#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CDC14A	8556	hgsc.bcm.edu	37	1	100856289	100856289	+	Splice_Site	SNP	C	C	T			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr1:100856289C>T	ENST00000336454.3	+	4	573	c.218C>T	c.(217-219)tCa>tTa	p.S73L	CDC14A_ENST00000544534.1_Splice_Site_p.S73L|CDC14A_ENST00000370125.2_Splice_Site_p.S73L|CDC14A_ENST00000542213.1_Splice_Site_p.S15L|CDC14A_ENST00000370124.3_Splice_Site_p.S73L|CDC14A_ENST00000361544.6_Splice_Site_p.S73L	NM_003672.3	NP_003663.2	Q9UNH5	CC14A_HUMAN	cell division cycle 14A	73	A.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(6)|large_intestine(6)|lung(10)|skin(2)|urinary_tract(1)	31		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)		TCTTTCTAGTCATACAGTTTG	0.368																																					p.S73L		Atlas-SNP	.											.	CDC14A	65	.	0			c.C218T						PASS	.						102.0	97.0	99.0					1																	100856289		2203	4300	6503	SO:0001630	splice_region_variant	8556	exon4			TCTAGTCATACAG	AF000367	CCDS769.1, CCDS770.1, CCDS771.1	1p21	2013-01-17	2013-01-17		ENSG00000079335	ENSG00000079335		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1718	protein-coding gene	gene with protein product		603504	"""CDC10 (cell division cycle 10, S. cerevisiae, homolog)"", ""CDC14 cell division cycle 14 homolog A (S. cerevisiae)"""			9367992, 10409437	Standard	NM_033312		Approved	Cdc14A1, Cdc14A2, cdc14	uc001dtf.2	Q9UNH5	OTTHUMG00000010987	ENST00000336454.3:c.217-1C>T	chr1.hg19:g.100856289C>T		57.0	0.0	.		62.0	47.0	.	NM_033313	A6MA65|B1AQ14|B1AQ15|O43171|O60727|O60728|Q52LH9|Q8IXX0	Missense_Mutation	SNP	ENST00000336454.3	hg19	CCDS769.1	.	.	.	.	.	.	.	.	.	.	C	18.55	3.648522	0.67358	.	.	ENSG00000079335	ENST00000542213;ENST00000455467;ENST00000370125;ENST00000361544;ENST00000370124;ENST00000336454;ENST00000544534	T;T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88;0.88	5.62	5.62	0.85841	.	0.061993	0.64402	D	0.000002	T	0.32793	0.0841	M	0.67700	2.07	0.80722	D	1	P;P;B;P;P;B	0.42483	0.781;0.674;0.01;0.479;0.781;0.006	B;B;B;B;B;B	0.35655	0.207;0.102;0.022;0.061;0.207;0.01	T	0.42582	-0.9443	10	0.72032	D	0.01	-12.363	18.4311	0.90625	0.0:1.0:0.0:0.0	.	15;73;73;73;73;73	F5H7B3;A6MA65;Q9UNH5-3;Q9UNH5;Q9UNH5-2;Q52LH9	.;.;.;CC14A_HUMAN;.;.	L	15;74;73;73;73;73;73	ENSP00000442640:S15L;ENSP00000388501:S74L;ENSP00000359143:S73L;ENSP00000354916:S73L;ENSP00000359142:S73L;ENSP00000336739:S73L;ENSP00000442543:S73L	ENSP00000336739:S73L	S	+	2	0	CDC14A	100628877	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	4.880000	0.63107	2.648000	0.89879	0.561000	0.74099	TCA	.	.	.	none		0.368	CDC14A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000030220.1	NM_033312	Missense_Mutation
TRH	7200	hgsc.bcm.edu	37	3	129695840	129695840	+	Silent	SNP	G	G	A			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr3:129695840G>A	ENST00000302649.3	+	3	1037	c.510G>A	c.(508-510)gaG>gaA	p.E170E	TRH_ENST00000507066.1_Silent_p.E166E	NM_007117.3	NP_009048.1	P20396	TRH_HUMAN	thyrotropin-releasing hormone	170					adult walking behavior (GO:0007628)|cell-cell signaling (GO:0007267)|eating behavior (GO:0042755)|histamine metabolic process (GO:0001692)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of feeding behavior (GO:2000252)|negative regulation of glutamate secretion (GO:0014050)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of insulin secretion (GO:0032024)|response to cold (GO:0009409)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	thyrotropin-releasing hormone activity (GO:0008437)	p.E170E(1)		NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	14						Gggaagaagaggaggaggagg	0.642																																					p.E170E	Esophageal Squamous(60;321 1330 17401 41911)	Atlas-SNP	.											TRH,right_upper_lobe,carcinoma,0,2	TRH	30	.	1	Substitution - coding silent(1)	prostate(1)	c.G510A						PASS	.						33.0	35.0	34.0					3																	129695840		2202	4300	6502	SO:0001819	synonymous_variant	7200	exon3			AGAAGAGGAGGAG		CCDS3066.1	3q13.3-q21	2013-02-28				ENSG00000170893		"""Endogenous ligands"""	12298	protein-coding gene	gene with protein product	"""prothyroliberin"""	613879				2126343, 1900134	Standard	NM_007117		Approved		uc003enc.4	P20396		ENST00000302649.3:c.510G>A	chr3.hg19:g.129695840G>A		52.0	0.0	.		80.0	4.0	.	NM_007117	B2R8R1|Q2TB83	Silent	SNP	ENST00000302649.3	hg19	CCDS3066.1																																																																																			.	.	.	none		0.642	TRH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356592.1	NM_007117	
SLC7A14	57709	hgsc.bcm.edu	37	3	170244698	170244698	+	Missense_Mutation	SNP	G	G	T			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr3:170244698G>T	ENST00000231706.5	-	2	343	c.28C>A	c.(28-30)Ccc>Acc	p.P10T	CLDN11_ENST00000451576.1_Intron|CLDN11_ENST00000486975.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	10					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			ACCCGCCGGGGGTCCAGCGAG	0.582																																					p.P10T		Atlas-SNP	.											.	SLC7A14	110	.	0			c.C28A						PASS	.						41.0	39.0	39.0					3																	170244698		2203	4300	6503	SO:0001583	missense	57709	exon2			GCCGGGGGTCCAG	BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.28C>A	chr3.hg19:g.170244698G>T	ENSP00000231706:p.Pro10Thr	63.0	0.0	.		93.0	28.0	.	NM_020949	B3KV33|Q9HCF9	Missense_Mutation	SNP	ENST00000231706.5	hg19	CCDS33892.1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.698447	0.68386	.	.	ENSG00000013293	ENST00000231706	D	0.90324	-2.65	5.26	5.26	0.73747	.	0.118551	0.64402	D	0.000019	D	0.92424	0.7595	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.93470	0.6818	10	0.72032	D	0.01	.	19.2442	0.93895	0.0:0.0:1.0:0.0	.	10	Q8TBB6	S7A14_HUMAN	T	10	ENSP00000231706:P10T	ENSP00000231706:P10T	P	-	1	0	SLC7A14	171727392	1.000000	0.71417	1.000000	0.80357	0.273000	0.26683	9.401000	0.97294	2.614000	0.88457	0.561000	0.74099	CCC	.	.	.	none		0.582	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352598.2	NM_020949	
MSH3	4437	hgsc.bcm.edu	37	5	79950745	79950745	+	Missense_Mutation	SNP	C	C	G	rs144629981|rs3045983|rs557874766	byFrequency	TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr5:79950745C>G	ENST00000265081.6	+	1	279	c.199C>G	c.(199-201)Cca>Gca	p.P67A	DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000513048.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000504396.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	67					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		CCCAGCGCCCCCAGCTCCCGC	0.731								Mismatch excision repair (MMR)					C|||	1091	0.217851	0.2678	0.1916	5008	,	,		6483	0.0476		0.2356	False		,,,				2504	0.3262				p.P67A	Melanoma(88;1010 1399 13793 26548 36275)	Atlas-SNP	.											MSH3,NS,carcinoma,0,1	MSH3	129	.	0			c.C199G						PASS	.						3.0	4.0	3.0					5																	79950745		1702	3410	5112	SO:0001583	missense	4437	exon1			GCGCCCCCAGCTC	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.199C>G	chr5.hg19:g.79950745C>G	ENSP00000265081:p.Pro67Ala	27.0	0.0	.		70.0	23.0	.	NM_002439	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Missense_Mutation	SNP	ENST00000265081.6	hg19	CCDS34195.1	.	.	.	.	.	.	.	.	.	.	C	6.333	0.429466	0.11987	.	.	ENSG00000113318	ENST00000265081;ENST00000535995	D	0.85484	-1.99	.	.	.	.	.	.	.	.	T	0.70150	0.3191	N	0.19112	0.55	0.19945	N	0.999946	B	0.18741	0.03	B	0.17098	0.017	T	0.53507	-0.8429	6	.	.	.	0.6693	.	.	.	.	67	P20585	MSH3_HUMAN	A	67;58	ENSP00000265081:P67A	.	P	+	1	0	MSH3	79986501	0.560000	0.26570	0.857000	0.33713	0.119000	0.20118	0.055000	0.14229	0.064000	0.16427	0.064000	0.15345	CCA	.	.	.	none		0.731	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
EPB41L4A	64097	hgsc.bcm.edu	37	5	111602024	111602024	+	Nonsense_Mutation	SNP	A	A	T			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr5:111602024A>T	ENST00000261486.5	-	5	615	c.339T>A	c.(337-339)taT>taA	p.Y113*		NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A	113	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		AGAAAAACTGATATCTAAAAG	0.463																																					p.Y113X		Atlas-SNP	.											.	EPB41L4A	130	.	0			c.T339A						PASS	.						32.0	33.0	32.0					5																	111602024		1878	4109	5987	SO:0001587	stop_gained	64097	exon5			AAACTGATATCTA	AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000261486.5:c.339T>A	chr5.hg19:g.111602024A>T	ENSP00000261486:p.Tyr113*	454.0	0.0	.		684.0	190.0	.	NM_022140	A4FUI6	Nonsense_Mutation	SNP	ENST00000261486.5	hg19	CCDS43350.1	.	.	.	.	.	.	.	.	.	.	A	36	5.879440	0.97062	.	.	ENSG00000129595	ENST00000261486	.	.	.	5.91	-4.25	0.03766	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.0521	0.58960	0.5598:0.0:0.4402:0.0	.	.	.	.	X	113	.	ENSP00000261486:Y113X	Y	-	3	2	EPB41L4A	111629923	0.989000	0.36119	0.970000	0.41538	0.897000	0.52465	0.329000	0.19698	-0.675000	0.05246	-0.256000	0.11100	TAT	.	.	.	none		0.463	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370969.1		
TRIM36	55521	hgsc.bcm.edu	37	5	114462477	114462477	+	Missense_Mutation	SNP	G	G	C			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr5:114462477G>C	ENST00000282369.3	-	10	2031	c.1910C>G	c.(1909-1911)aCt>aGt	p.T637S	TRIM36_ENST00000514154.1_Missense_Mutation_p.T482S|TRIM36_ENST00000513154.1_Missense_Mutation_p.T625S	NM_018700.3	NP_061170.2	Q9NQ86	TRI36_HUMAN	tripartite motif containing 36	637	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				acrosome reaction (GO:0007340)|regulation of cell cycle (GO:0051726)	acrosomal vesicle (GO:0001669)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	37		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		CATGCCTATAGTAACTAAGGT	0.378																																					p.T637S		Atlas-SNP	.											.	TRIM36	126	.	0			c.C1910G						PASS	.						94.0	95.0	94.0					5																	114462477		2202	4300	6502	SO:0001583	missense	55521	exon10			CCTATAGTAACTA	AJ272269	CCDS4115.1, CCDS34211.1, CCDS34212.1, CCDS75287.1	5q22	2013-02-11	2011-01-25		ENSG00000152503	ENSG00000152503		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16280	protein-coding gene	gene with protein product	"""zinc-binding protein Rbcc728"", ""tripartite motif protein 36"", ""RING finger protein 98"""	609317	"""tripartite motif-containing 36"""			11331580	Standard	XM_005272031		Approved	RBCC728, RNF98, HAPRIN	uc003kqs.3	Q9NQ86	OTTHUMG00000128892	ENST00000282369.3:c.1910C>G	chr5.hg19:g.114462477G>C	ENSP00000282369:p.Thr637Ser	100.0	0.0	.		193.0	70.0	.	NM_018700	A1L3Z1|A6NDD0|B7Z3V4|B7ZAV7|E9PFI8|Q0P5Z9	Missense_Mutation	SNP	ENST00000282369.3	hg19	CCDS4115.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.511711	0.85389	.	.	ENSG00000152503	ENST00000282369;ENST00000513154;ENST00000514154	T;T;T	0.66995	-0.24;-0.24;-0.24	5.37	5.37	0.77165	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.103031	0.64402	D	0.000004	T	0.78470	0.4288	L	0.53249	1.67	0.80722	D	1	P;P	0.39696	0.477;0.683	B;P	0.58391	0.26;0.838	T	0.73927	-0.3828	10	0.34782	T	0.22	.	19.4818	0.95013	0.0:0.0:1.0:0.0	.	625;637	E9PFI8;Q9NQ86	.;TRI36_HUMAN	S	637;625;482	ENSP00000282369:T637S;ENSP00000423934:T625S;ENSP00000424259:T482S	ENSP00000282369:T637S	T	-	2	0	TRIM36	114490376	1.000000	0.71417	0.658000	0.29665	0.759000	0.43091	9.203000	0.95033	2.658000	0.90341	0.591000	0.81541	ACT	.	.	.	none		0.378	TRIM36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250854.2	NM_018700	
RFX6	222546	hgsc.bcm.edu	37	6	117237249	117237249	+	Splice_Site	SNP	G	G	A			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr6:117237249G>A	ENST00000332958.2	+	8	874		c.e8+1		RFX6_ENST00000471966.1_Splice_Site	NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6						endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						CTTTGAAGAGGTAAGAATGAC	0.308																																					.		Atlas-SNP	.											.	RFX6	141	.	0			c.858+1G>A						PASS	.						111.0	109.0	110.0					6																	117237249		2203	4300	6503	SO:0001630	splice_region_variant	222546	exon8			GAAGAGGTAAGAA	BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.858+1G>A	chr6.hg19:g.117237249G>A		84.0	0.0	.		57.0	44.0	.	NM_173560	Q5T6B3	Splice_Site	SNP	ENST00000332958.2	hg19	CCDS5113.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.498525	0.85069	.	.	ENSG00000185002	ENST00000332958	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9384	0.97150	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RFX6	117343942	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	9.476000	0.97823	2.717000	0.92951	0.585000	0.79938	.	.	.	.	none		0.308	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041970.2	NM_173560	Intron
GPR158	57512	hgsc.bcm.edu	37	10	25464395	25464395	+	Nonsense_Mutation	SNP	C	C	T			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr10:25464395C>T	ENST00000376351.3	+	1	405	c.46C>T	c.(46-48)Cag>Tag	p.Q16*	GPR158-AS1_ENST00000449643.1_RNA	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	16					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						CCTGCTTGCTCAGCTGGGATT	0.637																																					p.Q16X		Atlas-SNP	.											.	GPR158	255	.	0			c.C46T						PASS	.						35.0	41.0	39.0					10																	25464395		2203	4293	6496	SO:0001587	stop_gained	57512	exon1			CTTGCTCAGCTGG	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.46C>T	chr10.hg19:g.25464395C>T	ENSP00000365529:p.Gln16*	55.0	0.0	.		105.0	42.0	.	NM_020752	Q6QR81|Q9ULT3	Nonsense_Mutation	SNP	ENST00000376351.3	hg19	CCDS31166.1	.	.	.	.	.	.	.	.	.	.	C	39	7.530076	0.98342	.	.	ENSG00000151025	ENST00000376351	.	.	.	4.72	4.72	0.59763	.	1.302630	0.05575	N	0.571782	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	11.0535	0.47905	0.0:0.9137:0.0:0.0863	.	.	.	.	X	16	.	ENSP00000365529:Q16X	Q	+	1	0	GPR158	25504401	0.641000	0.27251	0.139000	0.22197	0.942000	0.58702	3.736000	0.55052	2.462000	0.83206	0.467000	0.42956	CAG	.	.	.	none		0.637	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110	
ARHGEF25	115557	hgsc.bcm.edu	37	12	58006909	58006909	+	Silent	SNP	T	T	A			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr12:58006909T>A	ENST00000286494.4	+	2	754	c.294T>A	c.(292-294)ggT>ggA	p.G98G	AC025165.8_ENST00000356672.3_RNA|AC025165.8_ENST00000444467.1_RNA|ARHGEF25_ENST00000333972.7_Silent_p.G137G|AC025165.8_ENST00000610219.1_RNA|AC025165.8_ENST00000593846.1_RNA	NM_182947.3	NP_891992	Q86VW2	ARHGP_HUMAN	Rho guanine nucleotide exchange factor (GEF) 25	98						cytosol (GO:0005829)|myofibril (GO:0030016)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	28						CAGACAGTGGTCAGGCAGGAC	0.587																																					p.G137G		Atlas-SNP	.											.	ARHGEF25	111	.	0			c.T411A						PASS	.						34.0	29.0	30.0					12																	58006909		2203	4300	6503	SO:0001819	synonymous_variant	115557	exon3			CAGTGGTCAGGCA		CCDS8947.1, CCDS44931.1	12q13.3	2011-11-16			ENSG00000240771	ENSG00000240771		"""Rho guanine nucleotide exchange factors"""	30275	protein-coding gene	gene with protein product	"""RAC/CDC42 exchange factor"""	610215				12547822	Standard	NM_182947		Approved	GEFT, p63RhoGEF	uc009zpy.4	Q86VW2	OTTHUMG00000152516	ENST00000286494.4:c.294T>A	chr12.hg19:g.58006909T>A		54.0	0.0	.		94.0	42.0	.	NM_001111270	A6NJH5|A9CQZ6|F8W7Z4|Q8WV84|Q96E63	Silent	SNP	ENST00000286494.4	hg19	CCDS8947.1																																																																																			.	.	.	none		0.587	ARHGEF25-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000326561.1	NM_133483	
CHFR	55743	hgsc.bcm.edu	37	12	133428243	133428243	+	Missense_Mutation	SNP	C	C	G			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr12:133428243C>G	ENST00000432561.2	-	12	1562	c.1489G>C	c.(1489-1491)Gcg>Ccg	p.A497P	CHFR_ENST00000541837.2_5'UTR|CHFR_ENST00000537522.1_Missense_Mutation_p.A119P|CHFR_ENST00000266880.7_Missense_Mutation_p.A496P|CHFR_ENST00000315585.7_Missense_Mutation_p.A456P|CHFR_ENST00000450056.2_Missense_Mutation_p.A485P|CHFR_ENST00000443047.2_Missense_Mutation_p.A405P			Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase	497			A -> V (common polymorphism; dbSNP:rs2306541). {ECO:0000269|PubMed:11948416, ECO:0000269|PubMed:15489334}.		mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|modification-dependent protein catabolic process (GO:0019941)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)|PML body (GO:0016605)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		TCGCGCTCCGCTCTCCGGTCG	0.652																																					p.A497P		Atlas-SNP	.											.	CHFR	83	.	0			c.G1489C						PASS	.						74.0	77.0	76.0					12																	133428243		2203	4300	6503	SO:0001583	missense	55743	exon12			GCTCCGCTCTCCG	AK001658	CCDS31937.1, CCDS53847.1, CCDS53848.1, CCDS53849.1	12q24.33	2012-02-23	2012-02-23			ENSG00000072609		"""RING-type (C3HC4) zinc fingers"""	20455	protein-coding gene	gene with protein product		605209	"""checkpoint with forkhead and ring finger domains"""			10935642, 11807090	Standard	NM_001161344		Approved	FLJ10796, RNF196	uc001ulf.2	Q96EP1		ENST00000432561.2:c.1489G>C	chr12.hg19:g.133428243C>G	ENSP00000392395:p.Ala497Pro	60.0	0.0	.		114.0	43.0	.	NM_001161344	A6NEN5|B4DZ77|B4E2L6|Q96SL3|Q9NRT4|Q9NT32|Q9NVD5	Missense_Mutation	SNP	ENST00000432561.2	hg19	CCDS53849.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.116277	0.77323	.	.	ENSG00000072609	ENST00000315585;ENST00000443047;ENST00000450056;ENST00000266880;ENST00000537522;ENST00000541228;ENST00000432561	T;T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56;1.56	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.52517	0.1739	L	0.55481	1.735	0.80722	D	1	B;D;D;D;D	0.67145	0.036;0.995;0.991;0.995;0.996	B;D;D;D;D	0.69479	0.059;0.964;0.921;0.964;0.956	T	0.22452	-1.0216	10	0.33940	T	0.23	-16.074	20.6634	0.99662	0.0:1.0:0.0:0.0	.	405;496;497;485;456	Q96EP1-5;Q96EP1-4;Q96EP1;Q96EP1-2;Q96EP1-3	.;.;CHFR_HUMAN;.;.	P	456;405;485;496;119;297;497	ENSP00000320557:A456P;ENSP00000416431:A405P;ENSP00000398735:A485P;ENSP00000266880:A496P;ENSP00000442327:A119P;ENSP00000392395:A497P	ENSP00000266880:A496P	A	-	1	0	CHFR	131938316	1.000000	0.71417	0.994000	0.49952	0.268000	0.26511	3.975000	0.56859	2.894000	0.99253	0.655000	0.94253	GCG	.	.	.	none		0.652	CHFR-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397130.2		
KIAA0247	9766	hgsc.bcm.edu	37	14	70171432	70171432	+	Missense_Mutation	SNP	C	C	G			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr14:70171432C>G	ENST00000342745.4	+	4	744	c.431C>G	c.(430-432)cCa>cGa	p.P144R		NM_014734.3	NP_055549.1	Q92537	K0247_HUMAN	KIAA0247	144						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)	10				all cancers(60;0.00155)|BRCA - Breast invasive adenocarcinoma(234;0.0164)|OV - Ovarian serous cystadenocarcinoma(108;0.0196)		CTGCTGCAGCCAAAGCTGAAG	0.562																																					p.P144R		Atlas-SNP	.											.	KIAA0247	30	.	0			c.C431G						PASS	.						83.0	68.0	73.0					14																	70171432		2203	4300	6503	SO:0001583	missense	9766	exon4			TGCAGCCAAAGCT	D87434	CCDS9796.1	14q24.1	2012-11-29			ENSG00000100647	ENSG00000100647			19956	protein-coding gene	gene with protein product						9039502	Standard	NM_014734		Approved		uc001xlk.3	Q92537	OTTHUMG00000171234	ENST00000342745.4:c.431C>G	chr14.hg19:g.70171432C>G	ENSP00000344424:p.Pro144Arg	62.0	0.0	.		52.0	45.0	.	NM_014734		Missense_Mutation	SNP	ENST00000342745.4	hg19	CCDS9796.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.861030	0.91433	.	.	ENSG00000100647	ENST00000342745	T	0.66099	-0.19	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.78400	0.4277	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.79808	-0.1647	10	0.72032	D	0.01	-13.2989	19.2191	0.93789	0.0:1.0:0.0:0.0	.	144	Q92537	K0247_HUMAN	R	144	ENSP00000344424:P144R	ENSP00000344424:P144R	P	+	2	0	KIAA0247	69241185	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.426000	0.80270	2.541000	0.85698	0.561000	0.74099	CCA	.	.	.	none		0.562	KIAA0247-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412453.1	NM_014734	
SNRPA1	6627	hgsc.bcm.edu	37	15	101827180	101827180	+	Missense_Mutation	SNP	T	T	C			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr15:101827180T>C	ENST00000254193.6	-	5	464	c.392A>G	c.(391-393)tAc>tGc	p.Y131C	SNRPA1_ENST00000560856.1_5'UTR	NM_003090.2	NP_003081.2	P09661	RU2A_HUMAN	small nuclear ribonucleoprotein polypeptide A'	131	LRRCT.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U2 snRNP (GO:0005686)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6	Lung NSC(78;0.00156)|all_lung(78;0.00195)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00113)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ATACAATCTGTAATGCTTCTT	0.373																																					p.Y131C		Atlas-SNP	.											.	SNRPA1	11	.	0			c.A392G						PASS	.						116.0	119.0	118.0					15																	101827180		2203	4299	6502	SO:0001583	missense	6627	exon5			AATCTGTAATGCT	AJ130971	CCDS10391.1	15q26.3	2011-10-11			ENSG00000131876	ENSG00000131876			11152	protein-coding gene	gene with protein product		603521				2928112	Standard	NM_003090		Approved	Lea1	uc002bww.3	P09661	OTTHUMG00000149871	ENST00000254193.6:c.392A>G	chr15.hg19:g.101827180T>C	ENSP00000254193:p.Tyr131Cys	51.0	0.0	.		52.0	16.0	.	NM_003090	B2R5I6|Q8TBD2	Missense_Mutation	SNP	ENST00000254193.6	hg19	CCDS10391.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.439257	0.83885	.	.	ENSG00000131876	ENST00000254193	T	0.62941	-0.01	5.62	5.62	0.85841	U2A&apos (1);/phosphoprotein 32 family A, C-terminal (1);	0.060291	0.64402	D	0.000002	D	0.85513	0.5714	H	0.96239	3.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90103	0.4186	10	0.87932	D	0	-11.2598	14.9907	0.71387	0.0:0.0:0.0:1.0	.	131	P09661	RU2A_HUMAN	C	131	ENSP00000254193:Y131C	ENSP00000254193:Y131C	Y	-	2	0	SNRPA1	99644703	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.564000	0.82326	2.127000	0.65507	0.533000	0.62120	TAC	.	.	.	none		0.373	SNRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313621.2	NM_003090	
CCDC64B	146439	hgsc.bcm.edu	37	16	3079566	3079566	+	Missense_Mutation	SNP	C	C	T			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr16:3079566C>T	ENST00000572449.1	-	6	999	c.937G>A	c.(937-939)Gac>Aac	p.D313N	CCDC64B_ENST00000573514.1_Missense_Mutation_p.D106N|CCDC64B_ENST00000389347.4_Missense_Mutation_p.D313N|RP11-473M20.5_ENST00000382225.3_RNA			A1A5D9	BICR2_HUMAN	coiled-coil domain containing 64B	313										breast(1)|endometrium(2)|large_intestine(1)	4						CCGGGTGCGTCGGCGCCCTGG	0.682																																					p.D313N		Atlas-SNP	.											.	CCDC64B	19	.	0			c.G937A						PASS	.						7.0	8.0	8.0					16																	3079566		1861	4038	5899	SO:0001583	missense	146439	exon5			GTGCGTCGGCGCC	BC128602	CCDS45393.1	16p13.3	2008-07-04				ENSG00000162069			33584	protein-coding gene	gene with protein product							Standard	NM_001103175		Approved		uc002ctf.4	A1A5D9		ENST00000572449.1:c.937G>A	chr16.hg19:g.3079566C>T	ENSP00000459043:p.Asp313Asn	45.0	0.0	.		89.0	41.0	.	NM_001103175	Q658L9	Missense_Mutation	SNP	ENST00000572449.1	hg19	CCDS45393.1	.	.	.	.	.	.	.	.	.	.	C	14.22	2.469255	0.43839	.	.	ENSG00000162069	ENST00000389347	T	0.30182	1.54	4.61	-0.595	0.11660	.	2.409390	0.01588	N	0.021386	T	0.18882	0.0453	N	0.21448	0.665	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.10917	-1.0609	10	0.16420	T	0.52	-0.5399	4.1455	0.10214	0.0:0.4688:0.1861:0.345	.	313	A1A5D9	BICR2_HUMAN	N	313	ENSP00000373998:D313N	ENSP00000373998:D313N	D	-	1	0	CCDC64B	3019567	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	1.142000	0.31540	0.317000	0.23160	0.491000	0.48974	GAC	.	.	.	none		0.682	CCDC64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436991.1		
FBXL19	54620	hgsc.bcm.edu	37	16	30953551	30953551	+	Missense_Mutation	SNP	G	G	T			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr16:30953551G>T	ENST00000380310.2	+	8	1634	c.1476G>T	c.(1474-1476)tgG>tgT	p.W492C	FBXL19_ENST00000562319.1_Missense_Mutation_p.W472C|FBXL19_ENST00000565690.1_Missense_Mutation_p.W356C|FBXL19_ENST00000338343.4_Missense_Mutation_p.W472C|FBXL19_ENST00000471231.2_Missense_Mutation_p.W180C	NM_001099784.2	NP_001093254.2	Q6PCT2	FXL19_HUMAN	F-box and leucine-rich repeat protein 19	492					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	SCF ubiquitin ligase complex (GO:0019005)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						ACCTCAGCTGGACAGGTGTCT	0.632											OREG0023741	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.W492C		Atlas-SNP	.											.	FBXL19	74	.	0			c.G1476T						PASS	.						37.0	40.0	39.0					16																	30953551		2037	4186	6223	SO:0001583	missense	54620	exon8			CAGCTGGACAGGT	AK127701	CCDS45465.1, CCDS73873.1	16p11.2	2014-02-20			ENSG00000099364	ENSG00000099364		"""F-boxes / Leucine-rich repeats"""	25300	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1C"""	609085					Standard	NM_001099784		Approved	DKFZp434K0410, Fbl19, JHDM1C, CXXC11	uc002eab.2	Q6PCT2	OTTHUMG00000132403	ENST00000380310.2:c.1476G>T	chr16.hg19:g.30953551G>T	ENSP00000369666:p.Trp492Cys	55.0	0.0	.	821	63.0	32.0	.	NM_001099784	A8MT10|Q8N789|Q9NT14	Missense_Mutation	SNP	ENST00000380310.2	hg19	CCDS45465.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.51|18.51	3.639759|3.639759	0.67244|0.67244	.|.	.|.	ENSG00000099364|ENSG00000099364	ENST00000427128|ENST00000338343;ENST00000380310	.|T;T	.|0.51817	.|0.69;0.69	4.73|4.73	4.73|4.73	0.59995|0.59995	.|.	.|0.835286	.|0.10889	.|N	.|0.622978	T|T	0.66177|0.66177	0.2763|0.2763	L|L	0.61036|0.61036	1.89|1.89	0.58432|0.58432	D|D	0.999998|0.999998	.|D;D	.|0.71674	.|0.979;0.998	.|P;P	.|0.62649	.|0.905;0.85	T|T	0.64198|0.64198	-0.6464|-0.6464	5|10	.|0.56958	.|D	.|0.05	-11.5857|-11.5857	16.9952|16.9952	0.86365|0.86365	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|492;449	.|Q6PCT2;Q6PCT2-2	.|FXL19_HUMAN;.	Y|C	384|472;492	.|ENSP00000339712:W472C;ENSP00000369666:W492C	.|ENSP00000339712:W472C	D|W	+|+	1|3	0|0	FBXL19|FBXL19	30861052|30861052	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	4.088000|4.088000	0.57678|0.57678	2.631000|2.631000	0.89168|0.89168	0.655000|0.655000	0.94253|0.94253	GAC|TGG	.	.	.	none		0.632	FBXL19-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_019085	
SERPINF1	5176	hgsc.bcm.edu	37	17	1675238	1675238	+	Missense_Mutation	SNP	G	G	A			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr17:1675238G>A	ENST00000254722.4	+	5	675	c.512G>A	c.(511-513)gGc>gAc	p.G171D		NM_002615.5	NP_002606.3	P36955	PEDF_HUMAN	serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1	171					aging (GO:0007568)|cell proliferation (GO:0008283)|kidney development (GO:0001822)|multicellular organismal development (GO:0007275)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of inflammatory response (GO:0050728)|positive regulation of neurogenesis (GO:0050769)|regulation of proteolysis (GO:0030162)|response to glucocorticoid (GO:0051384)|response to retinoic acid (GO:0032526)|short-term memory (GO:0007614)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	16						GTCCTGACGGGCAACCCTCGC	0.557																																					p.G171D		Atlas-SNP	.											.	SERPINF1	31	.	0			c.G512A						PASS	.						70.0	66.0	67.0					17																	1675238		2203	4300	6503	SO:0001583	missense	5176	exon5			TGACGGGCAACCC	M76979	CCDS11012.1	17p13.3	2014-02-18	2005-08-18		ENSG00000132386	ENSG00000132386		"""Serine (or cysteine) peptidase inhibitors"""	8824	protein-coding gene	gene with protein product	"""pigment epithelium-derived factor"", ""proliferation-inducing protein 35"""	172860	"""serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1"""	PEDF		8434014, 24172014	Standard	NM_002615		Approved	EPC-1, PIG35	uc002ftl.3	P36955	OTTHUMG00000090571	ENST00000254722.4:c.512G>A	chr17.hg19:g.1675238G>A	ENSP00000254722:p.Gly171Asp	77.0	0.0	.		114.0	53.0	.	NM_002615	F1T092|Q13236|Q2TU83|Q96CT1|Q96R01|Q9BWA4	Missense_Mutation	SNP	ENST00000254722.4	hg19	CCDS11012.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.236450	0.79800	.	.	ENSG00000132386	ENST00000254722	T	0.35605	1.3	5.79	5.79	0.91817	Serpin domain (3);	0.000000	0.85682	D	0.000000	T	0.62109	0.2401	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.55134	-0.8188	10	0.27785	T	0.31	.	20.0212	0.97504	0.0:0.0:1.0:0.0	.	171	P36955	PEDF_HUMAN	D	171	ENSP00000254722:G171D	ENSP00000254722:G171D	G	+	2	0	SERPINF1	1621988	1.000000	0.71417	0.999000	0.59377	0.277000	0.26821	7.935000	0.87658	2.735000	0.93741	0.561000	0.74099	GGC	.	.	.	none		0.557	SERPINF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207109.4	NM_002615	
OR1A1	8383	hgsc.bcm.edu	37	17	3119721	3119721	+	Silent	SNP	C	C	T			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr17:3119721C>T	ENST00000304094.1	+	1	807	c.807C>T	c.(805-807)gaC>gaT	p.D269D		NM_014565.2	NP_055380.2	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A, member 1	269						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	23						GCCTAAAAGACGCAGTGATCA	0.478																																					p.D269D		Atlas-SNP	.											OR1A1,NS,carcinoma,0,1	OR1A1	54	.	0			c.C807T						PASS	.						153.0	135.0	141.0					17																	3119721		2203	4300	6503	SO:0001819	synonymous_variant	8383	exon1			AAAAGACGCAGTG	AF087918	CCDS11022.1	17p13.3	2012-08-09			ENSG00000172146	ENSG00000172146		"""GPCR / Class A : Olfactory receptors"""	8179	protein-coding gene	gene with protein product						10673334	Standard	NM_014565		Approved	OR17-7	uc010vrc.2	Q9P1Q5	OTTHUMG00000090637	ENST00000304094.1:c.807C>T	chr17.hg19:g.3119721C>T		123.0	0.0	.		164.0	7.0	.	NM_014565	A5D914|Q6IFM1|Q6NTA9|Q96R87	Silent	SNP	ENST00000304094.1	hg19	CCDS11022.1																																																																																			.	.	.	none		0.478	OR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207292.1	NM_014565	
PER1	5187	hgsc.bcm.edu	37	17	8045218	8045218	+	Nonsense_Mutation	SNP	G	G	A			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr17:8045218G>A	ENST00000317276.4	-	22	3742	c.3505C>T	c.(3505-3507)Cag>Tag	p.Q1169*	PER1_ENST00000578089.1_5'Flank|PER1_ENST00000581082.1_Nonsense_Mutation_p.Q1146*	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	1169	CRY binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CGAGGCTGCTGCTTCTGCATG	0.627			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																													p.Q1169X		Atlas-SNP	.		Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	.	PER1	104	.	0			c.C3505T						PASS	.						53.0	61.0	58.0					17																	8045218		2203	4300	6503	SO:0001587	stop_gained	5187	exon22			GCTGCTGCTTCTG	AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.3505C>T	chr17.hg19:g.8045218G>A	ENSP00000314420:p.Gln1169*	63.0	0.0	.		87.0	38.0	.	NM_002616	B2RPA8|B4DI49|D3DTR3	Nonsense_Mutation	SNP	ENST00000317276.4	hg19	CCDS11131.1	.	.	.	.	.	.	.	.	.	.	G	44	10.821248	0.99473	.	.	ENSG00000179094	ENST00000317276	.	.	.	5.67	5.67	0.87782	.	0.058964	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-16.6624	12.2416	0.54546	0.0:0.0:0.8302:0.1698	.	.	.	.	X	1169	.	ENSP00000314420:Q1169X	Q	-	1	0	PER1	7985943	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	5.071000	0.64382	2.697000	0.92050	0.655000	0.94253	CAG	.	.	.	none		0.627	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2		
MYO18A	399687	hgsc.bcm.edu	37	17	27447674	27447674	+	Missense_Mutation	SNP	T	T	A			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr17:27447674T>A	ENST00000527372.1	-	7	1868	c.1688A>T	c.(1687-1689)gAc>gTc	p.D563V	MYO18A_ENST00000533112.1_Missense_Mutation_p.D563V|MYO18A_ENST00000531253.1_Missense_Mutation_p.D563V|MYO18A_ENST00000354329.4_Missense_Mutation_p.D563V	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	563	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			TTGGTCAAAGTCCAGGGAGAG	0.572																																					p.D563V	Esophageal Squamous(182;472 2015 7001 15270 22562)	Atlas-SNP	.											.	MYO18A	217	.	0			c.A1688T						PASS	.						48.0	56.0	53.0					17																	27447674		2014	4174	6188	SO:0001583	missense	399687	exon7			TCAAAGTCCAGGG	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.1688A>T	chr17.hg19:g.27447674T>A	ENSP00000437073:p.Asp563Val	140.0	0.0	.		226.0	88.0	.	NM_078471	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	hg19	CCDS45642.1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.877086	0.91664	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000458428	D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24	5.73	5.73	0.89815	Myosin head, motor domain (3);DNA recombination/repair protein RecA, monomer-monomer interface (1);	0.042693	0.85682	D	0.000000	D	0.93025	0.7780	M	0.76574	2.34	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.996;0.977;0.977;0.995	D;P;P;P;D	0.76575	0.988;0.9;0.847;0.847;0.959	D	0.93772	0.7076	10	0.87932	D	0	.	15.7063	0.77583	0.0:0.0:0.0:1.0	.	232;175;563;563;563	Q92614-2;F8W6Y3;Q92614-3;Q92614-4;Q92614	.;.;.;.;MY18A_HUMAN	V	563;563;563;563;563;175	ENSP00000346291:D563V;ENSP00000435932:D563V;ENSP00000434228:D563V;ENSP00000437073:D563V	ENSP00000346291:D563V	D	-	2	0	MYO18A	24471800	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.662000	0.83803	2.197000	0.70478	0.533000	0.62120	GAC	.	.	.	none		0.572	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
FTCD	10841	hgsc.bcm.edu	37	21	47565766	47565766	+	Missense_Mutation	SNP	C	C	G			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr21:47565766C>G	ENST00000291670.5	-	9	1107	c.1064G>C	c.(1063-1065)gGg>gCg	p.G355A	FTCD_ENST00000355384.2_Missense_Mutation_p.G355A|FTCD_ENST00000397743.1_Missense_Mutation_p.G355A|FTCD_ENST00000359679.2_Missense_Mutation_p.G355A|FTCD_ENST00000397746.3_Missense_Mutation_p.G355A|FTCD_ENST00000498355.2_5'UTR|FTCD_ENST00000397748.1_Missense_Mutation_p.G355A	NM_006657.2	NP_006648.1	O95954	FTCD_HUMAN	formimidoyltransferase cyclodeaminase	355	Cyclodeaminase/cyclohydrolase. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|cytoskeleton organization (GO:0007010)|folic acid-containing compound metabolic process (GO:0006760)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	folic acid binding (GO:0005542)|formimidoyltetrahydrofolate cyclodeaminase activity (GO:0030412)|glutamate formimidoyltransferase activity (GO:0030409)			endometrium(1)|large_intestine(2)|lung(9)|pancreas(1)|prostate(3)|skin(3)	19	Breast(49;0.214)			Colorectal(79;0.235)	Tetrahydrofolic acid(DB00116)	cgagccgcccccgGGGGCCGC	0.781																																					p.G355A		Atlas-SNP	.											.	FTCD	59	.	0			c.G1064C						PASS	.						1.0	2.0	2.0					21																	47565766		825	1870	2695	SO:0001583	missense	10841	exon9			CCGCCCCCGGGGG	U91541	CCDS13731.1	21q22.3	2013-06-10	2013-06-10		ENSG00000160282	ENSG00000160282	2.1.2.5, 4.3.1.4		3974	protein-coding gene	gene with protein product		606806	"""formiminotransferase cyclodeaminase"""			10029623, 10773664	Standard	NM_006657		Approved		uc002zif.3	O95954	OTTHUMG00000090488	ENST00000291670.5:c.1064G>C	chr21.hg19:g.47565766C>G	ENSP00000291670:p.Gly355Ala	261.0	0.0	.		563.0	256.0	.	NM_206965	B9EGD0|Q86V03|Q9HCT4|Q9HCT5|Q9HCT6|Q9UHJ2	Missense_Mutation	SNP	ENST00000291670.5	hg19	CCDS13731.1	.	.	.	.	.	.	.	.	.	.	C	16.37	3.104888	0.56291	.	.	ENSG00000160282	ENST00000291670;ENST00000397748;ENST00000359679;ENST00000355384;ENST00000397746;ENST00000397743	T;T;T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05;-1.05;-1.05	4.91	4.91	0.64330	Cyclodeaminase/cyclohydrolase (2);	0.000000	0.85682	D	0.000000	D	0.90621	0.7059	H	0.95151	3.63	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.92495	0.6003	10	0.87932	D	0	.	11.2899	0.49244	0.0:0.91:0.0:0.09	.	355;355;355	B7WPK3;O95954-2;O95954	.;.;FTCD_HUMAN	A	355	ENSP00000291670:G355A;ENSP00000380856:G355A;ENSP00000352707:G355A;ENSP00000347545:G355A;ENSP00000380854:G355A;ENSP00000380851:G355A	ENSP00000291670:G355A	G	-	2	0	FTCD	46390194	0.968000	0.33430	0.963000	0.40424	0.157000	0.22087	3.958000	0.56737	2.279000	0.76181	0.453000	0.30009	GGG	.	.	.	none		0.781	FTCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206962.1	NM_006657	
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24382384	24382384	+	IGR	SNP	G	G	A			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chrX:24382384G>A								AC004552.1 (15361 upstream) : PDK3 (100953 downstream)																							tgctgctgctgctgctgctgc	0.582																																					p.A503T		Atlas-SNP	.											.	.	.	.	0			c.G1507A						PASS	.						4.0	4.0	4.0					X																	24382384		1400	3165	4565	SO:0001628	intergenic_variant	100130302	exon1			GCTGCTGCTGCTG																													chrX.hg19:g.24382384G>A		218.0	0.0	.		216.0	22.0	.	NM_001136234		Missense_Mutation	SNP		hg19																																																																																				.	.	.	none	0	0.582								
DOCK11	139818	hgsc.bcm.edu	37	X	117817167	117817167	+	Missense_Mutation	SNP	T	T	G			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chrX:117817167T>G	ENST00000276202.7	+	52	6152	c.6089T>G	c.(6088-6090)aTt>aGt	p.I2030S	DOCK11_ENST00000276204.6_Missense_Mutation_p.I2030S	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	2030	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TTATCTGACATTATCCATGAG	0.368																																					p.I2030S		Atlas-SNP	.											.	DOCK11	185	.	0			c.T6089G						PASS	.						90.0	84.0	86.0					X																	117817167		2203	4300	6503	SO:0001583	missense	139818	exon52			CTGACATTATCCA	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.6089T>G	chrX.hg19:g.117817167T>G	ENSP00000276202:p.Ile2030Ser	466.0	0.0	.		450.0	345.0	.	NM_144658	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	ENST00000276202.7	hg19	CCDS35373.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.412721	0.83340	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.19105	2.17;2.18	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.45696	0.1355	M	0.66939	2.045	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.44019	-0.9355	10	0.87932	D	0	-14.345	14.4074	0.67090	0.0:0.0:0.0:1.0	.	2030;2030	A6NIW2;Q5JSL3	.;DOC11_HUMAN	S	2030	ENSP00000276204:I2030S;ENSP00000276202:I2030S	ENSP00000276202:I2030S	I	+	2	0	DOCK11	117701195	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.621000	0.83083	2.001000	0.58596	0.486000	0.48141	ATT	.	.	.	none		0.368	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1	NM_144658	
TTN	7273	hgsc.bcm.edu	37	2	179505994	179505999	+	In_Frame_Del	DEL	TTTTTA	TTTTTA	-			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	TTTTTA	TTTTTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr2:179505994_179505999delTTTTTA	ENST00000591111.1	-	170	35903_35908	c.35679_35684delTAAAAA	c.(35677-35685)cctaaaaaa>cca	p.KK11894del	TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342992.6_In_Frame_Del_p.KK10967del|TTN-AS1_ENST00000418062.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342175.6_In_Frame_Del_p.KK4662del|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_In_Frame_Del_p.KK13535del|TTN_ENST00000359218.5_In_Frame_Del_p.KK4595del|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_In_Frame_Del_p.KK4470del|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin	11894	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTTTCTAGTTTTTTAGGTTCTACTT	0.282																																					p.13535_13536del		Atlas-Indel,Pindel	.											.	TTN	18412	.	0			c.40603_40608del						PASS	.																																			SO:0001651	inframe_deletion	7273	exon220			.	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.35679_35684delTAAAAA	chr2.hg19:g.179505994_179505999delTTTTTA	ENSP00000465570:p.Lys11894_Lys11895del	125.0	0.0	0		128.0	48.0	0.375	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	In_Frame_Del	DEL	ENST00000591111.1	hg19																																																																																				.	.	.	none		0.282	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FOXC1	2296	hgsc.bcm.edu	37	6	1611915	1611916	+	Frame_Shift_Ins	INS	-	-	G			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr6:1611915_1611916insG	ENST00000380874.2	+	1	1235_1236	c.1235_1236insG	c.(1234-1239)ttgcagfs	p.Q413fs		NM_001453.2	NP_001444.2	Q12948	FOXC1_HUMAN	forkhead box C1	413					artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|eye development (GO:0001654)|germ cell migration (GO:0008354)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lacrimal gland development (GO:0032808)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of mitotic cell cycle (GO:0045930)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|paraxial mesoderm formation (GO:0048341)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		GGGGGCCACTTGCAgggcgcgc	0.782																																					p.L412fs	Pancreas(133;719 1821 3197 26645 35015)	Atlas-Indel,Pindel	.											.	FOXC1	19	.	0			c.1235_1236insG						PASS	.																																			SO:0001589	frameshift_variant	2296	exon1			.	AF048693	CCDS4473.1	6p25	2008-04-10			ENSG00000054598	ENSG00000054598		"""Forkhead boxes"""	3800	protein-coding gene	gene with protein product		601090		FKHL7, IRID1		7957066, 9620769	Standard	NM_001453		Approved	FREAC3, ARA, IGDA, IHG1	uc003mtp.3	Q12948	OTTHUMG00000016182	ENST00000380874.2:c.1236dupG	chr6.hg19:g.1611916_1611916dupG	ENSP00000370256:p.Gln413fs	43.0	0.0	0		61.0	50.0	0.819672	NM_001453	Q86UP7|Q9BYM1|Q9NUE5|Q9UDD0|Q9UP06	Frame_Shift_Ins	INS	ENST00000380874.2	hg19	CCDS4473.1																																																																																			.	.	.	none		0.782	FOXC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043450.1		
CENPF	1063	hgsc.bcm.edu	37	1	214819565	214819565	+	Frame_Shift_Del	DEL	C	C	-			TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr1:214819565delC	ENST00000366955.3	+	13	6820	c.6652delC	c.(6652-6654)caafs	p.Q2218fs		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	2314	2 X 177 AA tandem repeats.|Interaction with NDE1 and NDEL1.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TCTGACAAAACAAATACAAGA	0.348																																					p.K2217fs	Colon(80;575 1284 11000 14801 43496)	Atlas-Indel,Pindel	.											.	CENPF	321	.	0			c.6651delA						PASS	.						45.0	51.0	49.0					1																	214819565		2198	4300	6498	SO:0001589	frameshift_variant	1063	exon13			.	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.6652delC	chr1.hg19:g.214819565delC	ENSP00000355922:p.Gln2218fs	299.0	0.0	0		286.0	240.0	0.839161	NM_016343	Q13171|Q13246|Q5VVM7	Frame_Shift_Del	DEL	ENST00000366955.3	hg19	CCDS31023.1																																																																																			.	.	.	none		0.348	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
HRASLS5	117245	hgsc.bcm.edu	37	11	63258431	63258432	+	Frame_Shift_Ins	INS	-	-	G	rs148328959		TCGA-UN-AAZ9-01A-11D-A382-10	TCGA-UN-AAZ9-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c956b4f3-cd21-4ff0-8b37-32cd8da4ea6a	5295faa5-5eb5-4e32-abfe-7c9e1d725be6	g.chr11:63258431_63258432insG	ENST00000301790.4	-	1	234_235	c.75_76insC	c.(73-78)cccgccfs	p.A26fs	HRASLS5_ENST00000539221.1_Frame_Shift_Ins_p.A26fs|HRASLS5_ENST00000540857.1_Frame_Shift_Ins_p.A26fs			Q96KN8	HRSL5_HUMAN	HRAS-like suppressor family, member 5	26							transferase activity, transferring acyl groups (GO:0016746)			endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	14						GTTCGCGAGGCGGGTTTGGGGA	0.723																																					p.A26fs		Atlas-INDEL	.											.	HRASLS5	28	.	0			c.76_77insC						PASS	.																																			SO:0001589	frameshift_variant	117245	exon1			.	AJ416558	CCDS8044.1, CCDS53646.1, CCDS53647.1	11q13.2	2006-08-16			ENSG00000168004	ENSG00000168004			24978	protein-coding gene	gene with protein product		611474					Standard	NM_001146729		Approved	HRLP5	uc001nwy.2	Q96KN8	OTTHUMG00000167806	ENST00000301790.4:c.76dupC	chr11.hg19:g.63258434_63258434dupG	ENSP00000301790:p.Ala26fs	109.0	0.0	0		189.0	13.0	0.0687831	NM_001146728	B7X6T1|F5GZ87|F5H4Y9	Frame_Shift_Ins	INS	ENST00000301790.4	hg19	CCDS8044.1																																																																																			.	.	.	none		0.723	HRASLS5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396375.1	NM_054108	
