#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CLIC4	25932	hgsc.bcm.edu	37	1	25140695	25140695	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr1:25140695T>C	ENST00000374379.4	+	3	490	c.293T>C	c.(292-294)gTc>gCc	p.V98A	CLIC4_ENST00000497755.1_3'UTR	NM_013943.2	NP_039234.1	Q9Y696	CLIC4_HUMAN	chloride intracellular channel 4	98	Required for insertion into the membrane. {ECO:0000305}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cell differentiation (GO:0030154)|cellular response to calcium ion (GO:0071277)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|endothelial cell morphogenesis (GO:0001886)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|fertilization (GO:0009566)|keratinocyte differentiation (GO:0030216)|multicellular organism growth (GO:0035264)|negative regulation of cell migration (GO:0030336)|regulation of cytoskeleton organization (GO:0051493)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|vacuolar acidification (GO:0007035)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|microvillus (GO:0005902)|midbody (GO:0030496)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			large_intestine(3)|lung(2)|skin(1)	6		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000778)|all_lung(284;0.00106)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0479)|OV - Ovarian serous cystadenocarcinoma(117;1.06e-24)|Colorectal(126;1.03e-07)|COAD - Colon adenocarcinoma(152;4.93e-06)|STAD - Stomach adenocarcinoma(196;0.000418)|GBM - Glioblastoma multiforme(114;0.000451)|BRCA - Breast invasive adenocarcinoma(304;0.00215)|KIRC - Kidney renal clear cell carcinoma(1967;0.00216)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.18)		CTTGAAGAAGTCTTATGCCCT	0.403																																					p.V98A		Atlas-SNP	.											.	CLIC4	20	.	0			c.T293C						PASS	.						81.0	86.0	84.0					1																	25140695		2203	4300	6503	SO:0001583	missense	25932	exon3			AAGAAGTCTTATG	AF097330	CCDS256.1	1p	2012-09-26			ENSG00000169504	ENSG00000169504		"""Ion channels / Chloride channels : Intracellular"""	13518	protein-coding gene	gene with protein product		606536				9139710, 10070163	Standard	NM_013943		Approved	DKFZP566G223, CLIC4L, P64H1, H1, huH1, p64H1	uc001bjo.2	Q9Y696	OTTHUMG00000003327	ENST00000374379.4:c.293T>C	chr1.hg19:g.25140695T>C	ENSP00000363500:p.Val98Ala	180.0	0.0	.		163.0	75.0	.	NM_013943	Q9UFW9|Q9UQJ6	Missense_Mutation	SNP	ENST00000374379.4	hg19	CCDS256.1	.	.	.	.	.	.	.	.	.	.	T	16.56	3.156029	0.57259	.	.	ENSG00000169504	ENST00000374379;ENST00000444041	T	0.41065	1.01	5.85	5.85	0.93711	Glutathione S-transferase/chloride channel, C-terminal (1);Thioredoxin-like fold (2);	0.054502	0.64402	D	0.000001	T	0.34542	0.0901	N	0.25992	0.78	0.29632	N	0.845361	B;B	0.31459	0.092;0.324	B;B	0.38921	0.138;0.285	T	0.24764	-1.0151	10	0.10902	T	0.67	-14.6151	15.2247	0.73342	0.0:0.0:0.0:1.0	.	78;98	B3KTR3;Q9Y696	.;CLIC4_HUMAN	A	98	ENSP00000363500:V98A	ENSP00000363500:V98A	V	+	2	0	CLIC4	25013282	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.902000	0.69869	2.234000	0.73211	0.533000	0.62120	GTC	.	.	.	none		0.403	CLIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009332.1	NM_013943	
ACADM	34	hgsc.bcm.edu	37	1	76211529	76211529	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr1:76211529C>T	ENST00000370841.4	+	8	1075	c.638C>T	c.(637-639)gCt>gTt	p.A213V	ACADM_ENST00000541113.1_Missense_Mutation_p.A177V|ACADM_ENST00000420607.2_Missense_Mutation_p.A217V|ACADM_ENST00000370834.5_Missense_Mutation_p.A246V|ACADM_ENST00000543667.1_Missense_Mutation_p.A24V	NM_000016.4|NM_001127328.1	NP_000007.1|NP_001120800.1	P11310	ACADM_HUMAN	acyl-CoA dehydrogenase, C-4 to C-12 straight chain	213					cardiac muscle cell differentiation (GO:0055007)|carnitine biosynthetic process (GO:0045329)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|glycogen biosynthetic process (GO:0005978)|liver development (GO:0001889)|medium-chain fatty acid catabolic process (GO:0051793)|medium-chain fatty acid metabolic process (GO:0051791)|oxidation-reduction process (GO:0055114)|post-embryonic development (GO:0009791)|regulation of gluconeogenesis (GO:0006111)|response to cold (GO:0009409)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|identical protein binding (GO:0042802)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)			breast(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	18					Flavin adenine dinucleotide(DB03147)	GATCCTAAAGCTCCTGCTAAT	0.393																																					p.A217V		Atlas-SNP	.											ACADM,NS,carcinoma,0,1	ACADM	50	.	0			c.C650T						PASS	.						100.0	99.0	100.0					1																	76211529		2203	4300	6503	SO:0001583	missense	34	exon8			CTAAAGCTCCTGC	M16827	CCDS668.1, CCDS44165.1, CCDS65562.1, CCDS72807.1	1p31	2014-09-17	2010-04-30		ENSG00000117054	ENSG00000117054	1.3.99.3		89	protein-coding gene	gene with protein product		607008	"""acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain"""			3035565	Standard	NM_000016		Approved	MCAD, MCADH, ACAD1	uc009wbp.3	P11310	OTTHUMG00000009784	ENST00000370841.4:c.638C>T	chr1.hg19:g.76211529C>T	ENSP00000359878:p.Ala213Val	49.0	0.0	.		65.0	30.0	.	NM_001127328	Q5T4U4|Q9NYF1	Missense_Mutation	SNP	ENST00000370841.4	hg19	CCDS668.1	.	.	.	.	.	.	.	.	.	.	C	11.95	1.792473	0.31685	.	.	ENSG00000117054	ENST00000370841;ENST00000370834;ENST00000541113;ENST00000543667;ENST00000420607	D;D;D;D;D	0.97924	-4.61;-4.54;-4.58;-4.15;-4.61	5.83	3.94	0.45596	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (1);	0.516485	0.23727	N	0.045173	D	0.93080	0.7797	M	0.67397	2.05	0.22684	N	0.99886	B;B;B;B;B	0.14012	0.009;0.002;0.003;0.008;0.002	B;B;B;B;B	0.11329	0.005;0.001;0.005;0.006;0.002	D	0.89120	0.3502	10	0.49607	T	0.09	.	8.7825	0.34800	0.0:0.7664:0.0:0.2336	.	177;127;246;217;213	B7Z9I1;B4DVE0;Q5T4U5;P11310-2;P11310	.;.;.;.;ACADM_HUMAN	V	213;246;177;24;217	ENSP00000359878:A213V;ENSP00000359871:A246V;ENSP00000442324:A177V;ENSP00000446176:A24V;ENSP00000409612:A217V	ENSP00000359871:A246V	A	+	2	0	ACADM	75984117	0.584000	0.26766	0.857000	0.33713	0.361000	0.29550	0.724000	0.25954	0.780000	0.33566	0.585000	0.79938	GCT	.	.	.	none		0.393	ACADM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026967.1		
BCAR3	8412	hgsc.bcm.edu	37	1	94054942	94054942	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr1:94054942A>G	ENST00000370244.1	-	7	809	c.521T>C	c.(520-522)tTc>tCc	p.F174S	BCAR3_ENST00000260502.6_Missense_Mutation_p.F174S|RP5-1033H22.2_ENST00000431770.1_RNA|BCAR3_ENST00000370247.3_Missense_Mutation_p.F83S|BCAR3_ENST00000370243.1_Missense_Mutation_p.F174S|RP5-1033H22.2_ENST00000417401.1_RNA|RP5-1033H22.2_ENST00000427243.1_RNA	NM_001261408.1	NP_001248337.1	O75815	BCAR3_HUMAN	breast cancer anti-estrogen resistance 3	174	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				lens morphogenesis in camera-type eye (GO:0002089)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)	25		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		ACGAACTAGGAAGTCACCATC	0.483																																					p.F174S		Atlas-SNP	.											.	BCAR3	62	.	0			c.T521C						PASS	.						53.0	53.0	53.0					1																	94054942		2203	4300	6503	SO:0001583	missense	8412	exon5			ACTAGGAAGTCAC	U92715	CCDS745.1, CCDS58010.1	1p22.1	2013-02-14			ENSG00000137936	ENSG00000137936		"""SH2 domain containing"""	973	protein-coding gene	gene with protein product		604704				9582273	Standard	NM_001261408		Approved	NSP2, SH2D3B	uc001dpz.4	O75815	OTTHUMG00000010301	ENST00000370244.1:c.521T>C	chr1.hg19:g.94054942A>G	ENSP00000359264:p.Phe174Ser	31.0	0.0	.		36.0	14.0	.	NM_001261409	D3DT43|Q5TEW3|Q6UW40|Q9BR50	Missense_Mutation	SNP	ENST00000370244.1	hg19	CCDS745.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.632314	0.87660	.	.	ENSG00000137936	ENST00000370247;ENST00000260502;ENST00000370244;ENST00000370243	D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73	5.1	5.1	0.69264	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.94568	0.8250	H	0.99090	4.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96857	0.9629	10	0.87932	D	0	-3.8704	15.167	0.72837	1.0:0.0:0.0:0.0	.	174;83	O75815;Q5TEW3	BCAR3_HUMAN;.	S	83;174;174;174	ENSP00000359267:F83S;ENSP00000260502:F174S;ENSP00000359264:F174S;ENSP00000359263:F174S	ENSP00000260502:F174S	F	-	2	0	BCAR3	93827530	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	8.848000	0.92172	2.052000	0.61016	0.533000	0.62120	TTC	.	.	.	none		0.483	BCAR3-003	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028420.1		
CELSR2	1952	hgsc.bcm.edu	37	1	109794683	109794683	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr1:109794683A>G	ENST00000271332.3	+	1	2043	c.1982A>G	c.(1981-1983)cAa>cGa	p.Q661R		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	661	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		ATCACCAGCCAAAGTGGTGGT	0.567																																					p.Q661R	NSCLC(158;1285 2011 34800 34852 42084)	Atlas-SNP	.											.	CELSR2	228	.	0			c.A1982G						PASS	.						138.0	130.0	133.0					1																	109794683		2203	4300	6503	SO:0001583	missense	1952	exon1			CCAGCCAAAGTGG	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.1982A>G	chr1.hg19:g.109794683A>G	ENSP00000271332:p.Gln661Arg	72.0	0.0	.		70.0	32.0	.	NM_001408	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	hg19	CCDS796.1	.	.	.	.	.	.	.	.	.	.	N	16.85	3.236767	0.58886	.	.	ENSG00000143126	ENST00000271332	T	0.51071	0.72	4.95	4.95	0.65309	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.43919	0.1269	N	0.24115	0.695	0.54753	D	0.999985	D	0.76494	0.999	D	0.79108	0.992	T	0.43343	-0.9397	9	0.37606	T	0.19	.	14.8253	0.70107	1.0:0.0:0.0:0.0	.	661	Q9HCU4	CELR2_HUMAN	R	661	ENSP00000271332:Q661R	ENSP00000271332:Q661R	Q	+	2	0	CELSR2	109596206	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.709000	0.91379	2.102000	0.63906	0.529000	0.55759	CAA	.	.	.	none		0.567	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
CTTNBP2NL	55917	hgsc.bcm.edu	37	1	112999757	112999757	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr1:112999757A>G	ENST00000271277.6	+	6	1868	c.1643A>G	c.(1642-1644)cAt>cGt	p.H548R	CTTNBP2NL_ENST00000607039.1_3'UTR	NM_018704.2	NP_061174.1	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like	548					negative regulation of transmembrane transport (GO:0034763)|negative regulation of transporter activity (GO:0032410)|protein dephosphorylation (GO:0006470)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	29		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GACACAAGCCATTCACCTACT	0.552																																					p.H548R		Atlas-SNP	.											.	CTTNBP2NL	65	.	0			c.A1643G						PASS	.						158.0	146.0	150.0					1																	112999757		2203	4300	6503	SO:0001583	missense	55917	exon6			CAAGCCATTCACC	AB037854	CCDS845.1	1p13.2	2008-02-05			ENSG00000143079	ENSG00000143079			25330	protein-coding gene	gene with protein product		615100				10718198	Standard	NM_018704		Approved	DKFZp547A023	uc001ebx.3	Q9P2B4	OTTHUMG00000011154	ENST00000271277.6:c.1643A>G	chr1.hg19:g.112999757A>G	ENSP00000271277:p.His548Arg	135.0	0.0	.		119.0	57.0	.	NM_018704	B3KMS5|Q96B40	Missense_Mutation	SNP	ENST00000271277.6	hg19	CCDS845.1	.	.	.	.	.	.	.	.	.	.	A	13.00	2.105932	0.37145	.	.	ENSG00000143079	ENST00000271277	T	0.21543	2.0	5.55	5.55	0.83447	.	0.118926	0.56097	D	0.000024	T	0.27278	0.0669	L	0.51422	1.61	0.53688	D	0.999971	D	0.57899	0.981	D	0.69824	0.966	T	0.02093	-1.1215	10	0.25106	T	0.35	-15.3785	14.5055	0.67750	1.0:0.0:0.0:0.0	.	548	Q9P2B4	CT2NL_HUMAN	R	548	ENSP00000271277:H548R	ENSP00000271277:H548R	H	+	2	0	CTTNBP2NL	112801280	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.619000	0.61218	2.108000	0.64289	0.379000	0.24179	CAT	.	.	.	none		0.552	CTTNBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030686.1	NM_018704	
DHX9	1660	hgsc.bcm.edu	37	1	182822459	182822459	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr1:182822459G>A	ENST00000367549.3	+	5	493	c.383G>A	c.(382-384)gGg>gAg	p.G128E		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	128	Interaction with CREBBP.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						TCTGAGGTAGGGGCCTCTGGC	0.388																																					p.G128E	Colon(69;210 1162 3697 13559 39565)	Atlas-SNP	.											.	DHX9	114	.	0			c.G383A						PASS	.						57.0	59.0	58.0					1																	182822459		1820	4076	5896	SO:0001583	missense	1660	exon5			AGGTAGGGGCCTC	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.383G>A	chr1.hg19:g.182822459G>A	ENSP00000356520:p.Gly128Glu	224.0	0.0	.		223.0	121.0	.	NM_001357	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	hg19	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	G	0.033	-1.321463	0.01320	.	.	ENSG00000135829	ENST00000399175;ENST00000367549	T	0.03580	3.88	5.85	3.59	0.41128	.	0.192677	0.43919	N	0.000511	T	0.02571	0.0078	L	0.31065	0.9	0.28768	N	0.90053	B	0.02656	0.0	B	0.04013	0.001	T	0.45205	-0.9277	10	0.02654	T	1	.	8.8523	0.35208	0.2076:0.0:0.7924:0.0	.	128	Q08211	DHX9_HUMAN	E	128	ENSP00000356520:G128E	ENSP00000356520:G128E	G	+	2	0	DHX9	181089082	0.998000	0.40836	0.324000	0.25361	0.236000	0.25371	2.876000	0.48498	0.558000	0.29135	0.650000	0.86243	GGG	.	.	.	none		0.388	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
DNMT3A	1788	hgsc.bcm.edu	37	2	25461998	25461998	+	Splice_Site	SNP	C	C	A			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr2:25461998C>A	ENST00000264709.3	-	20	2746		c.e20+1		DNMT3A_ENST00000321117.5_Splice_Site|DNMT3A_ENST00000402667.1_Splice_Site|DNMT3A_ENST00000380746.4_Splice_Site|DNMT3A_ENST00000474887.1_Splice_Site	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha						C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTTCACCAACCTGTTCATAC	0.607			"""Mis, F, N, S"""		AML																																.		Atlas-SNP	.		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	.	DNMT3A	1807	.	0			c.1841+1G>T						PASS	.						52.0	48.0	49.0					2																	25461998		2203	4300	6503	SO:0001630	splice_region_variant	1788	exon17			CACCAACCTGTTC		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.2408+1G>T	chr2.hg19:g.25461998C>A		75.0	0.0	.		73.0	36.0	.	NM_153759	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Splice_Site	SNP	ENST00000264709.3	hg19	CCDS33157.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.205133	0.79127	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	.	.	.	5.64	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5916	0.61964	0.1566:0.8434:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DNMT3A	25315502	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.783000	0.85696	1.367000	0.46095	0.561000	0.74099	.	.	.	.	none		0.607	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	NM_022552	Intron
TANK	10010	hgsc.bcm.edu	37	2	162087645	162087645	+	Silent	SNP	A	A	G			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr2:162087645A>G	ENST00000392749.2	+	7	923	c.684A>G	c.(682-684)tcA>tcG	p.S228S	TANK_ENST00000402568.1_Intron|TANK_ENST00000405852.1_Silent_p.S228S|TANK_ENST00000406287.1_Intron|AC009299.2_ENST00000445372.1_RNA|TANK_ENST00000259075.2_Silent_p.S228S|AC009299.2_ENST00000421122.2_RNA	NM_001199135.1	NP_001186064.1	Q92844	TANK_HUMAN	TRAF family member-associated NFKB activator	228					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)	21						CTTTTGAATCACTTTCTAAAT	0.448																																					p.S228S		Atlas-SNP	.											.	TANK	35	.	0			c.A684G						PASS	.						126.0	122.0	123.0					2																	162087645		2203	4300	6503	SO:0001819	synonymous_variant	10010	exon7			TGAATCACTTTCT	U59863	CCDS2215.1, CCDS46436.1	2q24-q31	2008-02-05			ENSG00000136560	ENSG00000136560			11562	protein-coding gene	gene with protein product		603893		TRAF2		8710854, 8855313	Standard	NM_004180		Approved	I-TRAF	uc002ubr.2	Q92844	OTTHUMG00000132037	ENST00000392749.2:c.684A>G	chr2.hg19:g.162087645A>G		185.0	0.0	.		194.0	99.0	.	NM_004180	D3DPB5|Q7Z4J6|Q92885	Silent	SNP	ENST00000392749.2	hg19	CCDS2215.1																																																																																			.	.	.	none		0.448	TANK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324232.1	NM_133484	
CDCA7	83879	hgsc.bcm.edu	37	2	174230206	174230206	+	Silent	SNP	C	C	G			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr2:174230206C>G	ENST00000347703.3	+	6	828	c.684C>G	c.(682-684)cgC>cgG	p.R228R	CDCA7_ENST00000306721.3_Silent_p.R307R|CDCA7_ENST00000392567.2_Silent_p.R228R|CDCA7_ENST00000410019.3_Silent_p.R186R|CDCA7_ENST00000410101.3_Silent_p.R263R	NM_145810.2	NP_665809.1	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7	228					apoptotic process (GO:0006915)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.116)			GAAGCCGTCGCTCCAGATCAT	0.433																																					p.R307R		Atlas-SNP	.											.	CDCA7	48	.	0			c.C921G						PASS	.						76.0	77.0	77.0					2																	174230206		2203	4300	6503	SO:0001819	synonymous_variant	83879	exon7			CCGTCGCTCCAGA	BG354580	CCDS2252.1, CCDS2253.1	2q31.1	2008-02-05			ENSG00000144354	ENSG00000144354			14628	protein-coding gene	gene with protein product		609937				11598121, 12188893	Standard	NM_145810		Approved	FLJ14736, JPO1	uc002uic.1	Q9BWT1	OTTHUMG00000132296	ENST00000347703.3:c.684C>G	chr2.hg19:g.174230206C>G		78.0	0.0	.		83.0	39.0	.	NM_031942	B4DLP8|B4DV66|Q53EW5|Q580W9|Q658K4|Q658N4|Q8NBY9|Q96BV8|Q96SP5	Silent	SNP	ENST00000347703.3	hg19	CCDS2253.1																																																																																			.	.	.	none		0.433	CDCA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255400.1	NM_031942	
TTN	7273	hgsc.bcm.edu	37	2	179469796	179469796	+	Silent	SNP	G	G	A			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr2:179469796G>A	ENST00000591111.1	-	230	49409	c.49185C>T	c.(49183-49185)gtC>gtT	p.V16395V	TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Silent_p.V9096V|TTN_ENST00000460472.2_Silent_p.V8971V|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Silent_p.V18036V|TTN_ENST00000342992.6_Silent_p.V15468V|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342175.6_Silent_p.V9163V|TTN-AS1_ENST00000589234.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16395	Ig-like 100.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTCCTCCCGGACCGCTTTGG	0.448																																					p.V18036V		Atlas-SNP	.											.	TTN	18412	.	0			c.C54108T						PASS	.						243.0	226.0	232.0					2																	179469796		1919	4124	6043	SO:0001819	synonymous_variant	7273	exon280			CTCCCGGACCGCT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.49185C>T	chr2.hg19:g.179469796G>A		72.0	0.0	.		57.0	27.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.	.	none		0.448	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
MARCH4	57574	hgsc.bcm.edu	37	2	217124358	217124358	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr2:217124358G>A	ENST00000273067.4	-	4	2676	c.910C>T	c.(910-912)Cgg>Tgg	p.R304W	AC012513.6_ENST00000417481.1_RNA	NM_020814.2	NP_065865.1	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase	304						Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(1)	20		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		GCCTGCCACCGTTTAAAGATG	0.552																																					p.R304W		Atlas-SNP	.											.	MARCH4	50	.	0			c.C910T						PASS	.						72.0	62.0	65.0					2																	217124358		2203	4300	6503	SO:0001583	missense	57574	exon4			GCCACCGTTTAAA	AB037820	CCDS33376.1	2q35	2013-01-09	2012-02-23		ENSG00000144583	ENSG00000144583		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	29269	protein-coding gene	gene with protein product		608208	"""membrane-associated ring finger (C3HC4) 4"""			10718198, 14722266	Standard	NM_020814		Approved	KIAA1399, MARCH-IV, RNF174	uc002vgb.3	Q9P2E8	OTTHUMG00000154824	ENST00000273067.4:c.910C>T	chr2.hg19:g.217124358G>A	ENSP00000273067:p.Arg304Trp	60.0	0.0	.		68.0	37.0	.	NM_020814	Q4KMN7|Q86WR8	Missense_Mutation	SNP	ENST00000273067.4	hg19	CCDS33376.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.630141	0.87660	.	.	ENSG00000144583	ENST00000273067	T	0.60797	0.16	5.51	3.62	0.41486	.	0.000000	0.85682	D	0.000000	T	0.74336	0.3703	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78486	-0.2185	10	0.87932	D	0	-3.9764	13.8298	0.63373	0.0:0.0:0.7219:0.2781	.	304	Q9P2E8	MARH4_HUMAN	W	304	ENSP00000273067:R304W	ENSP00000273067:R304W	R	-	1	2	MARCH4	216832603	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.743000	0.62110	1.302000	0.44855	0.561000	0.74099	CGG	.	.	.	none		0.552	MARCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337272.2	NM_020814	
RBM15B	29890	hgsc.bcm.edu	37	3	51431303	51431303	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr3:51431303G>T	ENST00000323686.4	+	1	2573	c.2473G>T	c.(2473-2475)Gtc>Ttc	p.V825F		NM_013286.4	NP_037418.3	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	825	Interaction with Epstein-Barr virus BMLF1.|SPOC. {ECO:0000255|PROSITE- ProRule:PRU00249}.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|large_intestine(5)|lung(3)	12				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CAGGAACCTGGTCTCCTACTT	0.637																																					p.V825F		Atlas-SNP	.											.	RBM15B	47	.	0			c.G2473T						PASS	.						27.0	31.0	30.0					3																	51431303		2203	4300	6503	SO:0001583	missense	29890	exon1			AACCTGGTCTCCT	AL831838	CCDS33764.1	3p21.1	2013-02-12			ENSG00000179837	ENSG00000259956		"""RNA binding motif (RRM) containing"""	24303	protein-coding gene	gene with protein product		612602				16129689	Standard	NM_013286		Approved	HUMAGCGB, OTT3	uc003dbd.3	Q8NDT2	OTTHUMG00000156896	ENST00000323686.4:c.2473G>T	chr3.hg19:g.51431303G>T	ENSP00000313890:p.Val825Phe	75.0	0.0	.		85.0	40.0	.	NM_013286	A4QPG7|Q6QE19|Q9BV96	Missense_Mutation	SNP	ENST00000323686.4	hg19	CCDS33764.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.484143	0.84854	.	.	ENSG00000179837	ENST00000323686;ENST00000540284;ENST00000541145;ENST00000536338	T	0.27890	1.64	5.95	5.95	0.96441	Spen Paralogue and Orthologue SPOC, C-terminal-like (2);Spen paralogue/orthologue C-terminal, metazoa (1);Spen paralogue and orthologue SPOC, C-terminal (1);	.	.	.	.	T	0.63721	0.2535	M	0.85542	2.76	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.66913	-0.5803	9	0.87932	D	0	-21.6876	20.3931	0.98965	0.0:0.0:1.0:0.0	.	825	Q8NDT2	RB15B_HUMAN	F	825;146;498;244	ENSP00000313890:V825F	ENSP00000313890:V825F	V	+	1	0	RBM15B	51406343	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.835000	0.99442	2.824000	0.97209	0.655000	0.94253	GTC	.	.	.	none		0.637	RBM15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346489.1	NM_013286	
ERC2	26059	hgsc.bcm.edu	37	3	55768837	55768837	+	Missense_Mutation	SNP	G	G	A	rs367719934		TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr3:55768837G>A	ENST00000288221.6	-	15	2929	c.2674C>T	c.(2674-2676)Cgg>Tgg	p.R892W		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	892						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		TCTTTTTCCCGCTTGAGGGCC	0.488																																					p.R890W		Atlas-SNP	.											.	ERC2	221	.	0			c.C2668T						PASS	.						105.0	99.0	101.0					3																	55768837		1867	4112	5979	SO:0001583	missense	26059	exon14			TTTCCCGCTTGAG	AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.2674C>T	chr3.hg19:g.55768837G>A	ENSP00000288221:p.Arg892Trp	95.0	0.0	.		98.0	39.0	.	NM_015576	Q2T9F6|Q86TK4	Missense_Mutation	SNP	ENST00000288221.6	hg19	CCDS46851.1	.	.	.	.	.	.	.	.	.	.	G	19.05	3.752617	0.69533	.	.	ENSG00000187672	ENST00000288221	T	0.52526	0.66	5.67	2.82	0.32997	.	0.000000	0.85682	D	0.000000	T	0.67126	0.2860	M	0.71581	2.175	0.47737	D	0.999501	D	0.89917	1.0	D	0.79784	0.993	T	0.70831	-0.4765	10	0.87932	D	0	-10.8864	15.9917	0.80211	0.0:0.0:0.4556:0.5444	.	892	O15083	ERC2_HUMAN	W	892	ENSP00000288221:R892W	ENSP00000288221:R892W	R	-	1	2	ERC2	55743877	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.909000	0.39917	0.286000	0.22352	0.655000	0.94253	CGG	.	.	.	alt		0.488	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350884.2	NM_015576	
POLN	353497	hgsc.bcm.edu	37	4	2087397	2087397	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr4:2087397T>G	ENST00000511885.2	-	21	2493	c.2140A>C	c.(2140-2142)Aag>Cag	p.K714Q	POLN_ENST00000382865.1_Missense_Mutation_p.K714Q			Q7Z5Q5	DPOLN_HUMAN	polymerase (DNA directed) nu	714					double-strand break repair via homologous recombination (GO:0000724)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	nucleus (GO:0005634)	cyclin binding (GO:0030332)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(2)|skin(4)|urinary_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			TTCTTGTACTTCTGCAAAAAA	0.537								DNA polymerases (catalytic subunits)																													p.K714Q		Atlas-SNP	.											.	POLN	82	.	0			c.A2140C						PASS	.						93.0	96.0	95.0					4																	2087397		2203	4300	6503	SO:0001583	missense	353497	exon19			TGTACTTCTGCAA	AF044578	CCDS3360.1	4p16.3	2012-05-18			ENSG00000130997	ENSG00000130997		"""DNA polymerases"""	18870	protein-coding gene	gene with protein product		610887				12794064	Standard	NM_181808		Approved		uc003ger.2	Q7Z5Q5	OTTHUMG00000090081	ENST00000511885.2:c.2140A>C	chr4.hg19:g.2087397T>G	ENSP00000435506:p.Lys714Gln	65.0	0.0	.		60.0	25.0	.	NM_181808	A2A336|B4E158|Q4TTW4|Q6ZNF4	Missense_Mutation	SNP	ENST00000511885.2	hg19	CCDS3360.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.75|15.75	2.925348|2.925348	0.52759|0.52759	.|.	.|.	ENSG00000130997|ENSG00000130997	ENST00000511885;ENST00000382865;ENST00000253313;ENST00000382857|ENST00000511098	D;D|.	0.96619|.	-4.07;-4.07|.	4.4|4.4	4.4|4.4	0.53042|0.53042	DNA-directed DNA polymerase, family A, palm domain (2);|.	0.135939|.	0.51477|.	D|.	0.000098|.	T|T	0.51176|0.51176	0.1659|0.1659	L|L	0.42487|0.42487	1.325|1.325	0.34686|0.34686	D|D	0.725274|0.725274	D;D;B|.	0.89917|.	1.0;0.998;0.382|.	D;D;B|.	0.77004|.	0.989;0.969;0.374|.	T|T	0.60767|0.60767	-0.7198|-0.7198	10|5	0.72032|.	D|.	0.01|.	-23.9851|-23.9851	10.2175|10.2175	0.43177|0.43177	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	245;405;714|.	C9JDP8;E9PE06;Q7Z5Q5|.	.;.;DPOLN_HUMAN|.	Q|S	714;714;405;245|346	ENSP00000435506:K714Q;ENSP00000372316:K714Q|.	ENSP00000253313:K405Q|.	K|R	-|-	1|3	0|2	POLN|POLN	2057195|2057195	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	4.234000|4.234000	0.58658|0.58658	1.962000|1.962000	0.57031|0.57031	0.528000|0.528000	0.53228|0.53228	AAG|AGA	.	.	.	none		0.537	POLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000205684.2	NM_181808	
TRMT44	152992	hgsc.bcm.edu	37	4	8469719	8469719	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr4:8469719A>C	ENST00000389737.4	+	9	1573	c.1573A>C	c.(1573-1575)Aag>Cag	p.K525Q	TRMT44_ENST00000513449.2_Missense_Mutation_p.K284Q	NM_152544.2	NP_689757.2	Q8IYL2	TRM44_HUMAN	tRNA methyltransferase 44 homolog (S. cerevisiae)	525					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										TCAGTACATTAAGAGCAGGCG	0.552																																					p.K525Q		Atlas-SNP	.											.	TRMT44	7	.	0			c.A1573C						PASS	.						49.0	55.0	53.0					4																	8469719		2203	4300	6503	SO:0001583	missense	152992	exon9			TACATTAAGAGCA	AK093044	CCDS3402.1, CCDS3402.2	4p16.1	2012-06-12	2012-06-12	2012-06-12	ENSG00000155275	ENSG00000155275			26653	protein-coding gene	gene with protein product	"""tRNA methyltransferase 44 homolog (S. cerevisiae)"""	614309	"""chromosome 4 open reading frame 23"", ""methyltransferase like 19"""	C4orf23, METTL19		21658913	Standard	NM_152544		Approved	FLJ35725, TRM44	uc003glg.2	Q8IYL2	OTTHUMG00000160935	ENST00000389737.4:c.1573A>C	chr4.hg19:g.8469719A>C	ENSP00000374387:p.Lys525Gln	191.0	0.0	.		137.0	67.0	.	NM_152544	Q8NA95	Missense_Mutation	SNP	ENST00000389737.4	hg19	CCDS3402.2	.	.	.	.	.	.	.	.	.	.	A	9.766	1.171459	0.21621	.	.	ENSG00000155275	ENST00000513449;ENST00000389737;ENST00000285635	T;T	0.18016	2.24;2.24	5.18	0.253	0.15551	.	1.019340	0.07792	N	0.955045	T	0.11495	0.0280	N	0.19112	0.55	0.09310	N	1	B;B	0.12630	0.001;0.006	B;B	0.13407	0.009;0.007	T	0.38672	-0.9650	10	0.21014	T	0.42	-2.6415	11.5332	0.50622	0.2948:0.6278:0.0774:0.0	.	525;284	Q8IYL2;Q8IYL2-2	TRM44_HUMAN;.	Q	284;525;133	ENSP00000424643:K284Q;ENSP00000374387:K525Q	ENSP00000285635:K133Q	K	+	1	0	METTL19	8520619	0.001000	0.12720	0.000000	0.03702	0.217000	0.24651	0.531000	0.23052	0.163000	0.19507	0.533000	0.62120	AAG	.	.	.	none		0.552	TRMT44-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359197.2	NM_152544	
FASTKD3	79072	hgsc.bcm.edu	37	5	7867537	7867537	+	Silent	SNP	A	A	G			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr5:7867537A>G	ENST00000264669.5	-	2	796	c.660T>C	c.(658-660)atT>atC	p.I220I	MTRR_ENST00000264668.2_5'Flank|MTRR_ENST00000440940.2_5'Flank|MTRR_ENST00000502509.1_Intron|FASTKD3_ENST00000513658.1_Intron|MTRR_ENST00000341013.6_5'Flank	NM_024091.3	NP_076996.2	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	220					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TTTCCCCAAGAATACAAAGAT	0.428																																					p.I220I		Atlas-SNP	.											.	FASTKD3	88	.	0			c.T660C						PASS	.						108.0	108.0	108.0					5																	7867537		2203	4300	6503	SO:0001819	synonymous_variant	79072	exon2			CCCAAGAATACAA	AK026927	CCDS3873.1	5p15.31	2008-02-05			ENSG00000124279	ENSG00000124279			28758	protein-coding gene	gene with protein product						12477932	Standard	NM_024091		Approved	MGC5297, FLJ23274	uc003jeb.3	Q14CZ7	OTTHUMG00000131029	ENST00000264669.5:c.660T>C	chr5.hg19:g.7867537A>G		83.0	0.0	.		89.0	45.0	.	NM_024091	Q9BVD3	Silent	SNP	ENST00000264669.5	hg19	CCDS3873.1																																																																																			.	.	.	none		0.428	FASTKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253673.1	NM_024091	
SMIM15	643155	hgsc.bcm.edu	37	5	60455870	60455870	+	Silent	SNP	T	T	C	rs140323722		TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr5:60455870T>C	ENST00000339020.3	-	3	554	c.129A>G	c.(127-129)aaA>aaG	p.K43K	CTC-436P18.1_ENST00000506902.1_RNA|SMIM15_ENST00000507416.1_Silent_p.K43K	NM_001048249.3	NP_001041714.1	Q7Z3B0	SIM15_HUMAN	small integral membrane protein 15	43						integral component of membrane (GO:0016021)											TCTTGGCCAATTTCCAAGACA	0.443																																					p.K43K		Atlas-SNP	.											.	.	.	.	0			c.A129G						PASS	.	T		0,4406		0,0,2203	158.0	144.0	149.0		129	-1.3	0.9	5	dbSNP_134	149	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	C5orf43	NM_001048249.3		0,2,6501	CC,CT,TT		0.0233,0.0,0.0154		43/75	60455870	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	643155	exon3			GGCCAATTTCCAA		CCDS34165.1	5q12	2013-06-21	2012-12-03	2012-12-03	ENSG00000188725	ENSG00000188725			33861	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 43"""	C5orf43			Standard	NM_001048249		Approved	DKFZP686E2158	uc010iwm.1	Q7Z3B0	OTTHUMG00000162241	ENST00000339020.3:c.129A>G	chr5.hg19:g.60455870T>C		80.0	0.0	.		74.0	33.0	.	NM_001048249	B9EJC4	Silent	SNP	ENST00000339020.3	hg19	CCDS34165.1																																																																																			.	T|1.000;C|0.000	0.000	weak		0.443	SMIM15-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368078.1	NM_001048249	
SPDL1	54908	hgsc.bcm.edu	37	5	169026069	169026069	+	Silent	SNP	T	T	G			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr5:169026069T>G	ENST00000265295.4	+	10	1509	c.1230T>G	c.(1228-1230)ctT>ctG	p.L410L		NM_017785.4	NP_060255.3			spindle apparatus coiled-coil protein 1																		AGCGAAAACTTTTTGCAAATG	0.353																																					p.L410L		Atlas-SNP	.											.	.	.	.	0			c.T1230G						PASS	.						49.0	51.0	51.0					5																	169026069		2203	4300	6503	SO:0001819	synonymous_variant	54908	exon10			AAAACTTTTTGCA	BC012568	CCDS4370.1	5q35.1	2012-09-27	2012-09-27	2012-09-27	ENSG00000040275	ENSG00000040275			26010	protein-coding gene	gene with protein product	"""spindly homolog (Drosophila)"""		"""coiled-coil domain containing 99"""	CCDC99		20427577	Standard	NM_017785		Approved	FLJ20364, hSpindly	uc003mae.4	Q96EA4	OTTHUMG00000130438	ENST00000265295.4:c.1230T>G	chr5.hg19:g.169026069T>G		243.0	0.0	.		255.0	124.0	.	NM_017785		Silent	SNP	ENST00000265295.4	hg19	CCDS4370.1																																																																																			.	.	.	none		0.353	SPDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252829.2	NM_017785	
CANX	821	hgsc.bcm.edu	37	5	179132798	179132798	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr5:179132798T>G	ENST00000247461.4	+	2	316	c.116T>G	c.(115-117)aTt>aGt	p.I39S	CANX_ENST00000452673.2_Missense_Mutation_p.I39S|CANX_ENST00000512607.2_De_novo_Start_OutOfFrame|CANX_ENST00000504734.1_Missense_Mutation_p.I39S|CANX_ENST00000415618.2_Missense_Mutation_p.I74S	NM_001746.3	NP_001737.1	P27824	CALX_HUMAN	calnexin	39					aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein folding (GO:0061077)|clathrin-mediated endocytosis (GO:0072583)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein secretion (GO:0009306)|synaptic vesicle endocytosis (GO:0048488)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ribosome (GO:0005840)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|prostate(2)|urinary_tract(3)	22	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Antihemophilic Factor(DB00025)|Tenecteplase(DB00031)	gacgatgtcattgaagaggta	0.413																																					p.I39S		Atlas-SNP	.											.	CANX	47	.	0			c.T116G						PASS	.						416.0	340.0	366.0					5																	179132798		2203	4300	6503	SO:0001583	missense	821	exon2			ATGTCATTGAAGA	L18887	CCDS4447.1	5q35	2008-07-18			ENSG00000127022	ENSG00000127022			1473	protein-coding gene	gene with protein product	"""major histocompatibility complex class I antigen-binding protein p88"""	114217				1326756, 8136357	Standard	NM_001746		Approved	CNX, IP90, P90	uc003mkl.3	P27824	OTTHUMG00000130910	ENST00000247461.4:c.116T>G	chr5.hg19:g.179132798T>G	ENSP00000247461:p.Ile39Ser	71.0	0.0	.		66.0	26.0	.	NM_001746	B2R5V8|B4DGP8|B4E2T8|D3DWQ3|D6R9K3	Missense_Mutation	SNP	ENST00000247461.4	hg19	CCDS4447.1	.	.	.	.	.	.	.	.	.	.	T	15.48	2.847345	0.51164	.	.	ENSG00000127022	ENST00000514383;ENST00000502296;ENST00000504734;ENST00000415618;ENST00000452673;ENST00000247461;ENST00000502498;ENST00000507307;ENST00000502673;ENST00000513246;ENST00000354394;ENST00000376953	T;T;T;T;D;T	0.82433	0.81;0.79;0.81;0.81;-1.61;0.14	4.57	4.57	0.56435	.	0.541869	0.20879	N	0.084024	T	0.65616	0.2708	N	0.04959	-0.14	0.80722	D	1	B;B;B	0.30236	0.001;0.274;0.001	B;B;B	0.32762	0.001;0.152;0.001	T	0.63051	-0.6723	10	0.21540	T	0.41	-9.4725	10.4884	0.44735	0.0:0.0:0.0:1.0	.	74;39;39	B4DGP8;Q6ZP56;P27824	.;.;CALX_HUMAN	S	39;39;39;74;39;39;39;39;39;39;31;39	ENSP00000424063:I39S;ENSP00000394817:I74S;ENSP00000391646:I39S;ENSP00000247461:I39S;ENSP00000425246:I39S;ENSP00000421107:I39S	ENSP00000247461:I39S	I	+	2	0	CANX	179065404	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.122000	0.50446	2.035000	0.60131	0.459000	0.35465	ATT	.	.	.	none		0.413	CANX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253500.2	NM_001024649	
GFPT2	9945	hgsc.bcm.edu	37	5	179758509	179758509	+	Silent	SNP	G	G	A			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr5:179758509G>A	ENST00000253778.8	-	5	554	c.385C>T	c.(385-387)Ctg>Ttg	p.L129L		NM_005110.2	NP_005101.1	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	129	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glutamine metabolic process (GO:0006541)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	AATTTCCTCAGATCTTTGTAA	0.428																																					p.L129L		Atlas-SNP	.											.	GFPT2	74	.	0			c.C385T						PASS	.						80.0	79.0	79.0					5																	179758509		1837	4094	5931	SO:0001819	synonymous_variant	9945	exon5			TCCTCAGATCTTT	AB016789	CCDS43411.1	5q	2008-07-18			ENSG00000131459	ENSG00000131459			4242	protein-coding gene	gene with protein product	"""glutamine: fructose-6-phosphate aminotransferase 2"""	603865				10198162	Standard	NM_005110		Approved	GFAT2	uc003mlw.1	O94808	OTTHUMG00000163442	ENST00000253778.8:c.385C>T	chr5.hg19:g.179758509G>A		81.0	0.0	.		94.0	45.0	.	NM_005110	Q53XM2|Q9BWS4	Silent	SNP	ENST00000253778.8	hg19	CCDS43411.1																																																																																			.	.	.	none		0.428	GFPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373444.4	NM_005110	
HLA-G	3135	hgsc.bcm.edu	37	6	29797430	29797430	+	Silent	SNP	G	G	T			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr6:29797430G>T	ENST00000360323.6	+	4	879	c.855G>T	c.(853-855)gtG>gtT	p.V285V	HLA-G_ENST00000376815.3_Intron|HLA-G_ENST00000376818.3_Silent_p.V193V|HLA-G_ENST00000376828.2_Silent_p.V290V|HLA-G_ENST00000428701.1_Silent_p.V285V			P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	285	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(5)|skin(1)	21						CGTGCCATGTGCAGCATGAGG	0.592																																					p.V285V		Atlas-SNP	.											.	HLA-G	90	.	0			c.G855T						PASS	.						58.0	58.0	58.0					6																	29797430		2203	4300	6503	SO:0001819	synonymous_variant	3135	exon5			CCATGTGCAGCAT		CCDS4668.1	6p21.3	2013-01-11	2007-12-12		ENSG00000204632	ENSG00000204632		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4964	protein-coding gene	gene with protein product	"""b2 microglobulin"""	142871	"""HLA-G histocompatibility antigen, class I, G"""				Standard	NM_002127		Approved		uc003nnw.2	P17693	OTTHUMG00000031157	ENST00000360323.6:c.855G>T	chr6.hg19:g.29797430G>T		66.0	0.0	.		94.0	6.0	.	NM_002127		Silent	SNP	ENST00000360323.6	hg19	CCDS4668.1																																																																																			.	.	.	none		0.592	HLA-G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076286.2	NM_002127	
CRIP3	401262	hgsc.bcm.edu	37	6	43275411	43275411	+	Silent	SNP	A	A	G			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr6:43275411A>G	ENST00000274990.4	-	4	271	c.267T>C	c.(265-267)ccT>ccC	p.P89P	CRIP3_ENST00000372569.3_Silent_p.P89P|ZNF318_ENST00000607252.1_5'UTR			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3	89					T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			TGGGGCTGAGAGGAGTGGTGC	0.612																																					p.P89P		Atlas-SNP	.											.	CRIP3	30	.	0			c.T267C						PASS	.						48.0	52.0	51.0					6																	43275411		2203	4300	6503	SO:0001819	synonymous_variant	401262	exon4			GCTGAGAGGAGTG	AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.267T>C	chr6.hg19:g.43275411A>G		89.0	0.0	.		86.0	40.0	.	NM_206922	A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Silent	SNP	ENST00000274990.4	hg19		.	.	.	.	.	.	.	.	.	.	A	7.649	0.682533	0.14907	.	.	ENSG00000146215	ENST00000416431	.	.	.	5.28	2.51	0.30379	.	.	.	.	.	T	0.37732	0.1014	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22977	-1.0201	4	.	.	.	-37.293	5.0692	0.14598	0.2608:0.1501:0.5891:0.0	.	.	.	.	P	37	.	.	S	-	1	0	CRIP3	43383389	0.993000	0.37304	0.924000	0.36721	0.731000	0.41821	1.442000	0.35046	0.304000	0.22809	-0.242000	0.12053	TCT	.	.	.	none		0.612	CRIP3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000313968.1		
IGF2R	3482	hgsc.bcm.edu	37	6	160467612	160467612	+	Silent	SNP	T	T	C			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr6:160467612T>C	ENST00000356956.1	+	15	2134	c.1986T>C	c.(1984-1986)aaT>aaC	p.N662N		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	662					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	TTTATATAAATGTGTGTGGCC	0.423																																					p.N662N		Atlas-SNP	.											.	IGF2R	251	.	0			c.T1986C						PASS	.						71.0	80.0	77.0					6																	160467612		2203	4300	6503	SO:0001819	synonymous_variant	3482	exon15			TATAAATGTGTGT	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.1986T>C	chr6.hg19:g.160467612T>C		65.0	0.0	.		65.0	25.0	.	NM_000876	Q7Z7G9|Q96PT5	Silent	SNP	ENST00000356956.1	hg19	CCDS5273.1																																																																																			.	.	.	none		0.423	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
PHF10	55274	hgsc.bcm.edu	37	6	170112545	170112545	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr6:170112545A>T	ENST00000339209.4	-	8	1017	c.894T>A	c.(892-894)gaT>gaA	p.D298E	PHF10_ENST00000366780.4_Missense_Mutation_p.D296E	NM_018288.3|NM_133325.2	NP_060758.2|NP_579866.2	Q8WUB8	PHF10_HUMAN	PHD finger protein 10	298	Essential to induce neural progenitor proliferation. {ECO:0000250}.				nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	npBAF complex (GO:0071564)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|liver(3)|lung(4)|prostate(2)|urinary_tract(1)	14		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		CTGAATCACCATCACTGTCTA	0.478																																					p.D298E		Atlas-SNP	.											.	PHF10	76	.	0			c.T894A						PASS	.						161.0	158.0	159.0					6																	170112545		2203	4300	6503	SO:0001583	missense	55274	exon8			ATCACCATCACTG	AF338735	CCDS5308.2, CCDS5309.2	6q27	2014-05-13			ENSG00000130024	ENSG00000130024		"""Zinc fingers, PHD-type"""	18250	protein-coding gene	gene with protein product		613069				11827455	Standard	NM_018288		Approved	FLJ10975, XAP135, BAF45a	uc011egy.2	Q8WUB8	OTTHUMG00000016058	ENST00000339209.4:c.894T>A	chr6.hg19:g.170112545A>T	ENSP00000341805:p.Asp298Glu	161.0	0.0	.		151.0	74.0	.	NM_018288	Q2YDA3|Q53HG8|Q9BXD2|Q9NV26	Missense_Mutation	SNP	ENST00000339209.4	hg19	CCDS5308.2	.	.	.	.	.	.	.	.	.	.	a	13.28	2.190749	0.38707	.	.	ENSG00000130024	ENST00000366780;ENST00000339209	D;D	0.87650	-2.28;-2.27	5.35	-7.28	0.01456	.	0.095024	0.64402	N	0.000001	T	0.60117	0.2244	L	0.35723	1.085	0.44754	D	0.997758	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.09377	0.004;0.002;0.001	T	0.15983	-1.0418	10	0.25751	T	0.34	-18.3504	9.5202	0.39131	0.4785:0.1052:0.4163:0.0	.	210;296;298	Q5T069;Q8WUB8-2;Q8WUB8	.;.;PHF10_HUMAN	E	296;298	ENSP00000355743:D296E;ENSP00000341805:D298E	ENSP00000341805:D298E	D	-	3	2	PHF10	169854470	0.012000	0.17670	0.491000	0.27477	0.856000	0.48823	-0.917000	0.04025	-1.277000	0.02411	-1.413000	0.01118	GAT	.	.	.	none		0.478	PHF10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346732.1	NM_018288	
MET	4233	hgsc.bcm.edu	37	7	116417457	116417457	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr7:116417457G>A	ENST00000318493.6	+	16	3515	c.3328G>A	c.(3328-3330)Gta>Ata	p.V1110I	MET_ENST00000539704.1_5'UTR|MET_ENST00000397752.3_Missense_Mutation_p.V1092I			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TTTTGGTTGTGTATATCATGG	0.338			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.V1110I		Atlas-SNP	.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	.	MET	412	.	0			c.G3328A	GRCh37	CM990852	MET	M		PASS	.						191.0	176.0	180.0					7																	116417457		1827	4084	5911	SO:0001583	missense	4233	exon16	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	GGTTGTGTATATC	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3328G>A	chr7.hg19:g.116417457G>A	ENSP00000317272:p.Val1110Ile	82.0	0.0	.		151.0	55.0	.	NM_001127500	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	hg19	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834124	0.91036	.	.	ENSG00000105976	ENST00000397752;ENST00000318493	T;T	0.64991	-0.13;-0.13	5.16	5.16	0.70880	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.81178	0.4768	M	0.80422	2.495	0.80722	D	1	D;D	0.76494	0.999;0.99	D;D	0.85130	0.997;0.99	D	0.83726	0.0195	10	0.87932	D	0	.	19.0107	0.92871	0.0:0.0:1.0:0.0	.	1110;1092	P08581-2;P08581	.;MET_HUMAN	I	1092;1110	ENSP00000380860:V1092I;ENSP00000317272:V1110I	ENSP00000317272:V1110I	V	+	1	0	MET	116204693	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.813000	0.99286	2.560000	0.86352	0.563000	0.77884	GTA	.	.	.	none		0.338	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
NUP205	23165	hgsc.bcm.edu	37	7	135255937	135255937	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr7:135255937T>G	ENST00000285968.6	+	2	139	c.113T>G	c.(112-114)cTt>cGt	p.L38R	NUP205_ENST00000440390.2_5'UTR|NUP205_ENST00000489493.1_3'UTR	NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	38					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						GCTGTTCACCTTCTTGATAAG	0.333																																					p.L38R		Atlas-SNP	.											.	NUP205	198	.	0			c.T113G						PASS	.						84.0	85.0	85.0					7																	135255937		2203	4300	6503	SO:0001583	missense	23165	exon2			TTCACCTTCTTGA	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.113T>G	chr7.hg19:g.135255937T>G	ENSP00000285968:p.Leu38Arg	362.0	0.0	.		522.0	160.0	.	NM_015135	A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	hg19	CCDS34759.1	.	.	.	.	.	.	.	.	.	.	T	9.099	1.003717	0.19121	.	.	ENSG00000155561	ENST00000285968	T	0.28069	1.63	5.44	5.44	0.79542	.	0.294988	0.35291	N	0.003315	T	0.15565	0.0375	N	0.16478	0.41	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.13683	-1.0500	10	0.10636	T	0.68	-16.5036	7.0046	0.24830	0.0:0.0783:0.1626:0.7591	.	38	Q92621	NU205_HUMAN	R	38	ENSP00000285968:L38R	ENSP00000285968:L38R	L	+	2	0	NUP205	134906477	1.000000	0.71417	0.998000	0.56505	0.870000	0.49936	2.571000	0.45990	2.069000	0.61940	0.477000	0.44152	CTT	.	.	.	none		0.333	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
POLB	5423	hgsc.bcm.edu	37	8	42218840	42218840	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr8:42218840T>C	ENST00000265421.4	+	10	748	c.578T>C	c.(577-579)gTt>gCt	p.V193A	POLB_ENST00000538005.1_Missense_Mutation_p.V39A	NM_002690.2	NP_002681.1	P06746	DPOLB_HUMAN	polymerase (DNA directed), beta	193					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neuron apoptotic process (GO:0051402)|pyrimidine dimer repair (GO:0006290)|response to ethanol (GO:0045471)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|enzyme binding (GO:0019899)|lyase activity (GO:0016829)|metal ion binding (GO:0046872)|microtubule binding (GO:0008017)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(1)	16	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.18e-11)|Lung(22;0.00467)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|LUSC - Lung squamous cell carcinoma(45;0.024)		Cytarabine(DB00987)	GACATGGATGTTCTCCTGACC	0.428								DNA polymerases (catalytic subunits)																													p.V193A		Atlas-SNP	.											.	POLB	60	.	0			c.T578C						PASS	.						172.0	144.0	153.0					8																	42218840		2203	4300	6503	SO:0001583	missense	5423	exon10			TGGATGTTCTCCT		CCDS6129.1	8p12-p11	2012-10-02			ENSG00000070501	ENSG00000070501	2.7.7.7	"""DNA polymerases"""	9174	protein-coding gene	gene with protein product		174760					Standard	NM_002690		Approved		uc003xoz.2	P06746	OTTHUMG00000164093	ENST00000265421.4:c.578T>C	chr8.hg19:g.42218840T>C	ENSP00000265421:p.Val193Ala	89.0	0.0	.		61.0	24.0	.	NM_002690	B2RC78|Q3KP48|Q6FI34	Missense_Mutation	SNP	ENST00000265421.4	hg19	CCDS6129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.75|15.75	2.926490|2.926490	0.52759|0.52759	.|.	.|.	ENSG00000070501|ENSG00000070501	ENST00000518579;ENST00000517393|ENST00000265421;ENST00000520008;ENST00000518925;ENST00000538005	.|T;T;T;T	.|0.36340	.|1.26;1.26;1.26;1.26	5.58|5.58	5.58|5.58	0.84498|0.84498	.|DNA-directed DNA polymerase X (1);	.|0.168551	.|0.51477	.|D	.|0.000087	T|T	0.34716|0.34716	0.0907|0.0907	L|L	0.50993|0.50993	1.605|1.605	0.52099|0.52099	D|D	0.999946|0.999946	.|B;B	.|0.10296	.|0.002;0.003	.|B;B	.|0.16289	.|0.012;0.015	T|T	0.09143|0.09143	-1.0688|-1.0688	5|10	.|0.42905	.|T	.|0.14	-10.0579|-10.0579	13.6995|13.6995	0.62599|0.62599	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|193;193	.|Q53EV2;P06746	.|.;DPOLB_HUMAN	L|A	51;9|193;39;228;39	.|ENSP00000265421:V193A;ENSP00000430610:V39A;ENSP00000430784:V228A;ENSP00000440497:V39A	.|ENSP00000265421:V193A	F|V	+|+	1|2	0|0	POLB|POLB	42337997|42337997	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.018000|0.018000	0.09664|0.09664	7.846000|7.846000	0.86887|0.86887	2.124000|2.124000	0.65301|0.65301	0.460000|0.460000	0.39030|0.39030	TTC|GTT	.	.	.	none		0.428	POLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377242.1	NM_002690	
ZFHX4	79776	hgsc.bcm.edu	37	8	77775575	77775575	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr8:77775575G>A	ENST00000521891.2	+	11	10073	c.9625G>A	c.(9625-9627)Gcc>Acc	p.A3209T	ZFHX4_ENST00000455469.2_Missense_Mutation_p.A3164T|ZFHX4_ENST00000518282.1_Missense_Mutation_p.A3183T|ZFHX4_ENST00000050961.6_Missense_Mutation_p.A3160T	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3160					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GGAATTAGAGGCCACCAAACC	0.418										HNSCC(33;0.089)																											p.A3209T		Atlas-SNP	.											.	ZFHX4	878	.	0			c.G9625A						PASS	.						109.0	107.0	107.0					8																	77775575		1873	4111	5984	SO:0001583	missense	79776	exon11			TTAGAGGCCACCA		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9625G>A	chr8.hg19:g.77775575G>A	ENSP00000430497:p.Ala3209Thr	164.0	0.0	.		124.0	44.0	.	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	hg19	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	7.146	0.582749	0.13749	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.50813	0.73;0.78;0.77;0.74	4.71	2.61	0.31194	.	0.176572	0.26931	U	0.021774	T	0.27419	0.0673	N	0.12182	0.205	0.36396	D	0.862813	B	0.06786	0.001	B	0.06405	0.002	T	0.17561	-1.0365	10	0.39692	T	0.17	.	10.0281	0.42083	0.2015:0.0:0.7985:0.0	.	3164	Q86UP3-4	.	T	3209;3193;3164;3160;3183	ENSP00000430497:A3209T;ENSP00000399605:A3164T;ENSP00000050961:A3160T;ENSP00000430848:A3183T	ENSP00000050961:A3160T	A	+	1	0	ZFHX4	77938130	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	2.398000	0.44486	1.084000	0.41184	0.561000	0.74099	GCC	.	.	.	none		0.418	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
HRSP12	10247	hgsc.bcm.edu	37	8	99118223	99118223	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr8:99118223T>C	ENST00000254878.3	-	4	382	c.238A>G	c.(238-240)Act>Gct	p.T80A		NM_005836.2	NP_005827.1	P52758	UK114_HUMAN	heat-responsive protein 12	80					regulation of translational termination (GO:0006449)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	deaminase activity (GO:0019239)|endonuclease activity (GO:0004519)|poly(A) RNA binding (GO:0044822)			large_intestine(3)|lung(1)|ovary(1)|urinary_tract(1)	6	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.214)			AGAAGAACAGTTGTTTTCACC	0.308																																					p.T80A		Atlas-SNP	.											.	HRSP12	13	.	0			c.A238G						PASS	.						156.0	154.0	154.0					8																	99118223		2202	4300	6502	SO:0001583	missense	10247	exon4			GAACAGTTGTTTT	BC008418	CCDS6276.1	8q22	2014-05-09			ENSG00000132541	ENSG00000132541			16897	protein-coding gene	gene with protein product	"""translational inhibitor p14.5"""	602487				8973653, 9405234, 20817725	Standard	NM_005836		Approved	UK114, P14.5, PSP	uc003yii.1	P52758	OTTHUMG00000164670	ENST00000254878.3:c.238A>G	chr8.hg19:g.99118223T>C	ENSP00000254878:p.Thr80Ala	89.0	0.0	.		69.0	41.0	.	NM_005836	Q6FHU9|Q6IBG0	Missense_Mutation	SNP	ENST00000254878.3	hg19	CCDS6276.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.3|21.3	4.135850|4.135850	0.77662|0.77662	.|.	.|.	ENSG00000132541|ENSG00000132541	ENST00000520507|ENST00000254878	.|.	.|.	.|.	5.53|5.53	5.53|5.53	0.82687|0.82687	.|Endoribonuclease L-PSP/chorismate mutase-like (2);	.|0.050056	.|0.85682	.|D	.|0.000000	T|T	0.80138|0.80138	0.4568|0.4568	H|H	0.98487|0.98487	4.245|4.245	0.80722|0.80722	D|D	1|1	.|P	.|0.34826	.|0.471	.|B	.|0.35510	.|0.204	D|D	0.84843|0.84843	0.0809|0.0809	5|9	.|0.72032	.|D	.|0.01	.|.	13.1896|13.1896	0.59702|0.59702	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|80	.|P52758	.|UK114_HUMAN	S|A	90|80	.|.	.|ENSP00000254878:T80A	N|T	-|-	2|1	0|0	HRSP12|HRSP12	99187399|99187399	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.954000|0.954000	0.61252|0.61252	6.663000|6.663000	0.74431|0.74431	2.110000|2.110000	0.64415|0.64415	0.379000|0.379000	0.24179|0.24179	AAC|ACT	.	.	.	none		0.308	HRSP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379687.1	NM_005836	
RIMS2	9699	hgsc.bcm.edu	37	8	104924308	104924308	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr8:104924308G>A	ENST00000436393.2	+	4	1295	c.1054G>A	c.(1054-1056)Gat>Aat	p.D352N	RIMS2_ENST00000406091.3_Missense_Mutation_p.D574N|RIMS2_ENST00000262231.10_Missense_Mutation_p.D429N|RIMS2_ENST00000507740.1_Missense_Mutation_p.D382N			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	652					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			ACCATCTAAAGATGGAGATCG	0.328										HNSCC(12;0.0054)																											p.D574N		Atlas-SNP	.											.	RIMS2	1357	.	0			c.G1720A						PASS	.						109.0	105.0	107.0					8																	104924308		1824	4085	5909	SO:0001583	missense	9699	exon6			TCTAAAGATGGAG	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.1054G>A	chr8.hg19:g.104924308G>A	ENSP00000390665:p.Asp352Asn	100.0	0.0	.		80.0	37.0	.	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	hg19		.	.	.	.	.	.	.	.	.	.	G	34	5.311317	0.95655	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T;T	0.22945	1.93;2.4;2.08;2.11;2.11;2.04;2.36	5.92	5.92	0.95590	PDZ/DHR/GLGF (1);	.	.	.	.	T	0.46946	0.1419	L	0.43923	1.385	0.80722	D	1	P;D;P;D;D	0.71674	0.623;0.976;0.887;0.998;0.998	P;D;D;D;D	0.85130	0.559;0.99;0.937;0.997;0.997	T	0.16867	-1.0388	9	0.49607	T	0.09	.	20.3343	0.98733	0.0:0.0:1.0:0.0	.	652;352;429;382;574	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	N	574;605;574;652;382;429;382;382;352	ENSP00000427018:D574N;ENSP00000384892:D574N;ENSP00000425205:D382N;ENSP00000262231:D429N;ENSP00000423559:D382N;ENSP00000386228:D382N;ENSP00000390665:D352N	ENSP00000262231:D429N	D	+	1	0	RIMS2	104993484	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.822000	0.97130	0.650000	0.86243	GAT	.	.	.	none		0.328	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
STX17	55014	hgsc.bcm.edu	37	9	102691077	102691077	+	Silent	SNP	C	C	A			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr9:102691077C>A	ENST00000259400.6	+	3	277	c.141C>A	c.(139-141)atC>atA	p.I47I	STX17_ENST00000534052.1_Silent_p.I47I|STX17_ENST00000525640.1_Silent_p.I47I|RP11-60I3.4_ENST00000524512.1_RNA	NM_017919.2	NP_060389.2	P56962	STX17_HUMAN	syntaxin 17	47					autophagic vacuole fusion (GO:0000046)|endoplasmic reticulum-Golgi intermediate compartment organization (GO:0097111)|ER to Golgi vesicle-mediated transport (GO:0006888)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|protein localization to pre-autophagosomal structure (GO:0034497)	autophagic vacuole membrane (GO:0000421)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|ER to Golgi transport vesicle (GO:0030134)|ER-mitochondrion membrane contact site (GO:0044233)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|smooth endoplasmic reticulum membrane (GO:0030868)|SNARE complex (GO:0031201)	protein phosphatase binding (GO:0019903)|SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			endometrium(2)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				GGTGCAGAATCTGGGACAAGT	0.358																																					p.I47I		Atlas-SNP	.											.	STX17	17	.	0			c.C141A						PASS	.						84.0	87.0	86.0					9																	102691077		2203	4300	6503	SO:0001819	synonymous_variant	55014	exon3			CAGAATCTGGGAC	AL834371	CCDS6745.1	9q31.1	2008-02-05			ENSG00000136874	ENSG00000136874			11432	protein-coding gene	gene with protein product		604204				9852078	Standard	NM_017919		Approved	FLJ20651	uc004bal.4	P56962	OTTHUMG00000020359	ENST00000259400.6:c.141C>A	chr9.hg19:g.102691077C>A		93.0	0.0	.		65.0	35.0	.	NM_017919	Q4VXC2	Silent	SNP	ENST00000259400.6	hg19	CCDS6745.1																																																																																			.	.	.	none		0.358	STX17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053398.3	NM_017919	
RABL6	55684	hgsc.bcm.edu	37	9	139730244	139730244	+	Silent	SNP	C	C	T			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr9:139730244C>T	ENST00000311502.7	+	8	992	c.756C>T	c.(754-756)gcC>gcT	p.A252A	RABL6_ENST00000357466.2_Silent_p.A252A|RABL6_ENST00000371675.3_Silent_p.A137A|RABL6_ENST00000466096.1_3'UTR|RABL6_ENST00000371663.4_Silent_p.A253A|RABL6_ENST00000432842.2_Silent_p.A214A			Q3YEC7	RABL6_HUMAN	RAB, member RAS oncogene family-like 6	252	Small GTPase-like.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										ACATGGACGCCACGCTGGAGG	0.682																																					p.A253A		Atlas-SNP	.											.	.	.	.	0			c.C759T						PASS	.						18.0	26.0	24.0					9																	139730244		2067	4062	6129	SO:0001819	synonymous_variant	55684	exon8			GGACGCCACGCTG	AK094382	CCDS48058.1, CCDS55352.1, CCDS55353.1	9q34.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000196642	ENSG00000196642			24703	protein-coding gene	gene with protein product	"""Rab-like protein 1"", ""partner of ARF"""	610615	"""chromosome 9 open reading frame 86"""	C9orf86		14702039, 16582619, 17962191, 19433581	Standard	NM_024718		Approved	FLJ10101, FLJ13045, pp8875, bA216L13.9, Parf, RBEL1	uc004cjj.1	Q3YEC7	OTTHUMG00000020947	ENST00000311502.7:c.756C>T	chr9.hg19:g.139730244C>T		173.0	0.0	.		157.0	73.0	.	NM_001173988	A8QVZ7|A8QVZ8|C6K8I4|C6K8I5|Q4F968|Q5T5R7|Q8IWK1|Q8TCL4|Q8WU94|Q96SR8|Q9BU21|Q9H935	Silent	SNP	ENST00000311502.7	hg19	CCDS48058.1																																																																																			.	.	.	none		0.682	RABL6-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055141.4	NM_024718	
IPO7	10527	hgsc.bcm.edu	37	11	9430091	9430091	+	Silent	SNP	A	A	C			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr11:9430091A>C	ENST00000379719.3	+	3	367	c.225A>C	c.(223-225)ccA>ccC	p.P75P		NM_006391.2	NP_006382.1	O95373	IPO7_HUMAN	importin 7	75	Importin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00115}.				innate immune response (GO:0045087)|protein import into nucleus (GO:0006606)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)|small GTPase regulator activity (GO:0005083)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		AAACAGCACCAGGGGATATAT	0.368																																					p.P75P		Atlas-SNP	.											.	IPO7	72	.	0			c.A225C						PASS	.						67.0	69.0	68.0					11																	9430091		2201	4296	6497	SO:0001819	synonymous_variant	10527	exon3			AGCACCAGGGGAT	AF098799	CCDS31425.1	11p15.3	2010-12-02	2003-03-11	2003-03-14	ENSG00000205339	ENSG00000205339		"""Importins"""	9852	protein-coding gene	gene with protein product		605586	"""RAN binding protein 7"""	RANBP7		9214382	Standard	NM_006391		Approved	Imp7	uc001mho.3	O95373	OTTHUMG00000165753	ENST00000379719.3:c.225A>C	chr11.hg19:g.9430091A>C		81.0	0.0	.		86.0	39.0	.	NM_006391	A6NNM5|B2R786|Q1RMF7|Q9H177|Q9NTE3	Silent	SNP	ENST00000379719.3	hg19	CCDS31425.1																																																																																			.	.	.	none		0.368	IPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386022.1	NM_006391	
CLSTN3	9746	hgsc.bcm.edu	37	12	7280907	7280907	+	5'Flank	SNP	A	A	G			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr12:7280907A>G	ENST00000266546.6	+	0	0				RP11-273B20.1_ENST00000538062.1_RNA|RBP5_ENST00000266560.3_Missense_Mutation_p.Y61H|RBP5_ENST00000542370.1_Missense_Mutation_p.Y61H|RP11-273B20.1_ENST00000544657.1_RNA	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3						homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						TGCACAGTGTAGTTTCGGAAG	0.592																																					p.Y61H		Atlas-SNP	.											.	RBP5	20	.	0			c.T181C						PASS	.						165.0	134.0	144.0					12																	7280907		2203	4300	6503	SO:0001631	upstream_gene_variant	83758	exon2			CAGTGTAGTTTCG	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167		chr12.hg19:g.7280907A>G	Exception_encountered	119.0	0.0	.		116.0	59.0	.	NM_031491	D3DUT6|O94831|Q2T9J5|Q5UE57	Missense_Mutation	SNP	ENST00000266546.6	hg19	CCDS8575.1	.	.	.	.	.	.	.	.	.	.	A	8.724	0.914971	0.17907	.	.	ENSG00000139194	ENST00000266560;ENST00000542370	T;T	0.07800	3.16;3.16	3.55	3.55	0.40652	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.062472	0.64402	D	0.000003	T	0.16171	0.0389	L	0.49126	1.545	0.58432	D	0.999996	P	0.48294	0.908	P	0.56278	0.795	T	0.06552	-1.0820	10	0.20046	T	0.44	.	13.1516	0.59492	1.0:0.0:0.0:0.0	.	61	P82980	RET5_HUMAN	H	61	ENSP00000266560:Y61H;ENSP00000438083:Y61H	ENSP00000266560:Y61H	Y	-	1	0	RBP5	7172174	1.000000	0.71417	0.848000	0.33437	0.075000	0.17131	5.670000	0.68088	1.841000	0.53522	0.402000	0.26972	TAC	.	.	.	none		0.592	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718	
C12orf74	338809	hgsc.bcm.edu	37	12	93100476	93100476	+	Silent	SNP	G	G	A			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr12:93100476G>A	ENST00000397833.3	+	2	520	c.69G>A	c.(67-69)tcG>tcA	p.S23S	C12orf74_ENST00000544406.2_Silent_p.S23S	NM_001037671.3|NM_001178097.2	NP_001032760.1|NP_001171568.1	Q32Q52	CL074_HUMAN	chromosome 12 open reading frame 74	23										kidney(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(2)	10						CTCGGCCCTCGCTGAGGAGCC	0.567																																					p.S23S		Atlas-SNP	.											.	C12orf74	17	.	0			c.G69A						PASS	.						31.0	34.0	33.0					12																	93100476		1909	4119	6028	SO:0001819	synonymous_variant	338809	exon2			GCCCTCGCTGAGG	BC043363	CCDS41819.1, CCDS53818.1	12q22	2012-08-16			ENSG00000214215	ENSG00000214215			27887	protein-coding gene	gene with protein product						12477932	Standard	NM_001037671		Approved		uc001tch.2	Q32Q52	OTTHUMG00000170105	ENST00000397833.3:c.69G>A	chr12.hg19:g.93100476G>A		46.0	0.0	.		62.0	31.0	.	NM_001037671	F5H4P0	Silent	SNP	ENST00000397833.3	hg19	CCDS41819.1																																																																																			.	.	.	none		0.567	C12orf74-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407285.1	NM_001037671	
GJA3	2700	hgsc.bcm.edu	37	13	20716205	20716205	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr13:20716205G>A	ENST00000241125.3	-	2	1399	c.1223C>T	c.(1222-1224)cCc>cTc	p.P408L		NM_021954.3	NP_068773.2	Q9Y6H8	CXA3_HUMAN	gap junction protein, alpha 3, 46kDa	408					cell-cell signaling (GO:0007267)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)			NS(1)|endometrium(1)|kidney(1)|lung(1)|pancreas(1)|prostate(1)|skin(1)	7		all_cancers(29;1.4e-21)|all_epithelial(30;8.75e-19)|all_lung(29;1.28e-17)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;0.000554)|Epithelial(112;0.000872)|OV - Ovarian serous cystadenocarcinoma(117;0.0105)|Lung(94;0.0251)|LUSC - Lung squamous cell carcinoma(192;0.0784)		GAGGGGCAAGGGCGGCTGGTG	0.736																																					p.P408L		Atlas-SNP	.											.	GJA3	32	.	0			c.C1223T						PASS	.						5.0	5.0	5.0					13																	20716205		1907	3719	5626	SO:0001583	missense	2700	exon2			GGCAAGGGCGGCT	AF075290	CCDS9289.1	13q12.11	2008-02-05	2007-01-16		ENSG00000121743	ENSG00000121743		"""Ion channels / Gap junction proteins (connexins)"""	4277	protein-coding gene	gene with protein product	"""connexin 46"""	121015	"""gap junction protein, alpha 3, 46kD (connexin 46)"", ""gap junction protein, alpha 3, 46kDa (connexin 46)"""	CZP3		10205266, 7342922	Standard	NM_021954		Approved	CX46	uc001umx.1	Q9Y6H8	OTTHUMG00000016510	ENST00000241125.3:c.1223C>T	chr13.hg19:g.20716205G>A	ENSP00000241125:p.Pro408Leu	105.0	0.0	.		102.0	50.0	.	NM_021954	Q0VAB7|Q9H537	Missense_Mutation	SNP	ENST00000241125.3	hg19	CCDS9289.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.652921	0.88056	.	.	ENSG00000121743	ENST00000241125	D	0.88586	-2.4	4.35	4.35	0.52113	.	.	.	.	.	D	0.91868	0.7426	L	0.39245	1.2	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92995	0.6418	9	0.66056	D	0.02	.	16.8836	0.86070	0.0:0.0:1.0:0.0	.	408	Q9Y6H8	CXA3_HUMAN	L	408	ENSP00000241125:P408L	ENSP00000241125:P408L	P	-	2	0	GJA3	19614205	1.000000	0.71417	0.022000	0.16811	0.060000	0.15804	9.035000	0.93752	1.968000	0.57251	0.313000	0.20887	CCC	.	.	.	none		0.736	GJA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044059.3	NM_021954	
INTS6	26512	hgsc.bcm.edu	37	13	51961636	51961636	+	Silent	SNP	A	A	G			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr13:51961636A>G	ENST00000311234.4	-	7	1252	c.780T>C	c.(778-780)ccT>ccC	p.P260P	INTS6_ENST00000425000.1_5'UTR|INTS6_ENST00000497989.1_Silent_p.P82P|INTS6_ENST00000490542.1_5'Flank|INTS6_ENST00000420668.2_3'UTR|INTS6_ENST00000398119.2_Silent_p.P247P|INTS6_ENST00000463928.1_Silent_p.P260P	NM_012141.2	NP_036273.1	Q9UL03	INT6_HUMAN	integrator complex subunit 6	260					signal transduction (GO:0007165)|snRNA processing (GO:0016180)	actin cytoskeleton (GO:0015629)|integrator complex (GO:0032039)|nucleus (GO:0005634)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		AGCTATGCCAAGGCTGAGATC	0.403																																					p.P260P		Atlas-SNP	.											.	INTS6	72	.	0			c.T780C						PASS	.						73.0	68.0	70.0					13																	51961636		2203	4300	6503	SO:0001819	synonymous_variant	26512	exon7			ATGCCAAGGCTGA	AF097645	CCDS9428.1, CCDS41890.1, CCDS45048.1	13q14.3	2010-08-20	2006-03-15	2006-03-15	ENSG00000102786	ENSG00000102786		"""DEAD-boxes"""	14879	protein-coding gene	gene with protein product		604331	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26"""	DDX26		10467397, 16239144	Standard	XM_005266340		Approved	DICE1, HDB, Notchl2, DBI-1, DDX26A, INT6	uc001vfk.3	Q9UL03	OTTHUMG00000016945	ENST00000311234.4:c.780T>C	chr13.hg19:g.51961636A>G		37.0	0.0	.		34.0	12.0	.	NM_012141	Q0P664|Q6PJP4|Q9UFK0|Q9Y5M9	Silent	SNP	ENST00000311234.4	hg19	CCDS9428.1																																																																																			.	.	.	none		0.403	INTS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045023.1	NM_012141	
ACOT2	10965	hgsc.bcm.edu	37	14	74036423	74036423	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr14:74036423T>C	ENST00000238651.5	+	1	661	c.479T>C	c.(478-480)gTg>gCg	p.V160A	ACOT2_ENST00000538782.1_Intron	NM_006821.5	NP_006812.3	P49753	ACOT2_HUMAN	acyl-CoA thioesterase 2	160					acyl-CoA metabolic process (GO:0006637)|long-chain fatty acid metabolic process (GO:0001676)|very long-chain fatty acid metabolic process (GO:0000038)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			breast(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(234;0.0033)|OV - Ovarian serous cystadenocarcinoma(108;0.0639)		AAGCGCGACGTGCGAACGCCC	0.721																																					p.V160A		Atlas-SNP	.											.	ACOT2	24	.	0			c.T479C						PASS	.						11.0	10.0	10.0					14																	74036423		1955	3921	5876	SO:0001583	missense	10965	exon1			GCGACGTGCGAAC	AY005822, AK001939	CCDS9816.1	14q24.3	2013-09-20			ENSG00000119673	ENSG00000119673		"""Acyl CoA thioesterases"""	18431	protein-coding gene	gene with protein product	"""mitochondrial acyl-CoA thioesterase 1"""	609972				16103133, 16940157	Standard	NM_006821		Approved	Mte1, ZAP128	uc001xon.5	P49753	OTTHUMG00000171608	ENST00000238651.5:c.479T>C	chr14.hg19:g.74036423T>C	ENSP00000238651:p.Val160Ala	161.0	0.0	.		137.0	49.0	.	NM_006821	Q3I5F8|Q53EK4|Q9NUX4	Missense_Mutation	SNP	ENST00000238651.5	hg19	CCDS9816.1	.	.	.	.	.	.	.	.	.	.	T	13.68	2.310408	0.40895	.	.	ENSG00000119673	ENST00000238651	T	0.72505	-0.66	3.58	2.39	0.29439	Acyl-CoA thioester hydrolase/bile acid-CoA amino acid N-acetyltransferase (1);	0.069512	0.56097	D	0.000026	D	0.83238	0.5211	M	0.87180	2.865	0.44771	D	0.997779	D	0.89917	1.0	D	0.81914	0.995	T	0.82739	-0.0308	10	0.87932	D	0	-17.2886	9.1588	0.37009	0.1635:0.0:0.0:0.8365	.	160	P49753	ACOT2_HUMAN	A	160	ENSP00000238651:V160A	ENSP00000238651:V160A	V	+	2	0	ACOT2	73106176	1.000000	0.71417	0.998000	0.56505	0.031000	0.12232	2.461000	0.45040	0.365000	0.24400	0.260000	0.18958	GTG	.	.	.	none		0.721	ACOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414435.1	NM_006821	
KAT8	84148	hgsc.bcm.edu	37	16	31131564	31131564	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr16:31131564A>G	ENST00000543774.2	+	3	604	c.269A>G	c.(268-270)tAt>tGt	p.Y90C	RP11-196G11.4_ENST00000576336.1_RNA|KAT8_ENST00000448516.2_Missense_Mutation_p.Y90C|KAT8_ENST00000219797.4_Missense_Mutation_p.Y90C			Q9H7Z6	KAT8_HUMAN	K(lysine) acetyltransferase 8	90	Chromo.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|myeloid cell differentiation (GO:0030099)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	histone acetyltransferase complex (GO:0000123)|kinetochore (GO:0000776)|MLL1 complex (GO:0071339)|MSL complex (GO:0072487)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|transcription factor binding (GO:0008134)	p.Y90C(1)									GAGGAATTCTATGTACACTAC	0.542																																					p.Y90C		Atlas-SNP	.											MYST1,rectum,NS,+1,1	.	.	.	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.A269G						PASS	.						153.0	138.0	143.0					16																	31131564		2197	4300	6497	SO:0001583	missense	84148	exon2			AATTCTATGTACA	AF217501	CCDS10706.1, CCDS45468.1	16p11.1	2013-01-10	2011-07-21	2011-07-21	ENSG00000103510	ENSG00000103510	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17933	protein-coding gene	gene with protein product		609912	"""MYST histone acetyltransferase 1"""	MYST1		10786633	Standard	NM_032188		Approved	MOF, FLJ14040, hMOF, ZC2HC8	uc002eax.3	Q9H7Z6	OTTHUMG00000132410	ENST00000543774.2:c.269A>G	chr16.hg19:g.31131564A>G	ENSP00000456933:p.Tyr90Cys	145.0	0.0	.		118.0	51.0	.	NM_182958	A8K4Z1|G5E9P2|Q659G0|Q7LC17|Q8IY59|Q8WYB4|Q8WZ14|Q9HAC5|Q9NR35	Missense_Mutation	SNP	ENST00000543774.2	hg19	CCDS10706.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.321720	0.81580	.	.	ENSG00000103510	ENST00000219797;ENST00000448516	T;T	0.56103	0.48;0.48	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.79690	0.4489	M	0.93420	3.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.85166	0.0995	10	0.87932	D	0	-14.9295	15.1835	0.72978	1.0:0.0:0.0:0.0	.	90;90	Q9H7Z6;G5E9P2	KAT8_HUMAN;.	C	90	ENSP00000219797:Y90C;ENSP00000406037:Y90C	ENSP00000219797:Y90C	Y	+	2	0	KAT8	31039065	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.286000	0.89916	2.235000	0.73313	0.533000	0.62120	TAT	.	.	.	none		0.542	KAT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000255546.3	NM_032188	
LRRC36	55282	hgsc.bcm.edu	37	16	67384190	67384190	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr16:67384190A>G	ENST00000329956.6	+	5	593	c.574A>G	c.(574-576)Atg>Gtg	p.M192V	LRRC36_ENST00000290940.7_5'UTR|LRRC36_ENST00000541146.1_5'UTR|LRRC36_ENST00000563189.1_Missense_Mutation_p.M71V|LRRC36_ENST00000435835.3_Missense_Mutation_p.M71V|LRRC36_ENST00000563303.1_3'UTR	NM_018296.5	NP_060766.5	Q1X8D7	LRC36_HUMAN	leucine rich repeat containing 36	192										endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	24		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0669)|Epithelial(162;0.161)		CAGGATTGAAATGGGTAAGTT	0.383																																					p.M192V		Atlas-SNP	.											.	LRRC36	68	.	0			c.A574G						PASS	.						133.0	139.0	137.0					16																	67384190		2198	4300	6498	SO:0001583	missense	55282	exon5			ATTGAAATGGGTA	BC026156	CCDS32467.1, CCDS58474.1	16q22.1	2008-02-05				ENSG00000159708			25615	protein-coding gene	gene with protein product						12477932	Standard	NM_001161575		Approved	FLJ11004	uc002esv.3	Q1X8D7		ENST00000329956.6:c.574A>G	chr16.hg19:g.67384190A>G	ENSP00000329943:p.Met192Val	84.0	0.0	.		89.0	43.0	.	NM_018296	A4FTV6|A6NDE9|A8K8E6|Q7Z5K5	Missense_Mutation	SNP	ENST00000329956.6	hg19	CCDS32467.1	.	.	.	.	.	.	.	.	.	.	A	11.64	1.697963	0.30142	.	.	ENSG00000159708	ENST00000329956;ENST00000435835	T;T	0.28069	3.35;1.63	5.51	1.97	0.26223	.	0.820676	0.11062	N	0.603836	T	0.13200	0.0320	N	0.08118	0	0.80722	D	1	B;B;B	0.09022	0.0;0.002;0.002	B;B;B	0.09377	0.002;0.004;0.004	T	0.15235	-1.0444	10	0.22706	T	0.39	2.7672	3.6735	0.08283	0.6641:0.0:0.1759:0.16	.	71;71;192	B7Z7B3;Q1X8D7-2;Q1X8D7	.;.;LRC36_HUMAN	V	192;71	ENSP00000329943:M192V;ENSP00000411122:M71V	ENSP00000329943:M192V	M	+	1	0	LRRC36	65941691	0.991000	0.36638	0.670000	0.29842	0.711000	0.40976	0.260000	0.18424	0.053000	0.16036	-0.379000	0.06801	ATG	.	.	.	none		0.383	LRRC36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421770.1	NM_018296	
SPIRE2	84501	hgsc.bcm.edu	37	16	89920723	89920723	+	Silent	SNP	G	G	T	rs148030912		TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr16:89920723G>T	ENST00000378247.3	+	4	718	c.675G>T	c.(673-675)ccG>ccT	p.P225P	SPIRE2_ENST00000393062.2_Silent_p.P225P	NM_032451.1	NP_115827.1	Q8WWL2	SPIR2_HUMAN	spire-type actin nucleation factor 2	225					actin cytoskeleton organization (GO:0030036)|cleavage furrow formation (GO:0036089)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|intracellular transport (GO:0046907)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		AGGACGAGCCGCATCTGGAGA	0.657																																					p.P225P		Atlas-SNP	.											SPIRE2,caecum,carcinoma,0,1	SPIRE2	63	.	0			c.G675T						PASS	.						39.0	35.0	36.0					16																	89920723		2193	4286	6479	SO:0001819	synonymous_variant	84501	exon4			CGAGCCGCATCTG	AL834408	CCDS32516.1	16q24	2013-08-27	2013-08-27			ENSG00000204991			30623	protein-coding gene	gene with protein product		609217	"""spire homolog 2 (Drosophila)"", ""spire family actin nucleation factor 2"""			11347906	Standard	NM_032451		Approved	spir-2, KIAA1832	uc002foz.1	Q8WWL2		ENST00000378247.3:c.675G>T	chr16.hg19:g.89920723G>T		109.0	0.0	.		94.0	46.0	.	NM_032451	A4QPB1|Q2TA98|Q6P433|Q8ND47|Q96JJ5	Silent	SNP	ENST00000378247.3	hg19	CCDS32516.1																																																																																			.	G|1.000;A|0.000	.	alt		0.657	SPIRE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421843.1	XM_047462	
CLUH	23277	hgsc.bcm.edu	37	17	2594073	2594073	+	Splice_Site	SNP	T	T	C			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr17:2594073T>C	ENST00000570628.2	-	26	3852		c.e26-2		CLUH_ENST00000435359.1_Splice_Site|RP11-74E22.6_ENST00000608984.1_lincRNA|CLUH_ENST00000538975.1_Splice_Site			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog						intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											TCTTTTTGGCTGAGGATAAGG	0.622																																					.		Atlas-SNP	.											.	.	.	.	0			c.3747-2A>G						PASS	.						25.0	28.0	27.0					17																	2594073		1868	4098	5966	SO:0001630	splice_region_variant	23277	exon27			TTTGGCTGAGGAT	AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.3747-2A>G	chr17.hg19:g.2594073T>C		36.0	0.0	.		40.0	21.0	.	NM_015229	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Splice_Site	SNP	ENST00000570628.2	hg19	CCDS45572.1	.	.	.	.	.	.	.	.	.	.	T	13.58	2.278446	0.40294	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	.	.	.	4.54	4.54	0.55810	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0378	0.58881	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA0664	2540823	1.000000	0.71417	0.990000	0.47175	0.448000	0.32197	7.383000	0.79741	1.808000	0.52836	0.482000	0.46254	.	.	.	.	none		0.622	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437807.2	NM_015229	Intron
SYNRG	11276	hgsc.bcm.edu	37	17	35969394	35969394	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr17:35969394G>A	ENST00000339208.6	-	1	150	c.10C>T	c.(10-12)Cgg>Tgg	p.R4W	SYNRG_ENST00000394378.2_Missense_Mutation_p.R4W|SYNRG_ENST00000346661.4_Missense_Mutation_p.R4W|SYNRG_ENST00000585472.1_Missense_Mutation_p.R4W|SYNRG_ENST00000502449.2_Missense_Mutation_p.R4W|SYNRG_ENST00000591288.1_Missense_Mutation_p.R4W|SYNRG_ENST00000345615.4_Missense_Mutation_p.R4W|RP11-697E22.1_ENST00000591689.1_RNA	NM_001163544.1|NM_001163545.1|NM_007247.4	NP_001157016.1|NP_001157017.1|NP_009178.3	Q9UMZ2	SYNRG_HUMAN	synergin, gamma	4					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)	AP-1 adaptor complex (GO:0030121)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						GCTCCTGGCCGCAGCGCCATC	0.726																																					p.R4W		Atlas-SNP	.											.	SYNRG	101	.	0			c.C10T						PASS	.						3.0	3.0	3.0					17																	35969394		1737	3608	5345	SO:0001583	missense	11276	exon1			CTGGCCGCAGCGC	AF169548	CCDS11321.1, CCDS11322.1, CCDS11322.2, CCDS54113.1, CCDS54114.1, CCDS59284.1, CCDS59285.1	17q12	2014-04-16	2009-07-20	2009-07-20	ENSG00000006114	ENSG00000275066			557	protein-coding gene	gene with protein product	"""gamma-synergin"", ""adaptor-related protein complex 1 gamma subunit-binding protein 1"""	607291	"""AP1 gamma subunit binding protein 1"""	AP1GBP1		10477754	Standard	XM_005256980		Approved	SYNG, MGC104959	uc010wdf.2	Q9UMZ2	OTTHUMG00000188473	ENST00000339208.6:c.10C>T	chr17.hg19:g.35969394G>A	ENSP00000343610:p.Arg4Trp	27.0	0.0	.		42.0	26.0	.	NM_001163544	A8MWU4|B7ZKZ2|B7ZKZ3|Q17RI2|Q5BKU5|Q6ZT17	Missense_Mutation	SNP	ENST00000339208.6	hg19	CCDS11321.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.052424	0.75960	.	.	ENSG00000006114	ENST00000346661;ENST00000339208;ENST00000345615;ENST00000502449;ENST00000394378;ENST00000394379	T;T;T;T;T	0.59224	0.9;0.91;0.28;0.28;0.29	4.6	4.6	0.57074	.	.	.	.	.	T	0.69904	0.3163	L	0.50333	1.59	0.54753	D	0.999987	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.80764	0.994;0.994;0.994;0.994;0.994;0.994;0.994	T	0.73011	-0.4117	9	0.87932	D	0	.	14.2726	0.66159	0.0:0.0:1.0:0.0	.	4;4;4;4;4;4;4	A8MYE0;B7ZKZ2;Q9UMZ2-3;A8MWU4;Q9UMZ2-4;Q9UMZ2-5;Q9UMZ2	.;.;.;.;.;.;SYNRG_HUMAN	W	4	ENSP00000005279:R4W;ENSP00000343610:R4W;ENSP00000315722:R4W;ENSP00000424893:R4W;ENSP00000377903:R4W	ENSP00000343610:R4W	R	-	1	2	SYNRG	33043507	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	4.018000	0.57174	2.383000	0.81215	0.591000	0.81541	CGG	.	.	.	none		0.726	SYNRG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256811.2	NM_007247	
SPATA20	64847	hgsc.bcm.edu	37	17	48626272	48626272	+	Missense_Mutation	SNP	G	G	A	rs540627294		TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr17:48626272G>A	ENST00000356488.4	+	4	498	c.415G>A	c.(415-417)Gta>Ata	p.V139I	SPATA20_ENST00000006658.6_Missense_Mutation_p.V155I|SPATA20_ENST00000393244.3_Missense_Mutation_p.V95I|SPATA20_ENST00000511937.1_3'UTR	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	139					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			GAGTGTGAAGGTAGACCGTGA	0.587													G|||	1	0.000199681	0.0	0.0	5008	,	,		20328	0.0		0.0	False		,,,				2504	0.001				p.V155I		Atlas-SNP	.											.	SPATA20	59	.	0			c.G463A						PASS	.						178.0	132.0	148.0					17																	48626272		2203	4300	6503	SO:0001583	missense	64847	exon5			GTGAAGGTAGACC		CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.415G>A	chr17.hg19:g.48626272G>A	ENSP00000348878:p.Val139Ile	91.0	0.0	.		100.0	67.0	.	NM_022827	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Missense_Mutation	SNP	ENST00000356488.4	hg19	CCDS58563.1	.	.	.	.	.	.	.	.	.	.	G	18.82	3.705844	0.68615	.	.	ENSG00000006282	ENST00000006658;ENST00000356488;ENST00000393244	T;T;T	0.54479	0.57;0.57;0.57	4.72	3.75	0.43078	Thioredoxin-like fold (2);Domain of unknown function DUF255 (1);	0.222830	0.37136	N	0.002224	T	0.70911	0.3278	M	0.85373	2.75	0.44388	D	0.997296	D;P;P	0.56521	0.976;0.954;0.888	P;P;P	0.61070	0.883;0.878;0.806	T	0.75863	-0.3167	10	0.72032	D	0.01	-1.6906	12.653	0.56772	0.0809:0.0:0.9191:0.0	.	139;139;155	B4DZC5;Q8TB22;Q8TB22-2	.;SPT20_HUMAN;.	I	155;139;95	ENSP00000006658:V155I;ENSP00000348878:V139I;ENSP00000376935:V95I	ENSP00000006658:V155I	V	+	1	0	SPATA20	45981271	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	5.966000	0.70395	0.981000	0.38548	0.436000	0.28706	GTA	.	.	.	none		0.587	SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	NM_022827	
ADAMTS10	81794	hgsc.bcm.edu	37	19	8654145	8654145	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr19:8654145G>C	ENST00000597188.1	-	18	2409	c.2139C>G	c.(2137-2139)agC>agG	p.S713R	ADAMTS10_ENST00000270328.4_Missense_Mutation_p.S713R|ADAMTS10_ENST00000595838.1_Missense_Mutation_p.S200R	NM_030957.2	NP_112219.3	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 10	713	Spacer.					extracellular matrix (GO:0031012)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(16)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(3)|skin(10)|urinary_tract(1)	53						GTGAGGCTGGGCTGAAGACGC	0.662																																					p.S713R		Atlas-SNP	.											.	ADAMTS10	132	.	0			c.C2139G						PASS	.						54.0	46.0	48.0					19																	8654145		2203	4300	6503	SO:0001583	missense	81794	exon18			GGCTGGGCTGAAG	AF163762	CCDS12206.1, CCDS62529.1	19p13.2	2014-08-12	2005-08-19		ENSG00000142303	ENSG00000142303		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13201	protein-coding gene	gene with protein product		608990	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10"""				Standard	XM_005272499		Approved	ADAM-TS10	uc002mkj.1	Q9H324	OTTHUMG00000182216	ENST00000597188.1:c.2139C>G	chr19.hg19:g.8654145G>C	ENSP00000471851:p.Ser713Arg	95.0	0.0	.		51.0	21.0	.	NM_030957	M0QZE4	Missense_Mutation	SNP	ENST00000597188.1	hg19	CCDS12206.1	.	.	.	.	.	.	.	.	.	.	G	7.625	0.677679	0.14841	.	.	ENSG00000142303	ENST00000270328;ENST00000393912	T	0.51325	0.71	5.21	1.29	0.21616	ADAM-TS Spacer 1 (1);	0.242826	0.39083	N	0.001480	T	0.37652	0.1011	N	0.16743	0.435	0.29576	N	0.84954	B;B;P	0.41188	0.328;0.254;0.741	B;B;P	0.48141	0.063;0.219;0.568	T	0.36016	-0.9765	10	0.49607	T	0.09	.	10.3729	0.44064	0.274:0.0:0.726:0.0	.	467;713;200	Q59FE5;Q9H324;E9PCI6	.;ATS10_HUMAN;.	R	713;467	ENSP00000270328:S713R	ENSP00000270328:S713R	S	-	3	2	ADAMTS10	8560145	1.000000	0.71417	0.343000	0.25615	0.023000	0.10783	1.797000	0.38804	0.513000	0.28278	-0.345000	0.07892	AGC	.	.	.	none		0.662	ADAMTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460085.3	NM_030957	
UPF1	5976	hgsc.bcm.edu	37	19	18964067	18964067	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr19:18964067G>A	ENST00000599848.1	+	8	1306	c.1097G>A	c.(1096-1098)cGg>cAg	p.R366Q	UPF1_ENST00000262803.5_Missense_Mutation_p.R355Q			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	366	Sufficient for interaction with RENT2.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						CAAGACATGCGGCTCATGCAG	0.537																																					p.R355Q		Atlas-SNP	.											.	UPF1	88	.	0			c.G1064A						PASS	.						57.0	53.0	54.0					19																	18964067		2203	4300	6503	SO:0001583	missense	5976	exon8			ACATGCGGCTCAT	AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.1097G>A	chr19.hg19:g.18964067G>A	ENSP00000470142:p.Arg366Gln	96.0	0.0	.		93.0	48.0	.	NM_002911	O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	ENST00000599848.1	hg19		.	.	.	.	.	.	.	.	.	.	G	21.8	4.199893	0.79015	.	.	ENSG00000005007	ENST00000262803	D	0.90563	-2.69	4.69	3.65	0.41850	.	0.000000	0.85682	D	0.000000	D	0.88584	0.6476	M	0.75615	2.305	0.80722	D	1	P;P	0.51791	0.913;0.948	B;B	0.38880	0.148;0.284	D	0.88849	0.3318	10	0.87932	D	0	-29.4704	12.3484	0.55134	0.0834:0.0:0.9166:0.0	.	366;355	Q92900;Q92900-2	RENT1_HUMAN;.	Q	355	ENSP00000262803:R355Q	ENSP00000262803:R355Q	R	+	2	0	UPF1	18825067	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.374000	0.97172	1.113000	0.41760	0.609000	0.83330	CGG	.	.	.	none		0.537	UPF1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464684.1	NM_002911	
ZNF729	100287226	hgsc.bcm.edu	37	19	22499586	22499586	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr19:22499586A>G	ENST00000601693.1	+	4	3485	c.3367A>G	c.(3367-3369)Aag>Gag	p.K1123E	ZNF729_ENST00000357491.6_Missense_Mutation_p.K1095E			A6NN14	ZN729_HUMAN	zinc finger protein 729	1123					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						TACGAAACATAAGATAATTCA	0.368																																					p.K1123E		Atlas-SNP	.											.	ZNF729	78	.	0			c.A3367G						PASS	.																																			SO:0001583	missense	100287226	exon4			AAACATAAGATAA		CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.3367A>G	chr19.hg19:g.22499586A>G	ENSP00000469582:p.Lys1123Glu	30.0	0.0	.		27.0	8.0	.	NM_001242680	M0QY45	Missense_Mutation	SNP	ENST00000601693.1	hg19	CCDS59368.1	.	.	.	.	.	.	.	.	.	.	.	7.370	0.626539	0.14257	.	.	ENSG00000196350	ENST00000357491	T	0.50813	0.73	0.96	-1.92	0.07618	.	.	.	.	.	T	0.26448	0.0646	N	0.05554	-0.025	.	.	.	.	.	.	.	.	.	T	0.29243	-1.0018	6	0.66056	D	0.02	.	6.4825	0.22071	0.4742:0.5258:0.0:0.0	.	.	.	.	E	1095	ENSP00000350085:K1095E	ENSP00000350085:K1095E	K	+	1	0	ZNF729	22291426	0.000000	0.05858	0.058000	0.19502	0.055000	0.15305	-0.846000	0.04336	-0.841000	0.04200	-0.900000	0.02857	AAG	.	.	.	none		0.368	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464396.1	XM_496301	
EXOSC5	56915	hgsc.bcm.edu	37	19	41898792	41898792	+	Missense_Mutation	SNP	C	C	A	rs370634546		TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr19:41898792C>A	ENST00000221233.4	-	2	392	c.242G>T	c.(241-243)aGg>aTg	p.R81M	CTC-435M10.3_ENST00000604424.1_Intron|CTC-435M10.3_ENST00000540732.1_Intron|EXOSC5_ENST00000596905.1_Intron|BCKDHA_ENST00000595085.1_Intron	NM_020158.3	NP_064543.3	Q9NQT4	EXOS5_HUMAN	exosome component 5	81					defense response to virus (GO:0051607)|DNA deamination (GO:0045006)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|transcriptionally active chromatin (GO:0035327)	3'-5'-exoribonuclease activity (GO:0000175)|RNA binding (GO:0003723)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	7						AATCTTCGGCCTCAGGATCAC	0.592																																					p.R81M		Atlas-SNP	.											.	EXOSC5	18	.	0			c.G242T						PASS	.						92.0	67.0	75.0					19																	41898792		2203	4300	6503	SO:0001583	missense	56915	exon2			TTCGGCCTCAGGA	AF285785	CCDS12580.1	19q13.1	2008-02-05				ENSG00000077348			24662	protein-coding gene	gene with protein product	"""exosome component Rrp46"""	606492				11110791, 11812149	Standard	NM_020158		Approved	hRrp46p, Rrp46p, RRP46, RRP41B, MGC12901, p12B	uc002oqo.3	Q9NQT4		ENST00000221233.4:c.242G>T	chr19.hg19:g.41898792C>A	ENSP00000221233:p.Arg81Met	83.0	0.0	.		65.0	5.0	.	NM_020158	Q32Q81|Q8NG16|Q96I89	Missense_Mutation	SNP	ENST00000221233.4	hg19	CCDS12580.1	.	.	.	.	.	.	.	.	.	.	C	18.67	3.674170	0.67928	.	.	ENSG00000077348	ENST00000221233	T	0.64438	-0.1	4.95	3.87	0.44632	Ribosomal protein S5 domain 2-type fold (1);Exoribonuclease, phosphorolytic domain 1 (1);	0.115804	0.64402	D	0.000009	T	0.77980	0.4212	M	0.86953	2.85	0.54753	D	0.999988	D	0.65815	0.995	P	0.61722	0.893	T	0.81949	-0.0699	10	0.87932	D	0	-37.0339	12.3853	0.55328	0.0:0.9039:0.0:0.0961	.	81	Q9NQT4	EXOS5_HUMAN	M	81	ENSP00000221233:R81M	ENSP00000221233:R81M	R	-	2	0	EXOSC5	46590632	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.008000	0.40893	2.568000	0.86640	0.555000	0.69702	AGG	.	.	.	alt		0.592	EXOSC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463492.1	NM_020158	
NLRP13	126204	hgsc.bcm.edu	37	19	56423298	56423298	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr19:56423298C>T	ENST00000342929.3	-	5	1884	c.1885G>A	c.(1885-1887)Gcc>Acc	p.A629T	NLRP13_ENST00000588751.1_Missense_Mutation_p.A629T	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	629							ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		TGGAGAGAGGCACTTTCAGCC	0.418																																					p.A629T		Atlas-SNP	.											.	NLRP13	220	.	0			c.G1885A						PASS	.						101.0	94.0	96.0					19																	56423298		2203	4300	6503	SO:0001583	missense	126204	exon5			GAGAGGCACTTTC	AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.1885G>A	chr19.hg19:g.56423298C>T	ENSP00000343891:p.Ala629Thr	143.0	0.0	.		182.0	100.0	.	NM_176810	Q7RTR5	Missense_Mutation	SNP	ENST00000342929.3	hg19	CCDS33119.1	.	.	.	.	.	.	.	.	.	.	C	8.248	0.808302	0.16467	.	.	ENSG00000173572	ENST00000342929	D	0.88046	-2.33	2.37	2.37	0.29283	.	.	.	.	.	T	0.72179	0.3428	N	0.14661	0.345	0.09310	N	1	B	0.33739	0.422	B	0.30251	0.113	T	0.58853	-0.7563	9	0.14656	T	0.56	.	8.7605	0.34672	0.0:1.0:0.0:0.0	.	629	Q86W25	NAL13_HUMAN	T	629	ENSP00000343891:A629T	ENSP00000343891:A629T	A	-	1	0	NLRP13	61115110	0.000000	0.05858	0.001000	0.08648	0.085000	0.17905	-1.407000	0.02488	1.285000	0.44548	0.543000	0.68304	GCC	.	.	.	none		0.418	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1	NM_176810	
RIN2	54453	hgsc.bcm.edu	37	20	19956369	19956369	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr20:19956369A>G	ENST00000255006.6	+	8	1996	c.1847A>G	c.(1846-1848)tAt>tGt	p.Y616C	RIN2_ENST00000440354.2_Intron|RIN2_ENST00000484638.1_3'UTR	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	567					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						GTCAAGAACTATTTGTCTCAG	0.498																																					p.Y616C		Atlas-SNP	.											.	RIN2	126	.	0			c.A1847G						PASS	.						23.0	25.0	24.0					20																	19956369		2068	4208	6276	SO:0001583	missense	54453	exon8			AGAACTATTTGTC	AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.1847A>G	chr20.hg19:g.19956369A>G	ENSP00000255006:p.Tyr616Cys	197.0	0.0	.		172.0	79.0	.	NM_001242581	Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	ENST00000255006.6	hg19	CCDS56182.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.970260	0.74246	.	.	ENSG00000132669	ENST00000255006	T	0.30714	1.52	5.95	5.95	0.96441	.	0.057617	0.64402	N	0.000001	T	0.54679	0.1873	M	0.69463	2.115	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.53005	-0.8499	9	.	.	.	-9.6229	16.066	0.80870	1.0:0.0:0.0:0.0	.	567	Q8WYP3	RIN2_HUMAN	C	616	ENSP00000255006:Y616C	.	Y	+	2	0	RIN2	19904369	1.000000	0.71417	0.944000	0.38274	0.882000	0.50991	9.307000	0.96226	2.277000	0.76020	0.533000	0.62120	TAT	.	.	.	none		0.498	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078212.1		
PCK1	5105	hgsc.bcm.edu	37	20	56138684	56138684	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr20:56138684T>C	ENST00000319441.4	+	6	1026	c.862T>C	c.(862-864)Tgc>Cgc	p.C288R	PCK1_ENST00000535860.1_Missense_Mutation_p.C156R|PCK1_ENST00000543666.1_Intron	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	288					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			TCCCAGCGCCTGCGGGAAGAC	0.542																																					p.C288R		Atlas-SNP	.											.	PCK1	95	.	0			c.T862C						PASS	.						79.0	79.0	79.0					20																	56138684		2203	4300	6503	SO:0001583	missense	5105	exon6			AGCGCCTGCGGGA		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.862T>C	chr20.hg19:g.56138684T>C	ENSP00000319814:p.Cys288Arg	89.0	0.0	.		86.0	28.0	.	NM_002591	A8K437|B4DT64|Q8TCA3|Q9UJD2	Missense_Mutation	SNP	ENST00000319441.4	hg19	CCDS13460.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.450060	0.84101	.	.	ENSG00000124253	ENST00000319441;ENST00000535860	T;T	0.08546	3.08;3.08	5.27	5.27	0.74061	Phosphoenolpyruvate carboxykinase, C-terminal (1);Phosphoenolpyruvate carboxykinase, GTP-utilising, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.46795	0.1411	H	0.98542	4.26	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68853	-0.5299	10	0.87932	D	0	-25.1308	15.1956	0.73084	0.0:0.0:0.0:1.0	.	288	P35558	PCKGC_HUMAN	R	288;156	ENSP00000319814:C288R;ENSP00000444342:C156R	ENSP00000319814:C288R	C	+	1	0	PCK1	55572090	1.000000	0.71417	0.999000	0.59377	0.878000	0.50629	7.587000	0.82613	2.006000	0.58801	0.459000	0.35465	TGC	.	.	.	none		0.542	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2		
SON	6651	hgsc.bcm.edu	37	21	34927348	34927348	+	Silent	SNP	A	A	T			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr21:34927348A>T	ENST00000356577.4	+	3	6286	c.5811A>T	c.(5809-5811)cgA>cgT	p.R1937R	SON_ENST00000381692.2_Intron|SON_ENST00000300278.4_Silent_p.R1937R|SON_ENST00000290239.6_Silent_p.R1937R|SON_ENST00000381679.4_Silent_p.R1937R	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1937	2 X 19 AA repeats of P-S-R-R-R-R-S-R-S-V- V-R-R-R-S-F-S-I-S.|7 X 7 AA repeats of P-S-R-R-S-R-[TS].				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CAAGTCGTCGACGAAGGTCTA	0.577																																					p.R1937R		Atlas-SNP	.											.	SON	343	.	0			c.A5811T						PASS	.						30.0	30.0	30.0					21																	34927348		2184	4275	6459	SO:0001819	synonymous_variant	6651	exon3			TCGTCGACGAAGG	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.5811A>T	chr21.hg19:g.34927348A>T		44.0	0.0	.		55.0	27.0	.	NM_032195	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Silent	SNP	ENST00000356577.4	hg19	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	A	4.663	0.123277	0.08931	.	.	ENSG00000159140	ENST00000436227	.	.	.	5.53	-3.72	0.04411	.	.	.	.	.	T	0.42877	0.1222	.	.	.	0.25553	N	0.987064	.	.	.	.	.	.	T	0.43940	-0.9360	4	.	.	.	.	14.7121	0.69241	0.4215:0.0:0.5785:0.0	.	.	.	.	V	932	.	.	D	+	2	0	SON	33849218	0.000000	0.05858	0.201000	0.23476	0.946000	0.59487	-0.249000	0.08842	-0.726000	0.04895	-0.256000	0.11100	GAC	.	.	.	none		0.577	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
MORC3	23515	hgsc.bcm.edu	37	21	37747537	37747537	+	Silent	SNP	A	A	G			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr21:37747537A>G	ENST00000400485.1	+	17	2839	c.2763A>G	c.(2761-2763)gtA>gtG	p.V921V	MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	921					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						ATGTTGATGTAGTTGATGAGA	0.363																																					p.V921V		Atlas-SNP	.											.	MORC3	78	.	0			c.A2763G						PASS	.						163.0	151.0	155.0					21																	37747537		1916	4124	6040	SO:0001819	synonymous_variant	23515	exon17			TGATGTAGTTGAT	AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.2763A>G	chr21.hg19:g.37747537A>G		52.0	0.0	.		73.0	35.0	.	NM_015358	A8KA92|Q9UEZ2	Silent	SNP	ENST00000400485.1	hg19	CCDS42924.1																																																																																			.	.	.	none		0.363	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1	NM_015358	
C21orf2	755	hgsc.bcm.edu	37	21	45751780	45751780	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr21:45751780A>G	ENST00000339818.4	-	5	698	c.491T>C	c.(490-492)cTc>cCc	p.L164P	C21orf2_ENST00000397956.3_Missense_Mutation_p.L164P|C21orf2_ENST00000496321.1_5'UTR|AP001062.7_ENST00000448927.1_RNA|C21orf2_ENST00000325223.7_Missense_Mutation_p.L164P|AP001062.8_ENST00000422357.1_RNA	NM_001271440.1|NM_004928.2	NP_001258369.1|NP_004919.1	O43822	CU002_HUMAN	chromosome 21 open reading frame 2	164					cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				endometrium(2)	2				Colorectal(79;0.0806)		AGCGGAGCTGAGGGAGCTCAG	0.687																																					p.L164P		Atlas-SNP	.											.	C21orf2	10	.	0			c.T491C						PASS	.						50.0	42.0	45.0					21																	45751780		2202	4300	6502	SO:0001583	missense	755	exon5			GAGCTGAGGGAGC	Y11392	CCDS13709.1, CCDS59444.1, CCDS59445.1	21q22.3	2014-03-24			ENSG00000160226	ENSG00000160226			1260	protein-coding gene	gene with protein product	"""nuclear encoded mitochondrial protein"", ""leucine rich repeat containing 76"""	603191				9465297	Standard	NM_004928		Approved	YF5, A2, LRRC76	uc002zeq.2	O43822	OTTHUMG00000086909	ENST00000339818.4:c.491T>C	chr21.hg19:g.45751780A>G	ENSP00000344566:p.Leu164Pro	57.0	0.0	.		55.0	22.0	.	NM_004928	A8MPS9|O14993|Q8N5X6|Q99837|Q99838	Missense_Mutation	SNP	ENST00000339818.4	hg19	CCDS13709.1	.	.	.	.	.	.	.	.	.	.	A	12.36	1.915165	0.33815	.	.	ENSG00000160226	ENST00000339818;ENST00000380160;ENST00000397956;ENST00000325223	T;T;T	0.36520	1.64;1.25;1.59	4.72	-0.634	0.11516	.	1.444430	0.03680	N	0.245363	T	0.25938	0.0632	N	0.22421	0.69	0.09310	N	1	P;D;P;P	0.56035	0.744;0.974;0.627;0.744	B;P;B;B	0.46208	0.341;0.507;0.184;0.341	T	0.11717	-1.0576	10	0.27082	T	0.32	-4.2235	2.5485	0.04742	0.4003:0.0:0.2579:0.3418	.	164;164;164;123	G5E952;Q8N5X6;O43822;O43822-2	.;.;CU002_HUMAN;.	P	164;200;164;164	ENSP00000344566:L164P;ENSP00000381047:L164P;ENSP00000317302:L164P	ENSP00000317302:L164P	L	-	2	0	C21orf2	44576208	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	0.486000	0.22340	-0.044000	0.13491	0.533000	0.62120	CTC	.	.	.	none		0.687	C21orf2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195799.1	NM_004928	
CELSR3	1951	hgsc.bcm.edu	37	3	48698992	48699004	+	Frame_Shift_Del	DEL	CGCCCGGCCTCGC	CGCCCGGCCTCGC	-			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	CGCCCGGCCTCGC	CGCCCGGCCTCGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr3:48698992_48699004delCGCCCGGCCTCGC	ENST00000164024.4	-	1	1344_1356	c.1064_1076delGCGAGGCCGGGCG	c.(1063-1077)ggcgaggccgggcgcfs	p.GEAGR355fs	RP11-148G20.1_ENST00000421275.1_RNA|CELSR3_ENST00000544264.1_Frame_Shift_Del_p.GEAGR355fs	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	355	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GTAGACTAGGCGCCCGGCCTCGCCGGCGTCCGG	0.667																																					p.355_359del		Atlas-INDEL	.											.	CELSR3	237	.	0			c.1065_1077del						PASS	.																																			SO:0001589	frameshift_variant	1951	exon1			.	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.1064_1076delGCGAGGCCGGGCG	chr3.hg19:g.48698992_48699004delCGCCCGGCCTCGC	ENSP00000164024:p.Gly355fs	65.0	0.0	0		45.0	19.0	0.422222	NM_001407	O75092	Frame_Shift_Del	DEL	ENST00000164024.4	hg19	CCDS2775.1																																																																																			.	.	.	none		0.667	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
RNF19A	25897	hgsc.bcm.edu	37	8	101299802	101299803	+	Frame_Shift_Ins	INS	-	-	T			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr8:101299802_101299803insT	ENST00000519449.1	-	3	916_917	c.600_601insA	c.(598-603)aaatacfs	p.Y201fs	RNF19A_ENST00000341084.2_Frame_Shift_Ins_p.Y201fs	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	Q9NV58	RN19A_HUMAN	ring finger protein 19A, RBR E3 ubiquitin protein ligase	201					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	30	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			AATTCTTCGTATTTTTCCATCA	0.386																																					p.Y201fs		Atlas-Indel,Pindel	.											.	RNF19A	67	.	0			c.601_602insA						PASS	.																																			SO:0001589	frameshift_variant	25897	exon2			.	AB029316	CCDS6286.1	8q22	2013-10-03	2013-10-03	2007-08-20		ENSG00000034677		"""RING-type (C3HC4) zinc fingers"""	13432	protein-coding gene	gene with protein product		607119	"""ring finger protein 19"", ""ring finger protein 19A"", ""ring finger protein 19A, E3 ubiquitin protein ligase"""	RNF19		11237715, 10976766	Standard	NM_183419		Approved	dorfin, DKFZp566B1346	uc003yjj.1	Q9NV58		ENST00000519449.1:c.601dupA	chr8.hg19:g.101299807_101299807dupT	ENSP00000428968:p.Tyr201fs	77.0	0.0	0		95.0	39.0	0.410526	NM_183419	A3KCU9|Q52LG1|Q9H5H9|Q9H8M8|Q9UFG0|Q9UFX6|Q9Y4Y1	Frame_Shift_Ins	INS	ENST00000519449.1	hg19	CCDS6286.1																																																																																			.	.	.	none		0.386	RNF19A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380004.1	NM_015435	
MLLT4	4301	hgsc.bcm.edu	37	6	168226643	168226643	+	5'Flank	DEL	C	C	-			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr6:168226643delC	ENST00000447894.2	+	0	0				MLLT4_ENST00000392108.3_5'Flank|MLLT4-AS1_ENST00000359760.5_RNA|MLLT4_ENST00000366806.2_5'Flank|MLLT4_ENST00000351017.4_5'Flank|MLLT4_ENST00000392112.1_5'Flank|MLLT4_ENST00000400822.3_5'Flank|MLLT4_ENST00000344191.4_5'Flank			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4						adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		GAACCTAGCACCGCCCGTCCG	0.701			T	MLL	AL																																.		Atlas-Indel,Pindel	.		Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	.	.	.	.	0			.						PASS	.						78.0	101.0	94.0					6																	168226643		1984	4123	6107	SO:0001631	upstream_gene_variant	653483	.			.	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031		chr6.hg19:g.168226643delC	Exception_encountered	130.0	0.0	0		98.0	43.0	0.438776	.	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	RNA	DEL	ENST00000447894.2	hg19																																																																																				.	.	.	none		0.701	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	NM_005936	
BPHL	670	hgsc.bcm.edu	37	6	3119054	3119059	+	In_Frame_Del	DEL	CACGGG	CACGGG	-			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	CACGGG	CACGGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr6:3119054_3119059delCACGGG	ENST00000380379.5	+	1	129_134	c.80_85delCACGGG	c.(79-87)ccacgggcc>ccc	p.RA28del	BPHL_ENST00000380368.2_5'UTR|BPHL_ENST00000380375.3_5'UTR|BPHL_ENST00000434640.1_Intron	NM_004332.2	NP_004323.2	Q86WA6	BPHL_HUMAN	biphenyl hydrolase-like (serine hydrolase)	28					cellular amino acid metabolic process (GO:0006520)|response to toxic substance (GO:0009636)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			endometrium(4)|kidney(1)|large_intestine(2)|lung(6)	13	Ovarian(93;0.0386)	all_hematologic(90;0.108)				ATCCACGTCCCACGGGCCGGACCCGC	0.752																																					p.27_28del		Atlas-Indel,Pindel	.											.	BPHL	32	.	0			c.79_84del						PASS	.																																			SO:0001651	inframe_deletion	670	exon1			.	X81372	CCDS4483.2	6p25	2008-08-29	2008-08-29		ENSG00000137274	ENSG00000137274			1094	protein-coding gene	gene with protein product	"""breast epithelial mucin-associated antigen"""	603156		MCNAA		7759552, 9721218, 15832508	Standard	NM_004332		Approved	Bph-rp	uc003mva.3	Q86WA6	OTTHUMG00000014140	ENST00000380379.5:c.80_85delCACGGG	chr6.hg19:g.3119054_3119059delCACGGG	ENSP00000369739:p.Arg28_Ala29del	59.0	0.0	0		46.0	15.0	0.326087	NM_004332	Q00306|Q13855|Q3KP51	In_Frame_Del	DEL	ENST00000380379.5	hg19	CCDS4483.2																																																																																			.	.	.	none		0.752	BPHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039670.5		
PBRM1	55193	hgsc.bcm.edu	37	3	52661338	52661338	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr3:52661338delT	ENST00000296302.7	-	13	1493	c.1492delA	c.(1492-1494)agcfs	p.S498fs	PBRM1_ENST00000409767.1_Frame_Shift_Del_p.S498fs|PBRM1_ENST00000410007.1_Frame_Shift_Del_p.S498fs|PBRM1_ENST00000337303.4_Frame_Shift_Del_p.S498fs|PBRM1_ENST00000356770.4_Frame_Shift_Del_p.S466fs|PBRM1_ENST00000409057.1_Frame_Shift_Del_p.S498fs|PBRM1_ENST00000409114.3_Frame_Shift_Del_p.S498fs|PBRM1_ENST00000394830.3_Frame_Shift_Del_p.S498fs			Q86U86	PB1_HUMAN	polybromo 1	498					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GAGATCATGCTGTCTCCGTCC	0.448			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.S498fs		Atlas-Indel,Pindel	.		Rec	yes		3	3p21	55193	polybromo 1		E	.	PBRM1	1252	.	0			c.1493delG						PASS	.						150.0	133.0	139.0					3																	52661338		2203	4300	6503	SO:0001589	frameshift_variant	55193	exon14			.	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1492delA	chr3.hg19:g.52661338delT	ENSP00000296302:p.Ser498fs	39.0	0.0	0		32.0	16.0	0.5	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Del	DEL	ENST00000296302.7	hg19																																																																																				.	.	.	none		0.448	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
ESRRG	2104	hgsc.bcm.edu	37	1	216850790	216850798	+	In_Frame_Del	DEL	TGGAATCAA	TGGAATCAA	-			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	TGGAATCAA	TGGAATCAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr1:216850790_216850798delTGGAATCAA	ENST00000408911.3	-	2	245_253	c.92_100delTTGATTCCA	c.(91-102)attgattccagc>agc	p.IDS31del	ESRRG_ENST00000391890.3_In_Frame_Del_p.IDS8del|ESRRG_ENST00000361395.2_In_Frame_Del_p.IDS8del|ESRRG_ENST00000493748.1_In_Frame_Del_p.IDS8del|ESRRG_ENST00000360012.3_In_Frame_Del_p.IDS8del|ESRRG_ENST00000366938.2_In_Frame_Del_p.IDS8del|ESRRG_ENST00000487276.1_In_Frame_Del_p.IDS8del|ESRRG_ENST00000366937.1_In_Frame_Del_p.IDS36del|ESRRG_ENST00000359162.2_In_Frame_Del_p.IDS8del|ESRRG_ENST00000361525.3_In_Frame_Del_p.IDS8del|ESRRG_ENST00000366940.2_In_Frame_Del_p.IDS8del|ESRRG_ENST00000493603.1_In_Frame_Del_p.IDS8del|ESRRG_ENST00000463665.1_In_Frame_Del_p.IDS8del	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	31					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	GACGAACAGCTGGAATCAATGTGTCGATC	0.522																																					p.36_39del		Atlas-Indel,Pindel	.											.	ESRRG	111	.	0			c.108_116del						PASS	.																																			SO:0001651	inframe_deletion	2104	exon3			.	AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.92_100delTTGATTCCA	chr1.hg19:g.216850790_216850798delTGGAATCAA	ENSP00000386171:p.Ile31_Ser33del	44.0	0.0	0		53.0	17.0	0.320755	NM_001243518	A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	In_Frame_Del	DEL	ENST00000408911.3	hg19	CCDS41468.1																																																																																			.	.	.	none		0.522	ESRRG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089882.2	NM_206595	
CELSR3	1951	hgsc.bcm.edu	37	3	48698992	48699005	+	Frame_Shift_Del	DEL	CGCCCGGCCTCGCC	CGCCCGGCCTCGCC	-			TCGA-UZ-A9PJ-01A-11D-A382-10	TCGA-UZ-A9PJ-10A-01D-A385-10	CGCCCGGCCTCGCC	CGCCCGGCCTCGCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	beb8581d-8471-4411-9521-4bf057f7d14a	b67bfe0e-ad19-4c1c-a9f3-cee65c1fee86	g.chr3:48698992_48699005delCGCCCGGCCTCGCC	ENST00000164024.4	-	1	1343_1356	c.1063_1076delGGCGAGGCCGGGCG	c.(1063-1077)ggcgaggccgggcgcfs	p.GEAGR355fs	RP11-148G20.1_ENST00000421275.1_RNA|CELSR3_ENST00000544264.1_Frame_Shift_Del_p.GEAGR355fs	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	355	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GTAGACTAGGCGCCCGGCCTCGCCGGCGTCCGGG	0.668																																					p.355_359del		Pindel	.											.	CELSR3	237	.	0			c.1064_1077del						PASS	.																																			SO:0001589	frameshift_variant	1951	exon1			.	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.1063_1076delGGCGAGGCCGGGCG	chr3.hg19:g.48698992_48699005delCGCCCGGCCTCGCC	ENSP00000164024:p.Gly355fs	66.0	0.0	.		50.0	19.0	0.380	NM_001407	O75092	Frame_Shift_Del	DEL	ENST00000164024.4	hg19	CCDS2775.1																																																																																			.	.	.	none		0.668	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
