#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DMAP1	55929	hgsc.bcm.edu	37	1	44680529	44680529	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr1:44680529G>A	ENST00000372289.2	+	3	615	c.352G>A	c.(352-354)Gcg>Acg	p.A118T	DMAP1_ENST00000361745.6_Missense_Mutation_p.A118T|DMAP1_ENST00000488433.1_3'UTR|DMAP1_ENST00000315913.5_Missense_Mutation_p.A118T	NM_019100.4	NP_061973.1	Q9NPF5	DMAP1_HUMAN	DNA methyltransferase 1 associated protein 1	118					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA methylation (GO:0006306)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription factor import into nucleus (GO:0042993)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|RNA polymerase II repressing transcription factor binding (GO:0001103)|transcription corepressor activity (GO:0003714)			breast(1)|cervix(1)|endometrium(6)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(166;0.155)					GCGACGTGCAGCGGAGGAGGG	0.572																																					p.A118T		Atlas-SNP	.											.	DMAP1	35	.	0			c.G352A						PASS	.						79.0	70.0	73.0					1																	44680529		2203	4300	6503	SO:0001583	missense	55929	exon4			CGTGCAGCGGAGG	AB037846	CCDS509.1	1p34	2009-07-13			ENSG00000178028	ENSG00000178028			18291	protein-coding gene	gene with protein product		605077				10888872, 10718198	Standard	XM_005271039		Approved	DNMAP1, FLJ11543, KIAA1425, DNMTAP1, EAF2, MEAF2, SWC4	uc001clq.1	Q9NPF5	OTTHUMG00000007577	ENST00000372289.2:c.352G>A	chr1.hg19:g.44680529G>A	ENSP00000361363:p.Ala118Thr	106.0	0.0	.		150.0	60.0	.	NM_001034023	A8K001|D3DPY8|Q0JSM4|Q5TG41|Q7Z3H7|Q9H0S8|Q9P2C2	Missense_Mutation	SNP	ENST00000372289.2	hg19	CCDS509.1	.	.	.	.	.	.	.	.	.	.	G	17.21	3.332860	0.60853	.	.	ENSG00000178028	ENST00000361745;ENST00000446292;ENST00000372283;ENST00000440641;ENST00000436069;ENST00000437511;ENST00000315913;ENST00000372289;ENST00000372290	T;T;T;T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83	5.27	5.27	0.74061	.	0.048507	0.85682	D	0.000000	T	0.28067	0.0692	N	0.20610	0.595	0.80722	D	1	B;B;B;B;D;B	0.62365	0.126;0.383;0.056;0.335;0.991;0.126	B;B;B;B;P;B	0.58820	0.031;0.343;0.029;0.19;0.846;0.031	T	0.02037	-1.1225	10	0.12103	T	0.63	-11.2103	14.1424	0.65327	0.0:0.0:0.85:0.15	.	118;118;118;118;144;118	B4DQG8;B4DEF2;B4DTH3;B4DTU6;B4DU03;Q9NPF5	.;.;.;.;.;DMAP1_HUMAN	T	118;118;144;118;144;144;118;118;89	ENSP00000354697:A118T;ENSP00000409200:A118T;ENSP00000401099:A118T;ENSP00000400269:A144T;ENSP00000402494:A144T;ENSP00000312697:A118T;ENSP00000361363:A118T;ENSP00000361364:A89T	ENSP00000312697:A118T	A	+	1	0	DMAP1	44453116	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	7.447000	0.80620	2.614000	0.88457	0.655000	0.94253	GCG	.	.	.	none		0.572	DMAP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020027.3	NM_019100	
OTUD7B	56957	hgsc.bcm.edu	37	1	149916007	149916007	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr1:149916007T>C	ENST00000369135.4	-	12	2575	c.2281A>G	c.(2281-2283)Agg>Ggg	p.R761G		NM_020205.2	NP_064590.2	Q6GQQ9	OTU7B_HUMAN	OTU deubiquitinase 7B	761					mucosal immune response (GO:0002385)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|DNA binding (GO:0003677)|Lys48-specific deubiquitinase activity (GO:1990380)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			AAGGCACCCCTGTGAAGTCCA	0.622																																					p.R761G		Atlas-SNP	.											.	OTUD7B	76	.	0			c.A2281G						PASS	.						35.0	37.0	37.0					1																	149916007		1944	4142	6086	SO:0001583	missense	56957	exon12			CACCCCTGTGAAG	AJ293573	CCDS72903.1	1q21.2	2014-02-24	2014-02-24	2006-07-07	ENSG00000163113	ENSG00000264522		"""OTU domain containing"""	16683	protein-coding gene	gene with protein product		611748	"""zinc finger, A20 domain containing 1"", ""OTU domain containing 7B"""	ZA20D1		11463333, 23827681	Standard	NM_020205		Approved	CEZANNE	uc001etn.3	Q6GQQ9	OTTHUMG00000012291	ENST00000369135.4:c.2281A>G	chr1.hg19:g.149916007T>C	ENSP00000358131:p.Arg761Gly	37.0	0.0	.		60.0	27.0	.	NM_020205	B7Z643|D3DUZ8|Q5SZ60|Q8WWA7|Q9NQ53|Q9UFF4	Missense_Mutation	SNP	ENST00000369135.4	hg19	CCDS41389.1	.	.	.	.	.	.	.	.	.	.	T	3.697	-0.062382	0.07273	.	.	ENSG00000163113	ENST00000369135;ENST00000543330	T	0.29655	1.56	4.8	-0.468	0.12146	.	0.596176	0.17810	N	0.161235	T	0.03305	0.0096	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.42865	-0.9426	9	.	.	.	-8.4456	3.9978	0.09566	0.0:0.2797:0.3849:0.3354	.	761	Q6GQQ9	OTU7B_HUMAN	G	761	ENSP00000358131:R761G	.	R	-	1	2	OTUD7B	148182631	0.922000	0.31269	0.189000	0.23252	0.672000	0.39443	0.923000	0.28757	0.006000	0.14734	0.374000	0.22700	AGG	.	.	.	none		0.622	OTUD7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034146.3	NM_020205	
HNRNPLL	92906	hgsc.bcm.edu	37	2	38812820	38812820	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr2:38812820A>T	ENST00000449105.3	-	3	851	c.512T>A	c.(511-513)cTc>cAc	p.L171H	HNRNPLL_ENST00000409636.1_Missense_Mutation_p.L166H|HNRNPLL_ENST00000410076.1_Missense_Mutation_p.L166H|HNRNPLL_ENST00000378915.3_Missense_Mutation_p.L171H|HNRNPLL_ENST00000608859.1_Missense_Mutation_p.L171H|HNRNPLL_ENST00000358367.4_Missense_Mutation_p.L171H|HNRNPLL_ENST00000409328.1_Missense_Mutation_p.L171H			Q8WVV9	HNRLL_HUMAN	heterogeneous nuclear ribonucleoprotein L-like	171	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)	membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)										CTGAATTGAGAGCAGAAGAAC	0.383																																					p.L171H		Atlas-SNP	.											.	HNRPLL	19	.	0			c.T512A						PASS	.						121.0	118.0	119.0					2																	38812820		2203	4300	6503	SO:0001583	missense	92906	exon3			ATTGAGAGCAGAA	BC008217	CCDS46261.1, CCDS1796.2	2p22	2014-02-10		2013-06-12	ENSG00000143889	ENSG00000143889		"""RNA binding motif (RRM) containing"""	25127	protein-coding gene	gene with protein product		611208		HNRPLL		18669861	Standard	NM_138394		Approved		uc021vgc.1	Q8WVV9	OTTHUMG00000102075	ENST00000449105.3:c.512T>A	chr2.hg19:g.38812820A>T	ENSP00000390625:p.Leu171His	75.0	0.0	.		145.0	67.0	.	NM_138394	Q53T80|Q5JB51|Q5JB52|Q659B9|Q8IVH5|Q8IVH6|Q96HR5	Missense_Mutation	SNP	ENST00000449105.3	hg19		.	.	.	.	.	.	.	.	.	.	A	21.0	4.086464	0.76642	.	.	ENSG00000143889	ENST00000449105;ENST00000409636;ENST00000378915;ENST00000409328;ENST00000358367;ENST00000410076;ENST00000425682	D	0.83335	-1.71	5.63	5.63	0.86233	.	0.000000	0.64402	D	0.000008	D	0.90635	0.7063	M	0.83118	2.625	0.50313	D	0.999869	D;D	0.69078	0.997;0.997	P;P	0.61722	0.893;0.893	D	0.92089	0.5679	10	0.87932	D	0	.	15.8534	0.78952	1.0:0.0:0.0:0.0	.	166;171	C9J9G0;D6W592	.;.	H	171;166;171;171;171;166;110	ENSP00000396669:L110H	ENSP00000351136:L171H	L	-	2	0	HNRPLL	38666324	0.987000	0.35691	0.997000	0.53966	0.735000	0.41995	9.210000	0.95106	2.154000	0.67381	0.533000	0.62120	CTC	.	.	.	none		0.383	HNRNPLL-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000219887.2	NM_138394	
TTLL4	9654	hgsc.bcm.edu	37	2	219619110	219619110	+	Nonstop_Mutation	SNP	T	T	A			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr2:219619110T>A	ENST00000392102.1	+	20	3938	c.3598T>A	c.(3598-3600)Taa>Aaa	p.*1200K	TTLL4_ENST00000457313.1_3'UTR|TTLL4_ENST00000442769.1_Nonstop_Mutation_p.*1136K|TTLL4_ENST00000258398.4_Nonstop_Mutation_p.*1200K	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	0					protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)			endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		TGTGAGCCCATAACTGGCCTC	0.557																																					p.X1200K	GBM(172;1818 2053 15407 20943 49753)	Atlas-SNP	.											.	TTLL4	96	.	0			c.T3598A						PASS	.						70.0	70.0	70.0					2																	219619110		2203	4300	6503	SO:0001578	stop_lost	9654	exon20			AGCCCATAACTGG		CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.3598T>A	chr2.hg19:g.219619110T>A	ENSP00000375951:p.*1200Lysext*28	81.0	0.0	.		93.0	36.0	.	NM_014640	A8K6V5|Q8WW29	Missense_Mutation	SNP	ENST00000392102.1	hg19	CCDS2422.1	.	.	.	.	.	.	.	.	.	.	T	10.53	1.376609	0.24857	.	.	ENSG00000135912	ENST00000392102;ENST00000442769;ENST00000258398	.	.	.	4.92	3.73	0.42828	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.4435	0.27198	0.0:0.0977:0.0:0.9023	.	.	.	.	K	1200;1136;1200	.	.	X	+	1	0	TTLL4	219327354	0.759000	0.28416	0.391000	0.26233	0.148000	0.21650	1.529000	0.35996	0.877000	0.35895	0.528000	0.53228	TAA	.	.	.	none		0.557	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256726.1	NM_014640	
IMPG2	50939	hgsc.bcm.edu	37	3	100964931	100964931	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr3:100964931C>T	ENST00000193391.7	-	12	1445	c.1258G>A	c.(1258-1260)Gca>Aca	p.A420T		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	420					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	GAGGGCCATGCAGCTTGAAAG	0.423																																					p.A420T		Atlas-SNP	.											.	IMPG2	164	.	0			c.G1258A						PASS	.						76.0	86.0	83.0					3																	100964931		2203	4300	6503	SO:0001583	missense	50939	exon12			GCCATGCAGCTTG	AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.1258G>A	chr3.hg19:g.100964931C>T	ENSP00000193391:p.Ala420Thr	63.0	0.0	.		146.0	6.0	.	NM_016247	A8MWT5|Q9UKD4|Q9UKK5	Missense_Mutation	SNP	ENST00000193391.7	hg19	CCDS2940.1	.	.	.	.	.	.	.	.	.	.	C	18.42	3.620949	0.66787	.	.	ENSG00000081148	ENST00000193391	T	0.22539	1.95	5.91	5.91	0.95273	.	0.319686	0.30695	N	0.009080	T	0.12774	0.0310	N	0.08118	0	0.31449	N	0.67096	P;B	0.34462	0.454;0.309	B;B	0.26770	0.073;0.073	T	0.04216	-1.0968	10	0.37606	T	0.19	-4.6946	20.2983	0.98569	0.0:1.0:0.0:0.0	.	420;420	F1T0J3;Q9BZV3	.;IMPG2_HUMAN	T	420	ENSP00000193391:A420T	ENSP00000193391:A420T	A	-	1	0	IMPG2	102447621	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	4.941000	0.63540	2.802000	0.96397	0.655000	0.94253	GCA	.	.	.	none		0.423	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353256.3		
SPATA16	83893	hgsc.bcm.edu	37	3	172835337	172835337	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr3:172835337C>A	ENST00000351008.3	-	2	368	c.185G>T	c.(184-186)aGa>aTa	p.R62I		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	62					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)				breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			CATTTTTGTTCTTTCAAGTGT	0.388																																					p.R62I		Atlas-SNP	.											.	SPATA16	111	.	0			c.G185T						PASS	.						323.0	310.0	314.0					3																	172835337		2203	4300	6503	SO:0001583	missense	83893	exon2			TTTGTTCTTTCAA	AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.185G>T	chr3.hg19:g.172835337C>A	ENSP00000341765:p.Arg62Ile	102.0	0.0	.		132.0	46.0	.	NM_031955	Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Missense_Mutation	SNP	ENST00000351008.3	hg19	CCDS3221.1	.	.	.	.	.	.	.	.	.	.	C	14.17	2.456127	0.43634	.	.	ENSG00000144962	ENST00000351008	T	0.25749	1.78	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000015	T	0.33702	0.0872	L	0.29908	0.895	0.44508	D	0.997459	D	0.63880	0.993	P	0.60682	0.878	T	0.06698	-1.0812	10	0.87932	D	0	-19.4976	11.2051	0.48765	0.0:0.915:0.0:0.085	.	62	Q9BXB7	SPT16_HUMAN	I	62	ENSP00000341765:R62I	ENSP00000341765:R62I	R	-	2	0	SPATA16	174318031	0.960000	0.32886	0.985000	0.45067	0.578000	0.36192	1.129000	0.31381	2.450000	0.82876	0.650000	0.86243	AGA	.	.	.	none		0.388	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346322.1	NM_031955	
PPP1R2	5504	hgsc.bcm.edu	37	3	195250521	195250521	+	Silent	SNP	C	C	T			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr3:195250521C>T	ENST00000328432.3	-	4	732	c.372G>A	c.(370-372)gaG>gaA	p.E124E	RNU6ATAC24P_ENST00000516811.1_RNA	NM_006241.4	NP_006232.1	P41236	IPP2_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 2	124					generation of precursor metabolites and energy (GO:0006091)|glycogen metabolic process (GO:0005977)|negative regulation of catalytic activity (GO:0043086)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of signal transduction (GO:0009966)		protein serine/threonine phosphatase inhibitor activity (GO:0004865)			endometrium(2)|kidney(1)|large_intestine(1)|urinary_tract(2)	6	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)		Epithelial(36;2.64e-22)|all cancers(36;2.69e-20)|OV - Ovarian serous cystadenocarcinoma(49;3.52e-19)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;9.55e-05)		CACTATCCTCCTCTCCACTGC	0.393																																					p.E124E		Atlas-SNP	.											.	PPP1R2	11	.	0			c.G372A						PASS	.						88.0	72.0	77.0					3																	195250521		2203	4300	6503	SO:0001819	synonymous_variant	5504	exon4			ATCCTCCTCTCCA	U68111	CCDS3309.1	3q29	2012-04-17			ENSG00000184203	ENSG00000184203	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9288	protein-coding gene	gene with protein product		601792				9126490, 8119416	Standard	XM_006713682		Approved	IPP2	uc003fup.3	P41236	OTTHUMG00000155887	ENST00000328432.3:c.372G>A	chr3.hg19:g.195250521C>T		71.0	0.0	.		105.0	42.0	.	NM_006241		Silent	SNP	ENST00000328432.3	hg19	CCDS3309.1																																																																																			.	.	.	none		0.393	PPP1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342133.1	NM_006241	
FRYL	285527	hgsc.bcm.edu	37	4	48552657	48552657	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr4:48552657C>G	ENST00000503238.1	-	35	4584	c.4585G>C	c.(4585-4587)Gaa>Caa	p.E1529Q	FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000537810.1_Missense_Mutation_p.E1529Q|FRYL_ENST00000358350.4_Missense_Mutation_p.E1529Q|FRYL_ENST00000507711.1_Missense_Mutation_p.E1529Q|FRYL_ENST00000507873.2_5'UTR			O94915	FRYL_HUMAN	FRY-like	1529					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						TATCGGGATTCTAGTCTGTGA	0.373																																					p.E1529Q		Atlas-SNP	.											.	FRYL	242	.	0			c.G4585C						PASS	.						186.0	169.0	174.0					4																	48552657		1890	4106	5996	SO:0001583	missense	285527	exon38			GGGATTCTAGTCT	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.4585G>C	chr4.hg19:g.48552657C>G	ENSP00000426064:p.Glu1529Gln	28.0	0.0	.		51.0	19.0	.	NM_015030	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	hg19	CCDS43227.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.83|19.83	3.900152|3.900152	0.72754|0.72754	.|.	.|.	ENSG00000075539|ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711|ENST00000514617	T;T;T;T|.	0.55588|.	1.82;1.82;1.82;0.51|.	5.53|5.53	5.53|5.53	0.82687|0.82687	Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75236|0.75236	0.3822|0.3822	M|M	0.68593|0.68593	2.085|2.085	0.80722|0.80722	D|D	1|1	D;D;P;P|.	0.63880|.	0.981;0.993;0.941;0.938|.	D;D;P;P|.	0.72982|.	0.932;0.979;0.71;0.849|.	T|T	0.73398|0.73398	-0.3995|-0.3995	10|5	0.33141|.	T|.	0.24|.	.|.	19.4662|19.4662	0.94943|0.94943	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1529;360;1529;1529|.	F2Z2S2;Q6ZR29;O94915;F5GX82|.	.;.;FRYL_HUMAN;.|.	Q|T	1529|399	ENSP00000426064:E1529Q;ENSP00000351113:E1529Q;ENSP00000441114:E1529Q;ENSP00000421584:E1529Q|.	ENSP00000351113:E1529Q|.	E|R	-|-	1|2	0|0	FRYL|FRYL	48247414|48247414	1.000000|1.000000	0.71417|0.71417	0.950000|0.950000	0.38849|0.38849	0.080000|0.080000	0.17528|0.17528	7.484000|7.484000	0.81180|0.81180	2.582000|2.582000	0.87167|0.87167	0.655000|0.655000	0.94253|0.94253	GAA|AGA	.	.	.	none		0.373	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
CCSER1	401145	hgsc.bcm.edu	37	4	91321220	91321221	+	Missense_Mutation	DNP	GA	GA	AC			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr4:91321220_91321221GA>AC	ENST00000509176.1	+	4	1831_1832	c.1543_1544GA>AC	c.(1543-1545)GAt>ACt	p.D515T	CCSER1_ENST00000333691.8_Missense_Mutation_p.D515T|CCSER1_ENST00000432775.2_Missense_Mutation_p.D515T	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	515																	TTGTGAACTGGATGAAGATGAT	0.332																																					p.D515N|p.D515A		Atlas-SNP	.											FAM190A_ENST00000509176,colon,carcinoma,0,3|FAM190A_ENST00000509176,colon,carcinoma,+1,12	.	.	.	0			c.G1543A|c.A1544C						PASS	.																																			SO:0001583	missense	401145	exon4			GAACTGGATGAAG|AACTGGATGAAGA		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	Exception_encountered	chr4.hg19:g.91321220_91321221delinsAC	ENSP00000425040:p.Asp515Thr	79.0	0.0	.		119.0|118.0	48.0|47.0	.	NM_001145065	Q4W5M0|Q86V57	Missense_Mutation	SNP	ENST00000509176.1	hg19	CCDS47099.1																																																																																			.	.	.	none		0.332	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065	
FRG1	2483	hgsc.bcm.edu	37	4	190884267	190884267	+	Missense_Mutation	SNP	G	G	A	rs373037319		TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr4:190884267G>A	ENST00000226798.4	+	9	982	c.760G>A	c.(760-762)Gac>Aac	p.D254N		NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	254					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		ATTGAAAGCCGACAGATACTG	0.299																																					p.D254N		Atlas-SNP	.											FRG1,middle_lobe,carcinoma,0,1	FRG1	76	.	0			c.G760A						PASS	.						99.0	111.0	107.0					4																	190884267		2203	4300	6503	SO:0001583	missense	2483	exon9			AAAGCCGACAGAT	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.760G>A	chr4.hg19:g.190884267G>A	ENSP00000226798:p.Asp254Asn	32.0	0.0	.		54.0	5.0	.	NM_004477	A8K775	Missense_Mutation	SNP	ENST00000226798.4	hg19	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	21.9	4.222509	0.79464	.	.	ENSG00000109536	ENST00000226798	T	0.65916	-0.18	4.0	4.0	0.46444	.	0.000000	0.85682	D	0.000000	T	0.80994	0.4731	M	0.89715	3.055	0.80722	D	1	D	0.76494	0.999	D	0.66716	0.946	D	0.85581	0.1240	10	0.72032	D	0.01	-19.8783	14.0213	0.64558	0.0:0.0:1.0:0.0	.	254	Q14331	FRG1_HUMAN	N	254	ENSP00000226798:D254N	ENSP00000226798:D254N	D	+	1	0	FRG1	191121261	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	9.201000	0.95017	1.976000	0.57569	0.479000	0.44913	GAC	.	.	.	weak		0.299	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
C5orf55	116349	hgsc.bcm.edu	37	5	442810	442810	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr5:442810C>T	ENST00000408966.2	-	1	448	c.128G>A	c.(127-129)gGg>gAg	p.G43E	EXOC3_ENST00000512944.1_5'Flank	NM_138464.2	NP_612473.1	Q8N2X6	CE055_HUMAN	chromosome 5 open reading frame 55	43						extracellular region (GO:0005576)				large_intestine(1)|lung(2)	3						CGTTTGATTCCCAACCTTCTC	0.597																																					p.G43E		Atlas-SNP	.											.	C5orf55	11	.	0			c.G128A						PASS	.						149.0	166.0	161.0					5																	442810		1980	4155	6135	SO:0001583	missense	116349	exon1			TGATTCCCAACCT	BC014011	CCDS43298.1	5p15.33	2012-02-24			ENSG00000221990	ENSG00000221990			25175	protein-coding gene	gene with protein product						12477932	Standard	NM_138464		Approved		uc010ita.3	Q8N2X6	OTTHUMG00000162235	ENST00000408966.2:c.128G>A	chr5.hg19:g.442810C>T	ENSP00000386139:p.Gly43Glu	56.0	0.0	.		103.0	41.0	.	NM_138464	Q96CR9	Missense_Mutation	SNP	ENST00000408966.2	hg19	CCDS43298.1	.	.	.	.	.	.	.	.	.	.	C	5.021	0.189573	0.09547	.	.	ENSG00000221990	ENST00000408966	T	0.46451	0.87	0.677	-1.35	0.09114	.	.	.	.	.	T	0.21307	0.0513	N	0.08118	0	0.09310	N	1	P	0.50710	0.938	B	0.43754	0.43	T	0.14254	-1.0479	8	0.87932	D	0	.	.	.	.	.	43	Q8N2X6	CE055_HUMAN	E	43	ENSP00000386139:G43E	ENSP00000386139:G43E	G	-	2	0	C5orf55	495810	0.002000	0.14202	0.001000	0.08648	0.023000	0.10783	0.811000	0.27198	-0.457000	0.07033	0.205000	0.17691	GGG	.	.	.	none		0.597	C5orf55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368033.1	NM_138464	
COL4A3BP	10087	hgsc.bcm.edu	37	5	74677819	74677819	+	Silent	SNP	T	T	C			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr5:74677819T>C	ENST00000405807.4	-	15	1993	c.1572A>G	c.(1570-1572)gaA>gaG	p.E524E	COL4A3BP_ENST00000261415.7_Silent_p.E498E|COL4A3BP_ENST00000508692.1_5'UTR|COL4A3BP_ENST00000380494.5_Silent_p.E652E	NM_005713.2	NP_005704.1	Q9Y5P4	C43BP_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen) binding protein	524	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|ceramide metabolic process (GO:0006672)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi ceramide transport (GO:0035621)|heart morphogenesis (GO:0003007)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lipid homeostasis (GO:0055088)|mitochondrion morphogenesis (GO:0070584)|muscle contraction (GO:0006936)|protein phosphorylation (GO:0006468)|response to endoplasmic reticulum stress (GO:0034976)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ceramide binding (GO:0097001)|ceramide transporter activity (GO:0035620)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein kinase activity (GO:0004672)			breast(1)|kidney(1)|large_intestine(5)|lung(4)|skin(3)|stomach(1)|urinary_tract(1)	16		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;1e-53)		CTATCCAAGTTTCAGGGTCAT	0.358																																					p.E652E		Atlas-SNP	.											.	COL4A3BP	72	.	0			c.A1956G						PASS	.						72.0	72.0	72.0					5																	74677819		2203	4300	6503	SO:0001819	synonymous_variant	10087	exon16			CCAAGTTTCAGGG	AF136450	CCDS4028.1, CCDS4029.1, CCDS47235.1	5q13.3	2013-01-10	2007-06-08	2007-06-08	ENSG00000113163	ENSG00000113163		"""StAR-related lipid transfer (START) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2205	protein-coding gene	gene with protein product	"""ceramide transporter"", ""StAR-related lipid transfer (START) domain containing 11"""	604677				10212244	Standard	NM_001130105		Approved	GPBP, STARD11, CERT	uc003kdt.3	Q9Y5P4	OTTHUMG00000102068	ENST00000405807.4:c.1572A>G	chr5.hg19:g.74677819T>C		161.0	0.0	.		339.0	146.0	.	NM_001130105	A8K7S2|B3KUB7|Q53YV1|Q53YV2|Q96Q85|Q96Q88|Q9H2S7|Q9H2S8	Silent	SNP	ENST00000405807.4	hg19	CCDS4028.1	.	.	.	.	.	.	.	.	.	.	T	10.21	1.287259	0.23478	.	.	ENSG00000113163	ENST00000508809	.	.	.	6.04	2.29	0.28610	.	.	.	.	.	T	0.53997	0.1831	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41466	-0.9507	4	.	.	.	-14.7757	6.1178	0.20136	0.0:0.1942:0.1241:0.6817	.	.	.	.	D	26	.	.	N	-	1	0	COL4A3BP	74713575	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.125000	0.31332	0.161000	0.19458	0.529000	0.55759	AAC	.	.	.	none		0.358	COL4A3BP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219875.2	NM_005713	
PHAX	51808	hgsc.bcm.edu	37	5	125939501	125939501	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr5:125939501G>C	ENST00000297540.4	+	2	1031	c.336G>C	c.(334-336)aaG>aaC	p.K112N	PHAX_ENST00000514725.1_3'UTR	NM_032177.3	NP_115553.2	Q9H814	PHAX_HUMAN	phosphorylated adaptor for RNA export	112	Necessary for interaction with CBP80. {ECO:0000250}.				gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|protein transport (GO:0015031)|RNA metabolic process (GO:0016070)|snRNA export from nucleus (GO:0006408)|spliceosomal snRNP assembly (GO:0000387)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA binding (GO:0003723)|toxic substance binding (GO:0015643)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	8						CTGGAGGAAAGAAGATTAACA	0.468																																					p.K112N		Atlas-SNP	.											.	PHAX	20	.	0			c.G336C						PASS	.						76.0	73.0	74.0					5																	125939501		2203	4300	6503	SO:0001583	missense	51808	exon2			AGGAAAGAAGATT	AK023255	CCDS4138.1	5q23.2	2011-05-24	2008-10-01	2008-10-01	ENSG00000164902	ENSG00000164902			10241	protein-coding gene	gene with protein product		604924	"""RNA U, small nuclear RNA export adaptor (phosphorylation regulated)"""	RNUXA		10786834	Standard	NM_032177		Approved	FLJ13193	uc003kua.2	Q9H814	OTTHUMG00000163273	ENST00000297540.4:c.336G>C	chr5.hg19:g.125939501G>C	ENSP00000297540:p.Lys112Asn	211.0	0.0	.		274.0	119.0	.	NM_032177	Q9H8W1	Missense_Mutation	SNP	ENST00000297540.4	hg19	CCDS4138.1	.	.	.	.	.	.	.	.	.	.	G	15.01	2.706865	0.48412	.	.	ENSG00000164902	ENST00000297540;ENST00000456348	T	0.23552	1.9	5.74	3.96	0.45880	.	0.155351	0.56097	D	0.000029	T	0.28134	0.0694	L	0.59436	1.845	0.39908	D	0.973988	P	0.48089	0.905	P	0.45119	0.47	T	0.06570	-1.0819	10	0.62326	D	0.03	-21.8128	8.3183	0.32113	0.2939:0.0:0.7061:0.0	.	112	Q9H814	PHAX_HUMAN	N	112	ENSP00000297540:K112N	ENSP00000297540:K112N	K	+	3	2	PHAX	125967400	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	1.025000	0.30090	0.781000	0.33589	0.655000	0.94253	AAG	.	.	.	none		0.468	PHAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250924.1	NM_032177	
CTNNA1	1495	hgsc.bcm.edu	37	5	138266330	138266330	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr5:138266330A>G	ENST00000302763.7	+	15	2269	c.2179A>G	c.(2179-2181)Aca>Gca	p.T727A	CTNNA1_ENST00000355078.5_Missense_Mutation_p.T624A|CTNNA1_ENST00000518825.1_Missense_Mutation_p.T727A|CTNNA1_ENST00000540387.1_Missense_Mutation_p.T357A	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	727					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)			NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GATGGAGATGACAGACTTTAC	0.567																																					p.T727A		Atlas-SNP	.											.	CTNNA1	114	.	0			c.A2179G						PASS	.						162.0	153.0	156.0					5																	138266330		2203	4300	6503	SO:0001583	missense	1495	exon15			GAGATGACAGACT	D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.2179A>G	chr5.hg19:g.138266330A>G	ENSP00000304669:p.Thr727Ala	97.0	0.0	.		170.0	76.0	.	NM_001903	Q12795|Q8N1C0	Missense_Mutation	SNP	ENST00000302763.7	hg19	CCDS34243.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.634797	0.87760	.	.	ENSG00000044115	ENST00000355078;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518825;ENST00000540387;ENST00000520520	T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.61850	0.2380	M	0.64404	1.975	0.80722	D	1	D;D;D	0.89917	1.0;0.995;0.998	D;D;D	0.85130	0.997;0.986;0.983	T	0.58962	-0.7543	10	0.35671	T	0.21	-19.3613	16.0443	0.80707	1.0:0.0:0.0:0.0	.	727;604;727	G3XAM7;B4DKT9;P35221	.;.;CTNA1_HUMAN	A	624;727;727;712;727;357;2	ENSP00000347190:T624A;ENSP00000304669:T727A;ENSP00000427821:T727A;ENSP00000438476:T357A;ENSP00000430076:T2A	ENSP00000304669:T727A	T	+	1	0	CTNNA1	138294229	1.000000	0.71417	0.998000	0.56505	0.802000	0.45316	9.057000	0.93889	2.326000	0.78906	0.533000	0.62120	ACA	.	.	.	none		0.567	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373868.1	NM_001903	
F12	2161	hgsc.bcm.edu	37	5	176830954	176830954	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr5:176830954A>G	ENST00000253496.3	-	10	1204	c.1156T>C	c.(1156-1158)Tac>Cac	p.Y386H	F12_ENST00000514943.1_5'Flank	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	386	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	GCGGCGATGTAGGGGTGCGCC	0.706									Hereditary Angioedema		OREG0017088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y386H		Atlas-SNP	.											.	F12	35	.	0			c.T1156C						PASS	.						12.0	15.0	14.0					5																	176830954		2188	4284	6472	SO:0001583	missense	2161	exon10	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	CGATGTAGGGGTG	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.1156T>C	chr5.hg19:g.176830954A>G	ENSP00000253496:p.Tyr386His	75.0	0.0	.	1934	135.0	54.0	.	NM_000505	P78339	Missense_Mutation	SNP	ENST00000253496.3	hg19	CCDS34302.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.648256	0.87958	.	.	ENSG00000131187	ENST00000253496	T	0.62498	0.02	5.61	5.61	0.85477	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.42682	D	0.000678	T	0.67183	0.2866	N	0.20845	0.615	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.72394	-0.4307	10	0.87932	D	0	.	14.7703	0.69671	1.0:0.0:0.0:0.0	.	386	P00748	FA12_HUMAN	H	386	ENSP00000253496:Y386H	ENSP00000253496:Y386H	Y	-	1	0	F12	176763560	1.000000	0.71417	1.000000	0.80357	0.424000	0.31475	4.136000	0.58004	2.137000	0.66172	0.459000	0.35465	TAC	.	.	.	none		0.706	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373217.1		
SYCP2L	221711	hgsc.bcm.edu	37	6	10935326	10935326	+	Silent	SNP	C	C	T			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr6:10935326C>T	ENST00000283141.6	+	21	2015	c.1719C>T	c.(1717-1719)ccC>ccT	p.P573P		NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	573						nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			AAGAAATACCCGAGCAAAATA	0.313																																					p.P573P		Atlas-SNP	.											.	SYCP2L	101	.	0			c.C1719T						PASS	.						77.0	71.0	73.0					6																	10935326		1794	4077	5871	SO:0001819	synonymous_variant	221711	exon21			AATACCCGAGCAA	AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.1719C>T	chr6.hg19:g.10935326C>T		233.0	0.0	.		390.0	153.0	.	NM_001040274	A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Silent	SNP	ENST00000283141.6	hg19	CCDS43423.1																																																																																			.	.	.	none		0.313	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039845.3	NM_194299	
C6orf58	352999	hgsc.bcm.edu	37	6	127911437	127911437	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr6:127911437C>G	ENST00000329722.7	+	5	892	c.880C>G	c.(880-882)Cta>Gta	p.L294V		NM_001010905.1	NP_001010905.1	Q6P5S2	CF058_HUMAN	chromosome 6 open reading frame 58	294						extracellular vesicular exosome (GO:0070062)				kidney(3)|large_intestine(3)|liver(1)|lung(7)|pancreas(1)	15				GBM - Glioblastoma multiforme(226;0.0405)|all cancers(137;0.156)		CCTGGTTCTTCTAAATATGCT	0.338																																					p.L294V		Atlas-SNP	.											.	C6orf58	35	.	0			c.C880G						PASS	.						135.0	139.0	138.0					6																	127911437		2203	4300	6503	SO:0001583	missense	352999	exon5			GTTCTTCTAAATA	BC062712	CCDS34533.1	6q22.33	2011-12-13			ENSG00000184530	ENSG00000184530			20960	protein-coding gene	gene with protein product							Standard	NM_001010905		Approved		uc003qbh.4	Q6P5S2	OTTHUMG00000015530	ENST00000329722.7:c.880C>G	chr6.hg19:g.127911437C>G	ENSP00000328069:p.Leu294Val	34.0	0.0	.		36.0	13.0	.	NM_001010905	B4E1I0|Q5VUP2	Missense_Mutation	SNP	ENST00000329722.7	hg19	CCDS34533.1	.	.	.	.	.	.	.	.	.	.	C	13.49	2.251728	0.39797	.	.	ENSG00000184530	ENST00000329722	T	0.53423	0.62	5.11	-6.07	0.02158	.	0.135773	0.50627	N	0.000106	T	0.17152	0.0412	M	0.74546	2.27	0.09310	N	1	B	0.32862	0.387	B	0.34873	0.191	T	0.18053	-1.0349	10	0.59425	D	0.04	-3.1435	0.0452	0.00010	0.3222:0.1806:0.2115:0.2856	.	294	Q6P5S2	CF058_HUMAN	V	294	ENSP00000328069:L294V	ENSP00000328069:L294V	L	+	1	2	C6orf58	127953130	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	-0.091000	0.11146	-1.770000	0.01295	-0.136000	0.14681	CTA	.	.	.	none		0.338	C6orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042152.1	NM_001010905	
CITED2	10370	hgsc.bcm.edu	37	6	139694378	139694378	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr6:139694378A>G	ENST00000367651.2	-	2	919	c.704T>C	c.(703-705)aTg>aCg	p.M235T	CITED2_ENST00000537332.1_Missense_Mutation_p.M235T|CITED2_ENST00000536159.1_Missense_Mutation_p.M235T	NM_006079.4	NP_006070.2	Q99967	CITE2_HUMAN	Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2	235	Asp/Glu-rich (acidic).				adrenal cortex formation (GO:0035802)|bone morphogenesis (GO:0060349)|cardiac neural crest cell development involved in heart development (GO:0061308)|cell aging (GO:0007569)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|cranial nerve morphogenesis (GO:0021602)|decidualization (GO:0046697)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|endocardial cushion development (GO:0003197)|erythrocyte development (GO:0048821)|granulocyte differentiation (GO:0030851)|heart development (GO:0007507)|heart looping (GO:0001947)|hematopoietic progenitor cell differentiation (GO:0002244)|left/right axis specification (GO:0070986)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|outflow tract morphogenesis (GO:0003151)|peripheral nervous system development (GO:0007422)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of gene expression (GO:0010628)|positive regulation of male gonad development (GO:2000020)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|pulmonary artery morphogenesis (GO:0061156)|regulation of organ formation (GO:0003156)|regulation of RNA biosynthetic process (GO:2001141)|response to estrogen (GO:0043627)|response to fluid shear stress (GO:0034405)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sex determination (GO:0007530)|skeletal muscle cell differentiation (GO:0035914)|spleen development (GO:0048536)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|LBD domain binding (GO:0050693)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			large_intestine(1)|lung(4)	5	Breast(32;0.226)			GBM - Glioblastoma multiforme(68;0.000171)|OV - Ovarian serous cystadenocarcinoma(155;0.00134)		GTCCAAACCCATTTCTATCAC	0.547																																					p.M240T	NSCLC(98;1219 1550 33720 43229 49330)	Atlas-SNP	.											.	CITED2	16	.	0			c.T719C						PASS	.						79.0	80.0	80.0					6																	139694378		2203	4300	6503	SO:0001583	missense	10370	exon2			AAACCCATTTCTA	U65093	CCDS5195.1, CCDS75530.1	6q23.3	2008-08-29			ENSG00000164442	ENSG00000164442			1987	protein-coding gene	gene with protein product		602937				8901575, 10552932	Standard	NM_006079		Approved	MRG1	uc021zfz.2	Q99967	OTTHUMG00000015691	ENST00000367651.2:c.704T>C	chr6.hg19:g.139694378A>G	ENSP00000356623:p.Met235Thr	87.0	0.0	.		108.0	50.0	.	NM_001168389	O95426|Q5VTF4	Missense_Mutation	SNP	ENST00000367651.2	hg19	CCDS5195.1	.	.	.	.	.	.	.	.	.	.	A	16.62	3.175054	0.57692	.	.	ENSG00000164442	ENST00000367651;ENST00000536159;ENST00000537332;ENST00000392312	T;T;T	0.66099	-0.19;-0.19;-0.19	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.34513	0.0900	N	0.24115	0.695	0.58432	D	0.999997	B	0.23128	0.08	B	0.28709	0.093	T	0.26121	-1.0112	9	.	.	.	-3.6977	15.9141	0.79496	1.0:0.0:0.0:0.0	.	235	Q99967	CITE2_HUMAN	T	235;235;235;179	ENSP00000356623:M235T;ENSP00000442831:M235T;ENSP00000444198:M235T	.	M	-	2	0	CITED2	139736071	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.875000	0.92372	2.156000	0.67533	0.533000	0.62120	ATG	.	.	.	none		0.547	CITED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042463.1		
SMARCA2	6595	hgsc.bcm.edu	37	9	2039785	2039785	+	Silent	SNP	G	G	A			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr9:2039785G>A	ENST00000382203.1	+	4	884	c.675G>A	c.(673-675)caG>caA	p.Q225Q	SMARCA2_ENST00000382194.1_Silent_p.Q225Q|SMARCA2_ENST00000349721.2_Silent_p.Q225Q|SMARCA2_ENST00000357248.2_Silent_p.Q225Q|SMARCA2_ENST00000491574.1_3'UTR|RP11-264I13.2_ENST00000426860.1_RNA			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	225	Poly-Gln.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		aacagcagcagcagcagcagc	0.637																																					p.Q225Q		Atlas-SNP	.											.	SMARCA2	313	.	0			c.G675A						PASS	.						9.0	12.0	11.0					9																	2039785		2093	4139	6232	SO:0001819	synonymous_variant	6595	exon4			GCAGCAGCAGCAG	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.675G>A	chr9.hg19:g.2039785G>A		57.0	0.0	.		106.0	11.0	.	NM_139045	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Silent	SNP	ENST00000382203.1	hg19	CCDS34977.1																																																																																			.	.	.	none		0.637	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
SMARCA2	6595	hgsc.bcm.edu	37	9	2039809	2039809	+	Silent	SNP	G	G	A			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr9:2039809G>A	ENST00000382203.1	+	4	908	c.699G>A	c.(697-699)caG>caA	p.Q233Q	SMARCA2_ENST00000382194.1_Silent_p.Q233Q|SMARCA2_ENST00000349721.2_Silent_p.Q233Q|SMARCA2_ENST00000357248.2_Silent_p.Q233Q|SMARCA2_ENST00000491574.1_3'UTR|RP11-264I13.2_ENST00000426860.1_RNA			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	233	Poly-Gln.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		agcagcagcagcagcagcaac	0.587																																					p.Q233Q		Atlas-SNP	.											.	SMARCA2	313	.	0			c.G699A						PASS	.						9.0	12.0	11.0					9																	2039809		2085	4079	6164	SO:0001819	synonymous_variant	6595	exon4			GCAGCAGCAGCAG	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.699G>A	chr9.hg19:g.2039809G>A		72.0	0.0	.		110.0	15.0	.	NM_139045	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Silent	SNP	ENST00000382203.1	hg19	CCDS34977.1																																																																																			.	.	.	none		0.587	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
UBAP2	55833	hgsc.bcm.edu	37	9	33944463	33944463	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr9:33944463T>G	ENST00000379238.1	-	14	1562	c.1445A>C	c.(1444-1446)cAg>cCg	p.Q482P	UBAP2_ENST00000418786.2_Missense_Mutation_p.Q429P|UBAP2_ENST00000449054.1_Missense_Mutation_p.Q482P|UBAP2_ENST00000379225.1_Missense_Mutation_p.Q115P|UBAP2_ENST00000360802.1_Missense_Mutation_p.Q482P|UBAP2_ENST00000539807.1_Missense_Mutation_p.Q237P|UBAP2_ENST00000379239.4_Missense_Mutation_p.Q215P					ubiquitin associated protein 2											endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(13)|ovary(3)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		GCTGGGAAGCTGCAAAAGCTT	0.512																																					p.Q482P		Atlas-SNP	.											.	UBAP2	82	.	0			c.A1445C						PASS	.						126.0	114.0	118.0					9																	33944463		2203	4300	6503	SO:0001583	missense	55833	exon14			GGAAGCTGCAAAA	AB040924	CCDS6547.1, CCDS75828.1	9p11.2	2008-02-05			ENSG00000137073	ENSG00000137073			14185	protein-coding gene	gene with protein product						8871400	Standard	NM_018449		Approved	KIAA1491, bA176F3.5, FLJ22435	uc003ztq.1	Q5T6F2	OTTHUMG00000000427	ENST00000379238.1:c.1445A>C	chr9.hg19:g.33944463T>G	ENSP00000368540:p.Gln482Pro	109.0	0.0	.		154.0	77.0	.	NM_018449		Missense_Mutation	SNP	ENST00000379238.1	hg19	CCDS6547.1	.	.	.	.	.	.	.	.	.	.	T	15.88	2.962763	0.53507	.	.	ENSG00000137073	ENST00000379238;ENST00000449054;ENST00000360802;ENST00000431417;ENST00000379239;ENST00000539807;ENST00000418786;ENST00000379225	T;T;T;T;T;T;T	0.26810	2.58;2.58;2.58;2.35;2.36;2.01;1.71	5.53	5.53	0.82687	.	0.327428	0.32503	N	0.006019	T	0.45256	0.1333	L	0.53249	1.67	0.52501	D	0.999952	D;D;D;D;D;B;D;D	0.76494	0.986;0.999;0.974;0.986;0.986;0.031;0.998;0.997	P;D;P;P;P;B;D;P	0.69824	0.744;0.966;0.663;0.663;0.744;0.013;0.925;0.854	T	0.21211	-1.0252	10	0.33141	T	0.24	-6.8583	15.6764	0.77326	0.0:0.0:0.0:1.0	.	429;407;237;215;391;115;407;482	E7EWG4;F5H4D5;F5H2U4;A6NCA8;F5H2C8;A2A306;B4DH66;Q5T6F2	.;.;.;.;.;.;.;UBAP2_HUMAN	P	482;482;482;391;215;237;429;115	ENSP00000368540:Q482P;ENSP00000416932:Q482P;ENSP00000354039:Q482P;ENSP00000368541:Q215P;ENSP00000439329:Q237P;ENSP00000404436:Q429P;ENSP00000368527:Q115P	ENSP00000354039:Q482P	Q	-	2	0	UBAP2	33934463	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	2.623000	0.46435	2.111000	0.64477	0.528000	0.53228	CAG	.	.	.	none		0.512	UBAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001071.1	NM_018449	
HNRNPH3	3189	hgsc.bcm.edu	37	10	70098346	70098346	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr10:70098346C>A	ENST00000265866.7	+	4	503	c.338C>A	c.(337-339)cCa>cAa	p.P113Q	HNRNPH3_ENST00000469172.1_3'UTR|HNRNPH3_ENST00000354695.5_Missense_Mutation_p.P113Q|HNRNPH3_ENST00000441000.2_Intron	NM_012207.2|NM_021644.3	NP_036339.1|NP_067676.2	P31942	HNRH3_HUMAN	heterogeneous nuclear ribonucleoprotein H3 (2H9)	113	Gly-rich.				epithelial cell differentiation (GO:0030855)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)	11						CGACCGGGACCATATGATAGA	0.438																																					p.P113Q		Atlas-SNP	.											.	HNRNPH3	33	.	0			c.C338A						PASS	.						192.0	188.0	190.0					10																	70098346		2203	4300	6503	SO:0001583	missense	3189	exon4			CGGGACCATATGA		CCDS7278.1, CCDS7279.1	10q22	2013-02-12		2008-04-18	ENSG00000096746	ENSG00000096746		"""RNA binding motif (RRM) containing"""	5043	protein-coding gene	gene with protein product		602324		HNRPH3		8999868	Standard	NM_021644		Approved	2H9	uc001jnw.4	P31942	OTTHUMG00000018349	ENST00000265866.7:c.338C>A	chr10.hg19:g.70098346C>A	ENSP00000265866:p.Pro113Gln	120.0	0.0	.		156.0	65.0	.	NM_012207	A8K682|B3KRE1|Q9BSX1|Q9NP53|Q9NP96|Q9NPA7|Q9NPI4|Q9UFU4|Q9Y4J5	Missense_Mutation	SNP	ENST00000265866.7	hg19	CCDS7278.1	.	.	.	.	.	.	.	.	.	.	C	16.40	3.113676	0.56398	.	.	ENSG00000096746	ENST00000265866;ENST00000354695	T;T	0.15834	2.59;2.39	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.47691	0.1459	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	T	0.36407	-0.9749	10	0.66056	D	0.02	.	20.6397	0.99537	0.0:1.0:0.0:0.0	.	113;113	P31942-2;P31942	.;HNRH3_HUMAN	Q	113	ENSP00000265866:P113Q;ENSP00000346726:P113Q	ENSP00000265866:P113Q	P	+	2	0	HNRNPH3	69768352	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.880000	0.98712	0.650000	0.86243	CCA	.	.	.	none		0.438	HNRNPH3-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090165.1		
PANK1	53354	hgsc.bcm.edu	37	10	91359120	91359120	+	Missense_Mutation	SNP	T	T	C	rs371501466		TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr10:91359120T>C	ENST00000307534.4	-	3	1354	c.1199A>G	c.(1198-1200)aAg>aGg	p.K400R	PANK1_ENST00000371774.2_Missense_Mutation_p.K202R|PANK1_ENST00000342512.3_Missense_Mutation_p.K175R|PANK1_ENST00000322191.6_Missense_Mutation_p.K175R	NM_148977.2	NP_683878.1	Q8TE04	PANK1_HUMAN	pantothenate kinase 1	400					coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell periphery (GO:0071944)|clathrin coat (GO:0030118)|cytosol (GO:0005829)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			cervix(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	11						GCAGTACGGCTTTTTTTGACA	0.438																																					p.K400R		Atlas-SNP	.											.,3	PANK1	35	.	0			c.A1199G						PASS	.	T	ARG/LYS,ARG/LYS,ARG/LYS	0,4406		0,0,2203	231.0	209.0	217.0		524,1199,524	3.5	1.0	10		217	1,8599		0,1,4299	no	missense,missense,missense	PANK1	NM_138316.3,NM_148977.2,NM_148978.2	26,26,26	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign,benign,benign	175/315,400/599,175/374	91359120	1,13005	2203	4300	6503	SO:0001583	missense	53354	exon3			TACGGCTTTTTTT	AF355198	CCDS7405.1, CCDS7406.1, CCDS31244.1	10q23.31	2008-05-14	2002-11-13	2002-11-15	ENSG00000152782	ENSG00000152782			8598	protein-coding gene	gene with protein product		606160	"""pantothenate kinase"""	PANK		11809413	Standard	NM_148977		Approved	MGC24596, PANK1a, PANK1b	uc001kgp.2	Q8TE04	OTTHUMG00000018718	ENST00000307534.4:c.1199A>G	chr10.hg19:g.91359120T>C	ENSP00000302108:p.Lys400Arg	170.0	0.0	.		257.0	97.0	.	NM_148977	A6NIP0|Q7RTX6|Q7Z495|Q8TBQ8	Missense_Mutation	SNP	ENST00000307534.4	hg19	CCDS31244.1	.	.	.	.	.	.	.	.	.	.	T	10.35	1.325206	0.24080	0.0	1.16E-4	ENSG00000152782	ENST00000342512;ENST00000322191;ENST00000371774;ENST00000307534;ENST00000371775	D;D;D;D	0.99519	-6.07;-6.07;-6.07;-6.07	5.89	3.48	0.39840	.	0.111375	0.64402	D	0.000008	D	0.96043	0.8711	N	0.11064	0.09	0.42341	D	0.992337	B;B;B;B	0.22800	0.0;0.075;0.0;0.0	B;B;B;B	0.18263	0.002;0.021;0.005;0.001	D	0.92579	0.6073	10	0.14656	T	0.56	.	8.0173	0.30389	0.1215:0.066:0.0:0.8125	.	202;400;175;175	Q8TE04-4;Q8TE04;Q8TE04-3;Q8TE04-2	.;PANK1_HUMAN;.;.	R	175;175;202;400;263	ENSP00000345118:K175R;ENSP00000318526:K175R;ENSP00000360839:K202R;ENSP00000302108:K400R	ENSP00000302108:K400R	K	-	2	0	PANK1	91349100	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.257000	0.32932	0.439000	0.26476	0.455000	0.32223	AAG	.	.	.	none		0.438	PANK1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
OR8H3	390152	hgsc.bcm.edu	37	11	55889939	55889939	+	Silent	SNP	C	C	T			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr11:55889939C>T	ENST00000313472.3	+	1	91	c.91C>T	c.(91-93)Cta>Tta	p.L31L		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	31						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					TCTGTTTATGCTATTTCTCCT	0.458																																					p.L31L		Atlas-SNP	.											.	OR8H3	92	.	0			c.C91T						PASS	.						226.0	218.0	220.0					11																	55889939		2201	4296	6497	SO:0001819	synonymous_variant	390152	exon1			TTTATGCTATTTC	AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.91C>T	chr11.hg19:g.55889939C>T		67.0	0.0	.		126.0	67.0	.	NM_001005201	Q6IFB7	Silent	SNP	ENST00000313472.3	hg19	CCDS31519.1																																																																																			.	.	.	none		0.458	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391541.1	NM_001005201	
TMEM109	79073	hgsc.bcm.edu	37	11	60689497	60689497	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr11:60689497C>G	ENST00000227525.3	+	4	995	c.592C>G	c.(592-594)Ctg>Gtg	p.L198V	TMEM109_ENST00000536171.1_Missense_Mutation_p.L198V|TMEM132A_ENST00000453848.2_5'Flank|TMEM132A_ENST00000005286.4_5'Flank|RP11-881M11.4_ENST00000543907.1_RNA	NM_024092.2	NP_076997.1	Q9BVC6	TM109_HUMAN	transmembrane protein 109	198					cellular response to gamma radiation (GO:0071480)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell death (GO:0060548)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8						CCTCTACGCCCTGCTGAGCCG	0.682																																					p.L198V		Atlas-SNP	.											.	TMEM109	24	.	0			c.C592G						PASS	.						40.0	43.0	42.0					11																	60689497		2203	4298	6501	SO:0001583	missense	79073	exon4			TACGCCCTGCTGA		CCDS7996.1	11q12.2	2005-12-22				ENSG00000110108			28771	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_024092		Approved	MGC5508	uc001nqg.3	Q9BVC6		ENST00000227525.3:c.592C>G	chr11.hg19:g.60689497C>G	ENSP00000227525:p.Leu198Val	47.0	0.0	.		62.0	36.0	.	NM_024092		Missense_Mutation	SNP	ENST00000227525.3	hg19	CCDS7996.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.630859	0.67015	.	.	ENSG00000110108	ENST00000227525;ENST00000540407;ENST00000536171	.	.	.	4.9	-5.32	0.02722	.	0.384411	0.20666	N	0.087928	T	0.35711	0.0941	L	0.54323	1.7	0.28670	N	0.905657	B	0.13594	0.008	B	0.20767	0.031	T	0.39502	-0.9611	9	0.62326	D	0.03	-10.2472	9.1152	0.36753	0.0:0.5283:0.1885:0.2832	.	198	Q9BVC6	TM109_HUMAN	V	198;120;198	.	ENSP00000227525:L198V	L	+	1	2	TMEM109	60446073	0.007000	0.16637	0.996000	0.52242	0.962000	0.63368	-1.096000	0.03353	-0.317000	0.08677	-0.302000	0.09304	CTG	.	.	.	none		0.682	TMEM109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396343.1	NM_024092	
MOGAT2	80168	hgsc.bcm.edu	37	11	75428970	75428970	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr11:75428970C>T	ENST00000198801.5	+	1	107	c.37C>T	c.(37-39)Cgc>Tgc	p.R13C	MOGAT2_ENST00000526712.1_5'Flank	NM_025098.2	NP_079374.2	Q3SYC2	MOGT2_HUMAN	monoacylglycerol O-acyltransferase 2	13					diacylglycerol biosynthetic process (GO:0006651)|glycerol metabolic process (GO:0006071)|intestinal absorption (GO:0050892)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|acetyltransferase activity (GO:0016407)			NS(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	20	Ovarian(111;0.103)					GCCGTGGGAGCGCAGGCTGCA	0.597																																					p.R13C		Atlas-SNP	.											.	MOGAT2	49	.	0			c.C37T						PASS	.						131.0	88.0	103.0					11																	75428970		2200	4293	6493	SO:0001583	missense	80168	exon1			TGGGAGCGCAGGC	AY157608	CCDS8240.1	11q13.5	2008-02-05			ENSG00000166391	ENSG00000166391			23248	protein-coding gene	gene with protein product		610270				14970677	Standard	NM_025098		Approved	MGAT2, DGAT2L5, FLJ22644	uc010rru.2	Q3SYC2	OTTHUMG00000165341	ENST00000198801.5:c.37C>T	chr11.hg19:g.75428970C>T	ENSP00000198801:p.Arg13Cys	71.0	0.0	.		106.0	45.0	.	NM_025098	A8K7I3|Q3SYC1|Q6ZQZ2|Q86UH6|Q9H630	Missense_Mutation	SNP	ENST00000198801.5	hg19	CCDS8240.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.847489	0.51164	.	.	ENSG00000166391	ENST00000198801	T	0.48522	0.81	4.87	4.87	0.63330	.	0.120026	0.53938	N	0.000043	T	0.54870	0.1885	M	0.91768	3.24	0.80722	D	1	P;D	0.53745	0.579;0.962	B;B	0.40602	0.22;0.334	T	0.68375	-0.5425	10	0.72032	D	0.01	2.0293	11.0357	0.47799	0.1859:0.8141:0.0:0.0	.	13;13	Q3SYC2;Q3SYC2-3	MOGT2_HUMAN;.	C	13	ENSP00000198801:R13C	ENSP00000198801:R13C	R	+	1	0	MOGAT2	75106618	0.994000	0.37717	1.000000	0.80357	0.907000	0.53573	1.299000	0.33424	2.390000	0.81377	0.557000	0.71058	CGC	.	.	.	none		0.597	MOGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383520.1	NM_025098	
SLC6A13	6540	hgsc.bcm.edu	37	12	368943	368943	+	Intron	SNP	G	G	A	rs568268715	byFrequency	TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr12:368943G>A	ENST00000343164.4	-	2	255				SLC6A13_ENST00000445055.2_Intron|SLC6A13_ENST00000436453.1_Silent_p.P92P|RP11-283I3.4_ENST00000540868.1_RNA	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13						neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			CTCCCCAGAGGGGCCGTAAGT	0.512																																					p.P92P		Atlas-SNP	.											.	SLC6A13	62	.	0			c.C276T						PASS	.																																			SO:0001627	intron_variant	6540	exon2			CCAGAGGGGCCGT	U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.202+73C>T	chr12.hg19:g.368943G>A		30.0	0.0	.		55.0	25.0	.	NM_001243392	B4DJL1|Q8TCC2|Q8WW56	Silent	SNP	ENST00000343164.4	hg19	CCDS8502.1																																																																																			.	.	.	none		0.512	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397801.1	NM_016615	
TMEM132C	92293	hgsc.bcm.edu	37	12	129180454	129180454	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr12:129180454G>T	ENST00000435159.2	+	7	1735	c.1735G>T	c.(1735-1737)Gtg>Ttg	p.V579L	TMEM132C_ENST00000537538.1_5'UTR|TMEM132C_ENST00000315208.8_Missense_Mutation_p.V195L	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	579						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						GCACGCCACCGTGCGGGTCCT	0.637																																					p.V579L		Atlas-SNP	.											.	TMEM132C	142	.	0			c.G1735T						PASS	.						53.0	58.0	56.0					12																	129180454		692	1591	2283	SO:0001583	missense	92293	exon7			GCCACCGTGCGGG	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.1735G>T	chr12.hg19:g.129180454G>T	ENSP00000410852:p.Val579Leu	56.0	0.0	.		53.0	15.0	.	NM_001136103	Q69YX8	Missense_Mutation	SNP	ENST00000435159.2	hg19		.	.	.	.	.	.	.	.	.	.	G	16.23	3.063502	0.55432	.	.	ENSG00000181234	ENST00000435159;ENST00000315208	T;T	0.10668	2.85;2.85	4.82	4.82	0.62117	.	0.000000	0.56097	D	0.000033	T	0.18718	0.0449	L	0.49571	1.57	0.80722	D	1	P	0.48834	0.916	P	0.50162	0.633	T	0.02326	-1.1176	10	0.25106	T	0.35	.	17.9238	0.88976	0.0:0.0:1.0:0.0	.	579	Q8N3T6	T132C_HUMAN	L	579;195	ENSP00000410852:V579L;ENSP00000324458:V195L	ENSP00000324458:V195L	V	+	1	0	TMEM132C	127746407	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	6.218000	0.72224	2.210000	0.71456	0.655000	0.94253	GTG	.	.	.	none		0.637	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_044062	
KATNAL1	84056	hgsc.bcm.edu	37	13	30814596	30814596	+	Splice_Site	SNP	C	C	A			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr13:30814596C>A	ENST00000380615.3	-	6	894		c.e6+1		KATNAL1_ENST00000380617.3_Splice_Site	NM_032116.4	NP_115492.1			katanin p60 subunit A-like 1											autonomic_ganglia(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|skin(1)|urinary_tract(3)	19		Lung SC(185;0.0257)		all cancers(112;0.114)|OV - Ovarian serous cystadenocarcinoma(117;0.213)		TAAATTCTCACCTTCCATGGC	0.378																																					.		Atlas-SNP	.											.	KATNAL1	53	.	0			c.726+1G>T						PASS	.						96.0	91.0	93.0					13																	30814596		2203	4300	6503	SO:0001630	splice_region_variant	84056	exon7			TTCTCACCTTCCA	AK097423	CCDS31956.1	13q12.3	2010-04-21			ENSG00000102781	ENSG00000102781		"""ATPases / AAA-type"""	28361	protein-coding gene	gene with protein product		614764				12477932	Standard	NM_001014380		Approved	MGC2599	uc001uss.4	Q9BW62	OTTHUMG00000016665	ENST00000380615.3:c.726+1G>T	chr13.hg19:g.30814596C>A		53.0	0.0	.		81.0	27.0	.	NM_001014380		Splice_Site	SNP	ENST00000380615.3	hg19	CCDS31956.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046053	0.75846	.	.	ENSG00000102781	ENST00000380615;ENST00000380617	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1853	0.89791	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KATNAL1	29712596	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	7.818000	0.86416	2.597000	0.87782	0.655000	0.94253	.	.	.	.	none		0.378	KATNAL1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044346.2	NM_032116	Intron
ANPEP	290	hgsc.bcm.edu	37	15	90340880	90340880	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr15:90340880A>G	ENST00000300060.6	-	15	2396	c.2083T>C	c.(2083-2085)Tgg>Cgg	p.W695R	ANPEP_ENST00000558177.1_5'UTR	NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	695	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	GCGGCCTCCCAGGGCATGTAC	0.557																																					p.W695R	NSCLC(30;827 977 2459 19669 26125)	Atlas-SNP	.											.	ANPEP	124	.	0			c.T2083C						PASS	.						135.0	127.0	130.0					15																	90340880		2200	4299	6499	SO:0001583	missense	290	exon15			CCTCCCAGGGCAT	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.2083T>C	chr15.hg19:g.90340880A>G	ENSP00000300060:p.Trp695Arg	101.0	0.0	.		128.0	58.0	.	NM_001150	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	ENST00000300060.6	hg19	CCDS10356.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.656308	0.88056	.	.	ENSG00000166825	ENST00000300060	T	0.07800	3.16	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.44052	0.1275	H	0.97806	4.08	0.80722	D	1	D	0.69078	0.997	D	0.66716	0.946	T	0.65018	-0.6270	10	0.87932	D	0	.	14.6536	0.68817	1.0:0.0:0.0:0.0	.	695	P15144	AMPN_HUMAN	R	695	ENSP00000300060:W695R	ENSP00000300060:W695R	W	-	1	0	ANPEP	88141884	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.142000	0.94618	2.202000	0.70862	0.533000	0.62120	TGG	.	.	.	none		0.557	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1		
ANPEP	290	hgsc.bcm.edu	37	15	90349683	90349683	+	Silent	SNP	G	G	A			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr15:90349683G>A	ENST00000300060.6	-	2	445	c.132C>T	c.(130-132)tcC>tcT	p.S44S		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	44	Cytosolic Ser/Thr-rich junction.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	AGGCCACGGGGGAGCTGTTGG	0.632																																					p.S44S	NSCLC(30;827 977 2459 19669 26125)	Atlas-SNP	.											.	ANPEP	124	.	0			c.C132T						PASS	.						116.0	122.0	120.0					15																	90349683		2200	4299	6499	SO:0001819	synonymous_variant	290	exon2			CACGGGGGAGCTG	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.132C>T	chr15.hg19:g.90349683G>A		79.0	0.0	.		107.0	42.0	.	NM_001150	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Silent	SNP	ENST00000300060.6	hg19	CCDS10356.1																																																																																			.	.	.	none		0.632	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1		
NFAT5	10725	hgsc.bcm.edu	37	16	69687291	69687291	+	Nonsense_Mutation	SNP	C	C	G			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr16:69687291C>G	ENST00000354436.2	+	4	1229	c.911C>G	c.(910-912)tCa>tGa	p.S304*	NFAT5_ENST00000432919.1_Nonsense_Mutation_p.S322*|NFAT5_ENST00000567239.1_Nonsense_Mutation_p.S322*|NFAT5_ENST00000393742.2_Nonsense_Mutation_p.S228*|NFAT5_ENST00000349945.1_Nonsense_Mutation_p.S228*|NFAT5_ENST00000566899.1_Nonsense_Mutation_p.S228*	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	304	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						AGCCGTGGCTCAGTGAAAGAT	0.408																																					p.S322X		Atlas-SNP	.											.	NFAT5	184	.	0			c.C965G						PASS	.						88.0	85.0	86.0					16																	69687291		2198	4300	6498	SO:0001587	stop_gained	10725	exon5			GTGGCTCAGTGAA	AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.911C>G	chr16.hg19:g.69687291C>G	ENSP00000346420:p.Ser304*	105.0	0.0	.		199.0	72.0	.	NM_001113178	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Nonsense_Mutation	SNP	ENST00000354436.2	hg19	CCDS10881.1	.	.	.	.	.	.	.	.	.	.	C	40	8.432947	0.98808	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	.	.	.	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-2.4058	18.6222	0.91324	0.0:1.0:0.0:0.0	.	.	.	.	X	322;322;228;304;228	.	ENSP00000338806:S228X	S	+	2	0	NFAT5	68244792	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.712000	0.84684	2.473000	0.83533	0.460000	0.39030	TCA	.	.	.	none		0.408	NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2	NM_138714	
SYNRG	11276	hgsc.bcm.edu	37	17	35944776	35944776	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr17:35944776G>A	ENST00000339208.6	-	6	709	c.569C>T	c.(568-570)gCa>gTa	p.A190V	SYNRG_ENST00000502449.2_Missense_Mutation_p.A190V|SYNRG_ENST00000346661.4_Missense_Mutation_p.A190V|SYNRG_ENST00000394378.2_Missense_Mutation_p.A190V|SYNRG_ENST00000345615.4_Missense_Mutation_p.A190V|SYNRG_ENST00000591288.1_Missense_Mutation_p.A190V|SYNRG_ENST00000585472.1_Missense_Mutation_p.A189V	NM_001163544.1|NM_001163545.1|NM_007247.4	NP_001157016.1|NP_001157017.1|NP_009178.3	Q9UMZ2	SYNRG_HUMAN	synergin, gamma	190					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)	AP-1 adaptor complex (GO:0030121)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						GGGGTGCGATGCTGGAGTAGG	0.403																																					p.A190V		Atlas-SNP	.											.	SYNRG	101	.	0			c.C569T						PASS	.						153.0	153.0	153.0					17																	35944776		2203	4300	6503	SO:0001583	missense	11276	exon6			TGCGATGCTGGAG	AF169548	CCDS11321.1, CCDS11322.1, CCDS11322.2, CCDS54113.1, CCDS54114.1, CCDS59284.1, CCDS59285.1	17q12	2014-04-16	2009-07-20	2009-07-20	ENSG00000006114	ENSG00000275066			557	protein-coding gene	gene with protein product	"""gamma-synergin"", ""adaptor-related protein complex 1 gamma subunit-binding protein 1"""	607291	"""AP1 gamma subunit binding protein 1"""	AP1GBP1		10477754	Standard	XM_005256980		Approved	SYNG, MGC104959	uc010wdf.2	Q9UMZ2	OTTHUMG00000188473	ENST00000339208.6:c.569C>T	chr17.hg19:g.35944776G>A	ENSP00000343610:p.Ala190Val	104.0	0.0	.		198.0	106.0	.	NM_001163544	A8MWU4|B7ZKZ2|B7ZKZ3|Q17RI2|Q5BKU5|Q6ZT17	Missense_Mutation	SNP	ENST00000339208.6	hg19	CCDS11321.1	.	.	.	.	.	.	.	.	.	.	G	19.17	3.775527	0.70107	.	.	ENSG00000006114	ENST00000346661;ENST00000339208;ENST00000345615;ENST00000502449;ENST00000394378;ENST00000394379	T;T;T;T;T	0.48201	1.34;1.34;0.83;0.83;0.82	5.43	4.45	0.53987	.	0.244651	0.42172	D	0.000746	T	0.39462	0.1079	L	0.45581	1.43	0.38111	D	0.937568	P;B;B;B;B;P;P	0.43578	0.811;0.018;0.018;0.018;0.018;0.763;0.763	B;B;B;B;B;B;B	0.40534	0.332;0.016;0.016;0.016;0.016;0.229;0.311	T	0.32561	-0.9902	10	0.29301	T	0.29	-12.9037	10.8313	0.46663	0.146:0.0:0.854:0.0	.	190;190;190;190;190;190;190	A8MYE0;B7ZKZ2;Q9UMZ2-3;A8MWU4;Q9UMZ2-4;Q9UMZ2-5;Q9UMZ2	.;.;.;.;.;.;SYNRG_HUMAN	V	190	ENSP00000005279:A190V;ENSP00000343610:A190V;ENSP00000315722:A190V;ENSP00000424893:A190V;ENSP00000377903:A190V	ENSP00000343610:A190V	A	-	2	0	SYNRG	33018889	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	3.080000	0.50112	2.548000	0.85928	0.555000	0.69702	GCA	.	.	.	none		0.403	SYNRG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256811.2	NM_007247	
KRTAP9-3	83900	hgsc.bcm.edu	37	17	39388890	39388890	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr17:39388890G>A	ENST00000411528.2	+	1	176	c.137G>A	c.(136-138)tGc>tAc	p.C46Y		NM_031962.2	NP_114168.1	Q9BYQ3	KRA93_HUMAN	keratin associated protein 9-3	46	16 X 5 AA repeats of C-C-[RQVSHE]-[SPTN]- [TASPI].					keratin filament (GO:0045095)				breast(1)|endometrium(3)|lung(2)|ovary(1)|prostate(1)	8		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			TGCCAGCCTTGCTGCCACCCA	0.622																																					p.C46Y		Atlas-SNP	.											.	KRTAP9-3	11	.	0			c.G137A						PASS	.						61.0	63.0	62.0					17																	39388890		2099	4296	6395	SO:0001583	missense	83900	exon1			AGCCTTGCTGCCA	AJ406947	CCDS11385.1	17q21.2	2013-06-25			ENSG00000204873	ENSG00000204873		"""Keratin associated proteins"""	16927	protein-coding gene	gene with protein product						11279113	Standard	NM_031962		Approved	KAP9.3	uc021txg.1	Q9BYQ3	OTTHUMG00000133427	ENST00000411528.2:c.137G>A	chr17.hg19:g.39388890G>A	ENSP00000392189:p.Cys46Tyr	53.0	0.0	.		130.0	81.0	.	NM_031962		Missense_Mutation	SNP	ENST00000411528.2	hg19	CCDS11385.1	.	.	.	.	.	.	.	.	.	.	.	13.26	2.183006	0.38511	.	.	ENSG00000204873	ENST00000411528	T	0.01647	4.71	2.45	2.45	0.29901	.	.	.	.	.	T	0.07188	0.0182	M	0.87682	2.9	0.37889	D	0.930631	.	.	.	.	.	.	T	0.01930	-1.1245	7	0.87932	D	0	.	5.2525	0.15529	0.1612:0.0:0.8388:0.0	.	.	.	.	Y	46	ENSP00000392189:C46Y	ENSP00000392189:C46Y	C	+	2	0	KRTAP9-3	36642416	0.005000	0.15991	0.997000	0.53966	0.496000	0.33645	-0.284000	0.08422	1.700000	0.51204	0.400000	0.26472	TGC	.	.	.	none		0.622	KRTAP9-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257290.1		
ABCA7	10347	hgsc.bcm.edu	37	19	1056069	1056069	+	Missense_Mutation	SNP	G	G	A	rs374185879		TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr19:1056069G>A	ENST00000263094.6	+	32	4474	c.4243G>A	c.(4243-4245)Gga>Aga	p.G1415R	ABCA7_ENST00000433129.1_Missense_Mutation_p.G1415R|ABCA7_ENST00000435683.2_Missense_Mutation_p.G1277R	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	1415					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCACAGATACGGAGGCTTCTC	0.716																																					p.G1415R		Atlas-SNP	.											.	ABCA7	174	.	0			c.G4243A						PASS	.	G	ARG/GLY	1,4403	2.1+/-5.4	0,1,2201	25.0	30.0	29.0		4243	2.8	1.0	19		29	0,8594		0,0,4297	no	missense	ABCA7	NM_019112.3	125	0,1,6498	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1415/2147	1056069	1,12997	2202	4297	6499	SO:0001583	missense	10347	exon32			AGATACGGAGGCT	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.4243G>A	chr19.hg19:g.1056069G>A	ENSP00000263094:p.Gly1415Arg	47.0	0.0	.		55.0	22.0	.	NM_019112	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	hg19	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	G	14.23	2.474727	0.43942	2.27E-4	0.0	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.97688	-4.49;-4.49	2.75	2.75	0.32379	.	.	.	.	.	D	0.98381	0.9462	M	0.83312	2.635	0.39760	D	0.972017	D	0.89917	1.0	D	0.73708	0.981	D	0.98917	1.0782	9	0.87932	D	0	.	11.1665	0.48545	0.0:0.0:1.0:0.0	.	1415	Q8IZY2	ABCA7_HUMAN	R	1415	ENSP00000263094:G1415R;ENSP00000414062:G1415R	ENSP00000263094:G1415R	G	+	1	0	ABCA7	1007069	0.980000	0.34600	0.957000	0.39632	0.040000	0.13550	1.241000	0.32743	1.859000	0.53934	0.561000	0.74099	GGA	.	.	.	weak		0.716	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
PRKCSH	5589	hgsc.bcm.edu	37	19	11558370	11558370	+	Silent	SNP	G	G	A	rs77563879		TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr19:11558370G>A	ENST00000589838.1	+	10	966	c.966G>A	c.(964-966)gaG>gaA	p.E322E	PRKCSH_ENST00000587327.1_Silent_p.E322E|PRKCSH_ENST00000412601.1_Silent_p.E322E|PRKCSH_ENST00000592741.1_Silent_p.E322E|PRKCSH_ENST00000591462.1_Silent_p.E322E|PRKCSH_ENST00000252455.2_Silent_p.E322E			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	322	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)	p.E321_E322delEE(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						aggaggaggaggaagaagagg	0.632																																					p.E322E		Atlas-SNP	.											PRKCSH,caecum,carcinoma,0,1	PRKCSH	55	.	1	Deletion - In frame(1)	central_nervous_system(1)	c.G966A						PASS	.						27.0	27.0	27.0					19																	11558370		2200	4298	6498	SO:0001819	synonymous_variant	5589	exon11			GGAGGAGGAAGAA		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.966G>A	chr19.hg19:g.11558370G>A		90.0	2.0	.		132.0	6.0	.	NM_001001329	A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	ENST00000589838.1	hg19	CCDS32911.1																																																																																			.	.	.	weak		0.632	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1		
NCCRP1	342897	hgsc.bcm.edu	37	19	39687821	39687821	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr19:39687821G>A	ENST00000339852.4	+	1	221	c.199G>A	c.(199-201)Gct>Act	p.A67T		NM_001001414.1	NP_001001414.1	Q6ZVX7	FBX50_HUMAN	non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)	67					positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	10						GCCGTCCGAGGCTCACGCCCG	0.786																																					p.A67T	Melanoma(107;1207 1556 14956 29427 52130)	Atlas-SNP	.											.	NCCRP1	25	.	0			c.G199A						PASS	.						1.0	1.0	1.0					19																	39687821		934	2129	3063	SO:0001583	missense	342897	exon1			TCCGAGGCTCACG	AK123941, BC067874	CCDS12529.1	19q13.2	2013-07-31	2008-11-19		ENSG00000188505	ENSG00000188505			33739	protein-coding gene	gene with protein product		615901					Standard	NM_001001414		Approved	LOC342897, NCCRP-1, FBXO50	uc002okq.1	Q6ZVX7		ENST00000339852.4:c.199G>A	chr19.hg19:g.39687821G>A	ENSP00000342137:p.Ala67Thr	16.0	0.0	.		19.0	5.0	.	NM_001001414	Q6NVV5	Missense_Mutation	SNP	ENST00000339852.4	hg19	CCDS12529.1	.	.	.	.	.	.	.	.	.	.	G	18.14	3.558257	0.65538	.	.	ENSG00000188505	ENST00000339852	T	0.33865	1.39	3.41	0.908	0.19326	.	0.556062	0.14784	U	0.298637	T	0.18841	0.0452	N	0.19112	0.55	0.09310	N	1	B	0.23058	0.079	B	0.17098	0.017	T	0.14755	-1.0461	10	0.30854	T	0.27	.	5.1669	0.15090	0.0:0.2537:0.5253:0.221	.	67	Q6ZVX7	NCRP1_HUMAN	T	67	ENSP00000342137:A67T	ENSP00000342137:A67T	A	+	1	0	NCCRP1	44379661	0.862000	0.29867	0.118000	0.21660	0.202000	0.24057	0.983000	0.29552	0.606000	0.29965	0.313000	0.20887	GCT	.	.	.	none		0.786	NCCRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463829.1	NM_001001414	
MTMR3	8897	hgsc.bcm.edu	37	22	30416092	30416092	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr22:30416092A>G	ENST00000401950.2	+	17	2786	c.2444A>G	c.(2443-2445)gAt>gGt	p.D815G	CTA-85E5.10_ENST00000453743.2_RNA|MTMR3_ENST00000351488.3_Missense_Mutation_p.D815G|MTMR3_ENST00000406629.1_Missense_Mutation_p.D815G|MTMR3_ENST00000323630.5_Missense_Mutation_p.D679G|CTA-85E5.10_ENST00000429350.1_RNA|MTMR3_ENST00000333027.3_Missense_Mutation_p.D815G	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	815					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			ATCCCAGTAGATGCAAAAGTT	0.517																																					p.D815G		Atlas-SNP	.											.	MTMR3	106	.	0			c.A2444G						PASS	.						124.0	113.0	117.0					22																	30416092		2203	4300	6503	SO:0001583	missense	8897	exon17			CAGTAGATGCAAA	U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.2444A>G	chr22.hg19:g.30416092A>G	ENSP00000384651:p.Asp815Gly	129.0	0.0	.		167.0	37.0	.	NM_153050	A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Missense_Mutation	SNP	ENST00000401950.2	hg19	CCDS13870.1	.	.	.	.	.	.	.	.	.	.	A	3.772	-0.047509	0.07407	.	.	ENSG00000100330	ENST00000401950;ENST00000333027;ENST00000323630;ENST00000351488;ENST00000406629	D;D;D;D;D	0.93426	-3.03;-3.0;-3.22;-3.05;-3.0	4.88	3.84	0.44239	.	1.378970	0.04300	N	0.347180	D	0.87022	0.6074	N	0.19112	0.55	0.09310	N	1	P;P;P	0.41848	0.763;0.651;0.763	B;B;B	0.35770	0.21;0.104;0.21	T	0.77811	-0.2449	10	0.23302	T	0.38	.	8.6349	0.33941	0.9129:0.0:0.0871:0.0	.	815;815;815	Q13615-3;Q13615;Q13615-2	.;MTMR3_HUMAN;.	G	815;815;679;815;815	ENSP00000384651:D815G;ENSP00000331649:D815G;ENSP00000318070:D679G;ENSP00000307271:D815G;ENSP00000384077:D815G	ENSP00000318070:D679G	D	+	2	0	MTMR3	28746092	0.032000	0.19561	0.168000	0.22838	0.187000	0.23431	1.914000	0.39966	0.987000	0.38709	0.533000	0.62120	GAT	.	.	.	none		0.517	MTMR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322066.1	NM_021090	
PACRG	135138	hgsc.bcm.edu	37	6	163483263	163483263	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr6:163483263delT	ENST00000337019.3	+	4	597	c.373delT	c.(373-375)tttfs	p.F126fs	PACRG_ENST00000366888.2_Frame_Shift_Del_p.F126fs|PACRG_ENST00000366889.2_Frame_Shift_Del_p.F126fs	NM_152410.2	NP_689623.2	Q96M98	PACRG_HUMAN	PARK2 co-regulated	126					spermatid development (GO:0007286)	cell body (GO:0044297)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm midpiece (GO:0097225)				endometrium(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)		TCCCTATGAGTTTTTTGCTCG	0.418																																					p.E124fs		Atlas-Indel,Pindel	.											.	PACRG	48	.	0			c.372delG						PASS	.						98.0	96.0	97.0					6																	163483263		2203	4300	6503	SO:0001589	frameshift_variant	135138	exon3			.	AK057286	CCDS5284.1, CCDS43524.1	6q26	2004-07-01			ENSG00000112530	ENSG00000112530			19152	protein-coding gene	gene with protein product		608427				12547187	Standard	NM_001080378		Approved	PARK2CRG, FLJ32724, Glup, HAK005771	uc003qua.3	Q96M98	OTTHUMG00000016116	ENST00000337019.3:c.373delT	chr6.hg19:g.163483263delT	ENSP00000337946:p.Phe126fs	89.0	0.0	0		173.0	69.0	0.398844	NM_001080379	E1P5B5|Q6IMB8|Q8IZM1|Q8NHP5|Q9H1V9	Frame_Shift_Del	DEL	ENST00000337019.3	hg19	CCDS5284.1																																																																																			.	.	.	none		0.418	PACRG-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400424.1	NM_152410	
KCNB1	3745	hgsc.bcm.edu	37	20	48098450	48098450	+	Splice_Site	DEL	C	C	-			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr20:48098450delC	ENST00000371741.4	-	1	734		c.e1+1			NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1						energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	CCCAGACTCACCTTGGCAGCC	0.567																																					.		Atlas-Indel,Pindel	.											.	KCNB1	142	.	0			c.567+2G>-						PASS	.						118.0	108.0	111.0					20																	48098450		2203	4300	6503	SO:0001630	splice_region_variant	3745	exon2			.	AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.567+1G>-	chr20.hg19:g.48098450delC		80.0	0.0	0		109.0	50.0	0.458716	NM_004975	Q14193	Splice_Site	DEL	ENST00000371741.4	hg19	CCDS13418.1																																																																																			.	.	.	none		0.567	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080374.3	NM_004975	Intron
KATNAL2	83473	hgsc.bcm.edu	37	18	44625645	44625646	+	In_Frame_Ins	INS	-	-	AGA			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr18:44625645_44625646insAGA	ENST00000245121.5	+	13	1221_1222	c.1027_1028insAGA	c.(1027-1029)gag>gAGAag	p.344_345insK	KATNAL2_ENST00000356157.7_In_Frame_Ins_p.416_417insK	NM_031303.2	NP_112593.2			katanin p60 subunit A-like 2											central_nervous_system(2)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	27						ACGCCGCCTGGAGAAGAGGATT	0.569																																					p.E343delinsEK		Atlas-Indel,Pindel	.											KATNAL2,colon,carcinoma,0,1	KATNAL2	64	.	0			c.1027_1028insAGA						PASS	.																																			SO:0001652	inframe_insertion	83473	exon13			.	BC034999	CCDS32828.1	18q21.1	2010-04-21			ENSG00000167216	ENSG00000167216		"""ATPases / AAA-type"""	25387	protein-coding gene	gene with protein product		614697				12477932	Standard	NM_031303		Approved	MGC33211, DKFZP667C165	uc002lco.3	Q8IYT4		ENST00000245121.5:c.1031_1033dupAGA	chr18.hg19:g.44625649_44625651dupAGA	ENSP00000245121:p.Lys344_Lys344dup	77.0	0.0	0		79.0	35.0	0.443038	NM_031303		In_Frame_Ins	INS	ENST00000245121.5	hg19	CCDS32828.1																																																																																			.	.	.	none		0.569	KATNAL2-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446138.2	NM_031303	
SGK223	157285	hgsc.bcm.edu	37	8	8235005	8235005	+	Frame_Shift_Del	DEL	G	G	-	rs538380081		TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr8:8235005delG	ENST00000520004.1	-	3	1178	c.914delC	c.(913-915)ccgfs	p.P305fs	SGK223_ENST00000330777.4_Frame_Shift_Del_p.P305fs			Q86YV5	SG223_HUMAN		305							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										GGGGAAGCTCGGGCCCCGCTT	0.672																																					p.P305fs	GBM(34;731 755 10259 33573 33867)	Atlas-Indel,Pindel	.											.	.	.	.	0			c.915delG						PASS	.						12.0	17.0	15.0					8																	8235005		1892	4045	5937	SO:0001589	frameshift_variant	0	exon2			.																												ENST00000520004.1:c.914delC	chr8.hg19:g.8235005delG	ENSP00000428054:p.Pro305fs	111.0	0.0	0		174.0	65.0	0.373563	NM_001080826	Q8N3N5	Frame_Shift_Del	DEL	ENST00000520004.1	hg19	CCDS43706.1																																																																																			.	.	.	none		0.672	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1		
PEPD	5184	hgsc.bcm.edu	37	19	33902620	33902621	+	In_Frame_Ins	INS	-	-	CGTGTC	rs370370158		TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr19:33902620_33902621insCGTGTC	ENST00000244137.7	-	11	808_809	c.775_776insGACACG	c.(775-777)gcc>gGACACGcc	p.258_259insGH	PEPD_ENST00000436370.3_In_Frame_Ins_p.194_195insGH|PEPD_ENST00000397032.4_In_Frame_Ins_p.217_218insGH	NM_000285.3	NP_000276.2	P12955	PEPD_HUMAN	peptidase D	258					cellular amino acid metabolic process (GO:0006520)|collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)	aminopeptidase activity (GO:0004177)|dipeptidase activity (GO:0016805)|manganese ion binding (GO:0030145)|metallocarboxypeptidase activity (GO:0004181)			endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	17	Esophageal squamous(110;0.137)					GGGAGCTCCGGCGTGTCCGTAG	0.599																																					p.A259delinsGHA		Pindel	.											.	PEPD	48	.	0			c.776_777insGACACG						PASS	.																																			SO:0001652	inframe_insertion	5184	exon11			.	BC015027	CCDS42544.1, CCDS54244.1, CCDS54245.1	19q13.11	2008-02-05				ENSG00000124299	3.4.13.9		8840	protein-coding gene	gene with protein product	"""prolidase"""	613230				2925654, 1972707	Standard	NM_000285		Approved		uc002nur.4	P12955		ENST00000244137.7:c.770_775dupGACACG	chr19.hg19:g.33902621_33902626dupCGTGTC	ENSP00000244137:p.Gly257_His258dup	48.0	0.0	.		41.0	13.0	0.317	NM_000285	A8K3Z1|A8K416|A8K696|A8MX47|B4DDB7|B4DGJ1|E9PCE8|Q8TBN9|Q9BT75	In_Frame_Ins	INS	ENST00000244137.7	hg19	CCDS42544.1																																																																																			.	.	.	none		0.599	PEPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451432.3	NM_000285	
ALS2	57679	hgsc.bcm.edu	37	2	202622485	202622485	+	Intron	DEL	A	A	-			TCGA-SX-A7SU-01A-11D-A35Z-10	TCGA-SX-A7SU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	06de0d9e-db97-4250-a774-fa0f4eabbe74	7d1da0d0-0c30-4440-b607-036215cc6509	g.chr2:202622485delA	ENST00000264276.6	-	5	1486					NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)						behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						AAAAGAGGCTAAAATATACAC	0.383																																					.		Pindel	.											.	ALS2	172	.	0			c.1114-2T>-						PASS	.						28.0	27.0	28.0					2																	202622485		1845	4087	5932	SO:0001627	intron_variant	57679	exon6			.	AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.1114-3T>-	chr2.hg19:g.202622485delA		18.0	0.0	.		38.0	10.0	0.263	NM_020919	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Splice_Site	DEL	ENST00000264276.6	hg19	CCDS42800.1																																																																																			.	.	.	none		0.383	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	NM_020919	
