+	1	0	CDHR2	175952379	0.000000	0.05858	0.488000	0.27440	0.363000	0.29612	-0.278000	0.08490	0.191000	0.20236	0.459000	0.35465	GAA	.	.	.	none		0.542	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675	
PPARD	5467	hgsc.bcm.edu	37	6	35387920	35387920	+	Silent	SNP	C	C	A			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr6:35387920C>A	ENST00000311565.4	+	5	496	c.147C>A	c.(145-147)tcC>tcA	p.S49S	PPARD_ENST00000444397.1_Silent_p.S49S|PPARD_ENST00000418635.2_Intron|PPARD_ENST00000360694.3_Silent_p.S49S|PPARD_ENST00000337400.2_Silent_p.S49S|PPARD_ENST00000448077.2_Silent_p.S10S|PPARD_ENST00000540939.1_Intron	NM_001171818.1	NP_001165289.1	Q03181	PPARD_HUMAN	peroxisome proliferator-activated receptor delta	49					adipose tissue development (GO:0060612)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|axon ensheathment (GO:0008366)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular response to hypoxia (GO:0071456)|cholesterol metabolic process (GO:0008203)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|fatty acid beta-oxidation (GO:0006635)|fatty acid catabolic process (GO:0009062)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)|lipid metabolic process (GO:0006629)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of inflammatory response (GO:0050728)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid biosynthetic process (GO:0008654)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epidermis development (GO:0045684)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|proteoglycan metabolic process (GO:0006029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to activity (GO:0014823)|response to glucose (GO:0009749)|response to vitamin A (GO:0033189)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vitamin A metabolic process (GO:0006776)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|linoleic acid binding (GO:0070539)|lipid binding (GO:0008289)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(4)|liver(2)|lung(9)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23					Bezafibrate(DB01393)|Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)	CCCGGAGCTCCTCGCCACCCT	0.677																																					p.S49S		Atlas-SNP	.											.	PPARD	46	.	0			c.C147A						PASS	.						53.0	51.0	52.0					6																	35387920		2203	4300	6503	SO:0001819	synonymous_variant	5467	exon5			GAGCTCCTCGCCA	L07592	CCDS4803.1, CCDS4804.1, CCDS54994.1, CCDS54995.1	6p21.2	2013-01-16	2006-10-17		ENSG00000112033	ENSG00000112033		"""Nuclear hormone receptors"""	9235	protein-coding gene	gene with protein product		600409	"""peroxisome proliferative activated receptor, delta"""			1333051	Standard	NM_177435		Approved	NUC1, NUCII, FAAR, NR1C2	uc003okm.3	Q03181	OTTHUMG00000014567	ENST00000311565.4:c.147C>A	chr6.hg19:g.35387920C>A		52.0	0.0	.		40.0	16.0	.	NM_001171818	A8K6J6|B4E3V3|B6ZGS1|B7Z3W1|E9PE18|Q5D1P0|Q7Z5K0|Q9BUD4	Silent	SNP	ENST00000311565.4	hg19	CCDS4803.1																																																																																			.	.	.	none		0.677	PPARD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040288.1	NM_006238	
RUNX2	860	hgsc.bcm.edu	37	6	45390463	45390463	+	Silent	SNP	G	G	A			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr6:45390463G>A	ENST00000371438.1	+	2	550	c.192G>A	c.(190-192)caG>caA	p.Q64Q	RUNX2_ENST00000465038.2_Silent_p.Q64Q|RUNX2_ENST00000371432.3_Silent_p.Q50Q|RUNX2_ENST00000371436.6_Silent_p.Q64Q|RUNX2_ENST00000576263.1_Silent_p.Q64Q|RUNX2_ENST00000541979.1_Silent_p.Q132Q|RUNX2_ENST00000352853.5_Silent_p.Q132Q|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000359524.5_Silent_p.Q50Q	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	64	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						agcagcagcagcaacagcagc	0.736																																					p.Q64Q		Atlas-SNP	.											RUNX2_ENST00000352853,NS,carcinoma,0,2	RUNX2	128	.	0			c.G192A						PASS	.						11.0	16.0	14.0					6																	45390463		1448	3096	4544	SO:0001819	synonymous_variant	860	exon3			GCAGCAGCAACAG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.192G>A	chr6.hg19:g.45390463G>A		63.0	0.0	.		45.0	4.0	.	NM_001024630	O14614|O14615|O95181	Silent	SNP	ENST00000371438.1	hg19	CCDS43467.2																																																																																			.	.	.	none		0.736	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
LAMB1	3912	hgsc.bcm.edu	37	7	107572669	107572669	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr7:107572669C>T	ENST00000222399.6	-	28	4572	c.4342G>A	c.(4342-4344)Gac>Aac	p.D1448N	LAMB1_ENST00000474380.1_5'UTR|LAMB1_ENST00000393561.1_Missense_Mutation_p.D1472N	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1448	Domain I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						ACATCTTGGTCCAAGTCCATG	0.517																																					p.D1448N		Atlas-SNP	.											.	LAMB1	185	.	0			c.G4342A						PASS	.						173.0	159.0	163.0					7																	107572669		2203	4300	6503	SO:0001583	missense	3912	exon28			CTTGGTCCAAGTC	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.4342G>A	chr7.hg19:g.107572669C>T	ENSP00000222399:p.Asp1448Asn	152.0	0.0	.		145.0	63.0	.	NM_002291	Q14D91	Missense_Mutation	SNP	ENST00000222399.6	hg19	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	C	34	5.389844	0.95988	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	T;T	0.32515	1.45;1.45	5.21	5.21	0.72293	.	.	.	.	.	T	0.54095	0.1837	M	0.62723	1.935	0.80722	D	1	P;D	0.76494	0.885;0.999	P;D	0.70487	0.468;0.969	T	0.52185	-0.8609	9	0.52906	T	0.07	.	18.9339	0.92577	0.0:1.0:0.0:0.0	.	1448;1472	P07942;G3XAI2	LAMB1_HUMAN;.	N	1472;1448	ENSP00000377191:D1472N;ENSP00000222399:D1448N	ENSP00000222399:D1448N	D	-	1	0	LAMB1	107359905	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.320000	0.79064	2.708000	0.92522	0.655000	0.94253	GAC	.	.	.	none		0.517	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291	
ABCB8	11194	hgsc.bcm.edu	37	7	150725694	150725694	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr7:150725694T>A	ENST00000297504.6	+	1	158	c.92T>A	c.(91-93)gTc>gAc	p.V31D	RP11-148K1.10_ENST00000479085.1_RNA|ABCB8_ENST00000498578.1_Missense_Mutation_p.V31D|ABCB8_ENST00000358849.4_Missense_Mutation_p.V31D|ABCB8_ENST00000477092.1_Missense_Mutation_p.V31D|ABCB8_ENST00000477719.1_Missense_Mutation_p.V31D|ABCB8_ENST00000542328.1_Nonsense_Mutation_p.C47*|ABCB8_ENST00000356058.4_Missense_Mutation_p.V31D			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	31					transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	TTCTCAGCTGTCAGGTAAAAA	0.632											OREG0018445	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V31D		Atlas-SNP	.											.	ABCB8	65	.	0			c.T92A						PASS	.						41.0	39.0	40.0					7																	150725694		2203	4300	6503	SO:0001583	missense	11194	exon1			CAGCTGTCAGGTA	AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.92T>A	chr7.hg19:g.150725694T>A	ENSP00000297504:p.Val31Asp	81.0	0.0	.	1734	69.0	11.0	.	NM_007188	A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Missense_Mutation	SNP	ENST00000297504.6	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	26.8|26.8	4.772126|4.772126	0.90108|0.90108	.|.	.|.	ENSG00000197150|ENSG00000197150	ENST00000542328|ENST00000461373;ENST00000358849;ENST00000360651;ENST00000297504;ENST00000498578;ENST00000356058;ENST00000477719;ENST00000477092	.|D;D;D;D;D;D	.|0.91686	.|-2.75;-2.75;-2.89;-2.53;-2.23;-2.26	4.99|4.99	-0.764|-0.764	0.11027|0.11027	.|.	.|0.847859	.|0.10224	.|N	.|0.700511	.|D	.|0.86087	.|0.5849	L|L	0.27053|0.27053	0.805|0.805	0.43364|0.43364	D|D	0.995446|0.995446	.|B;P;P;P;P	.|0.51351	.|0.232;0.664;0.573;0.664;0.944	.|B;B;P;B;P	.|0.47346	.|0.193;0.261;0.448;0.368;0.544	.|T	.|0.78011	.|-0.2371	.|10	0.15066|0.46703	T|T	0.55|0.11	-0.4325|-0.4325	4.4338|4.4338	0.11540|0.11540	0.0:0.3635:0.1804:0.4561|0.0:0.3635:0.1804:0.4561	.|.	.|31;31;31;31;31	.|A5D8W3;Q9NUT2;Q9NUT2-2;C9JTY4;E7ENE8	.|.;ABCB8_HUMAN;.;.;.	X|D	47|31	.|ENSP00000351717:V31D;ENSP00000297504:V31D;ENSP00000418271:V31D;ENSP00000348353:V31D;ENSP00000419891:V31D;ENSP00000419558:V31D	ENSP00000438776:C47X|ENSP00000297504:V31D	C|V	+|+	3|2	2|0	ABCB8|ABCB8	150356627|150356627	1.000000|1.000000	0.71417|0.71417	0.902000|0.902000	0.35471|0.35471	0.779000|0.779000	0.44077|0.44077	0.244000|0.244000	0.18124|0.18124	-0.269000|-0.269000	0.09298|0.09298	-0.256000|-0.256000	0.11100|0.11100	TGT|GTC	.	.	.	none		0.632	ABCB8-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351733.2	NM_007188	
NUGGC	389643	hgsc.bcm.edu	37	8	27918040	27918040	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr8:27918040G>T	ENST00000413272.2	-	8	1142	c.1000C>A	c.(1000-1002)Ctg>Atg	p.L334M	NUGGC_ENST00000341513.6_Missense_Mutation_p.L334M	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	334					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										CTCTCATTCAGAAGGTCTTCG	0.537											OREG0018675	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L334M		Atlas-SNP	.											.	.	.	.	0			c.C1000A						PASS	.						57.0	58.0	57.0					8																	27918040		1960	4147	6107	SO:0001583	missense	389643	exon8			CATTCAGAAGGTC	AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.1000C>A	chr8.hg19:g.27918040G>T	ENSP00000408697:p.Leu334Met	100.0	0.0	.	99	91.0	29.0	.	NM_001010906	Q6ZP73	Missense_Mutation	SNP	ENST00000413272.2	hg19	CCDS47833.1	.	.	.	.	.	.	.	.	.	.	G	16.42	3.117376	0.56505	.	.	ENSG00000189233	ENST00000413272;ENST00000341513	D;D	0.96334	-3.98;-3.98	5.67	3.84	0.44239	.	0.099090	0.41712	D	0.000832	D	0.96491	0.8855	M	0.71036	2.16	0.30739	N	0.746356	D	0.53151	0.958	P	0.56751	0.805	D	0.93916	0.7201	10	0.46703	T	0.11	-4.7393	7.9242	0.29865	0.0861:0.1608:0.7531:0.0	.	334	Q68CJ6	SLIP_HUMAN	M	334	ENSP00000408697:L334M;ENSP00000345031:L334M	ENSP00000345031:L334M	L	-	1	2	C8orf80	27973959	1.000000	0.71417	0.996000	0.52242	0.825000	0.46686	2.049000	0.41288	0.720000	0.32209	0.585000	0.79938	CTG	.	.	.	none		0.537	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342494.1	NM_001010906	
ANKS6	203286	hgsc.bcm.edu	37	9	101540705	101540705	+	Splice_Site	SNP	G	G	A			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr9:101540705G>A	ENST00000353234.4	-	7	1417	c.1370C>T	c.(1369-1371)tCc>tTc	p.S457F	ANKS6_ENST00000375019.2_Splice_Site_p.S156F|ANKS6_ENST00000540940.1_Splice_Site_p.S262F|ANKS6_ENST00000375018.1_Splice_Site_p.S457F			Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain containing 6	457						cilium (GO:0005929)|cytoplasm (GO:0005737)				endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	21		Acute lymphoblastic leukemia(62;0.0527)				GTTCCACCAGGACTGCCAAAG	0.572																																					p.S457F		Atlas-SNP	.											.	ANKS6	59	.	0			c.C1370T						PASS	.						29.0	34.0	32.0					9																	101540705		2117	4219	6336	SO:0001630	splice_region_variant	203286	exon7			CACCAGGACTGCC	AK094247	CCDS43856.1	9q31.1	2013-09-10	2006-02-17	2006-02-17	ENSG00000165138	ENSG00000165138		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26724	protein-coding gene	gene with protein product		615370	"""sterile alpha motif domain containing 6"", ""ankyrin repeat domain 14"""	SAMD6, ANKRD14		23793029	Standard	XM_005251793		Approved	FLJ36928, NPHP16	uc004ayu.3	Q68DC2	OTTHUMG00000020347	ENST00000353234.4:c.1369-1C>T	chr9.hg19:g.101540705G>A		169.0	0.0	.		125.0	48.0	.	NM_173551	A0SE62|Q5VSL0|Q5VSL2|Q5VSL3|Q5VSL4|Q68DB8|Q6P2R2|Q8N9L6|Q96D62	Missense_Mutation	SNP	ENST00000353234.4	hg19	CCDS43856.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.460139	0.84317	.	.	ENSG00000165138	ENST00000375019;ENST00000375018;ENST00000353234;ENST00000540940	T;T;T;T	0.72167	1.69;-0.62;-0.63;1.94	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.82949	0.5148	M	0.65498	2.005	0.58432	D	0.999994	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.996	D	0.84479	0.0604	10	0.72032	D	0.01	-24.47	16.6649	0.85250	0.0:0.0:1.0:0.0	.	457;457	Q68DC2-4;Q68DC2	.;ANKS6_HUMAN	F	156;457;457;262	ENSP00000364159:S156F;ENSP00000364158:S457F;ENSP00000297837:S457F;ENSP00000442189:S262F	ENSP00000297837:S457F	S	-	2	0	ANKS6	100580526	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	8.949000	0.93012	2.525000	0.85131	0.655000	0.94253	TCC	.	.	.	none		0.572	ANKS6-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277053.1	NM_173551	Missense_Mutation
PPP6C	5537	hgsc.bcm.edu	37	9	127916020	127916020	+	Splice_Site	SNP	A	A	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr9:127916020A>T	ENST00000373547.4	-	6	560	c.461T>A	c.(460-462)tTa>tAa	p.L154*	PPP6C_ENST00000373546.3_Splice_Site_p.L7*|PPP6C_ENST00000451402.1_Splice_Site_p.L191*|PPP6C_ENST00000415905.1_Splice_Site_p.L132*	NM_002721.4	NP_002712.1	O00743	PPP6_HUMAN	protein phosphatase 6, catalytic subunit	154					G1/S transition of mitotic cell cycle (GO:0000082)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			NS(2)|endometrium(1)|large_intestine(4)|liver(1)|lung(2)|ovary(1)|skin(3)	14						CTCATCTATTAACTAGCAAAA	0.343																																					p.L191X		Atlas-SNP	.											.	PPP6C	108	.	0			c.T572A						PASS	.						48.0	47.0	48.0					9																	127916020		2203	4300	6503	SO:0001630	splice_region_variant	5537	exon7			TCTATTAACTAGC	AF035158	CCDS6861.1, CCDS48018.1, CCDS48019.1	9q33.3	2010-03-17			ENSG00000119414	ENSG00000119414		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9323	protein-coding gene	gene with protein product		612725				9143513	Standard	NM_002721		Approved	PP6	uc004bpg.4	O00743	OTTHUMG00000020671	ENST00000373547.4:c.460-1T>A	chr9.hg19:g.127916020A>T		57.0	0.0	.		50.0	20.0	.	NM_001123355	B2R5V6|B7Z2W9|B7Z5K9|Q5U0A2|Q9UIC9	Nonsense_Mutation	SNP	ENST00000373547.4	hg19	CCDS6861.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.576849	0.86645	.	.	ENSG00000119414	ENST00000373547;ENST00000451402;ENST00000415905;ENST00000373546	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-29.0263	14.9689	0.71217	1.0:0.0:0.0:0.0	.	.	.	.	X	154;191;132;7	.	ENSP00000362647:L7X	L	-	2	0	PPP6C	126955841	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.910000	0.92685	2.132000	0.65825	0.377000	0.23210	TTA	.	.	.	none		0.343	PPP6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054060.1	NM_016294	Nonsense_Mutation
SH2D3C	10044	hgsc.bcm.edu	37	9	130502080	130502080	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr9:130502080G>A	ENST00000314830.8	-	11	2401	c.2288C>T	c.(2287-2289)cCt>cTt	p.P763L	SH2D3C_ENST00000373274.3_Missense_Mutation_p.P603L|SH2D3C_ENST00000373276.3_Missense_Mutation_p.P695L|SH2D3C_ENST00000420366.1_Missense_Mutation_p.P605L|SH2D3C_ENST00000429553.1_Missense_Mutation_p.P409L|SH2D3C_ENST00000373277.4_Missense_Mutation_p.P606L	NM_170600.2	NP_733745.1	Q8N5H7	SH2D3_HUMAN	SH2 domain containing 3C	763	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CCAGGGCTCAGGGCCCTCTGG	0.662																																					p.P763L		Atlas-SNP	.											.	SH2D3C	102	.	0			c.C2288T						PASS	.						19.0	17.0	17.0					9																	130502080		2199	4295	6494	SO:0001583	missense	10044	exon11			GGCTCAGGGCCCT	AF124251	CCDS6877.1, CCDS6878.1, CCDS48026.1, CCDS48028.1, CCDS59145.1	9q33.1-q33.3	2013-02-14	2002-01-14		ENSG00000095370	ENSG00000095370		"""SH2 domain containing"""	16884	protein-coding gene	gene with protein product		604722	"""SH2 domain-containing 3C"""			10187783	Standard	NM_170600		Approved	NSP3	uc004bsc.3	Q8N5H7	OTTHUMG00000020717	ENST00000314830.8:c.2288C>T	chr9.hg19:g.130502080G>A	ENSP00000317817:p.Pro763Leu	173.0	0.0	.		149.0	47.0	.	NM_170600	A8K5S8|E9PG48|Q5HYE5|Q5JU31|Q6UY42|Q8N6X3|Q9Y2X5	Missense_Mutation	SNP	ENST00000314830.8	hg19	CCDS6877.1	.	.	.	.	.	.	.	.	.	.	G	12.34	1.908323	0.33721	.	.	ENSG00000095370	ENST00000373277;ENST00000420366;ENST00000373276;ENST00000373274;ENST00000429553;ENST00000314830	T;T;T;T;T;T	0.21031	2.86;2.86;2.61;2.86;2.03;2.84	5.24	5.24	0.73138	Guanine-nucleotide dissociation stimulator CDC25 (2);	0.349077	0.35040	N	0.003483	T	0.08268	0.0206	N	0.02213	-0.635	0.58432	D	0.999997	B;B;B;B;B	0.16396	0.0;0.017;0.0;0.0;0.001	B;B;B;B;B	0.15052	0.001;0.012;0.002;0.003;0.003	T	0.24764	-1.0151	10	0.08381	T	0.77	-12.6255	13.6889	0.62533	0.0:0.1545:0.8455:0.0	.	603;763;695;606;605	E9PG48;Q8N5H7;E7EUN5;Q8N5H7-2;Q8N5H7-5	.;SH2D3_HUMAN;.;.;.	L	606;605;695;603;409;763	ENSP00000362374:P606L;ENSP00000388536:P605L;ENSP00000362373:P695L;ENSP00000362371:P603L;ENSP00000394632:P409L;ENSP00000317817:P763L	ENSP00000317817:P763L	P	-	2	0	SH2D3C	129541901	0.730000	0.28100	0.976000	0.42696	0.919000	0.55068	1.793000	0.38764	2.732000	0.93576	0.561000	0.74099	CCT	.	.	.	none		0.662	SH2D3C-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054264.1	NM_005489	
GBGT1	26301	hgsc.bcm.edu	37	9	136030630	136030630	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr9:136030630C>G	ENST00000372040.3	-	6	605	c.294G>C	c.(292-294)gaG>gaC	p.E98D	GBGT1_ENST00000372043.3_Missense_Mutation_p.E98D|GBGT1_ENST00000540636.1_Missense_Mutation_p.E81D|RALGDS_ENST00000542690.1_Missense_Mutation_p.A111P|GBGT1_ENST00000472281.1_5'UTR|GBGT1_ENST00000372038.3_Missense_Mutation_p.A111P	NM_001282629.1	NP_001269558.1	Q8N5D6	GBGT1_HUMAN	globoside alpha-1,3-N-acetylgalactosaminyltransferase 1	98					glycolipid biosynthetic process (GO:0009247)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	globoside alpha-N-acetylgalactosaminyltransferase activity (GO:0047277)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(4)|lung(2)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;3.49e-06)|Epithelial(140;2.59e-05)		GCTGCAGAAGCTCTGGGTTGA	0.632																																					p.E98D		Atlas-SNP	.											.	GBGT1	25	.	0			c.G294C						PASS	.						114.0	104.0	107.0					9																	136030630		2203	4300	6503	SO:0001583	missense	26301	exon6			CAGAAGCTCTGGG	AY358175	CCDS6960.1, CCDS65175.1, CCDS65176.1	9q34.13-q34.3	2014-07-18			ENSG00000148288	ENSG00000148288		"""Glycosyltransferase family 6 domain containing"""	20460	protein-coding gene	gene with protein product	"""Forssman glycolipid synthetase (FS)"", ""Forssman synthetase"""	606074				10506200, 8855242	Standard	NM_021996		Approved	UDP-GalNAc, A3GALNT, MGC44848, FS		Q8N5D6	OTTHUMG00000020853	ENST00000372040.3:c.294G>C	chr9.hg19:g.136030630C>G	ENSP00000361110:p.Glu98Asp	142.0	0.0	.		89.0	27.0	.	NM_021996	A8K633|B2RA95|B7Z8S5|Q45F07|Q5T7U9|Q5T7V1|Q8N2K4|Q9UKI5	Missense_Mutation	SNP	ENST00000372040.3	hg19	CCDS6960.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.731|4.731	0.135935|0.135935	0.09032|0.09032	.|.	.|.	ENSG00000160271;ENSG00000148288|ENSG00000148288	ENST00000542690;ENST00000372038|ENST00000372043;ENST00000372040;ENST00000540636	T;T|T;T;T	0.38560|0.01234	1.7;1.13|5.13;5.13;5.13	4.98|4.98	2.08|2.08	0.27032|0.27032	.|.	.|0.438261	.|0.23016	.|N	.|0.052913	T|T	0.00875|0.00875	0.0029|0.0029	N|N	0.25144|0.25144	0.715|0.715	0.09310|0.09310	N|N	0.999999|0.999999	B|B;B	0.06786|0.06786	0.001|0.001;0.001	B|B;B	0.09377|0.12156	0.004|0.004;0.007	T|T	0.49437|0.49437	-0.8940|-0.8940	9|10	0.87932|0.02654	D|T	0|1	-8.294|-8.294	2.9566|2.9566	0.05878|0.05878	0.1451:0.5578:0.1406:0.1565|0.1451:0.5578:0.1406:0.1565	.|.	111|81;98	F5H6M6|B7Z8S5;Q8N5D6	.|.;GBGT1_HUMAN	P|D	111|98;98;81	ENSP00000437518:A111P;ENSP00000361108:A111P|ENSP00000361113:E98D;ENSP00000361110:E98D;ENSP00000437663:E81D	ENSP00000361108:A111P|ENSP00000361110:E98D	A|E	-|-	1|3	0|2	GBGT1;RALGDS|GBGT1	135020451|135020451	0.001000|0.001000	0.12720|0.12720	0.017000|0.017000	0.16124|0.16124	0.019000|0.019000	0.09904|0.09904	-0.033000|-0.033000	0.12246|0.12246	0.135000|0.135000	0.18707|0.18707	-0.305000|-0.305000	0.09177|0.09177	GCT|GAG	.	.	.	none		0.632	GBGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054815.1	NM_021996	
DPP7	29952	hgsc.bcm.edu	37	9	140008368	140008368	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr9:140008368A>G	ENST00000371579.2	-	4	438	c.434T>C	c.(433-435)cTa>cCa	p.L145P		NM_013379.2	NP_037511.2	Q9UHL4	DPP2_HUMAN	dipeptidyl-peptidase 7	145						cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;4.25e-05)|Epithelial(140;0.000633)		GTCGCGTCGTAGCGCGCGGAG	0.746																																					p.L145P		Atlas-SNP	.											.	DPP7	22	.	0			c.T434C						PASS	.						8.0	8.0	8.0					9																	140008368		2136	4172	6308	SO:0001583	missense	29952	exon4			CGTCGTAGCGCGC	AF154502	CCDS7030.1	9q34.3	2008-02-05	2006-01-12		ENSG00000176978	ENSG00000176978			14892	protein-coding gene	gene with protein product		610537	"""dipeptidylpeptidase 7"""			10477574, 11139392	Standard	XM_005266075		Approved	DPPII	uc004clh.3	Q9UHL4	OTTHUMG00000020977	ENST00000371579.2:c.434T>C	chr9.hg19:g.140008368A>G	ENSP00000360635:p.Leu145Pro	57.0	0.0	.		47.0	13.0	.	NM_013379	A8K7U7|Q5VSF1|Q969X4	Missense_Mutation	SNP	ENST00000371579.2	hg19	CCDS7030.1	.	.	.	.	.	.	.	.	.	.	A	14.49	2.551014	0.45383	.	.	ENSG00000176978	ENST00000371579	D	0.93366	-3.21	4.5	4.5	0.54988	.	0.000000	0.64402	D	0.000007	D	0.97315	0.9122	H	0.95151	3.63	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97574	1.0106	10	0.72032	D	0.01	-33.7912	10.0965	0.42478	1.0:0.0:0.0:0.0	.	145	Q9UHL4	DPP2_HUMAN	P	145	ENSP00000360635:L145P	ENSP00000360635:L145P	L	-	2	0	DPP7	139128189	0.937000	0.31787	0.066000	0.19879	0.003000	0.03518	3.290000	0.51755	1.888000	0.54679	0.454000	0.30748	CTA	.	.	.	none		0.746	DPP7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055279.1	NM_013379	
CUBN	8029	hgsc.bcm.edu	37	10	17164807	17164807	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr10:17164807T>C	ENST00000377833.4	-	6	645	c.580A>G	c.(580-582)Atg>Gtg	p.M194V		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	194	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TAACTTCCCATTGTATTAACA	0.368																																					p.M194V		Atlas-SNP	.											.	CUBN	515	.	0			c.A580G						PASS	.						64.0	57.0	59.0					10																	17164807		2203	4300	6503	SO:0001583	missense	8029	exon6			TTCCCATTGTATT	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.580A>G	chr10.hg19:g.17164807T>C	ENSP00000367064:p.Met194Val	145.0	0.0	.		132.0	53.0	.	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	hg19	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	T	1.180	-0.638441	0.03557	.	.	ENSG00000107611	ENST00000377833;ENST00000433666	D;D	0.91407	-2.84;-2.84	5.22	-5.63	0.02474	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	2.038200	0.02936	N	0.139880	T	0.67702	0.2921	N	0.00894	-1.105	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.65772	-0.6087	10	0.14656	T	0.56	.	2.2608	0.04067	0.1568:0.2399:0.373:0.2303	.	194	O60494	CUBN_HUMAN	V	194;81	ENSP00000367064:M194V;ENSP00000415970:M81V	ENSP00000367064:M194V	M	-	1	0	CUBN	17204813	0.108000	0.22018	0.001000	0.08648	0.501000	0.33797	-0.357000	0.07651	-1.082000	0.03101	-1.292000	0.01352	ATG	.	.	.	none		0.368	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
TUBGCP2	10844	hgsc.bcm.edu	37	10	135095734	135095735	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr10:135095734_135095735GC>AT	ENST00000252936.3	-	15	2440_2441	c.2401_2402GC>AT	c.(2401-2403)GCc>ATc	p.A801I	TUBGCP2_ENST00000417178.2_Missense_Mutation_p.A671I|TUBGCP2_ENST00000543663.1_Missense_Mutation_p.A829I|TUBGCP2_ENST00000368563.2_Missense_Mutation_p.A801I|TUBGCP2_ENST00000368562.1_Missense_Mutation_p.A394I			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	801					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		CACCTTCCTGGCGAGCTCCTTC	0.688																																					p.A829V|p.A829T		Atlas-SNP	.											.	TUBGCP2	79	.	0			c.C2486T|c.G2485A						PASS	.																																			SO:0001583	missense	10844	exon17			TTCCTGGCGAGCT|TCCTGGCGAGCTC	AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.2401_2402delinsAT	chr10.hg19:g.135095734_135095735delinsAT	ENSP00000252936:p.Ala801Ile	75.0|73.0	0.0	.		54.0|53.0	17.0	.	NM_001256617	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Missense_Mutation	SNP	ENST00000252936.3	hg19	CCDS7676.1																																																																																			.	.	.	none		0.688	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051148.1		
PIK3C2A	5286	hgsc.bcm.edu	37	11	17156501	17156501	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr11:17156501A>G	ENST00000265970.7	-	10	1972	c.1973T>C	c.(1972-1974)cTc>cCc	p.L658P	PIK3C2A_ENST00000531428.1_Intron|PIK3C2A_ENST00000540361.1_Missense_Mutation_p.L278P	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	658					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						ATTTGCATGGAGTCTGAGAAG	0.378																																					p.L658P		Atlas-SNP	.											.	PIK3C2A	148	.	0			c.T1973C						PASS	.						140.0	138.0	139.0					11																	17156501		2200	4293	6493	SO:0001583	missense	5286	exon10			GCATGGAGTCTGA	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.1973T>C	chr11.hg19:g.17156501A>G	ENSP00000265970:p.Leu658Pro	95.0	0.0	.		89.0	32.0	.	NM_002645	B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	ENST00000265970.7	hg19	CCDS7824.1	.	.	.	.	.	.	.	.	.	.	A	19.20	3.781930	0.70222	.	.	ENSG00000011405	ENST00000265970;ENST00000540361	T;T	0.68331	-0.32;0.14	5.59	4.48	0.54585	.	0.190360	0.47852	N	0.000211	T	0.79311	0.4424	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.80246	-0.1462	10	0.72032	D	0.01	-2.1001	11.3443	0.49552	0.9293:0.0:0.0707:0.0	.	658	O00443	P3C2A_HUMAN	P	658;278	ENSP00000265970:L658P;ENSP00000438687:L278P	ENSP00000265970:L658P	L	-	2	0	PIK3C2A	17113077	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.637000	0.83313	0.987000	0.38709	0.477000	0.44152	CTC	.	.	.	none		0.378	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645	
FJX1	24147	hgsc.bcm.edu	37	11	35641396	35641396	+	Silent	SNP	C	C	G			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr11:35641396C>G	ENST00000317811.4	+	1	1662	c.1212C>G	c.(1210-1212)gcC>gcG	p.A404A	FJX1_ENST00000532914.1_3'UTR	NM_014344.3	NP_055159.2	Q86VR8	FJX1_HUMAN	four jointed box 1 (Drosophila)	404					retina layer formation (GO:0010842)	extracellular space (GO:0005615)				lung(1)|urinary_tract(1)	2	all_cancers(35;0.177)|all_lung(20;0.0238)|Lung NSC(22;0.0494)|all_epithelial(35;0.0739)	all_hematologic(20;0.107)				AGCTGGCCGCCCTTGCAGACC	0.711																																					p.A404A	Melanoma(161;10 2587 27165 47356)	Atlas-SNP	.											.	FJX1	32	.	0			c.C1212G						PASS	.						4.0	5.0	5.0					11																	35641396		1828	3908	5736	SO:0001819	synonymous_variant	24147	exon1			GGCCGCCCTTGCA	AJ245599	CCDS44570.1	11p13	2012-05-18				ENSG00000179431			17166	protein-coding gene	gene with protein product	"""putative secreted ligand homologous to fjx1"""	612206				7647465, 10072791	Standard	NM_014344		Approved	FLJ22416, FLJ25593	uc001mwh.3	Q86VR8		ENST00000317811.4:c.1212C>G	chr11.hg19:g.35641396C>G		142.0	0.0	.		112.0	28.0	.	NM_014344	B2RCA9|Q9UGK6	Silent	SNP	ENST00000317811.4	hg19	CCDS44570.1																																																																																			.	.	.	none		0.711	FJX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389078.1	NM_014344	
UCP3	7352	hgsc.bcm.edu	37	11	73715620	73715620	+	Silent	SNP	G	G	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr11:73715620G>T	ENST00000314032.4	-	5	1104	c.552C>A	c.(550-552)ccC>ccA	p.P184P	UCP3_ENST00000426995.2_Silent_p.P184P|UCP3_ENST00000545271.1_5'Flank|UCP3_ENST00000348534.4_Intron	NM_003356.3	NP_003347.1	P55916	UCP3_HUMAN	uncoupling protein 3 (mitochondrial, proton carrier)	184					aging (GO:0007568)|cellular metabolic process (GO:0044237)|cellular response to hormone stimulus (GO:0032870)|fatty acid metabolic process (GO:0006631)|lipid metabolic process (GO:0006629)|mitochondrial transport (GO:0006839)|proton transport (GO:0015992)|respiratory electron transport chain (GO:0022904)|respiratory gaseous exchange (GO:0007585)|response to activity (GO:0014823)|response to cold (GO:0009409)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|response to superoxide (GO:0000303)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	oxidative phosphorylation uncoupler activity (GO:0017077)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	12	Breast(11;2.08e-05)					TCATGATGTTGGGCAAAGTTC	0.562																																					p.P184P		Atlas-SNP	.											.	UCP3	31	.	0			c.C552A						PASS	.						182.0	134.0	151.0					11																	73715620		2200	4293	6493	SO:0001819	synonymous_variant	7352	exon5			GATGTTGGGCAAA	AF001787	CCDS8229.1, CCDS44677.1	11q13.4	2013-05-22				ENSG00000175564		"""Solute carriers"""	12519	protein-coding gene	gene with protein product		602044				9480760, 9196039	Standard	NM_003356		Approved	SLC25A9	uc001our.3	P55916		ENST00000314032.4:c.552C>A	chr11.hg19:g.73715620G>T		103.0	0.0	.		63.0	14.0	.	NM_003356	O60475|Q96HL3	Silent	SNP	ENST00000314032.4	hg19	CCDS8229.1																																																																																			.	.	.	none		0.562	UCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398200.1	NM_003356	
PDE3A	5139	hgsc.bcm.edu	37	12	20803382	20803382	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr12:20803382A>T	ENST00000359062.3	+	14	2813	c.2773A>T	c.(2773-2775)Aat>Tat	p.N925Y	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	925	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	CAAATAGGTAAATGATGATGT	0.284																																					p.N925Y		Atlas-SNP	.											.	PDE3A	184	.	0			c.A2773T						PASS	.						120.0	120.0	120.0					12																	20803382		2203	4300	6503	SO:0001583	missense	5139	exon14			TAGGTAAATGATG		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.2773A>T	chr12.hg19:g.20803382A>T	ENSP00000351957:p.Asn925Tyr	131.0	0.0	.		161.0	33.0	.	NM_000921	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	hg19	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	A	19.56	3.850442	0.71719	.	.	ENSG00000172572	ENST00000359062	T	0.77877	-1.13	5.96	5.96	0.96718	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.205141	0.52532	D	0.000063	D	0.88020	0.6325	M	0.77712	2.385	0.47183	D	0.999345	D	0.76494	0.999	D	0.71184	0.972	D	0.89336	0.3650	10	0.87932	D	0	.	16.4484	0.83959	1.0:0.0:0.0:0.0	.	925	Q14432	PDE3A_HUMAN	Y	925	ENSP00000351957:N925Y	ENSP00000351957:N925Y	N	+	1	0	PDE3A	20694649	1.000000	0.71417	0.985000	0.45067	0.899000	0.52679	6.909000	0.75735	2.285000	0.76669	0.533000	0.62120	AAT	.	.	.	none		0.284	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2		
KRT5	3852	hgsc.bcm.edu	37	12	52913749	52913749	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr12:52913749G>T	ENST00000252242.4	-	1	722	c.332C>A	c.(331-333)gCt>gAt	p.A111D		NM_000424.3	NP_000415.2	P13647	K2C5_HUMAN	keratin 5	111	Gly-rich.|Head.				cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|hemidesmosome assembly (GO:0031581)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			endometrium(5)|kidney(1)|large_intestine(8)|lung(15)|prostate(4)|skin(2)	35				BRCA - Breast invasive adenocarcinoma(357;0.189)		gccaccaccagctccaccgcc	0.617																																					p.A111D		Atlas-SNP	.											.	KRT5	88	.	0			c.C332A						PASS	.						114.0	123.0	120.0					12																	52913749		2203	4300	6503	SO:0001583	missense	3852	exon1			CCACCAGCTCCAC		CCDS8830.1	12q13.13	2013-01-16	2008-08-01		ENSG00000186081	ENSG00000186081		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6442	protein-coding gene	gene with protein product		148040	"""epidermolysis bullosa simplex 2 Dowling-Meara/Kobner/Weber-Cockayne types"", ""keratin 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cockayne types)"""	EBS2		1713141, 16831889	Standard	NM_000424		Approved	KRT5A	uc001san.3	P13647	OTTHUMG00000169657	ENST00000252242.4:c.332C>A	chr12.hg19:g.52913749G>T	ENSP00000252242:p.Ala111Asp	95.0	0.0	.		120.0	30.0	.	NM_000424	Q6PI71|Q6UBJ0|Q8TA91	Missense_Mutation	SNP	ENST00000252242.4	hg19	CCDS8830.1	.	.	.	.	.	.	.	.	.	.	G	12.45	1.940206	0.34283	.	.	ENSG00000186081	ENST00000252242;ENST00000456000;ENST00000551275;ENST00000546577	D;T;T	0.95885	-3.84;-1.02;1.19	5.73	2.87	0.33458	.	0.273876	0.26153	N	0.026035	D	0.89945	0.6862	L	0.31476	0.935	0.28550	N	0.911671	B	0.27559	0.181	B	0.22880	0.042	T	0.82764	-0.0296	10	0.49607	T	0.09	.	8.3726	0.32423	0.1332:0.3506:0.5161:0.0	.	111	P13647	K2C5_HUMAN	D	111;76;76;111	ENSP00000252242:A111D;ENSP00000448041:A76D;ENSP00000449651:A111D	ENSP00000252242:A111D	A	-	2	0	KRT5	51200016	0.000000	0.05858	0.782000	0.31804	0.980000	0.70556	-0.269000	0.08596	0.323000	0.23307	0.655000	0.94253	GCT	.	.	.	none		0.617	KRT5-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405312.1		
SDR9C7	121214	hgsc.bcm.edu	37	12	57324030	57324030	+	Silent	SNP	C	C	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr12:57324030C>T	ENST00000293502.1	-	2	683	c.540G>A	c.(538-540)gaG>gaA	p.E180E		NM_148897.2	NP_683695.1	Q8NEX9	DR9C7_HUMAN	short chain dehydrogenase/reductase family 9C, member 7	180					oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	retinol dehydrogenase activity (GO:0004745)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|pancreas(1)	7						CAGAGAAGGCCTCAACGCCAA	0.547																																					p.E180E		Atlas-SNP	.											.	SDR9C7	31	.	0			c.G540A						PASS	.						128.0	126.0	126.0					12																	57324030		2203	4300	6503	SO:0001819	synonymous_variant	121214	exon2			GAAGGCCTCAACG	AY044434	CCDS8926.1	12q13.3	2014-09-04			ENSG00000170426	ENSG00000170426	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	29958	protein-coding gene	gene with protein product		609769				12234675, 19027726	Standard	NM_148897		Approved	SDR-O, RDHS	uc010sqw.2	Q8NEX9	OTTHUMG00000171004	ENST00000293502.1:c.540G>A	chr12.hg19:g.57324030C>T		92.0	0.0	.		111.0	44.0	.	NM_148897	B3KVB4	Silent	SNP	ENST00000293502.1	hg19	CCDS8926.1																																																																																			.	.	.	none		0.547	SDR9C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411211.1	NM_148897	
PAWR	5074	hgsc.bcm.edu	37	12	80083574	80083574	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr12:80083574T>A	ENST00000328827.4	-	2	823	c.451A>T	c.(451-453)Atc>Ttc	p.I151F	PAWR_ENST00000547571.1_5'UTR|RP11-530C5.1_ENST00000551995.1_lincRNA	NM_002583.2	NP_002574.2	Q96IZ0	PAWR_HUMAN	PRKC, apoptosis, WT1, regulator	151	Selective for apoptosis induction in cancer cells (SAC).				actin filament bundle assembly (GO:0051017)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|interleukin-2 biosynthetic process (GO:0042094)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of amyloid precursor protein biosynthetic process (GO:0042986)|positive regulation of apoptotic process (GO:0043065)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|enzyme binding (GO:0019899)|leucine zipper domain binding (GO:0043522)|transcription corepressor activity (GO:0003714)			NS(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						CTCTTCTCGATCTGCCCCTTG	0.726																																					p.I151F		Atlas-SNP	.											.	PAWR	14	.	0			c.A451T						PASS	.						12.0	12.0	12.0					12																	80083574		2199	4297	6496	SO:0001583	missense	5074	exon2			TCTCGATCTGCCC	U63809	CCDS31863.1	12q21.2	2013-03-07			ENSG00000177425	ENSG00000177425			8614	protein-coding gene	gene with protein product	"""prostate apoptosis response-4"""	601936				8943350, 9790775	Standard	NM_002583		Approved	par-4, PAR4	uc001syx.3	Q96IZ0	OTTHUMG00000170080	ENST00000328827.4:c.451A>T	chr12.hg19:g.80083574T>A	ENSP00000328088:p.Ile151Phe	86.0	0.0	.		83.0	20.0	.	NM_002583	O75796|Q6FHY9|Q8N700	Missense_Mutation	SNP	ENST00000328827.4	hg19	CCDS31863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	31|31	5.100151|5.100151	0.94197|0.94197	.|.	.|.	ENSG00000177425|ENSG00000177425	ENST00000551712|ENST00000328827	.|T	.|0.09630	.|2.96	3.6|3.6	3.6|3.6	0.41247|0.41247	.|.	.|0.059454	.|0.64402	.|D	.|0.000003	T|T	0.21962|0.21962	0.0529|0.0529	L|L	0.48642|0.48642	1.525|1.525	0.80722|0.80722	D|D	1|1	.|D	.|0.67145	.|0.996	.|D	.|0.64410	.|0.925	T|T	0.00926|0.00926	-1.1512|-1.1512	5|9	.|.	.|.	.|.	-3.2716|-3.2716	12.3682|12.3682	0.55240|0.55240	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|151	.|Q96IZ0	.|PAWR_HUMAN	V|F	96|151	.|ENSP00000328088:I151F	.|.	D|I	-|-	2|1	0|0	PAWR|PAWR	78607705|78607705	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	6.617000|6.617000	0.74210|0.74210	1.482000|1.482000	0.48325|0.48325	0.460000|0.460000	0.39030|0.39030	GAT|ATC	.	.	.	none		0.726	PAWR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407175.1	NM_002583	
NUDT4	11163	hgsc.bcm.edu	37	12	93793130	93793130	+	Missense_Mutation	SNP	C	C	A	rs142846389		TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr12:93793130C>A	ENST00000415493.2	+	5	945	c.518C>A	c.(517-519)tCt>tAt	p.S173Y	NUDT4_ENST00000549992.1_Missense_Mutation_p.S121Y|NUDT4_ENST00000548662.1_Missense_Mutation_p.S121Y|NUDT4_ENST00000337179.5_Missense_Mutation_p.S174Y|NUDT4_ENST00000547014.1_Missense_Mutation_p.S122Y	NM_019094.4	NP_061967.3	Q9NZJ9	NUDT4_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 4	173					calcium-mediated signaling (GO:0019722)|cyclic nucleotide metabolic process (GO:0009187)|cyclic-nucleotide-mediated signaling (GO:0019935)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|regulation of RNA export from nucleus (GO:0046831)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)	diphosphoinositol-polyphosphate diphosphatase activity (GO:0008486)|inositol diphosphate tetrakisphosphate diphosphatase activity (GO:0052840)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 1-diphosphatase activity (GO:0052846)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052847)|inositol-1-diphosphate-2,3,4,5,6-pentakisphosphate diphosphatase activity (GO:0052843)|inositol-3,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052848)|inositol-3-diphosphate-1,2,4,5,6-pentakisphosphate diphosphatase activity (GO:0052844)|inositol-5-diphosphate-1,2,3,4,6-pentakisphosphate diphosphatase activity (GO:0052845)|metal ion binding (GO:0046872)|snoRNA binding (GO:0030515)			endometrium(2)|kidney(1)|lung(2)	5						GCACAGACCTCTGGGTTGCCA	0.498																																					p.S174Y		Atlas-SNP	.											.	NUDT4	6	.	0			c.C521A						PASS	.						111.0	119.0	117.0					12																	93793130		2203	4300	6503	SO:0001583	missense	11163	exon5			AGACCTCTGGGTT	AF067803	CCDS9044.1, CCDS44952.1, CCDS73504.1	12q21	2008-09-04			ENSG00000173598	ENSG00000173598		"""Nudix motif containing"""	8051	protein-coding gene	gene with protein product	"""diphosphoinositol polyphosphate phosphohydrolase type 2"""	609229				10777568, 11376937	Standard	XM_005268595		Approved	DIPP2, HDCMB47P, KIAA0487, DIPP2alpha, DIPP2beta	uc001tcm.3	Q9NZJ9	OTTHUMG00000170155	ENST00000415493.2:c.518C>A	chr12.hg19:g.93793130C>A	ENSP00000406612:p.Ser173Tyr	139.0	0.0	.		145.0	19.0	.	NM_199040	B7Z916|Q4AEJ6|Q53EZ2|Q68DD7|Q9NPC5|Q9NS30|Q9NZK0|Q9NZK1	Missense_Mutation	SNP	ENST00000415493.2	hg19	CCDS44952.1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.511311	0.44660	.	.	ENSG00000173598	ENST00000337179;ENST00000415493;ENST00000549992;ENST00000548662;ENST00000547014	T;T	0.34859	1.34;1.34	5.53	5.53	0.82687	.	0.259165	0.46442	D	0.000298	T	0.29158	0.0725	L	0.27053	0.805	0.49582	D	0.999805	P;P	0.37276	0.589;0.454	B;B	0.31245	0.126;0.059	T	0.14671	-1.0464	10	0.87932	D	0	-30.8911	19.8241	0.96610	0.0:1.0:0.0:0.0	.	174;173	Q9NZJ9-2;Q9NZJ9	.;NUDT4_HUMAN	Y	174;173;121;121;122	ENSP00000338352:S174Y;ENSP00000406612:S173Y	ENSP00000338352:S174Y	S	+	2	0	NUDT4	92317261	1.000000	0.71417	0.996000	0.52242	0.160000	0.22226	6.247000	0.72411	2.758000	0.94735	0.655000	0.94253	TCT	.	C|1.000;T|0.000	.	alt		0.498	NUDT4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407702.1	NM_019094	
USP44	84101	hgsc.bcm.edu	37	12	95907668	95907668	+	IGR	SNP	A	A	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr12:95907668A>T	ENST00000258499.3	-	0	4022				METAP2_ENST00000261220.9_Silent_p.G452G|METAP2_ENST00000323666.5_Silent_p.G475G|METAP2_ENST00000551840.1_Silent_p.G474G|METAP2_ENST00000546753.1_Silent_p.G452G|METAP2_ENST00000550777.1_Silent_p.G439G	NM_001278393.1|NM_032147.2	NP_001265322.1|NP_115523.2	Q9H0E7	UBP44_HUMAN	ubiquitin specific peptidase 44						mitotic nuclear division (GO:0007067)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deubiquitination (GO:0016579)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|regulation of spindle checkpoint (GO:0090231)	nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(5)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	36						TCAGCAGAGGAGATGACTATT	0.378																																					p.G475G		Atlas-SNP	.											.	METAP2	28	.	0			c.A1425T						PASS	.						121.0	105.0	110.0					12																	95907668		2203	4300	6503	SO:0001628	intergenic_variant	10988	exon11			CAGAGGAGATGAC	AK027434	CCDS9053.1	12q21.33	2005-08-08	2005-08-08			ENSG00000136014		"""Ubiquitin-specific peptidases"""	20064	protein-coding gene	gene with protein product		610993	"""ubiquitin specific protease 44"""			12838346	Standard	NM_001278393		Approved	FLJ14528	uc001teg.3	Q9H0E7			chr12.hg19:g.95907668A>T		107.0	0.0	.		127.0	36.0	.	NM_006838	B2RDW3	Silent	SNP	ENST00000258499.3	hg19	CCDS9053.1																																																																																			.	.	.	none		0.378	USP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408312.1	NM_032147	
ATXN2	6311	hgsc.bcm.edu	37	12	112036794	112036794	+	Silent	SNP	C	C	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr12:112036794C>T	ENST00000377617.3	-	1	686	c.525G>A	c.(523-525)caG>caA	p.Q175Q	ATXN2_ENST00000542287.2_Intron|ATXN2_ENST00000550104.1_Silent_p.Q175Q|ATXN2_ENST00000389153.4_5'Flank|ATXN2_ENST00000608853.1_Silent_p.Q15Q|RP11-686G8.2_ENST00000547021.1_RNA|ATXN2_ENST00000549455.1_5'UTR|ATXN2_ENST00000535949.1_Intron	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	175	Poly-Gln.				cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						gctgctgctgctgctgctgct	0.731																																					p.Q175Q		Atlas-SNP	.											.	ATXN2	99	.	0			c.G525A						PASS	.						1.0	1.0	1.0					12																	112036794		704	1738	2442	SO:0001819	synonymous_variant	6311	exon1			CTGCTGCTGCTGC	U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.525G>A	chr12.hg19:g.112036794C>T		15.0	0.0	.		20.0	7.0	.	NM_002973	A6NLD4|Q6ZQZ7|Q99493	Silent	SNP	ENST00000377617.3	hg19	CCDS31902.1																																																																																			.	.	.	none		0.731	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973	
ANAPC5	51433	hgsc.bcm.edu	37	12	121747554	121747554	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr12:121747554T>C	ENST00000261819.3	-	16	2127	c.2006A>G	c.(2005-2007)aAg>aGg	p.K669R	ANAPC5_ENST00000344395.4_Missense_Mutation_p.K557R|ANAPC5_ENST00000441917.2_Missense_Mutation_p.K557R|ANAPC5_ENST00000541887.1_Missense_Mutation_p.K656R|ANAPC5_ENST00000535482.1_Missense_Mutation_p.K335R|ANAPC5_ENST00000544314.1_5'UTR	NM_016237.4	NP_057321.2	Q9UJX4	APC5_HUMAN	anaphase promoting complex subunit 5	669					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(6)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(3)	31	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CACCTGGCACTTGGCCACTAA	0.522																																					p.K669R		Atlas-SNP	.											.	ANAPC5	60	.	0			c.A2006G						PASS	.						86.0	78.0	81.0					12																	121747554		2203	4300	6503	SO:0001583	missense	51433	exon16			TGGCACTTGGCCA	AF191339	CCDS9220.1, CCDS45000.1	12q24.31	2014-08-12			ENSG00000089053	ENSG00000089053		"""Anaphase promoting complex subunits"""	15713	protein-coding gene	gene with protein product		606948				9469815	Standard	NM_016237		Approved	APC5	uc001uag.3	Q9UJX4	OTTHUMG00000169157	ENST00000261819.3:c.2006A>G	chr12.hg19:g.121747554T>C	ENSP00000261819:p.Lys669Arg	100.0	0.0	.		115.0	49.0	.	NM_016237	E9PFB2|Q8N4H7|Q9BQD4	Missense_Mutation	SNP	ENST00000261819.3	hg19	CCDS9220.1	.	.	.	.	.	.	.	.	.	.	T	14.89	2.669258	0.47677	.	.	ENSG00000089053	ENST00000441917;ENST00000541887;ENST00000261819;ENST00000535482;ENST00000544314;ENST00000344395	T;T;T;T;T	0.75589	-0.95;-0.95;-0.95;-0.95;-0.95	5.75	5.75	0.90469	Tetratricopeptide-like helical (1);	0.050321	0.85682	D	0.000000	T	0.65943	0.2740	L	0.32530	0.975	0.80722	D	1	B;B;B	0.20368	0.044;0.002;0.005	B;B;B	0.22753	0.041;0.002;0.003	T	0.61043	-0.7142	10	0.32370	T	0.25	.	15.2318	0.73395	0.0:0.0:0.0:1.0	.	335;557;669	F5H0N1;E9PFB2;Q9UJX4	.;.;APC5_HUMAN	R	557;656;669;335;271;557	ENSP00000415061:K557R;ENSP00000439875:K656R;ENSP00000261819:K669R;ENSP00000438754:K335R;ENSP00000343787:K557R	ENSP00000261819:K669R	K	-	2	0	ANAPC5	120231937	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.267000	0.65530	2.189000	0.69895	0.454000	0.30748	AAG	.	.	.	none		0.522	ANAPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402582.1		
NEK3	4752	hgsc.bcm.edu	37	13	52730287	52730287	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr13:52730287A>G	ENST00000400357.2	-	1	1333	c.40T>C	c.(40-42)Tcc>Ccc	p.S14P	NEK3_ENST00000339406.3_Missense_Mutation_p.S14P|NEK3_ENST00000452082.2_Missense_Mutation_p.S35P|NEK3_ENST00000378101.2_Missense_Mutation_p.S14P			P51956	NEK3_HUMAN	NIMA-related kinase 3	14	Interaction with VAV2.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.			S -> F (in Ref. 1; BAC15599). {ECO:0000305}.	mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|stomach(2)	18		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.034)|Hepatocellular(98;0.065)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.81e-08)		CTGCCGAAGGAGCCCTCCCCA	0.502																																					p.S14P		Atlas-SNP	.											.	NEK3	41	.	0			c.T40C						PASS	.						68.0	64.0	65.0					13																	52730287		1924	4148	6072	SO:0001583	missense	4752	exon2			CGAAGGAGCCCTC	AK290259, BC019916	CCDS73576.1	13q14.2-q21.1	2014-07-17	2012-11-15		ENSG00000136098	ENSG00000136098	2.7.11.1		7746	protein-coding gene	gene with protein product	"""serine/threonine-protein kinase NEK3"", ""phosphorylase B kinase kinase"", ""glycogen synthase A kinase"", ""hydroxyalkyl-protein kinase"""	604044	"""NIMA (never in mitosis gene a)-related kinase 3"""			8274451, 7522034	Standard	NM_002498		Approved	HSPK36, MGC29949	uc010tgy.2	P51956	OTTHUMG00000016958	ENST00000400357.2:c.40T>C	chr13.hg19:g.52730287A>G	ENSP00000383210:p.Ser14Pro	76.0	0.0	.		83.0	28.0	.	NM_002498	A8K2J4|Q5TAP2|Q8J023|Q8WUN5	Missense_Mutation	SNP	ENST00000400357.2	hg19	CCDS53871.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.636807	0.87760	.	.	ENSG00000136098	ENST00000339406;ENST00000378101;ENST00000400357;ENST00000452082;ENST00000547422;ENST00000550841	T;T;T;T;T;T	0.54071	1.65;1.65;1.65;1.65;0.59;1.9	5.91	4.7	0.59300	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.100564	0.64402	D	0.000001	T	0.72471	0.3464	.	.	.	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.995;1.0;0.999	T	0.75695	-0.3228	9	0.87932	D	0	.	12.2965	0.54849	0.8729:0.0:0.0:0.127	.	14;35;14	P51956;Q6ZN64;F8VS47	NEK3_HUMAN;.;.	P	14;14;14;35;14;14	ENSP00000339429:S14P;ENSP00000367341:S14P;ENSP00000383210:S14P;ENSP00000404197:S35P;ENSP00000448716:S14P;ENSP00000449679:S14P	ENSP00000448782:S14P	S	-	1	0	NEK3	51628288	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.283000	0.72646	1.018000	0.39521	0.533000	0.62120	TCC	.	.	.	none		0.502	NEK3-002	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045047.3		
MYCBP2	23077	hgsc.bcm.edu	37	13	77853046	77853046	+	Splice_Site	SNP	T	T	G			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr13:77853046T>G	ENST00000544440.2	-	4	498	c.481A>C	c.(481-483)Att>Ctt	p.I161L	MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000407578.2_Splice_Site_p.I199L|MYCBP2_ENST00000357337.6_Splice_Site_p.I161L					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		ACCTCAATAATCTATTTAAAA	0.358																																					p.I199L		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.A595C						PASS	.						29.0	32.0	31.0					13																	77853046		2203	4299	6502	SO:0001630	splice_region_variant	23077	exon4			CAATAATCTATTT	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.481-1A>C	chr13.hg19:g.77853046T>G		119.0	0.0	.		120.0	42.0	.	NM_015057		Missense_Mutation	SNP	ENST00000544440.2	hg19		.	.	.	.	.	.	.	.	.	.	T	18.82	3.704169	0.68615	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.33654	1.41;1.4;1.41	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.49864	0.1582	L	0.58810	1.83	0.80722	D	1	P	0.35745	0.518	P	0.47827	0.558	T	0.51325	-0.8720	10	0.72032	D	0.01	.	16.0351	0.80621	0.0:0.0:0.0:1.0	.	161	O75592	MYCB2_HUMAN	L	161;199;161	ENSP00000349892:I161L;ENSP00000384288:I199L;ENSP00000444596:I161L	ENSP00000349892:I161L	I	-	1	0	MYCBP2	76751047	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	8.040000	0.89188	2.186000	0.69663	0.533000	0.62120	ATT	.	.	.	none		0.358	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	Missense_Mutation
ATL1	51062	hgsc.bcm.edu	37	14	51081222	51081222	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr14:51081222A>T	ENST00000358385.6	+	8	1096	c.855A>T	c.(853-855)aaA>aaT	p.K285N	ATL1_ENST00000354525.4_Missense_Mutation_p.K285N|ATL1_ENST00000441560.2_Missense_Mutation_p.K285N|ATL1_ENST00000357032.3_Missense_Mutation_p.K285N	NM_015915.4	NP_056999.2	Q8WXF7	ATLA1_HUMAN	atlastin GTPase 1	285	GB1/RHD3-type G.				axonogenesis (GO:0007409)|cell death (GO:0008219)|endoplasmic reticulum organization (GO:0007029)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi cis cisterna (GO:0000137)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(2)|large_intestine(4)|liver(1)|lung(6)|ovary(1)|skin(3)	18						TTGATGGAAAATTGAAAGGTT	0.338																																					p.K285N		Atlas-SNP	.											.	ATL1	46	.	0			c.A855T						PASS	.						94.0	85.0	88.0					14																	51081222		2203	4300	6503	SO:0001583	missense	51062	exon8			TGGAAAATTGAAA	AF131801	CCDS9700.1, CCDS32077.1	14q21.3	2014-09-17	2008-09-17	2008-09-17	ENSG00000198513	ENSG00000198513			11231	protein-coding gene	gene with protein product	"""atlastin"""	606439	"""spastic paraplegia 3A (autosomal dominant)"""	SPG3, SPG3A		8252041, 7825576	Standard	NM_015915		Approved	FSP1, AD-FSP	uc001wyd.4	Q8WXF7	OTTHUMG00000140297	ENST00000358385.6:c.855A>T	chr14.hg19:g.51081222A>T	ENSP00000351155:p.Lys285Asn	136.0	0.0	.		131.0	43.0	.	NM_015915	A6NND5|A8K2C0|G5E9T1|O95890|Q69YH7|Q96FK0	Missense_Mutation	SNP	ENST00000358385.6	hg19	CCDS9700.1	.	.	.	.	.	.	.	.	.	.	A	6.428	0.447080	0.12223	.	.	ENSG00000198513	ENST00000441560;ENST00000358385;ENST00000357032;ENST00000354525	D;D;D;D	0.88896	-2.44;-2.44;-2.44;-2.44	5.63	3.28	0.37604	Guanylate-binding protein, N-terminal (1);	0.041939	0.85682	D	0.000000	T	0.81039	0.4740	L	0.29908	0.895	0.43364	D	0.995448	B;B	0.23806	0.068;0.091	B;B	0.20767	0.031;0.018	T	0.73161	-0.4070	10	0.44086	T	0.13	-19.0005	9.245	0.37520	0.7855:0.0:0.2145:0.0	.	285;285	Q8WXF7;G5E9T1	ATLA1_HUMAN;.	N	285	ENSP00000413675:K285N;ENSP00000351155:K285N;ENSP00000349534:K285N;ENSP00000346522:K285N	ENSP00000346522:K285N	K	+	3	2	ATL1	50150972	1.000000	0.71417	0.761000	0.31378	0.056000	0.15407	1.929000	0.40114	0.502000	0.28037	0.460000	0.39030	AAA	.	.	.	none		0.338	ATL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276884.2		
GNPNAT1	64841	hgsc.bcm.edu	37	14	53248584	53248584	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr14:53248584A>T	ENST00000216410.3	-	4	450	c.263T>A	c.(262-264)gTt>gAt	p.V88D	GNPNAT1_ENST00000554230.1_Missense_Mutation_p.V17D	NM_198066.3	NP_932332.1	Q96EK6	GNA1_HUMAN	glucosamine-phosphate N-acetyltransferase 1	88	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|glucosamine metabolic process (GO:0006041)|liver development (GO:0001889)|N-acetylglucosamine metabolic process (GO:0006044)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|membrane (GO:0016020)	glucosamine 6-phosphate N-acetyltransferase activity (GO:0004343)|monosaccharide binding (GO:0048029)	p.K80fs*17(1)		liver(1)|lung(1)|prostate(1)|skin(1)	4	Breast(41;0.176)					ATCTTCTACAACTGTAACATA	0.353																																					p.V88D		Atlas-SNP	.											.	GNPNAT1	14	.	1	Deletion - Frameshift(1)	liver(1)	c.T263A						PASS	.						98.0	99.0	99.0					14																	53248584		2203	4300	6503	SO:0001583	missense	64841	exon4			TCTACAACTGTAA	AK001469	CCDS9712.1	14q22.1	2011-11-16			ENSG00000100522	ENSG00000100522	2.3.1.4		19980	protein-coding gene	gene with protein product							Standard	NM_198066		Approved	Gpnat1, FLJ10607	uc001xab.3	Q96EK6	OTTHUMG00000152334	ENST00000216410.3:c.263T>A	chr14.hg19:g.53248584A>T	ENSP00000216410:p.Val88Asp	74.0	0.0	.		87.0	29.0	.	NM_198066		Missense_Mutation	SNP	ENST00000216410.3	hg19	CCDS9712.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.651373	0.88056	.	.	ENSG00000100522	ENST00000216410;ENST00000554230;ENST00000557604	.	.	.	5.52	5.52	0.82312	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.87192	0.6116	H	0.95611	3.695	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91052	0.4879	9	0.87932	D	0	-13.8082	15.9507	0.79835	1.0:0.0:0.0:0.0	.	88	Q96EK6	GNA1_HUMAN	D	88;17;88	.	ENSP00000216410:V88D	V	-	2	0	GNPNAT1	52318334	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.877000	0.92386	2.232000	0.73038	0.528000	0.53228	GTT	.	.	.	none		0.353	GNPNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276898.1		
PTPN21	11099	hgsc.bcm.edu	37	14	88945296	88945296	+	Nonsense_Mutation	SNP	T	T	A			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr14:88945296T>A	ENST00000556564.1	-	13	2763	c.2479A>T	c.(2479-2481)Aag>Tag	p.K827*	PTPN21_ENST00000328736.3_Nonsense_Mutation_p.K827*	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	827					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						ACGATGTTCTTCTTCCCAGAG	0.652																																					p.K827X		Atlas-SNP	.											.	PTPN21	113	.	0			c.A2479T						PASS	.						44.0	51.0	48.0					14																	88945296		2203	4300	6503	SO:0001587	stop_gained	11099	exon13			TGTTCTTCTTCCC	X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.2479A>T	chr14.hg19:g.88945296T>A	ENSP00000452414:p.Lys827*	87.0	0.0	.		67.0	16.0	.	NM_007039		Nonsense_Mutation	SNP	ENST00000556564.1	hg19	CCDS9884.1	.	.	.	.	.	.	.	.	.	.	T	40	8.015674	0.98610	.	.	ENSG00000070778	ENST00000328736;ENST00000556564	.	.	.	5.42	5.42	0.78866	.	0.292618	0.36591	N	0.002511	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.4652	0.75394	0.0:0.0:0.0:1.0	.	.	.	.	X	827	.	ENSP00000330276:K827X	K	-	1	0	PTPN21	88015049	1.000000	0.71417	0.861000	0.33841	0.222000	0.24845	4.961000	0.63681	2.057000	0.61298	0.460000	0.39030	AAG	.	.	.	none		0.652	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410303.1		
MTA1	9112	hgsc.bcm.edu	37	14	105930891	105930891	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr14:105930891A>T	ENST00000331320.7	+	14	1545	c.1331A>T	c.(1330-1332)aAc>aTc	p.N444I	MTA1_ENST00000435036.2_5'UTR|MTA1_ENST00000406191.1_Missense_Mutation_p.N444I|MTA1_ENST00000405646.1_Missense_Mutation_p.N427I	NM_001203258.1|NM_004689.3	NP_001190187.1|NP_004680.2	Q13330	MTA1_HUMAN	metastasis associated 1	444					circadian regulation of gene expression (GO:0032922)|double-strand break repair (GO:0006302)|entrainment of circadian clock by photoperiod (GO:0043153)|locomotor rhythm (GO:0045475)|positive regulation of protein autoubiquitination (GO:1902499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression, epigenetic (GO:0040029)|regulation of inflammatory response (GO:0050727)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|secretory granule organization (GO:0033363)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|microtubule (GO:0005874)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|stomach(1)	14		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		CCAGGACCAAACCGCAGTAAC	0.597																																					p.N444I		Atlas-SNP	.											.	MTA1	61	.	0			c.A1331T						PASS	.						52.0	53.0	53.0					14																	105930891		2202	4300	6502	SO:0001583	missense	9112	exon14			GACCAAACCGCAG	U35113	CCDS32169.1, CCDS55954.1	14q32.33	2013-01-25			ENSG00000182979	ENSG00000182979		"""GATA zinc finger domain containing"""	7410	protein-coding gene	gene with protein product		603526				8083195, 7607577	Standard	NM_004689		Approved		uc001yqx.3	Q13330	OTTHUMG00000150362	ENST00000331320.7:c.1331A>T	chr14.hg19:g.105930891A>T	ENSP00000333633:p.Asn444Ile	117.0	0.0	.		76.0	27.0	.	NM_004689	A5PLK4|Q86SW2|Q8NFI8|Q96GI8	Missense_Mutation	SNP	ENST00000331320.7	hg19	CCDS32169.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.561353	0.86335	.	.	ENSG00000182979	ENST00000414153;ENST00000331320;ENST00000406191;ENST00000405646;ENST00000434050;ENST00000550551	T;T;T;T	0.32515	1.46;1.46;1.45;1.45	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.50718	0.1632	.	.	.	0.80722	D	1	D;P	0.76494	0.999;0.527	D;B	0.67103	0.949;0.157	T	0.47156	-0.9139	9	0.34782	T	0.22	-41.8187	13.862	0.63566	1.0:0.0:0.0:0.0	.	236;444	Q59FW1;Q13330	.;MTA1_HUMAN	I	353;444;444;427;236;33	ENSP00000333633:N444I;ENSP00000385702:N444I;ENSP00000384180:N427I;ENSP00000394106:N236I	ENSP00000333633:N444I	N	+	2	0	MTA1	105001936	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.331000	0.59273	1.978000	0.57642	0.379000	0.24179	AAC	.	.	.	none		0.597	MTA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317849.15		
RASGRF1	5923	hgsc.bcm.edu	37	15	79339110	79339110	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr15:79339110C>T	ENST00000419573.3	-	5	1130	c.856G>A	c.(856-858)Gtc>Atc	p.V286I	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Missense_Mutation_p.V286I	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	286	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						ATGCTGCTGACGTCGTCGTGT	0.577																																					p.V286I		Atlas-SNP	.											.	RASGRF1	168	.	0			c.G856A						PASS	.						193.0	152.0	166.0					15																	79339110		2196	4293	6489	SO:0001583	missense	5923	exon5			TGCTGACGTCGTC	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.856G>A	chr15.hg19:g.79339110C>T	ENSP00000405963:p.Val286Ile	107.0	0.0	.		66.0	20.0	.	NM_001145648	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	hg19	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.092158	0.76756	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.60797	0.16	4.03	4.03	0.46877	Dbl homology (DH) domain (5);	0.083759	0.48767	D	0.000176	T	0.45196	0.1330	N	0.20328	0.56	0.80722	D	1	P;P;P;P	0.44776	0.843;0.843;0.743;0.698	B;B;B;B	0.44108	0.408;0.441;0.441;0.314	T	0.39143	-0.9628	10	0.30078	T	0.28	.	13.7003	0.62604	0.0:1.0:0.0:0.0	.	286;286;286;286	A8K270;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	I	286	ENSP00000405963:V286I	ENSP00000378224:V286I	V	-	1	0	RASGRF1	77126165	1.000000	0.71417	0.964000	0.40570	0.736000	0.42039	7.434000	0.80377	2.072000	0.62099	0.655000	0.94253	GTC	.	.	.	none		0.577	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
CHD9	80205	hgsc.bcm.edu	37	16	53301317	53301317	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr16:53301317C>G	ENST00000398510.3	+	20	4519	c.4432C>G	c.(4432-4434)Ccc>Gcc	p.P1478A	CHD9_ENST00000564845.1_Missense_Mutation_p.P1478A|CHD9_ENST00000566029.1_Missense_Mutation_p.P1478A|CHD9_ENST00000447540.1_Missense_Mutation_p.P1478A			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1478					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				AGATGAAAAGCCCAAACTCCG	0.398																																					p.P1478A		Atlas-SNP	.											.	CHD9	203	.	0			c.C4432G						PASS	.						129.0	124.0	126.0					16																	53301317		1860	4104	5964	SO:0001583	missense	80205	exon21			GAAAAGCCCAAAC	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.4432C>G	chr16.hg19:g.53301317C>G	ENSP00000381522:p.Pro1478Ala	113.0	0.0	.		146.0	75.0	.	NM_025134	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	ENST00000398510.3	hg19		.	.	.	.	.	.	.	.	.	.	C	23.5	4.426732	0.83667	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000219084	D;D	0.85556	-2.0;-2.0	5.1	4.15	0.48705	.	0.222920	0.31461	N	0.007614	D	0.90892	0.7138	M	0.78223	2.4	0.58432	D	0.999999	P;D;D;D	0.64830	0.63;0.984;0.99;0.994	P;D;P;P	0.63703	0.459;0.917;0.76;0.879	D	0.91002	0.4843	10	0.48119	T	0.1	-1.7269	13.907	0.63843	0.0:0.926:0.0:0.074	.	1004;1478;1478;1478	B4DR07;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	A	1478;1478;1004	ENSP00000396345:P1478A;ENSP00000381522:P1478A	ENSP00000219084:P1004A	P	+	1	0	CHD9	51858818	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	6.005000	0.70716	1.285000	0.44548	0.650000	0.86243	CCC	.	.	.	none		0.398	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
DRC7	84229	hgsc.bcm.edu	37	16	57735929	57735929	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr16:57735929A>T	ENST00000360716.3	+	6	807	c.586A>T	c.(586-588)Atg>Ttg	p.M196L	CCDC135_ENST00000394337.4_Missense_Mutation_p.M196L|CCDC135_ENST00000336825.8_Intron|RP11-405F3.4_ENST00000563062.1_RNA			Q8IY82	CC135_HUMAN		196					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						GCTCTGCTCCATGCTTATCGG	0.587																																					p.M196L		Atlas-SNP	.											.	CCDC135	97	.	0			c.A586T						PASS	.						181.0	137.0	152.0					16																	57735929		2198	4300	6498	SO:0001583	missense	84229	exon5			TGCTCCATGCTTA																												ENST00000360716.3:c.586A>T	chr16.hg19:g.57735929A>T	ENSP00000353942:p.Met196Leu	92.0	0.0	.		72.0	31.0	.	NM_032269	A8K943|Q8NAA0|Q9H080	Missense_Mutation	SNP	ENST00000360716.3	hg19	CCDS10787.1	.	.	.	.	.	.	.	.	.	.	A	1.504	-0.551352	0.03996	.	.	ENSG00000159625	ENST00000394337;ENST00000360716	T;T	0.14893	2.47;2.47	5.09	0.938	0.19500	.	0.352176	0.30252	N	0.010045	T	0.05731	0.0150	N	0.05177	-0.1	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37126	-0.9719	10	0.02654	T	1	-29.2494	8.5455	0.33419	0.4764:0.4138:0.0:0.1098	.	196	Q8IY82	CC135_HUMAN	L	196	ENSP00000377869:M196L;ENSP00000353942:M196L	ENSP00000353942:M196L	M	+	1	0	CCDC135	56293430	0.683000	0.27633	1.000000	0.80357	0.483000	0.33249	-0.062000	0.11674	0.743000	0.32719	0.366000	0.22137	ATG	.	.	.	none		0.587	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433323.2		
SGSM2	9905	hgsc.bcm.edu	37	17	2274584	2274584	+	Silent	SNP	C	C	A			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr17:2274584C>A	ENST00000426855.2	+	12	1492	c.1317C>A	c.(1315-1317)ggC>ggA	p.G439G	SGSM2_ENST00000268989.3_Silent_p.G484G|SGSM2_ENST00000574563.1_Silent_p.G439G	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2	439					late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		AGATGCAGGGCTTTGGGCCCA	0.662																																					p.G484G		Atlas-SNP	.											.	SGSM2	60	.	0			c.C1452A						PASS	.						31.0	29.0	30.0					17																	2274584		2201	4298	6499	SO:0001819	synonymous_variant	9905	exon13			GCAGGGCTTTGGG	BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.1317C>A	chr17.hg19:g.2274584C>A		72.0	0.0	.		84.0	18.0	.	NM_014853	A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Silent	SNP	ENST00000426855.2	hg19	CCDS45570.1																																																																																			.	.	.	none		0.662	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438186.1	NM_014853	
CYB5D2	124936	hgsc.bcm.edu	37	17	4060165	4060165	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr17:4060165G>T	ENST00000301391.3	+	4	1084	c.584G>T	c.(583-585)gGt>gTt	p.G195V	CYB5D2_ENST00000573984.1_Intron|CYB5D2_ENST00000575251.1_Missense_Mutation_p.G83V|CYB5D2_ENST00000575411.2_3'UTR	NM_144611.3	NP_653212.1	Q8WUJ1	NEUFC_HUMAN	cytochrome b5 domain containing 2	195					nervous system development (GO:0007399)	extracellular region (GO:0005576)	heme binding (GO:0020037)			breast(1)|large_intestine(3)|liver(2)|ovary(1)	7						CTTAGTGGAGGTGTGAGCAGA	0.557											OREG0024097	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G195V		Atlas-SNP	.											.	CYB5D2	22	.	0			c.G584T						PASS	.						48.0	44.0	46.0					17																	4060165		2203	4300	6503	SO:0001583	missense	124936	exon4			GTGGAGGTGTGAG	AK172844	CCDS11044.1, CCDS58501.1	17p13.2	2006-03-10							28471	protein-coding gene	gene with protein product							Standard	NM_144611		Approved	MGC32124	uc002fxm.4	Q8WUJ1		ENST00000301391.3:c.584G>T	chr17.hg19:g.4060165G>T	ENSP00000301391:p.Gly195Val	129.0	0.0	.	615	110.0	49.0	.	NM_144611	B2R7R6|D3DTJ9|I3L1K2	Missense_Mutation	SNP	ENST00000301391.3	hg19	CCDS11044.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.094421	0.56075	.	.	ENSG00000167740	ENST00000301391	T	0.80824	-1.42	4.95	4.95	0.65309	.	0.110364	0.64402	D	0.000009	D	0.91462	0.7305	M	0.90483	3.12	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.93098	0.6506	10	0.87932	D	0	-17.1409	16.9081	0.86133	0.0:0.0:1.0:0.0	.	195	Q8WUJ1	NEUFC_HUMAN	V	195	ENSP00000301391:G195V	ENSP00000301391:G195V	G	+	2	0	CYB5D2	4006914	1.000000	0.71417	1.000000	0.80357	0.155000	0.21991	7.025000	0.76449	2.563000	0.86464	0.561000	0.74099	GGT	.	.	.	none		0.557	CYB5D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438698.1	NM_144611	
CYB5D2	124936	hgsc.bcm.edu	37	17	4060190	4060190	+	Silent	SNP	C	C	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr17:4060190C>T	ENST00000301391.3	+	4	1109	c.609C>T	c.(607-609)gtC>gtT	p.V203V	CYB5D2_ENST00000573984.1_Intron|CYB5D2_ENST00000575251.1_Silent_p.V91V|CYB5D2_ENST00000575411.2_3'UTR	NM_144611.3	NP_653212.1	Q8WUJ1	NEUFC_HUMAN	cytochrome b5 domain containing 2	203					nervous system development (GO:0007399)	extracellular region (GO:0005576)	heme binding (GO:0020037)			breast(1)|large_intestine(3)|liver(2)|ovary(1)	7						GGATTGGCGTCCCCAGGAAGC	0.567											OREG0024097	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V203V		Atlas-SNP	.											.	CYB5D2	22	.	0			c.C609T						PASS	.						56.0	51.0	53.0					17																	4060190		2203	4300	6503	SO:0001819	synonymous_variant	124936	exon4			TGGCGTCCCCAGG	AK172844	CCDS11044.1, CCDS58501.1	17p13.2	2006-03-10							28471	protein-coding gene	gene with protein product							Standard	NM_144611		Approved	MGC32124	uc002fxm.4	Q8WUJ1		ENST00000301391.3:c.609C>T	chr17.hg19:g.4060190C>T		128.0	0.0	.	615	104.0	46.0	.	NM_144611	B2R7R6|D3DTJ9|I3L1K2	Silent	SNP	ENST00000301391.3	hg19	CCDS11044.1																																																																																			.	.	.	none		0.567	CYB5D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438698.1	NM_144611	
ULK2	9706	hgsc.bcm.edu	37	17	19720216	19720216	+	Silent	SNP	C	C	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr17:19720216C>T	ENST00000395544.4	-	13	1441	c.942G>A	c.(940-942)caG>caA	p.Q314Q	ULK2_ENST00000361658.2_Silent_p.Q314Q|ULK2_ENST00000580130.1_Intron	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	314					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					CCTGAATATGCTGCATATCTG	0.348																																					p.Q314Q		Atlas-SNP	.											.	ULK2	142	.	0			c.G942A						PASS	.						78.0	78.0	78.0					17																	19720216		2203	4300	6503	SO:0001819	synonymous_variant	9706	exon13			AATATGCTGCATA	AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.942G>A	chr17.hg19:g.19720216C>T		157.0	0.0	.		165.0	74.0	.	NM_001142610	A8MY69|O75119	Silent	SNP	ENST00000395544.4	hg19	CCDS11213.1																																																																																			.	.	.	none		0.348	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132375.2	NM_014683	
EFCAB5	374786	hgsc.bcm.edu	37	17	28418892	28418892	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr17:28418892T>C	ENST00000394835.3	+	21	4133	c.3941T>C	c.(3940-3942)aTt>aCt	p.I1314T	EFCAB5_ENST00000320856.5_Missense_Mutation_p.I1190T|RP11-1148O4.2_ENST00000582938.1_RNA|EFCAB5_ENST00000394832.2_Intron	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	1314							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						ATTCCAGAGATTGAAAATGTC	0.383																																					p.I1314T		Atlas-SNP	.											.	EFCAB5	122	.	0			c.T3941C						PASS	.						97.0	91.0	93.0					17																	28418892		1896	4115	6011	SO:0001583	missense	374786	exon21			CAGAGATTGAAAA	AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.3941T>C	chr17.hg19:g.28418892T>C	ENSP00000378312:p.Ile1314Thr	115.0	0.0	.		126.0	39.0	.	NM_198529	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Missense_Mutation	SNP	ENST00000394835.3	hg19	CCDS11254.2	.	.	.	.	.	.	.	.	.	.	T	12.19	1.863578	0.32884	.	.	ENSG00000176927	ENST00000394835;ENST00000320856;ENST00000419434	T;T;T	0.11821	2.74;2.75;2.76	5.54	5.54	0.83059	.	0.392046	0.25214	N	0.032292	T	0.20536	0.0494	L	0.60455	1.87	0.80722	D	1	D;P	0.56521	0.976;0.944	P;P	0.51701	0.677;0.546	T	0.01524	-1.1333	10	0.45353	T	0.12	-5.0614	6.6082	0.22737	0.0:0.1706:0.0:0.8294	.	1190;1314	E7EVS9;A4FU69	.;EFCB5_HUMAN	T	1314;1190;996	ENSP00000378312:I1314T;ENSP00000322003:I1190T;ENSP00000417009:I996T	ENSP00000322003:I1190T	I	+	2	0	EFCAB5	25443018	1.000000	0.71417	1.000000	0.80357	0.512000	0.34134	3.543000	0.53633	2.107000	0.64212	0.533000	0.62120	ATT	.	.	.	none		0.383	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256120.4	NM_198529	
CRLF3	51379	hgsc.bcm.edu	37	17	29120581	29120581	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr17:29120581T>A	ENST00000324238.6	-	5	837	c.713A>T	c.(712-714)cAc>cTc	p.H238L	CTD-2349P21.9_ENST00000580085.1_lincRNA|CRLF3_ENST00000544695.1_Missense_Mutation_p.H122L|CRLF3_ENST00000577725.1_Intron	NM_015986.3	NP_057070.3	Q8IUI8	CRLF3_HUMAN	cytokine receptor-like factor 3	238	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of cell growth (GO:0030308)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)				GGGGTCTATGTGCAATACTAT	0.458																																					p.H238L	Pancreas(30;346 881 29244 33464 41299)	Atlas-SNP	.											.	CRLF3	36	.	0			c.A713T						PASS	.						104.0	100.0	101.0					17																	29120581		2203	4300	6503	SO:0001583	missense	51379	exon5			TCTATGTGCAATA	AF120151	CCDS32607.1	17q11.2	2008-05-02				ENSG00000176390			17177	protein-coding gene	gene with protein product		614853					Standard	NM_015986		Approved	CREME9, CYTOR4	uc002hfr.4	Q8IUI8		ENST00000324238.6:c.713A>T	chr17.hg19:g.29120581T>A	ENSP00000318804:p.His238Leu	127.0	0.0	.		129.0	74.0	.	NM_015986	A6NJF3|B2R8C3|Q2MLY7|Q9UNI3|Q9Y6M8	Missense_Mutation	SNP	ENST00000324238.6	hg19	CCDS32607.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.821473	0.90873	.	.	ENSG00000176390	ENST00000324238;ENST00000544695	T;T	0.24151	1.87;1.87	5.64	5.64	0.86602	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.085303	0.85682	D	0.000000	T	0.29783	0.0744	L	0.48642	1.525	0.80722	D	1	P	0.41848	0.763	B	0.42422	0.387	T	0.03945	-1.0990	10	0.62326	D	0.03	-11.32	15.8343	0.78787	0.0:0.0:0.0:1.0	.	238	Q8IUI8	CRLF3_HUMAN	L	238;122	ENSP00000318804:H238L;ENSP00000444188:H122L	ENSP00000318804:H238L	H	-	2	0	CRLF3	26144707	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.631000	0.83237	2.150000	0.67090	0.482000	0.46254	CAC	.	.	.	none		0.458	CRLF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444354.1		
KRTAP16-1	100505753	hgsc.bcm.edu	37	17	39465268	39465268	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr17:39465268C>T	ENST00000391352.1	-	1	237	c.238G>A	c.(238-240)Gag>Aag	p.E80K		NM_001146182.1	NP_001139654.1	A8MUX0	KR161_HUMAN	keratin associated protein 16-1	80	11 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				haematopoietic_and_lymphoid_tissue(1)	1						CAAGAAGGCTCACAAATGACA	0.592																																					p.E80K		Atlas-SNP	.											.	KRTAP16-1	12	.	0			c.G238A						PASS	.																																			SO:0001583	missense	100505753	exon1			AAGGCTCACAAAT	AP001708	CCDS56032.1	17q21.2	2012-07-04			ENSG00000212657	ENSG00000212657		"""Keratin associated proteins"""	18916	protein-coding gene	gene with protein product							Standard	NM_001146182		Approved	KAP16.1	uc021txi.1	A8MUX0	OTTHUMG00000133640	ENST00000391352.1:c.238G>A	chr17.hg19:g.39465268C>T	ENSP00000375147:p.Glu80Lys	322.0	0.0	.		293.0	156.0	.	NM_001146182		Missense_Mutation	SNP	ENST00000391352.1	hg19	CCDS56032.1	.	.	.	.	.	.	.	.	.	.	C	12.21	1.868811	0.32977	.	.	ENSG00000212657	ENST00000391352	T	0.01397	4.94	3.38	3.38	0.38709	.	.	.	.	.	T	0.02012	0.0063	L	0.38175	1.15	0.29660	N	0.843268	.	.	.	.	.	.	T	0.36114	-0.9761	7	0.13853	T	0.58	.	12.2753	0.54730	0.0:1.0:0.0:0.0	.	.	.	.	K	80	ENSP00000375147:E80K	ENSP00000375147:E80K	E	-	1	0	KRTAP16-1	36718794	0.009000	0.17119	0.892000	0.35008	0.092000	0.18411	-0.051000	0.11885	1.737000	0.51674	0.313000	0.20887	GAG	.	.	.	none		0.592	KRTAP16-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257785.1	NM_001146182	
SCRN2	90507	hgsc.bcm.edu	37	17	45916327	45916327	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr17:45916327A>G	ENST00000290216.9	-	5	727	c.602T>C	c.(601-603)aTc>aCc	p.I201T	SCRN2_ENST00000584123.1_Missense_Mutation_p.I209T|SCRN2_ENST00000407215.3_Missense_Mutation_p.I201T	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	201						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						TTGGGCCGAGATGTCCGTGCC	0.587																																					p.I201T		Atlas-SNP	.											.	SCRN2	35	.	0			c.T602C						PASS	.						84.0	88.0	87.0					17																	45916327		2203	4300	6503	SO:0001583	missense	90507	exon5			GCCGAGATGTCCG	BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.602T>C	chr17.hg19:g.45916327A>G	ENSP00000290216:p.Ile201Thr	67.0	0.0	.		52.0	10.0	.	NM_138355	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Missense_Mutation	SNP	ENST00000290216.9	hg19	CCDS11519.1	.	.	.	.	.	.	.	.	.	.	A	15.65	2.895935	0.52121	.	.	ENSG00000141295	ENST00000290216;ENST00000407215	T;T	0.22743	1.94;1.94	5.52	5.52	0.82312	.	0.204208	0.50627	D	0.000110	T	0.37972	0.1023	M	0.90759	3.145	0.51012	D	0.999909	P;P;P	0.36354	0.549;0.549;0.549	B;B;B	0.43413	0.419;0.419;0.419	T	0.36890	-0.9729	10	0.49607	T	0.09	-16.3059	9.1893	0.37189	0.9175:0.0:0.0825:0.0	.	201;201;201	E9PBV5;Q96FV2;B7Z8S7	.;SCRN2_HUMAN;.	T	201	ENSP00000290216:I201T;ENSP00000383935:I201T	ENSP00000290216:I201T	I	-	2	0	SCRN2	43271326	1.000000	0.71417	1.000000	0.80357	0.148000	0.21650	7.472000	0.80996	2.091000	0.63221	0.533000	0.62120	ATC	.	.	.	none		0.587	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441383.1	NM_138355	
CACNA1G	8913	hgsc.bcm.edu	37	17	48674235	48674235	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr17:48674235G>T	ENST00000359106.5	+	16	3209	c.3209G>T	c.(3208-3210)aGc>aTc	p.S1070I	CACNA1G_ENST00000502264.1_Missense_Mutation_p.S1047I|CACNA1G_ENST00000503485.1_Missense_Mutation_p.S1070I|CACNA1G_ENST00000360761.4_Missense_Mutation_p.S1047I|CACNA1G_ENST00000515165.1_Missense_Mutation_p.S1070I|CACNA1G_ENST00000352832.5_Missense_Mutation_p.S1047I|CACNA1G_ENST00000510115.1_Missense_Mutation_p.S1047I|CACNA1G_ENST00000515765.1_Missense_Mutation_p.S1070I|CACNA1G_ENST00000505165.1_Missense_Mutation_p.S1070I|CACNA1G_ENST00000507896.1_Missense_Mutation_p.S1070I|CACNA1G_ENST00000358244.5_Missense_Mutation_p.S1047I|CACNA1G_ENST00000416767.4_Missense_Mutation_p.S1070I|CACNA1G_ENST00000510366.1_Missense_Mutation_p.S1070I|CACNA1G_ENST00000515411.1_Missense_Mutation_p.S1070I|CACNA1G_ENST00000514717.1_Missense_Mutation_p.S1047I|CACNA1G_ENST00000514181.1_Missense_Mutation_p.S1070I|CACNA1G_ENST00000514079.1_Missense_Mutation_p.S1070I|CACNA1G_ENST00000512389.1_Missense_Mutation_p.S1070I|CACNA1G_ENST00000513964.1_Missense_Mutation_p.S1070I|CACNA1G_ENST00000507609.1_Missense_Mutation_p.S1070I|CACNA1G_ENST00000442258.2_Missense_Mutation_p.S1047I|CACNA1G_ENST00000513689.2_Missense_Mutation_p.S1070I|CACNA1G_ENST00000429973.2_Missense_Mutation_p.S1070I|CACNA1G_ENST00000507336.1_Missense_Mutation_p.S1070I|CACNA1G_ENST00000354983.4_Missense_Mutation_p.S1047I|CACNA1G_ENST00000507510.2_Missense_Mutation_p.S1070I	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1070					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	CGCCGCACCAGCAGCAGCGGG	0.687																																					p.S1070I		Atlas-SNP	.											.	CACNA1G	659	.	0			c.G3209T						PASS	.						6.0	7.0	7.0					17																	48674235		1921	4043	5964	SO:0001583	missense	8913	exon16			GCACCAGCAGCAG	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.3209G>T	chr17.hg19:g.48674235G>T	ENSP00000352011:p.Ser1070Ile	110.0	0.0	.		118.0	5.0	.	NM_001256360	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	ENST00000359106.5	hg19	CCDS45730.1	.	.	.	.	.	.	.	.	.	.	g	18.51	3.639706	0.67244	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000416767;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97209	-4.13;-4.12;-4.29;-4.07;-4.1;-4.11;-4.15;-4.22;-4.19;-4.2;-4.22;-4.09;-4.11;-4.16;-4.11;-4.05;-4.15;-4.1;-4.09;-4.15;-4.11;-4.11;-4.14;-4.08;-4.15;-4.14	4.87	4.87	0.63330	.	0.478379	0.24303	N	0.039707	D	0.97284	0.9112	L	0.45137	1.4	0.38458	D	0.947139	P;B;P;B;B;P;P;B;P;P;P;B;B;D;P;B;B;P;B;P;B;B;B;B;D;P	0.61697	0.498;0.084;0.722;0.399;0.356;0.822;0.549;0.228;0.549;0.871;0.579;0.313;0.356;0.975;0.722;0.019;0.356;0.933;0.356;0.825;0.437;0.07;0.351;0.28;0.99;0.488	B;B;B;B;B;B;B;B;B;P;B;B;B;P;B;B;B;P;B;P;B;B;B;B;D;B	0.66497	0.131;0.042;0.282;0.342;0.197;0.227;0.282;0.09;0.19;0.695;0.096;0.272;0.14;0.793;0.227;0.028;0.089;0.668;0.09;0.466;0.098;0.058;0.043;0.065;0.944;0.182	D	0.98346	1.0541	10	0.48119	T	0.1	.	16.2113	0.82164	0.0:0.0:1.0:0.0	.	1047;1070;1070;1070;1070;1070;1070;1070;1070;1070;1070;1047;1070;1070;1070;1070;1070;1047;1070;1047;1047;1047;1047;1070;1047;1070	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13;O43497-11	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.;.	I	1047;1047;1070;1047;1047;1047;1070;1070;1047;1070;1070;1070;1070;1070;1070;1047;1070;1070;1070;1070;1047;1070;1070;1070;1070;1070	ENSP00000353990:S1047I;ENSP00000339302:S1047I;ENSP00000392390:S1070I;ENSP00000347078:S1047I;ENSP00000409759:S1047I;ENSP00000425522:S1047I;ENSP00000426261:S1070I;ENSP00000425451:S1070I;ENSP00000422407:S1047I;ENSP00000426814:S1070I;ENSP00000427238:S1070I;ENSP00000423112:S1070I;ENSP00000420918:S1070I;ENSP00000426172:S1070I;ENSP00000423045:S1070I;ENSP00000427173:S1047I;ENSP00000426098:S1070I;ENSP00000425698:S1070I;ENSP00000426232:S1070I;ENSP00000423317:S1070I;ENSP00000350979:S1047I;ENSP00000352011:S1070I;ENSP00000414388:S1070I;ENSP00000423155:S1070I;ENSP00000422268:S1070I;ENSP00000421518:S1070I	ENSP00000339302:S1047I	S	+	2	0	CACNA1G	46029234	1.000000	0.71417	1.000000	0.80357	0.354000	0.29330	8.006000	0.88564	2.258000	0.74832	0.561000	0.74099	AGC	.	.	.	none		0.687	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	
NT5C	30833	hgsc.bcm.edu	37	17	73127154	73127154	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr17:73127154A>T	ENST00000245552.2	-	3	409	c.322T>A	c.(322-324)Tgt>Agt	p.C108S	NT5C_ENST00000582160.1_Missense_Mutation_p.C22S|NT5C_ENST00000579082.1_5'UTR|NT5C_ENST00000582170.1_Missense_Mutation_p.C108S|NT5C_ENST00000578337.1_Missense_Mutation_p.C22S	NM_014595.2	NP_055410.1	Q8TCD5	NT5C_HUMAN	5', 3'-nucleotidase, cytosolic	108					dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine deoxyribonucleotide catabolic process (GO:0009223)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotidase activity (GO:0008252)|pyrimidine nucleotide binding (GO:0019103)					all_lung(278;0.14)|Lung NSC(278;0.168)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Lamivudine(DB00709)	TCACCCACACAGTGGTGGTAC	0.617																																					p.C108S		Atlas-SNP	.											.	NT5C	3	.	0			c.T322A						PASS	.						18.0	22.0	21.0					17																	73127154		2194	4295	6489	SO:0001583	missense	30833	exon3			CCACACAGTGGTG	AF154829	CCDS11715.1	17q25	2011-03-29	2002-05-23		ENSG00000125458	ENSG00000125458	3.1.3.5		17144	protein-coding gene	gene with protein product		191720	"""5' nucleotidase, deoxy (pyrimidine), cytosolic type C"", ""uridine 5-prime monophosphate hydrolase 2"""	UMPH2		10899995	Standard	NM_014595		Approved	DNT1, DNT-1, PN-I, cdN, dNT-1	uc002jmx.3	Q8TCD5		ENST00000245552.2:c.322T>A	chr17.hg19:g.73127154A>T	ENSP00000245552:p.Cys108Ser	225.0	0.0	.		223.0	52.0	.	NM_001252377	Q96HS6|Q9NP82	Missense_Mutation	SNP	ENST00000245552.2	hg19	CCDS11715.1	.	.	.	.	.	.	.	.	.	.	A	15.68	2.904872	0.52333	.	.	ENSG00000125458	ENST00000245552	T	0.41065	1.01	5.09	3.99	0.46301	HAD-like domain (2);	0.114961	0.64402	N	0.000010	T	0.53400	0.1794	L	0.47078	1.49	0.41943	D	0.990625	D	0.63880	0.993	D	0.74023	0.982	T	0.53236	-0.8467	10	0.66056	D	0.02	-3.5863	9.0684	0.36478	0.8359:0.0:0.0:0.1641	.	108	Q8TCD5	NT5C_HUMAN	S	108	ENSP00000245552:C108S	ENSP00000245552:C108S	C	-	1	0	NT5C	70638749	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.811000	0.55620	0.769000	0.33313	0.459000	0.35465	TGT	.	.	.	none		0.617	NT5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445853.1		
PLPPR3	79948	hgsc.bcm.edu	37	19	814451	814451	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr19:814451C>T	ENST00000520876.3	-	7	892	c.814G>A	c.(814-816)Ggc>Agc	p.G272S	MIR3187_ENST00000583431.1_RNA|LPPR3_ENST00000359894.2_Missense_Mutation_p.G300S	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN		272						integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										GCAGCGATGCCCGCCCCGATG	0.662																																					p.G300S		Atlas-SNP	.											.	.	.	.	0			c.G898A						PASS	.						26.0	27.0	27.0					19																	814451		2191	4294	6485	SO:0001583	missense	0	exon6			CGATGCCCGCCCC																												ENST00000520876.3:c.814G>A	chr19.hg19:g.814451C>T	ENSP00000430297:p.Gly272Ser	60.0	0.0	.		29.0	15.0	.	NM_024888	Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Missense_Mutation	SNP	ENST00000520876.3	hg19	CCDS58636.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.68|13.68	2.307986|2.307986	0.40895|0.40895	.|.	.|.	ENSG00000129951|ENSG00000129951	ENST00000517665|ENST00000300947;ENST00000359894;ENST00000520876	.|T;T	.|0.74315	.|-0.83;-0.83	4.66|4.66	4.66|4.66	0.58398|0.58398	.|Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.114726|0.114726	0.64402|0.64402	D|D	0.000019|0.000019	T|T	0.72755|0.72755	0.3500|0.3500	L|L	0.35414|0.35414	1.06|1.06	0.40705|0.40705	D|D	0.982513|0.982513	.|B;B;P	.|0.46952	.|0.317;0.368;0.887	.|B;P;P	.|0.49597	.|0.335;0.466;0.616	T|T	0.75056|0.75056	-0.3452|-0.3452	6|10	.|0.42905	.|T	.|0.14	-7.2365|-7.2365	16.5199|16.5199	0.84311|0.84311	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|273;272;300	.|Q6T4P5-2;Q6T4P5;Q6T4P5-3	.|.;LPPR3_HUMAN;.	E|S	60|273;300;272	.|ENSP00000352962:G300S;ENSP00000430297:G272S	.|ENSP00000300947:G273S	G|G	-|-	2|1	0|0	AC006273.1|AC006273.1	765451|765451	0.996000|0.996000	0.38824|0.38824	0.916000|0.916000	0.36221|0.36221	0.143000|0.143000	0.21401|0.21401	3.475000|3.475000	0.53136|0.53136	2.137000|2.137000	0.66172|0.66172	0.555000|0.555000	0.69702|0.69702	GGG|GGC	.	.	.	none		0.662	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379096.3		
MKNK2	2872	hgsc.bcm.edu	37	19	2041888	2041888	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr19:2041888C>T	ENST00000591601.1	-	10	931	c.896G>A	c.(895-897)tGt>tAt	p.C299Y	MKNK2_ENST00000250896.3_Missense_Mutation_p.C299Y|MKNK2_ENST00000309340.7_Missense_Mutation_p.C299Y|MKNK2_ENST00000591142.1_Missense_Mutation_p.C43Y|MKNK2_ENST00000541165.1_Missense_Mutation_p.C168Y|MKNK2_ENST00000591588.1_Missense_Mutation_p.C43Y|MKNK2_ENST00000588014.1_Missense_Mutation_p.C43Y			Q9HBH9	MKNK2_HUMAN	MAP kinase interacting serine/threonine kinase 2	299	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell surface receptor signaling pathway (GO:0007166)|cellular response to arsenic-containing substance (GO:0071243)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|hemopoiesis (GO:0030097)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|kidney(3)|large_intestine(3)|lung(3)	10		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCGCTGCCACAGCGGCCCAC	0.711																																					p.C299Y		Atlas-SNP	.											.	MKNK2	56	.	0			c.G896A						PASS	.						17.0	15.0	15.0					19																	2041888		2031	3979	6010	SO:0001583	missense	2872	exon11			CTGCCACAGCGGC	AF125532	CCDS12079.1, CCDS12080.1	19p13.3	2012-12-20			ENSG00000099875	ENSG00000099875			7111	protein-coding gene	gene with protein product	"""Putative map kinase interacting kinase"""	605069	"""G protein-coupled receptor kinase 7"""	GPRK7		11013076	Standard	NM_199054		Approved	MNK2	uc002lus.2	Q9HBH9	OTTHUMG00000180020	ENST00000591601.1:c.896G>A	chr19.hg19:g.2041888C>T	ENSP00000467811:p.Cys299Tyr	98.0	0.0	.		57.0	24.0	.	NM_017572	Q6GPI3|Q9HBH8|Q9UHR0|Q9Y2N6	Missense_Mutation	SNP	ENST00000591601.1	hg19	CCDS12080.1	.	.	.	.	.	.	.	.	.	.	C	19.11	3.763123	0.69763	.	.	ENSG00000099875	ENST00000309340;ENST00000250896;ENST00000541165;ENST00000545627	T;T;T	0.38887	1.11;1.11;1.11	4.12	4.12	0.48240	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.46776	0.1410	N	0.12182	0.205	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;0.998;0.998	T	0.57774	-0.7753	10	0.87932	D	0	-4.0557	15.5219	0.75871	0.0:1.0:0.0:0.0	.	104;299;299;201	Q59GN5;Q9HBH9;Q9HBH9-2;Q9NT28	.;MKNK2_HUMAN;.;.	Y	299;299;168;239	ENSP00000309485:C299Y;ENSP00000250896:C299Y;ENSP00000438904:C168Y	ENSP00000250896:C299Y	C	-	2	0	MKNK2	1992888	1.000000	0.71417	0.998000	0.56505	0.263000	0.26337	7.366000	0.79548	2.137000	0.66172	0.555000	0.69702	TGT	.	.	.	none		0.711	MKNK2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449312.1	NM_199054	
KLK7	5650	hgsc.bcm.edu	37	19	51485606	51485606	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr19:51485606G>T	ENST00000391807.1	-	2	151	c.50C>A	c.(49-51)gCc>gAc	p.A17D	KLK7_ENST00000595638.1_5'UTR|KLK7_ENST00000597707.1_Intron|CTB-147C22.9_ENST00000594512.1_RNA|KLK7_ENST00000336317.4_5'UTR|KLK7_ENST00000595820.1_Missense_Mutation_p.A17D	NM_139277.2	NP_644806.1	P49862	KLK7_HUMAN	kallikrein-related peptidase 7	17					epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(2)	19		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00382)|GBM - Glioblastoma multiforme(134;0.00895)		AGTTTCCAAGGCTAAGGATAG	0.597																																					p.S59R		Atlas-SNP	.											.	KLK7	40	.	0			c.C177A						PASS	.						63.0	47.0	53.0					19																	51485606		2203	4299	6502	SO:0001583	missense	5650	exon2			TCCAAGGCTAAGG	L33404	CCDS12812.1, CCDS59414.1	19q13.33	2011-09-07	2006-10-27			ENSG00000169035		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6368	protein-coding gene	gene with protein product		604438	"""kallikrein 7 (chymotryptic, stratum corneum)"""	PRSS6		8034709, 16800724, 16800723	Standard	NM_005046		Approved	SCCE	uc021uyj.1	P49862		ENST00000391807.1:c.50C>A	chr19.hg19:g.51485606G>T	ENSP00000375683:p.Ala17Asp	70.0	0.0	.		50.0	9.0	.	NM_001243126	A8K0U5|Q8N5N9|Q8NFV7	Missense_Mutation	SNP	ENST00000391807.1	hg19	CCDS12812.1	.	.	.	.	.	.	.	.	.	.	g	10.70	1.424474	0.25639	.	.	ENSG00000169035	ENST00000304045;ENST00000391807	D	0.94000	-3.33	3.65	2.61	0.31194	.	.	.	.	.	D	0.92805	0.7712	L	0.49571	1.57	0.30110	N	0.806664	D	0.61080	0.989	P	0.55112	0.769	D	0.88031	0.2775	9	0.62326	D	0.03	.	7.0792	0.25221	0.1278:0.0:0.8722:0.0	.	17	P49862	KLK7_HUMAN	D	17	ENSP00000375683:A17D	ENSP00000304791:A17D	A	-	2	0	KLK7	56177418	0.072000	0.21174	0.114000	0.21550	0.005000	0.04900	0.592000	0.23984	0.893000	0.36288	0.645000	0.84053	GCC	.	.	.	none		0.597	KLK7-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464344.1	NM_005046	
EPS8L1	54869	hgsc.bcm.edu	37	19	55591174	55591174	+	Silent	SNP	G	G	A			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr19:55591174G>A	ENST00000201647.6	+	5	290	c.234G>A	c.(232-234)ctG>ctA	p.L78L	EPS8L1_ENST00000245618.5_5'Flank|EPS8L1_ENST00000592824.1_3'UTR|EPS8L1_ENST00000588359.1_5'Flank|EPS8L1_ENST00000586329.1_Silent_p.L60L|EPS8L1_ENST00000540810.1_Silent_p.L14L	NM_133180.2	NP_573441.2	Q8TE68	ES8L1_HUMAN	EPS8-like 1	78					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|T cell receptor binding (GO:0042608)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|prostate(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		AGATGCTGCTGCGAGTGTCTC	0.667																																					p.L78L	Ovarian(149;255 1863 3636 27051 29647)	Atlas-SNP	.											.	EPS8L1	122	.	0			c.G234A						PASS	.						89.0	67.0	74.0					19																	55591174		2203	4300	6503	SO:0001819	synonymous_variant	54869	exon5			GCTGCTGCGAGTG	AK057052	CCDS12914.1, CCDS12915.1	19q13.42	2008-02-05				ENSG00000131037			21295	protein-coding gene	gene with protein product		614987				12620401	Standard	NM_133180		Approved	FLJ20258, DRC3, MGC23164, MGC4642	uc002qis.4	Q8TE68		ENST00000201647.6:c.234G>A	chr19.hg19:g.55591174G>A		91.0	0.0	.		67.0	21.0	.	NM_133180	Q71RE2|Q8NC10|Q96BB7|Q9BSQ2|Q9GZQ2|Q9NXH0	Silent	SNP	ENST00000201647.6	hg19	CCDS12914.1																																																																																			.	.	.	none		0.667	EPS8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451713.1	NM_017729	
NNAT	4826	hgsc.bcm.edu	37	20	36151076	36151076	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr20:36151076G>T	ENST00000062104.2	+	3	278	c.161G>T	c.(160-162)aGg>aTg	p.R54M	BLCAP_ENST00000373537.2_Intron|BLCAP_ENST00000414542.2_Intron|BLCAP_ENST00000397131.1_Intron|BLCAP_ENST00000397137.1_Intron|BLCAP_ENST00000397134.1_5'Flank|NNAT_ENST00000346199.2_Missense_Mutation_p.R27M|BLCAP_ENST00000397135.1_Intron	NM_005386.2	NP_005377.1	Q16517	NNAT_HUMAN	neuronatin	54					brain development (GO:0007420)|neuron differentiation (GO:0030182)|positive regulation of insulin secretion (GO:0032024)|protein lipoylation (GO:0009249)|regulation of protein localization (GO:0032880)|response to glucose (GO:0009749)|transport (GO:0006810)	cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|lung(1)	3		Myeloproliferative disorder(115;0.00878)				CAGGTGTTCAGGTACTCCCTG	0.687																																					p.R54M		Atlas-SNP	.											NNAT,NS,carcinoma,0,1	NNAT	8	.	0			c.G161T						PASS	.						59.0	43.0	48.0					20																	36151076		2203	4300	6503	SO:0001583	missense	4826	exon3			TGTTCAGGTACTC		CCDS13296.1, CCDS13297.1	20q11.2-q12	2007-12-07			ENSG00000053438	ENSG00000053438			7860	protein-coding gene	gene with protein product		603106				8660979	Standard	NM_005386		Approved	Peg5	uc002xhd.3	Q16517	OTTHUMG00000032420	ENST00000062104.2:c.161G>T	chr20.hg19:g.36151076G>T	ENSP00000062104:p.Arg54Met	96.0	0.0	.		71.0	30.0	.	NM_005386	B2R558|E1P5V6|Q16596|Q5U0N3	Missense_Mutation	SNP	ENST00000062104.2	hg19	CCDS13296.1	.	.	.	.	.	.	.	.	.	.	G	17.27	3.346799	0.61073	.	.	ENSG00000053438	ENST00000062104;ENST00000346199	.	.	.	5.0	4.05	0.47172	.	0.000000	0.53938	D	0.000058	T	0.47544	0.1451	.	.	.	0.30345	N	0.785383	D;P	0.58268	0.982;0.927	P;P	0.52793	0.709;0.702	T	0.52704	-0.8540	8	0.87932	D	0	-12.1953	8.6775	0.34187	0.1003:0.0:0.8997:0.0	.	27;54	Q16517-2;Q16517	.;NNAT_HUMAN	M	54;27	.	ENSP00000062104:R54M	R	+	2	0	NNAT	35584490	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.344000	0.44010	2.780000	0.95670	0.644000	0.83932	AGG	.	.	.	none		0.687	NNAT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079116.2	NM_005386	
GTSF1L	149699	hgsc.bcm.edu	37	20	42355169	42355169	+	Silent	SNP	G	G	A	rs17826038	byFrequency	TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr20:42355169G>A	ENST00000373003.1	-	1	469	c.166C>T	c.(166-168)Ctg>Ttg	p.L56L	GTSF1L_ENST00000373005.2_Silent_p.L56L	NM_001008901.1|NM_176791.3	NP_001008901.1|NP_789761.1	Q9H1H1	GTSFL_HUMAN	gametocyte specific factor 1-like	56			L -> V (in dbSNP:rs17826038).				metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			TGTTCCTCCAGATTTTTGATG	0.522																																					p.L56L		Atlas-SNP	.											.	GTSF1L	14	.	0			c.C166T						PASS	.						125.0	111.0	116.0					20																	42355169		2203	4300	6503	SO:0001819	synonymous_variant	149699	exon1			CCTCCAGATTTTT	AK058060	CCDS13323.1, CCDS33471.1	20q13.12	2007-11-27	2007-11-27	2007-11-27	ENSG00000124196	ENSG00000124196			16198	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 65"", ""family with sequence similarity 112, member A"""	C20orf65, FAM112A			Standard	NM_176791		Approved	dJ1028D15.4	uc002xld.3	Q9H1H1	OTTHUMG00000032510	ENST00000373003.1:c.166C>T	chr20.hg19:g.42355169G>A		173.0	0.0	.		132.0	48.0	.	NM_001008901	Q5JWH5	Silent	SNP	ENST00000373003.1	hg19	CCDS13323.1																																																																																			.	G|0.981;C|0.019	.	alt		0.522	GTSF1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079313.1	NM_176791	
HELZ2	85441	hgsc.bcm.edu	37	20	62198210	62198210	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr20:62198210G>C	ENST00000467148.1	-	6	2570	c.2501C>G	c.(2500-2502)tCc>tGc	p.S834C	HELZ2_ENST00000427522.2_Missense_Mutation_p.S265C	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	834	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GGCACCGTGGGAAACGACACA	0.711																																					p.S834C		Atlas-SNP	.											.	.	.	.	0			c.C2501G						PASS	.						31.0	36.0	34.0					20																	62198210		2199	4298	6497	SO:0001583	missense	85441	exon7			CCGTGGGAAACGA	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.2501C>G	chr20.hg19:g.62198210G>C	ENSP00000417401:p.Ser834Cys	48.0	0.0	.		36.0	12.0	.	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	hg19	CCDS33508.1	.	.	.	.	.	.	.	.	.	.	G	15.97	2.989411	0.53934	.	.	ENSG00000130589	ENST00000427522;ENST00000467148	D;D	0.93659	-3.26;-3.26	5.13	5.13	0.70059	.	0.247072	0.42420	D	0.000715	D	0.96454	0.8843	M	0.75777	2.31	0.45541	D	0.998499	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.991	D	0.96215	0.9156	10	0.48119	T	0.1	-45.9206	18.5866	0.91192	0.0:0.0:1.0:0.0	.	834;265	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	C	265;834	ENSP00000393257:S265C;ENSP00000417401:S834C	ENSP00000393257:S265C	S	-	2	0	RP4-697K14.7	61668654	1.000000	0.71417	0.900000	0.35374	0.009000	0.06853	6.746000	0.74866	2.399000	0.81585	0.561000	0.74099	TCC	.	.	.	none		0.711	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
MX2	4600	hgsc.bcm.edu	37	21	42770936	42770936	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr21:42770936T>C	ENST00000330714.3	+	9	1446	c.1262T>C	c.(1261-1263)tTt>tCt	p.F421S	MX2_ENST00000496774.1_3'UTR	NM_002463.1	NP_002454.1	P20592	MX2_HUMAN	MX dynamin-like GTPase 2	421					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|GTP catabolic process (GO:0006184)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of nucleocytoplasmic transport (GO:0046822)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	34		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				AAGATGTTCTTTCTAATTGAG	0.577																																					p.F421S		Atlas-SNP	.											.	MX2	84	.	0			c.T1262C						PASS	.						74.0	77.0	76.0					21																	42770936		2203	4300	6503	SO:0001583	missense	4600	exon9			TGTTCTTTCTAAT		CCDS13672.1	21q22.3	2014-07-15	2014-07-15		ENSG00000183486	ENSG00000183486			7533	protein-coding gene	gene with protein product	"""interferon-regulated resistance GTP-binding protein MXB"", ""second interferon-induced protein p78"""	147890	"""myxovirus (influenza) resistance 2, homolog of murine"", ""myxovirus (influenza virus) resistance 2 (mouse)"""			2481229, 8798556	Standard	NM_002463		Approved	MXB	uc002yzf.1	P20592	OTTHUMG00000086753	ENST00000330714.3:c.1262T>C	chr21.hg19:g.42770936T>C	ENSP00000333657:p.Phe421Ser	111.0	0.0	.		79.0	28.0	.	NM_002463	B7Z5D3|D3DSI7	Missense_Mutation	SNP	ENST00000330714.3	hg19	CCDS13672.1	.	.	.	.	.	.	.	.	.	.	T	19.56	3.849740	0.71603	.	.	ENSG00000183486	ENST00000330714	T	0.74315	-0.83	3.96	3.96	0.45880	Dynamin central domain (1);	0.000000	0.85682	D	0.000000	D	0.83862	0.5346	M	0.83774	2.66	0.80722	D	1	D	0.56746	0.977	P	0.61722	0.893	D	0.85784	0.1363	10	0.66056	D	0.02	-11.5518	10.8722	0.46889	0.0:0.0:0.0:1.0	.	421	P20592	MX2_HUMAN	S	421	ENSP00000333657:F421S	ENSP00000333657:F421S	F	+	2	0	MX2	41692806	1.000000	0.71417	0.970000	0.41538	0.785000	0.44390	3.190000	0.50973	1.737000	0.51674	0.402000	0.26972	TTT	.	.	.	none		0.577	MX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195147.1	NM_002463	
TBC1D10A	83874	hgsc.bcm.edu	37	22	30690962	30690962	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr22:30690962C>A	ENST00000215790.7	-	5	771	c.607G>T	c.(607-609)Gcc>Tcc	p.A203S	TBC1D10A_ENST00000403362.1_Missense_Mutation_p.A115S|TBC1D10A_ENST00000403477.3_Missense_Mutation_p.A210S|RP1-130H16.18_ENST00000447976.1_Missense_Mutation_p.A77S	NM_031937.2	NP_114143.1	Q9BXI6	TB10A_HUMAN	TBC1 domain family, member 10A	203	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				activation of cysteine-type endopeptidase activity (GO:0097202)|positive regulation of proteolysis (GO:0045862)|retrograde transport, endosome to Golgi (GO:0042147)	extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rab GTPase activator activity (GO:0005097)			cervix(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	23						AAGACAGCGGCAATGGGCGCC	0.667																																					p.A210S		Atlas-SNP	.											.	TBC1D10A	49	.	0			c.G628T						PASS	.						69.0	71.0	70.0					22																	30690962		2203	4300	6503	SO:0001583	missense	83874	exon5			CAGCGGCAATGGG	AF331038	CCDS13874.1, CCDS56227.1	22q12.2	2013-07-09	2005-03-10	2005-03-10	ENSG00000099992	ENSG00000099992			23609	protein-coding gene	gene with protein product	"""EBP50-PDZ interactor of 64 kD"""	610020	"""TBC1 domain family, member 10"""	TBC1D10		11285285, 20404108	Standard	NM_001204240		Approved	EPI64, AC004997.C22.2	uc010gvu.3	Q9BXI6	OTTHUMG00000150924	ENST00000215790.7:c.607G>T	chr22.hg19:g.30690962C>A	ENSP00000215790:p.Ala203Ser	101.0	0.0	.		68.0	20.0	.	NM_001204240	B3KXT8|O76053|Q20WK7|Q543A2	Missense_Mutation	SNP	ENST00000215790.7	hg19	CCDS13874.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.450603	0.84101	.	.	ENSG00000248751;ENSG00000099992;ENSG00000099992;ENSG00000099992;ENSG00000099992	ENST00000434291;ENST00000215790;ENST00000403477;ENST00000403362;ENST00000393906	T;T;T;T;T	0.06449	3.3;3.3;3.3;3.3;3.3	4.33	3.29	0.37713	Rab-GAP/TBC domain (4);	0.051488	0.85682	N	0.000000	T	0.29524	0.0736	M	0.91561	3.22	0.80722	D	1	D;D;D;D	0.71674	0.998;0.975;0.998;0.998	D;D;D;D	0.70016	0.951;0.919;0.951;0.967	T	0.31308	-0.9948	10	0.87932	D	0	.	12.5231	0.56072	0.1684:0.8316:0.0:0.0	.	203;210;203;203	Q20WK7;B3KXT8;Q9BXI6;A7E244	.;.;TB10A_HUMAN;.	S	77;203;210;115;115	ENSP00000401535:A77S;ENSP00000215790:A203S;ENSP00000384996:A210S;ENSP00000385050:A115S;ENSP00000377484:A115S	ENSP00000331267:A64S	A	-	1	0	TBC1D10A;RP1-130H16.18	29020962	1.000000	0.71417	0.806000	0.32338	0.901000	0.52897	7.592000	0.82676	1.150000	0.42419	0.561000	0.74099	GCC	.	.	.	none		0.667	TBC1D10A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320550.1	NM_031937	
MORC2	22880	hgsc.bcm.edu	37	22	31331096	31331096	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr22:31331096A>G	ENST00000397641.3	-	19	2273	c.1865T>C	c.(1864-1866)aTc>aCc	p.I622T	MORC2_ENST00000469915.1_5'Flank|MORC2-AS1_ENST00000441558.1_RNA|MORC2_ENST00000215862.4_Missense_Mutation_p.I560T			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	622						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						GGCGTTCCTGATCACAGCAGG	0.577																																					p.I560T		Atlas-SNP	.											.	MORC2	78	.	0			c.T1679C						PASS	.						25.0	28.0	27.0					22																	31331096		2203	4300	6503	SO:0001583	missense	22880	exon20			TTCCTGATCACAG	AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.1865T>C	chr22.hg19:g.31331096A>G	ENSP00000380763:p.Ile622Thr	117.0	0.0	.		78.0	31.0	.	NM_014941	B2RNB1|Q9UF28|Q9Y6V2	Missense_Mutation	SNP	ENST00000397641.3	hg19		.	.	.	.	.	.	.	.	.	.	A	14.91	2.675729	0.47781	.	.	ENSG00000133422	ENST00000397641;ENST00000215862	T;T	0.11495	2.77;2.77	5.76	5.76	0.90799	.	0.113886	0.64402	D	0.000005	T	0.12987	0.0315	L	0.51422	1.61	0.80722	D	1	P	0.44734	0.842	B	0.42692	0.395	T	0.13495	-1.0507	10	0.13853	T	0.58	.	14.6387	0.68708	1.0:0.0:0.0:0.0	.	622	Q9Y6X9	MORC2_HUMAN	T	622;560	ENSP00000380763:I622T;ENSP00000215862:I560T	ENSP00000215862:I560T	I	-	2	0	MORC2	29661096	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.554000	0.82212	2.201000	0.70794	0.533000	0.62120	ATC	.	.	.	none		0.577	MORC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000321710.2	NM_014941	
ARHGAP6	395	hgsc.bcm.edu	37	X	11160422	11160422	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chrX:11160422C>T	ENST00000337414.4	-	12	3060	c.2188G>A	c.(2188-2190)Gag>Aag	p.E730K	ARHGAP6_ENST00000303025.6_Missense_Mutation_p.E527K|ARHGAP6_ENST00000380736.1_Missense_Mutation_p.E527K|ARHGAP6_ENST00000534860.1_Missense_Mutation_p.E555K	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	730					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TCGAAAGGCTCCTCTGACAGA	0.328																																					p.E730K		Atlas-SNP	.											.	ARHGAP6	130	.	0			c.G2188A						PASS	.						87.0	85.0	86.0					X																	11160422		2203	4300	6503	SO:0001583	missense	395	exon12			AAGGCTCCTCTGA	AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.2188G>A	chrX.hg19:g.11160422C>T	ENSP00000338967:p.Glu730Lys	200.0	0.0	.		151.0	95.0	.	NM_013427	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	ENST00000337414.4	hg19	CCDS14140.1	.	.	.	.	.	.	.	.	.	.	C	19.15	3.771539	0.69992	.	.	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414	T;T;T;T	0.28454	1.73;1.65;1.65;1.61	5.24	5.24	0.73138	.	0.111709	0.39083	N	0.001463	T	0.37892	0.1020	M	0.65975	2.015	0.80722	D	1	P;P	0.46064	0.872;0.872	B;B	0.42738	0.396;0.396	T	0.21930	-1.0231	10	0.32370	T	0.25	.	18.0066	0.89211	0.0:1.0:0.0:0.0	.	730;730	O43182;A8KAL3	RHG06_HUMAN;.	K	555;527;527;730	ENSP00000438135:E555K;ENSP00000370112:E527K;ENSP00000302312:E527K;ENSP00000338967:E730K	ENSP00000302312:E527K	E	-	1	0	ARHGAP6	11070343	1.000000	0.71417	0.998000	0.56505	0.931000	0.56810	6.483000	0.73617	2.186000	0.69663	0.594000	0.82650	GAG	.	.	.	none		0.328	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055760.2	NM_013427	
GPRASP1	9737	hgsc.bcm.edu	37	X	101909675	101909675	+	Silent	SNP	T	T	C	rs369864268		TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chrX:101909675T>C	ENST00000361600.5	+	5	1635	c.834T>C	c.(832-834)gaT>gaC	p.D278D	GPRASP1_ENST00000415986.1_Silent_p.D278D|GPRASP1_ENST00000444152.1_Silent_p.D278D|GPRASP1_ENST00000537097.1_Silent_p.D278D|RP4-769N13.7_ENST00000602441.1_RNA	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	278					endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						CCAGGGAAGATCCCAATAGCA	0.468																																					p.D278D		Atlas-SNP	.											.	GPRASP1	140	.	0			c.T834C						PASS	.						107.0	108.0	107.0					X																	101909675		2203	4300	6503	SO:0001819	synonymous_variant	9737	exon3			GGAAGATCCCAAT	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.834T>C	chrX.hg19:g.101909675T>C		91.0	0.0	.		61.0	43.0	.	NM_001099411	O43168|Q96LA1	Silent	SNP	ENST00000361600.5	hg19	CCDS35352.1																																																																																			.	.	.	alt		0.468	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710	
RGAG1	57529	hgsc.bcm.edu	37	X	109697329	109697329	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chrX:109697329T>C	ENST00000465301.2	+	3	3730	c.3484T>C	c.(3484-3486)Tgc>Cgc	p.C1162R	RGAG1_ENST00000540313.1_Missense_Mutation_p.C1162R	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	1162										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						CCGGGGCTCATGCTCTGTGGA	0.502																																					p.C1162R		Atlas-SNP	.											.	RGAG1	168	.	0			c.T3484C						PASS	.						97.0	90.0	92.0					X																	109697329		2203	4300	6503	SO:0001583	missense	57529	exon3			GGCTCATGCTCTG	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.3484T>C	chrX.hg19:g.109697329T>C	ENSP00000419786:p.Cys1162Arg	178.0	0.0	.		160.0	121.0	.	NM_020769	Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	hg19	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	T	8.415	0.845068	0.16963	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.45276	0.9;0.9	4.02	2.82	0.32997	.	0.628162	0.13294	N	0.398806	T	0.36936	0.0985	L	0.27053	0.805	0.18873	N	0.999985	P	0.48016	0.904	P	0.51355	0.667	T	0.09975	-1.0650	9	.	.	.	-0.0425	6.6276	0.22839	0.0:0.0:0.2422:0.7578	.	1162	Q8NET4	RGAG1_HUMAN	R	1162;1162;723	ENSP00000419786:C1162R;ENSP00000441452:C1162R	.	C	+	1	0	RGAG1	109583985	0.000000	0.05858	0.006000	0.13384	0.954000	0.61252	-0.659000	0.05323	0.672000	0.31204	0.486000	0.48141	TGC	.	.	.	none		0.502	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
TEX9	374618	hgsc.bcm.edu	37	15	56686971	56686972	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr15:56686971_56686972delTT	ENST00000352903.2	+	9	791_792	c.767_768delTT	c.(766-768)cttfs	p.L256fs	TEX9_ENST00000558083.2_Frame_Shift_Del_p.L181fs|TEX9_ENST00000560582.1_Frame_Shift_Del_p.L12fs|RP11-48G14.2_ENST00000564401.1_lincRNA|TEX9_ENST00000561221.2_Frame_Shift_Del_p.L256fs|TEX9_ENST00000537232.1_Frame_Shift_Del_p.L181fs	NM_198524.1	NP_940926.1	Q8N6V9	TEX9_HUMAN	testis expressed 9	256										cervix(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	14				all cancers(107;0.0394)|GBM - Glioblastoma multiforme(80;0.056)		TACAAAACTCTTTTCGAAGAAG	0.307																																					p.256_256del		Atlas-Indel,Pindel	.											.	TEX9	29	.	0			c.766_767del						PASS	.																																			SO:0001589	frameshift_variant	374618	exon9			.	BC028119	CCDS10157.1, CCDS66776.1	15q21.3	2007-03-13	2007-03-13		ENSG00000151575	ENSG00000151575			29585	protein-coding gene	gene with protein product			"""testis expressed sequence 9"""				Standard	XM_005254361		Approved		uc002adp.3	Q8N6V9	OTTHUMG00000132035	ENST00000352903.2:c.767_768delTT	chr15.hg19:g.56686973_56686974delTT	ENSP00000342169:p.Leu256fs	535.0	0.0	0		447.0	161.0	0.360179	NM_198524	B4DH73	Frame_Shift_Del	DEL	ENST00000352903.2	hg19	CCDS10157.1																																																																																			.	.	.	none		0.307	TEX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255048.2	NM_198524	
SPIDR	23514	hgsc.bcm.edu	37	8	48625228	48625240	+	Frame_Shift_Del	DEL	AGAGTCTGCTGCT	AGAGTCTGCTGCT	-	rs547240956		TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	AGAGTCTGCTGCT	AGAGTCTGCTGCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr8:48625228_48625240delAGAGTCTGCTGCT	ENST00000297423.4	+	15	2366_2378	c.1982_1994delAGAGTCTGCTGCT	c.(1981-1995)aagagtctgctgcttfs	p.KSLLL661fs	SPIDR_ENST00000518074.1_Frame_Shift_Del_p.KSLLL601fs|SPIDR_ENST00000517693.1_Frame_Shift_Del_p.KSLLL136fs|SPIDR_ENST00000521214.1_3'UTR|SPIDR_ENST00000541342.1_Frame_Shift_Del_p.KSLLL591fs	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	661					cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											TTGTAGCTGAAGAGTCTGCTGCTTCTGGAGCAA	0.399																																					p.661_665del		Atlas-Indel,Pindel	.											.	KIAA0146	64	.	0			c.1981_1993del						PASS	.																																			SO:0001589	frameshift_variant	23514	exon15			.	AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.1982_1994delAGAGTCTGCTGCT	chr8.hg19:g.48625228_48625240delAGAGTCTGCTGCT	ENSP00000297423:p.Lys661fs	85.0	0.0	0		78.0	15.0	0.192308	NM_001080394	B4DFV2|B4E0Y6|Q96BI5	Frame_Shift_Del	DEL	ENST00000297423.4	hg19	CCDS43737.1																																																																																			.	.	.	none		0.399	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377611.1	NM_001080394	
XDH	7498	hgsc.bcm.edu	37	2	31600100	31600100	+	Frame_Shift_Del	DEL	C	C	-			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr2:31600100delC	ENST00000379416.3	-	14	1294	c.1246delG	c.(1246-1248)gagfs	p.E416fs		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	416					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	GAGAAATACTCCCCCTAAAAG	0.517																																					p.E416fs	Colon(66;682 1445 30109 40147)	Atlas-Indel,Pindel	.											.	XDH	191	.	0			c.1247delA						PASS	.						96.0	93.0	94.0					2																	31600100		2203	4300	6503	SO:0001589	frameshift_variant	7498	exon14			.	D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.1246delG	chr2.hg19:g.31600100delC	ENSP00000368727:p.Glu416fs	77.0	0.0	0		72.0	31.0	0.430556	NM_000379	Q16681|Q16712|Q4PJ16	Frame_Shift_Del	DEL	ENST00000379416.3	hg19	CCDS1775.1																																																																																			.	.	.	none		0.517	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379	
NET1	10276	hgsc.bcm.edu	37	10	5494436	5494436	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr10:5494436delT	ENST00000355029.4	+	5	621	c.479delT	c.(478-480)ctgfs	p.L160fs	NET1_ENST00000380359.3_Frame_Shift_Del_p.L106fs|NET1_ENST00000542715.1_5'UTR	NM_001047160.2	NP_001040625.1	Q7Z628	ARHG8_HUMAN	neuroepithelial cell transforming 1	160					apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|myoblast migration (GO:0051451)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|kidney(2)|large_intestine(9)|lung(5)|prostate(2)|skin(1)	23						TCAGAGATGCTGGACATCACC	0.532																																					p.L160fs		Atlas-Indel,Pindel	.											.	NET1	82	.	0			c.478delC						PASS	.						97.0	85.0	89.0					10																	5494436		2203	4300	6503	SO:0001589	frameshift_variant	10276	exon5			.	AJ010046	CCDS7067.1, CCDS41483.1	10p15	2013-01-10	2008-09-12		ENSG00000173848	ENSG00000173848		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14592	protein-coding gene	gene with protein product		606450				8649828	Standard	NR_073040		Approved	ARHGEF8, NET1A	uc001iia.4	Q7Z628	OTTHUMG00000017596	ENST00000355029.4:c.479delT	chr10.hg19:g.5494436delT	ENSP00000347134:p.Leu160fs	76.0	0.0	0		106.0	35.0	0.330189	NM_001047160	Q12773|Q96D82|Q99903|Q9UEN6	Frame_Shift_Del	DEL	ENST00000355029.4	hg19	CCDS41483.1																																																																																			.	.	.	none		0.532	NET1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000046553.3	NM_005863	
SLC41A3	54946	hgsc.bcm.edu	37	3	125725271	125725271	+	Frame_Shift_Del	DEL	C	C	-	rs111477552|rs377657493	byFrequency	TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr3:125725271delC	ENST00000315891.6	-	12	1741	c.1503delG	c.(1501-1503)ttgfs	p.L502fs	SLC41A3_ENST00000383598.2_3'UTR|SLC41A3_ENST00000360370.4_3'UTR|SLC41A3_ENST00000346785.5_Frame_Shift_Del_p.L466fs	NM_001008485.1|NM_017836.3	NP_001008485|NP_060306.3	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3	502						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			breast(1)|endometrium(4)|large_intestine(6)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18				GBM - Glioblastoma multiforme(114;0.167)		TTTTTGCTAACAAACAAAAAG	0.353																																					p.L502X		Atlas-Indel,Pindel	.											.	SLC41A3	80	.	0			c.1504delT						PASS	.						30.0	29.0	29.0					3																	125725271		2200	4271	6471	SO:0001589	frameshift_variant	54946	exon12			.		CCDS33842.1, CCDS33843.1, CCDS33844.1, CCDS43144.1, CCDS54635.1	3q21.2	2013-09-02			ENSG00000114544	ENSG00000114544		"""Solute carriers"""	31046	protein-coding gene	gene with protein product		610803					Standard	NM_001164475		Approved	FLJ20473	uc003eij.3	Q96GZ6	OTTHUMG00000162678	ENST00000315891.6:c.1503delG	chr3.hg19:g.125725271delC	ENSP00000326070:p.Leu502fs	322.0	0.0	0		219.0	72.0	0.328767	NM_001008485	A6ND60|B3KSD9|B7Z4Y2|C9JE96|E7ENY4|Q8N342|Q8NB27|Q9H9I6|Q9HAB1|Q9NX30	Frame_Shift_Del	DEL	ENST00000315891.6	hg19	CCDS33843.1																																																																																			.	.	.	alt		0.353	SLC41A3-024	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370886.1	NM_017836	
LRRK1	79705	hgsc.bcm.edu	37	15	101550745	101550745	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr15:101550745delA	ENST00000388948.3	+	8	1439	c.1080delA	c.(1078-1080)tcafs	p.S360fs	LRRK1_ENST00000284395.5_Frame_Shift_Del_p.S357fs	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TGACAGCTTCAAAAAATTGTT	0.368																																					p.S360X		Atlas-Indel,Pindel	.											.	LRRK1	310	.	0			c.1079delC						PASS	.						64.0	62.0	62.0					15																	101550745		1808	4077	5885	SO:0001589	frameshift_variant	79705	exon8			.	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.1080delA	chr15.hg19:g.101550745delA	ENSP00000373600:p.Ser360fs	285.0	0.0	0		216.0	67.0	0.310185	NM_024652		Frame_Shift_Del	DEL	ENST00000388948.3	hg19	CCDS42086.1																																																																																			.	.	.	none		0.368	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
TTC28	23331	hgsc.bcm.edu	37	22	28490116	28490118	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	TGC	TGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr22:28490116_28490118delTGC	ENST00000397906.2	-	12	4023_4025	c.3882_3884delGCA	c.(3880-3885)cagcac>cac	p.Q1294del		NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	1294					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						ACTGGCAATGTGCTGCTCCAGGG	0.517																																					p.1295_1295del		Atlas-Indel,Pindel	.											.	TTC28	84	.	0			c.3883_3885del						PASS	.																																			SO:0001651	inframe_deletion	23331	exon12			.	AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.3882_3884delGCA	chr22.hg19:g.28490119_28490121delTGC	ENSP00000381003:p.Gln1294del	82.0	0.0	0		73.0	26.0	0.356164	NM_001145418	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	In_Frame_Del	DEL	ENST00000397906.2	hg19	CCDS46678.1																																																																																			.	.	.	none		0.517	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000320930.2	XM_929318	
TEP1	7011	hgsc.bcm.edu	37	14	20839416	20839416	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr14:20839416delA	ENST00000262715.5	-	51	7318	c.7278delT	c.(7276-7278)tttfs	p.F2426fs	TEP1_ENST00000556935.1_Frame_Shift_Del_p.F2318fs	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	2426					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		GCTGCAGGACAAATATGCCAT	0.423																																					p.V2427fs		Atlas-Indel,Pindel	.											.	TEP1	224	.	0			c.7279delG						PASS	.						187.0	174.0	178.0					14																	20839416		2203	4300	6503	SO:0001589	frameshift_variant	7011	exon51			.		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.7278delT	chr14.hg19:g.20839416delA	ENSP00000262715:p.Phe2426fs	174.0	0.0	0		113.0	32.0	0.283186	NM_007110	A0AUV9	Frame_Shift_Del	DEL	ENST00000262715.5	hg19	CCDS9548.1																																																																																			.	.	.	none		0.423	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	
SMC6	79677	hgsc.bcm.edu	37	2	17902443	17902443	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr2:17902443delA	ENST00000448223.2	-	10	1081	c.812delT	c.(811-813)ttafs	p.L271fs	SMC6_ENST00000381272.4_Frame_Shift_Del_p.L297fs|SMC6_ENST00000402989.1_Frame_Shift_Del_p.L271fs|SMC6_ENST00000351948.4_Frame_Shift_Del_p.L271fs	NM_001142286.1	NP_001135758.1	Q96SB8	SMC6_HUMAN	structural maintenance of chromosomes 6	271					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			NS(1)|biliary_tract(1)|breast(6)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					CAAGGACTCTAAATTAGTCTT	0.343																																					p.L271fs		Atlas-Indel,Pindel	.											.	SMC6	102	.	0			c.813delA						PASS	.						133.0	135.0	134.0					2																	17902443		2202	4300	6502	SO:0001589	frameshift_variant	79677	exon10			.	AJ310551	CCDS1690.1	2p24.3	2008-02-05	2006-07-06	2006-07-06	ENSG00000163029	ENSG00000163029		"""Structural maintenance of chromosomes proteins"""	20466	protein-coding gene	gene with protein product		609387	"""SMC6 structural maintenance of chromosomes 6-like 1 (yeast)"""	SMC6L1		11230166	Standard	NM_024624		Approved	FLJ22116	uc002rcn.3	Q96SB8	OTTHUMG00000090675	ENST00000448223.2:c.812delT	chr2.hg19:g.17902443delA	ENSP00000404092:p.Leu271fs	341.0	0.0	0		366.0	114.0	0.311475	NM_001142286	A8K8Q6|D6W518|Q05BV4|Q9H0X3|Q9H6M0	Frame_Shift_Del	DEL	ENST00000448223.2	hg19	CCDS1690.1																																																																																			.	.	.	none		0.343	SMC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207359.1	NM_024624	
TF	7018	hgsc.bcm.edu	37	3	133497449	133497449	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr3:133497449delT	ENST00000402696.3	+	17	2567	c.2082delT	c.(2080-2082)actfs	p.T694fs	TF_ENST00000264998.3_Frame_Shift_Del_p.T567fs	NM_001063.3	NP_001054	P02787	TRFE_HUMAN	transferrin	694					blood coagulation (GO:0007596)|cellular iron ion homeostasis (GO:0006879)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|retina homeostasis (GO:0001895)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|basal plasma membrane (GO:0009925)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|secretory granule lumen (GO:0034774)|vesicle (GO:0031982)	ferric iron binding (GO:0008199)			NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(7)|large_intestine(13)|liver(2)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49					Aluminium(DB01370)|Bismuth Subsalicylate(DB01294)|Gallium nitrate(DB05260)|Iron Dextran(DB00893)	AAGCCTGCACTTTCCGTAGAC	0.468																																					p.T694fs		Atlas-Indel,Pindel	.											.	TF	116	.	0			c.2081delC						PASS	.						70.0	65.0	66.0					3																	133497449		2203	4300	6503	SO:0001589	frameshift_variant	7018	exon17			.		CCDS3080.1	3q21	2012-10-02			ENSG00000091513	ENSG00000091513			11740	protein-coding gene	gene with protein product		190000				6585826	Standard	NM_001063		Approved	PRO1557, PRO2086	uc003epv.2	P02787	OTTHUMG00000150356	ENST00000402696.3:c.2082delT	chr3.hg19:g.133497449delT	ENSP00000385834:p.Thr694fs	100.0	0.0	0		90.0	26.0	0.288889	NM_001063	O43890|Q1HBA5|Q9NQB8|Q9UHV0	Frame_Shift_Del	DEL	ENST00000402696.3	hg19	CCDS3080.1																																																																																			.	.	.	none		0.468	TF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317775.1	NM_001063	
CERS3	204219	hgsc.bcm.edu	37	15	100943017	100943018	+	Frame_Shift_Ins	INS	-	-	T	rs541833197	byFrequency	TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr15:100943017_100943018insT	ENST00000394113.1	-	14	1742_1743	c.1052_1053insA	c.(1051-1053)gagfs	p.E351fs	RP11-168G16.2_ENST00000560718.1_RNA|RP11-168G16.2_ENST00000560643.1_RNA|CERS3_ENST00000284382.4_Frame_Shift_Ins_p.E351fs|CERS3_ENST00000560944.1_5'UTR|CERS3_ENST00000538112.2_Frame_Shift_Ins_p.E351fs			Q8IU89	CERS3_HUMAN	ceramide synthase 3	351	Poly-Glu.				ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)	p.E351E(1)									cttcttcttcctcttcctcttc	0.485																																					p.E351fs		Atlas-INDEL	.											LASS3,colon,carcinoma,0,1	.	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.1053_1054insA						PASS	.																																			SO:0001589	frameshift_variant	204219	exon13			.		CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568	ENST00000394113.1:c.1053dupA	chr15.hg19:g.100943018_100943018dupT	ENSP00000377672:p.Glu351fs	58.0	0.0	0		67.0	25.0	0.373134	NM_178842	Q8NE64|Q8NEN6	Frame_Shift_Ins	INS	ENST00000394113.1	hg19	CCDS10384.1																																																																																			.	.	.	none		0.485	CERS3-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313594.4	NM_178842	
CNTF	1270	hgsc.bcm.edu	37	11	58391563	58391569	+	Frame_Shift_Del	DEL	AGTGGCA	AGTGGCA	-			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	AGTGGCA	AGTGGCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr11:58391563_58391569delAGTGGCA	ENST00000361987.4	+	2	251_257	c.171_177delAGTGGCA	c.(169-177)ccagtggcafs	p.PVA57fs	ZFP91-CNTF_ENST00000389919.4_3'UTR	NM_000614.3	NP_000605.1	P26441	CNTF_HUMAN	ciliary neurotrophic factor	57					ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|growth (GO:0040007)|muscle organ morphogenesis (GO:0048644)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of photoreceptor cell differentiation (GO:0046533)|neuron development (GO:0048666)|positive regulation of cell proliferation (GO:0008284)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of retinal cell programmed cell death (GO:0046668)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor activity (GO:0008083)|interleukin-6 receptor binding (GO:0005138)			NS(1)|breast(1)|kidney(2)|large_intestine(4)|lung(1)|ovary(1)	10		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				ATGGGATGCCAGTGGCAAGCACTGATC	0.527																																					p.57_59del		Atlas-Indel,Pindel	.											.	CNTF	22	.	0			c.170_176del						PASS	.																																			SO:0001589	frameshift_variant	1270	exon2			.	BC068030	CCDS31554.1	11q12	2011-07-21			ENSG00000242689	ENSG00000242689			2169	protein-coding gene	gene with protein product		118945				1840538, 1714745	Standard	NM_000614		Approved	HCNTF	uc001nna.4	P26441	OTTHUMG00000137476	ENST00000361987.4:c.171_177delAGTGGCA	chr11.hg19:g.58391563_58391569delAGTGGCA	ENSP00000355370:p.Pro57fs	91.0	0.0	0		108.0	33.0	0.305556	NM_000614	B2RAB2	Frame_Shift_Del	DEL	ENST00000361987.4	hg19	CCDS31554.1																																																																																			.	.	.	none		0.527	CNTF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268673.1	NM_000614	
RBMS2	5939	hgsc.bcm.edu	37	12	56975006	56975007	+	Frame_Shift_Ins	INS	-	-	T			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr12:56975006_56975007insT	ENST00000262031.5	+	6	676_677	c.581_582insT	c.(580-585)cactttfs	p.F195fs	RBMS2_ENST00000542360.1_Frame_Shift_Ins_p.F50fs|RBMS2_ENST00000552247.2_Frame_Shift_Ins_p.F195fs|RBMS2_ENST00000550726.1_Frame_Shift_Ins_p.F70fs	NM_002898.3	NP_002889.1	Q15434	RBMS2_HUMAN	RNA binding motif, single stranded interacting protein 2	195	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(3)|skin(2)|urinary_tract(1)	18						ATCATCACCCACTTTAATGGAA	0.495																																					p.H194fs		Atlas-Indel,Pindel	.											.	RBMS2	29	.	0			c.581_582insT						PASS	.																																			SO:0001589	frameshift_variant	5939	exon6			.	D28483	CCDS8923.1	12q13.13	2013-02-12			ENSG00000076067	ENSG00000076067		"""RNA binding motif (RRM) containing"""	9909	protein-coding gene	gene with protein product		602387				8041632	Standard	NM_002898		Approved	SCR3	uc001sln.2	Q15434	OTTHUMG00000170488	Exception_encountered	chr12.hg19:g.56975006_56975007insT	ENSP00000262031:p.Phe195fs	101.0	0.0	0		110.0	59.0	0.536364	NM_002898		Frame_Shift_Ins	INS	ENST00000262031.5	hg19	CCDS8923.1																																																																																			.	.	.	none		0.495	RBMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409366.2	NM_002898	
CNST	163882	hgsc.bcm.edu	37	1	246829056	246829056	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr1:246829056delT	ENST00000366513.4	+	11	2296	c.2027delT	c.(2026-2028)gttfs	p.V676fs		NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	676					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						ATAGCAACGGTTTTCCTCAGT	0.443																																					p.V676fs		Atlas-Indel,Pindel	.											.	CNST	73	.	0			c.2026delG						PASS	.						205.0	178.0	187.0					1																	246829056		2203	4300	6503	SO:0001589	frameshift_variant	163882	exon11			.	AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.2027delT	chr1.hg19:g.246829056delT	ENSP00000355470:p.Val676fs	117.0	0.0	0		88.0	29.0	0.329545	NM_152609	Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Frame_Shift_Del	DEL	ENST00000366513.4	hg19	CCDS1628.1																																																																																			.	.	.	none		0.443	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096780.1	NM_152609	
SPATA8	145946	hgsc.bcm.edu	37	15	97328262	97328262	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SX-A7SR-01A-12D-A35Z-10	TCGA-SX-A7SR-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ac24403-4088-4192-a6ee-57913809b464	3c89ac32-79c6-4277-ace0-1bc1779f3be8	g.chr15:97328262delA	ENST00000328504.3	+	3	500	c.233delA	c.(232-234)caafs	p.Q78fs	SPATA8_ENST00000558553.1_Frame_Shift_Del_p.S37fs|SPATA8-AS1_ENST00000558722.1_RNA	NM_173499.3	NP_775770.1	Q6RVD6	SPAT8_HUMAN	spermatogenesis associated 8	78										large_intestine(4)|lung(8)|ovary(1)|skin(3)	16	Melanoma(26;0.0142)|Lung NSC(78;0.041)|all_lung(78;0.0468)		OV - Ovarian serous cystadenocarcinoma(32;0.0718)			CAAAGGGTTCAAAGGCGAAGG	0.443																																					p.Q78fs		Atlas-Indel,Pindel	.											.	SPATA8	42	.	0			c.232delC						PASS	.						159.0	147.0	151.0					15																	97328262		2197	4298	6495	SO:0001589	frameshift_variant	145946	exon3			.	AY489187	CCDS10376.1	15q26	2008-02-05			ENSG00000185594	ENSG00000185594			28676	protein-coding gene	gene with protein product		613948					Standard	NM_173499		Approved	MGC44294	uc002bue.3	Q6RVD6	OTTHUMG00000149847	ENST00000328504.3:c.233delA	chr15.hg19:g.97328262delA	ENSP00000328149:p.Gln78fs	66.0	0.0	0		43.0	15.0	0.348837	NM_173499	Q2KJ07	Frame_Shift_Del	DEL	ENST00000328504.3	hg19	CCDS10376.1																																																																																			.	.	.	none		0.443	SPATA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313533.1	NM_173499	
