#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CPSF3L	54973	hgsc.bcm.edu	37	1	1248221	1248221	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr1:1248221G>A	ENST00000435064.1	-	12	1322	c.1240C>T	c.(1240-1242)Cat>Tat	p.H414Y	CPSF3L_ENST00000450926.2_Missense_Mutation_p.H392Y|CPSF3L_ENST00000462432.1_5'UTR|CPSF3L_ENST00000540437.1_Missense_Mutation_p.H420Y|CPSF3L_ENST00000419704.1_Missense_Mutation_p.H313Y|CPSF3L_ENST00000421495.2_Missense_Mutation_p.H156Y|CPSF3L_ENST00000411962.1_Missense_Mutation_p.H316Y|CPSF3L_ENST00000545578.1_Missense_Mutation_p.H385Y	NM_001256460.1|NM_017871.5	NP_001243389.1|NP_060341.2	Q5TA45	INT11_HUMAN	cleavage and polyadenylation specific factor 3-like	414					snRNA processing (GO:0016180)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|integrator complex (GO:0032039)	hydrolase activity (GO:0016787)			endometrium(4)|kidney(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(3)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(86;4.35e-21)|Colorectal(212;0.000166)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.00235)|BRCA - Breast invasive adenocarcinoma(365;0.00255)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0349)|Lung(427;0.201)		GCCTCGCCATGCACCAGCAGC	0.652																																					p.H420Y		Atlas-SNP	.											.	CPSF3L	33	.	0			c.C1258T						PASS	.						45.0	43.0	44.0					1																	1248221		2202	4295	6497	SO:0001583	missense	54973	exon14			CGCCATGCACCAG	AL136813	CCDS21.1, CCDS57959.1, CCDS57960.1, CCDS57961.1, CCDS72678.1	1p36.33	2008-02-05			ENSG00000127054	ENSG00000127054			26052	protein-coding gene	gene with protein product	"""integrator complex subunit 11"""	611354				15684398, 16239144	Standard	NM_001256456		Approved	FLJ20542, RC-68, CPSF73L, INT11, INTS11	uc001aee.2	Q5TA45	OTTHUMG00000003330	ENST00000435064.1:c.1240C>T	chr1.hg19:g.1248221G>A	ENSP00000413493:p.His414Tyr	74.0	0.0	.		40.0	17.0	.	NM_001256456	A8K5S2|B3KPR3|B4DM87|G3V1S5|Q5TA46|Q5TA48|Q5TA52|Q5TA53|Q5TA54|Q7L3D7|Q96HY1|Q9BW36|Q9H0F9|Q9H8R5|Q9HAA6|Q9NWX9	Missense_Mutation	SNP	ENST00000435064.1	hg19	CCDS21.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.659224	0.88154	.	.	ENSG00000127054	ENST00000435064;ENST00000411962;ENST00000419704;ENST00000540437;ENST00000450926;ENST00000545578	T;T;T;T;T	0.77098	-0.53;-0.53;-0.53;-0.53;-1.07	5.56	5.56	0.83823	RNA-metabolising metallo-beta-lactamase (1);	0.000000	0.85682	D	0.000000	D	0.93605	0.7958	H	0.98996	4.395	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.95947	0.8951	10	0.87932	D	0	-33.6557	19.5079	0.95127	0.0:0.0:1.0:0.0	.	392;385;316;313;420;414	Q5TA45-3;B4DM87;C9IYS7;Q5TA45-2;G3V1S5;Q5TA45	.;.;.;.;.;INT11_HUMAN	Y	414;316;313;420;392;385	ENSP00000413493:H414Y;ENSP00000404886:H313Y;ENSP00000445001:H420Y;ENSP00000392848:H392Y;ENSP00000444672:H385Y	ENSP00000400548:H316Y	H	-	1	0	CPSF3L	1238084	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.758000	0.91663	2.611000	0.88343	0.563000	0.77884	CAT	.	.	.	none		0.652	CPSF3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009360.2	NM_017871	
CROCC	9696	hgsc.bcm.edu	37	1	17287328	17287328	+	Silent	SNP	C	C	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr1:17287328C>T	ENST00000375541.5	+	27	4177	c.4108C>T	c.(4108-4110)Ctg>Ttg	p.L1370L		NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GCTGGGCTCCCTGGAGGAGGC	0.697											OREG0013143	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L1370L		Atlas-SNP	.											.	CROCC	185	.	0			c.C4108T						PASS	.						4.0	5.0	5.0					1																	17287328		2042	4015	6057	SO:0001819	synonymous_variant	9696	exon27			GGCTCCCTGGAGG	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.4108C>T	chr1.hg19:g.17287328C>T		14.0	0.0	.	716	7.0	5.0	.	NM_014675		Silent	SNP	ENST00000375541.5	hg19	CCDS30616.1																																																																																			.	.	.	none		0.697	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675	
ZBTB40	9923	hgsc.bcm.edu	37	1	22816649	22816649	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr1:22816649G>A	ENST00000375647.4	+	2	415	c.208G>A	c.(208-210)Gag>Aag	p.E70K	ZBTB40_ENST00000404138.1_Missense_Mutation_p.E70K|ZBTB40_ENST00000374651.4_Missense_Mutation_p.E70K	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	70	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		GAGCCCCGAGGAGTTTGCGCT	0.507																																					p.E70K		Atlas-SNP	.											.	ZBTB40	87	.	0			c.G208A						PASS	.						82.0	74.0	77.0					1																	22816649		2203	4300	6503	SO:0001583	missense	9923	exon3			CCCGAGGAGTTTG	AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.208G>A	chr1.hg19:g.22816649G>A	ENSP00000364798:p.Glu70Lys	92.0	0.0	.		88.0	33.0	.	NM_001083621	O75066|Q5TFU5|Q8N1R1	Missense_Mutation	SNP	ENST00000375647.4	hg19	CCDS224.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.781627	0.90282	.	.	ENSG00000184677	ENST00000404138;ENST00000374649;ENST00000375647;ENST00000400239;ENST00000374651	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	4.61	4.61	0.57282	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.53938	D	0.000053	T	0.80210	0.4581	M	0.73217	2.22	0.34524	D	0.708489	D;D	0.76494	0.999;0.999	D;D	0.79784	0.987;0.993	D	0.85064	0.0936	10	0.40728	T	0.16	-21.3726	16.3638	0.83307	0.0:0.0:1.0:0.0	.	70;70	F8WAI8;Q9NUA8	.;ZBT40_HUMAN	K	70	ENSP00000384527:E70K;ENSP00000364798:E70K;ENSP00000383098:E70K;ENSP00000363782:E70K	ENSP00000363780:E70K	E	+	1	0	ZBTB40	22689236	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.780000	0.99024	2.248000	0.74166	0.591000	0.81541	GAG	.	.	.	none		0.507	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008094.1	NM_014870	
RUNX3	864	hgsc.bcm.edu	37	1	25229150	25229150	+	Silent	SNP	C	C	T	rs567207182		TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr1:25229150C>T	ENST00000308873.6	-	5	719	c.711G>A	c.(709-711)tcG>tcA	p.S237S	RUNX3_ENST00000540420.1_Silent_p.S144S|RUNX3_ENST00000338888.3_Silent_p.S251S|RUNX3_ENST00000399916.1_Silent_p.S251S|RUNX3_ENST00000496967.1_5'UTR	NM_004350.2	NP_004341.1	Q13761	RUNX3_HUMAN	runt-related transcription factor 3	237	Pro/Ser/Thr-rich.				axon guidance (GO:0007411)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|hair follicle morphogenesis (GO:0031069)|interferon-gamma production (GO:0032609)|negative regulation of cell cycle (GO:0045786)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system neuron development (GO:0048935)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(3)	18		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		GGTTCAGTTCCGAGGTGCCTG	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		14814	0.0		0.0	False		,,,				2504	0.001				p.S251S		Atlas-SNP	.											.	RUNX3	72	.	0			c.G753A						PASS	.						60.0	54.0	56.0					1																	25229150		2170	4261	6431	SO:0001819	synonymous_variant	864	exon6			CAGTTCCGAGGTG	BC013362	CCDS257.1, CCDS30633.1	1p36	2008-02-05			ENSG00000020633	ENSG00000020633			10473	protein-coding gene	gene with protein product		600210		CBFA3		7835892	Standard	NM_001031680		Approved	AML2, PEBP2A3	uc001bjq.3	Q13761	OTTHUMG00000003316	ENST00000308873.6:c.711G>A	chr1.hg19:g.25229150C>T		129.0	0.0	.		117.0	12.0	.	NM_001031680	B1AJV5|Q12969|Q13760	Silent	SNP	ENST00000308873.6	hg19	CCDS257.1																																																																																			.	.	.	none		0.617	RUNX3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009284.1	NM_004350	
ZMYM6	9204	hgsc.bcm.edu	37	1	35453543	35453543	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr1:35453543G>A	ENST00000357182.4	-	16	3367	c.3140C>T	c.(3139-3141)tCa>tTa	p.S1047L	ZMYM6_ENST00000373340.2_Intron|ZMYM6_ENST00000487874.1_Intron|RP11-244H3.1_ENST00000417456.1_RNA|ZMYM6_ENST00000493328.1_5'UTR|ZMYM6NB_ENST00000373337.3_5'Flank	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	1047					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				taacatacgtgaatttaatgc	0.353																																					p.S1047L		Atlas-SNP	.											.	ZMYM6	110	.	0			c.C3140T						PASS	.						45.0	40.0	42.0					1																	35453543		1243	2620	3863	SO:0001583	missense	9204	exon16			ATACGTGAATTTA	AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.3140C>T	chr1.hg19:g.35453543G>A	ENSP00000349708:p.Ser1047Leu	172.0	0.0	.		123.0	48.0	.	NM_007167	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Missense_Mutation	SNP	ENST00000357182.4	hg19	CCDS387.2	.	.	.	.	.	.	.	.	.	.	G	15.62	2.888269	0.52014	.	.	ENSG00000163867	ENST00000357182	T	0.20463	2.07	4.2	4.2	0.49525	Ribonuclease H-like (1);	0.074167	0.56097	D	0.000037	T	0.40247	0.1109	M	0.76838	2.35	0.80722	D	1	D	0.69078	0.997	D	0.63488	0.915	T	0.13953	-1.0490	10	0.16420	T	0.52	-12.7494	12.3464	0.55124	0.0:0.0:1.0:0.0	.	1047	O95789	ZMYM6_HUMAN	L	1047	ENSP00000349708:S1047L	ENSP00000349708:S1047L	S	-	2	0	ZMYM6	35226130	1.000000	0.71417	0.993000	0.49108	0.992000	0.81027	1.528000	0.35985	2.634000	0.89283	0.650000	0.86243	TCA	.	.	.	none		0.353	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011999.1	NM_007167	
RASAL2	9462	hgsc.bcm.edu	37	1	178063786	178063786	+	Silent	SNP	T	T	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr1:178063786T>C	ENST00000367649.3	+	1	511	c.159T>C	c.(157-159)ctT>ctC	p.L53L	RASAL2_ENST00000448150.3_Silent_p.L35L|RASAL2-AS1_ENST00000421505.1_lincRNA			Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	0	PH.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						ATCGGATCCTTCTGGAGTCCG	0.627																																					p.L53L		Atlas-SNP	.											.	RASAL2	334	.	0			c.T159C						PASS	.						47.0	38.0	41.0					1																	178063786		2203	4300	6503	SO:0001819	synonymous_variant	9462	exon1			GATCCTTCTGGAG	AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000367649.3:c.159T>C	chr1.hg19:g.178063786T>C		221.0	0.0	.		193.0	79.0	.	NM_170692	F8W755|O95174|Q2TB22|Q5TFU9	Silent	SNP	ENST00000367649.3	hg19	CCDS1321.2																																																																																			.	.	.	none		0.627	RASAL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352415.1	NM_170692	
CDC73	79577	hgsc.bcm.edu	37	1	193119495	193119495	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr1:193119495G>C	ENST00000367435.3	+	9	1074	c.890G>C	c.(889-891)aGa>aCa	p.R297T		NM_024529.4	NP_078805.3	Q6P1J9	CDC73_HUMAN	cell division cycle 73	297	Interaction with POLR2A and PAF1.				cell cycle (GO:0007049)|cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein destabilization (GO:0031648)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(14)|ovary(1)|pancreas(1)|parathyroid(51)|skin(1)|upper_aerodigestive_tract(1)	87						GATCAGGAAAGATTCAAAGGA	0.393																																					p.R297T		Atlas-SNP	.											.	CDC73	163	.	0			c.G890C						PASS	.						120.0	119.0	119.0					1																	193119495		2203	4300	6503	SO:0001583	missense	79577	exon9			AGGAAAGATTCAA	AF312865	CCDS1382.1	1q25	2014-09-17	2013-01-17	2005-07-20	ENSG00000134371	ENSG00000134371			16783	protein-coding gene	gene with protein product	"""Paf1/RNA polymerase II complex component"""	607393	"""chromosome 1 open reading frame 28"", ""hyperparathyroidism 2 (with jaw tumor)"", ""cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"", ""hyperparathyroidism 1"""	C1orf28, HRPT2, HRPT1		11318611, 15632063, 18755853	Standard	NM_024529		Approved	parafibromin, FIHP	uc001gtb.3	Q6P1J9	OTTHUMG00000035676	ENST00000367435.3:c.890G>C	chr1.hg19:g.193119495G>C	ENSP00000356405:p.Arg297Thr	93.0	0.0	.		90.0	32.0	.	NM_024529	A6NLZ8|B2RBR2|Q6PK51|Q96A07|Q9H245|Q9H5L7	Missense_Mutation	SNP	ENST00000367435.3	hg19	CCDS1382.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.571388	0.86542	.	.	ENSG00000134371	ENST00000367435;ENST00000445394	T	0.64260	-0.09	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.79052	0.4381	M	0.85945	2.785	0.80722	D	1	D	0.54207	0.965	P	0.58780	0.845	T	0.81564	-0.0875	10	0.56958	D	0.05	-21.1674	16.9636	0.86279	0.0:0.0:1.0:0.0	.	297	Q6P1J9	CDC73_HUMAN	T	297	ENSP00000356405:R297T	ENSP00000356405:R297T	R	+	2	0	CDC73	191386118	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.330000	0.79181	2.613000	0.88420	0.655000	0.94253	AGA;AGG	.	.	.	none		0.393	CDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086696.2	NM_024529	
DISP1	84976	hgsc.bcm.edu	37	1	223176848	223176848	+	Silent	SNP	A	A	G			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr1:223176848A>G	ENST00000284476.6	+	8	2273	c.2109A>G	c.(2107-2109)cgA>cgG	p.R703R		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	703					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		AAGCATCTCGAATTTTTTTCG	0.418																																					p.R703R		Atlas-SNP	.											.	DISP1	145	.	0			c.A2109G						PASS	.						129.0	130.0	130.0					1																	223176848		2203	4300	6503	SO:0001819	synonymous_variant	84976	exon10			ATCTCGAATTTTT	AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.2109A>G	chr1.hg19:g.223176848A>G		104.0	0.0	.		106.0	58.0	.	NM_032890	Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Silent	SNP	ENST00000284476.6	hg19	CCDS1536.1																																																																																			.	.	.	none		0.418	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092512.1	NM_032890	
DISC1	27185	hgsc.bcm.edu	37	1	232094574	232094574	+	Splice_Site	SNP	A	A	G			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr1:232094574A>G	ENST00000439617.2	+	10	2035	c.1982A>G	c.(1981-1983)gAa>gGa	p.E661G	DISC1_ENST00000366637.3_5'UTR|DISC1_ENST00000535983.1_Intron|DISC1_ENST00000537876.1_Splice_Site_p.R545R|DISC1_ENST00000427560.1_3'UTR	NM_001164537.1|NM_001164540.1|NM_018662.2	NP_001158009.1|NP_001158012.1|NP_061132.2	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1	661	Interaction with ATF4 and ATF5.|Interaction with TRAF3IP1.|Necessary and sufficient for interaction with PCNT and localization at the centrosome.				canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				TTTCCCCCAGAAACAAGTGTG	0.358																																					p.E693G		Atlas-SNP	.											.	DISC1	207	.	0			c.A2078G						PASS	.						134.0	119.0	123.0					1																	232094574		1844	4087	5931	SO:0001630	splice_region_variant	27185	exon11			CCCCAGAAACAAG	AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000439617.2:c.1982-1A>G	chr1.hg19:g.232094574A>G		118.0	0.0	.		141.0	77.0	.	NM_001164537	A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	Missense_Mutation	SNP	ENST00000439617.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.22|11.22	1.575582|1.575582	0.28092|0.28092	.|.	.|.	ENSG00000162946|ENSG00000162946	ENST00000439617;ENST00000366637;ENST00000366638;ENST00000532576|ENST00000422590	T|.	0.10960|.	2.82|.	5.25|5.25	2.93|2.93	0.34026|0.34026	.|.	0.882695|.	0.09800|.	N|.	0.754132|.	T|T	0.36082|0.36082	0.0954|0.0954	N|N	0.20685|0.20685	0.6|0.6	0.80722|0.80722	D|D	1|1	P;B;P;D;B;B;B;B|.	0.60575|.	0.617;0.202;0.617;0.988;0.202;0.202;0.202;0.202|.	B;B;B;P;B;B;B;B|.	0.56343|.	0.306;0.097;0.242;0.796;0.158;0.097;0.097;0.097|.	T|T	0.06267|0.06267	-1.0836|-1.0836	9|5	.|.	.|.	.|.	.|.	5.0735|5.0735	0.14618|0.14618	0.6221:0.0:0.0788:0.2991|0.6221:0.0:0.0788:0.2991	.|.	693;539;693;661;539;661;661;661|.	C4P096;C4P094;E2QRA4;C4P098;F5H1F1;C4P0A4;Q9NRI5-2;Q9NRI5|.	.;.;.;.;.;.;.;DISC1_HUMAN|.	G|E	661;661;693;539|64	ENSP00000403888:E661G|.	.|.	E|K	+|+	2|1	0|0	DISC1|DISC1	230161197|230161197	0.900000|0.900000	0.30661|0.30661	0.670000|0.670000	0.29842|0.29842	0.008000|0.008000	0.06430|0.06430	0.726000|0.726000	0.25984|0.25984	0.439000|0.439000	0.26476|0.26476	-0.336000|-0.336000	0.08194|0.08194	GAA|AAA	.	.	.	none		0.358	DISC1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000092351.2	NM_018662	Missense_Mutation
C2orf70	339778	hgsc.bcm.edu	37	2	26798881	26798881	+	Silent	SNP	T	T	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr2:26798881T>C	ENST00000329615.3	+	2	217	c.186T>C	c.(184-186)acT>acC	p.T62T	C2orf70_ENST00000409392.1_Missense_Mutation_p.S50P	NM_001105519.1	NP_001098989.1	A6NJV1	CB070_HUMAN	chromosome 2 open reading frame 70	62						nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	13						AGAGCCACACTCCCTTCAGCC	0.632																																					p.T62T		Atlas-SNP	.											.	C2orf70	26	.	0			c.T186C						PASS	.						113.0	123.0	120.0					2																	26798881		2100	4228	6328	SO:0001819	synonymous_variant	339778	exon2			CCACACTCCCTTC		CCDS42661.1	2p23.3	2011-05-09			ENSG00000173557	ENSG00000173557			27938	protein-coding gene	gene with protein product	"""hypothetical protein LOC339778"""						Standard	NM_001105519		Approved	LOC339778	uc010eyn.3	A6NJV1	OTTHUMG00000151994	ENST00000329615.3:c.186T>C	chr2.hg19:g.26798881T>C		106.0	0.0	.		86.0	44.0	.	NM_001105519		Silent	SNP	ENST00000329615.3	hg19	CCDS42661.1	.	.	.	.	.	.	.	.	.	.	T	3.981	-0.006358	0.07773	.	.	ENSG00000173557	ENST00000409392	.	.	.	4.68	-0.428	0.12306	.	.	.	.	.	T	0.37945	0.1022	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39563	-0.9608	5	0.87932	D	0	-0.6075	5.2587	0.15561	0.0:0.3001:0.4213:0.2786	.	.	.	.	P	50	.	ENSP00000386615:S50P	S	+	1	0	C2orf70	26652385	0.000000	0.05858	0.000000	0.03702	0.176000	0.22953	-0.100000	0.10990	-0.085000	0.12573	0.260000	0.18958	TCC	.	.	.	none		0.632	C2orf70-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353258.1	NM_001105519	
MTA3	57504	hgsc.bcm.edu	37	2	42931435	42931435	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr2:42931435G>A	ENST00000405094.1	+	12	1127	c.1127G>A	c.(1126-1128)gGg>gAg	p.G376E	MTA3_ENST00000407270.3_Missense_Mutation_p.G376E|MTA3_ENST00000405592.1_Missense_Mutation_p.G319E|MTA3_ENST00000472767.1_3'UTR|MTA3_ENST00000406652.1_Missense_Mutation_p.G319E|MTA3_ENST00000406911.1_Missense_Mutation_p.G375E			Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3	376						intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(9)|ovary(2)|stomach(1)	15						CCTCTCTTAGGGAGAGCCTGT	0.517																																					p.G376E		Atlas-SNP	.											.	MTA3	39	.	0			c.G1127A						PASS	.						105.0	104.0	104.0					2																	42931435		1939	4130	6069	SO:0001583	missense	57504	exon12			TCTTAGGGAGAGC	AB033092	CCDS46267.1, CCDS62900.1	2p22.1	2013-01-25	2004-12-15		ENSG00000057935	ENSG00000057935		"""GATA zinc finger domain containing"""	23784	protein-coding gene	gene with protein product		609050	"""metastasis associated gene family, member 3"""			12705869, 14613024	Standard	NM_001282755		Approved	KIAA1266	uc002rsq.3	Q9BTC8	OTTHUMG00000150452	ENST00000405094.1:c.1127G>A	chr2.hg19:g.42931435G>A	ENSP00000385823:p.Gly376Glu	140.0	0.0	.		118.0	48.0	.	NM_020744	Q9NSP2|Q9ULF4	Missense_Mutation	SNP	ENST00000405094.1	hg19		.	.	.	.	.	.	.	.	.	.	G	24.9	4.580971	0.86748	.	.	ENSG00000057935	ENST00000405592;ENST00000406652;ENST00000407270;ENST00000282366;ENST00000406911;ENST00000405094	D;D;D;D;D	0.99683	-6.39;-6.39;-6.39;-6.39;-6.39	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.99677	0.9879	M	0.78637	2.42	0.80722	D	1	D;D;D	0.76494	0.998;0.995;0.999	D;D;D	0.72982	0.963;0.972;0.979	D	0.98212	1.0473	10	0.72032	D	0.01	-19.9737	20.1931	0.98233	0.0:0.0:1.0:0.0	.	375;376;319	E7EQY4;Q9BTC8-2;D6W5A2	.;.;.	E	319;319;376;376;375;376	ENSP00000383973:G319E;ENSP00000384249:G319E;ENSP00000385045:G376E;ENSP00000385241:G375E;ENSP00000385823:G376E	ENSP00000282366:G376E	G	+	2	0	MTA3	42784939	1.000000	0.71417	0.161000	0.22692	0.689000	0.40095	7.568000	0.82369	2.771000	0.95319	0.563000	0.77884	GGG	.	.	.	none		0.517	MTA3-017	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000318159.1	NM_020744	
ABCG8	64241	hgsc.bcm.edu	37	2	44100948	44100948	+	Nonsense_Mutation	SNP	C	C	T	rs137852991		TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr2:44100948C>T	ENST00000272286.2	+	9	1324	c.1234C>T	c.(1234-1236)Cga>Tga	p.R412*		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	412	ABC transmembrane type-2.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)	p.R412*(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	CAACGACTTCCGAGACCTGCC	0.537																																					p.R412X		Atlas-SNP	.											ABCG8,NS,carcinoma,0,1	ABCG8	98	.	1	Substitution - Nonsense(1)	endometrium(1)	c.C1234T	GRCh37	CM003583	ABCG8	M	rs137852991	PASS	.						185.0	184.0	184.0					2																	44100948		2203	4300	6503	SO:0001587	stop_gained	64241	exon9			GACTTCCGAGACC	AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.1234C>T	chr2.hg19:g.44100948C>T	ENSP00000272286:p.Arg412*	60.0	0.0	.		58.0	3.0	.	NM_022437	Q53QN8	Nonsense_Mutation	SNP	ENST00000272286.2	hg19	CCDS1815.1	.	.	.	.	.	.	.	.	.	.	C	37	6.316278	0.97467	.	.	ENSG00000143921	ENST00000272286	.	.	.	5.16	4.19	0.49359	.	0.110224	0.64402	D	0.000017	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.54	0.84383	0.1692:0.8308:0.0:0.0	.	.	.	.	X	412	.	ENSP00000272286:R412X	R	+	1	2	ABCG8	43954452	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.074000	0.41529	2.420000	0.82092	0.561000	0.74099	CGA	.	.	.	weak		0.537	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250671.1	NM_022437	
WDR33	55339	hgsc.bcm.edu	37	2	128482691	128482691	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr2:128482691A>C	ENST00000322313.4	-	9	1108	c.950T>G	c.(949-951)aTc>aGc	p.I317S		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	317					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		TAGGTTTCTGATATCAAAAAG	0.403																																					p.I317S		Atlas-SNP	.											.	WDR33	136	.	0			c.T950G						PASS	.						99.0	98.0	98.0					2																	128482691		2203	4300	6503	SO:0001583	missense	55339	exon9			TTTCTGATATCAA		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.950T>G	chr2.hg19:g.128482691A>C	ENSP00000325377:p.Ile317Ser	142.0	0.0	.		116.0	48.0	.	NM_018383	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Missense_Mutation	SNP	ENST00000322313.4	hg19	CCDS2150.1	.	.	.	.	.	.	.	.	.	.	A	19.38	3.816481	0.70912	.	.	ENSG00000136709	ENST00000322313	T	0.01438	4.89	5.43	5.43	0.79202	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.07279	0.0184	M	0.64170	1.965	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.03784	-1.1004	10	0.87932	D	0	-6.5886	15.4804	0.75521	1.0:0.0:0.0:0.0	.	317	Q9C0J8	WDR33_HUMAN	S	317	ENSP00000325377:I317S	ENSP00000325377:I317S	I	-	2	0	WDR33	128199161	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.109000	0.94291	2.058000	0.61347	0.460000	0.39030	ATC	.	.	.	none		0.403	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383	
MBD5	55777	hgsc.bcm.edu	37	2	149243320	149243320	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr2:149243320C>T	ENST00000407073.1	+	11	3852	c.2855C>T	c.(2854-2856)tCa>tTa	p.S952L	MBD5_ENST00000404807.1_Missense_Mutation_p.S1185L	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	952					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		GGTGATATGTCATCAATAAAC	0.358																																					p.S952L		Atlas-SNP	.											.	MBD5	164	.	0			c.C2855T						PASS	.						41.0	37.0	39.0					2																	149243320		2203	4300	6503	SO:0001583	missense	55777	exon11			ATATGTCATCAAT	AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.2855C>T	chr2.hg19:g.149243320C>T	ENSP00000386049:p.Ser952Leu	159.0	0.0	.		133.0	47.0	.	NM_018328	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	ENST00000407073.1	hg19	CCDS33302.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.5|27.5	4.833069|4.833069	0.91036|0.91036	.|.	.|.	ENSG00000204406|ENSG00000204406	ENST00000416015|ENST00000407073;ENST00000404807	.|T;T	.|0.26660	.|1.72;1.72	5.47|5.47	5.47|5.47	0.80525|0.80525	.|.	.|0.122895	.|0.37483	.|N	.|0.002076	T|T	0.16257|0.16257	0.0391|0.0391	N|N	0.14661|0.14661	0.345|0.345	0.35544|0.35544	D|D	0.803325|0.803325	.|P;P	.|0.42518	.|0.782;0.782	.|B;B	.|0.31614	.|0.098;0.133	T|T	0.19582|0.19582	-1.0301|-1.0301	5|10	.|0.72032	.|D	.|0.01	-1.3737|-1.3737	19.3258|19.3258	0.94261|0.94261	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1185;952	.|E9PHH0;Q9P267	.|.;MBD5_HUMAN	Y|L	925|952;1185	.|ENSP00000386049:S952L;ENSP00000384672:S1185L	.|ENSP00000384672:S1185L	H|S	+|+	1|2	0|0	MBD5|MBD5	148959790|148959790	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.677000|5.677000	0.68142|0.68142	2.579000|2.579000	0.87056|0.87056	0.591000|0.591000	0.81541|0.81541	CAT|TCA	.	.	.	none		0.358	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2		
TTN	7273	hgsc.bcm.edu	37	2	179606399	179606399	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr2:179606399A>T	ENST00000591111.1	-	46	10834	c.10610T>A	c.(10609-10611)tTc>tAc	p.F3537Y	TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.F3683Y|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.F3616Y|TTN_ENST00000589042.1_Missense_Mutation_p.F3854Y|TTN_ENST00000460472.2_Missense_Mutation_p.F3491Y|TTN-AS1_ENST00000582847.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13872	Ig-like 21.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCATTAAAGAACCACTGAAT	0.403																																					p.F3854Y		Atlas-SNP	.											.	TTN	18412	.	0			c.T11561A						PASS	.						118.0	114.0	115.0					2																	179606399		1916	4118	6034	SO:0001583	missense	7273	exon48			TTAAAGAACCACT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10610T>A	chr2.hg19:g.179606399A>T	ENSP00000465570:p.Phe3537Tyr	168.0	0.0	.		124.0	41.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	14.22	2.470726	0.43942	.	.	ENSG00000155657	ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T	0.40756	1.02;1.02;1.02	6.07	6.07	0.98685	.	.	.	.	.	T	0.39436	0.1078	N	0.05280	-0.08	0.24253	N	0.995318	P;P;P	0.51537	0.946;0.946;0.946	P;P;P	0.54060	0.741;0.741;0.741	T	0.46978	-0.9152	9	0.87932	D	0	.	16.635	0.85050	1.0:0.0:0.0:0.0	.	3491;3616;3683	D3DPF9;E7EQE6;E7ET18	.;.;.	Y	3491;3683;3616;3491	ENSP00000434586:F3491Y;ENSP00000340554:F3683Y;ENSP00000352154:F3616Y	ENSP00000340554:F3683Y	F	-	2	0	TTN	179314644	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.141000	0.71744	2.330000	0.79161	0.477000	0.44152	TTC	.	.	.	none		0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UNC80	285175	hgsc.bcm.edu	37	2	210824431	210824431	+	Splice_Site	SNP	G	G	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr2:210824431G>C	ENST00000439458.1	+	50	7687	c.7607G>C	c.(7606-7608)aGg>aCg	p.R2536T	UNC80_ENST00000272845.6_Splice_Site_p.R2531T|UNC80_ENST00000539183.1_5'Flank	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	2536					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						TCTCACATGAGGTACTGGCCT	0.532																																					p.R2536T		Atlas-SNP	.											.	UNC80	280	.	0			c.G7607C						PASS	.						104.0	91.0	95.0					2																	210824431		692	1591	2283	SO:0001630	splice_region_variant	285175	exon50			ACATGAGGTACTG	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.7607+1G>C	chr2.hg19:g.210824431G>C		104.0	0.0	.		87.0	34.0	.	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	hg19	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	G	31	5.088564	0.94100	.	.	ENSG00000144406	ENST00000439458;ENST00000272845;ENST00000333907	T;T	0.64991	-0.13;-0.13	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.76069	0.3936	L	0.49126	1.545	0.80722	D	1	D	0.57899	0.981	D	0.69142	0.962	T	0.76900	-0.2788	10	0.87932	D	0	-18.8557	19.879	0.96888	0.0:0.0:1.0:0.0	.	2536	Q8N2C7	UNC80_HUMAN	T	2536;2531;62	ENSP00000391088:R2536T;ENSP00000272845:R2531T	ENSP00000272845:R2531T	R	+	2	0	UNC80	210532676	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.745000	0.98856	2.695000	0.91970	0.655000	0.94253	AGG	.	.	.	none		0.532	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	Missense_Mutation
UGT1A9	54600	hgsc.bcm.edu	37	2	234581095	234581095	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr2:234581095T>C	ENST00000354728.4	+	1	597	c.515T>C	c.(514-516)aTa>aCa	p.I172T	UGT1A10_ENST00000344644.5_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609637.1_Missense_Mutation_p.I172T			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	172					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)			breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	GCCAGGGGAATACTTTGCCAC	0.468																																					p.I172T		Atlas-SNP	.											.	UGT1A9	79	.	0			c.T515C						PASS	.						170.0	172.0	171.0					2																	234581095		2203	4300	6503	SO:0001583	missense	54600	exon1			GGGGAATACTTTG	AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.515T>C	chr2.hg19:g.234581095T>C	ENSP00000346768:p.Ile172Thr	117.0	0.0	.		86.0	38.0	.	NM_021027	B8K285|P36509|Q9HAX0	Missense_Mutation	SNP	ENST00000354728.4	hg19	CCDS2505.1	.	.	.	.	.	.	.	.	.	.	T	0.009	-1.809371	0.00606	.	.	ENSG00000241119	ENST00000354728	T	0.60171	0.21	3.41	0.854	0.19007	.	.	.	.	.	T	0.40094	0.1103	L	0.28694	0.88	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.003	T	0.22452	-1.0216	9	0.21014	T	0.42	.	7.6603	0.28400	0.0:0.1854:0.0:0.8146	.	172;172	Q5DSZ5;O60656	.;UD19_HUMAN	T	172	ENSP00000346768:I172T	ENSP00000346768:I172T	I	+	2	0	UGT1A9	234245834	0.009000	0.17119	0.005000	0.12908	0.099000	0.18886	1.826000	0.39092	0.066000	0.16515	0.362000	0.22060	ATA	.	.	.	none		0.468	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130995.1	NM_021027	
ZNF660	285349	hgsc.bcm.edu	37	3	44636593	44636593	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr3:44636593A>T	ENST00000322734.2	+	3	1241	c.908A>T	c.(907-909)aAa>aTa	p.K303I	RP11-944L7.4_ENST00000457331.1_RNA	NM_173658.2	NP_775929.2	Q6AZW8	ZN660_HUMAN	zinc finger protein 660	303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(4)	6				KIRC - Kidney renal clear cell carcinoma(197;0.0468)|Kidney(197;0.0585)		AAACCCTATAAATGTAGTGAG	0.378																																					p.K303I		Atlas-SNP	.											.	ZNF660	28	.	0			c.A908T						PASS	.						62.0	63.0	63.0					3																	44636593		2203	4300	6503	SO:0001583	missense	285349	exon3			CCTATAAATGTAG	AK094189	CCDS2716.1	3p21.32	2013-01-08			ENSG00000144792	ENSG00000144792		"""Zinc fingers, C2H2-type"""	26720	protein-coding gene	gene with protein product							Standard	NM_173658		Approved	FLJ36870	uc003cnl.1	Q6AZW8	OTTHUMG00000133097	ENST00000322734.2:c.908A>T	chr3.hg19:g.44636593A>T	ENSP00000324605:p.Lys303Ile	228.0	0.0	.		243.0	151.0	.	NM_173658	Q7Z331|Q8N9M8	Missense_Mutation	SNP	ENST00000322734.2	hg19	CCDS2716.1	.	.	.	.	.	.	.	.	.	.	A	16.02	3.003841	0.54254	.	.	ENSG00000144792	ENST00000322734	T	0.20881	2.04	4.21	4.21	0.49690	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.30039	0.0752	M	0.64170	1.965	0.80722	D	1	P	0.37122	0.583	P	0.45343	0.477	T	0.04041	-1.0982	8	.	.	.	.	12.6704	0.56864	1.0:0.0:0.0:0.0	.	303	Q6AZW8	ZN660_HUMAN	I	303	ENSP00000324605:K303I	.	K	+	2	0	ZNF660	44611597	0.000000	0.05858	1.000000	0.80357	0.992000	0.81027	0.027000	0.13621	1.887000	0.54652	0.528000	0.53228	AAA	.	.	.	none		0.378	ZNF660-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256756.4	NM_173658	
ITIH1	3697	hgsc.bcm.edu	37	3	52822035	52822035	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr3:52822035C>A	ENST00000273283.2	+	17	1982	c.1958C>A	c.(1957-1959)aCt>aAt	p.T653N	ITIH1_ENST00000405128.3_Missense_Mutation_p.T19N|ITIH1_ENST00000537050.1_Missense_Mutation_p.T365N|ITIH1_ENST00000542827.1_Intron|ITIH1_ENST00000540715.1_Missense_Mutation_p.T511N	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	653	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		CCTTCTCCTACTCATTCCAGC	0.617																																					p.T653N		Atlas-SNP	.											.	ITIH1	108	.	0			c.C1958A						PASS	.						136.0	125.0	129.0					3																	52822035		2203	4300	6503	SO:0001583	missense	3697	exon17			CTCCTACTCATTC		CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.1958C>A	chr3.hg19:g.52822035C>A	ENSP00000273283:p.Thr653Asn	194.0	0.0	.		173.0	41.0	.	NM_002215	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	ENST00000273283.2	hg19	CCDS2864.1	.	.	.	.	.	.	.	.	.	.	C	13.90	2.374837	0.42105	.	.	ENSG00000055957	ENST00000273283;ENST00000540715;ENST00000537050;ENST00000428133;ENST00000405128	T;T;T;T;T	0.11604	4.82;4.69;4.51;3.98;2.76	4.0	4.0	0.46444	.	0.496604	0.21728	N	0.070006	T	0.10723	0.0262	N	0.14661	0.345	0.25779	N	0.984742	B;P;D;P	0.67145	0.13;0.704;0.996;0.842	B;B;P;B	0.53649	0.039;0.138;0.731;0.397	T	0.20874	-1.0262	10	0.24483	T	0.36	-19.4772	11.9255	0.52817	0.0:1.0:0.0:0.0	.	511;19;254;653	F5H165;B5MCP1;Q9P1C5;P19827	.;.;.;ITIH1_HUMAN	N	653;511;365;206;19	ENSP00000273283:T653N;ENSP00000443973:T511N;ENSP00000443847:T365N;ENSP00000395836:T206N;ENSP00000384589:T19N	ENSP00000273283:T653N	T	+	2	0	ITIH1	52797075	0.039000	0.19947	0.357000	0.25798	0.136000	0.21042	1.311000	0.33562	2.525000	0.85131	0.655000	0.94253	ACT	.	.	.	none		0.617	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1	NM_002215	
DNAH12	201625	hgsc.bcm.edu	37	3	57419454	57419454	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr3:57419454T>C	ENST00000351747.2	-	31	4868	c.4688A>G	c.(4687-4689)gAa>gGa	p.E1563G		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	1563	AAA 2. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						AATGACCTTTTCTTCCTCTCC	0.388																																					p.E1563G		Atlas-SNP	.											.	DNAH12	182	.	0			c.A4688G						PASS	.						240.0	209.0	218.0					3																	57419454		692	1591	2283	SO:0001583	missense	201625	exon31			ACCTTTTCTTCCT	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.4688A>G	chr3.hg19:g.57419454T>C	ENSP00000295937:p.Glu1563Gly	82.0	0.0	.		92.0	9.0	.	NM_178504	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	ENST00000351747.2	hg19		.	.	.	.	.	.	.	.	.	.	T	17.35	3.368116	0.61513	.	.	ENSG00000174844	ENST00000351747;ENST00000495027	T;T	0.52754	0.65;0.65	5.73	5.73	0.89815	ATPase, dynein-related, AAA domain (1);	.	.	.	.	T	0.47985	0.1475	N	0.20610	0.595	0.80722	D	1	D	0.58268	0.982	P	0.56278	0.795	T	0.40627	-0.9553	9	0.27082	T	0.32	.	16.0246	0.80532	0.0:0.0:0.0:1.0	.	1563	Q6ZR08	DYH12_HUMAN	G	1563;1586	ENSP00000295937:E1563G;ENSP00000418137:E1586G	ENSP00000295937:E1563G	E	-	2	0	DNAH12	57394494	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.896000	0.87350	2.175000	0.68902	0.533000	0.62120	GAA	.	.	.	none		0.388	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
ZNF717	100131827	hgsc.bcm.edu	37	3	75786895	75786895	+	Missense_Mutation	SNP	T	T	G	rs144168413		TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr3:75786895T>G	ENST00000478296.1	-	4	2005	c.1729A>C	c.(1729-1731)Acc>Ccc	p.T577P	ZNF717_ENST00000477374.1_Intron|ZNF717_ENST00000491507.1_Intron|ZNF717_ENST00000422325.1_Missense_Mutation_p.T627P|ZNF717_ENST00000400845.3_Missense_Mutation_p.T620P|MIR4273_ENST00000582824.1_RNA			Q9BY31	ZN717_HUMAN	zinc finger protein 717	620					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(6)|endometrium(3)|lung(2)|ovary(1)|stomach(7)	19						TGACGAAAGGTTTTTCCACAT	0.393																																					p.T627P		Atlas-SNP	.											.,1	ZNF717	160	.	0			c.A1879C						PASS	.						13.0	14.0	14.0					3																	75786895		589	1486	2075	SO:0001583	missense	100131827	exon5			GAAAGGTTTTTCC	AF226994		3p12.3	2013-01-08			ENSG00000227124	ENSG00000227124		"""Zinc fingers, C2H2-type"", ""-"""	29448	protein-coding gene	gene with protein product			"""zinc finger protein 838"""	ZNF838			Standard	NM_001128223		Approved	X17	uc011bgi.2	Q9BY31	OTTHUMG00000158965	ENST00000478296.1:c.1729A>C	chr3.hg19:g.75786895T>G	ENSP00000419377:p.Thr577Pro	54.0	0.0	.		46.0	4.0	.	NM_001128223		Missense_Mutation	SNP	ENST00000478296.1	hg19		.	.	.	.	.	.	.	.	.	.	.	12.10	1.835619	0.32421	.	.	ENSG00000227124	ENST00000478296;ENST00000422325;ENST00000400845	T;T;T	0.01172	5.23;5.23;5.23	1.9	-3.81	0.04294	.	.	.	.	.	T	0.02012	0.0063	L	0.58925	1.835	0.09310	N	1	D	0.53619	0.961	P	0.51135	0.66	T	0.20840	-1.0263	9	0.62326	D	0.03	.	3.9643	0.09424	0.6241:0.1451:0.0:0.2308	.	627	C9JSV9	.	P	577;627;620	ENSP00000419377:T577P;ENSP00000409514:T627P;ENSP00000383643:T620P	ENSP00000383643:T620P	T	-	1	0	ZNF717	75869585	0.002000	0.14202	0.003000	0.11579	0.022000	0.10575	-0.162000	0.10012	-0.928000	0.03761	-0.530000	0.04314	ACC	.	.	.	none		0.393	ZNF717-002	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000352764.2	NM_001128223	
EPHA6	285220	hgsc.bcm.edu	37	3	97311466	97311466	+	Silent	SNP	G	G	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr3:97311466G>A	ENST00000514100.1	+	9	815	c.573G>A	c.(571-573)ccG>ccA	p.P191P	EPHA6_ENST00000389672.5_Silent_p.P799P|EPHA6_ENST00000442602.2_Silent_p.P165P|EPHA6_ENST00000502694.1_Silent_p.P191P	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	705	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						GATCCTTCCCGGCCATTGGGG	0.448																																					p.P799P		Atlas-SNP	.											.	EPHA6	439	.	0			c.G2397A						PASS	.						60.0	61.0	61.0					3																	97311466		1820	4086	5906	SO:0001819	synonymous_variant	285220	exon12			CTTCCCGGCCATT	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.573G>A	chr3.hg19:g.97311466G>A		117.0	0.0	.		119.0	33.0	.	NM_001080448	D6RAL5	Silent	SNP	ENST00000514100.1	hg19																																																																																				.	.	.	none		0.448	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000359997.1	NM_001080448	
MBNL1	4154	hgsc.bcm.edu	37	3	152132779	152132779	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr3:152132779T>C	ENST00000463374.1	+	2	735	c.224T>C	c.(223-225)tTa>tCa	p.L75S	MBNL1_ENST00000324210.5_Missense_Mutation_p.L75S|MBNL1_ENST00000545754.1_Missense_Mutation_p.L75S|MBNL1_ENST00000498502.1_Missense_Mutation_p.L75S|MBNL1_ENST00000492948.1_Missense_Mutation_p.L75S|MBNL1_ENST00000485910.1_Missense_Mutation_p.L75S|MBNL1_ENST00000485509.1_Missense_Mutation_p.L75S|MBNL1_ENST00000493459.1_Missense_Mutation_p.L18S|MBNL1_ENST00000282488.7_Missense_Mutation_p.L75S|MBNL1_ENST00000355460.2_Missense_Mutation_p.L75S|MBNL1_ENST00000282486.6_Missense_Mutation_p.L75S|MBNL1_ENST00000324196.5_Missense_Mutation_p.L75S|MBNL1_ENST00000357472.3_Missense_Mutation_p.L75S	NM_207293.1	NP_997176.1	Q9NR56	MBNL1_HUMAN	muscleblind-like splicing regulator 1	75					alternative mRNA splicing, via spliceosome (GO:0000380)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|mRNA splice site selection (GO:0006376)|myoblast differentiation (GO:0045445)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|skeletal muscle tissue development (GO:0007519)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			CCCCCACATTTAAAAACGCAG	0.433																																					p.L75S		Atlas-SNP	.											.	MBNL1	100	.	0			c.T224C						PASS	.						119.0	112.0	115.0					3																	152132779		2203	4300	6503	SO:0001583	missense	4154	exon3			CACATTTAAAAAC	Y13829	CCDS3163.1, CCDS3164.1, CCDS3165.1, CCDS3166.1, CCDS3167.1, CCDS3168.1, CCDS54656.1	3q25	2013-01-18	2012-02-23	2003-03-14	ENSG00000152601	ENSG00000152601		"""Zinc fingers, CCCH-type domain containing"""	6923	protein-coding gene	gene with protein product		606516	"""muscleblind (Drosophila)-like"", ""muscleblind-like (Drosophila)"""	MBNL			Standard	NM_021038		Approved	KIAA0428, EXP42, EXP40, EXP35, EXP	uc003ezm.3	Q9NR56	OTTHUMG00000159163	ENST00000463374.1:c.224T>C	chr3.hg19:g.152132779T>C	ENSP00000418108:p.Leu75Ser	135.0	0.0	.		191.0	115.0	.	NM_207292	E9PBW7|O43311|O43797|Q86UV8|Q86UV9|Q96P92|Q96RE3	Missense_Mutation	SNP	ENST00000463374.1	hg19	CCDS3165.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	29.3|29.3	4.997318|4.997318	0.93167|0.93167	.|.	.|.	ENSG00000152601|ENSG00000152601	ENST00000282486;ENST00000282488;ENST00000355460;ENST00000493459;ENST00000324210;ENST00000459747;ENST00000498502;ENST00000324196;ENST00000545754;ENST00000357472;ENST00000485910;ENST00000463374;ENST00000465907;ENST00000492948;ENST00000485509|ENST00000464596	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.46451|.	0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87|.	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	D|.	0.83968|.	0.5369|.	M|M	0.89904|0.89904	3.07|3.07	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D;D;D|.	0.97110|.	0.996;0.999;0.994;0.998;0.999;0.992;0.998;1.0|.	D|.	0.87138|.	0.2201|.	10|.	0.87932|.	D|.	0|.	-6.3313|-6.3313	16.1606|16.1606	0.81704|0.81704	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	75;75;75;75;75;18;75;75|.	E9PBW7;Q9NR56-3;Q96RE3;Q9NR56;Q86UV8;Q86VM6;Q9NR56-2;Q96P92|.	.;.;.;MBNL1_HUMAN;.;.;.;.|.	S|Q	75;75;75;18;75;19;75;75;75;75;75;75;75;75;75|74	ENSP00000282486:L75S;ENSP00000282488:L75S;ENSP00000347637:L75S;ENSP00000419347:L18S;ENSP00000319429:L75S;ENSP00000417169:L19S;ENSP00000420327:L75S;ENSP00000319374:L75S;ENSP00000437491:L75S;ENSP00000350064:L75S;ENSP00000418427:L75S;ENSP00000418108:L75S;ENSP00000417630:L75S;ENSP00000420103:L75S;ENSP00000418876:L75S|.	ENSP00000282486:L75S|.	L|X	+|+	2|1	0|0	MBNL1|MBNL1	153615469|153615469	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	7.930000|7.930000	0.87610|0.87610	2.227000|2.227000	0.72691|0.72691	0.460000|0.460000	0.39030|0.39030	TTA|TAA	.	.	.	none		0.433	MBNL1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353604.1	NM_021038	
TNFSF10	8743	hgsc.bcm.edu	37	3	172224318	172224318	+	Silent	SNP	A	A	G			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr3:172224318A>G	ENST00000241261.2	-	5	932	c.810T>C	c.(808-810)caT>caC	p.H270H	TNFSF10_ENST00000420541.2_3'UTR	NM_003810.3	NP_003801.1	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily, member 10	270					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|immune response (GO:0006955)|male gonad development (GO:0008584)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to insulin (GO:0032868)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|receptor binding (GO:0005102)			breast(2)|cervix(1)|large_intestine(1)|lung(6)|ovary(1)|skin(4)	15	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			AACTGGCTTCATGGTCCATGT	0.368																																					p.H270H		Atlas-SNP	.											.	TNFSF10	30	.	0			c.T810C						PASS	.						70.0	67.0	68.0					3																	172224318		2203	4300	6503	SO:0001819	synonymous_variant	8743	exon5			GGCTTCATGGTCC	U37518	CCDS3219.1, CCDS54680.1	3q26	2006-09-20			ENSG00000121858	ENSG00000121858		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11925	protein-coding gene	gene with protein product		603598				8777713, 8663110	Standard	NM_003810		Approved	TRAIL, Apo-2L, TL2, CD253	uc003fid.3	P50591	OTTHUMG00000156917	ENST00000241261.2:c.810T>C	chr3.hg19:g.172224318A>G		262.0	0.0	.		275.0	175.0	.	NM_003810	A1Y9B3	Silent	SNP	ENST00000241261.2	hg19	CCDS3219.1																																																																																			.	.	.	none		0.368	TNFSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346601.1		
EHHADH	1962	hgsc.bcm.edu	37	3	184947277	184947277	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr3:184947277T>C	ENST00000231887.3	-	4	481	c.406A>G	c.(406-408)Acc>Gcc	p.T136A	EHHADH_ENST00000475987.1_5'UTR|EHHADH_ENST00000456310.1_Missense_Mutation_p.T40A	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	136	Enoyl-CoA hydratase / isomerase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			AGAAGCTGGGTTCCTCTTGCA	0.468																																					p.T136A		Atlas-SNP	.											.	EHHADH	73	.	0			c.A406G						PASS	.						97.0	85.0	89.0					3																	184947277		2203	4300	6503	SO:0001583	missense	1962	exon4			GCTGGGTTCCTCT	L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.406A>G	chr3.hg19:g.184947277T>C	ENSP00000231887:p.Thr136Ala	60.0	0.0	.		90.0	36.0	.	NM_001966	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Missense_Mutation	SNP	ENST00000231887.3	hg19	CCDS33901.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.239203	0.79800	.	.	ENSG00000113790	ENST00000537544;ENST00000231887;ENST00000456310	T;T	0.73897	-0.79;-0.79	6.07	4.9	0.64082	Crotonase, core (1);	0.135951	0.64402	D	0.000003	T	0.80939	0.4720	M	0.88031	2.925	0.80722	D	1	P	0.49559	0.925	P	0.46510	0.519	D	0.83620	0.0139	10	0.87932	D	0	-17.9369	11.8215	0.52240	0.1316:0.0:0.0:0.8684	.	136	Q08426	ECHP_HUMAN	A	136;136;40	ENSP00000231887:T136A;ENSP00000387746:T40A	ENSP00000231887:T136A	T	-	1	0	EHHADH	186429971	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.466000	0.60148	1.086000	0.41228	0.528000	0.53228	ACC	.	.	.	none		0.468	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345326.1		
TMEM156	80008	hgsc.bcm.edu	37	4	38990469	38990469	+	Splice_Site	SNP	A	A	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr4:38990469A>C	ENST00000381938.3	-	4	847		c.e4+1			NM_024943.1	NP_079219.1	Q8N614	TM156_HUMAN	transmembrane protein 156							integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|stomach(1)	10						GATTATACTTACTCTGCCACT	0.358																																					.		Atlas-SNP	.											.	TMEM156	31	.	0			c.739+2T>G						PASS	.						156.0	157.0	157.0					4																	38990469		2203	4300	6503	SO:0001630	splice_region_variant	80008	exon5			ATACTTACTCTGC	AK026888	CCDS3448.1	4p14	2008-02-05			ENSG00000121895	ENSG00000121895			26260	protein-coding gene	gene with protein product						12477932	Standard	NM_024943		Approved	FLJ23235	uc003gto.3	Q8N614	OTTHUMG00000128582	ENST00000381938.3:c.739+1T>G	chr4.hg19:g.38990469A>C		72.0	0.0	.		61.0	30.0	.	NM_024943	Q9H5N9	Splice_Site	SNP	ENST00000381938.3	hg19	CCDS3448.1	.	.	.	.	.	.	.	.	.	.	A	11.88	1.771644	0.31320	.	.	ENSG00000121895	ENST00000381938	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9433	0.52913	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMEM156	38666864	1.000000	0.71417	1.000000	0.80357	0.171000	0.22731	4.188000	0.58351	2.317000	0.78254	0.459000	0.35465	.	.	.	.	none		0.358	TMEM156-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250435.3	NM_024943	Intron
RASGEF1B	153020	hgsc.bcm.edu	37	4	82369435	82369435	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr4:82369435T>C	ENST00000264400.2	-	5	593	c.442A>G	c.(442-444)Aca>Gca	p.T148A	RASGEF1B_ENST00000509081.1_Splice_Site_p.T147A|RASGEF1B_ENST00000335927.7_Splice_Site_p.T106A	NM_152545.1	NP_689758.1	Q0VAM2	RGF1B_HUMAN	RasGEF domain family, member 1B	148	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				positive regulation of Ras GTPase activity (GO:0032320)|small GTPase mediated signal transduction (GO:0007264)	endosome (GO:0005768)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)			endometrium(2)|kidney(5)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	26						TTTCTGTATGTCTGCTAGGGA	0.473																																					p.T148A		Atlas-SNP	.											.	RASGEF1B	44	.	0			c.A442G						PASS	.						117.0	106.0	110.0					4																	82369435		2203	4300	6503	SO:0001583	missense	153020	exon5			TGTATGTCTGCTA	AK056257	CCDS34022.1, CCDS75151.1, CCDS75152.1	4q21.21	2013-09-24				ENSG00000138670			24881	protein-coding gene	gene with protein product		614532				12488504	Standard	XM_005262776		Approved	GPIG4, FLJ31695	uc003hmi.1	Q0VAM2		ENST00000264400.2:c.442A>G	chr4.hg19:g.82369435T>C	ENSP00000264400:p.Thr148Ala	96.0	0.0	.		79.0	23.0	.	NM_152545	Q0VAM1|Q4W5L7|Q4W5M3|Q96MY8	Missense_Mutation	SNP	ENST00000264400.2	hg19	CCDS34022.1	.	.	.	.	.	.	.	.	.	.	T	5.620	0.299156	0.10622	.	.	ENSG00000138670	ENST00000509081;ENST00000264400;ENST00000335927	T;T;T	0.28069	1.63;1.63;1.63	5.31	2.9	0.33743	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (2);	0.421187	0.27735	N	0.018077	T	0.13970	0.0338	N	0.11560	0.145	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.09552	-1.0669	10	0.12430	T	0.62	.	9.1866	0.37174	0.0:0.1481:0.0:0.8519	.	106;147;148	Q0VAM2-2;Q0VAM2-3;Q0VAM2	.;.;RGF1B_HUMAN	A	147;148;106	ENSP00000425393:T147A;ENSP00000264400:T148A;ENSP00000338437:T106A	ENSP00000264400:T148A	T	-	1	0	RASGEF1B	82588459	0.997000	0.39634	0.997000	0.53966	0.918000	0.54935	0.682000	0.25335	0.489000	0.27749	0.482000	0.46254	ACA	.	.	.	none		0.473	RASGEF1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362830.1	NM_152545	
WDFY3	23001	hgsc.bcm.edu	37	4	85731169	85731169	+	Nonsense_Mutation	SNP	G	G	T	rs79515377		TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr4:85731169G>T	ENST00000295888.4	-	14	2623	c.2216C>A	c.(2215-2217)tCa>tAa	p.S739*	WDFY3-AS1_ENST00000510449.1_RNA|WDFY3_ENST00000322366.6_Nonsense_Mutation_p.S739*	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	739					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CTGTGTATTTGAGGGGAAGAC	0.388																																					p.S739X		Atlas-SNP	.											.	WDFY3	314	.	0			c.C2216A						PASS	.						155.0	149.0	151.0					4																	85731169		2203	4300	6503	SO:0001587	stop_gained	23001	exon14			GTATTTGAGGGGA	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.2216C>A	chr4.hg19:g.85731169G>T	ENSP00000295888:p.Ser739*	154.0	0.0	.		155.0	61.0	.	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Nonsense_Mutation	SNP	ENST00000295888.4	hg19	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	G	43	10.432204	0.99404	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	.	.	.	X	739	.	ENSP00000295888:S739X	S	-	2	0	WDFY3	85950193	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	9.338000	0.96553	2.885000	0.99019	0.655000	0.94253	TCA	.	.	.	weak		0.388	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
ANK2	287	hgsc.bcm.edu	37	4	114153415	114153415	+	Splice_Site	SNP	G	G	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr4:114153415G>A	ENST00000357077.4	+	5	536	c.483G>A	c.(481-483)gaG>gaA	p.E161E	ANK2_ENST00000264366.6_Splice_Site_p.E161E|ANK2_ENST00000506722.1_Splice_Site_p.E140E|ANK2_ENST00000394537.3_Splice_Site_p.E161E	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	161					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTGCTACAGAGGTAAGACTGT	0.373																																					p.E161E		Atlas-SNP	.											.	ANK2	576	.	0			c.G483A						PASS	.						108.0	99.0	102.0					4																	114153415		2203	4300	6503	SO:0001630	splice_region_variant	287	exon5			TACAGAGGTAAGA	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.483+1G>A	chr4.hg19:g.114153415G>A		74.0	0.0	.		55.0	23.0	.	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	ENST00000357077.4	hg19	CCDS3702.1																																																																																			.	.	.	none		0.373	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	Silent
CCNA2	890	hgsc.bcm.edu	37	4	122740067	122740067	+	Splice_Site	SNP	A	A	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr4:122740067A>C	ENST00000274026.5	-	6	1307	c.1004T>G	c.(1003-1005)tTt>tGt	p.F335C		NM_001237.3	NP_001228	P20248	CCNA2_HUMAN	cyclin A2	335					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|organ regeneration (GO:0031100)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|response to estradiol (GO:0032355)|response to glucagon (GO:0033762)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	12						TTCTCCCAAAAACTGGAATAA	0.383																																					p.F335C		Atlas-SNP	.											.	CCNA2	30	.	0			c.T1004G						PASS	.						65.0	66.0	66.0					4																	122740067		2203	4300	6503	SO:0001630	splice_region_variant	890	exon6			CCCAAAAACTGGA		CCDS3723.1	4q27	2012-07-12			ENSG00000145386	ENSG00000145386			1578	protein-coding gene	gene with protein product		123835		CCNA, CCN1		1675006	Standard	NM_001237		Approved		uc003iec.4	P20248	OTTHUMG00000133072	ENST00000274026.5:c.1003-1T>G	chr4.hg19:g.122740067A>C		158.0	0.0	.		151.0	65.0	.	NM_001237	A8K7B6|Q2M3U6|Q4W5P4|Q6LER8	Missense_Mutation	SNP	ENST00000274026.5	hg19	CCDS3723.1	.	.	.	.	.	.	.	.	.	.	A	18.32	3.598714	0.66332	.	.	ENSG00000145386	ENST00000274026	T	0.26067	1.76	6.02	6.02	0.97574	Cyclin, C-terminal (1);Cyclin-like (3);	0.226591	0.47455	D	0.000226	T	0.58104	0.2099	M	0.91768	3.24	0.54753	D	0.999987	D	0.89917	1.0	D	0.85130	0.997	T	0.67019	-0.5776	10	0.87932	D	0	.	11.3618	0.49648	0.8331:0.0:0.0:0.1669	.	335	P20248	CCNA2_HUMAN	C	335	ENSP00000274026:F335C	ENSP00000274026:F335C	F	-	2	0	CCNA2	122959517	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	3.008000	0.49544	2.311000	0.77944	0.533000	0.62120	TTT	.	.	.	none		0.383	CCNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256712.2	NM_001237	Missense_Mutation
ZNF827	152485	hgsc.bcm.edu	37	4	146686704	146686704	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr4:146686704T>C	ENST00000508784.1	-	12	3274	c.3047A>G	c.(3046-3048)gAg>gGg	p.E1016G	ZNF827_ENST00000513320.1_Missense_Mutation_p.E666G|ZNF827_ENST00000379448.4_Missense_Mutation_p.E1016G			Q17R98	ZN827_HUMAN	zinc finger protein 827	1016					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	all_hematologic(180;0.151)					CTTACCTTTCTCTGGCTTTTC	0.537																																					p.E1016G		Atlas-SNP	.											.	ZNF827	102	.	0			c.A3047G						PASS	.						72.0	65.0	67.0					4																	146686704		2203	4300	6503	SO:0001583	missense	152485	exon12			CCTTTCTCTGGCT	AK091130	CCDS34072.1	4q31.22	2013-01-08			ENSG00000151612	ENSG00000151612		"""Zinc fingers, C2H2-type"""	27193	protein-coding gene	gene with protein product						12477932	Standard	NM_178835		Approved		uc003ikm.3	Q17R98	OTTHUMG00000161362	ENST00000508784.1:c.3047A>G	chr4.hg19:g.146686704T>C	ENSP00000421863:p.Glu1016Gly	58.0	0.0	.		57.0	29.0	.	NM_178835	B7ZL52|Q7Z4S7|Q8N279	Missense_Mutation	SNP	ENST00000508784.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.48|19.48	3.834667|3.834667	0.71373|0.71373	.|.	.|.	ENSG00000151612|ENSG00000151612	ENST00000508784;ENST00000513320;ENST00000379448;ENST00000281318;ENST00000440280|ENST00000511659	T;T;T|.	0.64260|.	-0.09;-0.09;-0.09|.	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	0.143012|.	0.64402|.	D|.	0.000006|.	T|T	0.53318|0.53318	0.1789|0.1789	N|N	0.24115|0.24115	0.695|0.695	0.58432|0.58432	D|D	0.999996|0.999996	B;P;P;P|.	0.38711|.	0.361;0.455;0.59;0.643|.	B;B;B;B|.	0.38921|.	0.187;0.091;0.187;0.285|.	T|T	0.50074|0.50074	-0.8870|-0.8870	10|5	0.54805|.	T|.	0.06|.	-20.6979|-20.6979	16.1519|16.1519	0.81629|0.81629	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	666;1016;1016;666|.	G5E9Z1;Q17R98;Q17R98-2;E7ESI8|.	.;ZN827_HUMAN;.;.|.	G|G	1016;666;1016;1015;666|117	ENSP00000421863:E1016G;ENSP00000423130:E666G;ENSP00000368761:E1016G|.	ENSP00000281318:E1015G|.	E|R	-|-	2|1	0|2	ZNF827|ZNF827	146906154|146906154	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	7.168000|7.168000	0.77570|0.77570	2.216000|2.216000	0.71823|0.71823	0.533000|0.533000	0.62120|0.62120	GAG|AGA	.	.	.	none		0.537	ZNF827-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000364654.2	NM_178835	
SLC45A2	51151	hgsc.bcm.edu	37	5	33954590	33954590	+	Nonsense_Mutation	SNP	A	A	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr5:33954590A>T	ENST00000296589.4	-	4	1054	c.908T>A	c.(907-909)tTa>tAa	p.L303*	SLC45A2_ENST00000509381.1_Silent_p.I194I|SLC45A2_ENST00000382102.3_Nonsense_Mutation_p.L303*|SLC45A2_ENST00000345083.5_Nonsense_Mutation_p.L195*|SLC45A2_ENST00000342059.3_Nonsense_Mutation_p.L244*	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	303					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						CAGTGACTTTAATGTCATTGC	0.493																																					p.L303X	Ovarian(31;380 859 8490 22203 49048)	Atlas-SNP	.											.	SLC45A2	100	.	0			c.T908A						PASS	.						183.0	138.0	154.0					5																	33954590		2203	4300	6503	SO:0001587	stop_gained	51151	exon4			GACTTTAATGTCA	AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.908T>A	chr5.hg19:g.33954590A>T	ENSP00000296589:p.Leu303*	114.0	0.0	.		86.0	39.0	.	NM_016180	Q6P2P0|Q9BTM3	Nonsense_Mutation	SNP	ENST00000296589.4	hg19	CCDS3901.1	.	.	.	.	.	.	.	.	.	.	A	33	5.261044	0.95368	.	.	ENSG00000164175	ENST00000296589;ENST00000342059;ENST00000382102;ENST00000510600;ENST00000345083	.	.	.	5.85	5.85	0.93711	.	0.356296	0.35320	N	0.003295	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	-14.0922	16.2291	0.82321	1.0:0.0:0.0:0.0	.	.	.	.	X	303;244;303;128;195	.	ENSP00000296589:L303X	L	-	2	0	SLC45A2	33990347	1.000000	0.71417	1.000000	0.80357	0.375000	0.29983	8.710000	0.91388	2.238000	0.73509	0.528000	0.53228	TTA	.	.	.	none		0.493	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	NM_016180	
DAB2	1601	hgsc.bcm.edu	37	5	39383191	39383191	+	Silent	SNP	A	A	G			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr5:39383191A>G	ENST00000320816.6	-	10	1337	c.870T>C	c.(868-870)ccT>ccC	p.P290P	DAB2_ENST00000339788.6_Intron|DAB2_ENST00000509337.1_Silent_p.P269P|DAB2_ENST00000512525.1_5'Flank|DAB2_ENST00000545653.1_Silent_p.P269P	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	290	Required for localization to clathrin- coated pits. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			GATCAGGATTAGGGGTGGGAA	0.473																																					p.P290P		Atlas-SNP	.											.	DAB2	124	.	0			c.T870C						PASS	.						142.0	148.0	146.0					5																	39383191		2203	4300	6503	SO:0001819	synonymous_variant	1601	exon10			AGGATTAGGGGTG	U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.870T>C	chr5.hg19:g.39383191A>G		162.0	0.0	.		135.0	51.0	.	NM_001343	A6NES5|Q13598|Q9BTY0|Q9UK04	Silent	SNP	ENST00000320816.6	hg19	CCDS34149.1																																																																																			.	.	.	none		0.473	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367014.1	NM_001343	
FTMT	94033	hgsc.bcm.edu	37	5	121187742	121187742	+	Silent	SNP	C	C	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr5:121187742C>A	ENST00000321339.1	+	1	93	c.84C>A	c.(82-84)ctC>ctA	p.L28L		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	28					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		GCTTCGCGCTCCCGCTGCGTT	0.751																																					p.L28L		Atlas-SNP	.											.	FTMT	71	.	0			c.C84A						PASS	.						11.0	13.0	13.0					5																	121187742		2194	4277	6471	SO:0001819	synonymous_variant	94033	exon1			CGCGCTCCCGCTG	BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.84C>A	chr5.hg19:g.121187742C>A		33.0	0.0	.		26.0	12.0	.	NM_177478		Silent	SNP	ENST00000321339.1	hg19	CCDS4128.1																																																																																			.	.	.	none		0.751	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250884.1	NM_177478	
PCDHGB3	56102	hgsc.bcm.edu	37	5	140751854	140751854	+	Silent	SNP	C	C	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr5:140751854C>A	ENST00000576222.1	+	1	2024	c.1893C>A	c.(1891-1893)acC>acA	p.T631T	PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_5'Flank|PCDHGB1_ENST00000523390.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	631	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGCGCGTACCTTGGGCGACA	0.667																																					p.T631T		Atlas-SNP	.											.	PCDHGB3	168	.	0			c.C1893A						PASS	.						37.0	42.0	41.0					5																	140751854		2147	4254	6401	SO:0001819	synonymous_variant	56102	exon1			GCGTACCTTGGGC	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.1893C>A	chr5.hg19:g.140751854C>A		66.0	0.0	.		58.0	25.0	.	NM_018924	A7E229|Q9Y5C7	Silent	SNP	ENST00000576222.1	hg19	CCDS58980.1																																																																																			.	.	.	none		0.667	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924	
WWC1	23286	hgsc.bcm.edu	37	5	167812372	167812372	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr5:167812372A>T	ENST00000265293.4	+	3	888	c.386A>T	c.(385-387)cAg>cTg	p.Q129L	WWC1_ENST00000521089.1_Missense_Mutation_p.Q129L	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	129					cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		CAGGAGTACCAGCAACTGCAT	0.592																																					p.Q129L		Atlas-SNP	.											.	WWC1	98	.	0			c.A386T						PASS	.						84.0	86.0	85.0					5																	167812372		2203	4300	6503	SO:0001583	missense	23286	exon3			AGTACCAGCAACT	AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.386A>T	chr5.hg19:g.167812372A>T	ENSP00000265293:p.Gln129Leu	92.0	0.0	.		68.0	34.0	.	NM_015238	B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Missense_Mutation	SNP	ENST00000265293.4	hg19	CCDS4366.1	.	.	.	.	.	.	.	.	.	.	A	13.16	2.154225	0.38021	.	.	ENSG00000113645	ENST00000265293;ENST00000521089	T;T	0.05580	3.42;3.42	5.62	3.3	0.37823	.	0.091306	0.43579	D	0.000560	T	0.03783	0.0107	N	0.24115	0.695	0.34096	D	0.661339	B;B;B	0.26147	0.143;0.007;0.005	B;B;B	0.29077	0.098;0.013;0.01	T	0.31280	-0.9949	10	0.08599	T	0.76	.	5.7876	0.18343	0.6246:0.0:0.3754:0.0	.	129;35;129	Q8IX03-2;B3KX05;Q8IX03	.;.;KIBRA_HUMAN	L	129	ENSP00000265293:Q129L;ENSP00000427772:Q129L	ENSP00000265293:Q129L	Q	+	2	0	WWC1	167744950	0.998000	0.40836	0.999000	0.59377	0.903000	0.53119	1.318000	0.33643	0.985000	0.38656	0.459000	0.35465	CAG	.	.	.	none		0.592	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252791.2	NM_015238	
MCM3	4172	hgsc.bcm.edu	37	6	52141273	52141273	+	Splice_Site	SNP	T	T	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr6:52141273T>A	ENST00000229854.7	-	9	1243	c.1167A>T	c.(1165-1167)ggA>ggT	p.G389G	MCM3_ENST00000596288.1_Splice_Site_p.G434G|MCM3_ENST00000476448.1_5'UTR|MCM3_ENST00000419835.2_Splice_Site_p.G343G			P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	389	MCM.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	alpha DNA polymerase:primase complex (GO:0005658)|centrosome (GO:0005813)|intracellular membrane-bounded organelle (GO:0043231)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Lung NSC(77;0.0931)					GACGGCGCTCTCCTGGGAAGT	0.507																																					p.G434G		Atlas-SNP	.											.	MCM3	63	.	0			c.A1302T						PASS	.						43.0	40.0	41.0					6																	52141273		2203	4300	6503	SO:0001630	splice_region_variant	4172	exon9			GCGCTCTCCTGGG	X62153	CCDS4940.1, CCDS4940.2, CCDS75468.1	6p12	2008-02-05	2007-04-04		ENSG00000112118	ENSG00000112118			6945	protein-coding gene	gene with protein product		602693	"""minichromosome maintenance deficient (S. cerevisiae) 3"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)"""			1549468	Standard	NM_002388		Approved		uc011dwu.2	P25205	OTTHUMG00000014844	ENST00000229854.7:c.1166-1A>T	chr6.hg19:g.52141273T>A		88.0	0.0	.		68.0	56.0	.	NM_002388	B4DWW4|Q92660|Q9BTR3|Q9NUE7	Silent	SNP	ENST00000229854.7	hg19																																																																																				.	.	.	none		0.507	MCM3-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470784.1		Silent
KIAA1586	57691	hgsc.bcm.edu	37	6	56917572	56917572	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr6:56917572A>C	ENST00000370733.4	+	4	482	c.275A>C	c.(274-276)gAa>gCa	p.E92A	KIAA1586_ENST00000488682.1_3'UTR|KIAA1586_ENST00000545356.1_Missense_Mutation_p.E65A	NM_020931.2	NP_065982.1	Q9HCI6	K1586_HUMAN	KIAA1586	92							nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)	18	Lung NSC(77;0.0969)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			GAAAATAATGAAGTGAGCAAA	0.333																																					p.E92A		Atlas-SNP	.											.	KIAA1586	59	.	0			c.A275C						PASS	.						69.0	69.0	69.0					6																	56917572		2203	4300	6503	SO:0001583	missense	57691	exon4			ATAATGAAGTGAG	AB046806	CCDS34480.1, CCDS69138.1	6p12.1	2014-03-27			ENSG00000168116	ENSG00000168116			21360	protein-coding gene	gene with protein product						10997877	Standard	NM_001286274		Approved		uc003pdj.3	Q9HCI6	OTTHUMG00000014915	ENST00000370733.4:c.275A>C	chr6.hg19:g.56917572A>C	ENSP00000359768:p.Glu92Ala	233.0	0.0	.		176.0	144.0	.	NM_020931	A8K4M3|Q8IW25	Missense_Mutation	SNP	ENST00000370733.4	hg19	CCDS34480.1	.	.	.	.	.	.	.	.	.	.	a	10.12	1.262690	0.23051	.	.	ENSG00000168116	ENST00000370733;ENST00000545356	T;T	0.32988	1.44;1.43	3.87	1.41	0.22369	.	.	.	.	.	T	0.05135	0.0137	N	0.08118	0	0.09310	N	1	B;B	0.12630	0.006;0.006	B;B	0.14023	0.01;0.01	T	0.38478	-0.9659	9	0.62326	D	0.03	.	5.6065	0.17383	0.7671:0.0:0.2329:0.0	.	65;92	F5H2N6;Q9HCI6	.;K1586_HUMAN	A	92;65	ENSP00000359768:E92A;ENSP00000445507:E65A	ENSP00000359768:E92A	E	+	2	0	KIAA1586	57025531	0.182000	0.23173	0.000000	0.03702	0.064000	0.16182	1.360000	0.34125	0.183000	0.20059	0.383000	0.25322	GAA	.	.	.	none		0.333	KIAA1586-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041033.1	NM_020931	
HBS1L	10767	hgsc.bcm.edu	37	6	135358037	135358037	+	Intron	SNP	G	G	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr6:135358037G>C	ENST00000367837.5	-	4	637				HBS1L_ENST00000367820.2_Intron|HBS1L_ENST00000314674.3_Intron|HBS1L_ENST00000415177.2_Intron|HBS1L_ENST00000367822.5_Missense_Mutation_p.L520V|HBS1L_ENST00000445176.2_Intron|HBS1L_ENST00000367826.2_Intron|HBS1L_ENST00000367824.4_Intron	NM_001145158.1|NM_006620.3	NP_001138630.1|NP_006611.1	Q9Y450	HBS1L_HUMAN	HBS1-like translational GTPase						signal transduction (GO:0007165)|translation (GO:0006412)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)	p.L520L(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	20	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)		TTTGAACTTAGAACTTTAGTT	0.368																																					p.L520V		Atlas-SNP	.											HBS1L_ENST00000367822,NS,carcinoma,0,1	HBS1L	75	.	1	Substitution - coding silent(1)	endometrium(1)	c.C1558G						PASS	.						45.0	41.0	42.0					6																	135358037		692	1591	2283	SO:0001627	intron_variant	10767	exon5			AACTTAGAACTTT	U87791	CCDS5173.1, CCDS47479.1, CCDS47480.1	6q23.3	2014-04-30	2014-04-30		ENSG00000112339	ENSG00000112339			4834	protein-coding gene	gene with protein product	"""eRF3 family member"""	612450	"""HBS1 (S. cerevisiae)-like"", ""HBS1-like (S. cerevisiae)"""			9872408, 23667253	Standard	NM_006620		Approved	ERFS, HBS1, HSPC276, KIAA1038, DKFZp434g247, EF-1a, eRF3c	uc003qez.2	Q9Y450	OTTHUMG00000015626	ENST00000367837.5:c.430+2673C>G	chr6.hg19:g.135358037G>C		97.0	0.0	.		120.0	97.0	.	NM_001145207	B7Z365|Q4VX89|Q4VX90|Q5T7G3|Q8NDW9|Q9UPW3	Missense_Mutation	SNP	ENST00000367837.5	hg19	CCDS5173.1	.	.	.	.	.	.	.	.	.	.	G	2.970	-0.212719	0.06140	.	.	ENSG00000112339	ENST00000367822	.	.	.	5.32	-2.6	0.06190	.	.	.	.	.	T	0.20047	0.0482	.	.	.	0.43885	D	0.996509	B	0.12630	0.006	B	0.16289	0.015	T	0.19647	-1.0299	7	0.59425	D	0.04	.	0.8108	0.01093	0.2713:0.3313:0.174:0.2234	.	520	Q9Y450-2	.	V	520	.	ENSP00000356796:L520V	L	-	1	2	HBS1L	135399730	0.010000	0.17322	0.359000	0.25824	0.108000	0.19459	-0.189000	0.09629	-0.497000	0.06641	0.655000	0.94253	CTA	.	.	.	none		0.368	HBS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042339.2		
PCLO	27445	hgsc.bcm.edu	37	7	82578940	82578940	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr7:82578940T>G	ENST00000333891.9	-	6	11301	c.10964A>C	c.(10963-10965)aAa>aCa	p.K3655T	PCLO_ENST00000423517.2_Missense_Mutation_p.K3655T|PCLO_ENST00000437081.1_Missense_Mutation_p.K375T	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ATGCAGTACTTTCTGTGGACT	0.473																																					p.K3655T		Atlas-SNP	.											.	PCLO	1506	.	0			c.A10964C						PASS	.						188.0	183.0	185.0					7																	82578940		1919	4123	6042	SO:0001583	missense	27445	exon6			AGTACTTTCTGTG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.10964A>C	chr7.hg19:g.82578940T>G	ENSP00000334319:p.Lys3655Thr	111.0	0.0	.		150.0	75.0	.	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	11.43	1.635879	0.29068	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.26810	1.71;1.72	5.7	5.7	0.88788	.	.	.	.	.	T	0.50205	0.1602	M	0.72118	2.19	0.39015	D	0.959633	P;D;D	0.76494	0.608;0.999;0.999	B;D;D	0.67382	0.244;0.951;0.951	T	0.56798	-0.7919	9	0.87932	D	0	.	15.9619	0.79936	0.0:0.0:0.0:1.0	.	3586;3655;3655	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	T	3586;3655;3655;375	ENSP00000334319:K3655T;ENSP00000388393:K3655T	ENSP00000334319:K3655T	K	-	2	0	PCLO	82416876	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.689000	0.61723	2.167000	0.68274	0.528000	0.53228	AAA	.	.	.	none		0.473	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
SLC4A2	6522	hgsc.bcm.edu	37	7	150773188	150773188	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr7:150773188T>C	ENST00000485713.1	+	22	4600	c.3560T>C	c.(3559-3561)cTg>cCg	p.L1187P	SLC4A2_ENST00000461735.1_Missense_Mutation_p.L1173P|FASTK_ENST00000489884.1_5'Flank|SLC4A2_ENST00000392826.2_Missense_Mutation_p.L1178P|RP11-148K1.12_ENST00000485974.1_RNA|SLC4A2_ENST00000413384.2_Missense_Mutation_p.L1187P|SLC4A2_ENST00000310317.5_Missense_Mutation_p.L1105P	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	1187	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCTGCCTCCCTGGCCTTCCCC	0.642																																					p.L1187P		Atlas-SNP	.											.	SLC4A2	98	.	0			c.T3560C						PASS	.						106.0	100.0	102.0					7																	150773188		2203	4300	6503	SO:0001583	missense	6522	exon22			CCTCCCTGGCCTT		CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.3560T>C	chr7.hg19:g.150773188T>C	ENSP00000419412:p.Leu1187Pro	44.0	0.0	.		84.0	41.0	.	NM_003040	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	ENST00000485713.1	hg19	CCDS5917.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.466972	0.84425	.	.	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000009	T	0.80497	0.4634	M	0.82823	2.61	0.80722	D	1	D;D;D	0.89917	0.969;1.0;1.0	P;D;D	0.91635	0.828;0.999;0.997	D	0.83661	0.0161	10	0.87932	D	0	.	14.5667	0.68182	0.0:0.0:0.0:1.0	.	1178;1173;1187	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	P	1187;1187;1105;1178;1173	ENSP00000419412:L1187P;ENSP00000405600:L1187P;ENSP00000311402:L1105P;ENSP00000376571:L1178P;ENSP00000419164:L1173P	ENSP00000311402:L1105P	L	+	2	0	SLC4A2	150404121	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.125000	0.65367	0.533000	0.62120	CTG	.	.	.	none		0.642	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040	
AP3M2	10947	hgsc.bcm.edu	37	8	42015584	42015584	+	Silent	SNP	C	C	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr8:42015584C>T	ENST00000518421.1	+	4	690	c.399C>T	c.(397-399)ctC>ctT	p.L133L	AP3M2_ENST00000520685.1_Intron|AP3M2_ENST00000174653.3_Silent_p.L133L|AP3M2_ENST00000517922.1_Silent_p.L133L|AP3M2_ENST00000396926.3_Silent_p.L133L	NM_001134296.1	NP_001127768.1	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit	133					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|stomach(1)	17	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)			TTAAAGAACTCATAAAGCCTC	0.458																																					p.L133L		Atlas-SNP	.											.	AP3M2	41	.	0			c.C399T						PASS	.						150.0	137.0	142.0					8																	42015584		2203	4300	6503	SO:0001819	synonymous_variant	10947	exon4			AGAACTCATAAAG	D38293	CCDS6125.1	8p11.2	2008-07-07			ENSG00000070718	ENSG00000070718			570	protein-coding gene	gene with protein product		610469				7601449	Standard	NM_006803		Approved	CLA20, AP47B	uc003xoo.3	P53677	OTTHUMG00000164060	ENST00000518421.1:c.399C>T	chr8.hg19:g.42015584C>T		101.0	0.0	.		90.0	35.0	.	NM_001134296	B2RCR0|D3DSY2|Q7Z472	Silent	SNP	ENST00000518421.1	hg19	CCDS6125.1																																																																																			.	.	.	none		0.458	AP3M2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376996.1		
ARMC1	55156	hgsc.bcm.edu	37	8	66517664	66517664	+	Missense_Mutation	SNP	T	T	G	rs561352733		TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr8:66517664T>G	ENST00000276569.3	-	5	819	c.575A>C	c.(574-576)aAa>aCa	p.K192T	ARMC1_ENST00000458464.2_Missense_Mutation_p.K90T	NM_018120.4	NP_060590.1	Q9NVT9	ARMC1_HUMAN	armadillo repeat containing 1	192					metal ion transport (GO:0030001)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(1)|lung(8)|skin(1)	14			Epithelial(68;0.103)|OV - Ovarian serous cystadenocarcinoma(28;0.235)			TACCTCAGCTTTCAAATCTGA	0.333																																					p.K192T		Atlas-SNP	.											.	ARMC1	22	.	0			c.A575C						PASS	.						73.0	74.0	73.0					8																	66517664		2203	4300	6503	SO:0001583	missense	55156	exon5			TCAGCTTTCAAAT	BC011607	CCDS6181.1, CCDS69490.1	8q12.3	2013-02-14			ENSG00000104442	ENSG00000104442		"""Armadillo repeat containing"""	17684	protein-coding gene	gene with protein product							Standard	XM_005251264		Approved	FLJ10511, Arcp	uc003xvl.3	Q9NVT9	OTTHUMG00000164374	ENST00000276569.3:c.575A>C	chr8.hg19:g.66517664T>G	ENSP00000276569:p.Lys192Thr	209.0	0.0	.		201.0	86.0	.	NM_018120	B4E2W7|Q9H018|Q9H820	Missense_Mutation	SNP	ENST00000276569.3	hg19	CCDS6181.1	.	.	.	.	.	.	.	.	.	.	T	14.85	2.659799	0.47572	.	.	ENSG00000104442	ENST00000276569;ENST00000458464	T;T	0.45668	0.89;0.89	5.36	5.36	0.76844	Heavy metal-associated domain, HMA (1);	0.043521	0.85682	D	0.000000	T	0.38161	0.1030	L	0.52573	1.65	0.58432	D	0.999999	B;B	0.31318	0.319;0.087	B;B	0.26416	0.069;0.018	T	0.20240	-1.0281	10	0.39692	T	0.17	.	15.366	0.74523	0.0:0.0:0.0:1.0	.	90;192	B4E2W7;Q9NVT9	.;ARMC1_HUMAN	T	192;90	ENSP00000276569:K192T;ENSP00000388572:K90T	ENSP00000276569:K192T	K	-	2	0	ARMC1	66680218	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.835000	0.69368	2.028000	0.59812	0.454000	0.30748	AAA	.	.	.	none		0.333	ARMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378480.1	NM_018120	
TLN1	7094	hgsc.bcm.edu	37	9	35697810	35697810	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr9:35697810G>T	ENST00000314888.9	-	57	7957	c.7604C>A	c.(7603-7605)tCa>tAa	p.S2535*	TLN1_ENST00000540444.1_Nonsense_Mutation_p.S2423*	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	2535					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TCGAAGCTCTGAAGGCAGAAA	0.552											OREG0019174	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S2535X		Atlas-SNP	.											.	TLN1	185	.	0			c.C7604A						PASS	.						90.0	88.0	89.0					9																	35697810		2203	4300	6503	SO:0001587	stop_gained	7094	exon57			AGCTCTGAAGGCA	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.7604C>A	chr9.hg19:g.35697810G>T	ENSP00000316029:p.Ser2535*	97.0	0.0	.	857	84.0	45.0	.	NM_006289	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Nonsense_Mutation	SNP	ENST00000314888.9	hg19	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	G	50	16.117539	0.99854	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	.	.	.	5.23	5.23	0.72850	.	0.380728	0.27826	N	0.017689	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.3191	18.9866	0.92773	0.0:0.0:1.0:0.0	.	.	.	.	X	2535;2423	.	ENSP00000316029:S2535X	S	-	2	0	TLN1	35687810	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	7.629000	0.83207	2.721000	0.93114	0.563000	0.77884	TCA	.	.	.	none		0.552	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
C9orf3	84909	hgsc.bcm.edu	37	9	97522664	97522664	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr9:97522664G>C	ENST00000375315.2	+	1	599	c.599G>C	c.(598-600)aGg>aCg	p.R200T	C9orf3_ENST00000277198.2_Missense_Mutation_p.R200T|C9orf3_ENST00000297979.5_Missense_Mutation_p.R200T	NM_001193329.1	NP_001180258.1	Q8N6M6	AMPO_HUMAN	chromosome 9 open reading frame 3	200					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		AATCGTTGGAGGGAGCAGTTA	0.498																																					p.R200T		Atlas-SNP	.											.	C9orf3	100	.	0			c.G599C						PASS	.						84.0	74.0	77.0					9																	97522664		2203	4300	6503	SO:0001583	missense	84909	exon2			GTTGGAGGGAGCA	AF043896	CCDS6713.1, CCDS55327.1, CCDS55328.1	9q22	2013-06-27			ENSG00000148120	ENSG00000148120			1361	protein-coding gene	gene with protein product	aminopeptidase O					15687497	Standard	NM_001193329		Approved	C90RF3, FLJ14675, APO, AOPEP, AP-O	uc004ava.3	Q8N6M6	OTTHUMG00000020276	ENST00000375315.2:c.599G>C	chr9.hg19:g.97522664G>C	ENSP00000364464:p.Arg200Thr	73.0	0.0	.		52.0	19.0	.	NM_001193331	Q5T9B1|Q5T9B3|Q5T9B4|Q8WUL6|Q96M23|Q96SS1	Missense_Mutation	SNP	ENST00000375315.2	hg19	CCDS55328.1	.	.	.	.	.	.	.	.	.	.	G	13.25	2.180287	0.38511	.	.	ENSG00000148120	ENST00000277198;ENST00000297979;ENST00000375315;ENST00000427193;ENST00000424143	T;T;T;T;T	0.25912	2.56;2.54;2.75;1.77;2.58	4.69	3.79	0.43588	.	0.205241	0.40818	N	0.001006	T	0.33265	0.0857	L	0.60455	1.87	0.80722	D	1	P;D;P;P	0.62365	0.745;0.991;0.763;0.9	B;P;P;P	0.56434	0.276;0.798;0.463;0.65	T	0.06881	-1.0802	10	0.49607	T	0.09	-17.7167	4.3309	0.11062	0.3002:0.0:0.6998:0.0	.	200;200;200;200	Q8N6M6;Q8N6M6-4;Q8N6M6-2;Q8N6M6-3	AMPO_HUMAN;.;.;.	T	200;200;200;74;23	ENSP00000277198:R200T;ENSP00000297979:R200T;ENSP00000364464:R200T;ENSP00000387736:R74T;ENSP00000402171:R23T	ENSP00000277198:R200T	R	+	2	0	C9orf3	96562485	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	1.756000	0.38390	2.591000	0.87537	0.467000	0.42956	AGG	.	.	.	none		0.498	C9orf3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032823	
TTLL11	158135	hgsc.bcm.edu	37	9	124751966	124751966	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr9:124751966G>C	ENST00000373776.3	-	4	1234	c.1047C>G	c.(1045-1047)atC>atG	p.I349M	TTLL11_ENST00000321582.5_Missense_Mutation_p.I349M|TTLL11_ENST00000474723.1_5'UTR	NM_194252.2	NP_919228.2	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11	349	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(3)|skin(1)	18						TAATGAGGTAGATTCCATCAC	0.532																																					p.I349M		Atlas-SNP	.											.	TTLL11	67	.	0			c.C1047G						PASS	.						113.0	121.0	118.0					9																	124751966		2203	4300	6503	SO:0001583	missense	158135	exon4			GAGGTAGATTCCA	AF521886	CCDS6834.2, CCDS48012.1	9q34.11	2013-02-14	2005-07-28	2005-07-28	ENSG00000175764	ENSG00000175764		"""Tubulin tyrosine ligase-like family"""	18113	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 20"""	C9orf20		15890843	Standard	NM_001139442		Approved	bA244O19.1	uc011lyl.2	Q8NHH1	OTTHUMG00000020597	ENST00000373776.3:c.1047C>G	chr9.hg19:g.124751966G>C	ENSP00000362881:p.Ile349Met	109.0	0.0	.		78.0	27.0	.	NM_001139442		Missense_Mutation	SNP	ENST00000373776.3	hg19	CCDS6834.2	.	.	.	.	.	.	.	.	.	.	G	21.3	4.133337	0.77662	.	.	ENSG00000175764	ENST00000321582;ENST00000373776	T;T	0.14144	2.53;2.53	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.48484	0.1502	M	0.92784	3.345	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.62982	-0.6738	10	0.87932	D	0	.	17.1382	0.86745	0.0:0.0:1.0:0.0	.	349;349	F8W6M1;Q8NHH1	.;TTL11_HUMAN	M	349	ENSP00000321346:I349M;ENSP00000362881:I349M	ENSP00000321346:I349M	I	-	3	3	TTLL11	123791787	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.472000	0.97709	2.283000	0.76528	0.549000	0.68633	ATC	.	.	.	none		0.532	TTLL11-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053907.1	XM_088486	
DNA2	1763	hgsc.bcm.edu	37	10	70182647	70182647	+	Splice_Site	SNP	G	G	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr10:70182647G>T	ENST00000358410.3	-	15	2259	c.2209C>A	c.(2209-2211)Ctt>Att	p.L737I	DNA2_ENST00000399179.2_Intron|DNA2_ENST00000399180.2_Splice_Site_p.L823I	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	737	Helicase activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						GCAACTATAAGCTAAAAACAA	0.294																																					p.L737I		Atlas-SNP	.											.	DNA2	76	.	0			c.C2209A						PASS	.						33.0	33.0	33.0					10																	70182647		1795	4064	5859	SO:0001630	splice_region_variant	1763	exon15			CTATAAGCTAAAA	D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.2209-1C>A	chr10.hg19:g.70182647G>T		138.0	0.0	.		170.0	108.0	.	NM_001080449	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Missense_Mutation	SNP	ENST00000358410.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.90|14.90	2.673086|2.673086	0.47781|0.47781	.|.	.|.	ENSG00000138346|ENSG00000138346	ENST00000399180;ENST00000358410|ENST00000440722	D;D|.	0.81996|.	-1.56;-1.56|.	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	0.805718|.	0.11759|.	N|.	0.532301|.	T|T	0.71239|0.71239	0.3316|0.3316	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	B|.	0.20459|.	0.045|.	B|.	0.23716|.	0.048|.	T|T	0.66905|0.66905	-0.5805|-0.5805	10|5	0.27785|.	T|.	0.31|.	.|.	18.2358|18.2358	0.89949|0.89949	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	737|.	P51530|.	DNA2L_HUMAN|.	I|N	823;737|58	ENSP00000382133:L823I;ENSP00000351185:L737I|.	ENSP00000351185:L737I|.	L|T	-|-	1|2	0|0	DNA2|DNA2	69852653|69852653	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	6.533000|6.533000	0.73829|0.73829	2.754000|2.754000	0.94517|0.94517	0.585000|0.585000	0.79938|0.79938	CTT|ACT	.	.	.	none		0.294	DNA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048334.2		Missense_Mutation
TET1	80312	hgsc.bcm.edu	37	10	70432683	70432683	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr10:70432683G>C	ENST00000373644.4	+	8	4914	c.4705G>C	c.(4705-4707)Gag>Cag	p.E1569Q		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1569					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						AATTGATCCAGAGACTTGTGG	0.393																																					p.E1569Q		Atlas-SNP	.											.	TET1	255	.	0			c.G4705C						PASS	.						231.0	213.0	219.0					10																	70432683		2203	4300	6503	SO:0001583	missense	80312	exon8			GATCCAGAGACTT	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.4705G>C	chr10.hg19:g.70432683G>C	ENSP00000362748:p.Glu1569Gln	89.0	0.0	.		96.0	54.0	.	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	hg19	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.873167	0.51695	.	.	ENSG00000138336	ENST00000373644;ENST00000545846	T	0.09163	3.01	5.35	3.02	0.34903	TET cysteine-rich domain (1);	0.315805	0.34133	N	0.004223	T	0.09379	0.0231	L	0.43923	1.385	0.34559	D	0.71219	B	0.20671	0.047	B	0.21917	0.037	T	0.09552	-1.0669	10	0.52906	T	0.07	.	6.1008	0.20045	0.1921:0.1458:0.6621:0.0	.	1569	Q8NFU7	TET1_HUMAN	Q	1569;41	ENSP00000362748:E1569Q	ENSP00000362748:E1569Q	E	+	1	0	TET1	70102689	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	6.613000	0.74192	0.471000	0.27319	0.585000	0.79938	GAG	.	.	.	none		0.393	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
NEUROG3	50674	hgsc.bcm.edu	37	10	71332496	71332496	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr10:71332496C>T	ENST00000242462.4	-	2	333	c.304G>A	c.(304-306)Gca>Aca	p.A102T		NM_020999.3	NP_066279.2	Q9Y4Z2	NGN3_HUMAN	neurogenin 3	102	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				central nervous system development (GO:0007417)|endocrine pancreas development (GO:0031018)|epithelial cell differentiation (GO:0030855)|forebrain development (GO:0030900)|hindbrain development (GO:0030902)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|peripheral nervous system development (GO:0007422)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of dendrite morphogenesis (GO:0048814)|spinal cord development (GO:0021510)|transdifferentiation (GO:0060290)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription coactivator activity (GO:0003713)			endometrium(4)|large_intestine(2)|lung(6)|prostate(1)	13						GCGTCCAGTGCCGAGTTGAGG	0.632																																					p.A102T		Atlas-SNP	.											.	NEUROG3	33	.	0			c.G304A						PASS	.						100.0	65.0	77.0					10																	71332496		2203	4300	6503	SO:0001583	missense	50674	exon2			CCAGTGCCGAGTT	AJ133776	CCDS31212.1	10q21.3	2013-05-21			ENSG00000122859	ENSG00000122859		"""Basic helix-loop-helix proteins"""	13806	protein-coding gene	gene with protein product		604882				9000438, 10677506	Standard	NM_020999		Approved	Atoh5, Math4B, ngn3, bHLHa7	uc001jpp.3	Q9Y4Z2	OTTHUMG00000018391	ENST00000242462.4:c.304G>A	chr10.hg19:g.71332496C>T	ENSP00000242462:p.Ala102Thr	124.0	0.0	.		103.0	53.0	.	NM_020999	Q5VVI0|Q6DJX6|Q9BY24	Missense_Mutation	SNP	ENST00000242462.4	hg19	CCDS31212.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.671709	0.88348	.	.	ENSG00000122859	ENST00000242462	D	0.98329	-4.87	4.53	4.53	0.55603	Helix-loop-helix DNA-binding (5);	0.000000	0.40728	N	0.001030	D	0.98982	0.9653	M	0.92649	3.33	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	D	0.99267	1.0892	10	0.87932	D	0	-15.9262	10.508	0.44845	0.0:0.9052:0.0:0.0948	.	102	Q9Y4Z2	NGN3_HUMAN	T	102	ENSP00000242462:A102T	ENSP00000242462:A102T	A	-	1	0	NEUROG3	71002502	1.000000	0.71417	0.932000	0.37286	0.710000	0.40934	5.808000	0.69165	2.307000	0.77673	0.591000	0.81541	GCA	.	.	.	none		0.632	NEUROG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048464.1	NM_020999	
DUPD1	338599	hgsc.bcm.edu	37	10	76818209	76818209	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr10:76818209G>A	ENST00000338487.5	-	1	63	c.64C>T	c.(64-66)Ccg>Tcg	p.P22S		NM_001003892.1	NP_001003892.1	Q68J44	DUPD1_HUMAN	dual specificity phosphatase and pro isomerase domain containing 1	22					protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(2)|lung(5)|ovary(2)|urinary_tract(1)	11	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					TCCATCTTCGGCGACAGCCTC	0.552																																					p.P22S		Atlas-SNP	.											.	DUPD1	30	.	0			c.C64T						PASS	.						86.0	79.0	82.0					10																	76818209		2203	4300	6503	SO:0001583	missense	338599	exon1			TCTTCGGCGACAG		CCDS31223.1	10q22.3	2011-06-09			ENSG00000188716	ENSG00000188716		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	23481	protein-coding gene	gene with protein product							Standard	NM_001003892		Approved	DUSP27	uc001jwq.1	Q68J44	OTTHUMG00000018512	ENST00000338487.5:c.64C>T	chr10.hg19:g.76818209G>A	ENSP00000340609:p.Pro22Ser	56.0	0.0	.		79.0	45.0	.	NM_001003892	B2RP93	Missense_Mutation	SNP	ENST00000338487.5	hg19	CCDS31223.1	.	.	.	.	.	.	.	.	.	.	G	2.665	-0.278797	0.05642	.	.	ENSG00000188716	ENST00000338487	T	0.04758	3.56	3.74	0.838	0.18902	.	4.428410	0.00520	N	0.000188	T	0.04318	0.0119	N	0.22421	0.69	0.09310	N	1	B	0.26635	0.155	B	0.25405	0.06	T	0.37291	-0.9712	10	0.32370	T	0.25	-4.5968	4.2727	0.10794	0.2154:0.1879:0.5966:0.0	.	22	Q68J44	DUPD1_HUMAN	S	22	ENSP00000340609:P22S	ENSP00000340609:P22S	P	-	1	0	DUPD1	76488215	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.474000	0.22148	0.191000	0.20236	-0.244000	0.11960	CCG	.	.	.	none		0.552	DUPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048777.2	XM_291741	
BTRC	8945	hgsc.bcm.edu	37	10	103294516	103294516	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr10:103294516G>C	ENST00000370187.3	+	10	1314	c.1196G>C	c.(1195-1197)tGc>tCc	p.C399S	BTRC_ENST00000393441.4_Missense_Mutation_p.C358S|BTRC_ENST00000408038.2_Missense_Mutation_p.C363S	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	399					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		ATGGTGACCTGCTCCAAAGAT	0.483																																					p.C399S		Atlas-SNP	.											.	BTRC	64	.	0			c.G1196C						PASS	.						288.0	229.0	249.0					10																	103294516		2203	4300	6503	SO:0001583	missense	8945	exon10			TGACCTGCTCCAA	Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.1196G>C	chr10.hg19:g.103294516G>C	ENSP00000359206:p.Cys399Ser	128.0	0.0	.		133.0	35.0	.	NM_033637	B5MD49|Q5W141|Q5W142|Q9Y213	Missense_Mutation	SNP	ENST00000370187.3	hg19	CCDS7512.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.760650	0.89932	.	.	ENSG00000166167	ENST00000370187;ENST00000393441;ENST00000408038	T;T;T	0.58797	0.31;0.31;0.31	5.51	5.51	0.81932	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.196293	0.46758	D	0.000272	T	0.71685	0.3369	L	0.45744	1.44	0.80722	D	1	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.91635	0.969;0.991;0.999	T	0.69431	-0.5147	10	0.41790	T	0.15	-9.4875	19.4137	0.94687	0.0:0.0:1.0:0.0	.	373;363;399	B7Z3H4;Q9Y297-2;Q9Y297	.;.;FBW1A_HUMAN	S	399;358;363	ENSP00000359206:C399S;ENSP00000377088:C358S;ENSP00000385339:C363S	ENSP00000359206:C399S	C	+	2	0	BTRC	103284506	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.597000	0.87782	0.655000	0.94253	TGC	.	.	.	none		0.483	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049936.1	NM_033637	
FTH1	2495	hgsc.bcm.edu	37	11	61732247	61732247	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr11:61732247T>G	ENST00000273550.7	-	4	738	c.504A>C	c.(502-504)gaA>gaC	p.E168D	BEST1_ENST00000449131.2_3'UTR|FTH1_ENST00000532601.1_Missense_Mutation_p.E98D|FTH1_ENST00000529191.1_Intron|FTH1_ENST00000529631.1_Intron|FTH1_ENST00000526640.1_Missense_Mutation_p.E138D	NM_002032.2	NP_002023.2	P02794	FRIH_HUMAN	ferritin, heavy polypeptide 1	168					cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|intracellular sequestering of iron ion (GO:0006880)|iron ion transport (GO:0006826)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|post-Golgi vesicle-mediated transport (GO:0006892)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular ferritin complex (GO:0008043)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)|iron ion binding (GO:0005506)			NS(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8					Iron Dextran(DB00893)	CAAAGAGATATTCCGCCAAGC	0.522																																					p.E168D		Atlas-SNP	.											.	FTH1	18	.	0			c.A504C						PASS	.						57.0	55.0	55.0					11																	61732247		1872	4092	5964	SO:0001583	missense	2495	exon4			GAGATATTCCGCC		CCDS41655.1	11q13	2012-10-02			ENSG00000167996	ENSG00000167996			3976	protein-coding gene	gene with protein product	"""apoferritin"", ""placenta immunoregulatory factor"", ""proliferation-inducing protein 15"""	134770		FTHL6		3020541	Standard	NM_002032		Approved	FTH, PLIF, PIG15, FHC	uc001nsu.3	P02794		ENST00000273550.7:c.504A>C	chr11.hg19:g.61732247T>G	ENSP00000273550:p.Glu168Asp	343.0	0.0	.		289.0	114.0	.	NM_002032	B3KNR5|Q3KRA8|Q3SWW1	Missense_Mutation	SNP	ENST00000273550.7	hg19	CCDS41655.1	.	.	.	.	.	.	.	.	.	.	.	14.79	2.640495	0.47153	.	.	ENSG00000167996	ENST00000273550;ENST00000406545;ENST00000526640;ENST00000532601	T;T;T	0.71103	-0.54;-0.54;-0.54	5.13	0.569	0.17340	Ferritin/ribonucleotide reductase-like (1);Ferritin-related (1);	0.000000	0.85682	D	0.000000	T	0.75072	0.3800	M	0.92649	3.33	0.54753	D	0.999983	B	0.10296	0.003	B	0.21546	0.035	T	0.72469	-0.4284	10	0.66056	D	0.02	.	10.9125	0.47116	0.0:0.697:0.0:0.303	.	168	P02794	FRIH_HUMAN	D	168;217;138;98	ENSP00000273550:E168D;ENSP00000433321:E138D;ENSP00000435111:E98D	ENSP00000273550:E168D	E	-	3	2	FTH1	61488823	1.000000	0.71417	0.992000	0.48379	0.907000	0.53573	0.791000	0.26915	0.064000	0.16427	-1.670000	0.00746	GAA	.	.	.	none		0.522	FTH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388444.1	NM_002032	
MRPL49	740	hgsc.bcm.edu	37	11	64892052	64892052	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr11:64892052C>T	ENST00000279242.2	+	2	176	c.157C>T	c.(157-159)Ccg>Tcg	p.P53S	FAU_ENST00000529639.1_5'Flank|FAU_ENST00000525297.1_5'Flank|FAU_ENST00000279259.3_5'Flank|FAU_ENST00000527548.1_5'Flank|MRPL49_ENST00000524482.1_3'UTR|FAU_ENST00000529259.1_5'Flank|MRPL49_ENST00000531705.1_Missense_Mutation_p.P53S|MRPL49_ENST00000534078.1_Intron|FAU_ENST00000531743.1_5'Flank|MRPL49_ENST00000526171.1_Missense_Mutation_p.P53S|FAU_ENST00000434372.2_5'Flank	NM_004927.3	NP_004918.1	Q13405	RM49_HUMAN	mitochondrial ribosomal protein L49	53					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)			endometrium(1)|ovary(1)	2						GCGCCTGTTACCGGCTACCAG	0.532																																					p.P53S		Atlas-SNP	.											.	MRPL49	5	.	0			c.C157T						PASS	.						95.0	95.0	95.0					11																	64892052		2201	4297	6498	SO:0001583	missense	740	exon2			CTGTTACCGGCTA		CCDS8096.1	11q13.1	2012-11-14	2001-10-16	2001-10-19	ENSG00000149792	ENSG00000149792		"""Mitochondrial ribosomal proteins / large subunits"""	1176	protein-coding gene	gene with protein product	"""neighbor of FAU"", ""next to FAU"""	606866	"""chromosome 11 open reading frame 4"""	C11orf4		8786148	Standard	NM_004927		Approved	NOF, NOF1, L49mt	uc001oda.2	Q13405	OTTHUMG00000165608	ENST00000279242.2:c.157C>T	chr11.hg19:g.64892052C>T	ENSP00000279242:p.Pro53Ser	169.0	0.0	.		129.0	61.0	.	NM_004927	B2R4G6	Missense_Mutation	SNP	ENST00000279242.2	hg19	CCDS8096.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.428742	0.83667	.	.	ENSG00000149792	ENST00000526171;ENST00000279242;ENST00000531705	T;T;T	0.61274	0.63;0.66;0.12	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.77605	0.4155	M	0.81341	2.54	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78650	-0.2121	10	0.51188	T	0.08	-14.1545	17.02	0.86431	0.0:1.0:0.0:0.0	.	53	Q13405	RM49_HUMAN	S	53	ENSP00000437177:P53S;ENSP00000279242:P53S;ENSP00000436740:P53S	ENSP00000279242:P53S	P	+	1	0	MRPL49	64648628	1.000000	0.71417	0.999000	0.59377	0.546000	0.35178	6.539000	0.73856	2.632000	0.89209	0.655000	0.94253	CCG	.	.	.	none		0.532	MRPL49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385293.1	NM_004927	
C11orf54	28970	hgsc.bcm.edu	37	11	93494797	93494797	+	Silent	SNP	A	A	G			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr11:93494797A>G	ENST00000331239.4	+	9	1070	c.891A>G	c.(889-891)gcA>gcG	p.A297A	C11orf54_ENST00000528288.1_Silent_p.A247A|C11orf54_ENST00000528099.1_Silent_p.A297A|C11orf54_ENST00000354421.3_Silent_p.A297A|C11orf54_ENST00000540113.1_Silent_p.A278A			Q9H0W9	CK054_HUMAN	chromosome 11 open reading frame 54	297					metabolic process (GO:0008152)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|large_intestine(1)|lung(5)	8		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TCTTACCTGCAGAGTTTCTCT	0.363																																					p.A247A		Atlas-SNP	.											.	C11orf54	23	.	0			c.A741G						PASS	.						132.0	120.0	124.0					11																	93494797		2201	4298	6499	SO:0001819	synonymous_variant	28970	exon8			ACCTGCAGAGTTT	AF092133	CCDS8294.1, CCDS66204.1, CCDS73365.1, CCDS73366.1	11q21	2012-08-09			ENSG00000182919	ENSG00000182919			30204	protein-coding gene	gene with protein product		615810				16522806	Standard	NM_014039		Approved	PTD012	uc001pef.3	Q9H0W9	OTTHUMG00000167452	ENST00000331239.4:c.891A>G	chr11.hg19:g.93494797A>G		123.0	0.0	.		104.0	45.0	.	NM_014039	A8K850|Q6FI88|Q6XYB0|Q96EI3|Q96IX1|Q9Y6B4	Silent	SNP	ENST00000331239.4	hg19																																																																																				.	.	.	none		0.363	C11orf54-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394671.1	NM_014039	
GPR19	2842	hgsc.bcm.edu	37	12	12814283	12814283	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr12:12814283G>C	ENST00000540510.1	-	2	1292	c.1100C>G	c.(1099-1101)gCc>gGc	p.A367G	GPR19_ENST00000332427.2_Missense_Mutation_p.A367G			P46093	GPR4_HUMAN	G protein-coupled receptor 19	329					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.048)		GTTTTTTTTGGCCATCCTTGA	0.393																																					p.A367G		Atlas-SNP	.											.	GPR19	47	.	0			c.C1100G						PASS	.						197.0	183.0	188.0					12																	12814283		2203	4300	6503	SO:0001583	missense	2842	exon4			TTTTTGGCCATCC		CCDS8652.1	12p12.3	2014-01-30				ENSG00000183150		"""GPCR / Class A : Orphans"""	4473	protein-coding gene	gene with protein product		602927					Standard	NM_006143		Approved		uc001raq.2	Q15760		ENST00000540510.1:c.1100C>G	chr12.hg19:g.12814283G>C	ENSP00000441832:p.Ala367Gly	120.0	0.0	.		125.0	41.0	.	NM_006143	A8K3T3|B0M0K1|Q6NWM4	Missense_Mutation	SNP	ENST00000540510.1	hg19	CCDS8652.1	.	.	.	.	.	.	.	.	.	.	G	16.19	3.053890	0.55218	.	.	ENSG00000183150	ENST00000540510;ENST00000332427	T;T	0.69306	-0.39;-0.39	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.69922	0.3165	N	0.14661	0.345	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.69101	-0.5234	10	0.29301	T	0.29	-24.4311	19.3003	0.94141	0.0:0.0:1.0:0.0	.	367	Q15760	GPR19_HUMAN	G	367	ENSP00000441832:A367G;ENSP00000333744:A367G	ENSP00000333744:A367G	A	-	2	0	GPR19	12705550	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.858000	0.99539	2.658000	0.90341	0.650000	0.86243	GCC	.	.	.	none		0.393	GPR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400662.1	NM_006143	
IPO8	10526	hgsc.bcm.edu	37	12	30792466	30792466	+	Silent	SNP	A	A	G			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr12:30792466A>G	ENST00000256079.4	-	21	2810	c.2472T>C	c.(2470-2472)gaT>gaC	p.D824D	IPO8_ENST00000544829.1_Silent_p.D619D	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	824					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					AACAATCTGTATCATTCATCC	0.343																																					p.D824D		Atlas-SNP	.											.	IPO8	105	.	0			c.T2472C						PASS	.						122.0	113.0	116.0					12																	30792466		2203	4300	6503	SO:0001819	synonymous_variant	10526	exon21			ATCTGTATCATTC	U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.2472T>C	chr12.hg19:g.30792466A>G		166.0	0.0	.		184.0	62.0	.	NM_006390	B7Z7M3	Silent	SNP	ENST00000256079.4	hg19	CCDS8719.1																																																																																			.	.	.	none		0.343	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402700.2	NM_006390	
MTIF3	219402	hgsc.bcm.edu	37	13	28006937	28006937	+	IGR	SNP	C	C	G			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr13:28006937C>G	ENST00000381116.1	-	0	1104				GTF3A_ENST00000381140.4_Missense_Mutation_p.H186Q|MTIF3_ENST00000461838.1_5'Flank|GTF3A_ENST00000470606.1_3'UTR			Q9H2K0	IF3M_HUMAN	mitochondrial translational initiation factor 3						formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	7		Lung SC(185;0.0161)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.108)|OV - Ovarian serous cystadenocarcinoma(117;0.157)		CCAAGGCCCACGAGGGTGTGT	0.537																																					p.H186Q		Atlas-SNP	.											GTF3A,NS,carcinoma,0,1	GTF3A	11	.	0			c.C558G						PASS	.						51.0	46.0	47.0					13																	28006937		1568	3582	5150	SO:0001628	intergenic_variant	2971	exon5			GGCCCACGAGGGT	BC046166	CCDS9322.1	13q12.2	2007-05-03			ENSG00000122033	ENSG00000122033			29788	protein-coding gene	gene with protein product						12095986	Standard	NM_152912		Approved	IF-3mt, IF3(mt)	uc001uri.3	Q9H2K0	OTTHUMG00000016633		chr13.hg19:g.28006937C>G		155.0	0.0	.		140.0	54.0	.	NM_002097	Q05BL8|Q5W0V0|Q86X68	Missense_Mutation	SNP	ENST00000381116.1	hg19	CCDS9322.1	.	.	.	.	.	.	.	.	.	.	C	13.18	2.160143	0.38119	.	.	ENSG00000122034	ENST00000381140;ENST00000439403	D;D	0.81908	-1.55;-1.55	5.83	-4.3	0.03710	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.91157	0.7215	M	0.91406	3.205	0.42190	D	0.991722	D	0.89917	1.0	D	0.97110	1.0	D	0.92191	0.5759	9	0.87932	D	0	-33.4783	15.88	0.79197	0.0:0.3529:0.0:0.6471	.	186	Q92664	TF3A_HUMAN	Q	186;56	ENSP00000370532:H186Q;ENSP00000393050:H56Q	ENSP00000370532:H186Q	H	+	3	2	GTF3A	26904937	0.910000	0.30920	0.717000	0.30585	0.048000	0.14542	-0.039000	0.12124	-0.765000	0.04645	-1.223000	0.01593	CAC	.	.	.	none		0.537	MTIF3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044300.1	NM_152912	
TOX4	9878	hgsc.bcm.edu	37	14	21961062	21961062	+	Silent	SNP	T	T	A	rs571846793		TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr14:21961062T>A	ENST00000405508.1	+	8	1563	c.1287T>A	c.(1285-1287)gcT>gcA	p.A429A	TOX4_ENST00000262709.3_Silent_p.A429A|TOX4_ENST00000448790.2_Silent_p.A406A			O94842	TOX4_HUMAN	TOX high mobility group box family member 4	429	Gln/Pro-rich.|Poly-Ala.					chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)	p.A429A(1)		large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(95;0.000465)		Epithelial(56;6.61e-06)|all cancers(55;5.15e-05)	GBM - Glioblastoma multiforme(265;0.0149)		CAGCAGCAGCTGCTGCTGCTG	0.582													T|||	1	0.000199681	0.0	0.0014	5008	,	,		14814	0.0		0.0	False		,,,				2504	0.0				p.A429A		Atlas-SNP	.											TOX4,NS,carcinoma,0,2	TOX4	50	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1287A						PASS	.						63.0	73.0	70.0					14																	21961062		2201	4298	6499	SO:0001819	synonymous_variant	9878	exon7			AGCAGCTGCTGCT	AB018280	CCDS32043.1	14q11.2	2007-03-20	2007-03-20	2007-03-20	ENSG00000092203	ENSG00000092203			20161	protein-coding gene	gene with protein product		614032	"""chromosome 14 open reading frame 92"", ""KIAA0737"""	C14orf92, KIAA0737			Standard	NM_014828		Approved	LCP1	uc001waz.3	O94842	OTTHUMG00000150278	ENST00000405508.1:c.1287T>A	chr14.hg19:g.21961062T>A		75.0	1.0	.		64.0	3.0	.	NM_014828	B4DPY8|B4DSM0|E7EV69	Silent	SNP	ENST00000405508.1	hg19	CCDS32043.1																																																																																			.	.	.	none		0.582	TOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317287.2	NM_014828	
DHRS4	10901	hgsc.bcm.edu	37	14	24424419	24424419	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr14:24424419A>T	ENST00000313250.5	+	2	507	c.304A>T	c.(304-306)Acg>Tcg	p.T102S	DHRS4_ENST00000543741.2_Missense_Mutation_p.T102S|DHRS4_ENST00000382761.3_Missense_Mutation_p.T84S|DHRS4_ENST00000397073.2_Missense_Mutation_p.T84S|DHRS4_ENST00000397074.3_Missense_Mutation_p.T102S|DHRS4_ENST00000559632.1_Missense_Mutation_p.T102S|DHRS4_ENST00000558263.1_Missense_Mutation_p.T102S|DHRS4_ENST00000308178.8_Missense_Mutation_p.T84S|DHRS4_ENST00000397075.3_Missense_Mutation_p.T102S|DHRS4_ENST00000558581.1_Missense_Mutation_p.T102S|DHRS4-AS1_ENST00000556379.1_RNA|DHRS4_ENST00000421831.1_Missense_Mutation_p.T84S	NM_021004.2	NP_066284.2	Q9BTZ2	DHRS4_HUMAN	dehydrogenase/reductase (SDR family) member 4	102				T -> M (in Ref. 1; AAD02292). {ECO:0000305}.	alcohol metabolic process (GO:0006066)|cellular ketone metabolic process (GO:0042180)|oxidation-reduction process (GO:0055114)|protein tetramerization (GO:0051262)|steroid metabolic process (GO:0008202)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	3-keto sterol reductase activity (GO:0000253)|alcohol dehydrogenase [NAD(P)+] activity (GO:0018455)|carbonyl reductase (NADPH) activity (GO:0004090)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|receptor binding (GO:0005102)			central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)	GCTGGTGGCCACGGTGAGCTG	0.652																																					p.T102S		Atlas-SNP	.											.	DHRS4	22	.	0			c.A304T						PASS	.						19.0	23.0	21.0					14																	24424419		2201	4298	6499	SO:0001583	missense	10901	exon2			GTGGCCACGGTGA	AF044127	CCDS9605.1, CCDS61408.1, CCDS61409.1, CCDS61410.1, CCDS61411.1, CCDS61412.1	14q11.2	2013-06-14			ENSG00000157326	ENSG00000157326	1.1.1.184	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	16985	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 2"""	611596				10333503, 19027726	Standard	NM_021004		Approved	SCAD-SRL, SDR-SRL, humNRDR, FLJ11008, SDR25C2	uc001wla.3	Q9BTZ2	OTTHUMG00000028777	ENST00000313250.5:c.304A>T	chr14.hg19:g.24424419A>T	ENSP00000326219:p.Thr102Ser	202.0	0.0	.		170.0	76.0	.	NM_021004	B2RB10|B7WNS9|D3YTB8|E2QRL8|O95162|Q20CR0|Q2LC19|Q2LE81|Q58IU4|Q6E0Y1|Q6UWU3|Q71UQ6|Q8TD03|Q9H3N5|Q9NV08	Missense_Mutation	SNP	ENST00000313250.5	hg19	CCDS9605.1	.	.	.	.	.	.	.	.	.	.	.	12.04	1.818425	0.32145	.	.	ENSG00000157326	ENST00000313250;ENST00000421831;ENST00000397073;ENST00000308178;ENST00000382761;ENST00000397075;ENST00000397074;ENST00000543741	T;T;D;D;D;D;D;D	0.87571	1.03;1.02;-2.27;-2.27;-2.27;-2.27;-2.27;-2.27	3.78	3.78	0.43462	NAD(P)-binding domain (1);	0.264094	0.42294	D	0.000732	T	0.81059	0.4744	N	0.20483	0.58	0.33769	D	0.622794	P;B;B;B;B;B	0.48911	0.917;0.0;0.0;0.002;0.409;0.003	P;B;B;B;B;B	0.49799	0.622;0.002;0.001;0.006;0.273;0.01	T	0.82275	-0.0538	10	0.22706	T	0.39	.	10.5463	0.45062	1.0:0.0:0.0:0.0	.	102;102;102;102;102;102	Q9BTZ2-5;F5GWZ1;Q9BTZ2-2;Q9BTZ2-7;Q9BTZ2-4;Q9BTZ2	.;.;.;.;.;DHRS4_HUMAN	S	102;84;84;84;84;102;102;102	ENSP00000326219:T102S;ENSP00000404147:T84S;ENSP00000380263:T84S;ENSP00000311993:T84S;ENSP00000372209:T84S;ENSP00000380265:T102S;ENSP00000380264:T102S;ENSP00000440508:T102S	ENSP00000311993:T84S	T	+	1	0	DHRS4	23494259	0.466000	0.25823	0.992000	0.48379	0.573000	0.36030	2.775000	0.47702	1.597000	0.50072	0.392000	0.25879	ACG	.	.	.	none		0.652	DHRS4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071857.3		
TTC7B	145567	hgsc.bcm.edu	37	14	91142993	91142993	+	Silent	SNP	G	G	A	rs149388931		TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr14:91142993G>A	ENST00000328459.6	-	9	1147	c.1026C>T	c.(1024-1026)gaC>gaT	p.D342D	RP11-661G16.1_ENST00000554967.1_RNA|TTC7B_ENST00000357056.2_Silent_p.D342D	NM_001010854.1	NP_001010854.1	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	342								p.D342D(1)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	36		Melanoma(154;0.222)				TCAGCACAGCGTCCCGGTTGG	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		19900	0.001		0.0	False		,,,				2504	0.0				p.D342D		Atlas-SNP	.											TTC7B,NS,carcinoma,0,1	TTC7B	93	.	1	Substitution - coding silent(1)	endometrium(1)	c.C1026T						PASS	.	G		0,4406		0,0,2203	125.0	102.0	110.0		1026	-10.1	0.2	14	dbSNP_134	110	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TTC7B	NM_001010854.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		342/844	91142993	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	145567	exon9			CACAGCGTCCCGG	BC035865	CCDS32140.1	14q32.12	2013-01-11	2004-06-02	2004-06-04		ENSG00000165914		"""Tetratricopeptide (TTC) repeat domain containing"""	19858	protein-coding gene	gene with protein product			"""tetratricopeptide repeat domain 7 like 1"""	TTC7L1			Standard	XM_005267367		Approved		uc001xyp.3	Q86TV6		ENST00000328459.6:c.1026C>T	chr14.hg19:g.91142993G>A		47.0	0.0	.		48.0	15.0	.	NM_001010854	Q86U24|Q86VT3	Silent	SNP	ENST00000328459.6	hg19	CCDS32140.1	.	.	.	.	.	.	.	.	.	.	G	0.952	-0.706004	0.03255	0.0	1.16E-4	ENSG00000165914	ENST00000554462	.	.	.	5.15	-10.1	0.00402	.	.	.	.	.	T	0.55657	0.1934	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66188	-0.5986	4	.	.	.	-13.7471	12.5361	0.56142	0.732:0.0:0.1834:0.0847	.	.	.	.	C	12	.	.	R	-	1	0	TTC7B	90212746	0.524000	0.26282	0.175000	0.22980	0.153000	0.21895	-0.170000	0.09897	-2.269000	0.00684	-2.956000	0.00083	CGC	.	G|1.000;A|0.000	0.000	weak		0.532	TTC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411364.2		
MAPKBP1	23005	hgsc.bcm.edu	37	15	42109123	42109123	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr15:42109123C>A	ENST00000456763.2	+	15	1815	c.1619C>A	c.(1618-1620)gCa>gAa	p.A540E	MAPKBP1_ENST00000457542.2_Missense_Mutation_p.A534E|MAPKBP1_ENST00000221214.6_Missense_Mutation_p.A417E|MAPKBP1_ENST00000260357.7_Missense_Mutation_p.A373E|MAPKBP1_ENST00000514566.1_Missense_Mutation_p.A534E	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	540										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		AAACTGCTAGCATCGGCGAGC	0.592																																					p.A540E		Atlas-SNP	.											.	MAPKBP1	120	.	0			c.C1619A						PASS	.						93.0	95.0	95.0					15																	42109123		2203	4300	6503	SO:0001583	missense	23005	exon15			TGCTAGCATCGGC	AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.1619C>A	chr15.hg19:g.42109123C>A	ENSP00000393099:p.Ala540Glu	70.0	0.0	.		42.0	16.0	.	NM_001128608	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	ENST00000456763.2	hg19	CCDS45239.1	.	.	.	.	.	.	.	.	.	.	c	21.5	4.160189	0.78226	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000260357;ENST00000456763;ENST00000514566	T;T;T;T;T	0.71579	1.2;1.2;0.73;-0.58;0.73	5.63	5.63	0.86233	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.89924	0.6856	H	0.96430	3.82	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.999;1.0;0.999	D	0.92621	0.6108	10	0.87932	D	0	-12.8407	19.7096	0.96089	0.0:1.0:0.0:0.0	.	373;417;534;540;534	F8WC21;O60336-3;O60336-2;O60336;O60336-6	.;.;.;MABP1_HUMAN;.	E	534;417;373;540;534	ENSP00000397570:A534E;ENSP00000221214:A417E;ENSP00000260357:A373E;ENSP00000393099:A540E;ENSP00000426154:A534E	ENSP00000221214:A417E	A	+	2	0	MAPKBP1	39896415	1.000000	0.71417	0.802000	0.32245	0.055000	0.15305	7.815000	0.86186	2.652000	0.90054	0.655000	0.94253	GCA	.	.	.	none		0.592	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	NM_014994	
RCN2	5955	hgsc.bcm.edu	37	15	77227974	77227974	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr15:77227974G>C	ENST00000394885.3	+	3	581	c.358G>C	c.(358-360)Gat>Cat	p.D120H	RCN2_ENST00000394883.3_Intron|RCN2_ENST00000320963.5_Missense_Mutation_p.D120H	NM_002902.2	NP_002893.1	Q14257	RCN2_HUMAN	reticulocalbin 2, EF-hand calcium binding domain	120	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(2)|large_intestine(2)|lung(1)	7						TGTGACTTGGGATGAATATAA	0.373																																					p.D120H		Atlas-SNP	.											.	RCN2	16	.	0			c.G358C						PASS	.						225.0	196.0	206.0					15																	77227974		2196	4294	6490	SO:0001583	missense	5955	exon3			ACTTGGGATGAAT	X78669	CCDS10291.1, CCDS61719.1	15q22.33-q24.1	2013-01-10			ENSG00000117906	ENSG00000117906		"""EF-hand domain containing"""	9935	protein-coding gene	gene with protein product	"""Reticulocalbin 2, EF-hand calcium binding domain (endoplasmic reticulum calcium-binding protein, 55kD)"""	602584				9533013, 7624774	Standard	NM_002902		Approved	ERC-55, E6BP, ERC55, TCBP49	uc002bcd.3	Q14257	OTTHUMG00000143730	ENST00000394885.3:c.358G>C	chr15.hg19:g.77227974G>C	ENSP00000378349:p.Asp120His	145.0	0.0	.		103.0	43.0	.	NM_002902	A8MTG6|F8WCY5|Q53XN8	Missense_Mutation	SNP	ENST00000394885.3	hg19	CCDS10291.1	.	.	.	.	.	.	.	.	.	.	G	16.18	3.051489	0.55218	.	.	ENSG00000117906	ENST00000394885;ENST00000320963	T;T	0.74209	-0.82;-0.82	5.74	5.74	0.90152	EF-hand-like domain (1);	0.189000	0.56097	D	0.000037	T	0.82135	0.4971	M	0.72576	2.205	0.80722	D	1	D;D	0.61080	0.989;0.966	P;P	0.60345	0.847;0.873	D	0.83656	0.0158	10	0.87932	D	0	-30.4362	10.9266	0.47195	0.1131:0.0:0.8869:0.0	.	120;120	F8WCY5;Q14257	.;RCN2_HUMAN	H	120	ENSP00000378349:D120H;ENSP00000319739:D120H	ENSP00000319739:D120H	D	+	1	0	RCN2	75015029	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	4.439000	0.59968	2.709000	0.92574	0.591000	0.81541	GAT	.	.	.	none		0.373	RCN2-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289795.1	NM_002902	
AMDHD2	51005	hgsc.bcm.edu	37	16	2577574	2577574	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr16:2577574A>C	ENST00000293971.6	+	4	467	c.373A>C	c.(373-375)Atc>Ctc	p.I125L	AMDHD2_ENST00000565570.1_Intron|ATP6C_ENST00000569317.1_Missense_Mutation_p.I78L|AMDHD2_ENST00000302956.4_Missense_Mutation_p.I125L|AMDHD2_ENST00000413459.3_Missense_Mutation_p.I125L|CEMP1_ENST00000382350.1_Intron	NM_015944.3	NP_057028.2	Q9Y303	NAGA_HUMAN	amidohydrolase domain containing 2	125					carbohydrate metabolic process (GO:0005975)|N-acetylglucosamine metabolic process (GO:0006044)|N-acetylneuraminate catabolic process (GO:0019262)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-phosphate deacetylase activity (GO:0008448)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(3)|skin(2)|urinary_tract(2)	19						TGTTCCTCAGATCCCTGTGAA	0.647																																					p.I125L		Atlas-SNP	.											.	AMDHD2	33	.	0			c.A373C						PASS	.						82.0	64.0	70.0					16																	2577574		2197	4300	6497	SO:0001583	missense	51005	exon4			CCTCAGATCCCTG	AF132948	CCDS10471.1, CCDS53984.1	16p13.3	2008-02-05			ENSG00000162066	ENSG00000162066			24262	protein-coding gene	gene with protein product						10810093	Standard	NM_001145815		Approved	CGI-14	uc010uwc.2	Q9Y303	OTTHUMG00000128866	ENST00000293971.6:c.373A>C	chr16.hg19:g.2577574A>C	ENSP00000293971:p.Ile125Leu	82.0	0.0	.		56.0	14.0	.	NM_001145815	B4DL77|Q8WV54	Missense_Mutation	SNP	ENST00000293971.6	hg19		.	.	.	.	.	.	.	.	.	.	A	7.181	0.589511	0.13812	.	.	ENSG00000162066	ENST00000413459;ENST00000302956;ENST00000293971	T;T;T	0.08193	3.12;3.12;3.12	5.09	5.09	0.68999	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.164761	0.53938	D	0.000047	T	0.06234	0.0161	N	0.12527	0.23	0.80722	D	1	B;B;B	0.23249	0.082;0.011;0.004	B;B;B	0.28553	0.091;0.044;0.026	T	0.44467	-0.9326	10	0.30078	T	0.28	-19.5213	13.8369	0.63415	1.0:0.0:0.0:0.0	.	125;125;125	Q9Y303-3;Q9Y303;Q9Y303-2	.;NAGA_HUMAN;.	L	125	ENSP00000391596:I125L;ENSP00000307481:I125L;ENSP00000293971:I125L	ENSP00000293971:I125L	I	+	1	0	AMDHD2	2517575	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.941000	0.49011	2.142000	0.66516	0.459000	0.35465	ATC	.	.	.	none		0.647	AMDHD2-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000435652.1	NM_015944	
ABCC6	368	hgsc.bcm.edu	37	16	16267179	16267179	+	Nonsense_Mutation	SNP	C	C	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr16:16267179C>A	ENST00000205557.7	-	21	2778	c.2749G>T	c.(2749-2751)Gga>Tga	p.G917*		NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	917					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	GCTGGCCATCCTGCCCTGTCA	0.577																																					p.G917X		Atlas-SNP	.											.	ABCC6	110	.	0			c.G2749T						PASS	.						118.0	98.0	105.0					16																	16267179		2197	4300	6497	SO:0001587	stop_gained	368	exon21			GCCATCCTGCCCT	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.2749G>T	chr16.hg19:g.16267179C>A	ENSP00000205557:p.Gly917*	117.0	0.0	.		101.0	35.0	.	NM_001171	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Nonsense_Mutation	SNP	ENST00000205557.7	hg19	CCDS10568.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.808638|5.808638	0.96967|0.96967	.|.	.|.	ENSG00000091262|ENSG00000091262	ENST00000205557|ENST00000456970	.|D	.|0.90385	.|-2.66	4.54|4.54	2.57|2.57	0.30868|0.30868	.|.	0.145914|.	0.30940|.	U|.	0.008566|.	.|D	.|0.89160	.|0.6636	.|.	.|.	.|.	0.09310|0.09310	N|N	0.999995|0.999995	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.80984	.|-0.1138	.|6	0.42905|0.66056	T|D	0.14|0.02	.|.	7.0018|7.0018	0.24813|0.24813	0.0:0.786:0.0:0.214|0.0:0.786:0.0:0.214	.|.	.|.	.|.	.|.	X|H	917|858	.|ENSP00000405002:Q858H	ENSP00000205557:G917X|ENSP00000405002:Q858H	G|Q	-|-	1|3	0|2	ABCC6|ABCC6	16174680|16174680	0.497000|0.497000	0.26067|0.26067	0.002000|0.002000	0.10522|0.10522	0.014000|0.014000	0.08584|0.08584	0.950000|0.950000	0.29122|0.29122	0.366000|0.366000	0.24427|0.24427	0.542000|0.542000	0.68232|0.68232	GGA|CAG	.	.	.	none		0.577	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2		
TAOK2	9344	hgsc.bcm.edu	37	16	29998173	29998173	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr16:29998173C>A	ENST00000308893.4	+	16	3623	c.2580C>A	c.(2578-2580)agC>agA	p.S860R	TAOK2_ENST00000543033.1_Missense_Mutation_p.S747R|TAOK2_ENST00000416441.2_Missense_Mutation_p.S687R|TAOK2_ENST00000279394.3_Intron	NM_001252043.1|NM_016151.3	NP_001238972.1|NP_057235.2	Q9UL54	TAOK2_HUMAN	TAO kinase 2	860	Glu-rich.				actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|focal adhesion assembly (GO:0048041)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein targeting to membrane (GO:0006612)|regulation of cell growth (GO:0001558)|regulation of cell shape (GO:0008360)|response to stress (GO:0006950)|stress-activated MAPK cascade (GO:0051403)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase binding (GO:0031434)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(3)|skin(1)	22						AGGAGAGGAGCATTGTTGGCC	0.577																																					p.S860R		Atlas-SNP	.											.	TAOK2	142	.	0			c.C2580A						PASS	.						98.0	98.0	98.0					16																	29998173		2197	4300	6497	SO:0001583	missense	9344	exon16			GAGGAGCATTGTT	AB020688	CCDS10662.1, CCDS10663.1, CCDS58448.1	16p11.2	2008-02-05			ENSG00000149930	ENSG00000149930			16835	protein-coding gene	gene with protein product		613199				10048485, 9786855	Standard	NM_016151		Approved	TAO1, KIAA0881, PSK, PSK1, TAO2, MAP3K17	uc002dva.2	Q9UL54	OTTHUMG00000132111	ENST00000308893.4:c.2580C>A	chr16.hg19:g.29998173C>A	ENSP00000310094:p.Ser860Arg	140.0	0.0	.		166.0	111.0	.	NM_016151	A5PKY1|A7MCZ2|B2RN35|B7ZM88|O94957|Q6UW73|Q7LC09|Q9NSW2	Missense_Mutation	SNP	ENST00000308893.4	hg19	CCDS10663.1	.	.	.	.	.	.	.	.	.	.	C	6.082	0.383409	0.11524	.	.	ENSG00000149930	ENST00000308893;ENST00000543033	T;T	0.69926	-0.44;-0.44	5.32	3.28	0.37604	.	0.497301	0.18706	N	0.133460	T	0.37625	0.1010	N	0.03608	-0.345	0.18873	N	0.999988	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.09377	0.001;0.004;0.001	T	0.17806	-1.0357	9	.	.	.	.	8.0473	0.30557	0.0:0.6917:0.2053:0.103	.	1051;687;860	Q86V37;Q9UL54-3;Q9UL54	.;.;TAOK2_HUMAN	R	860;747	ENSP00000310094:S860R;ENSP00000440336:S747R	.	S	+	3	2	TAOK2	29905674	0.995000	0.38212	0.991000	0.47740	0.900000	0.52787	1.367000	0.34204	1.225000	0.43566	0.563000	0.77884	AGC	.	.	.	none		0.577	TAOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255152.2	NM_016151	
HYDIN	54768	hgsc.bcm.edu	37	16	71101222	71101222	+	Silent	SNP	T	T	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr16:71101222T>C	ENST00000393567.2	-	15	2196	c.2046A>G	c.(2044-2046)gaA>gaG	p.E682E	HYDIN_ENST00000543639.1_5'Flank|HYDIN_ENST00000393550.2_Silent_p.E697E|HYDIN_ENST00000448089.2_Silent_p.E682E|HYDIN_ENST00000541601.1_Silent_p.E699E|HYDIN_ENST00000448691.1_Silent_p.E682E|HYDIN_ENST00000538248.1_Silent_p.E709E|HYDIN_ENST00000288168.10_Silent_p.E699E|HYDIN_ENST00000321489.5_Silent_p.E682E	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	682					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CCAGCACCTCTTCTCCGATGC	0.547																																					p.E709E		Atlas-SNP	.											.	HYDIN	788	.	0			c.A2127G						PASS	.						69.0	61.0	64.0					16																	71101222		2198	4300	6498	SO:0001819	synonymous_variant	54768	exon15			CACCTCTTCTCCG	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.2046A>G	chr16.hg19:g.71101222T>C		44.0	0.0	.		58.0	16.0	.	NM_001198542	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	ENST00000393567.2	hg19	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	T	9.980	1.227788	0.22542	.	.	ENSG00000157423	ENST00000542890	.	.	.	4.99	-0.229	0.13094	.	.	.	.	.	T	0.50497	0.1619	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37009	-0.9724	4	.	.	.	.	5.1347	0.14928	0.1409:0.3851:0.0:0.4739	.	.	.	.	R	84	.	.	K	-	2	0	HYDIN	69658723	0.998000	0.40836	0.999000	0.59377	0.982000	0.71751	0.373000	0.20484	-0.024000	0.13941	0.491000	0.48974	AAG	.	.	.	none		0.547	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
DNAAF1	123872	hgsc.bcm.edu	37	16	84189316	84189316	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr16:84189316C>T	ENST00000378553.5	+	5	827	c.703C>T	c.(703-705)Ccg>Tcg	p.P235S	DNAAF1_ENST00000334315.5_Missense_Mutation_p.P235S	NM_178452.4	NP_848547.4	Q8NEP3	DAAF1_HUMAN	dynein, axonemal, assembly factor 1	235					axonemal dynein complex assembly (GO:0070286)|cilium morphogenesis (GO:0060271)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|left/right pattern formation (GO:0060972)|lung development (GO:0030324)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|regulation of cilium beat frequency (GO:0003356)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dynein binding (GO:0045502)			NS(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(4)|urinary_tract(1)	41						GCTGAGTGACCCGGAGATCCT	0.453																																					p.P235S		Atlas-SNP	.											.	DNAAF1	81	.	0			c.C703T						PASS	.						127.0	103.0	111.0					16																	84189316		2200	4300	6500	SO:0001583	missense	123872	exon5			AGTGACCCGGAGA	BC024009	CCDS10943.2	16q24.1	2012-05-03	2011-06-09	2011-06-09	ENSG00000154099	ENSG00000154099			30539	protein-coding gene	gene with protein product	"""outer row dynein assembly 7 homolog (Chlamydomonas)"""	613190	"""leucine rich repeat containing 50"""	LRRC50		19944405	Standard	NM_178452		Approved	FLJ25330, ODA7, CILD13	uc002fhl.4	Q8NEP3	OTTHUMG00000128517	ENST00000378553.5:c.703C>T	chr16.hg19:g.84189316C>T	ENSP00000367815:p.Pro235Ser	95.0	0.0	.		130.0	28.0	.	NM_178452	B4DJA3|Q69YI8|Q69YJ0|Q69YW5|Q96LP3|Q96MB6	Missense_Mutation	SNP	ENST00000378553.5	hg19	CCDS10943.2	.	.	.	.	.	.	.	.	.	.	C	14.51	2.555524	0.45487	.	.	ENSG00000154099	ENST00000334315;ENST00000378553	T;T	0.21031	2.03;2.03	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.26521	0.0648	L	0.55481	1.735	0.58432	D	0.999997	P	0.35542	0.508	B	0.39531	0.302	T	0.02925	-1.1093	10	0.22706	T	0.39	-13.7883	18.3021	0.90167	0.0:1.0:0.0:0.0	.	235	Q8NEP3	DAAF1_HUMAN	S	235	ENSP00000334593:P235S;ENSP00000367815:P235S	ENSP00000334593:P235S	P	+	1	0	DNAAF1	82746817	1.000000	0.71417	0.121000	0.21740	0.027000	0.11550	7.358000	0.79466	2.318000	0.78349	0.655000	0.94253	CCG	.	.	.	none		0.453	DNAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250328.3	NM_178452	
USP10	9100	hgsc.bcm.edu	37	16	84778731	84778731	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr16:84778731C>T	ENST00000219473.7	+	4	757	c.644C>T	c.(643-645)tCc>tTc	p.S215F	USP10_ENST00000570191.1_Missense_Mutation_p.S219F|USP10_ENST00000562743.1_3'UTR	NM_001272075.1|NM_005153.2	NP_001259004.1|NP_005144.2	Q14694	UBP10_HUMAN	ubiquitin specific peptidase 10	215					autophagy (GO:0006914)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA repair (GO:0006281)|protein deubiquitination (GO:0016579)|regulation of autophagy (GO:0010506)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|stomach(1)|urinary_tract(1)	17						CCCCAGAACTCCACAGACTCT	0.592																																					p.S219F		Atlas-SNP	.											.	USP10	51	.	0			c.C656T						PASS	.						25.0	25.0	25.0					16																	84778731		1967	4145	6112	SO:0001583	missense	9100	exon5			AGAACTCCACAGA	D80012	CCDS45537.1, CCDS62004.1	16q	2008-03-25	2005-08-08			ENSG00000103194		"""Ubiquitin-specific peptidases"""	12608	protein-coding gene	gene with protein product		609818	"""ubiquitin specific protease 10"""			12838346	Standard	NM_005153		Approved	UBPO, KIAA0190	uc002fii.3	Q14694		ENST00000219473.7:c.644C>T	chr16.hg19:g.84778731C>T	ENSP00000219473:p.Ser215Phe	157.0	0.0	.		137.0	35.0	.	NM_001272075	B2RDJ8|B4DS84|Q9BWG7|Q9NSL7	Missense_Mutation	SNP	ENST00000219473.7	hg19	CCDS45537.1	.	.	.	.	.	.	.	.	.	.	C	12.30	1.896996	0.33535	.	.	ENSG00000103194	ENST00000219473	T	0.07800	3.16	5.17	5.17	0.71159	.	1.000500	0.08066	N	0.999021	T	0.09379	0.0231	L	0.35414	1.06	0.32033	N	0.59923	B;B	0.14012	0.009;0.001	B;B	0.13407	0.009;0.002	T	0.03773	-1.1005	10	0.51188	T	0.08	-3.5155	11.1822	0.48636	0.0:0.916:0.0:0.084	.	219;215	Q14694-3;Q14694	.;UBP10_HUMAN	F	215	ENSP00000219473:S215F	ENSP00000219473:S215F	S	+	2	0	USP10	83336232	1.000000	0.71417	0.054000	0.19295	0.728000	0.41692	4.964000	0.63701	2.403000	0.81681	0.491000	0.48974	TCC	.	.	.	none		0.592	USP10-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433660.1		
ZNF469	84627	hgsc.bcm.edu	37	16	88503562	88503562	+	Silent	SNP	G	G	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr16:88503562G>C	ENST00000437464.1	+	2	9600	c.9600G>C	c.(9598-9600)ctG>ctC	p.L3200L	ZNF469_ENST00000565624.1_Silent_p.L3228L	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	3200					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CCCACCTTCTGAACAGCATCA	0.731																																					p.L3200L		Atlas-SNP	.											.	ZNF469	121	.	0			c.G9600C						PASS	.						2.0	2.0	2.0					16																	88503562		503	1309	1812	SO:0001819	synonymous_variant	84627	exon2			CCTTCTGAACAGC	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.9600G>C	chr16.hg19:g.88503562G>C		120.0	0.0	.		114.0	31.0	.	NM_001127464		Silent	SNP	ENST00000437464.1	hg19	CCDS45544.1																																																																																			.	.	.	none		0.731	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
MYH4	4622	hgsc.bcm.edu	37	17	10366192	10366192	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr17:10366192A>T	ENST00000255381.2	-	11	1108	c.998T>A	c.(997-999)aTg>aAg	p.M333K	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	333	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						ATCTGTGGCCATCAGCTCTTC	0.428																																					p.M333K		Atlas-SNP	.											.	MYH4	349	.	0			c.T998A						PASS	.						118.0	112.0	114.0					17																	10366192		2203	4300	6503	SO:0001583	missense	4622	exon11			GTGGCCATCAGCT		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.998T>A	chr17.hg19:g.10366192A>T	ENSP00000255381:p.Met333Lys	65.0	0.0	.		94.0	36.0	.	NM_017533		Missense_Mutation	SNP	ENST00000255381.2	hg19	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	A	14.32	2.499918	0.44455	.	.	ENSG00000141048	ENST00000255381	D	0.85629	-2.01	5.37	5.37	0.77165	Myosin head, motor domain (2);	0.320982	0.21520	U	0.073229	T	0.70439	0.3224	N	0.10809	0.05	0.49299	D	0.999774	B	0.02656	0.0	B	0.06405	0.002	T	0.65957	-0.6042	10	0.06365	T	0.9	.	15.6589	0.77165	1.0:0.0:0.0:0.0	.	333	Q9Y623	MYH4_HUMAN	K	333	ENSP00000255381:M333K	ENSP00000255381:M333K	M	-	2	0	MYH4	10306917	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.108000	0.71522	2.153000	0.67306	0.528000	0.53228	ATG	.	.	.	none		0.428	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
RNF112	7732	hgsc.bcm.edu	37	17	19315946	19315946	+	Nonsense_Mutation	SNP	C	C	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr17:19315946C>A	ENST00000461366.1	+	3	446	c.231C>A	c.(229-231)tgC>tgA	p.C77*	CTB-187M2.2_ENST00000579897.1_RNA|RNF112_ENST00000580109.1_3'UTR	NM_007148.4	NP_009079.2	Q9ULX5	RN112_HUMAN	ring finger protein 112	77						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|urinary_tract(1)	12						ACGACTTCTGCATACGGTGCT	0.667																																					p.C77X		Atlas-SNP	.											.	RNF112	37	.	0			c.C231A						PASS	.						37.0	39.0	38.0					17																	19315946		2054	4202	6256	SO:0001587	stop_gained	7732	exon3			CTTCTGCATACGG	AF054587	CCDS58529.1	17p11.2	2013-01-16	2008-06-13	2008-06-13	ENSG00000128482	ENSG00000128482		"""RING-type (C3HC4) zinc fingers"""	12968	protein-coding gene	gene with protein product		601237	"""zinc finger protein 179"""	ZNF179		8660987, 9806830	Standard	NM_007148		Approved	BFP	uc010vyw.2	Q9ULX5	OTTHUMG00000059601	ENST00000461366.1:c.231C>A	chr17.hg19:g.19315946C>A	ENSP00000454919:p.Cys77*	79.0	0.0	.		65.0	22.0	.	NM_007148	O60633|Q7Z5V9	Nonsense_Mutation	SNP	ENST00000461366.1	hg19	CCDS58529.1																																																																																			.	.	.	none		0.667	RNF112-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132549.4	NM_007148	
SRCIN1	80725	hgsc.bcm.edu	37	17	36708714	36708714	+	Missense_Mutation	SNP	C	C	T	rs370322301		TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr17:36708714C>T	ENST00000264659.7	-	13	2673	c.2449G>A	c.(2449-2451)Ggg>Agg	p.G817R	SRCIN1_ENST00000578925.1_Missense_Mutation_p.G851R|SRCIN1_ENST00000398579.4_5'UTR	NM_025248.2	NP_079524.2	Q9C0H9	SRCN1_HUMAN	SRC kinase signaling inhibitor 1	689					exocytosis (GO:0006887)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell migration (GO:0030334)|regulation of dendritic spine morphogenesis (GO:0061001)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	protein kinase binding (GO:0019901)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	19						TCCGTGACCCCGCGGCAGCGC	0.637																																					p.G817R		Atlas-SNP	.											SRCIN1,NS,carcinoma,0,1	SRCIN1	66	.	0			c.G2449A						PASS	.	C	ARG/GLY	0,4048		0,0,2024	15.0	18.0	17.0		2449	4.1	0.9	17		17	1,8363		0,1,4181	no	missense	SRCIN1	NM_025248.2	125	0,1,6205	TT,TC,CC		0.012,0.0,0.0081	benign	817/1184	36708714	1,12411	2024	4182	6206	SO:0001583	missense	80725	exon13			TGACCCCGCGGCA		CCDS45660.1	17q12	2009-12-14			ENSG00000017373	ENSG00000277363			29506	protein-coding gene	gene with protein product	"""p130Cas-associated protein"", ""SNAP-25-interacting protein"""	610786				11214970	Standard	NM_025248		Approved	SNIP, p140Cap, KIAA1684	uc002hqd.3	Q9C0H9		ENST00000264659.7:c.2449G>A	chr17.hg19:g.36708714C>T	ENSP00000264659:p.Gly817Arg	114.0	0.0	.		113.0	33.0	.	NM_025248	Q75T46|Q8N4W8	Missense_Mutation	SNP	ENST00000264659.7	hg19	CCDS45660.1	.	.	.	.	.	.	.	.	.	.	C	16.25	3.071632	0.55646	0.0	1.2E-4	ENSG00000017373	ENST00000264659;ENST00000542707;ENST00000398579	T;T	0.45276	0.9;0.93	5.05	4.09	0.47781	.	0.339539	0.30302	N	0.009923	T	0.31327	0.0793	L	0.40543	1.245	0.31267	N	0.692233	P;P;P;P	0.48503	0.911;0.709;0.813;0.489	B;B;B;B	0.41412	0.356;0.141;0.213;0.141	T	0.30446	-0.9978	10	0.27082	T	0.32	-17.7161	8.7631	0.34687	0.0:0.8266:0.0:0.1734	.	123;689;689;817	Q9C0H9-4;Q9C0H9-2;Q9C0H9;Q9C0H9-5	.;.;SRCN1_HUMAN;.	R	817;598;671	ENSP00000264659:G817R;ENSP00000445368:G598R	ENSP00000264659:G817R	G	-	1	0	SRCIN1	33962240	0.973000	0.33851	0.921000	0.36526	0.977000	0.68977	2.487000	0.45268	1.362000	0.46000	0.561000	0.74099	GGG	.	.	.	weak		0.637	SRCIN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441878.4	NM_025248	
NBR1	4077	hgsc.bcm.edu	37	17	41343586	41343586	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr17:41343586C>G	ENST00000422280.1	+	10	1520	c.1061C>G	c.(1060-1062)tCt>tGt	p.S354C	NBR1_ENST00000389312.4_Missense_Mutation_p.S354C|NBR1_ENST00000590996.1_Missense_Mutation_p.S354C|NBR1_ENST00000589872.1_Missense_Mutation_p.S354C|NBR1_ENST00000542611.1_Missense_Mutation_p.S333C|NBR1_ENST00000341165.6_Missense_Mutation_p.S354C	NM_031858.2	NP_114064.1	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	354					macroautophagy (GO:0016236)|negative regulation of osteoblast differentiation (GO:0045668)|protein oligomerization (GO:0051259)|regulation of bone mineralization (GO:0030500)|regulation of stress-activated MAPK cascade (GO:0032872)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	mitogen-activated protein kinase binding (GO:0051019)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	24		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		TTGCTCCAGTCTAATACCCTG	0.478																																					p.S354C		Atlas-SNP	.											.	NBR1	55	.	0			c.C1061G						PASS	.						27.0	26.0	27.0					17																	41343586		1840	4090	5930	SO:0001583	missense	4077	exon10			TCCAGTCTAATAC	X76952	CCDS45694.1	17q21.31	2008-02-01	2005-02-15	2005-02-16		ENSG00000188554			6746	protein-coding gene	gene with protein product		166945	"""membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125)"""	M17S2		8069304	Standard	XM_006721903		Approved	CA125, KIAA0049, 1A1-3B	uc010whv.2	Q14596		ENST00000422280.1:c.1061C>G	chr17.hg19:g.41343586C>G	ENSP00000411250:p.Ser354Cys	213.0	0.0	.		281.0	76.0	.	NM_031862	Q13173|Q15026|Q5J7Q8|Q96GB6|Q9NRF7	Missense_Mutation	SNP	ENST00000422280.1	hg19	CCDS45694.1	.	.	.	.	.	.	.	.	.	.	C	15.12	2.739376	0.49045	.	.	ENSG00000188554	ENST00000422280;ENST00000542611;ENST00000341165;ENST00000389312;ENST00000389311	T;T;T;T	0.49432	1.36;0.78;1.36;1.36	5.37	5.37	0.77165	.	0.426202	0.26824	N	0.022311	T	0.51312	0.1667	N	0.25647	0.755	0.09310	N	1	D;D;D;D	0.65815	0.995;0.995;0.995;0.995	P;P;P;P	0.58820	0.784;0.784;0.846;0.784	T	0.48502	-0.9030	10	0.66056	D	0.02	-6.7866	13.8872	0.63714	0.1516:0.8484:0.0:0.0	.	354;333;354;354	A8K1U0;B7Z5R6;Q14596-2;Q14596	.;.;.;NBR1_HUMAN	C	354;333;354;354;354	ENSP00000411250:S354C;ENSP00000437545:S333C;ENSP00000343479:S354C;ENSP00000373963:S354C	ENSP00000343479:S354C	S	+	2	0	NBR1	38597112	0.968000	0.33430	0.920000	0.36463	0.709000	0.40893	2.358000	0.44134	2.528000	0.85240	0.655000	0.94253	TCT	.	.	.	none		0.478	NBR1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453461.1	NM_005899	
MAP3K3	4215	hgsc.bcm.edu	37	17	61767096	61767096	+	Splice_Site	SNP	G	G	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr17:61767096G>A	ENST00000361733.3	+	11	1383		c.e11+1		MAP3K3_ENST00000361357.3_Splice_Site|MAP3K3_ENST00000577395.1_Splice_Site|MAP3K3_ENST00000584573.1_Splice_Site|MAP3K3_ENST00000579585.1_Splice_Site	NM_002401.3	NP_002392.2	Q99759	M3K3_HUMAN	mitogen-activated protein kinase kinase kinase 3						activation of MAPKK activity (GO:0000186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)			breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	28						CCAACCAAGTGTGAGGAGCTG	0.632																																					.		Atlas-SNP	.											.	MAP3K3	56	.	0			c.1156+1G>A						PASS	.						34.0	31.0	32.0					17																	61767096		2203	4300	6503	SO:0001630	splice_region_variant	4215	exon12			CCAAGTGTGAGGA	U78876	CCDS32701.1, CCDS32702.1	17q	2011-06-09				ENSG00000198909		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6855	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 3"", ""MAPK/ERK kinase kinase 3"""	602539		MEKK3		9006902	Standard	NM_002401		Approved	MAPKKK3	uc002jbf.3	Q99759		ENST00000361733.3:c.1063+1G>A	chr17.hg19:g.61767096G>A		108.0	0.0	.		99.0	20.0	.	NM_203351	B2RCW2|D3DU15|Q5BKZ6|Q8N3I9	Splice_Site	SNP	ENST00000361733.3	hg19	CCDS32702.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.591205	0.86851	.	.	ENSG00000198909	ENST00000361357;ENST00000361733	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4437	0.94838	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAP3K3	59120828	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.685000	0.84117	2.600000	0.87896	0.561000	0.74099	.	.	.	.	none		0.632	MAP3K3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000443867.1	NM_002401	Intron
QRICH2	84074	hgsc.bcm.edu	37	17	74288747	74288747	+	Silent	SNP	C	C	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr17:74288747C>T	ENST00000262765.5	-	4	1742	c.1563G>A	c.(1561-1563)caG>caA	p.Q521Q		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	521	Gln-rich.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						CCAAGCCAGGCTGATATGCAC	0.537																																					p.Q521Q		Atlas-SNP	.											.	QRICH2	143	.	0			c.G1563A						PASS	.						151.0	124.0	133.0					17																	74288747		2203	4300	6503	SO:0001819	synonymous_variant	84074	exon4			GCCAGGCTGATAT	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.1563G>A	chr17.hg19:g.74288747C>T		87.0	0.0	.		90.0	5.0	.	NM_032134	A2RRE1|Q96LM3	Silent	SNP	ENST00000262765.5	hg19	CCDS32741.1																																																																																			.	.	.	none		0.537	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134	
FSCN2	25794	hgsc.bcm.edu	37	17	79503808	79503808	+	Silent	SNP	G	G	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr17:79503808G>A	ENST00000417245.2	+	4	1402	c.1266G>A	c.(1264-1266)cgG>cgA	p.R422R	FSCN2_ENST00000334850.7_Silent_p.R446R	NM_001077182.2|NM_012418.3	NP_001070650.1|NP_036550.1	O14926	FSCN2_HUMAN	fascin actin-bundling protein 2, retinal	422					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|anatomical structure morphogenesis (GO:0009653)|eye photoreceptor cell development (GO:0042462)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|stereocilium (GO:0032420)	actin binding (GO:0003779)|actin filament binding (GO:0051015)			endometrium(1)|lung(1)|prostate(1)|urinary_tract(1)	4	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			GCGCCTACCGGATCCGAGGTG	0.741																																					p.R446R		Atlas-SNP	.											.	FSCN2	35	.	0			c.G1338A						PASS	.						8.0	10.0	10.0					17																	79503808		1928	4087	6015	SO:0001819	synonymous_variant	25794	exon4			CTACCGGATCCGA	AF030165	CCDS45810.1, CCDS45811.1	17q25	2014-02-03	2014-02-03		ENSG00000186765	ENSG00000186765		"""Fascins"""	3960	protein-coding gene	gene with protein product		607643	"""fascin (Strongylocentrotus purpuratus) homolog 2 (actin-bundling protein, retinal)"", ""fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)"""			10234509	Standard	NM_012418		Approved	RP30, RFSN	uc010wuo.2	O14926	OTTHUMG00000167477	ENST00000417245.2:c.1266G>A	chr17.hg19:g.79503808G>A		368.0	0.0	.		441.0	128.0	.	NM_001077182	A0AVC4|A8MRA6	Silent	SNP	ENST00000417245.2	hg19	CCDS45811.1																																																																																			.	.	.	none		0.741	FSCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394746.1	NM_012418	
ROCK1	6093	hgsc.bcm.edu	37	18	18624118	18624118	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr18:18624118T>A	ENST00000399799.2	-	6	1560	c.620A>T	c.(619-621)gAt>gTt	p.D207V		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	207	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					TCCAGATTTATCCAGCAGCAT	0.323																																					p.D207V		Atlas-SNP	.											.	ROCK1	162	.	0			c.A620T						PASS	.						106.0	113.0	110.0					18																	18624118		2203	4300	6503	SO:0001583	missense	6093	exon6			GATTTATCCAGCA		CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.620A>T	chr18.hg19:g.18624118T>A	ENSP00000382697:p.Asp207Val	81.0	0.0	.		108.0	29.0	.	NM_005406	B0YJ91|Q2KHM4|Q59GZ4	Missense_Mutation	SNP	ENST00000399799.2	hg19	CCDS11870.2	.	.	.	.	.	.	.	.	.	.	T	25.7	4.660341	0.88154	.	.	ENSG00000067900	ENST00000399799	T	0.32753	1.44	4.91	4.91	0.64330	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.54838	0.1883	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.59941	-0.7359	10	0.87932	D	0	.	14.6987	0.69142	0.0:0.0:0.0:1.0	.	207	Q13464	ROCK1_HUMAN	V	207	ENSP00000382697:D207V	ENSP00000382697:D207V	D	-	2	0	ROCK1	16878116	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.834000	0.86773	2.035000	0.60131	0.528000	0.53228	GAT	.	.	.	none		0.323	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406	
DCC	1630	hgsc.bcm.edu	37	18	50589777	50589777	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr18:50589777A>C	ENST00000442544.2	+	6	1704	c.1088A>C	c.(1087-1089)aAt>aCt	p.N363T	DCC_ENST00000581580.1_Missense_Mutation_p.N18T|DCC_ENST00000412726.1_Missense_Mutation_p.N211T|DCC_ENST00000580146.1_3'UTR	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	363	Ig-like C2-type 4.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CCCACTGTGAATTGGATGAAG	0.363																																					p.N363T		Atlas-SNP	.											.	DCC	360	.	0			c.A1088C						PASS	.						258.0	236.0	244.0					18																	50589777		2203	4300	6503	SO:0001583	missense	1630	exon6			CTGTGAATTGGAT	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.1088A>C	chr18.hg19:g.50589777A>C	ENSP00000389140:p.Asn363Thr	113.0	0.0	.		143.0	76.0	.	NM_005215		Missense_Mutation	SNP	ENST00000442544.2	hg19	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	A	13.52	2.262590	0.39995	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	T;T	0.64991	-0.13;-0.13	5.95	5.95	0.96441	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.127696	0.53938	D	0.000048	T	0.24699	0.0599	N	0.00077	-2.24	0.35591	D	0.807111	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.16289	0.006;0.006;0.015	T	0.40079	-0.9582	10	0.25751	T	0.34	.	15.3941	0.74778	1.0:0.0:0.0:0.0	.	211;211;363	E7EQM8;B4DYX2;P43146	.;.;DCC_HUMAN	T	363;296;211	ENSP00000389140:N363T;ENSP00000397322:N211T	ENSP00000304146:N296T	N	+	2	0	DCC	48843775	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.881000	0.56152	2.276000	0.75962	0.528000	0.53228	AAT	.	.	.	none		0.363	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
RAX	30062	hgsc.bcm.edu	37	18	56936510	56936510	+	Missense_Mutation	SNP	G	G	C	rs568443004	byFrequency	TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr18:56936510G>C	ENST00000334889.3	-	3	953	c.767C>G	c.(766-768)gCg>gGg	p.A256G	RAX_ENST00000256852.7_3'UTR	NM_013435.2	NP_038463.2	Q9Y2V3	RX_HUMAN	retina and anterior neural fold homeobox	256					camera-type eye development (GO:0043010)|hypothalamus development (GO:0021854)|limb development (GO:0060173)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6		Lung NSC(161;0.0804)|Colorectal(73;0.0946)		STAD - Stomach adenocarcinoma(84;0.18)		GCTCTGCAGCGCCGTggcgcc	0.821																																					p.A256G	GBM(150;770 1898 17679 24325 37807)	Atlas-SNP	.											.	RAX	19	.	0			c.C767G						PASS	.						1.0	2.0	2.0					18																	56936510		490	1309	1799	SO:0001583	missense	30062	exon3			TGCAGCGCCGTGG	AF115392	CCDS11972.1	18q21.31	2011-06-20			ENSG00000134438	ENSG00000134438		"""Homeoboxes / PRD class"""	18662	protein-coding gene	gene with protein product		601881				10625658, 10766016, 14662654	Standard	NM_013435		Approved	RX	uc002lhx.3	Q9Y2V3	OTTHUMG00000132757	ENST00000334889.3:c.767C>G	chr18.hg19:g.56936510G>C	ENSP00000334813:p.Ala256Gly	59.0	0.0	.		77.0	50.0	.	NM_013435	Q86V11	Missense_Mutation	SNP	ENST00000334889.3	hg19	CCDS11972.1	.	.	.	.	.	.	.	.	.	.	G	16.47	3.133512	0.56828	.	.	ENSG00000134438	ENST00000334889	D	0.89746	-2.56	4.16	4.16	0.48862	.	0.386572	0.29218	N	0.012795	D	0.86460	0.5938	L	0.55481	1.735	0.43846	D	0.996431	B	0.27166	0.17	B	0.26693	0.072	D	0.85448	0.1159	10	0.49607	T	0.09	.	15.204	0.73162	0.0:0.0:1.0:0.0	.	256	Q9Y2V3	RX_HUMAN	G	256	ENSP00000334813:A256G	ENSP00000334813:A256G	A	-	2	0	RAX	55087490	0.943000	0.32029	0.727000	0.30756	0.605000	0.37080	5.576000	0.67437	1.854000	0.53819	0.561000	0.74099	GCG	.	.	.	none		0.821	RAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256128.2		
FSD1	79187	hgsc.bcm.edu	37	19	4306010	4306010	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr19:4306010C>A	ENST00000221856.6	+	2	230	c.83C>A	c.(82-84)tCc>tAc	p.S28Y	FSD1_ENST00000597590.1_Missense_Mutation_p.S28Y	NM_024333.2	NP_077309.1	Q9BTV5	FSD1_HUMAN	fibronectin type III and SPRY domain containing 1	28					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.034)|STAD - Stomach adenocarcinoma(1328;0.18)		TTTATCTACTCCCTGAAACAG	0.547																																					p.S28Y		Atlas-SNP	.											.	FSD1	51	.	0			c.C83A						PASS	.						135.0	134.0	134.0					19																	4306010		2203	4300	6503	SO:0001583	missense	79187	exon2			TCTACTCCCTGAA	AF316829	CCDS12127.1	19p13.3	2013-02-11	2005-03-01			ENSG00000105255		"""Fibronectin type III domain containing"""	13745	protein-coding gene	gene with protein product		609828	"""fibronectin type 3 and SPRY domain containing 1"""			11267680	Standard	NM_024333		Approved	MGC3213, MIR1	uc002lzy.2	Q9BTV5		ENST00000221856.6:c.83C>A	chr19.hg19:g.4306010C>A	ENSP00000221856:p.Ser28Tyr	118.0	0.0	.		82.0	34.0	.	NM_024333	B2RDT0|Q9BXN0|Q9HAG4	Missense_Mutation	SNP	ENST00000221856.6	hg19	CCDS12127.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.720049	0.48728	.	.	ENSG00000105255	ENST00000221856	T	0.47528	0.84	4.22	4.22	0.49857	B-box, C-terminal (1);	0.397945	0.25189	N	0.032470	T	0.49167	0.1541	L	0.46157	1.445	0.37051	D	0.897617	P;P	0.50528	0.936;0.823	P;P	0.50708	0.648;0.492	T	0.59584	-0.7427	10	0.72032	D	0.01	.	10.2079	0.43124	0.0:0.7967:0.2032:0.0	.	15;28	B4DIC5;Q9BTV5	.;FSD1_HUMAN	Y	28	ENSP00000221856:S28Y	ENSP00000221856:S28Y	S	+	2	0	FSD1	4257010	0.966000	0.33281	1.000000	0.80357	0.598000	0.36846	1.937000	0.40193	1.912000	0.55364	0.491000	0.48974	TCC	.	.	.	none		0.547	FSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458091.1	NM_024333	
CATSPERD	257062	hgsc.bcm.edu	37	19	5739405	5739405	+	Silent	SNP	A	A	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr19:5739405A>T	ENST00000381624.3	+	7	589	c.528A>T	c.(526-528)tcA>tcT	p.S176S	CATSPERD_ENST00000381614.2_5'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	176					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											TATATTATTCAAATACTGGGG	0.294																																					p.S176S		Atlas-SNP	.											.	.	.	.	0			c.A528T						PASS	.						85.0	84.0	85.0					19																	5739405		1795	4076	5871	SO:0001819	synonymous_variant	257062	exon7			TTATTCAAATACT	BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.528A>T	chr19.hg19:g.5739405A>T		81.0	0.0	.		67.0	20.0	.	NM_152784	Q6ZRP1	Silent	SNP	ENST00000381624.3	hg19	CCDS12149.2																																																																																			.	.	.	none		0.294	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286953.2	NM_152784	
MUC16	94025	hgsc.bcm.edu	37	19	9068211	9068211	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr19:9068211T>C	ENST00000397910.4	-	3	19438	c.19235A>G	c.(19234-19236)cAa>cGa	p.Q6412R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6414	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTCAGTGCCTTGGATGGATGT	0.483																																					p.Q6412R		Atlas-SNP	.											.	MUC16	4315	.	0			c.A19235G						PASS	.						178.0	178.0	178.0					19																	9068211		2041	4183	6224	SO:0001583	missense	94025	exon3			GTGCCTTGGATGG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.19235A>G	chr19.hg19:g.9068211T>C	ENSP00000381008:p.Gln6412Arg	165.0	0.0	.		146.0	6.0	.	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	2.917	-0.224039	0.06061	.	.	ENSG00000181143	ENST00000397910	T	0.02323	4.34	2.15	-3.61	0.04556	.	.	.	.	.	T	0.01489	0.0048	N	0.08118	0	.	.	.	B	0.18310	0.027	B	0.13407	0.009	T	0.45745	-0.9240	8	0.87932	D	0	.	3.206	0.06666	0.2279:0.0:0.3944:0.3778	.	6412	B5ME49	.	R	6412	ENSP00000381008:Q6412R	ENSP00000381008:Q6412R	Q	-	2	0	MUC16	8929211	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.511000	0.06321	-1.244000	0.02516	-1.830000	0.00593	CAA	.	.	.	none		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
IL12RB1	3594	hgsc.bcm.edu	37	19	18180414	18180414	+	Silent	SNP	G	G	A	rs371543581		TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr19:18180414G>A	ENST00000600835.2	-	11	1429	c.1131C>T	c.(1129-1131)gaC>gaT	p.D377D	IL12RB1_ENST00000593993.2_Silent_p.D377D			P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1	377	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-23-mediated signaling pathway (GO:0038155)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|interleukin-12 receptor complex (GO:0042022)|interleukin-23 receptor complex (GO:0072536)	cytokine receptor activity (GO:0004896)			endometrium(1)|kidney(1)|lung(3)|pancreas(1)|skin(2)	8						CAAGGCCCCCGTCCTGGCCCA	0.627																																					p.D377D		Atlas-SNP	.											.	IL12RB1	92	.	0			c.C1131T						PASS	.	G		0,4042		0,0,2021	57.0	63.0	61.0		1131	-8.4	0.0	19		61	2,8348		0,2,4173	no	coding-synonymous	IL12RB1	NM_005535.1		0,2,6194	AA,AG,GG		0.024,0.0,0.0161		377/663	18180414	2,12390	2021	4175	6196	SO:0001819	synonymous_variant	3594	exon10			GCCCCCGTCCTGG	U03187	CCDS32957.1, CCDS54232.1	19p13.1	2014-09-17						"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	5971	protein-coding gene	gene with protein product		601604		IL12RB		9284929	Standard	XM_005259893		Approved	CD212	uc002nhw.1	P42701		ENST00000600835.2:c.1131C>T	chr19.hg19:g.18180414G>A		39.0	0.0	.		20.0	10.0	.	NM_005535	A8K308|B2RPF1|B7ZKK3|Q8N6Q7	Silent	SNP	ENST00000600835.2	hg19	CCDS54232.1																																																																																			.	.	.	weak		0.627	IL12RB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466525.3		
NCAN	1463	hgsc.bcm.edu	37	19	19338444	19338444	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr19:19338444C>A	ENST00000252575.6	+	8	2114	c.2015C>A	c.(2014-2016)gCt>gAt	p.A672D	NCAN_ENST00000538881.1_Missense_Mutation_p.A123D	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	672					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	CCCTCCCCTGCTGCAGAGACC	0.617																																					p.A672D		Atlas-SNP	.											.	NCAN	277	.	0			c.C2015A						PASS	.						93.0	97.0	96.0					19																	19338444		2203	4300	6503	SO:0001583	missense	1463	exon8			CCCCTGCTGCAGA	AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.2015C>A	chr19.hg19:g.19338444C>A	ENSP00000252575:p.Ala672Asp	71.0	0.0	.		46.0	19.0	.	NM_004386	Q9UPK6	Missense_Mutation	SNP	ENST00000252575.6	hg19	CCDS12397.1	.	.	.	.	.	.	.	.	.	.	C	11.48	1.651240	0.29336	.	.	ENSG00000130287	ENST00000539499;ENST00000252575;ENST00000538881	D;D	0.85339	-1.85;-1.97	4.31	-1.71	0.08133	.	0.647616	0.12787	N	0.439143	T	0.68329	0.2989	L	0.27053	0.805	0.09310	N	1	B;B	0.18863	0.031;0.011	B;B	0.18263	0.021;0.006	T	0.51276	-0.8726	10	0.13853	T	0.58	.	3.5545	0.07860	0.1714:0.4363:0.0:0.3924	.	686;672	Q4LE67;O14594	.;NCAN_HUMAN	D	686;672;123	ENSP00000252575:A672D;ENSP00000442202:A123D	ENSP00000252575:A672D	A	+	2	0	NCAN	19199444	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.175000	0.09825	-0.268000	0.09312	-0.339000	0.08088	GCT	.	.	.	none		0.617	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460111.2	NM_004386	
ZNF737	100129842	hgsc.bcm.edu	37	19	20728068	20728068	+	Missense_Mutation	SNP	T	T	G	rs146757334	byFrequency	TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr19:20728068T>G	ENST00000427401.4	-	4	1035	c.941A>C	c.(940-942)aAa>aCa	p.K314T		NM_001159293.1	NP_001152765.1	O75373	ZN737_HUMAN	zinc finger protein 737	314					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	13						TTCTTCACATTTGTAGGGTTT	0.428																																					p.K314T		Atlas-SNP	.											.	ZNF737	50	.	0			c.A941C						PASS	.						35.0	34.0	34.0					19																	20728068		692	1591	2283	SO:0001583	missense	100129842	exon4			TCACATTTGTAGG	BC015765	CCDS54238.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	32468	protein-coding gene	gene with protein product		603984					Standard	NM_001159293		Approved	ZNF102	uc002npa.3	O75373		ENST00000427401.4:c.941A>C	chr19.hg19:g.20728068T>G	ENSP00000395733:p.Lys314Thr	91.0	0.0	.		67.0	29.0	.	NM_001159293	C9JHM3	Missense_Mutation	SNP	ENST00000427401.4	hg19	CCDS54238.1	.	.	.	.	.	.	.	.	.	.	-	9.442	1.088262	0.20390	.	.	ENSG00000237440	ENST00000427401	T	0.08458	3.09	0.801	0.801	0.18679	.	.	.	.	.	T	0.13670	0.0331	L	0.58925	1.835	0.09310	N	1	P	0.47409	0.895	P	0.52343	0.696	T	0.15549	-1.0433	9	0.66056	D	0.02	.	3.5302	0.07774	0.0:0.0:0.417:0.583	.	314	C9JHM3	.	T	314	ENSP00000395733:K314T	ENSP00000395733:K314T	K	-	2	0	ZNF737	20519908	0.000000	0.05858	0.183000	0.23137	0.184000	0.23303	-1.481000	0.02323	0.147000	0.19030	0.145000	0.16022	AAA	.	T|0.998;C|0.002	.	alt		0.428	ZNF737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447844.2	NM_145289	
RYR1	6261	hgsc.bcm.edu	37	19	38949843	38949843	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr19:38949843T>G	ENST00000359596.3	+	19	2225	c.2225T>G	c.(2224-2226)gTg>gGg	p.V742G	RYR1_ENST00000360985.3_Missense_Mutation_p.V742G|RYR1_ENST00000355481.4_Missense_Mutation_p.V742G			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	742	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CCTGAAGACGTGATCAGCTGC	0.632																																					p.V742G		Atlas-SNP	.											.	RYR1	708	.	0			c.T2225G						PASS	.						109.0	88.0	95.0					19																	38949843		2203	4300	6503	SO:0001583	missense	6261	exon19			AAGACGTGATCAG	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.2225T>G	chr19.hg19:g.38949843T>G	ENSP00000352608:p.Val742Gly	62.0	0.0	.		51.0	17.0	.	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	hg19	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	t	14.51	2.557863	0.45590	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.73152	-0.72;-0.72;-0.72	4.36	4.36	0.52297	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	U	0.000015	D	0.86834	0.6028	M	0.92691	3.335	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.89980	0.4100	10	0.87932	D	0	.	13.3946	0.60843	0.0:0.0:0.0:1.0	.	742;742	P21817-2;P21817	.;RYR1_HUMAN	G	742	ENSP00000352608:V742G;ENSP00000347667:V742G;ENSP00000354254:V742G	ENSP00000347667:V742G	V	+	2	0	RYR1	43641683	1.000000	0.71417	0.999000	0.59377	0.567000	0.35839	7.868000	0.87116	1.827000	0.53221	0.375000	0.23000	GTG	.	.	.	none		0.632	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
SUPT5H	6829	hgsc.bcm.edu	37	19	39964953	39964953	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr19:39964953T>C	ENST00000599117.1	+	28	3098	c.2731T>C	c.(2731-2733)Tac>Cac	p.Y911H	SUPT5H_ENST00000359191.6_Missense_Mutation_p.Y907H|SUPT5H_ENST00000402194.2_Missense_Mutation_p.Y907H|SUPT5H_ENST00000432763.2_Missense_Mutation_p.Y911H|SUPT5H_ENST00000598725.1_Missense_Mutation_p.Y911H			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	911	10 X 8 AA approximate tandem repeats of P-[TS]-P-S-P-[QA]-[SG]-Y, motif CTR2.|Pro-rich.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CCCCCAGAGCTACCACCAGGT	0.617											OREG0025462	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y911H		Atlas-SNP	.											.	SUPT5H	119	.	0			c.T2731C						PASS	.						76.0	73.0	74.0					19																	39964953		2203	4300	6503	SO:0001583	missense	6829	exon26			CAGAGCTACCACC	U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.2731T>C	chr19.hg19:g.39964953T>C	ENSP00000470252:p.Tyr911His	282.0	0.0	.	889	168.0	59.0	.	NM_003169	O43279|Q59G52|Q99639	Missense_Mutation	SNP	ENST00000599117.1	hg19	CCDS12536.1	.	.	.	.	.	.	.	.	.	.	T	17.21	3.330351	0.60743	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.64746	0.2626	L	0.54323	1.7	0.80722	D	1	P;D;B	0.56035	0.776;0.974;0.258	B;P;B	0.55391	0.258;0.775;0.054	T	0.64588	-0.6372	8	.	.	.	-16.7403	13.5134	0.61526	0.0:0.0:0.0:1.0	.	703;907;911	B4DJK4;O00267-2;O00267	.;.;SPT5H_HUMAN	H	911;907;889;911	.	.	Y	+	1	0	SUPT5H	44656793	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	5.927000	0.70080	2.034000	0.60081	0.379000	0.24179	TAC	.	.	.	none		0.617	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464918.1	NM_003169	
ZNF324B	388569	hgsc.bcm.edu	37	19	58966867	58966867	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr19:58966867G>T	ENST00000336614.4	+	4	663	c.556G>T	c.(556-558)Ggg>Tgg	p.G186W	ZNF324B_ENST00000391696.1_Missense_Mutation_p.G176W|ZNF324B_ENST00000545523.1_Missense_Mutation_p.G186W	NM_207395.2	NP_997278.2	Q6AW86	Z324B_HUMAN	zinc finger protein 324B	186					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		CCGGGTGCCTGGGAGGCAGCC	0.667																																					p.G186W		Atlas-SNP	.											.	ZNF324B	58	.	0			c.G556T						PASS	.						34.0	41.0	39.0					19																	58966867		2203	4300	6503	SO:0001583	missense	388569	exon4			GTGCCTGGGAGGC	AK127750	CCDS33138.1	19q13.43	2013-01-08				ENSG00000249471		"""Zinc fingers, C2H2-type"", ""-"""	33107	protein-coding gene	gene with protein product							Standard	NM_207395		Approved	FLJ45850	uc002qsv.1	Q6AW86		ENST00000336614.4:c.556G>T	chr19.hg19:g.58966867G>T	ENSP00000337473:p.Gly186Trp	89.0	0.0	.		51.0	24.0	.	NM_207395	B2RTZ6|Q6ZMX8|Q6ZS42	Missense_Mutation	SNP	ENST00000336614.4	hg19	CCDS33138.1	.	.	.	.	.	.	.	.	.	.	G	10.82	1.459539	0.26248	.	.	ENSG00000249471	ENST00000336614;ENST00000545523;ENST00000391696	T;T;T	0.08458	3.3;3.3;3.09	2.48	-2.19	0.07015	.	0.628796	0.13278	N	0.399985	T	0.12433	0.0302	L	0.32530	0.975	0.09310	N	1	D;D	0.69078	0.997;0.989	P;P	0.62813	0.907;0.775	T	0.13629	-1.0502	10	0.52906	T	0.07	.	7.2895	0.26358	0.4723:0.0:0.5277:0.0	.	186;176	Q6AW86;C9JTQ8	Z324B_HUMAN;.	W	186;186;176	ENSP00000337473:G186W;ENSP00000438930:G186W;ENSP00000375578:G176W	ENSP00000337473:G186W	G	+	1	0	ZNF324B	63658679	0.013000	0.17824	0.000000	0.03702	0.001000	0.01503	0.815000	0.27253	-0.429000	0.07329	-0.658000	0.03865	GGG	.	.	.	none		0.667	ZNF324B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467038.1	NM_207395	
ZNFX1	57169	hgsc.bcm.edu	37	20	47865692	47865692	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr20:47865692A>T	ENST00000396105.1	-	14	4115	c.3869T>A	c.(3868-3870)cTg>cAg	p.L1290Q	ZNFX1_ENST00000371752.1_Missense_Mutation_p.L1290Q|ZNFX1_ENST00000371754.4_Intron	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1290							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			CTCGCAGGGCAGGCTGCAGCC	0.582																																					p.L1290Q		Atlas-SNP	.											.	ZNFX1	194	.	0			c.T3869A						PASS	.						81.0	82.0	82.0					20																	47865692		2203	4300	6503	SO:0001583	missense	57169	exon14			CAGGGCAGGCTGC	AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.3869T>A	chr20.hg19:g.47865692A>T	ENSP00000379412:p.Leu1290Gln	125.0	0.0	.		145.0	86.0	.	NM_021035	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Missense_Mutation	SNP	ENST00000396105.1	hg19	CCDS13417.1	.	.	.	.	.	.	.	.	.	.	A	6.376	0.437429	0.12104	.	.	ENSG00000124201	ENST00000371752;ENST00000396105	D;D	0.86562	-2.14;-2.14	6.07	4.96	0.65561	.	0.307250	0.31370	N	0.007768	T	0.76828	0.4042	L	0.31926	0.97	0.26692	N	0.971326	B	0.12013	0.005	B	0.09377	0.004	T	0.59653	-0.7414	10	0.13853	T	0.58	-5.7428	6.7253	0.23353	0.6309:0.134:0.0:0.2351	.	1290	Q9P2E3	ZNFX1_HUMAN	Q	1290	ENSP00000360817:L1290Q;ENSP00000379412:L1290Q	ENSP00000360817:L1290Q	L	-	2	0	ZNFX1	47299099	0.988000	0.35896	1.000000	0.80357	0.983000	0.72400	1.024000	0.30077	1.080000	0.41073	0.533000	0.62120	CTG	.	.	.	none		0.582	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2	NM_021035	
SLC9A8	23315	hgsc.bcm.edu	37	20	48429466	48429466	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr20:48429466G>C	ENST00000361573.2	+	1	49	c.7G>C	c.(7-9)Gag>Cag	p.E3Q	SLC9A8_ENST00000541138.1_5'UTR|SLC9A8_ENST00000417961.1_Missense_Mutation_p.E3Q|SLC9A8_ENST00000539601.1_5'UTR			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8	3					ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			CAGGATGGGGGAGAAGATGGC	0.731																																					p.E3Q		Atlas-SNP	.											.	SLC9A8	63	.	0			c.G7C						PASS	.						22.0	27.0	25.0					20																	48429466		1595	2909	4504	SO:0001583	missense	23315	exon1			ATGGGGGAGAAGA	AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.7G>C	chr20.hg19:g.48429466G>C	ENSP00000354966:p.Glu3Gln	29.0	0.0	.		29.0	19.0	.	NM_001260491	B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Missense_Mutation	SNP	ENST00000361573.2	hg19	CCDS13421.1	.	.	.	.	.	.	.	.	.	.	G	15.72	2.916117	0.52546	.	.	ENSG00000197818	ENST00000417961;ENST00000361573	T;T	0.64618	-0.11;-0.11	5.78	3.74	0.42951	.	0.638943	0.14719	N	0.302454	T	0.38295	0.1035	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.15037	-1.0451	10	0.18710	T	0.47	.	9.5823	0.39495	0.0:0.1538:0.6865:0.1597	.	3;3	Q9Y2E8-2;Q9Y2E8	.;SL9A8_HUMAN	Q	3	ENSP00000416418:E3Q;ENSP00000354966:E3Q	ENSP00000354966:E3Q	E	+	1	0	SLC9A8	47862873	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.561000	0.36342	1.437000	0.47472	0.549000	0.68633	GAG	.	.	.	none		0.731	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106483.3	XM_030524	
CTCFL	140690	hgsc.bcm.edu	37	20	56099187	56099187	+	Silent	SNP	T	T	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr20:56099187T>C	ENST00000608263.1	-	1	736	c.75A>G	c.(73-75)aaA>aaG	p.K25K	CTCFL_ENST00000432255.2_Silent_p.K25K|CTCFL_ENST00000608440.1_Silent_p.K25K|CTCFL_ENST00000481655.2_Silent_p.K25K|CTCFL_ENST00000422869.2_Silent_p.K25K|CTCFL_ENST00000371196.2_Silent_p.K25K|CTCFL_ENST00000502686.2_Intron|CTCFL_ENST00000429804.3_Silent_p.K25K|CTCFL_ENST00000608858.1_Intron|CTCFL_ENST00000608903.1_Intron|CTCFL_ENST00000243914.3_Silent_p.K25K|CTCFL_ENST00000608158.1_Silent_p.K25K|CTCFL_ENST00000423479.3_Silent_p.K25K|CTCFL_ENST00000539382.1_Intron|CTCFL_ENST00000608425.1_Silent_p.K25K|CTCFL_ENST00000433949.3_Intron|CTCFL_ENST00000609232.1_Silent_p.K25K	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	25					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			CCTTCAGGCCTTTTTCCGGCA	0.502																																					p.K25K		Atlas-SNP	.											.,1	CTCFL	97	.	0			c.A75G						PASS	.						231.0	258.0	249.0					20																	56099187		2203	4300	6503	SO:0001819	synonymous_variant	140690	exon1			CAGGCCTTTTTCC		CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.75A>G	chr20.hg19:g.56099187T>C		49.0	0.0	.		54.0	3.0	.	NM_001269044	A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Silent	SNP	ENST00000608263.1	hg19	CCDS13459.1																																																																																			.	.	.	none		0.502	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472040.1	NM_080618	
DONSON	29980	hgsc.bcm.edu	37	21	34951869	34951869	+	Splice_Site	SNP	C	C	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr21:34951869C>A	ENST00000303071.5	-	9	1417		c.e9-1		DONSON_ENST00000453626.1_Intron|DONSON_ENST00000303113.6_Splice_Site|DONSON_ENST00000432378.1_Intron	NM_017613.3	NP_060083.1	Q9NYP3	DONS_HUMAN	downstream neighbor of SON						multicellular organismal development (GO:0007275)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|ovary(1)	11						CACTCCGTGCCTTCATGAAAA	0.378																																					.		Atlas-SNP	.											.	DONSON	34	.	0			c.1351-1G>T						PASS	.						99.0	92.0	94.0					21																	34951869		2203	4300	6503	SO:0001630	splice_region_variant	29980	exon10			CCGTGCCTTCATG	AF000002	CCDS13632.1	21q22.1	2008-07-31			ENSG00000159147	ENSG00000159147			2993	protein-coding gene	gene with protein product		611428		C21orf60		10773462, 10950926	Standard	NM_017613		Approved	B17, C2TA, DKFZP434M035	uc002ysk.4	Q9NYP3	OTTHUMG00000065904	ENST00000303071.5:c.1351-1G>T	chr21.hg19:g.34951869C>A		116.0	0.0	.		66.0	26.0	.	NM_017613	Q8NC53|Q9NSR9|Q9NVZ5|Q9NYP1|Q9NYP2	Splice_Site	SNP	ENST00000303071.5	hg19	CCDS13632.1	.	.	.	.	.	.	.	.	.	.	C	14.09	2.432562	0.43224	.	.	ENSG00000159147	ENST00000303113;ENST00000303071;ENST00000437395;ENST00000440810	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6299	0.95698	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DONSON	33873739	1.000000	0.71417	1.000000	0.80357	0.348000	0.29142	5.242000	0.65389	2.740000	0.93945	0.447000	0.29281	.	.	.	.	none		0.378	DONSON-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141184.1	NM_017613	Intron
NIPSNAP1	8508	hgsc.bcm.edu	37	22	29957632	29957632	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr22:29957632A>T	ENST00000216121.7	-	6	696	c.442T>A	c.(442-444)Tac>Aac	p.Y148N		NM_001202502.1|NM_003634.3	NP_001189431.1|NP_003625.2	Q9BPW8	NIPS1_HUMAN	nipsnap homolog 1 (C. elegans)	148					sensory perception of pain (GO:0019233)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|synaptic membrane (GO:0097060)	neurotransmitter binding (GO:0042165)	p.?(1)		large_intestine(2)|lung(2)|skin(1)	5						AACTCCAGGTACTCCTGTGGG	0.587																																					p.Y148N		Atlas-SNP	.											.	NIPSNAP1	17	.	1	Unknown(1)	lung(1)	c.T442A						PASS	.						99.0	92.0	94.0					22																	29957632		2203	4300	6503	SO:0001583	missense	8508	exon6			CCAGGTACTCCTG	AJ001258	CCDS13860.1	22q12	2013-09-12	2001-11-28		ENSG00000184117	ENSG00000184117			7827	protein-coding gene	gene with protein product	"""4-nitrophenylphosphatase domain and non-neuronal SNAP25-like 1"""	603249	"""NIPSNAP, C. elegans, homolog 1"""			9661659	Standard	NM_003634		Approved		uc003afx.4	Q9BPW8	OTTHUMG00000151294	ENST00000216121.7:c.442T>A	chr22.hg19:g.29957632A>T	ENSP00000216121:p.Tyr148Asn	49.0	0.0	.		30.0	19.0	.	NM_003634	B2RAY3|O43800	Missense_Mutation	SNP	ENST00000216121.7	hg19	CCDS13860.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.8|26.8	4.773116|4.773116	0.90108|0.90108	.|.	.|.	ENSG00000184117|ENSG00000184117	ENST00000415100|ENST00000216121;ENST00000437094	.|T;T	.|0.70631	.|0.91;-0.5	4.61|4.61	4.61|4.61	0.57282|0.57282	.|Dimeric alpha-beta barrel (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.76278|0.76278	0.3965|0.3965	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	.|P;P	.|0.52692	.|0.955;0.955	.|P;P	.|0.53450	.|0.726;0.635	T|T	0.79928|0.79928	-0.1596|-0.1596	5|10	.|0.87932	.|D	.|0	.|.	14.4366|14.4366	0.67284|0.67284	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|128;148	.|B4DQI7;Q9BPW8	.|.;NIPS1_HUMAN	E|N	164|148;13	.|ENSP00000216121:Y148N;ENSP00000403448:Y13N	.|ENSP00000216121:Y148N	V|Y	-|-	2|1	0|0	NIPSNAP1|NIPSNAP1	28287632|28287632	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.920000|0.920000	0.55202|0.55202	8.822000|8.822000	0.92013|0.92013	2.070000|2.070000	0.61991|0.61991	0.379000|0.379000	0.24179|0.24179	GTA|TAC	.	.	.	none		0.587	NIPSNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322117.1		
SMTN	6525	hgsc.bcm.edu	37	22	31486118	31486118	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr22:31486118C>A	ENST00000347557.2	+	8	1035	c.817C>A	c.(817-819)Cct>Act	p.P273T	SMTN_ENST00000333137.7_Missense_Mutation_p.P273T|SMTN_ENST00000358743.1_Missense_Mutation_p.P273T	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin	273	Pro-rich.				muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)			breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						CAAAGAGACCCCTGCTGCCCA	0.637																																					p.P329T		Atlas-SNP	.											.	SMTN	219	.	0			c.C985A						PASS	.						55.0	55.0	55.0					22																	31486118		2203	4300	6503	SO:0001583	missense	6525	exon7			GAGACCCCTGCTG	AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.817C>A	chr22.hg19:g.31486118C>A	ENSP00000328635:p.Pro273Thr	152.0	0.0	.		101.0	37.0	.	NM_001207018	O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Missense_Mutation	SNP	ENST00000347557.2	hg19	CCDS13886.1	.	.	.	.	.	.	.	.	.	.	C	4.350	0.064425	0.08388	.	.	ENSG00000183963	ENST00000358743;ENST00000347557;ENST00000333137;ENST00000329852;ENST00000404496	T;T;T	0.67698	0.14;-0.28;-0.28	4.14	0.863	0.19062	.	0.210963	0.24276	N	0.039954	T	0.42921	0.1224	N	0.17082	0.46	0.58432	D	0.999999	B;B;B;B;B;B	0.14438	0.01;0.003;0.006;0.007;0.003;0.01	B;B;B;B;B;B	0.15484	0.013;0.004;0.005;0.008;0.009;0.007	T	0.08576	-1.0715	10	0.26408	T	0.33	-1.1918	6.0239	0.19644	0.0:0.6593:0.0:0.3407	.	329;327;265;273;273;273	E7ETT8;B4E229;B5MC56;E7EWD0;P53814;P53814-5	.;.;.;.;SMTN_HUMAN;.	T	273;273;273;273;265	ENSP00000351593:P273T;ENSP00000328635:P273T;ENSP00000329532:P273T	ENSP00000329393:P273T	P	+	1	0	SMTN	29816118	0.130000	0.22417	0.941000	0.38009	0.108000	0.19459	0.092000	0.15066	0.289000	0.22422	-0.251000	0.11542	CCT	.	.	.	none		0.637	SMTN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321766.1	NM_134270	
PKDREJ	10343	hgsc.bcm.edu	37	22	46656408	46656408	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr22:46656408C>A	ENST00000253255.5	-	1	2811	c.2812G>T	c.(2812-2814)Gat>Tat	p.D938Y		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	938					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		CTACCGTTATCTGCAACTCCT	0.428																																					p.D938Y		Atlas-SNP	.											.	PKDREJ	195	.	0			c.G2812T						PASS	.						173.0	181.0	179.0					22																	46656408		2203	4300	6503	SO:0001583	missense	10343	exon1			CGTTATCTGCAAC	AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.2812G>T	chr22.hg19:g.46656408C>A	ENSP00000253255:p.Asp938Tyr	128.0	0.0	.		89.0	4.0	.	NM_006071	B1AJY3|O95850	Missense_Mutation	SNP	ENST00000253255.5	hg19	CCDS14073.1	.	.	.	.	.	.	.	.	.	.	C	11.98	1.800967	0.31869	.	.	ENSG00000130943	ENST00000253255	T	0.39056	1.1	5.33	-0.92	0.10475	.	0.787491	0.11134	N	0.595970	T	0.28333	0.0700	L	0.43152	1.355	0.09310	N	1	P	0.42337	0.776	B	0.32289	0.143	T	0.11372	-1.0590	10	0.66056	D	0.02	-2.6123	8.9992	0.36072	0.0:0.3715:0.4915:0.137	.	938	Q9NTG1	PKDRE_HUMAN	Y	938	ENSP00000253255:D938Y	ENSP00000253255:D938Y	D	-	1	0	PKDREJ	45035072	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	0.056000	0.14256	-0.198000	0.10333	-0.176000	0.13171	GAT	.	.	.	none		0.428	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071	
TBC1D22A	25771	hgsc.bcm.edu	37	22	47290719	47290719	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr22:47290719A>C	ENST00000337137.4	+	7	1043	c.877A>C	c.(877-879)Atc>Ctc	p.I293L	TBC1D22A_ENST00000407381.3_Missense_Mutation_p.I234L|TBC1D22A_ENST00000380995.1_Missense_Mutation_p.I246L|TBC1D22A_ENST00000406733.1_Missense_Mutation_p.I246L|TBC1D22A_ENST00000355704.3_Missense_Mutation_p.I215L	NM_001284304.1|NM_001284305.1|NM_014346.2	NP_001271233.1|NP_001271234.1|NP_055161.1	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	293	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						protein homodimerization activity (GO:0042803)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(3)|large_intestine(10)|lung(5)|ovary(2)|prostate(1)	22		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		TGAAGCGTTGATCCTGCAGCC	0.542																																					p.I293L		Atlas-SNP	.											.	TBC1D22A	54	.	0			c.A877C						PASS	.						206.0	154.0	172.0					22																	47290719		2203	4300	6503	SO:0001583	missense	25771	exon7			GCGTTGATCCTGC	AK125705	CCDS14078.1, CCDS63511.1, CCDS63512.1, CCDS74877.1	22q13	2008-01-22	2005-01-05	2005-01-05	ENSG00000054611	ENSG00000054611			1309	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 4"""	C22orf4			Standard	XM_005261496		Approved		uc003bib.3	Q8WUA7	OTTHUMG00000150332	ENST00000337137.4:c.877A>C	chr22.hg19:g.47290719A>C	ENSP00000336724:p.Ile293Leu	105.0	0.0	.		76.0	26.0	.	NM_014346	B0QYI2|B0QYI3|B9A6M3|Q5TE47|Q6ZUH2|Q92680|Q9BVD6|Q9UGG0|Q9UGT2|Q9UGU6|Q9UH25|Q9Y4W5	Missense_Mutation	SNP	ENST00000337137.4	hg19	CCDS14078.1	.	.	.	.	.	.	.	.	.	.	A	0.013	-1.608035	0.00842	.	.	ENSG00000054611	ENST00000337137;ENST00000380995;ENST00000407381;ENST00000355704;ENST00000406733	T;T;T;T;T	0.03801	3.8;3.8;3.8;3.8;3.8	5.06	1.7	0.24286	Rab-GAP/TBC domain (4);	0.340608	0.32719	N	0.005728	T	0.01905	0.0060	N	0.05306	-0.075	0.09310	N	0.999998	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.19666	0.001;0.026;0.006;0.001	T	0.48822	-0.9001	10	0.02654	T	1	.	6.5479	0.22416	0.6247:0.2948:0.0805:0.0	.	293;215;234;293	B9A6M3;Q8WUA7-2;B0QYI1;Q8WUA7	.;.;.;TB22A_HUMAN	L	293;246;234;215;246	ENSP00000336724:I293L;ENSP00000370383:I246L;ENSP00000384036:I234L;ENSP00000347932:I215L;ENSP00000385634:I246L	ENSP00000336724:I293L	I	+	1	0	TBC1D22A	45669383	0.985000	0.35326	0.000000	0.03702	0.074000	0.17049	2.196000	0.42686	-0.027000	0.13873	-0.291000	0.09656	ATC	.	.	.	none		0.542	TBC1D22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317600.3	NM_014346	
KDM6A	7403	hgsc.bcm.edu	37	X	44937747	44937747	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chrX:44937747T>G	ENST00000377967.4	+	19	2976	c.2935T>G	c.(2935-2937)Tta>Gta	p.L979V	KDM6A_ENST00000543216.1_Missense_Mutation_p.L900V|KDM6A_ENST00000382899.4_Missense_Mutation_p.L986V|KDM6A_ENST00000536777.1_Missense_Mutation_p.L934V	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	979	Interaction with SUPT6H. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						AGCTCTTAAGTTAGGTAAGCC	0.343			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																p.L979V	Colon(129;1273 1667 15230 27352 52914)	Atlas-SNP	.		Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	.	KDM6A	274	.	6	Whole gene deletion(6)	oesophagus(2)|breast(2)|pancreas(2)	c.T2935G						PASS	.						85.0	74.0	78.0					X																	44937747		2203	4300	6503	SO:0001583	missense	7403	exon19			CTTAAGTTAGGTA	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.2935T>G	chrX.hg19:g.44937747T>G	ENSP00000367203:p.Leu979Val	437.0	0.0	.		340.0	283.0	.	NM_021140	Q52LL9|Q5JVQ7	Missense_Mutation	SNP	ENST00000377967.4	hg19	CCDS14265.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.6|20.6	4.017728|4.017728	0.75161|0.75161	.|.	.|.	ENSG00000147050|ENSG00000147050	ENST00000334516;ENST00000377967;ENST00000536777;ENST00000382899;ENST00000543216|ENST00000414389;ENST00000433797	T;T;T;T|.	0.71103|.	-0.54;-0.54;-0.54;-0.54|.	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78521|0.78521	0.4296|0.4296	M|M	0.86268|0.86268	2.805|2.805	0.80722|0.80722	D|D	1|1	D;D;P;P;P;P|.	0.63880|.	0.993;0.974;0.797;0.864;0.921;0.944|.	D;D;P;B;D;P|.	0.70487|.	0.952;0.969;0.779;0.234;0.957;0.529|.	T|T	0.81357|0.81357	-0.0969|-0.0969	10|5	0.87932|.	D|.	0|.	-7.2923|-7.2923	14.4858|14.4858	0.67616|0.67616	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	618;986;934;1031;945;979|.	B4E0L8;F8W8R6;F5H6S1;B7ZKN5;B4E253;O15550|.	.;.;.;.;.;KDM6A_HUMAN|.	V|G	676;979;934;986;900|576;621	ENSP00000367203:L979V;ENSP00000437405:L934V;ENSP00000372355:L986V;ENSP00000443078:L900V|.	ENSP00000334340:L676V|.	L|V	+|+	1|2	2|0	KDM6A|KDM6A	44822691|44822691	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	5.449000|5.449000	0.66619|0.66619	1.800000|1.800000	0.52685|0.52685	0.437000|0.437000	0.28790|0.28790	TTA|GTT	.	.	.	none		0.343	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1	NM_021140	
HDAC6	10013	hgsc.bcm.edu	37	X	48661330	48661330	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chrX:48661330A>G	ENST00000334136.5	+	3	324	c.146A>G	c.(145-147)gAg>gGg	p.E49G	HDAC6_ENST00000469223.1_3'UTR|HDAC6_ENST00000376619.2_Missense_Mutation_p.E49G|HDAC6_ENST00000413163.2_5'UTR|HDAC6_ENST00000444343.2_Missense_Mutation_p.E63G			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	49					aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	AATCTAGCGGAGGTAAAGAAG	0.507																																					p.E49G	Pancreas(112;205 1675 2305 8976 15959)	Atlas-SNP	.											.	HDAC6	111	.	0			c.A146G						PASS	.						65.0	52.0	56.0					X																	48661330		2200	4300	6500	SO:0001583	missense	10013	exon3			TAGCGGAGGTAAA	AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.146A>G	chrX.hg19:g.48661330A>G	ENSP00000334061:p.Glu49Gly	202.0	0.0	.		149.0	120.0	.	NM_006044	O94975|Q6NT75|Q7L3E5|Q96CY0	Missense_Mutation	SNP	ENST00000334136.5	hg19	CCDS14306.1	.	.	.	.	.	.	.	.	.	.	A	18.70	3.679096	0.68042	.	.	ENSG00000094631	ENST00000423941;ENST00000438518;ENST00000376643;ENST00000444343;ENST00000376610;ENST00000334136;ENST00000376619;ENST00000436813;ENST00000441703;ENST00000426196;ENST00000443563;ENST00000440653	T;T;T	0.64085	-0.08;-0.07;-0.07	4.42	4.42	0.53409	.	0.513308	0.18131	N	0.150754	T	0.63674	0.2531	L	0.34521	1.04	0.80722	D	1	D;P;P	0.65815	0.995;0.919;0.827	P;P;P	0.57425	0.82;0.45;0.526	T	0.64449	-0.6405	10	0.54805	T	0.06	-19.7689	10.7808	0.46377	1.0:0.0:0.0:0.0	.	39;49;49	B4DZN1;Q9UBN7;Q9BRX7	.;HDAC6_HUMAN;.	G	49;49;49;63;49;49;49;49;49;49;49;49	ENSP00000398566:E63G;ENSP00000334061:E49G;ENSP00000365804:E49G	ENSP00000334061:E49G	E	+	2	0	HDAC6	48546274	1.000000	0.71417	0.468000	0.27192	0.916000	0.54674	4.544000	0.60691	1.744000	0.51775	0.486000	0.48141	GAG	.	.	.	none		0.507	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083394.2	NM_006044	
AMER1	139285	hgsc.bcm.edu	37	X	63412149	63412149	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chrX:63412149T>C	ENST00000330258.3	-	2	1290	c.1018A>G	c.(1018-1020)Atg>Gtg	p.M340V	AMER1_ENST00000403336.1_Missense_Mutation_p.M340V|AMER1_ENST00000374869.3_Missense_Mutation_p.M340V	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	340					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									CTGTCTGTCATACTGTCCATG	0.537																																					p.M340V		Atlas-SNP	.											.	.	.	.	67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)	c.A1018G						PASS	.						171.0	148.0	155.0					X																	63412149		2203	4300	6503	SO:0001583	missense	139285	exon2			CTGTCATACTGTC	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1018A>G	chrX.hg19:g.63412149T>C	ENSP00000329117:p.Met340Val	53.0	0.0	.		27.0	27.0	.	NM_152424	A2IB86|Q8N885	Missense_Mutation	SNP	ENST00000330258.3	hg19	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	T	4.090	0.014768	0.07959	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	T;T;T	0.15139	2.45;2.45;2.45	5.18	5.18	0.71444	.	0.097775	0.64402	D	0.000001	T	0.06050	0.0157	N	0.04508	-0.205	0.33997	D	0.64987	B	0.31383	0.321	B	0.29176	0.099	T	0.21042	-1.0257	10	0.05833	T	0.94	-11.8023	7.9073	0.29769	0.0:0.0931:0.0:0.9069	.	340	Q5JTC6	F123B_HUMAN	V	340	ENSP00000364003:M340V;ENSP00000329117:M340V;ENSP00000384722:M340V	ENSP00000329117:M340V	M	-	1	0	FAM123B	63328874	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.105000	0.41825	2.047000	0.60756	0.430000	0.28490	ATG	.	.	.	none		0.537	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
MT-ND4	4538	hgsc.bcm.edu	37	M	11126	11126	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chrM:11126G>A	ENST00000361381.2	+	1	367	c.367G>A	c.(367-369)Gaa>Aaa	p.E123K	MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	123					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						ATATCTTCTTCGAAACCACAC	0.413																																					p.E123K		Atlas-SNP	.											.	.	.	.	0			c.G367A						PASS	.																																			SO:0001583	missense	0	exon1			TTCTTCGAAACCA			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.367G>A	chrM.hg19:g.11126G>A	ENSP00000354961:p.Glu123Lys	39.0	0.0	.		73.0	29.0	.	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	hg19																																																																																				.	.	.	none		0.413	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
MT-ND5	4540	hgsc.bcm.edu	37	M	12838	12838	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chrM:12838G>A	ENST00000361567.2	+	1	502	c.502G>A	c.(502-504)Gcc>Acc	p.A168T	MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TL2_ENST00000387456.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TR_ENST00000387439.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	168					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CCAACACAGCAGCCATTCAAG	0.468																																					p.A168T		Atlas-SNP	.											.	.	.	.	0			c.G502A						PASS	.																																			SO:0001583	missense	0	exon1			ACAGCAGCCATTC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.502G>A	chrM.hg19:g.12838G>A	ENSP00000354813:p.Ala168Thr	30.0	0.0	.		63.0	16.0	.	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.	.	none		0.468	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
PPOX	5498	hgsc.bcm.edu	37	1	161140540	161140541	+	Frame_Shift_Ins	INS	-	-	CTTGGTCCATCTA			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr1:161140540_161140541insCTTGGTCCATCTA	ENST00000367999.4	+	11	1495_1496	c.1229_1230insCTTGGTCCATCTA	c.(1228-1233)tgcttgfs	p.-411fs	PPOX_ENST00000495483.1_3'UTR|PPOX_ENST00000352210.5_Frame_Shift_Ins_p.-411fs|PPOX_ENST00000432542.2_Frame_Shift_Ins_p.-156fs|PPOX_ENST00000535223.1_Frame_Shift_Ins_p.-74fs|B4GALT3_ENST00000470882.1_5'Flank|PPOX_ENST00000544598.1_Frame_Shift_Ins_p.-119fs	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase						heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CCGAGCCACTGCTTGGTCCATC	0.515																																					p.C410fs		Atlas-Indel,Pindel	.											.	PPOX	34	.	0			c.1229_1230insCTTGGTCCATCTA						PASS	.																																			SO:0001589	frameshift_variant	5498	exon11			.	BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	ENST00000367999.4:c.1230_1242dupCTTGGTCCATCTA	chr1.hg19:g.161140540_161140541insCTTGGTCCATCTA	ENSP00000356978:p.Leu411fs	78.0	0.0	0		60.0	10.0	0.166667	NM_001122764	D3DVG0|Q5VTW8	Frame_Shift_Ins	INS	ENST00000367999.4	hg19	CCDS1221.1																																																																																			.	.	.	none		0.515	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082993.1	NM_000309	
PYROXD2	84795	hgsc.bcm.edu	37	10	100152221	100152222	+	Frame_Shift_Ins	INS	-	-	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr10:100152221_100152222insT	ENST00000370575.4	-	10	1077_1078	c.1029_1030insA	c.(1027-1032)tcaccgfs	p.P344fs	PYROXD2_ENST00000483923.1_5'UTR|MIR1287_ENST00000408492.1_RNA	NM_032709.2	NP_116098.2	Q8N2H3	PYRD2_HUMAN	pyridine nucleotide-disulphide oxidoreductase domain 2	344							oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	12						GTGATCTGCGGTGATGTGTTGG	0.54																																					p.P344fs		Atlas-Indel,Pindel	.											.	PYROXD2	43	.	0			c.1030_1031insA						PASS	.																																			SO:0001589	frameshift_variant	84795	exon10			.	AK074429	CCDS7474.1	10q24.2	2009-04-22	2009-04-22	2009-04-22	ENSG00000119943	ENSG00000119943			23517	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 33"""	C10orf33			Standard	NM_032709		Approved	FLJ23849	uc001kpc.3	Q8N2H3	OTTHUMG00000018877	ENST00000370575.4:c.1030dupA	chr10.hg19:g.100152222_100152222dupT	ENSP00000359607:p.Pro344fs	60.0	0.0	0		67.0	45.0	0.671642	NM_032709	D3DR61|Q5TAA9|Q9BRQ1	Frame_Shift_Ins	INS	ENST00000370575.4	hg19	CCDS7474.1																																																																																			.	.	.	none		0.540	PYROXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049782.2	NM_032709	
MYO1B	4430	hgsc.bcm.edu	37	2	192206229	192206230	+	Frame_Shift_Ins	INS	-	-	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr2:192206229_192206230insA	ENST00000392318.3	+	5	636_637	c.389_390insA	c.(388-393)ggaaaafs	p.GK130fs	MYO1B_ENST00000339514.4_Frame_Shift_Ins_p.GK130fs|MYO1B_ENST00000392316.1_Frame_Shift_Ins_p.GK130fs|MYO1B_ENST00000304164.4_Frame_Shift_Ins_p.GK130fs	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	130	Myosin motor.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			GCTGTTTGTGGAAAAGGAGCAG	0.381																																					p.G130fs		Atlas-Indel,Pindel	.											.	MYO1B	160	.	0			c.389_390insA						PASS	.																																			SO:0001589	frameshift_variant	4430	exon5			.	L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.393dupA	chr2.hg19:g.192206233_192206233dupA	ENSP00000376132:p.Gly130fs	154.0	0.0	0		86.0	32.0	0.372093	NM_012223	O43794|Q7Z6L5	Frame_Shift_Ins	INS	ENST00000392318.3	hg19	CCDS46477.1																																																																																			.	.	.	none		0.381	MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334774.1	NM_012223	
PALB2	79728	hgsc.bcm.edu	37	16	23641617	23641624	+	Frame_Shift_Del	DEL	CAAAGTCT	CAAAGTCT	-			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	CAAAGTCT	CAAAGTCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr16:23641617_23641624delCAAAGTCT	ENST00000261584.4	-	5	2003_2010	c.1851_1858delAGACTTTG	c.(1849-1860)gaagactttggafs	p.DFG618fs		NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	618					DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		TTAAGAGGTCCAAAGTCTTCATCAGGTA	0.413			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																													p.618_620del		Atlas-Indel,Pindel	.	yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	.	PALB2	108	.	0			c.1852_1859del						PASS	.																																			SO:0001589	frameshift_variant	79728	exon5			.		CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.1851_1858delAGACTTTG	chr16.hg19:g.23641617_23641624delCAAAGTCT	ENSP00000261584:p.Asp618fs	207.0	0.0	0		201.0	102.0	0.507463	NM_024675	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Frame_Shift_Del	DEL	ENST00000261584.4	hg19	CCDS32406.1																																																																																			.	.	.	none		0.413	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435287.2	NM_024675	
ZNF490	57474	hgsc.bcm.edu	37	19	12693708	12693709	+	Frame_Shift_Ins	INS	-	-	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr19:12693708_12693709insT	ENST00000311437.6	-	4	427_428	c.305_306insA	c.(304-306)gacfs	p.D102fs	CTD-2192J16.20_ENST00000593682.1_5'Flank|ZNF490_ENST00000465656.1_5'Flank	NM_020714.2	NP_065765.1	Q9ULM2	ZN490_HUMAN	zinc finger protein 490	102	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	18						CAATATCCTGGTCTTTCCATTT	0.317																																					p.D102fs		Atlas-Indel,Pindel	.											.	ZNF490	42	.	0			c.306_307insA						PASS	.																																			SO:0001589	frameshift_variant	57474	exon4			.	AB033024	CCDS12272.1	19p13.2	2013-01-08			ENSG00000188033	ENSG00000188033		"""Zinc fingers, C2H2-type"", ""-"""	23705	protein-coding gene	gene with protein product							Standard	NM_020714		Approved	KIAA1198	uc002mtz.2	Q9ULM2	OTTHUMG00000156398	ENST00000311437.6:c.306dupA	chr19.hg19:g.12693709_12693709dupT	ENSP00000311521:p.Asp102fs	108.0	0.0	0		79.0	32.0	0.405063	NM_020714		Frame_Shift_Ins	INS	ENST00000311437.6	hg19	CCDS12272.1																																																																																			.	.	.	none		0.317	ZNF490-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344073.1	NM_020714	
SLC23A1	9963	hgsc.bcm.edu	37	5	138716053	138716054	+	Frame_Shift_Ins	INS	-	-	T			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr5:138716053_138716054insT	ENST00000348729.3	-	6	536_537	c.490_491insA	c.(490-492)agcfs	p.S164fs	SLC23A1_ENST00000503919.1_5'Flank|SLC23A1_ENST00000353963.3_Frame_Shift_Ins_p.S168fs	NM_005847.4	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 1	164					brain development (GO:0007420)|dehydroascorbic acid transport (GO:0070837)|L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|lung development (GO:0030324)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|brush border (GO:0005903)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular organelle (GO:0043229)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dehydroascorbic acid transporter activity (GO:0033300)|L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium ion transmembrane transporter activity (GO:0015081)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(5)|ovary(1)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	CTCCACCACGCTGGACACCATG	0.584																																					p.S168fs		Atlas-Indel,Pindel	.											.	SLC23A1	51	.	0			c.503_504insA						PASS	.																																			SO:0001589	frameshift_variant	9963	exon6			.	AF058317	CCDS4212.1, CCDS4213.1	5q31.2	2013-07-18	2013-07-18	2003-03-21	ENSG00000170482	ENSG00000170482		"""Solute carriers"""	10974	protein-coding gene	gene with protein product		603790	"""solute carrier family 23 (nucleobase transporters), member 2"""	SLC23A2		9804989, 10331392	Standard	NM_005847		Approved	YSPL3, SVCT1	uc003leg.3	Q9UHI7	OTTHUMG00000129228	ENST00000348729.3:c.491dupA	chr5.hg19:g.138716054_138716054dupT	ENSP00000302701:p.Ser164fs	110.0	0.0	0		94.0	33.0	0.351064	NM_152685	O95191|Q8WWB6|Q9UGH4|Q9UI39	Frame_Shift_Ins	INS	ENST00000348729.3	hg19	CCDS4212.1																																																																																			.	.	.	none		0.584	SLC23A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374185.1	NM_152685	
ANKIB1	54467	hgsc.bcm.edu	37	7	92021609	92021609	+	Intron	DEL	A	A	-			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr7:92021609delA	ENST00000265742.3	+	17	2659					NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1								zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CACCAGAGGTAATTGTTTTAT	0.338																																					.		Atlas-Indel,Pindel	.											.	ANKIB1	92	.	0			c.2283+2A>-						PASS	.						335.0	324.0	328.0					7																	92021609		1826	4066	5892	SO:0001627	intron_variant	54467	exon17			.	AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.2283+3A>-	chr7.hg19:g.92021609delA		127.0	0.0	0		200.0	74.0	0.37	NM_019004	Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Splice_Site	DEL	ENST00000265742.3	hg19	CCDS47639.1																																																																																			.	.	.	none		0.338	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342018.1		
ZBTB25	7597	hgsc.bcm.edu	37	14	64957106	64957106	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr14:64957106delA	ENST00000608382.1	-	2	337	c.146delT	c.(145-147)ttcfs	p.F49fs	ZBTB25_ENST00000555424.1_Frame_Shift_Del_p.F49fs|ZBTB25_ENST00000394715.1_Frame_Shift_Del_p.F49fs|ZBTB25_ENST00000555220.1_Frame_Shift_Del_p.F49fs	NM_006977.2	NP_008908.2	P24278	ZBT25_HUMAN	zinc finger and BTB domain containing 25	49	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				gene expression (GO:0010467)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(2)|skin(2)	10				all cancers(60;0.00865)|OV - Ovarian serous cystadenocarcinoma(108;0.0102)|BRCA - Breast invasive adenocarcinoma(234;0.0469)		TATCATCTTGAAATAGTTAGA	0.313																																					p.F49fs		Atlas-Indel,Pindel	.											.	ZBTB25	27	.	0			c.147delC						PASS	.						58.0	60.0	59.0					14																	64957106		2203	4300	6503	SO:0001589	frameshift_variant	7597	exon2			.	X16576	CCDS9765.1	14q23-q24	2013-01-08	2005-05-22	2005-05-22	ENSG00000089775	ENSG00000089775		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13112	protein-coding gene	gene with protein product		194541	"""zinc finger protein 46 (KUP)"", ""chromosome 14 open reading frame 51"""	ZNF46, C14orf51			Standard	NM_006977		Approved	KUP	uc001xhf.3	P24278	OTTHUMG00000141310	ENST00000608382.1:c.146delT	chr14.hg19:g.64957106delA	ENSP00000476746:p.Phe49fs	364.0	0.0	0		285.0	113.0	0.396491	NM_006977	B3KUX6|Q8IYH9	Frame_Shift_Del	DEL	ENST00000608382.1	hg19	CCDS9765.1																																																																																			.	.	.	none		0.313	ZBTB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280649.2	NM_006977	
KDM7A	80853	hgsc.bcm.edu	37	7	139818990	139818990	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr7:139818990delG	ENST00000397560.2	-	9	1266	c.1169delC	c.(1168-1170)acafs	p.T390fs	JHDM1D_ENST00000006967.5_Frame_Shift_Del_p.T390fs	NM_030647.1	NP_085150.1	Q6ZMT4	KDM7A_HUMAN		390					histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|midbrain development (GO:0030901)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)	22	Melanoma(164;0.0142)					AAGATCTGGTGTTTTTAGCCT	0.308																																					p.T390fs		Atlas-Indel,Pindel	.											.	JHDM1D	54	.	0			c.1170delA						PASS	.						132.0	129.0	130.0					7																	139818990		1792	4064	5856	SO:0001589	frameshift_variant	80853	exon9			.																												ENST00000397560.2:c.1169delC	chr7.hg19:g.139818990delG	ENSP00000380692:p.Thr390fs	128.0	0.0	0		221.0	95.0	0.429864	NM_030647	A4D1S9|C9JJH9|C9JQU2|Q6MZL8|Q9C0E5	Frame_Shift_Del	DEL	ENST00000397560.2	hg19	CCDS43658.1																																																																																			.	.	.	none		0.308	JHDM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348460.1		
APBA2	321	hgsc.bcm.edu	37	15	29346965	29346966	+	Frame_Shift_Ins	INS	-	-	CT			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr15:29346965_29346966insCT	ENST00000558402.1	+	5	1477_1478	c.878_879insCT	c.(877-882)cccggafs	p.G294fs	APBA2_ENST00000558330.1_Frame_Shift_Ins_p.G294fs|APBA2_ENST00000561069.1_Frame_Shift_Ins_p.G294fs|APBA2_ENST00000411764.1_Frame_Shift_Ins_p.G294fs|APBA2_ENST00000558259.1_Frame_Shift_Ins_p.G294fs			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	294					in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		GCCAAGCACCCCGGAGACCCCC	0.663																																					p.P293fs		Atlas-INDEL	.											.	APBA2	132	.	0			c.878_879insCT						PASS	.																																			SO:0001589	frameshift_variant	321	exon3			.	AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	Exception_encountered	chr15.hg19:g.29346965_29346966insCT	ENSP00000453293:p.Gly294fs	32.0	0.0	0		26.0	10.0	0.384615	NM_005503	E9PGI4|O60571|Q5XKC0	Frame_Shift_Ins	INS	ENST00000558402.1	hg19	CCDS10022.1																																																																																			.	.	.	none		0.663	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251362.3	NM_005503	
ELL2	22936	hgsc.bcm.edu	37	5	95234239	95234240	+	Frame_Shift_Ins	INS	-	-	AGGTCTTG			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr5:95234239_95234240insAGGTCTTG	ENST00000237853.4	-	8	1578_1579	c.1229_1230insCAAGACCT	c.(1228-1230)ctafs	p.-410fs	ELL2_ENST00000431061.2_Frame_Shift_Ins_p.-160fs	NM_012081.5	NP_036213.2	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2						regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|transcription elongation from RNA polymerase II promoter (GO:0006368)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	24		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		TGTCAACAGGTAGGTCTTGAGT	0.485																																					p.L410fs		Atlas-Indel,Pindel	.											.	ELL2	63	.	0			c.1230_1231insCAAGACCT						PASS	.																																			SO:0001589	frameshift_variant	22936	exon8			.	U88629	CCDS4080.1	5q15	2010-11-29			ENSG00000118985	ENSG00000118985			17064	protein-coding gene	gene with protein product		601874				9108030	Standard	NM_012081		Approved		uc003klr.4	O00472	OTTHUMG00000122085	ENST00000237853.4:c.1222_1229dupCAAGACCT	chr5.hg19:g.95234240_95234247dupAGGTCTTG	ENSP00000237853:p.Leu410fs	170.0	0.0	0		137.0	32.0	0.233577	NM_012081	B4DNK7	Frame_Shift_Ins	INS	ENST00000237853.4	hg19	CCDS4080.1																																																																																			.	.	.	none		0.485	ELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242846.1	NM_012081	
IGSF22	283284	hgsc.bcm.edu	37	11	18738437	18738444	+	Frame_Shift_Del	DEL	ACTTCCAC	ACTTCCAC	-			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	ACTTCCAC	ACTTCCAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr11:18738437_18738444delACTTCCAC	ENST00000513874.1	-	10	1216_1223	c.1077_1084delGTGGAAGT	c.(1075-1086)gtgtggaagttcfs	p.WKF360fs	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	360										NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						TTCCCATTGAACTTCCACACAAAGTTGG	0.505																																					p.360_362del		Atlas-Indel,Pindel	.											.	IGSF22	211	.	0			c.1078_1085del						PASS	.																																			SO:0001589	frameshift_variant	283284	exon10			.	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.1077_1084delGTGGAAGT	chr11.hg19:g.18738437_18738444delACTTCCAC	ENSP00000421191:p.Trp360fs	159.0	0.0	0		101.0	23.0	0.227723	NM_173588	A6NNA0|D6RGV7	Frame_Shift_Del	DEL	ENST00000513874.1	hg19	CCDS41625.2																																																																																			.	.	.	none		0.505	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2	NM_173588	
FAM71F2	346653	hgsc.bcm.edu	37	7	128315824	128315824	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr7:128315824delT	ENST00000480462.1	+	2	382	c.276delT	c.(274-276)aatfs	p.N92fs	FAM71F2_ENST00000378704.3_Frame_Shift_Del_p.N83fs|FAM71F2_ENST00000460349.1_3'UTR|FAM71F2_ENST00000477515.1_Frame_Shift_Del_p.N92fs			Q6NXP2	F71F2_HUMAN	family with sequence similarity 71, member F2	92										NS(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(2)	7						CACTCCCCAATGTCCTCCTGA	0.602																																					p.N92fs		Atlas-INDEL	.											.	FAM71F2	19	.	0			c.275delA						PASS	.						48.0	47.0	47.0					7																	128315824		1941	4152	6093	SO:0001589	frameshift_variant	346653	exon2			.	BC047310	CCDS47701.1, CCDS47702.1	7q32.1	2009-04-17	2007-11-20	2007-11-20	ENSG00000205085	ENSG00000205085			27998	protein-coding gene	gene with protein product			"""family with sequence similarity 137, member B"""	FAM137B		12477932	Standard	XM_006715964		Approved		uc003vnk.4	Q6NXP2	OTTHUMG00000158275	ENST00000480462.1:c.276delT	chr7.hg19:g.128315824delT	ENSP00000420140:p.Asn92fs	50.0	0.0	0		69.0	34.0	0.492754	NM_001012454	Q0VGF6|Q0VGF7|Q86X39	Frame_Shift_Del	DEL	ENST00000480462.1	hg19	CCDS47701.1																																																																																			.	.	.	none		0.602	FAM71F2-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350537.1		
ZFC3H1	196441	hgsc.bcm.edu	37	12	72017305	72017306	+	Frame_Shift_Ins	INS	-	-	CCATG			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr12:72017305_72017306insCCATG	ENST00000378743.3	-	24	4936_4937	c.4578_4579insCATGG	c.(4576-4581)tggttgfs	p.L1527fs		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1527					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						ATGTAGGCCAACCATGCCAAAC	0.307																																					p.L1527fs		Atlas-Indel,Pindel	.											.	ZFC3H1	172	.	0			c.4579_4580insCATGG						PASS	.																																			SO:0001589	frameshift_variant	196441	exon24			.	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.4574_4578dupCATGG	chr12.hg19:g.72017306_72017310dupCCATG	ENSP00000368017:p.Leu1527fs	106.0	0.0	0		204.0	77.0	0.377451	NM_144982	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Frame_Shift_Ins	INS	ENST00000378743.3	hg19	CCDS41813.1																																																																																			.	.	.	none		0.307	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982	
GBA2	57704	hgsc.bcm.edu	37	9	35736483	35736484	+	IGR	INS	-	-	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr9:35736483_35736484insA	ENST00000378103.3	-	0	3611				GBA2_ENST00000467252.1_5'Flank|CREB3_ENST00000486056.1_3'UTR|CREB3_ENST00000353704.2_Frame_Shift_Ins_p.Q293fs	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2						bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			ACAGCACACACCAGTGGTTGGA	0.619											OREG0019176	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H292fs		Atlas-Indel,Pindel	.											.	CREB3	24	.	0			c.876_877insA						PASS	.																																			SO:0001628	intergenic_variant	10488	exon9			.	AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024		chr9.hg19:g.35736483_35736484insA		77.0	0.0	0	857	44.0	19.0	0.431818	NM_006368	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Frame_Shift_Ins	INS	ENST00000378103.3	hg19	CCDS6589.1																																																																																			.	.	.	none		0.619	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1	NM_020944	
HIC2	23119	hgsc.bcm.edu	37	22	21799452	21799458	+	Frame_Shift_Del	DEL	TCCACAG	TCCACAG	-			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	TCCACAG	TCCACAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr22:21799452_21799458delTCCACAG	ENST00000443632.2	+	2	640_646	c.268_274delTCCACAG	c.(268-276)tccacagtgfs	p.STV90fs	HIC2_ENST00000407598.2_Frame_Shift_Del_p.STV90fs|HIC2_ENST00000407464.2_Frame_Shift_Del_p.STV90fs			Q96JB3	HIC2_HUMAN	hypermethylated in cancer 2	90	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(1)|endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16	Melanoma(16;0.000465)|Ovarian(15;0.00438)|Colorectal(54;0.0968)	Lung SC(17;0.0262)|all_lung(157;0.205)				CATGGTCAGCTCCACAGTGTTCCAGCA	0.585																																					p.89_91del	NSCLC(23;437 858 2282 27947 40366)	Atlas-INDEL	.											.	HIC2	42	.	0			c.267_273del						PASS	.																																			SO:0001589	frameshift_variant	23119	exon3			.	AB028943	CCDS13789.1	22q11.21	2013-01-09			ENSG00000169635	ENSG00000169635		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18595	protein-coding gene	gene with protein product		607712				11554746	Standard	NM_015094		Approved	KIAA1020, HRG22, ZBTB30, ZNF907	uc002zur.4	Q96JB3	OTTHUMG00000150781	ENST00000443632.2:c.268_274delTCCACAG	chr22.hg19:g.21799452_21799458delTCCACAG	ENSP00000387757:p.Ser90fs	72.0	0.0	0		40.0	11.0	0.275	NM_015094	Q504T6|Q96KR3|Q9NSM9|Q9UPX9	Frame_Shift_Del	DEL	ENST00000443632.2	hg19	CCDS13789.1																																																																																			.	.	.	none		0.585	HIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320061.2		
KRT19	3880	hgsc.bcm.edu	37	17	39684113	39684113	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr17:39684113delG	ENST00000361566.3	-	1	447	c.387delC	c.(385-387)cacfs	p.H129fs		NM_002276.4	NP_002267.2	P08727	K1C19_HUMAN	keratin 19	129	Linker 1.|Rod.				cell differentiation involved in embryonic placenta development (GO:0060706)|response to estrogen (GO:0043627)|sarcomere organization (GO:0045214)|viral process (GO:0016032)	cell periphery (GO:0071944)|costamere (GO:0043034)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	12		Breast(137;0.00038)				TCGTGTAGTAGTGGCTGTAGT	0.706																																					p.Y130fs		Atlas-Indel,Pindel	.											.	KRT19	41	.	0			c.388delT						PASS	.						28.0	35.0	33.0					17																	39684113		2199	4298	6497	SO:0001589	frameshift_variant	3880	exon1			.		CCDS11399.1	17q21.2	2013-06-20			ENSG00000171345	ENSG00000171345		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6436	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 19"", ""keratin, type I, 40-kd"", ""cytokeratin 19"", ""40-kDa keratin intermediate filament"""	148020				16831889	Standard	NM_002276		Approved	K19, CK19, K1CS, MGC15366		P08727	OTTHUMG00000133422	ENST00000361566.3:c.387delC	chr17.hg19:g.39684113delG	ENSP00000355124:p.His129fs	93.0	0.0	0		76.0	28.0	0.368421	NM_002276	B2R874|Q5XG83|Q6NW33|Q7L5M9|Q96A53|Q96FV1|Q9BYF9|Q9P1Y4	Frame_Shift_Del	DEL	ENST00000361566.3	hg19	CCDS11399.1																																																																																			.	.	.	none		0.706	KRT19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257285.1	NM_002276	
RNF123	63891	hgsc.bcm.edu	37	3	49740161	49740162	+	Frame_Shift_Ins	INS	-	-	A			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr3:49740161_49740162insA	ENST00000327697.6	+	20	1869_1870	c.1725_1726insA	c.(1726-1728)aatfs	p.N576fs	RNF123_ENST00000432042.1_Frame_Shift_Ins_p.N430fs	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	576					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		ACAAGGCTTCCAATCCTCATGC	0.569																																					p.S575fs		Atlas-Indel,Pindel	.											.	RNF123	100	.	0			c.1725_1726insA						PASS	.																																			SO:0001589	frameshift_variant	63891	exon20			.	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.1727dupA	chr3.hg19:g.49740163_49740163dupA	ENSP00000328287:p.Asn576fs	65.0	0.0	0		68.0	14.0	0.205882	NM_022064	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Frame_Shift_Ins	INS	ENST00000327697.6	hg19	CCDS33758.1																																																																																			.	.	.	none		0.569	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
TNRC18	84629	hgsc.bcm.edu	37	7	5352663	5352665	+	In_Frame_Del	DEL	GAT	GAT	-			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	GAT	GAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr7:5352663_5352665delGAT	ENST00000430969.1	-	27	8205_8207	c.7857_7859delATC	c.(7855-7860)tcatcc>tcc	p.2619_2620SS>S	TNRC18_ENST00000399537.4_In_Frame_Del_p.2619_2620SS>S	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2619	Ser-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		ggaggaggaggatgaggaggagg	0.66																																					p.2620_2620del		Atlas-INDEL	.											.	TNRC18	311	.	0			c.7858_7860del						PASS	.			411,3111		85,241,1435						-7.4	0.0			7	664,5958		120,424,2767	no	coding	TNRC18	NM_001080495.2		205,665,4202	A1A1,A1R,RR		10.0272,11.6695,10.5974				1075,9069				SO:0001651	inframe_deletion	84629	exon27			.	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.7857_7859delATC	chr7.hg19:g.5352663_5352665delGAT	ENSP00000395538:p.Ser2671del	8.0	0.0	0		18.0	11.0	0.611111	NM_001080495	A8MX41|Q96JH1|Q96K91	In_Frame_Del	DEL	ENST00000430969.1	hg19	CCDS47534.1																																																																																			.	.	.	none		0.660	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
FAM71F2	346653	hgsc.bcm.edu	37	7	128315818	128315818	+	Frame_Shift_Del	DEL	C	C	-			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr7:128315818delC	ENST00000480462.1	+	2	376	c.270delC	c.(268-270)ctcfs	p.L90fs	FAM71F2_ENST00000378704.3_Frame_Shift_Del_p.L81fs|FAM71F2_ENST00000460349.1_3'UTR|FAM71F2_ENST00000477515.1_Frame_Shift_Del_p.L90fs			Q6NXP2	F71F2_HUMAN	family with sequence similarity 71, member F2	90										NS(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(2)	7						CCCTGCCACTCCCCAATGTCC	0.592																																					p.L90fs		Pindel	.											.	FAM71F2	19	.	0			c.269delT						PASS	.						46.0	46.0	46.0					7																	128315818		1942	4148	6090	SO:0001589	frameshift_variant	346653	exon2			.	BC047310	CCDS47701.1, CCDS47702.1	7q32.1	2009-04-17	2007-11-20	2007-11-20	ENSG00000205085	ENSG00000205085			27998	protein-coding gene	gene with protein product			"""family with sequence similarity 137, member B"""	FAM137B		12477932	Standard	XM_006715964		Approved		uc003vnk.4	Q6NXP2	OTTHUMG00000158275	ENST00000480462.1:c.270delC	chr7.hg19:g.128315818delC	ENSP00000420140:p.Leu90fs	52.0	0.0	.		65.0	10.0	0.154	NM_001012454	Q0VGF6|Q0VGF7|Q86X39	Frame_Shift_Del	DEL	ENST00000480462.1	hg19	CCDS47701.1																																																																																			.	.	.	none		0.592	FAM71F2-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350537.1		
COL4A3	1285	hgsc.bcm.edu	37	2	228176530	228176530	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr2:228176530delG	ENST00000396578.3	+	52	5119	c.4957delG	c.(4957-4959)gggfs	p.G1653fs	AC097662.2_ENST00000439598.2_RNA|AC097662.2_ENST00000433324.1_RNA|AC097662.2_ENST00000396588.2_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	1653	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		TGTGAAAGCTGGGGAATTAGA	0.318																																					p.A1652fs		Pindel	.											.	COL4A3	293	.	0			c.4956delT						PASS	.						62.0	62.0	62.0					2																	228176530		1802	4070	5872	SO:0001589	frameshift_variant	1285	exon52			.		CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.4957delG	chr2.hg19:g.228176530delG	ENSP00000379823:p.Gly1653fs	642.0	0.0	.		502.0	112.0	0.223	NM_000091	Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Frame_Shift_Del	DEL	ENST00000396578.3	hg19	CCDS42829.1																																																																																			.	.	.	none		0.318	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331409.2	NM_000091	
SPTLC1	10558	hgsc.bcm.edu	37	9	94821586	94821604	+	Splice_Site	DEL	TATCTCTGCAAGGAAAAGA	TATCTCTGCAAGGAAAAGA	-	rs575148158|rs376271947		TCGA-SX-A7SS-01A-11D-A35Z-10	TCGA-SX-A7SS-10A-01D-A35Z-10	TATCTCTGCAAGGAAAAGA	TATCTCTGCAAGGAAAAGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a5b9c2f-52f8-4f4c-864e-288f4a31f85f	b78095c0-dd7d-406b-9d5c-0e0a56f03118	g.chr9:94821586_94821604delTATCTCTGCAAGGAAAAGA	ENST00000262554.2	-	7	566_570	c.561_565delTCTTTTCCTTGCAGAGATA	c.(559-567)gttcttttc>gttc	p.LF188fs	SPTLC1_ENST00000482632.1_5'UTR	NM_006415.2	NP_006406.1	O15269	SPTC1_HUMAN	serine palmitoyltransferase, long chain base subunit 1	188					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)|SPOTS complex (GO:0035339)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)	p.?(1)		breast(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14					L-Serine(DB00133)	CAGGCAGCTCTATCTCTGCAAGGAAAAGAGATCCACCAA	0.402																																					p.187_189del		Pindel	.											.	SPTLC1	42	.	1	Unknown(1)	ovary(1)	c.561_566del						PASS	.																																			SO:0001630	splice_region_variant	10558	exon7			.	Y08685	CCDS6692.1, CCDS6693.1	9q22.31	2014-09-17	2003-12-02		ENSG00000090054	ENSG00000090054	2.3.1.50		11277	protein-coding gene	gene with protein product		605712	"""hereditary sensory neuropathy, type 1"""	HSN1		9363775	Standard	NM_006415		Approved	LCB1, SPTI, HSAN1, hLCB1	uc004arl.1	O15269	OTTHUMG00000021047	ENST00000262554.2:c.561-1TCTTTTCCTTGCAGAGATA>-	chr9.hg19:g.94821586_94821604delTATCTCTGCAAGGAAAAGA		82.0	0.0	.		52.0	10.0	0.192	NM_006415	A8K681|Q5VWB4|Q96IX6	In_Frame_Del	DEL	ENST00000262554.2	hg19	CCDS6692.1																																																																																			.	.	.	none		0.402	SPTLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055553.1	NM_006415	Frame_Shift_Del
