#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FPGT-TNNI3K	100526835	hgsc.bcm.edu	37	1	74905231	74905231	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr1:74905231G>A	ENST00000370899.3	+	22	2276	c.2239G>A	c.(2239-2241)Gca>Aca	p.A747T	TNNI3K_ENST00000326637.3_Missense_Mutation_p.A646T|TNNI3K_ENST00000370891.2_Missense_Mutation_p.A747T|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.A760T	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough																		CACCATCAAAGCAGATGTCTT	0.473																																					p.A747T		Atlas-SNP	.											.	.	.	.	0			c.G2239A						PASS	.						161.0	134.0	143.0					1																	74905231		2203	4300	6503	SO:0001583	missense	100526835	exon22			ATCAAAGCAGATG			1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.2239G>A	chr1.hg19:g.74905231G>A	ENSP00000359936:p.Ala747Thr	92.0	0.0	.		95.0	36.0	.	NM_001199327		Missense_Mutation	SNP	ENST00000370899.3	hg19		.	.	.	.	.	.	.	.	.	.	G	29.3	4.992671	0.93167	.	.	ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000370899;ENST00000557284;ENST00000370891;ENST00000326637	D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66	5.96	5.96	0.96718	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87565	0.6209	L	0.46157	1.445	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.997	D;D;D	0.69824	0.966;0.942;0.942	D	0.87440	0.2394	10	0.72032	D	0.01	.	20.4144	0.99026	0.0:0.0:1.0:0.0	.	646;747;747	Q59H18;Q59H18-1;Q59H18-4	TNI3K_HUMAN;.;.	T	747;747;747;646	ENSP00000359936:A747T;ENSP00000450895:A747T;ENSP00000359928:A747T;ENSP00000322251:A646T	ENSP00000322251:A646T	A	+	1	0	RP11-653A5.2;AC093158.1	74677819	1.000000	0.71417	0.996000	0.52242	0.484000	0.33280	7.443000	0.80521	2.833000	0.97629	0.555000	0.69702	GCA	.	.	.	none		0.473	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000026438.3		
HIST2H2BE	8349	hgsc.bcm.edu	37	1	149858172	149858172	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr1:149858172A>T	ENST00000369155.2	-	1	60	c.19T>A	c.(19-21)Tcc>Acc	p.S7T	BOLA1_ENST00000369153.2_5'Flank|HIST2H2AC_ENST00000331380.2_5'Flank	NM_003528.2	NP_003519.1	Q16778	H2B2E_HUMAN	histone cluster 2, H2be	7					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	14	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			GCCGGAGCGGATTTTGCCGGT	0.512																																					p.S7T		Atlas-SNP	.											.	HIST2H2BE	33	.	0			c.T19A						PASS	.						62.0	63.0	63.0					1																	149858172		2203	4300	6503	SO:0001583	missense	8349	exon1			GAGCGGATTTTGC	AY131979	CCDS936.1	1q21.2	2011-01-27	2006-10-11	2003-03-07	ENSG00000184678	ENSG00000184678		"""Histones / Replication-dependent"""	4760	protein-coding gene	gene with protein product		601831	"""H2B histone family, member Q"", ""histone 2, H2be"""	H2B, H2BFQ		1469070, 12408966	Standard	NM_003528		Approved	H2B/q, H2B.1	uc001etc.3	Q16778	OTTHUMG00000012095	ENST00000369155.2:c.19T>A	chr1.hg19:g.149858172A>T	ENSP00000358151:p.Ser7Thr	159.0	0.0	.		154.0	58.0	.	NM_003528	A3KMC7|A8K110|Q4KMY1|Q5QNX0|Q9UE88	Missense_Mutation	SNP	ENST00000369155.2	hg19	CCDS936.1	.	.	.	.	.	.	.	.	.	.	A	15.64	2.893516	0.52121	.	.	ENSG00000184678	ENST00000369155	T	0.17691	2.26	5.99	5.99	0.97316	Histone-fold (2);	0.000000	0.85682	D	0.000000	T	0.11793	0.0287	M	0.69823	2.125	0.26659	N	0.971944	B	0.02656	0.0	B	0.01281	0.0	T	0.04115	-1.0976	10	0.56958	D	0.05	.	15.377	0.74615	1.0:0.0:0.0:0.0	.	7	Q16778	H2B2E_HUMAN	T	7	ENSP00000358151:S7T	ENSP00000358151:S7T	S	-	1	0	HIST2H2BE	148124796	0.951000	0.32395	0.984000	0.44739	0.961000	0.63080	3.076000	0.50081	2.305000	0.77605	0.529000	0.55759	TCC	.	.	.	none		0.512	HIST2H2BE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033455.1	NM_003528	
ECM1	1893	hgsc.bcm.edu	37	1	150482014	150482014	+	Silent	SNP	G	G	T	rs200429908		TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr1:150482014G>T	ENST00000369047.4	+	2	203	c.78G>T	c.(76-78)acG>acT	p.T26T	ECM1_ENST00000369049.4_Silent_p.T26T|ECM1_ENST00000346569.6_Silent_p.T26T|ECM1_ENST00000470432.1_3'UTR	NM_004425.3	NP_004416.2	Q16610	ECM1_HUMAN	extracellular matrix protein 1	26					angiogenesis (GO:0001525)|biomineral tissue development (GO:0031214)|inflammatory response (GO:0006954)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of peptidase activity (GO:0010466)|ossification (GO:0001503)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of T cell migration (GO:2000404)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type 2 immune response (GO:0002828)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	enzyme binding (GO:0019899)|laminin binding (GO:0043236)|protease binding (GO:0002020)|protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|urinary_tract(1)	22	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CAGGCTTCACGGCTACAGGAC	0.597																																					p.T26T	Melanoma(156;1696 2560 11093 19685)	Atlas-SNP	.											.	ECM1	96	.	0			c.G78T						PASS	.						73.0	70.0	71.0					1																	150482014		2203	4300	6503	SO:0001819	synonymous_variant	1893	exon2			CTTCACGGCTACA	U68186	CCDS953.1, CCDS954.1, CCDS55632.1	1q21	2008-02-05			ENSG00000143369	ENSG00000143369			3153	protein-coding gene	gene with protein product		602201				9367673, 9501329	Standard	NM_004425		Approved		uc001eus.3	Q16610	OTTHUMG00000012806	ENST00000369047.4:c.78G>T	chr1.hg19:g.150482014G>T		83.0	0.0	.		97.0	36.0	.	NM_022664	A8K8S0|B4DW49|B4DY60|O43266|Q5T5G4|Q5T5G5|Q5T5G6|Q8IZ60	Silent	SNP	ENST00000369047.4	hg19	CCDS953.1																																																																																			.	G|0.999;A|0.001	.	alt		0.597	ECM1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035832.2	NM_004425	
EFNA1	1942	hgsc.bcm.edu	37	1	155104053	155104053	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr1:155104053T>C	ENST00000368407.3	+	2	849	c.331T>C	c.(331-333)Ttc>Ctc	p.F111L	EFNA1_ENST00000469878.1_3'UTR|EFNA1_ENST00000368406.2_Missense_Mutation_p.F111L	NM_004428.2	NP_004419.2	P20827	EFNA1_HUMAN	ephrin-A1	111	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|ephrin receptor signaling pathway (GO:0048013)|mitral valve morphogenesis (GO:0003183)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|notochord formation (GO:0014028)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of angiogenesis (GO:0045765)|regulation of axonogenesis (GO:0050770)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|substrate adhesion-dependent cell spreading (GO:0034446)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ephrin receptor binding (GO:0046875)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|kidney(1)|lung(1)|skin(1)	5	all_epithelial(22;4.71e-30)|all_lung(78;3.15e-27)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;2.28e-10)|all cancers(21;6.16e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000395)|LUSC - Lung squamous cell carcinoma(543;0.193)			GTTCCAGCGCTTCACACCTTT	0.567																																					p.F111L		Atlas-SNP	.											.	EFNA1	10	.	0			c.T331C						PASS	.						53.0	47.0	49.0					1																	155104053		2203	4300	6503	SO:0001583	missense	1942	exon2			CAGCGCTTCACAC		CCDS1091.1, CCDS1092.1	1q21-q22	2011-03-09			ENSG00000169242	ENSG00000169242		"""Ephrins"""	3221	protein-coding gene	gene with protein product		191164		TNFAIP4, EPLG1		2233719, 8660976	Standard	NM_182685		Approved	LERK1, ECKLG	uc001fhh.3	P20827	OTTHUMG00000035312	ENST00000368407.3:c.331T>C	chr1.hg19:g.155104053T>C	ENSP00000357392:p.Phe111Leu	253.0	0.0	.		249.0	84.0	.	NM_182685	D3DV86|Q5SR60|Q5SR61|Q6I9T9|Q8N578	Missense_Mutation	SNP	ENST00000368407.3	hg19	CCDS1091.1	.	.	.	.	.	.	.	.	.	.	T	33	5.231564	0.95207	.	.	ENSG00000169242	ENST00000368407;ENST00000368406	D;D	0.94280	-3.39;-3.39	5.22	5.22	0.72569	Ephrin, conserved site (1);Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.96009	0.8700	M	0.83012	2.62	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96161	0.9115	10	0.54805	T	0.06	-1.3233	13.3345	0.60509	0.0:0.0:0.0:1.0	.	111;111	P20827-2;P20827	.;EFNA1_HUMAN	L	111	ENSP00000357392:F111L;ENSP00000357391:F111L	ENSP00000357391:F111L	F	+	1	0	EFNA1	153370677	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.616000	0.83018	2.097000	0.63578	0.533000	0.62120	TTC	.	.	.	none		0.567	EFNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085428.1	NM_004428	
GMCL1	64395	hgsc.bcm.edu	37	2	70074701	70074701	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr2:70074701G>A	ENST00000282570.3	+	7	1036	c.785G>A	c.(784-786)gGt>gAt	p.G262D		NM_178439.3	NP_848526.1	Q96IK5	GMCL1_HUMAN	germ cell-less, spermatogenesis associated 1	262					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)	nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)				endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	15						CAGCTCATTGGTTCATCTAAC	0.358																																					p.G262D		Atlas-SNP	.											.	GMCL1	50	.	0			c.G785A						PASS	.						172.0	183.0	179.0					2																	70074701		2203	4299	6502	SO:0001583	missense	64395	exon7			TCATTGGTTCATC	AK023119	CCDS1895.1	2p13.3	2013-01-09	2012-08-20		ENSG00000087338	ENSG00000087338		"""BTB/POZ domain containing"""	23843	protein-coding gene	gene with protein product	"""spermatogenesis associated 29"""		"""germ cell-less homolog 1 (Drosophila)"""				Standard	NM_178439		Approved	FLJ13057, BTBD13, GCL1, SPATA29	uc002sfu.3	Q96IK5	OTTHUMG00000129643	ENST00000282570.3:c.785G>A	chr2.hg19:g.70074701G>A	ENSP00000282570:p.Gly262Asp	88.0	0.0	.		98.0	50.0	.	NM_178439	Q9H826|Q9H8V7|Q9H927	Missense_Mutation	SNP	ENST00000282570.3	hg19	CCDS1895.1	.	.	.	.	.	.	.	.	.	.	G	8.869	0.948779	0.18356	.	.	ENSG00000087338	ENST00000282570	T	0.68331	-0.32	4.84	4.84	0.62591	BTB/Kelch-associated (2);	0.416817	0.27936	N	0.017242	T	0.47563	0.1452	N	0.14661	0.345	0.31480	N	0.667243	B	0.06786	0.001	B	0.12837	0.008	T	0.49234	-0.8961	10	0.29301	T	0.29	-2.464	11.2063	0.48771	0.0:0.1853:0.8147:0.0	.	262	Q96IK5	GMCL1_HUMAN	D	262	ENSP00000282570:G262D	ENSP00000282570:G262D	G	+	2	0	GMCL1	69928205	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.322000	0.59215	2.509000	0.84616	0.650000	0.86243	GGT	.	.	.	none		0.358	GMCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251841.2	NM_178439	
PTCD3	55037	hgsc.bcm.edu	37	2	86352186	86352186	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr2:86352186T>C	ENST00000254630.7	+	10	851	c.785T>C	c.(784-786)aTg>aCg	p.M262T	PTCD3_ENST00000409277.3_3'UTR	NM_017952.5	NP_060422.4	Q96EY7	PTCD3_HUMAN	pentatricopeptide repeat domain 3	262					mitochondrial translation (GO:0032543)|regulation of translation (GO:0006417)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|rRNA binding (GO:0019843)			NS(1)|breast(2)|endometrium(3)|kidney(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)	22						TATTGCACAATGATCCGAGGA	0.388																																					p.M262T		Atlas-SNP	.											.	PTCD3	51	.	0			c.T785C						PASS	.						94.0	89.0	91.0					2																	86352186		2203	4300	6503	SO:0001583	missense	55037	exon10			GCACAATGATCCG		CCDS33235.1	2p11.2	2014-02-12	2012-02-24		ENSG00000132300	ENSG00000132300			24717	protein-coding gene	gene with protein product		614918				8889548	Standard	NM_017952		Approved	FLJ20758, DKFZp666K071	uc002sqw.2	Q96EY7	OTTHUMG00000153168	ENST00000254630.7:c.785T>C	chr2.hg19:g.86352186T>C	ENSP00000254630:p.Met262Thr	88.0	0.0	.		109.0	36.0	.	NM_017952	A6NHD2|D6W5M1|Q597H0|Q658Y9|Q9BUZ8|Q9NWL0	Missense_Mutation	SNP	ENST00000254630.7	hg19	CCDS33235.1	.	.	.	.	.	.	.	.	.	.	T	19.09	3.758936	0.69763	.	.	ENSG00000132300	ENST00000254630	T	0.27104	1.69	5.63	5.63	0.86233	.	0.189515	0.56097	D	0.000027	T	0.53449	0.1797	M	0.92459	3.31	0.80722	D	1	P	0.45634	0.863	P	0.52514	0.701	T	0.65269	-0.6209	10	0.87932	D	0	-13.1111	14.8254	0.70107	0.0:0.0:0.0:1.0	.	262	Q96EY7	PTCD3_HUMAN	T	262	ENSP00000254630:M262T	ENSP00000254630:M262T	M	+	2	0	PTCD3	86205697	1.000000	0.71417	0.962000	0.40283	0.976000	0.68499	6.686000	0.74548	2.145000	0.66743	0.533000	0.62120	ATG	.	.	.	none		0.388	PTCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329854.1	NM_017952	
MPP4	58538	hgsc.bcm.edu	37	2	202514863	202514863	+	Nonsense_Mutation	SNP	G	G	T	rs376163949		TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr2:202514863G>T	ENST00000409474.3	-	19	1614	c.1407C>A	c.(1405-1407)taC>taA	p.Y469*	MPP4_ENST00000428900.2_Nonsense_Mutation_p.Y445*|MPP4_ENST00000315506.7_Nonsense_Mutation_p.Y425*|MPP4_ENST00000447335.2_Nonsense_Mutation_p.Y462*|MPP4_ENST00000396886.3_Nonsense_Mutation_p.Y394*|MPP4_ENST00000409143.1_Nonsense_Mutation_p.Y411*|MPP4_ENST00000359962.5_Nonsense_Mutation_p.Y469*	NM_033066.2	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)	469	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				protein localization to synapse (GO:0035418)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)		p.Y469Y(1)		kidney(1)|lung(11)	12						CATTCATTTCGTAACTCTTTT	0.353																																					p.Y469X		Atlas-SNP	.											MPP4_ENST00000409474,NS,carcinoma,0,1	MPP4	93	.	1	Substitution - coding silent(1)	breast(1)	c.C1407A						PASS	.						104.0	90.0	95.0					2																	202514863		1844	4088	5932	SO:0001587	stop_gained	58538	exon19			CATTTCGTAACTC	AF316032	CCDS46491.1	2q33.2	2008-05-15			ENSG00000082126	ENSG00000082126			13680	protein-coding gene	gene with protein product		606575		DLG6		11414766	Standard	NM_033066		Approved		uc002uyk.4	Q96JB8	OTTHUMG00000154525	ENST00000409474.3:c.1407C>A	chr2.hg19:g.202514863G>T	ENSP00000387278:p.Tyr469*	94.0	0.0	.		104.0	6.0	.	NM_033066	C9IZK4|Q53TT3|Q6ZNH6|Q96Q43|Q96Q44	Nonsense_Mutation	SNP	ENST00000409474.3	hg19	CCDS46491.1	.	.	.	.	.	.	.	.	.	.	A	38	6.664329	0.97747	.	.	ENSG00000082126	ENST00000409474;ENST00000315506;ENST00000396886;ENST00000359962;ENST00000315549;ENST00000374605;ENST00000428900;ENST00000409143;ENST00000447335	.	.	.	5.51	5.51	0.81932	.	0.371594	0.28859	N	0.013908	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.6368	0.51209	0.9312:0.0:0.0688:0.0	.	.	.	.	X	469;425;394;469;434;398;445;411;462	.	ENSP00000319363:Y425X	Y	-	3	2	MPP4	202223108	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	1.191000	0.32138	1.113000	0.41760	-0.361000	0.07541	TAC	.	.	.	alt		0.353	MPP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335748.2		
LRRFIP2	9209	hgsc.bcm.edu	37	3	37107344	37107344	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr3:37107344C>A	ENST00000336686.4	-	23	1736	c.1656G>T	c.(1654-1656)caG>caT	p.Q552H	MLH1_ENST00000536378.1_3'UTR|LRRFIP2_ENST00000440230.1_Missense_Mutation_p.Q255H|LRRFIP2_ENST00000421276.2_Missense_Mutation_p.Q255H|LRRFIP2_ENST00000396428.2_Missense_Mutation_p.Q334H|LRRFIP2_ENST00000354379.4_Missense_Mutation_p.Q231H|LRRFIP2_ENST00000421307.1_Missense_Mutation_p.Q552H			Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting protein 2	552					Wnt signaling pathway (GO:0016055)		LRR domain binding (GO:0030275)	p.0?(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						GAGCAGCTTCCTGAGACACAA	0.493																																					p.Q552H		Atlas-SNP	.											.	LRRFIP2	71	.	1	Whole gene deletion(1)	ovary(1)	c.G1656T						PASS	.						99.0	98.0	99.0					3																	37107344		2203	4300	6503	SO:0001583	missense	9209	exon24			AGCTTCCTGAGAC	AF115509	CCDS2664.1, CCDS2665.1, CCDS46791.1, CCDS63592.1	3p22.1	2008-07-18			ENSG00000093167	ENSG00000093167			6703	protein-coding gene	gene with protein product		614043				10366446	Standard	NM_017724		Approved	HUFI-2	uc003cgp.2	Q9Y608	OTTHUMG00000130796	ENST00000336686.4:c.1656G>T	chr3.hg19:g.37107344C>A	ENSP00000338727:p.Gln552His	134.0	0.0	.		164.0	75.0	.	NM_006309	A8K649|A8MXR0|B4DY63|Q68CV3|Q9NXH5	Missense_Mutation	SNP	ENST00000336686.4	hg19	CCDS2664.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.92|19.92	3.915615|3.915615	0.73098|0.73098	.|.	.|.	ENSG00000093167|ENSG00000093167	ENST00000440742|ENST00000421307;ENST00000354379;ENST00000336686;ENST00000421276;ENST00000396428;ENST00000440230	.|T;T;T;T;T;T	.|0.44881	.|0.91;0.91;0.91;0.91;0.91;0.91	6.17|6.17	5.3|5.3	0.74995|0.74995	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.62732	.|0.2452	M|M	0.76328|0.76328	2.33|2.33	0.58432|0.58432	D|D	0.999997|0.999997	.|D;D;D;D	.|0.71674	.|0.995;0.996;0.994;0.998	.|D;D;D;D	.|0.85130	.|0.978;0.93;0.964;0.997	.|T	.|0.66256	.|-0.5969	.|10	.|0.66056	.|D	.|0.02	-6.844|-6.844	11.0179|11.0179	0.47701|0.47701	0.0:0.8037:0.13:0.0663|0.0:0.8037:0.13:0.0663	.|.	.|334;231;255;552	.|A8MXR0;Q9Y608-2;Q9Y608-4;Q9Y608	.|.;.;.;LRRF2_HUMAN	X|H	134|552;231;552;255;334;255	.|ENSP00000392217:Q552H;ENSP00000346349:Q231H;ENSP00000338727:Q552H;ENSP00000416364:Q255H;ENSP00000379705:Q334H;ENSP00000405480:Q255H	.|ENSP00000338727:Q552H	G|Q	-|-	1|3	0|2	LRRFIP2|LRRFIP2	37082348|37082348	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	1.849000|1.849000	0.39318|0.39318	1.616000|1.616000	0.50265|0.50265	0.655000|0.655000	0.94253|0.94253	GGA|CAG	.	.	.	none		0.493	LRRFIP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253335.3	NM_006309	
ACAA1	30	hgsc.bcm.edu	37	3	38163861	38163861	+	IGR	SNP	A	A	G			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr3:38163861A>G	ENST00000333167.8	-	0	1785				DLEC1_ENST00000346219.3_Missense_Mutation_p.K1701R|DLEC1_ENST00000452631.2_Silent_p.Q1745Q|ACAA1_ENST00000480865.1_5'Flank|DLEC1_ENST00000308059.6_Silent_p.Q1742Q|Y_RNA_ENST00000365095.1_RNA	NM_001607.3	NP_001598.1	P09110	THIK_HUMAN	acetyl-CoA acyltransferase 1						alpha-linolenic acid metabolic process (GO:0036109)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acetyl-CoA C-acyltransferase activity (GO:0003988)|palmitoyl-CoA oxidase activity (GO:0016401)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0523)|Kidney(284;0.0657)		TCCGGGGCCAAGGCTCCTATG	0.622																																					p.K1701R		Atlas-SNP	.											.	DLEC1	278	.	0			c.A5102G						PASS	.						59.0	64.0	62.0					3																	38163861		2019	4189	6208	SO:0001628	intergenic_variant	9940	exon36			GGGCCAAGGCTCC	X14813	CCDS2673.1, CCDS46794.1	3p22.2	2012-05-16	2010-04-30		ENSG00000060971	ENSG00000060971	2.3.1.16		82	protein-coding gene	gene with protein product	"""peroxisomal 3-oxoacyl-Coenzyme A thiolase"""	604054	"""acetyl-Coenzyme A acyltransferase 1"""				Standard	NM_001607		Approved		uc003cht.3	P09110	OTTHUMG00000131087		chr3.hg19:g.38163861A>G		127.0	0.0	.		176.0	87.0	.	NM_007337	G5E935|Q96CA6	Missense_Mutation	SNP	ENST00000333167.8	hg19	CCDS2673.1	.	.	.	.	.	.	.	.	.	.	A	19.59	3.856224	0.71834	.	.	ENSG00000008226	ENST00000346219	T	0.05786	3.39	4.86	-2.38	0.06622	.	1.890310	0.02332	N	0.074018	T	0.06188	0.0160	.	.	.	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.24764	-1.0151	9	0.87932	D	0	0.102	5.6407	0.17562	0.3921:0.2598:0.3481:0.0	.	1701	Q9Y238-3	.	R	1701	ENSP00000315914:K1701R	ENSP00000315914:K1701R	K	+	2	0	DLEC1	38138865	0.000000	0.05858	0.612000	0.29024	0.919000	0.55068	-0.264000	0.08658	-0.349000	0.08274	0.459000	0.35465	AAG	.	.	.	none		0.622	ACAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342980.1	NM_001607	
XIRP1	165904	hgsc.bcm.edu	37	3	39229398	39229398	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr3:39229398C>A	ENST00000340369.3	-	2	1767	c.1539G>T	c.(1537-1539)agG>agT	p.R513S	XIRP1_ENST00000396251.1_Missense_Mutation_p.R513S|XIRP1_ENST00000421646.1_Intron	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	513					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CAAACATCCACCTGTAGCCCT	0.627																																					p.R513S		Atlas-SNP	.											.	XIRP1	173	.	0			c.G1539T						PASS	.						94.0	87.0	90.0					3																	39229398		2203	4300	6503	SO:0001583	missense	165904	exon2			CATCCACCTGTAG	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.1539G>T	chr3.hg19:g.39229398C>A	ENSP00000343140:p.Arg513Ser	59.0	0.0	.		107.0	29.0	.	NM_001198621	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	hg19	CCDS2683.1	.	.	.	.	.	.	.	.	.	.	C	13.62	2.290208	0.40494	.	.	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.38401	1.14;1.14	5.17	2.37	0.29283	.	0.299854	0.34291	N	0.004084	T	0.43299	0.1241	M	0.64170	1.965	0.80722	D	1	D;P	0.58268	0.982;0.828	P;B	0.55055	0.767;0.234	T	0.31052	-0.9957	10	0.87932	D	0	.	4.8529	0.13545	0.0:0.5878:0.1562:0.2559	.	513;513	Q702N8;Q702N8-2	XIRP1_HUMAN;.	S	513	ENSP00000379550:R513S;ENSP00000343140:R513S	ENSP00000343140:R513S	R	-	3	2	XIRP1	39204402	1.000000	0.71417	0.983000	0.44433	0.949000	0.60115	1.046000	0.30354	0.283000	0.22279	0.655000	0.94253	AGG	.	.	.	none		0.627	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522	
BAP1	8314	hgsc.bcm.edu	37	3	52439133	52439133	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr3:52439133G>T	ENST00000460680.1	-	11	1580	c.1109C>A	c.(1108-1110)cCc>cAc	p.P370H	BAP1_ENST00000296288.5_Missense_Mutation_p.P352H	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TACCTGCATGGGGGACTTGGC	0.542			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.P370H	GBM(101;493 1458 7992 21037 25532)	Atlas-SNP	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	371	.	0			c.C1109A						PASS	.						85.0	95.0	92.0					3																	52439133		2203	4300	6503	SO:0001583	missense	8314	exon11			TGCATGGGGGACT	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1109C>A	chr3.hg19:g.52439133G>T	ENSP00000417132:p.Pro370His	119.0	0.0	.		152.0	39.0	.	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000460680.1	hg19	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.042149	0.93685	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.75260	-0.81;-0.92	5.72	5.72	0.89469	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (1);	0.000000	0.85682	D	0.000000	D	0.85168	0.5635	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.85506	0.1194	10	0.72032	D	0.01	-9.2799	19.885	0.96909	0.0:0.0:1.0:0.0	.	370	Q92560	BAP1_HUMAN	H	370;352	ENSP00000417132:P370H;ENSP00000296288:P352H	ENSP00000296288:P352H	P	-	2	0	BAP1	52414173	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.768000	0.98965	2.705000	0.92388	0.655000	0.94253	CCC	.	.	.	none		0.542	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
LRRIQ4	344657	hgsc.bcm.edu	37	3	169539716	169539716	+	Nonsense_Mutation	SNP	A	A	T			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr3:169539716A>T	ENST00000340806.6	+	1	7	c.7A>T	c.(7-9)Aaa>Taa	p.K3*		NM_001080460.1	NP_001073929.1	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	3										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30						AATAATGTCAAAAGACATAAA	0.318																																					p.K3X		Atlas-SNP	.											.	LRRIQ4	68	.	0			c.A7T						PASS	.						43.0	40.0	41.0					3																	169539716		1833	4086	5919	SO:0001587	stop_gained	344657	exon1			ATGTCAAAAGACA		CCDS46951.1	3q26.2	2008-08-08	2008-06-12	2008-06-12	ENSG00000188306	ENSG00000188306			34298	protein-coding gene	gene with protein product	"""leucine rich repeat containing 64"""						Standard	NM_001080460		Approved	LRRC64	uc003fgb.3	A6NIV6	OTTHUMG00000164420	ENST00000340806.6:c.7A>T	chr3.hg19:g.169539716A>T	ENSP00000342188:p.Lys3*	354.0	1.0	.		433.0	237.0	.	NM_001080460		Nonsense_Mutation	SNP	ENST00000340806.6	hg19	CCDS46951.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.138694	0.77775	.	.	ENSG00000188306	ENST00000340806	.	.	.	5.39	1.69	0.24217	.	2.757410	0.00853	N	0.001846	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.3243	0.26547	0.7289:0.0:0.2711:0.0	.	.	.	.	X	3	.	ENSP00000342188:K3X	K	+	1	0	LRRIQ4	171022410	0.056000	0.20664	0.001000	0.08648	0.060000	0.15804	1.033000	0.30191	0.442000	0.26555	0.459000	0.35465	AAA	.	.	.	none		0.318	LRRIQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378698.1	NM_001080460	
LEF1	51176	hgsc.bcm.edu	37	4	108999439	108999439	+	Silent	SNP	C	C	T	rs375238109		TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr4:108999439C>T	ENST00000265165.1	-	8	1599	c.945G>A	c.(943-945)gcG>gcA	p.A315A	LEF1_ENST00000510624.1_Silent_p.A219A|LEF1_ENST00000438313.2_Silent_p.A287A|LEF1_ENST00000503879.1_5'UTR|LEF1_ENST00000379951.2_Silent_p.A287A	NM_016269.4	NP_057353.1	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1	315					alpha-beta T cell differentiation (GO:0046632)|anatomical structure regression (GO:0060033)|apoptotic process involved in morphogenesis (GO:0060561)|apoptotic process involved in patterning of blood vessels (GO:1902262)|B cell proliferation (GO:0042100)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cell chemotaxis (GO:0060326)|cellular response to cytokine stimulus (GO:0071345)|cellular response to interleukin-4 (GO:0071353)|chorio-allantoic fusion (GO:0060710)|dentate gyrus development (GO:0021542)|embryonic limb morphogenesis (GO:0030326)|epithelial to mesenchymal transition (GO:0001837)|eye pigmentation (GO:0048069)|face morphogenesis (GO:0060325)|forebrain neuroblast division (GO:0021873)|forebrain neuron differentiation (GO:0021879)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|mammary gland development (GO:0030879)|muscle fiber development (GO:0048747)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic process in bone marrow (GO:0071866)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA binding (GO:0043392)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of interleukin-13 production (GO:0032696)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neutrophil differentiation (GO:0030223)|odontoblast differentiation (GO:0071895)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesoderm formation (GO:0048341)|patterning of blood vessels (GO:0001569)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell cycle process (GO:0090068)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell-cell adhesion (GO:0022407)|regulation of striated muscle tissue development (GO:0016202)|sensory perception of taste (GO:0050909)|somitogenesis (GO:0001756)|sprouting angiogenesis (GO:0002040)|steroid hormone mediated signaling pathway (GO:0043401)|T cell receptor V(D)J recombination (GO:0033153)|T-helper 1 cell differentiation (GO:0045063)|tongue development (GO:0043586)|trachea gland development (GO:0061153)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer binding (GO:0035326)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|gamma-catenin binding (GO:0045295)|histone binding (GO:0042393)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(14)|prostate(1)|urinary_tract(1)	25				OV - Ovarian serous cystadenocarcinoma(123;0.000224)		CAACGACATTCGCTCTCATTT	0.428																																					p.A315A		Atlas-SNP	.											.	LEF1	93	.	0			c.G945A						PASS	.	T	,,,	1,4405	2.1+/-5.4	0,1,2202	270.0	266.0	268.0		861,861,657,945	-6.5	0.8	4		268	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	LEF1	NM_001130713.2,NM_001130714.2,NM_001166119.1,NM_016269.4	,,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,	287/372,287/387,219/304,315/400	108999439	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	51176	exon8			GACATTCGCTCTC		CCDS3679.1, CCDS47122.1, CCDS47123.1, CCDS54791.1	4q23-q25	2011-07-08			ENSG00000138795	ENSG00000138795			6551	protein-coding gene	gene with protein product		153245				1783375	Standard	NM_016269		Approved	TCF1ALPHA, TCF10, TCF7L3	uc003hyt.2	Q9UJU2	OTTHUMG00000131809	ENST00000265165.1:c.945G>A	chr4.hg19:g.108999439C>T		122.0	0.0	.		122.0	52.0	.	NM_016269	B4DG38|B7Z8E2|E9PDK3|Q3ZCU4|Q9HAZ0	Silent	SNP	ENST00000265165.1	hg19	CCDS3679.1																																																																																			.	.	.	weak		0.428	LEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254749.2		
NDST4	64579	hgsc.bcm.edu	37	4	115997318	115997318	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr4:115997318G>A	ENST00000264363.2	-	2	1553	c.875C>T	c.(874-876)tCa>tTa	p.S292L		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	292	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		CCTCTTCCCTGACAAGAAGGA	0.433																																					p.S292L		Atlas-SNP	.											.	NDST4	193	.	0			c.C875T						PASS	.						172.0	154.0	160.0					4																	115997318		2203	4300	6503	SO:0001583	missense	64579	exon2			TTCCCTGACAAGA	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.875C>T	chr4.hg19:g.115997318G>A	ENSP00000264363:p.Ser292Leu	104.0	0.0	.		100.0	36.0	.	NM_022569	Q2KHM8	Missense_Mutation	SNP	ENST00000264363.2	hg19	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.641655	0.87859	.	.	ENSG00000138653	ENST00000264363	T	0.37915	1.17	5.79	5.79	0.91817	.	0.058271	0.64402	D	0.000001	T	0.60051	0.2239	M	0.72894	2.215	0.80722	D	1	P	0.40266	0.71	P	0.56216	0.794	T	0.59118	-0.7514	10	0.87932	D	0	.	20.0367	0.97561	0.0:0.0:1.0:0.0	.	292	Q9H3R1	NDST4_HUMAN	L	292	ENSP00000264363:S292L	ENSP00000264363:S292L	S	-	2	0	NDST4	116216767	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.807000	0.99171	2.727000	0.93392	0.591000	0.81541	TCA	.	.	.	none		0.433	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569	
FAM71B	153745	hgsc.bcm.edu	37	5	156592638	156592638	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr5:156592638C>G	ENST00000302938.4	-	1	637	c.542G>C	c.(541-543)aGt>aCt	p.S181T		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	181						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ACTGCAGTAACTCTCTACTGG	0.493																																					p.S181T		Atlas-SNP	.											.	FAM71B	145	.	0			c.G542C						PASS	.						174.0	175.0	175.0					5																	156592638		2203	4300	6503	SO:0001583	missense	153745	exon1			CAGTAACTCTCTA		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.542G>C	chr5.hg19:g.156592638C>G	ENSP00000305596:p.Ser181Thr	139.0	0.0	.		161.0	55.0	.	NM_130899	Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	ENST00000302938.4	hg19	CCDS4335.1	.	.	.	.	.	.	.	.	.	.	C	13.54	2.269023	0.40095	.	.	ENSG00000170613	ENST00000302938	T	0.16196	2.36	4.56	1.49	0.22878	.	0.531595	0.18243	N	0.147193	T	0.24661	0.0598	L	0.43923	1.385	0.09310	N	1	D	0.76494	0.999	D	0.74023	0.982	T	0.06752	-1.0809	10	0.30078	T	0.28	-10.0605	4.4562	0.11643	0.0:0.6087:0.1849:0.2064	.	181	Q8TC56	FA71B_HUMAN	T	181	ENSP00000305596:S181T	ENSP00000305596:S181T	S	-	2	0	FAM71B	156525216	0.010000	0.17322	0.007000	0.13788	0.003000	0.03518	0.949000	0.29109	0.599000	0.29845	-0.136000	0.14681	AGT	.	.	.	none		0.493	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899	
CYFIP2	26999	hgsc.bcm.edu	37	5	156738675	156738675	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr5:156738675G>T	ENST00000521420.1	+	10	1009	c.918G>T	c.(916-918)tgG>tgT	p.W306C	CYFIP2_ENST00000522463.1_Missense_Mutation_p.W136C|CYFIP2_ENST00000435847.2_Missense_Mutation_p.W6C|CYFIP2_ENST00000377576.3_Missense_Mutation_p.W332C|CYFIP2_ENST00000347377.6_Missense_Mutation_p.W332C|CYFIP2_ENST00000318218.6_Missense_Mutation_p.W332C|CYFIP2_ENST00000442283.2_5'UTR|CYFIP2_ENST00000541131.1_Missense_Mutation_p.W257C					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TACCCAGGTGGACGTGCACCC	0.602																																					p.W332C		Atlas-SNP	.											.	CYFIP2	354	.	0			c.G996T						PASS	.						32.0	34.0	33.0					5																	156738675		2134	4251	6385	SO:0001583	missense	26999	exon11			CAGGTGGACGTGC	AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.918G>T	chr5.hg19:g.156738675G>T	ENSP00000430904:p.Trp306Cys	207.0	0.0	.		188.0	57.0	.	NM_001037332		Missense_Mutation	SNP	ENST00000521420.1	hg19		.	.	.	.	.	.	.	.	.	.	G	22.8	4.331186	0.81690	.	.	ENSG00000055163	ENST00000318218;ENST00000522463;ENST00000521420;ENST00000347377;ENST00000377576;ENST00000541131;ENST00000435847	T;T;T;T;T;T;T	0.45276	2.07;2.07;2.09;2.09;2.09;2.09;0.9	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.66703	0.2816	M	0.77486	2.375	0.80722	D	1	D;D;P;D;D;P	0.89917	1.0;1.0;0.719;1.0;1.0;0.943	D;D;B;D;D;D	0.97110	1.0;1.0;0.222;0.998;0.999;0.941	T	0.65047	-0.6263	10	0.34782	T	0.22	-13.0951	19.0225	0.92920	0.0:0.0:1.0:0.0	.	196;136;306;332;332;332	A8MUM2;E7EW33;E7EVJ5;E7EVF4;Q96F07-2;Q96F07	.;.;.;.;.;CYFP2_HUMAN	C	332;136;306;332;332;257;6	ENSP00000325817:W332C;ENSP00000428009:W136C;ENSP00000430904:W306C;ENSP00000313567:W332C;ENSP00000366799:W332C;ENSP00000444645:W257C;ENSP00000403793:W6C	ENSP00000325817:W332C	W	+	3	0	CYFIP2	156671253	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	9.792000	0.99085	2.496000	0.84212	0.655000	0.94253	TGG	.	.	.	none		0.602	CYFIP2-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000373710.1	NM_001037332	
LRFN2	57497	hgsc.bcm.edu	37	6	40399746	40399746	+	Silent	SNP	C	C	T			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr6:40399746C>T	ENST00000338305.6	-	2	1649	c.1107G>A	c.(1105-1107)acG>acA	p.T369T		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	369	Ig-like.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					CCACCATGGCCGTGGCCTCTC	0.607																																					p.T369T		Atlas-SNP	.											.	LRFN2	133	.	0			c.G1107A						PASS	.						62.0	45.0	51.0					6																	40399746		2203	4300	6503	SO:0001819	synonymous_variant	57497	exon2			CATGGCCGTGGCC	AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.1107G>A	chr6.hg19:g.40399746C>T		50.0	0.0	.		57.0	20.0	.	NM_020737	A5PKU3|Q5SYP9	Silent	SNP	ENST00000338305.6	hg19	CCDS34443.1																																																																																			.	.	.	none		0.607	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372	
LCA5	167691	hgsc.bcm.edu	37	6	80223369	80223369	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr6:80223369G>A	ENST00000392959.1	-	4	891	c.280C>T	c.(280-282)Cgg>Tgg	p.R94W	LCA5_ENST00000467898.3_Missense_Mutation_p.R94W|LCA5_ENST00000369846.4_Missense_Mutation_p.R94W	NM_181714.3	NP_859065.2	Q86VQ0	LCA5_HUMAN	Leber congenital amaurosis 5	94					intraciliary transport (GO:0042073)|photoreceptor cell maintenance (GO:0045494)|protein transport (GO:0015031)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein complex binding (GO:0032403)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	32		all_cancers(76;3.32e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0176)		BRCA - Breast invasive adenocarcinoma(397;0.0657)		GTATCTTTCCGAAGTGGCTCT	0.453																																					p.R94W		Atlas-SNP	.											.	LCA5	71	.	0			c.C280T						PASS	.						153.0	163.0	160.0					6																	80223369		2203	4299	6502	SO:0001583	missense	167691	exon3			CTTTCCGAAGTGG		CCDS4990.1	6q14	2014-01-28			ENSG00000135338	ENSG00000135338			31923	protein-coding gene	gene with protein product	"""lebercilin"""	611408	"""chromosome 6 open reading frame 152"""	C6orf152		10631161, 17546029	Standard	NM_181714		Approved		uc003pix.3	Q86VQ0	OTTHUMG00000015080	ENST00000392959.1:c.280C>T	chr6.hg19:g.80223369G>A	ENSP00000376686:p.Arg94Trp	90.0	0.0	.		70.0	22.0	.	NM_001122769	E1P542|Q9BWX7	Missense_Mutation	SNP	ENST00000392959.1	hg19	CCDS4990.1	.	.	.	.	.	.	.	.	.	.	G	9.229	1.035405	0.19590	.	.	ENSG00000135338	ENST00000369846;ENST00000392959	T;T	0.33216	1.42;1.42	6.07	3.32	0.38043	.	0.549102	0.20451	N	0.092094	T	0.06690	0.0171	N	0.22421	0.69	0.29390	N	0.862704	B;B	0.17465	0.022;0.004	B;B	0.09377	0.004;0.002	T	0.23904	-1.0175	10	0.54805	T	0.06	-0.1203	4.3299	0.11059	0.141:0.1334:0.6021:0.1235	.	94;94	B4DRL2;Q86VQ0	.;LCA5_HUMAN	W	94	ENSP00000358861:R94W;ENSP00000376686:R94W	ENSP00000358861:R94W	R	-	1	2	LCA5	80280088	0.999000	0.42202	0.997000	0.53966	0.177000	0.22998	1.043000	0.30316	0.439000	0.26476	0.655000	0.94253	CGG	.	.	.	none		0.453	LCA5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259269.1	NM_181714	
GFRA2	2675	hgsc.bcm.edu	37	8	21560336	21560336	+	Missense_Mutation	SNP	G	G	C	rs76990589		TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr8:21560336G>C	ENST00000524240.1	-	7	1849	c.1199C>G	c.(1198-1200)aCc>aGc	p.T400S	GFRA2_ENST00000400782.4_Missense_Mutation_p.T295S|GFRA2_ENST00000518077.1_Missense_Mutation_p.T267S|GFRA2_ENST00000517328.1_Missense_Mutation_p.T400S	NM_001495.4	NP_001486.4	O00451	GFRA2_HUMAN	GDNF family receptor alpha 2	400					negative regulation of protein autophosphorylation (GO:0031953)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	anchored component of membrane (GO:0031225)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|prostate(1)|skin(1)	7				Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)		CGTGCAGGTGGTGATGACACT	0.632																																					p.T400S		Atlas-SNP	.											.	GFRA2	23	.	0			c.C1199G						PASS	.						79.0	86.0	83.0					8																	21560336		2102	4221	6323	SO:0001583	missense	2675	exon7			CAGGTGGTGATGA	AF002700	CCDS47816.1, CCDS55207.1	8p21.3	2008-05-02			ENSG00000168546	ENSG00000168546			4244	protein-coding gene	gene with protein product		601956				9177201	Standard	NM_001165038		Approved	RETL2, GDNFRB, NTNRA, TRNR2	uc003wzu.1	O00451	OTTHUMG00000163897	ENST00000524240.1:c.1199C>G	chr8.hg19:g.21560336G>C	ENSP00000428518:p.Thr400Ser	107.0	0.0	.		83.0	30.0	.	NM_001495	E9PD47|O15316|O15328|Q58J92|Q6GTR9|Q7Z5C2	Missense_Mutation	SNP	ENST00000524240.1	hg19	CCDS47816.1	.	.	.	.	.	.	.	.	.	.	G	6.929	0.541169	0.13250	.	.	ENSG00000168546	ENST00000524240;ENST00000400782;ENST00000517328;ENST00000518077;ENST00000517892	T;T;T;T;T	0.28069	2.05;1.64;2.05;1.63;1.64	4.88	3.99	0.46301	.	0.292251	0.33346	N	0.005012	T	0.19485	0.0468	N	0.25144	0.715	0.38692	D	0.952799	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.08055	0.002;0.003;0.0	T	0.07385	-1.0775	10	0.14252	T	0.57	-31.8924	12.7087	0.57078	0.0:0.1663:0.8337:0.0	.	267;295;400	O00451-2;E9PD47;O00451	.;.;GFRA2_HUMAN	S	400;295;400;267;295	ENSP00000428518:T400S;ENSP00000383592:T295S;ENSP00000429445:T400S;ENSP00000429206:T267S;ENSP00000429979:T295S	ENSP00000383592:T295S	T	-	2	0	GFRA2	21604616	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.820000	0.48057	1.163000	0.42636	0.561000	0.74099	ACC	.	.	.	alt		0.632	GFRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376254.3	NM_001495	
NBN	4683	hgsc.bcm.edu	37	8	90965471	90965471	+	Splice_Site	SNP	C	C	T			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr8:90965471C>T	ENST00000265433.3	-	11	2000		c.e11+1		NBN_ENST00000409330.1_Splice_Site	NM_002485.4	NP_002476.2	O60934	NBN_HUMAN	nibrin						blastocyst growth (GO:0001832)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|DNA damage checkpoint (GO:0000077)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intrinsic apoptotic signaling pathway (GO:0097193)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G2 DNA damage checkpoint (GO:0007095)|neuromuscular process controlling balance (GO:0050885)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|telomere maintenance (GO:0000723)	Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nuclear inclusion body (GO:0042405)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|replication fork (GO:0005657)|site of double-strand break (GO:0035861)	damaged DNA binding (GO:0003684)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(11;0.0344)			ATGTTACTTACAGATATTTTG	0.343								Homologous recombination																													.		Atlas-SNP	.											.	NBN	86	.	0			c.1845+1G>A						PASS	.						203.0	198.0	199.0					8																	90965471		2203	4299	6502	SO:0001630	splice_region_variant	4683	exon12			TACTTACAGATAT	AF058696	CCDS6249.1	8q21-q24	2014-09-17	2005-06-02	2005-06-02	ENSG00000104320	ENSG00000104320			7652	protein-coding gene	gene with protein product		602667	"""Nijmegen breakage syndrome 1 (nibrin)"""	NBS, NBS1		9590181, 9590180	Standard	XM_005250923		Approved	ATV, AT-V2, AT-V1	uc003yej.1	O60934	OTTHUMG00000153546	ENST00000265433.3:c.1845+1G>A	chr8.hg19:g.90965471C>T		56.0	0.0	.		62.0	17.0	.	NM_002485	B2R626|B2RNC5|O60672|Q32NF7|Q53FM6|Q63HR6|Q7LDM2	Splice_Site	SNP	ENST00000265433.3	hg19	CCDS6249.1	.	.	.	.	.	.	.	.	.	.	C	12.53	1.964595	0.34659	.	.	ENSG00000104320	ENST00000265433;ENST00000409330	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4314	0.67254	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NBN	91034647	0.998000	0.40836	0.998000	0.56505	0.234000	0.25298	3.894000	0.56250	2.469000	0.83416	0.650000	0.86243	.	.	.	.	none		0.343	NBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331583.3	NM_001024688	Intron
VPS13B	157680	hgsc.bcm.edu	37	8	100865879	100865879	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr8:100865879A>G	ENST00000358544.2	+	56	10448	c.10337A>G	c.(10336-10338)gAg>gGg	p.E3446G	VPS13B_ENST00000357162.2_Missense_Mutation_p.E3421G|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3446					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TACTGTGTGGAGATCTGCTGT	0.512																																					p.E3446G	Colon(161;2205 2542 7338 31318)	Atlas-SNP	.											.	VPS13B	811	.	0			c.A10337G						PASS	.						70.0	67.0	68.0					8																	100865879		2203	4300	6503	SO:0001583	missense	157680	exon56			GTGTGGAGATCTG	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.10337A>G	chr8.hg19:g.100865879A>G	ENSP00000351346:p.Glu3446Gly	158.0	0.0	.		168.0	50.0	.	NM_017890	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	hg19	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	A	18.63	3.666129	0.67700	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.70399	-0.48;-0.48	5.43	5.43	0.79202	.	0.127455	0.52532	D	0.000080	T	0.68604	0.3019	L	0.50333	1.59	0.80722	D	1	B;D	0.53619	0.095;0.961	B;B	0.44224	0.042;0.444	T	0.72827	-0.4175	10	0.56958	D	0.05	.	15.4706	0.75437	1.0:0.0:0.0:0.0	.	3421;3446	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	G	3421;3446	ENSP00000349685:E3421G;ENSP00000351346:E3446G	ENSP00000349685:E3421G	E	+	2	0	VPS13B	100935055	1.000000	0.71417	0.661000	0.29709	0.306000	0.27790	4.545000	0.60698	2.036000	0.60181	0.528000	0.53228	GAG	.	.	.	none		0.512	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
C9orf66	157983	hgsc.bcm.edu	37	9	214701	214701	+	Nonsense_Mutation	SNP	G	G	T			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr9:214701G>T	ENST00000382387.2	-	1	1192	c.696C>A	c.(694-696)taC>taA	p.Y232*	DOCK8_ENST00000453981.1_5'Flank|DOCK8_ENST00000432829.2_5'Flank	NM_152569.2	NP_689782.2	Q5T8R8	CI066_HUMAN	chromosome 9 open reading frame 66	232	Arg-rich.									central_nervous_system(1)|cervix(1)|kidney(1)|skin(1)	4	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		GTCTGCCCCAGTATCGGGAGG	0.786																																					p.Y232X		Atlas-SNP	.											.	C9orf66	16	.	0			c.C696A						PASS	.						4.0	4.0	4.0					9																	214701		1792	3538	5330	SO:0001587	stop_gained	157983	exon1			GCCCCAGTATCGG	AK055720	CCDS6439.1	9p24.3	2008-02-05			ENSG00000183784	ENSG00000183784			26436	protein-coding gene	gene with protein product							Standard	NM_152569		Approved	FLJ31158	uc003zge.4	Q5T8R8	OTTHUMG00000021017	ENST00000382387.2:c.696C>A	chr9.hg19:g.214701G>T	ENSP00000371824:p.Tyr232*	96.0	0.0	.		100.0	41.0	.	NM_152569	Q96NB0	Nonsense_Mutation	SNP	ENST00000382387.2	hg19	CCDS6439.1	.	.	.	.	.	.	.	.	.	.	.	37	6.298205	0.97453	.	.	ENSG00000183784	ENST00000382387	.	.	.	3.91	1.81	0.25067	.	.	.	.	.	.	.	.	.	.	.	0.35445	D	0.795188	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	4.6513	0.12596	0.1264:0.227:0.6465:0.0	.	.	.	.	X	232	.	ENSP00000371824:Y232X	Y	-	3	2	C9orf66	204701	0.079000	0.21365	0.068000	0.19968	0.006000	0.05464	1.997000	0.40786	0.937000	0.37394	0.484000	0.47621	TAC	.	.	.	none		0.786	C9orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055436.1	NM_152569	
DMRT3	58524	hgsc.bcm.edu	37	9	990923	990923	+	Nonsense_Mutation	SNP	C	C	G			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr9:990923C>G	ENST00000190165.2	+	2	1375	c.1337C>G	c.(1336-1338)tCa>tGa	p.S446*		NM_021240.2	NP_067063.1	Q9NQL9	DMRT3_HUMAN	doublesex and mab-3 related transcription factor 3	446					adult walking behavior (GO:0007628)|male sex differentiation (GO:0046661)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|sex differentiation (GO:0007548)|transcription, DNA-templated (GO:0006351)|transmission of nerve impulse (GO:0019226)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)		Lung(218;0.0196)		CCATTTGTGTCAAAGCAGTCC	0.527																																					p.S446X		Atlas-SNP	.											.	DMRT3	83	.	0			c.C1337G						PASS	.						91.0	89.0	90.0					9																	990923		2203	4300	6503	SO:0001587	stop_gained	58524	exon2			TTGTGTCAAAGCA	AJ301581	CCDS6443.1	9p24.3	2008-07-21	2001-12-17	2001-12-07	ENSG00000064218	ENSG00000064218			13909	protein-coding gene	gene with protein product	"""testis-specific protein"""	614754	"""DMRT-like family A3"""	DMRTA3		11543627, 10729223	Standard	NM_021240		Approved		uc003zgw.2	Q9NQL9	OTTHUMG00000019436	ENST00000190165.2:c.1337C>G	chr9.hg19:g.990923C>G	ENSP00000190165:p.Ser446*	108.0	0.0	.		99.0	35.0	.	NM_021240	Q7LA03|Q7LCH8|Q96SC7|Q9NRQ9	Nonsense_Mutation	SNP	ENST00000190165.2	hg19	CCDS6443.1	.	.	.	.	.	.	.	.	.	.	C	35	5.504853	0.96371	.	.	ENSG00000064218	ENST00000190165	.	.	.	5.22	5.22	0.72569	.	0.558234	0.17930	N	0.157210	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-2.7083	12.1775	0.54194	0.0:0.922:0.0:0.078	.	.	.	.	X	446	.	ENSP00000190165:S446X	S	+	2	0	DMRT3	980923	0.995000	0.38212	0.061000	0.19648	0.891000	0.51852	4.428000	0.59894	2.424000	0.82194	0.655000	0.94253	TCA	.	.	.	none		0.527	DMRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051490.1	NM_021240	
KCNV2	169522	hgsc.bcm.edu	37	9	2718860	2718860	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr9:2718860A>G	ENST00000382082.3	+	1	1359	c.1121A>G	c.(1120-1122)cAg>cGg	p.Q374R		NM_133497.3	NP_598004.1	Q8TDN2	KCNV2_HUMAN	potassium channel, subfamily V, member 2	374					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	35				GBM - Glioblastoma multiforme(50;0.0257)		AAGGTGGGTCAGGTGTTGCGC	0.672																																					p.Q374R		Atlas-SNP	.											.	KCNV2	72	.	0			c.A1121G						PASS	.						98.0	79.0	85.0					9																	2718860		2203	4300	6503	SO:0001583	missense	169522	exon1			TGGGTCAGGTGTT	AF348983	CCDS6447.1	9p24.2	2011-07-05			ENSG00000168263	ENSG00000168263		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19698	protein-coding gene	gene with protein product		607604				12060745, 16382104	Standard	NM_133497		Approved	Kv8.2	uc003zho.2	Q8TDN2	OTTHUMG00000019449	ENST00000382082.3:c.1121A>G	chr9.hg19:g.2718860A>G	ENSP00000371514:p.Gln374Arg	55.0	0.0	.		61.0	23.0	.	NM_133497	Q5T6X0	Missense_Mutation	SNP	ENST00000382082.3	hg19	CCDS6447.1	.	.	.	.	.	.	.	.	.	.	A	14.50	2.553862	0.45487	.	.	ENSG00000168263	ENST00000382082	D	0.98164	-4.76	5.07	5.07	0.68467	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.95840	0.8646	N	0.10916	0.065	0.58432	D	0.999999	P	0.51791	0.948	P	0.56278	0.795	D	0.94056	0.7322	10	0.06625	T	0.88	.	14.8658	0.70416	1.0:0.0:0.0:0.0	.	374	Q8TDN2	KCNV2_HUMAN	R	374	ENSP00000371514:Q374R	ENSP00000371514:Q374R	Q	+	2	0	KCNV2	2708860	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	9.339000	0.96797	1.908000	0.55244	0.460000	0.39030	CAG	.	.	.	none		0.672	KCNV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051528.1	NM_133497	
IFNK	56832	hgsc.bcm.edu	37	9	27524419	27524419	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr9:27524419G>T	ENST00000276943.2	+	1	108	c.85G>T	c.(85-87)Gac>Tac	p.D29Y	MOB3B_ENST00000262244.5_Intron	NM_020124.2	NP_064509.2	Q9P0W0	IFNK_HUMAN	interferon, kappa	29					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|natural killer cell activation involved in immune response (GO:0002323)|negative regulation of cell proliferation (GO:0008285)|positive regulation of innate immune response (GO:0045089)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of transcription, DNA-templated (GO:0006355)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			large_intestine(1)	1		all_neural(11;7.9e-11)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.000158)		CCTATCCCTGGACTGTAACTT	0.408																																					p.D29Y		Atlas-SNP	.											.	IFNK	14	.	0			c.G85T						PASS	.						108.0	103.0	105.0					9																	27524419		2203	4300	6503	SO:0001583	missense	56832	exon1			TCCCTGGACTGTA	AF384048	CCDS6521.1	9p21.2	2008-02-05			ENSG00000147896	ENSG00000147896		"""Interferons"""	21714	protein-coding gene	gene with protein product		615326				12391192, 11514542	Standard	NM_020124		Approved		uc003zqp.3	Q9P0W0	OTTHUMG00000019715	ENST00000276943.2:c.85G>T	chr9.hg19:g.27524419G>T	ENSP00000276943:p.Asp29Tyr	133.0	0.0	.		153.0	60.0	.	NM_020124	Q5T166	Missense_Mutation	SNP	ENST00000276943.2	hg19	CCDS6521.1	.	.	.	.	.	.	.	.	.	.	G	12.68	2.010976	0.35511	.	.	ENSG00000147896	ENST00000276943	T	0.16897	2.31	5.67	-5.19	0.02832	Four-helical cytokine-like, core (1);	1.187680	0.05921	N	0.633525	T	0.30541	0.0768	M	0.76002	2.32	0.09310	N	1	D	0.62365	0.991	P	0.57324	0.818	T	0.45411	-0.9263	10	0.87932	D	0	-7.6703	6.5888	0.22636	0.43:0.3306:0.2394:0.0	.	29	Q9P0W0	IFNK_HUMAN	Y	29	ENSP00000276943:D29Y	ENSP00000276943:D29Y	D	+	1	0	IFNK	27514419	0.000000	0.05858	0.012000	0.15200	0.272000	0.26649	-1.028000	0.03589	-0.809000	0.04381	-0.300000	0.09419	GAC	.	.	.	none		0.408	IFNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051968.1	NM_020124	
NUDT2	318	hgsc.bcm.edu	37	9	34343386	34343386	+	Missense_Mutation	SNP	T	T	C	rs368502630		TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr9:34343386T>C	ENST00000379158.2	+	5	750	c.392T>C	c.(391-393)aTg>aCg	p.M131T	NUDT2_ENST00000379155.5_Missense_Mutation_p.M131T|NUDT2_ENST00000346365.4_Missense_Mutation_p.M131T	NM_001161.4	NP_001152.1	P50583	AP4A_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 2	131	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				apoptotic process (GO:0006915)|nucleobase-containing compound metabolic process (GO:0006139)	mitochondrion (GO:0005739)	bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity (GO:0004081)|bis(5'-nucleosyl)-tetraphosphatase (symmetrical) activity (GO:0008803)|GTP binding (GO:0005525)			lung(3)	3			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.126)		TTCAAGGAGATGAAGGCAGCG	0.572																																					p.M131T	Melanoma(95;1683 1957 4276 39813)	Atlas-SNP	.											.	NUDT2	7	.	0			c.T392C						PASS	.	T	THR/MET,THR/MET,THR/MET	0,4406		0,0,2203	42.0	42.0	42.0		392,392,392	5.9	1.0	9		42	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	NUDT2	NM_001161.4,NM_147172.2,NM_147173.2	81,81,81	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	131/148,131/148,131/148	34343386	1,13005	2203	4300	6503	SO:0001583	missense	318	exon4			AGGAGATGAAGGC	U30313	CCDS6552.1	9p13	2008-07-21			ENSG00000164978	ENSG00000164978		"""Nudix motif containing"""	8049	protein-coding gene	gene with protein product	"""Ap4A hydrolase 1"", ""Ap4Aase"", ""bis(5'-nucleosyl)-tetraphosphatase (asymmetrical)"", ""diadenosine tetraphosphatase"", ""diadenosine 5',5''-P1,P4-tetraphosphate pyrophosphohydrolase"""	602852		APAH1		7487923, 9479504	Standard	NM_001161		Approved		uc022bga.1	P50583	OTTHUMG00000019817	ENST00000379158.2:c.392T>C	chr9.hg19:g.34343386T>C	ENSP00000368455:p.Met131Thr	98.0	0.0	.		106.0	25.0	.	NM_147173	D3DRM0|Q5T589	Missense_Mutation	SNP	ENST00000379158.2	hg19	CCDS6552.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.243920	0.79912	0.0	1.16E-4	ENSG00000164978	ENST00000337747;ENST00000379154;ENST00000379155;ENST00000346365;ENST00000379158	T;T;T	0.07114	3.22;3.22;3.22	5.88	5.88	0.94601	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.162705	0.64402	D	0.000003	T	0.18130	0.0435	L	0.33189	0.99	0.80722	D	1	D	0.57571	0.98	D	0.81914	0.995	T	0.13202	-1.0518	10	0.14252	T	0.57	-14.7876	16.2987	0.82793	0.0:0.0:0.0:1.0	.	131	P50583	AP4A_HUMAN	T	131	ENSP00000368452:M131T;ENSP00000344187:M131T;ENSP00000368455:M131T	ENSP00000338397:M131T	M	+	2	0	NUDT2	34333386	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	7.797000	0.85911	2.257000	0.74773	0.459000	0.35465	ATG	.	.	.	weak		0.572	NUDT2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052160.2	NM_001161	
GNAQ	2776	hgsc.bcm.edu	37	9	80537112	80537112	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr9:80537112T>A	ENST00000286548.4	-	2	508	c.286A>T	c.(286-288)Aca>Tca	p.T96S		NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	96					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)	p.T96S(1)		NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						ATCTTGAGTGTGTCCATGGCT	0.473			Mis		uveal melanoma																																p.T96S		Atlas-SNP	.		Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	GNAQ,NS,carcinoma,0,2	GNAQ	384	.	1	Substitution - Missense(1)	prostate(1)	c.A286T						PASS	.																																			SO:0001583	missense	2776	exon2			TGAGTGTGTCCAT		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.286A>T	chr9.hg19:g.80537112T>A	ENSP00000286548:p.Thr96Ser	46.0	0.0	.		49.0	5.0	.	NM_002072	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Missense_Mutation	SNP	ENST00000286548.4	hg19	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	13.12	2.141103	0.37825	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	D;D	0.87809	-2.3;-2.3	5.86	5.86	0.93980	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.84170	0.5413	L	0.52126	1.63	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.79122	-0.1933	10	0.29301	T	0.29	.	16.2652	0.82574	0.0:0.0:0.0:1.0	.	96	P50148	GNAQ_HUMAN	S	96;67	ENSP00000286548:T96S;ENSP00000391501:T67S	ENSP00000286548:T96S	T	-	1	0	GNAQ	79726932	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.145000	0.64839	2.241000	0.73720	0.528000	0.53228	ACA	.	.	.	none		0.473	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1	NM_002072	
SPATA31D1	389763	hgsc.bcm.edu	37	9	84607291	84607291	+	Missense_Mutation	SNP	T	T	G	rs201182137	byFrequency	TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr9:84607291T>G	ENST00000344803.2	+	4	1953	c.1906T>G	c.(1906-1908)Ttg>Gtg	p.L636V		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	636					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GCAGGAAAGTTTGTGGGGCTT	0.478													G|||	3	0.000599042	0.0008	0.0	5008	,	,		19868	0.0		0.001	False		,,,				2504	0.001				p.L636V		Atlas-SNP	.											FAM75D4,NS,carcinoma,0,2	.	.	.	0			c.T1906G						PASS	.	G	VAL/LEU	0,3730		0,0,1865	101.0	98.0	99.0		1906	-3.7	0.0	9		99	1,8223		0,1,4111	no	missense	FAM75D1	NM_001001670.2	32	0,1,5976	GG,GT,TT		0.0122,0.0,0.0084	benign	636/1577	84607291	1,11953	1865	4112	5977	SO:0001583	missense	389763	exon4			GAAAGTTTGTGGG		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.1906T>G	chr9.hg19:g.84607291T>G	ENSP00000341988:p.Leu636Val	128.0	1.0	.		118.0	6.0	.	NM_001001670		Missense_Mutation	SNP	ENST00000344803.2	hg19	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	G	4.363	0.066840	0.08388	0.0	1.22E-4	ENSG00000214929	ENST00000344803	T	0.05786	3.39	3.83	-3.67	0.04476	.	1.454400	0.04584	N	0.395509	T	0.02970	0.0088	N	0.11023	0.085	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.43261	-0.9402	10	0.16420	T	0.52	0.4754	3.7406	0.08528	0.108:0.096:0.4463:0.3497	.	636	Q6ZQQ2	F75D1_HUMAN	V	636	ENSP00000341988:L636V	ENSP00000341988:L636V	L	+	1	2	FAM75D1	83797111	0.011000	0.17503	0.002000	0.10522	0.000000	0.00434	-0.756000	0.04777	-1.293000	0.02362	-0.729000	0.03580	TTG	.	.	.	weak		0.478	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670	
HABP4	22927	hgsc.bcm.edu	37	9	99246828	99246828	+	Silent	SNP	A	A	G			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr9:99246828A>G	ENST00000375249.4	+	6	987	c.912A>G	c.(910-912)agA>agG	p.R304R	HABP4_ENST00000375251.3_Silent_p.R199R|HABP4_ENST00000466976.1_3'UTR	NM_014282.2	NP_055097.2			hyaluronan binding protein 4											NS(1)|cervix(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	13		Acute lymphoblastic leukemia(62;0.0169)|all_hematologic(171;0.214)				AACAGACCAGACCAAAGCCTG	0.398																																					p.R304R		Atlas-SNP	.											.	HABP4	25	.	0			c.A912G						PASS	.						120.0	113.0	115.0					9																	99246828		2203	4300	6503	SO:0001819	synonymous_variant	22927	exon6			GACCAGACCAAAG	AF241831	CCDS6719.1	9q22.3-q31	2008-02-05			ENSG00000130956	ENSG00000130956			17062	protein-coding gene	gene with protein product						9523163, 10887182	Standard	XM_005251812		Approved	IHABP4, SERBP1L	uc010msg.3	Q5JVS0	OTTHUMG00000020298	ENST00000375249.4:c.912A>G	chr9.hg19:g.99246828A>G		316.0	0.0	.		327.0	109.0	.	NM_014282		Silent	SNP	ENST00000375249.4	hg19	CCDS6719.1																																																																																			.	.	.	none		0.398	HABP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053269.1	NM_014282	
TNC	3371	hgsc.bcm.edu	37	9	117803252	117803252	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr9:117803252T>C	ENST00000350763.4	-	19	5771	c.5360A>G	c.(5359-5361)gAa>gGa	p.E1787G	TNC_ENST00000423613.2_Missense_Mutation_p.E1514G|TNC_ENST00000341037.4_Missense_Mutation_p.E1605G|TNC_ENST00000535648.1_Missense_Mutation_p.E1332G|TNC_ENST00000340094.3_Missense_Mutation_p.E1423G|TNC_ENST00000345230.3_Missense_Mutation_p.E1150G|TNC_ENST00000542877.1_Missense_Mutation_p.E1424G|TNC_ENST00000346706.3_Missense_Mutation_p.E1241G|TNC_ENST00000537320.1_Missense_Mutation_p.E1150G	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1787	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						AGGTTCACTTTCCTCAAAGCC	0.498																																					p.E1787G		Atlas-SNP	.											.	TNC	282	.	0			c.A5360G						PASS	.						179.0	157.0	165.0					9																	117803252		2203	4300	6503	SO:0001583	missense	3371	exon19			TCACTTTCCTCAA		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.5360A>G	chr9.hg19:g.117803252T>C	ENSP00000265131:p.Glu1787Gly	114.0	0.0	.		140.0	42.0	.	NM_002160	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	hg19	CCDS6811.1	.	.	.	.	.	.	.	.	.	.	T	19.10	3.761583	0.69763	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877	T;T;T;T;T;T;T;T;T	0.58060	0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36	5.93	5.93	0.95920	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.79975	0.4539	M	0.93720	3.45	0.26344	N	0.977311	D;D	0.89917	1.0;1.0	D;D	0.87578	0.995;0.998	T	0.77542	-0.2549	10	0.59425	D	0.04	.	16.3789	0.83431	0.0:0.0:0.0:1.0	.	1514;1787	E9PC84;P24821	.;TENA_HUMAN	G	1423;1332;1241;1150;1787;1605;1514;1150;1424	ENSP00000344400:E1423G;ENSP00000438152:E1332G;ENSP00000344555:E1241G;ENSP00000345861:E1150G;ENSP00000265131:E1787G;ENSP00000339553:E1605G;ENSP00000411406:E1514G;ENSP00000443478:E1150G;ENSP00000442242:E1424G	ENSP00000344400:E1423G	E	-	2	0	TNC	116843073	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.679000	0.84048	2.267000	0.75376	0.533000	0.62120	GAA	.	.	.	none		0.498	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160	
CUBN	8029	hgsc.bcm.edu	37	10	17107509	17107509	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr10:17107509G>C	ENST00000377833.4	-	22	3202	c.3137C>G	c.(3136-3138)aCa>aGa	p.T1046R		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1046					cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TTTGTTACCTGTTGCTGCACT	0.413																																					p.T1046R		Atlas-SNP	.											.	CUBN	515	.	0			c.C3137G						PASS	.						208.0	182.0	191.0					10																	17107509		2203	4300	6503	SO:0001583	missense	8029	exon22			TTACCTGTTGCTG	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.3137C>G	chr10.hg19:g.17107509G>C	ENSP00000367064:p.Thr1046Arg	117.0	0.0	.		104.0	38.0	.	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	hg19	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	G	9.635	1.137432	0.21123	.	.	ENSG00000107611	ENST00000377833	T	0.76578	-1.03	5.92	-3.02	0.05446	CUB (1);	1.836900	0.02981	N	0.145596	T	0.72518	0.3470	L	0.45228	1.405	0.47511	D	0.999447	B	0.20459	0.045	B	0.21151	0.033	T	0.53606	-0.8415	10	0.29301	T	0.29	.	14.9627	0.71169	0.0:0.0695:0.4674:0.4631	.	1046	O60494	CUBN_HUMAN	R	1046	ENSP00000367064:T1046R	ENSP00000367064:T1046R	T	-	2	0	CUBN	17147515	0.983000	0.35010	0.031000	0.17742	0.732000	0.41865	1.542000	0.36137	-0.299000	0.08909	0.650000	0.86243	ACA	.	.	.	none		0.413	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
ABCC2	1244	hgsc.bcm.edu	37	10	101605502	101605502	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr10:101605502T>C	ENST00000370449.4	+	29	4222	c.4109T>C	c.(4108-4110)cTc>cCc	p.L1370P		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	1370	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	TCCATTGGGCTCCACGACCTC	0.507											OREG0020434	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L1370P		Atlas-SNP	.											.	ABCC2	160	.	0			c.T4109C						PASS	.						93.0	80.0	85.0					10																	101605502		2203	4300	6503	SO:0001583	missense	1244	exon29			TTGGGCTCCACGA	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.4109T>C	chr10.hg19:g.101605502T>C	ENSP00000359478:p.Leu1370Pro	107.0	0.0	.	1360	127.0	36.0	.	NM_000392	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	ENST00000370449.4	hg19	CCDS7484.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.449048	0.84101	.	.	ENSG00000023839	ENST00000370449	D	0.94457	-3.43	5.61	5.61	0.85477	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.96352	0.8810	L	0.53617	1.68	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96920	0.9673	10	0.87932	D	0	0.7125	16.1025	0.81194	0.0:0.0:0.0:1.0	.	1370	Q92887	MRP2_HUMAN	P	1370	ENSP00000359478:L1370P	ENSP00000359478:L1370P	L	+	2	0	ABCC2	101595492	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	7.994000	0.88315	2.254000	0.74563	0.533000	0.62120	CTC	.	.	.	none		0.507	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392	
CPXM2	119587	hgsc.bcm.edu	37	10	125521473	125521473	+	Silent	SNP	G	G	A	rs547897756		TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr10:125521473G>A	ENST00000241305.3	-	11	1846	c.1692C>T	c.(1690-1692)gaC>gaT	p.D564D	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	564					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		TCCTCCGGGCGTCTGTCATGA	0.652													G|||	1	0.000199681	0.0	0.0	5008	,	,		16148	0.001		0.0	False		,,,				2504	0.0				p.D564D		Atlas-SNP	.											CPXM2,colon,carcinoma,-2,1	CPXM2	120	.	0			c.C1692T						PASS	.						42.0	42.0	42.0					10																	125521473		2203	4300	6503	SO:0001819	synonymous_variant	119587	exon11			CCGGGCGTCTGTC	AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.1692C>T	chr10.hg19:g.125521473G>A		72.0	0.0	.		65.0	22.0	.	NM_198148	B4E3Q2	Silent	SNP	ENST00000241305.3	hg19	CCDS7637.1																																																																																			.	.	.	none		0.652	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050853.1	NM_198148	
RNF17	56163	hgsc.bcm.edu	37	13	25378553	25378553	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr13:25378553T>A	ENST00000255324.5	+	15	2129	c.2077T>A	c.(2077-2079)Ttc>Atc	p.F693I	RNF17_ENST00000381921.1_Missense_Mutation_p.F693I|RNF17_ENST00000255325.6_Intron	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	693					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TCCTGGAGATTTCTATCTTCA	0.279																																					p.F693I		Atlas-SNP	.											.	RNF17	259	.	0			c.T2077A						PASS	.						65.0	64.0	64.0					13																	25378553		2198	4299	6497	SO:0001583	missense	56163	exon15			GGAGATTTCTATC	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.2077T>A	chr13.hg19:g.25378553T>A	ENSP00000255324:p.Phe693Ile	99.0	0.0	.		92.0	34.0	.	NM_001184993	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	ENST00000255324.5	hg19	CCDS9308.2	.	.	.	.	.	.	.	.	.	.	T	19.45	3.830362	0.71258	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000418120	T;T;T	0.14640	2.49;2.49;2.49	5.25	5.25	0.73442	Maternal tudor protein (1);	0.062472	0.64402	D	0.000006	T	0.36413	0.0966	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.09487	-1.0672	10	0.49607	T	0.09	.	12.6676	0.56851	0.0:0.0:0.0:1.0	.	693;693	B7Z7S1;Q9BXT8	.;RNF17_HUMAN	I	693;693;552;17	ENSP00000255324:F693I;ENSP00000371346:F693I;ENSP00000388892:F17I	ENSP00000255324:F693I	F	+	1	0	RNF17	24276553	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	5.412000	0.66392	1.985000	0.57927	0.482000	0.46254	TTC	.	.	.	none		0.279	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
LMO7	4008	hgsc.bcm.edu	37	13	76427487	76427487	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr13:76427487C>T	ENST00000321797.8	+	26	4646	c.3925C>T	c.(3925-3927)Cct>Tct	p.P1309S	LMO7_ENST00000357063.3_Missense_Mutation_p.P1594S|LMO7_ENST00000377534.3_Missense_Mutation_p.P1594S|LMO7_ENST00000341547.4_Missense_Mutation_p.P1260S|LMO7_ENST00000465261.2_Missense_Mutation_p.P1309S|LMO7_ENST00000526202.1_Missense_Mutation_p.P1186S			Q8WWI1	LMO7_HUMAN	LIM domain 7	1594					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		AAGCCATTCCCCTTCAGCTTC	0.552																																					p.P1309S		Atlas-SNP	.											.	LMO7	334	.	0			c.C3925T						PASS	.						50.0	43.0	45.0					13																	76427487		2203	4300	6503	SO:0001583	missense	4008	exon25			CATTCCCCTTCAG	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.3925C>T	chr13.hg19:g.76427487C>T	ENSP00000317802:p.Pro1309Ser	98.0	0.0	.		77.0	26.0	.	NM_015842	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	ENST00000321797.8	hg19		.	.	.	.	.	.	.	.	.	.	C	12.47	1.948732	0.34377	.	.	ENSG00000136153	ENST00000341547;ENST00000357063;ENST00000377534;ENST00000321797;ENST00000526202;ENST00000465261	T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91	5.54	1.78	0.24846	.	0.550372	0.18949	N	0.126737	T	0.35970	0.0950	M	0.72118	2.19	0.09310	N	1	B;B;B	0.23377	0.011;0.084;0.028	B;B;B	0.16289	0.005;0.015;0.014	T	0.35151	-0.9800	10	0.54805	T	0.06	-3.1545	3.9455	0.09346	0.2622:0.4635:0.0:0.2743	.	1186;1260;1309	E9PMS6;Q8WWI1-3;E9PLH4	.;.;.	S	1260;1594;1594;1309;1186;1309	ENSP00000342112:P1260S;ENSP00000349571:P1594S;ENSP00000366757:P1594S;ENSP00000317802:P1309S;ENSP00000431129:P1186S;ENSP00000433352:P1309S	ENSP00000317802:P1309S	P	+	1	0	LMO7	75325488	0.003000	0.15002	0.023000	0.16930	0.185000	0.23345	-0.032000	0.12266	0.011000	0.14865	0.555000	0.69702	CCT	.	.	.	none		0.552	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	NM_005358	
SIPA1L1	26037	hgsc.bcm.edu	37	14	72196928	72196928	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr14:72196928G>T	ENST00000555818.1	+	18	5182	c.4834G>T	c.(4834-4836)Gac>Tac	p.D1612Y	SIPA1L1_ENST00000537413.1_Missense_Mutation_p.D1066Y|SIPA1L1_ENST00000381232.3_Missense_Mutation_p.D1591Y|SIPA1L1_ENST00000554874.1_3'UTR|SIPA1L1_ENST00000358550.2_Missense_Mutation_p.D1591Y	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	1612					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		CCTGCCCAACGACGTCCTCTT	0.547																																					p.D1612Y		Atlas-SNP	.											.	SIPA1L1	219	.	0			c.G4834T						PASS	.						113.0	96.0	102.0					14																	72196928		2203	4300	6503	SO:0001583	missense	26037	exon18			CCCAACGACGTCC	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.4834G>T	chr14.hg19:g.72196928G>T	ENSP00000450832:p.Asp1612Tyr	132.0	0.0	.		121.0	43.0	.	NM_015556	J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	ENST00000555818.1	hg19	CCDS9807.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.587630	0.86851	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550;ENST00000537413	T;T;T;T	0.62788	0.0;0.0;0.0;0.0	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.80193	0.4578	M	0.74467	2.265	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.994;1.0	D;D;D;P;D	0.97110	1.0;0.986;0.999;0.886;1.0	T	0.82345	-0.0503	10	0.87932	D	0	-21.812	19.0376	0.92985	0.0:0.0:1.0:0.0	.	1066;1612;1066;1591;1612	F5GYF8;A6H8W6;B4DYX7;O43166-2;O43166	.;.;.;.;SI1L1_HUMAN	Y	1591;1612;1591;1066	ENSP00000370630:D1591Y;ENSP00000450832:D1612Y;ENSP00000351352:D1591Y;ENSP00000440682:D1066Y	ENSP00000351352:D1612Y	D	+	1	0	SIPA1L1	71266681	1.000000	0.71417	0.748000	0.31131	0.966000	0.64601	9.300000	0.96151	2.491000	0.84063	0.462000	0.41574	GAC	.	.	.	none		0.547	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556	
ABCC1	4363	hgsc.bcm.edu	37	16	16215909	16215909	+	Silent	SNP	C	C	T			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr16:16215909C>T	ENST00000399410.3	+	24	3643	c.3468C>T	c.(3466-3468)aaC>aaT	p.N1156N	ABCC1_ENST00000351154.5_Silent_p.N1097N|ABCC1_ENST00000346370.5_Silent_p.N1100N|ABCC1_ENST00000345148.5_Silent_p.N1156N|ABCC1_ENST00000399408.2_Silent_p.N1166N|ABCC1_ENST00000349029.5_Silent_p.N1041N	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	1156	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	CCCATTTCAACGAGACCTTGC	0.602																																					p.N1156N		Atlas-SNP	.											.	ABCC1	156	.	0			c.C3468T						PASS	.						47.0	51.0	50.0					16																	16215909		2177	4291	6468	SO:0001819	synonymous_variant	4363	exon24			TTTCAACGAGACC	L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.3468C>T	chr16.hg19:g.16215909C>T		148.0	0.0	.		189.0	102.0	.	NM_004996	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Silent	SNP	ENST00000399410.3	hg19	CCDS42122.1																																																																																			.	.	.	none		0.602	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109701.1	NM_004996	
SIAH1	6477	hgsc.bcm.edu	37	16	48395959	48395959	+	Silent	SNP	G	G	A			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr16:48395959G>A	ENST00000380006.2	-	1	1834	c.381C>T	c.(379-381)tcC>tcT	p.S127S	SIAH1_ENST00000573005.1_5'Flank|SIAH1_ENST00000356721.3_Silent_p.S158S|SIAH1_ENST00000394725.2_Silent_p.S127S			Q8IUQ4	SIAH1_HUMAN	siah E3 ubiquitin protein ligase 1	127	SBD.				anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell cycle (GO:0007049)|nervous system development (GO:0007399)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein catabolic process (GO:0030163)|protein destabilization (GO:0031648)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	beta-catenin destruction complex (GO:0030877)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|stomach(1)	7		all_cancers(37;0.157)|all_lung(18;0.11)|Breast(268;0.238)				GGCACGGACAGGAATAAGGCC	0.473																																					p.S158S		Atlas-SNP	.											.	SIAH1	33	.	0			c.C474T						PASS	.						82.0	61.0	69.0					16																	48395959		2200	4300	6500	SO:0001819	synonymous_variant	6477	exon2			CGGACAGGAATAA	U76247	CCDS10735.1, CCDS32444.1	16q12.1	2013-06-03	2012-02-23		ENSG00000196470	ENSG00000196470			10857	protein-coding gene	gene with protein product		602212	"""seven in absentia homolog 1 (Drosophila)"""			9403064, 9334332	Standard	NM_001006610		Approved	hSIAH1	uc002efo.1	Q8IUQ4	OTTHUMG00000175417	ENST00000380006.2:c.381C>T	chr16.hg19:g.48395959G>A		125.0	0.0	.		140.0	34.0	.	NM_001006610	A0FKF3|O43269|Q49A58|Q92880	Silent	SNP	ENST00000380006.2	hg19	CCDS10735.1																																																																																			.	.	.	none		0.473	SIAH1-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256842.12		
SLC16A13	201232	hgsc.bcm.edu	37	17	6941759	6941759	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr17:6941759T>C	ENST00000308027.6	+	3	940	c.632T>C	c.(631-633)cTc>cCc	p.L211P		NM_201566.2	NP_963860.1	Q7RTY0	MOT13_HUMAN	solute carrier family 16, member 13	211						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	10						ACCTCTCTCCTCCATCATGGC	0.627																																					p.L211P		Atlas-SNP	.											.	SLC16A13	28	.	0			c.T632C						PASS	.						128.0	114.0	119.0					17																	6941759		2203	4300	6503	SO:0001583	missense	201232	exon3			CTCTCCTCCATCA	BN000145	CCDS11085.1	17p13.1	2013-07-18	2013-07-18		ENSG00000174327	ENSG00000174327		"""Solute carriers"""	31037	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 13"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 13"""				Standard	NM_201566		Approved	MCT13	uc002geh.3	Q7RTY0	OTTHUMG00000102089	ENST00000308027.6:c.632T>C	chr17.hg19:g.6941759T>C	ENSP00000309751:p.Leu211Pro	79.0	0.0	.		111.0	63.0	.	NM_201566	A3KMG3|A5PKU5|Q2VP92	Missense_Mutation	SNP	ENST00000308027.6	hg19	CCDS11085.1	.	.	.	.	.	.	.	.	.	.	T	19.89	3.911210	0.72983	.	.	ENSG00000174327	ENST00000308027	T	0.65364	-0.15	5.46	5.46	0.80206	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.77968	0.4210	M	0.83483	2.645	0.80722	D	1	D	0.59767	0.986	D	0.63597	0.916	T	0.81335	-0.0979	10	0.72032	D	0.01	.	11.9187	0.52779	0.0:0.0:0.0:1.0	.	211	Q7RTY0	MOT13_HUMAN	P	211	ENSP00000309751:L211P	ENSP00000309751:L211P	L	+	2	0	SLC16A13	6882483	0.987000	0.35691	0.255000	0.24374	0.994000	0.84299	4.424000	0.59868	2.057000	0.61298	0.460000	0.39030	CTC	.	.	.	none		0.627	SLC16A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219923.2		
MYH13	8735	hgsc.bcm.edu	37	17	10222337	10222337	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr17:10222337T>C	ENST00000418404.3	-	26	3671	c.3508A>G	c.(3508-3510)Aag>Gag	p.K1170E	RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Missense_Mutation_p.K1170E|RP11-401O9.3_ENST00000577743.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1170					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						GCCTCCCTCTTCTTGTTCATC	0.582																																					p.K1170E		Atlas-SNP	.											.	MYH13	533	.	0			c.A3508G						PASS	.						140.0	147.0	144.0					17																	10222337		2203	4300	6503	SO:0001583	missense	8735	exon27			CCCTCTTCTTGTT	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.3508A>G	chr17.hg19:g.10222337T>C	ENSP00000404570:p.Lys1170Glu	118.0	0.0	.		211.0	115.0	.	NM_003802	O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	hg19	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.641331	0.87859	.	.	ENSG00000006788	ENST00000252172	D	0.84873	-1.91	4.05	4.05	0.47172	Myosin tail (1);	.	.	.	.	D	0.94532	0.8239	H	0.97540	4.025	0.43517	D	0.995783	P	0.45011	0.848	P	0.62435	0.902	D	0.95834	0.8860	9	0.66056	D	0.02	.	13.4569	0.61204	0.0:0.0:0.0:1.0	.	1170	Q9UKX3	MYH13_HUMAN	E	1170	ENSP00000252172:K1170E	ENSP00000252172:K1170E	K	-	1	0	MYH13	10163062	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.971000	0.70440	1.815000	0.52974	0.482000	0.46254	AAG	.	.	.	none		0.582	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802	
DNAH9	1770	hgsc.bcm.edu	37	17	11845791	11845791	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr17:11845791C>T	ENST00000262442.4	+	67	12900	c.12832C>T	c.(12832-12834)Ctc>Ttc	p.L4278F	DNAH9_ENST00000454412.2_Missense_Mutation_p.L4202F|DNAH9_ENST00000608377.1_Missense_Mutation_p.L590F|DNAH9_ENST00000396001.2_3'UTR	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	4278					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GGAGCTGGAGCTCGGCTTAAA	0.567																																					p.L4278F		Atlas-SNP	.											.	DNAH9	695	.	0			c.C12832T						PASS	.						66.0	60.0	62.0					17																	11845791		2203	4300	6503	SO:0001583	missense	1770	exon67			CTGGAGCTCGGCT	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.12832C>T	chr17.hg19:g.11845791C>T	ENSP00000262442:p.Leu4278Phe	99.0	0.0	.		109.0	36.0	.	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	hg19	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.574755	0.65878	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703;ENST00000396001	T;T;T	0.09630	2.96;2.96;2.96	4.86	3.89	0.44902	Dynein heavy chain (1);	0.142496	0.47852	D	0.000204	T	0.47395	0.1443	H	0.97587	4.035	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.66756	-0.5843	10	0.87932	D	0	.	13.5144	0.61533	0.0:0.9244:0.0:0.0756	.	4278	Q9NYC9	DYH9_HUMAN	F	4278;4202;2784;590	ENSP00000262442:L4278F;ENSP00000414874:L4202F;ENSP00000379323:L590F	ENSP00000262442:L4278F	L	+	1	0	DNAH9	11786516	0.986000	0.35501	0.977000	0.42913	0.806000	0.45545	2.527000	0.45615	1.266000	0.44231	0.462000	0.41574	CTC	.	.	.	none		0.567	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
SMG8	55181	hgsc.bcm.edu	37	17	57289014	57289014	+	Silent	SNP	G	G	A			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr17:57289014G>A	ENST00000543872.2	+	2	1866	c.1602G>A	c.(1600-1602)gtG>gtA	p.V534V	SMG8_ENST00000580498.1_Intron|CTD-2510F5.6_ENST00000577660.1_Intron|SMG8_ENST00000578922.1_Silent_p.V534V|SMG8_ENST00000300917.5_Silent_p.V534V			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	534					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						CTCTTCGAGTGTACAGTCAAC	0.458																																					p.V534V		Atlas-SNP	.											.	SMG8	79	.	0			c.G1602A						PASS	.						91.0	82.0	85.0					17																	57289014		2203	4300	6503	SO:0001819	synonymous_variant	55181	exon1			TCGAGTGTACAGT	AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.1602G>A	chr17.hg19:g.57289014G>A		152.0	0.0	.		228.0	117.0	.	NM_018149	Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Silent	SNP	ENST00000543872.2	hg19	CCDS11615.1																																																																																			.	.	.	none		0.458	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445960.2	NM_018149	
ALPK2	115701	hgsc.bcm.edu	37	18	56246259	56246259	+	Silent	SNP	A	A	G			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr18:56246259A>G	ENST00000361673.3	-	4	1962	c.1749T>C	c.(1747-1749)acT>acC	p.T583T	ALPK2_ENST00000587399.1_5'UTR	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	583						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						TGGTGTGAGAAGTCTCTCTTT	0.488											OREG0025011	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T583T		Atlas-SNP	.											.	ALPK2	487	.	0			c.T1749C						PASS	.						112.0	98.0	103.0					18																	56246259		2203	4300	6503	SO:0001819	synonymous_variant	115701	exon4			GTGAGAAGTCTCT	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.1749T>C	chr18.hg19:g.56246259A>G		135.0	0.0	.	1014	139.0	47.0	.	NM_052947	Q6ZUX0|Q8NAT5|Q96L95	Silent	SNP	ENST00000361673.3	hg19	CCDS11966.2																																																																																			.	.	.	none		0.488	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947	
ALPK2	115701	hgsc.bcm.edu	37	18	56246453	56246453	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr18:56246453T>C	ENST00000361673.3	-	4	1768	c.1555A>G	c.(1555-1557)Aga>Gga	p.R519G	ALPK2_ENST00000587399.1_5'Flank	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	519						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						CCCCCCACTCTCTTGTCAGCT	0.517											OREG0025011	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R519G		Atlas-SNP	.											.	ALPK2	487	.	0			c.A1555G						PASS	.						215.0	216.0	215.0					18																	56246453		2203	4300	6503	SO:0001583	missense	115701	exon4			CCACTCTCTTGTC	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.1555A>G	chr18.hg19:g.56246453T>C	ENSP00000354991:p.Arg519Gly	97.0	0.0	.	1014	82.0	22.0	.	NM_052947	Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	hg19	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	T	15.35	2.806447	0.50421	.	.	ENSG00000198796	ENST00000361673	T	0.55052	0.54	5.14	1.07	0.20283	.	1.544590	0.04399	N	0.363947	T	0.44871	0.1314	L	0.31752	0.955	0.09310	N	1	B	0.24963	0.115	B	0.25614	0.062	T	0.40887	-0.9539	10	0.39692	T	0.17	-1.5845	12.1854	0.54236	0.0:0.0:0.4301:0.5699	.	519	Q86TB3	ALPK2_HUMAN	G	519	ENSP00000354991:R519G	ENSP00000354991:R519G	R	-	1	2	ALPK2	54397433	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.462000	0.21956	0.270000	0.21984	0.533000	0.62120	AGA	.	.	.	none		0.517	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947	
ODF3L2	284451	hgsc.bcm.edu	37	19	464231	464231	+	Silent	SNP	A	A	G			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr19:464231A>G	ENST00000315489.4	-	4	718	c.483T>C	c.(481-483)ccT>ccC	p.P161P	ODF3L2_ENST00000382696.3_Silent_p.P125P	NM_182577.2	NP_872383.1	Q3SX64	OD3L2_HUMAN	outer dense fiber of sperm tails 3-like 2	161	Pro-rich.					cytoplasmic microtubule (GO:0005881)				large_intestine(1)|lung(2)	3						TGTAGGCATTAGGGGCAGGGG	0.711																																					p.P161P		Atlas-SNP	.											.	ODF3L2	18	.	0			c.T483C						PASS	.						6.0	7.0	7.0					19																	464231		1948	3822	5770	SO:0001819	synonymous_variant	284451	exon4			GGCATTAGGGGCA	AK097378	CCDS12027.1	19p13.3	2010-04-23	2008-07-04	2008-07-04		ENSG00000181781			26841	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 19"""	C19orf19		14702039	Standard	NM_182577		Approved	FLJ40059	uc002lor.3	Q3SX64		ENST00000315489.4:c.483T>C	chr19.hg19:g.464231A>G		87.0	0.0	.		84.0	18.0	.	NM_182577	Q3SX65|Q8N1L2	Silent	SNP	ENST00000315489.4	hg19	CCDS12027.1																																																																																			.	.	.	none		0.711	ODF3L2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451849.2	NM_182577	
UBXN6	80700	hgsc.bcm.edu	37	19	4446696	4446696	+	Missense_Mutation	SNP	C	C	T	rs563472721		TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr19:4446696C>T	ENST00000301281.6	-	8	845	c.721G>A	c.(721-723)Gtg>Atg	p.V241M	CTB-50L17.7_ENST00000588798.1_RNA|MIR4746_ENST00000579802.1_RNA|UBXN6_ENST00000394765.3_Missense_Mutation_p.V188M	NM_025241.2	NP_079517.1	Q9BZV1	UBXN6_HUMAN	UBX domain protein 6	241	PUB.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	12						TCGCTCAGCACGTAGAACTCC	0.677																																					p.V241M		Atlas-SNP	.											.	UBXN6	27	.	0			c.G721A						PASS	.						41.0	39.0	39.0					19																	4446696		2203	4299	6502	SO:0001583	missense	80700	exon8			TCAGCACGTAGAA	AF272893	CCDS12129.1, CCDS54201.1	19p13	2008-07-25	2008-07-25	2008-07-25		ENSG00000167671		"""UBX domain containing"""	14928	protein-coding gene	gene with protein product		611946	"""UBX domain-containing 1"", ""UBX domain containing 1"""	UBXD1		11342112	Standard	NM_025241		Approved	UBXDC2	uc002man.2	Q9BZV1		ENST00000301281.6:c.721G>A	chr19.hg19:g.4446696C>T	ENSP00000301281:p.Val241Met	108.0	0.0	.		114.0	46.0	.	NM_025241	D6W626|Q96AH1|Q96IK9|Q9BZV0	Missense_Mutation	SNP	ENST00000301281.6	hg19	CCDS12129.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.123000	0.77436	.	.	ENSG00000167671	ENST00000301281;ENST00000394765	T;T	0.39056	1.54;1.1	4.82	4.82	0.62117	PUG domain (1);PUB domain (1);	0.000000	0.85682	D	0.000000	T	0.67221	0.2870	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	T	0.72994	-0.4122	10	0.72032	D	0.01	-49.8103	16.8633	0.86023	0.0:1.0:0.0:0.0	.	188;241	Q9BZV1-2;Q9BZV1	.;UBXN6_HUMAN	M	241;188	ENSP00000301281:V241M;ENSP00000378246:V188M	ENSP00000301281:V241M	V	-	1	0	UBXN6	4397696	1.000000	0.71417	0.994000	0.49952	0.566000	0.35808	5.377000	0.66184	2.227000	0.72691	0.491000	0.48974	GTG	.	.	.	none		0.677	UBXN6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458447.3	NM_025241	
SMARCA4	6597	hgsc.bcm.edu	37	19	11113759	11113759	+	Nonsense_Mutation	SNP	G	G	T			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr19:11113759G>T	ENST00000429416.3	+	13	2148	c.1867G>T	c.(1867-1869)Gag>Tag	p.E623*	SMARCA4_ENST00000590574.1_Nonsense_Mutation_p.E623*|SMARCA4_ENST00000413806.3_Nonsense_Mutation_p.E623*|SMARCA4_ENST00000589677.1_Nonsense_Mutation_p.E623*|SMARCA4_ENST00000541122.2_Nonsense_Mutation_p.E623*|SMARCA4_ENST00000344626.4_Nonsense_Mutation_p.E623*|SMARCA4_ENST00000444061.3_Nonsense_Mutation_p.E623*|SMARCA4_ENST00000358026.2_Nonsense_Mutation_p.E623*|SMARCA4_ENST00000450717.3_Nonsense_Mutation_p.E623*	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	623					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GATCCACGTGGAGAGTGGGAA	0.602			"""F, N, Mis"""		NSCLC																																p.E623X		Atlas-SNP	.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4	502	.	1	Unknown(1)	lung(1)	c.G1867T						PASS	.						85.0	84.0	84.0					19																	11113759		2203	4300	6503	SO:0001587	stop_gained	6597	exon12			CACGTGGAGAGTG	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.1867G>T	chr19.hg19:g.11113759G>T	ENSP00000395654:p.Glu623*	111.0	0.0	.		90.0	38.0	.	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Nonsense_Mutation	SNP	ENST00000429416.3	hg19	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	39	7.430867	0.98279	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	.	.	.	4.57	4.57	0.56435	.	0.059842	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-47.5138	16.6596	0.85238	0.0:0.0:1.0:0.0	.	.	.	.	X	623;623;687;623;623;623;623;623	.	ENSP00000343896:E623X	E	+	1	0	SMARCA4	10974759	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	9.601000	0.98297	2.526000	0.85167	0.563000	0.77884	GAG	.	.	.	none		0.602	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
ELAVL3	1995	hgsc.bcm.edu	37	19	11577519	11577519	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr19:11577519A>G	ENST00000359227.3	-	2	557	c.133T>C	c.(133-135)Tac>Cac	p.Y45H	CTC-398G3.6_ENST00000585656.1_3'UTR|ELAVL3_ENST00000438662.2_Missense_Mutation_p.Y45H|RN7SL669P_ENST00000581926.1_RNA	NM_001420.3|NM_032281.2	NP_001411.2|NP_115657.2	Q14576	ELAV3_HUMAN	ELAV like neuron-specific RNA binding protein 3	45	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)		AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15						TGGGGCAGGTAGTTGACGATG	0.602																																					p.Y45H		Atlas-SNP	.											.	ELAVL3	58	.	0			c.T133C						PASS	.						149.0	127.0	134.0					19																	11577519		2203	4300	6503	SO:0001583	missense	1995	exon2			GCAGGTAGTTGAC		CCDS32912.1, CCDS45978.1	19p13.2	2013-10-03	2013-10-03			ENSG00000196361		"""RNA binding motif (RRM) containing"""	3314	protein-coding gene	gene with protein product	"""Hu antigen C"", ""paraneoplastic limbic encephalitis antigen 21"", ""paraneoplastic cerebellar degeneration-associated antigen"", ""ELAV-like protein 3"""	603458	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)"""			9799595	Standard	NM_001420		Approved	HUC, PLE21, DKFZp547J036, HUCL, MGC20653	uc002mry.1	Q14576		ENST00000359227.3:c.133T>C	chr19.hg19:g.11577519A>G	ENSP00000352162:p.Tyr45His	129.0	0.0	.		102.0	32.0	.	NM_032281	Q16135|Q96CL8|Q96QS9	Missense_Mutation	SNP	ENST00000359227.3	hg19	CCDS32912.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.214625	0.79352	.	.	ENSG00000196361	ENST00000359227;ENST00000438662	T;T	0.73897	-0.79;3.4	4.83	3.82	0.43975	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.72969	0.3527	N	0.13352	0.335	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.76071	0.987;0.986	T	0.75033	-0.3460	10	0.87932	D	0	.	9.5216	0.39138	0.9149:0.0:0.085:0.0	.	45;45	Q14576;Q14576-2	ELAV3_HUMAN;.	H	45	ENSP00000352162:Y45H;ENSP00000390878:Y45H	ENSP00000352162:Y45H	Y	-	1	0	ELAVL3	11438519	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.943000	0.92975	0.887000	0.36136	0.523000	0.50628	TAC	.	.	.	none		0.602	ELAVL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458827.2	NM_001420	
ZBTB32	27033	hgsc.bcm.edu	37	19	36205913	36205913	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr19:36205913G>A	ENST00000392197.2	+	3	703	c.385G>A	c.(385-387)Gag>Aag	p.E129K	ZBTB32_ENST00000262630.3_Missense_Mutation_p.E129K			Q9Y2Y4	ZBT32_HUMAN	zinc finger and BTB domain containing 32	129					DNA repair (GO:0006281)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cytokine production (GO:0001817)|T cell proliferation (GO:0042098)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(1)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	14	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GAAACATCAGGAGGAGCCAGA	0.572																																					p.E129K		Atlas-SNP	.											.	ZBTB32	33	.	0			c.G385A						PASS	.						45.0	48.0	47.0					19																	36205913		2203	4300	6503	SO:0001583	missense	27033	exon2			CATCAGGAGGAGC	AF130255	CCDS12471.1	19q13.1	2013-01-08			ENSG00000011590	ENSG00000011590		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16763	protein-coding gene	gene with protein product	"""repressor of GATA"""	605859				10572087	Standard	XM_005258739		Approved	TZFP, FAZF, FAXF, Rog, ZNF538	uc002oay.3	Q9Y2Y4	OTTHUMG00000048118	ENST00000392197.2:c.385G>A	chr19.hg19:g.36205913G>A	ENSP00000376035:p.Glu129Lys	147.0	0.0	.		173.0	17.0	.	NM_014383	Q8WVP2	Missense_Mutation	SNP	ENST00000392197.2	hg19	CCDS12471.1	.	.	.	.	.	.	.	.	.	.	G	10.90	1.482481	0.26598	.	.	ENSG00000011590	ENST00000262630;ENST00000392197	T;T	0.09073	3.02;3.02	4.6	3.56	0.40772	.	0.471504	0.18012	N	0.154527	T	0.05593	0.0147	L	0.27053	0.805	0.28847	N	0.896287	B	0.27997	0.197	B	0.19148	0.024	T	0.28650	-1.0037	10	0.27785	T	0.31	-7.7093	8.4166	0.32674	0.1093:0.0:0.8907:0.0	.	129	Q9Y2Y4	ZBT32_HUMAN	K	129	ENSP00000262630:E129K;ENSP00000376035:E129K	ENSP00000262630:E129K	E	+	1	0	ZBTB32	40897753	0.482000	0.25948	0.266000	0.24541	0.184000	0.23303	0.556000	0.23438	0.916000	0.36871	0.655000	0.94253	GAG	.	.	.	none		0.572	ZBTB32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109491.3	NM_014383	
PPP1R15A	23645	hgsc.bcm.edu	37	19	49376934	49376934	+	Silent	SNP	A	A	T			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr19:49376934A>T	ENST00000200453.5	+	2	713	c.444A>T	c.(442-444)atA>atT	p.I148I		NM_014330.3	NP_055145.3	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	148					apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of translation (GO:0006417)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(8)|skin(2)|urinary_tract(1)	23		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		GCCTTCTGATAAGGACACTGC	0.532																																					p.I148I		Atlas-SNP	.											.	PPP1R15A	48	.	0			c.A444T						PASS	.						146.0	135.0	139.0					19																	49376934		2203	4300	6503	SO:0001819	synonymous_variant	23645	exon2			TCTGATAAGGACA	U83981	CCDS12738.1	19q13.2	2012-04-17	2011-10-04		ENSG00000087074	ENSG00000087074		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14375	protein-coding gene	gene with protein product	"""growth arrest and DNA-damage-inducible 34"""	611048	"""protein phosphatase 1, regulatory (inhibitor) subunit 15A"""			9153226, 9413226	Standard	NM_014330		Approved	GADD34	uc002pky.4	O75807		ENST00000200453.5:c.444A>T	chr19.hg19:g.49376934A>T		112.0	0.0	.		136.0	48.0	.	NM_014330	B4DKQ3|Q6IA96|Q9NVU6	Silent	SNP	ENST00000200453.5	hg19	CCDS12738.1																																																																																			.	.	.	none		0.532	PPP1R15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466226.1	NM_014330	
POFUT1	23509	hgsc.bcm.edu	37	20	30803187	30803187	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr20:30803187A>G	ENST00000375749.3	+	3	424	c.362A>G	c.(361-363)aAg>aGg	p.K121R	POFUT1_ENST00000375730.3_Missense_Mutation_p.K121R|POFUT1_ENST00000486717.1_3'UTR|POFUT1_ENST00000539210.1_Intron	NM_015352.1	NP_056167.1	Q9H488	OFUT1_HUMAN	protein O-fucosyltransferase 1	121					angiogenesis (GO:0001525)|embryo development (GO:0009790)|fucose metabolic process (GO:0006004)|heart development (GO:0007507)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|O-glycan processing (GO:0016266)|protein O-linked fucosylation (GO:0036066)|protein O-linked glycosylation (GO:0006493)|regulation of transcription, DNA-templated (GO:0006355)|somitogenesis (GO:0001756)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	fucosyltransferase activity (GO:0008417)|peptide-O-fucosyltransferase activity (GO:0046922)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|urinary_tract(1)	6			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CCCCCTGAGAAGCGGGTGGCA	0.597																																					p.K121R		Atlas-SNP	.											.	POFUT1	52	.	0			c.A362G						PASS	.						78.0	84.0	82.0					20																	30803187		2203	4300	6503	SO:0001583	missense	23509	exon3			CTGAGAAGCGGGT	AF375884	CCDS13198.1, CCDS13199.1	20q11	2013-03-06			ENSG00000101346	ENSG00000101346	2.4.1.221	"""Fucosyltransferases"""	14988	protein-coding gene	gene with protein product	"""peptide-O-fucosyltransferase"", ""GDP-fucose protein O-fucosyltransferase 1"""	607491				9023546, 9525914	Standard	NM_015352		Approved	O-FUT, O-Fuc-T, KIAA0180, FUT12	uc002wxp.3	Q9H488	OTTHUMG00000133268	ENST00000375749.3:c.362A>G	chr20.hg19:g.30803187A>G	ENSP00000364902:p.Lys121Arg	135.0	0.0	.		141.0	57.0	.	NM_172236	A8K4R8|E1P5M4|Q14685|Q5W185|Q9BW76	Missense_Mutation	SNP	ENST00000375749.3	hg19	CCDS13198.1	.	.	.	.	.	.	.	.	.	.	A	13.72	2.322856	0.41096	.	.	ENSG00000101346	ENST00000375749;ENST00000375730	T;T	0.30448	1.53;1.53	5.64	-2.63	0.06133	.	0.492888	0.25987	N	0.027029	T	0.20414	0.0491	L	0.37697	1.125	0.80722	D	1	B;B	0.11235	0.001;0.004	B;B	0.13407	0.009;0.004	T	0.15752	-1.0426	10	0.17832	T	0.49	-15.5232	13.9147	0.63890	0.4791:0.0:0.5209:0.0	.	121;121	Q9H488;Q9H488-2	OFUT1_HUMAN;.	R	121	ENSP00000364902:K121R;ENSP00000364882:K121R	ENSP00000364882:K121R	K	+	2	0	POFUT1	30266848	0.995000	0.38212	0.916000	0.36221	0.996000	0.88848	0.605000	0.24179	-0.744000	0.04778	0.533000	0.62120	AAG	.	.	.	none		0.597	POFUT1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078613.1	NM_015352	
NEFH	4744	hgsc.bcm.edu	37	22	29885848	29885848	+	Missense_Mutation	SNP	T	T	A	rs464517		TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr22:29885848T>A	ENST00000310624.6	+	4	2252	c.2219T>A	c.(2218-2220)gTg>gAg	p.V740E		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	746	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AAGTCCCCAGTGAAGGAAGAA	0.547																																					p.V740E		Atlas-SNP	.											.	NEFH	178	.	0			c.T2219A						PASS	.						101.0	102.0	102.0					22																	29885848		2203	4300	6503	SO:0001583	missense	4744	exon4			CCCCAGTGAAGGA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2219T>A	chr22.hg19:g.29885848T>A	ENSP00000311997:p.Val740Glu	193.0	0.0	.		279.0	46.0	.	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	hg19	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	T	0.201	-1.044796	0.01997	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.82344	-1.6	4.0	2.89	0.33648	.	0.451396	0.18731	N	0.132724	T	0.72220	0.3433	L	0.51422	1.61	0.26362	N	0.977028	B	0.17667	0.023	B	0.12156	0.007	T	0.53683	-0.8404	10	0.13470	T	0.59	.	4.1768	0.10356	0.496:0.0989:0.0:0.4051	rs464517;rs464517	746	P12036	NFH_HUMAN	E	740	ENSP00000311997:V740E	ENSP00000311997:V740E	V	+	2	0	NEFH	28215848	0.000000	0.05858	0.465000	0.27155	0.670000	0.39368	-2.059000	0.01393	0.375000	0.24679	0.418000	0.28097	GTG	.	T|1.000;|0.000	.	weak		0.547	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
EP300	2033	hgsc.bcm.edu	37	22	41542756	41542756	+	Silent	SNP	T	T	C			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr22:41542756T>C	ENST00000263253.7	+	11	3286	c.2067T>C	c.(2065-2067)ccT>ccC	p.P689P		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	689					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						GCCCTCTACCTGACCCAAGTA	0.373			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.P689P		Atlas-SNP	.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300	367	.	0			c.T2067C						PASS	.						93.0	91.0	92.0					22																	41542756		2203	4300	6503	SO:0001819	synonymous_variant	2033	exon11	Familial Cancer Database	Broad Thumb-Hallux syndrome	TCTACCTGACCCA	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.2067T>C	chr22.hg19:g.41542756T>C		64.0	0.0	.		81.0	27.0	.	NM_001429	B1AKC2	Silent	SNP	ENST00000263253.7	hg19	CCDS14010.1																																																																																			.	.	.	none		0.373	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
USP11	8237	hgsc.bcm.edu	37	X	47103934	47103934	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chrX:47103934G>A	ENST00000218348.3	+	14	1957	c.1957G>A	c.(1957-1959)Gat>Aat	p.D653N	USP11_ENST00000377107.2_Missense_Mutation_p.D610N	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	653	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						TGATGAGGACGATGGGGATGA	0.572																																					p.D653N		Atlas-SNP	.											.	USP11	93	.	0			c.G1957A						PASS	.						77.0	61.0	67.0					X																	47103934		2203	4300	6503	SO:0001583	missense	8237	exon14			GAGGACGATGGGG	U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.1957G>A	chrX.hg19:g.47103934G>A	ENSP00000218348:p.Asp653Asn	109.0	0.0	.		103.0	71.0	.	NM_004651	B2RTX1|Q8IUG6|Q9BWE1	Missense_Mutation	SNP	ENST00000218348.3	hg19	CCDS14277.1	.	.	.	.	.	.	.	.	.	.	G	13.82	2.350316	0.41599	.	.	ENSG00000102226	ENST00000377107;ENST00000218348	T;T	0.20738	2.06;2.05	5.29	5.29	0.74685	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.135164	0.33631	N	0.004707	T	0.15132	0.0365	N	0.16066	0.365	0.37750	D	0.925941	B;P	0.52463	0.041;0.953	B;P	0.46237	0.026;0.508	T	0.13791	-1.0496	10	0.16420	T	0.52	-7.848	13.3561	0.60629	0.0:0.0:1.0:0.0	.	380;653	B3KP28;P51784	.;UBP11_HUMAN	N	610;653	ENSP00000366311:D610N;ENSP00000218348:D653N	ENSP00000218348:D653N	D	+	1	0	USP11	46988878	0.983000	0.35010	0.533000	0.28001	0.881000	0.50899	3.296000	0.51802	2.217000	0.71921	0.600000	0.82982	GAT	.	.	.	none		0.572	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_004651	
DGKQ	1609	hgsc.bcm.edu	37	4	959714	959715	+	Splice_Site	INS	-	-	C			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr4:959714_959715insC	ENST00000273814.3	-	13	1653		c.e13+1		DGKQ_ENST00000502309.1_Intron	NM_001347.3	NP_001338.2	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta 110kDa						blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|protein kinase C signaling (GO:0070528)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to ATP (GO:0033198)|thrombin receptor signaling pathway (GO:0070493)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|phospholipase binding (GO:0043274)			breast(1)|endometrium(2)|kidney(2)|lung(2)|prostate(2)	9			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			CAGTGGTCACACCTTTGGTAGC	0.688																																					.	Esophageal Squamous(17;537 645 4447 26373)	Atlas-Indel,Pindel	.											.	DGKQ	29	.	0			c.1579+2->G						PASS	.																																			SO:0001630	splice_region_variant	1609	exon14			.	L38707	CCDS3342.1	4p16.3	2008-08-29	2002-08-29		ENSG00000145214	ENSG00000145214			2856	protein-coding gene	gene with protein product		601207	"""diacylglycerol kinase, theta (110kD)"""	DAGK4		8617502, 9099683	Standard	NM_001347		Approved	DAGK, DAGK7	uc003gbw.4	P52824	OTTHUMG00000088629	ENST00000273814.3:c.1579+1->G	chr4.hg19:g.959716_959716dupC		150.0	0.0	0		123.0	45.0	0.365854	NM_001347	Q6P3W4	Splice_Site	INS	ENST00000273814.3	hg19	CCDS3342.1																																																																																			.	.	.	none		0.688	DGKQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000200888.1		Intron
NHLRC2	374354	hgsc.bcm.edu	37	10	115636691	115636691	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr10:115636691delT	ENST00000369301.3	+	3	955	c.743delT	c.(742-744)attfs	p.I248fs		NM_198514.3	NP_940916.2	Q8NBF2	NHLC2_HUMAN	NHL repeat containing 2	248										breast(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	15				Epithelial(162;0.017)|all cancers(201;0.0187)		CATCATAGAATTTTGGTCGTT	0.353																																					p.I248fs		Atlas-Indel,Pindel	.											NHLRC2,NS,carcinoma,0,1	NHLRC2	56	.	0			c.742delA						PASS	.						55.0	57.0	57.0					10																	115636691		2157	4275	6432	SO:0001589	frameshift_variant	374354	exon3			.	AK090631	CCDS7585.1	10q26.11	2006-03-31			ENSG00000196865	ENSG00000196865			24731	protein-coding gene	gene with protein product						12477932	Standard	NM_198514		Approved	FLJ25621, FLJ20147, FLJ33312, MGC45492, DKFZp779F115	uc001lax.2	Q8NBF2	OTTHUMG00000019078	ENST00000369301.3:c.743delT	chr10.hg19:g.115636691delT	ENSP00000358307:p.Ile248fs	63.0	0.0	0		62.0	16.0	0.258065	NM_198514	Q8N1H1|Q8N5A6	Frame_Shift_Del	DEL	ENST00000369301.3	hg19	CCDS7585.1																																																																																			.	.	.	none		0.353	NHLRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050446.1	NM_198514	
C16orf86	388284	hgsc.bcm.edu	37	16	67702481	67702482	+	Frame_Shift_Ins	INS	-	-	T	rs376801265		TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr16:67702481_67702482insT	ENST00000403458.4	+	4	1087_1088	c.932_933insT	c.(931-936)ccgctcfs	p.L312fs	ENKD1_ENST00000602644.1_5'Flank|ENKD1_ENST00000243878.4_5'Flank|ENKD1_ENST00000602409.1_5'Flank	NM_001012984.2	NP_001013002.2	Q6ZW13	CP086_HUMAN	chromosome 16 open reading frame 86	312										endometrium(2)|lung(4)	6		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		CTTGTCCCCCCGCTCTCTCCTC	0.609											OREG0023886	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P311fs		Atlas-Indel,Pindel	.											.	C16orf86	20	.	0			c.932_933insT						PASS	.																																			SO:0001589	frameshift_variant	388284	exon4			.		CCDS32468.2	16q22.1	2008-10-30			ENSG00000159761	ENSG00000159761			33755	protein-coding gene	gene with protein product							Standard	NM_001012984		Approved	FLJ41802	uc002ety.3	Q6ZW13	OTTHUMG00000150527	Exception_encountered	chr16.hg19:g.67702481_67702482insT	ENSP00000384117:p.Leu312fs	80.0	0.0	0	1101	114.0	57.0	0.5	NM_001012984	B5MCW6	Frame_Shift_Ins	INS	ENST00000403458.4	hg19	CCDS32468.2																																																																																			.	.	.	none		0.609	C16orf86-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318767.2	NM_001012984	
TIGD6	81789	hgsc.bcm.edu	37	5	149375126	149375127	+	Frame_Shift_Ins	INS	-	-	T			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr5:149375126_149375127insT	ENST00000296736.3	-	2	1559_1560	c.785_786insA	c.(784-786)aatfs	p.N262fs	TIGD6_ENST00000515406.2_Frame_Shift_Ins_p.N262fs	NM_030953.3	NP_112215.1	Q17RP2	TIGD6_HUMAN	tigger transposable element derived 6	262	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|stomach(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TCAGCCACTCATTAAACAGATC	0.525																																					p.N262fs		Atlas-Indel,Pindel	.											.	TIGD6	29	.	0			c.786_787insA						PASS	.																																			SO:0001589	frameshift_variant	81789	exon2			.	AK056604	CCDS4301.1	5q33.1	2008-02-05			ENSG00000164296	ENSG00000164296			18332	protein-coding gene	gene with protein product						11230166	Standard	NM_030953		Approved	DKFZp761E2110	uc003lrj.3	Q17RP2	OTTHUMG00000130045	ENST00000296736.3:c.786dupA	chr5.hg19:g.149375128_149375128dupT	ENSP00000296736:p.Asn262fs	164.0	0.0	0		166.0	59.0	0.355422	NM_001243253	B3KTZ8|Q96MQ4|Q9H0X7	Frame_Shift_Ins	INS	ENST00000296736.3	hg19	CCDS4301.1																																																																																			.	.	.	none		0.525	TIGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252324.1	NM_030953	
DPCD	25911	hgsc.bcm.edu	37	10	103360511	103360512	+	Frame_Shift_Ins	INS	-	-	A			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr10:103360511_103360512insA	ENST00000370151.4	+	3	211_212	c.162_163insA	c.(163-165)aaafs	p.K55fs	DPCD_ENST00000370147.1_Frame_Shift_Ins_p.K55fs|DPCD_ENST00000370148.2_Frame_Shift_Ins_p.K55fs|MIR3158-1_ENST00000583596.1_RNA	NM_015448.1	NP_056263.1	Q9BVM2	DPCD_HUMAN	deleted in primary ciliary dyskinesia homolog (mouse)	55					determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|lateral ventricle development (GO:0021670)|left/right pattern formation (GO:0060972)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)	nucleus (GO:0005634)				endometrium(1)|large_intestine(1)|lung(2)|skin(1)	5						AGTGGCGTGTGAAAAGTGCCCT	0.554																																					p.V54fs		Atlas-Indel,Pindel	.											.	DPCD	15	.	0			c.162_163insA						PASS	.																																			SO:0001589	frameshift_variant	25911	exon3			.		CCDS7514.1	10q24.32	2012-05-03			ENSG00000166171	ENSG00000166171			24542	protein-coding gene	gene with protein product						14630615	Standard	NM_015448		Approved	DKFZP566F084, RP11-529I10.4	uc001ktn.3	Q9BVM2	OTTHUMG00000018934	ENST00000370151.4:c.166dupA	chr10.hg19:g.103360515_103360515dupA	ENSP00000359170:p.Lys55fs	99.0	0.0	0		103.0	30.0	0.291262	NM_015448	A8K289|Q6QNL3|Q8N5R1|Q9UFY6	Frame_Shift_Ins	INS	ENST00000370151.4	hg19	CCDS7514.1																																																																																			.	.	.	none		0.554	DPCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049958.2		
NEFH	4744	hgsc.bcm.edu	37	22	29885853	29885858	+	In_Frame_Del	DEL	GAAGAA	GAAGAA	-	rs59890097|rs570663492|rs377642315|rs532587474	byFrequency	TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	GAAGAA	GAAGAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr22:29885853_29885858delGAAGAA	ENST00000310624.6	+	4	2257_2262	c.2224_2229delGAAGAA	c.(2224-2229)gaagaadel	p.EE742del		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	748	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CCCAGTGAAGGAAGAAGCTAAGTCCC	0.553																																					p.741_743del		Atlas-INDEL	.											.	NEFH	178	.	0			c.2223_2228del						PASS	.																																			SO:0001651	inframe_deletion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2224_2229delGAAGAA	chr22.hg19:g.29885853_29885858delGAAGAA	ENSP00000311997:p.Glu742_Glu743del	326.0	0.0	0		290.0	20.0	0.0689655	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Del	DEL	ENST00000310624.6	hg19	CCDS13858.1																																																																																			.	.	.	weak		0.553	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NAT9	26151	hgsc.bcm.edu	37	17	72767943	72767946	+	Frame_Shift_Del	DEL	ACTC	ACTC	-			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	ACTC	ACTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr17:72767943_72767946delACTC	ENST00000357814.3	-	7	614_617	c.541_544delGAGT	c.(541-546)gagtccfs	p.ES181fs	NAT9_ENST00000583476.1_3'UTR|NAT9_ENST00000578822.1_Frame_Shift_Del_p.ES186fs|NAT9_ENST00000582870.1_Frame_Shift_Del_p.ES185fs|NAT9_ENST00000580216.1_5'Flank|NAT9_ENST00000582524.1_Stop_Codon_Del|NAT9_ENST00000581136.1_Frame_Shift_Del_p.ES176fs|NAT9_ENST00000583757.1_Stop_Codon_Del|NAT9_ENST00000580301.1_Frame_Shift_Del_p.ES180fs|NAT9_ENST00000580632.1_Frame_Shift_Del_p.ES181fs	NM_015654.3	NP_056469.2	Q9BTE0	NAT9_HUMAN	N-acetyltransferase 9 (GCN5-related, putative)	181						protein complex (GO:0043234)	N-acetyltransferase activity (GO:0008080)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)	8						TGATGCTCGGACTCACTCACTGTC	0.559																																					p.181_182del		Atlas-Indel,Pindel	.											.	NAT9	16	.	0			c.542_545del						PASS	.																																			SO:0001589	frameshift_variant	26151	exon7			.	AK123115	CCDS11706.1	17q25.2	2011-11-25	2008-09-24		ENSG00000109065	ENSG00000109065			23133	protein-coding gene	gene with protein product			"""N-acetyltransferase 9"""			14608357	Standard	NM_015654		Approved	DKFZP564C103	uc002jlq.3	Q9BTE0		ENST00000357814.3:c.541_544delGAGT	chr17.hg19:g.72767947_72767950delACTC	ENSP00000350467:p.Glu181fs	78.0	0.0	0		115.0	56.0	0.486957	NM_015654	B2R7F0|Q9BTD0|Q9Y3T3	Frame_Shift_Del	DEL	ENST00000357814.3	hg19	CCDS11706.1																																																																																			.	.	.	none		0.559	NAT9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000443700.1	NM_015654	
NRDE2	55051	hgsc.bcm.edu	37	14	90769166	90769166	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr14:90769166delT	ENST00000354366.3	-	6	1541	c.1309delA	c.(1309-1311)attfs	p.I437fs	NRDE2_ENST00000357904.3_Frame_Shift_Del_p.I206fs	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing	437																	AGACTGTGAATTTTTGATATC	0.428																																					p.I437fs		Atlas-Indel,Pindel	.											.	.	.	.	0			c.1310delT						PASS	.						68.0	69.0	69.0					14																	90769166		2203	4300	6503	SO:0001589	frameshift_variant	55051	exon6			.	AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.1309delA	chr14.hg19:g.90769166delT	ENSP00000346335:p.Ile437fs	88.0	0.0	0		99.0	32.0	0.323232	NM_017970	B4DH71|Q4G0A7|Q9NWH6	Frame_Shift_Del	DEL	ENST00000354366.3	hg19	CCDS9890.1																																																																																			.	.	.	none		0.428	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411264.1	NM_017970	
ANK1	286	hgsc.bcm.edu	37	8	41551435	41551438	+	Frame_Shift_Del	DEL	GCGC	GCGC	-			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	GCGC	GCGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr8:41551435_41551438delGCGC	ENST00000347528.4	-	29	3593_3596	c.3510_3513delGCGC	c.(3508-3513)ctgcgcfs	p.LR1170fs	ANK1_ENST00000396945.1_Frame_Shift_Del_p.LR1170fs|ANK1_ENST00000265709.8_Frame_Shift_Del_p.LR1211fs|ANK1_ENST00000289734.7_Frame_Shift_Del_p.LR1170fs|ANK1_ENST00000379758.2_Frame_Shift_Del_p.LR1170fs|ANK1_ENST00000352337.4_Frame_Shift_Del_p.LR1170fs|ANK1_ENST00000396942.1_Frame_Shift_Del_p.LR1170fs	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1170	ZU5 2. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.R1171H(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TGCAAAGCAGGCGCAGGCTGGTGG	0.652																																					p.1212_1213del		Atlas-Indel,Pindel	.											.	ANK1	497	.	1	Substitution - Missense(1)	large_intestine(1)	c.3634_3637del						PASS	.																																			SO:0001589	frameshift_variant	286	exon30			.	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.3510_3513delGCGC	chr8.hg19:g.41551435_41551438delGCGC	ENSP00000339620:p.Leu1170fs	216.0	0.0	0		251.0	81.0	0.322709	NM_001142446	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Frame_Shift_Del	DEL	ENST00000347528.4	hg19	CCDS6119.1																																																																																			.	.	.	none		0.652	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
LDLR	3949	hgsc.bcm.edu	37	19	11217362	11217363	+	Splice_Site	DEL	TG	TG	-			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr19:11217362_11217363delTG	ENST00000558518.1	+	5	1003_1004	c.816_817delTG	c.(814-819)aatgtg>aatg	p.V273fs	LDLR_ENST00000558013.1_Splice_Site_p.V273fs|LDLR_ENST00000455727.2_Intron|LDLR_ENST00000545707.1_Splice_Site_p.V146fs|LDLR_ENST00000535915.1_Splice_Site_p.V232fs|LDLR_ENST00000557933.1_Splice_Site_p.V273fs	NM_000527.4|NM_001195798.1	NP_000518.1|NP_001182727.1	P01130	LDLR_HUMAN	low density lipoprotein receptor	273					cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|intestinal cholesterol absorption (GO:0030299)|lipid metabolic process (GO:0006629)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|phototransduction, visible light (GO:0007603)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol homeostasis (GO:2000188)|regulation of phosphatidylcholine catabolic process (GO:0010899)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.?(1)		breast(2)|endometrium(2)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Porfimer(DB00707)	GCTGCGTTAATGGTGAGCGCTG	0.54																																					p.272_272del	GBM(18;201 575 7820 21545)	Atlas-Indel,Pindel	.											.	LDLR	72	.	1	Unknown(1)	lung(1)	c.815_816del						PASS	.																																			SO:0001630	splice_region_variant	3949	exon5			.	AY114155	CCDS12254.1, CCDS56083.1, CCDS56084.1, CCDS56085.1, CCDS58651.1	19p13.2	2014-09-17	2008-08-01		ENSG00000130164	ENSG00000130164		"""Low density lipoprotein receptors"""	6547	protein-coding gene	gene with protein product	"""familial hypercholesterolemia"""	606945					Standard	NM_000527		Approved	LDLCQ2	uc002mqk.4	P01130		ENST00000558518.1:c.817+1TG>-	chr19.hg19:g.11217362_11217363delTG		148.0	0.0	0		120.0	48.0	0.4	NM_001195798	B4DII3|B4DJZ8|B4DR00|B4DTQ3|C0JYY8|H0YLU8|H0YNT7|Q53ZD9|Q59FQ1|Q9UDH7	Frame_Shift_Del	DEL	ENST00000558518.1	hg19	CCDS12254.1																																																																																			.	.	.	none		0.540	LDLR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415973.2		Frame_Shift_Del
ENTPD4	9583	hgsc.bcm.edu	37	8	23306313	23306313	+	Frame_Shift_Del	DEL	A	A	-			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr8:23306313delA	ENST00000358689.4	-	3	383	c.148delT	c.(148-150)tctfs	p.S50fs	ENTPD4_ENST00000356206.6_Frame_Shift_Del_p.S50fs|ENTPD4_ENST00000417069.2_Frame_Shift_Del_p.S50fs	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	50					UDP catabolic process (GO:0006256)	cytoplasmic vesicle (GO:0031410)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)	uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	25		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		ATGACAACAGAAAAATATAAA	0.378																																					p.S50fs		Atlas-Indel,Pindel	.											.	ENTPD4	56	.	0			c.149delC						PASS	.						108.0	114.0	112.0					8																	23306313		2203	4300	6503	SO:0001589	frameshift_variant	9583	exon3			.	AJ131358	CCDS6041.1, CCDS47827.1	8p21.3	2014-05-16	2004-09-22	2004-09-22	ENSG00000197217	ENSG00000197217			14573	protein-coding gene	gene with protein product		607577	"""lysosomal apyrase-like 1"""	LYSAL1		10393803, 9205841	Standard	NM_001128930		Approved	LALP70, LAP70, KIAA0392, NTPDase-4, UDPase	uc003xdl.3	Q9Y227	OTTHUMG00000097852	ENST00000358689.4:c.148delT	chr8.hg19:g.23306313delA	ENSP00000351520:p.Ser50fs	119.0	0.0	0		116.0	41.0	0.353448	NM_004901	D3DSS3|O15092	Frame_Shift_Del	DEL	ENST00000358689.4	hg19	CCDS6041.1																																																																																			.	.	.	none		0.378	ENTPD4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215142.1	NM_004901	
NAALADL2	254827	hgsc.bcm.edu	37	3	175184939	175184939	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr3:175184939delT	ENST00000454872.1	+	8	1628	c.1500delT	c.(1498-1500)gctfs	p.A500fs	NAALADL2_ENST00000473253.1_3'UTR	NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2	500						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		GAGGAACAGCTTTTGGCAATA	0.383																																					p.A500fs		Pindel	.											.	NAALADL2	86	.	0			c.1499delC						PASS	.						71.0	68.0	69.0					3																	175184939		1876	4108	5984	SO:0001589	frameshift_variant	254827	exon8			.		CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.1500delT	chr3.hg19:g.175184939delT	ENSP00000404705:p.Ala500fs	162.0	0.0	.		190.0	71.0	0.374	NM_207015	Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Frame_Shift_Del	DEL	ENST00000454872.1	hg19	CCDS46960.1																																																																																			.	.	.	none		0.383	NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347390.2	NM_207015	
DR1	1810	hgsc.bcm.edu	37	1	93812241	93812241	+	Frame_Shift_Del	DEL	C	C	-			TCGA-UZ-A9PK-01A-11D-A382-10	TCGA-UZ-A9PK-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9cb79cdb-d48d-4fd8-bdce-1f969be4a55f	36e67294-52d8-43b6-a9c0-0ed08f740cb3	g.chr1:93812241delC	ENST00000370272.4	+	1	797	c.39delC	c.(37-39)atcfs	p.I13fs	RP4-717I23.3_ENST00000413606.1_RNA|DR1_ENST00000370267.1_Frame_Shift_Del_p.I13fs|RP4-717I23.3_ENST00000451302.2_RNA	NM_001938.2	NP_001929.1	Q01658	NC2B_HUMAN	down-regulator of transcription 1, TBP-binding (negative cofactor 2)	13					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(3)|large_intestine(1)	4		all_lung(203;0.00252)|Lung NSC(277;0.011)|Melanoma(281;0.155)		all cancers(265;0.0032)|GBM - Glioblastoma multiforme(16;0.0165)|Epithelial(280;0.0977)		ATCTCACTATCCCCAGAGCTG	0.507																																					p.I13fs		Pindel	.											.	DR1	10	.	0			c.38delT						PASS	.						87.0	89.0	88.0					1																	93812241		2203	4300	6503	SO:0001589	frameshift_variant	1810	exon1			.	M97388	CCDS744.1	1p22.1	2008-02-05			ENSG00000117505	ENSG00000117505			3017	protein-coding gene	gene with protein product		601482				1339312, 9040789	Standard	NM_001938		Approved	NC2, NC2-BETA	uc001dpu.3	Q01658	OTTHUMG00000010862	ENST00000370272.4:c.39delC	chr1.hg19:g.93812241delC	ENSP00000359295:p.Ile13fs	137.0	0.0	.		110.0	30.0	0.273	NM_001938		Frame_Shift_Del	DEL	ENST00000370272.4	hg19	CCDS744.1																																																																																			.	.	.	none		0.507	DR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029976.2	NM_001938	
