#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SPOCD1	90853	hgsc.bcm.edu	37	1	32265460	32265460	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr1:32265460C>T	ENST00000360482.2	-	6	1862	c.1733G>A	c.(1732-1734)gGc>gAc	p.G578D	SPOCD1_ENST00000373648.2_Missense_Mutation_p.G519D|SPOCD1_ENST00000257100.3_Missense_Mutation_p.G71D|SPOCD1_ENST00000533231.1_Missense_Mutation_p.G578D	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	578					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		CTCCATTGGGCCACTCTGTAG	0.622																																					p.G578D		Atlas-SNP	.											.	SPOCD1	109	.	0			c.G1733A						PASS	.						56.0	56.0	56.0					1																	32265460		2203	4300	6503	SO:0001583	missense	90853	exon6			ATTGGGCCACTCT	AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.1733G>A	chr1.hg19:g.32265460C>T	ENSP00000353670:p.Gly578Asp	108.0	0.0	.		101.0	44.0	.	NM_144569	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	ENST00000360482.2	hg19	CCDS347.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.041247	0.55003	.	.	ENSG00000134668	ENST00000257100;ENST00000360482;ENST00000373648;ENST00000533231;ENST00000528791	T;T;T;T	0.51071	0.99;1.99;0.72;1.97	3.95	0.984	0.19773	.	.	.	.	.	T	0.24509	0.0594	N	0.14661	0.345	0.09310	N	1	B;B	0.23891	0.093;0.056	B;B	0.24541	0.054;0.024	T	0.19679	-1.0298	9	0.22706	T	0.39	-0.0365	2.9274	0.05788	0.218:0.5427:0.0:0.2393	.	578;578	Q6ZMY3-2;Q6ZMY3	.;SPOC1_HUMAN	D	71;578;519;578;71	ENSP00000257100:G71D;ENSP00000353670:G578D;ENSP00000362752:G519D;ENSP00000435851:G578D	ENSP00000257100:G71D	G	-	2	0	SPOCD1	32038047	0.000000	0.05858	0.000000	0.03702	0.335000	0.28730	0.008000	0.13197	0.218000	0.20820	0.551000	0.68910	GGC	.	.	.	none		0.622	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000381912.1	NM_144569	
SFPQ	6421	hgsc.bcm.edu	37	1	35656516	35656516	+	Silent	SNP	A	A	G			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr1:35656516A>G	ENST00000357214.5	-	3	1196	c.1098T>C	c.(1096-1098)ttT>ttC	p.F366F		NM_005066.2	NP_005057.1	P23246	SFPQ_HUMAN	splicing factor proline/glutamine-rich	366	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H3 deacetylation (GO:0070932)|mRNA processing (GO:0006397)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|histone deacetylase binding (GO:0042826)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)		SFPQ/TFE3(6)	NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				CATGTGTGGCAAAGCGAACTC	0.453			T	TFE3	papillary renal cell																																p.F366F		Atlas-SNP	.		Dom	yes		1	1p34.3	6421	splicing factor proline/glutamine rich(polypyrimidine tract binding protein associated)		E	.	SFPQ	51	.	0			c.T1098C						PASS	.						76.0	74.0	75.0					1																	35656516		2203	4300	6503	SO:0001819	synonymous_variant	6421	exon3			TGTGGCAAAGCGA	X70944	CCDS388.1	1p34.3	2014-06-13	2010-05-04		ENSG00000116560	ENSG00000116560		"""RNA binding motif (RRM) containing"""	10774	protein-coding gene	gene with protein product	"""polypyrimidine tract binding protein associated"", ""protein phosphatase 1, regulatory subunit 140"""	605199	"""splicing factor proline/glutamine rich (polypyrimidine tract-binding protein-associated)"""			8449401	Standard	NM_005066		Approved	PSF, PPP1R140	uc001bys.3	P23246	OTTHUMG00000004157	ENST00000357214.5:c.1098T>C	chr1.hg19:g.35656516A>G		183.0	0.0	.		192.0	93.0	.	NM_005066	P30808|Q5SZ71	Silent	SNP	ENST00000357214.5	hg19	CCDS388.1																																																																																			.	.	.	none		0.453	SFPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011984.4	NM_005066	
LRRC8D	55144	hgsc.bcm.edu	37	1	90400895	90400895	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr1:90400895T>G	ENST00000337338.5	+	3	2675	c.2268T>G	c.(2266-2268)caT>caG	p.H756Q	LRRC8D_ENST00000394593.3_Missense_Mutation_p.H756Q	NM_001134479.1	NP_001127951.1	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member D	756					ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(2)|skin(1)	29		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		ACCTGCAGCATTTGCATATCA	0.383																																					p.H756Q		Atlas-SNP	.											.	LRRC8D	78	.	0			c.T2268G						PASS	.						97.0	97.0	97.0					1																	90400895		2203	4300	6503	SO:0001583	missense	55144	exon3			GCAGCATTTGCAT	AK001332	CCDS726.1	1p22.2	2008-02-05	2005-06-29	2005-06-29	ENSG00000171492	ENSG00000171492			16992	protein-coding gene	gene with protein product		612890	"""leucine rich repeat containing 5"""	LRRC5			Standard	NM_018103		Approved	FLJ10470	uc001dnn.3	Q7L1W4	OTTHUMG00000010583	ENST00000337338.5:c.2268T>G	chr1.hg19:g.90400895T>G	ENSP00000338887:p.His756Gln	184.0	0.0	.		212.0	94.0	.	NM_018103	D3DT29|Q6UWB2|Q9NVW3	Missense_Mutation	SNP	ENST00000337338.5	hg19	CCDS726.1	.	.	.	.	.	.	.	.	.	.	T	9.831	1.188401	0.21954	.	.	ENSG00000171492	ENST00000337338;ENST00000394593	T;T	0.57273	0.41;0.41	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.24812	0.0602	L	0.31371	0.925	0.52501	D	0.999957	B	0.20164	0.042	B	0.27262	0.078	T	0.13575	-1.0504	9	.	.	.	.	10.8883	0.46981	0.0:0.0695:0.0:0.9305	.	756	Q7L1W4	LRC8D_HUMAN	Q	756	ENSP00000338887:H756Q;ENSP00000378093:H756Q	.	H	+	3	2	LRRC8D	90173483	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.826000	0.39092	2.326000	0.78906	0.533000	0.62120	CAT	.	.	.	none		0.383	LRRC8D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029203.2	NM_018103	
INSRR	3645	hgsc.bcm.edu	37	1	156811515	156811515	+	Missense_Mutation	SNP	G	G	A	rs201172210		TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr1:156811515G>A	ENST00000368195.3	-	20	3865	c.3469C>T	c.(3469-3471)Cgc>Tgc	p.R1157C	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	1157	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GCCATCCAGCGCACGGGCAGC	0.627																																					p.R1157C		Atlas-SNP	.											INSRR_ENST00000368195,NS,carcinoma,+2,2	INSRR	309	.	0			c.C3469T						PASS	.	G	,CYS/ARG	0,4406		0,0,2203	79.0	75.0	77.0		,3469	5.1	1.0	1		77	3,8597	3.0+/-9.4	0,3,4297	yes	intron,missense	INSRR,NTRK1	NM_001007792.1,NM_014215.2	,180	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	,probably-damaging	,1157/1298	156811515	3,13003	2203	4300	6503	SO:0001583	missense	3645	exon20			TCCAGCGCACGGG	J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.3469C>T	chr1.hg19:g.156811515G>A	ENSP00000357178:p.Arg1157Cys	182.0	0.0	.		174.0	43.0	.	NM_014215	O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	hg19	CCDS1160.1	.	.	.	.	.	.	.	.	.	.	G	19.75	3.885533	0.72410	0.0	3.49E-4	ENSG00000027644	ENST00000368195	D	0.83755	-1.76	5.07	5.07	0.68467	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.47093	D	0.000245	D	0.88746	0.6520	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89679	0.3889	9	0.87932	D	0	.	12.2864	0.54795	0.0:0.0:0.8305:0.1695	.	1157	P14616	INSRR_HUMAN	C	1157	ENSP00000357178:R1157C	ENSP00000357178:R1157C	R	-	1	0	INSRR	155078139	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.247000	0.58750	2.639000	0.89480	0.561000	0.74099	CGC	.	.	.	weak		0.627	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215	
CFHR2	3080	hgsc.bcm.edu	37	1	196887456	196887456	+	Intron	SNP	G	G	A			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr1:196887456G>A	ENST00000367421.3	+	2	135				CFHR4_ENST00000251424.4_Missense_Mutation_p.G306R|CFHR4_ENST00000608469.1_Missense_Mutation_p.G176R|CFHR4_ENST00000367416.2_Missense_Mutation_p.G552R|CFHR4_ENST00000367418.2_Missense_Mutation_p.G306R			P36980	FHR2_HUMAN	complement factor H-related 2							extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						GTGTAAATTGGGATATAATGC	0.333																																					p.G553R		Atlas-SNP	.											.	CFHR4	141	.	0			c.G1657A						PASS	.						172.0	180.0	177.0					1																	196887456		2202	4300	6502	SO:0001627	intron_variant	10877	exon10			AAATTGGGATATA	X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367421.3:c.59-31129G>A	chr1.hg19:g.196887456G>A		456.0	1.0	.		450.0	189.0	.	NM_001201550	Q14310|Q5T9T1	Missense_Mutation	SNP	ENST00000367421.3	hg19		.	.	.	.	.	.	.	.	.	.	G	7.601	0.672808	0.14776	.	.	ENSG00000134365	ENST00000367416;ENST00000367418;ENST00000251424;ENST00000538553	D;D;D	0.84223	-1.82;-1.82;-1.82	3.24	2.28	0.28536	Complement control module (1);	.	.	.	.	T	0.75715	0.3887	L	0.46157	1.445	0.09310	N	1	P;P;P	0.46706	0.825;0.883;0.685	B;B;B	0.34093	0.175;0.105;0.04	T	0.63932	-0.6525	9	0.48119	T	0.1	.	8.3994	0.32576	0.0:0.2442:0.7558:0.0	.	552;553;306	C9J7J7;Q5DVJ7;Q92496	.;.;FHR4_HUMAN	R	552;306;306;306	ENSP00000356386:G552R;ENSP00000356388:G306R;ENSP00000251424:G306R	ENSP00000251424:G306R	G	+	1	0	CFHR4	195154079	0.004000	0.15560	0.006000	0.13384	0.053000	0.15095	1.009000	0.29886	0.433000	0.26313	0.436000	0.28706	GGA	.	.	.	none		0.333	CFHR2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_005666	
ALMS1	7840	hgsc.bcm.edu	37	2	73613036	73613036	+	Missense_Mutation	SNP	G	G	C	rs61156725|rs72319667|rs3074417	byFrequency	TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr2:73613036G>C	ENST00000264448.6	+	1	151	c.40G>C	c.(40-42)Gag>Cag	p.E14Q	ALMS1_ENST00000409009.1_Missense_Mutation_p.E14Q|ALMS1_ENST00000377715.1_Missense_Mutation_p.E14Q	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	14	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.E27_E28delEE(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CGAGCTggaggaggaggagga	0.692																																					p.E14Q		Atlas-SNP	.											.	ALMS1	384	.	1	Deletion - In frame(1)	ovary(1)	c.G40C						PASS	.						3.0	4.0	4.0					2																	73613036		1509	3234	4743	SO:0001583	missense	7840	exon1			CTGGAGGAGGAGG	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.40G>C	chr2.hg19:g.73613036G>C	ENSP00000264448:p.Glu14Gln	149.0	0.0	.		241.0	19.0	.	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	hg19	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.731519	0.48939	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.26373	2.4;2.61;1.74	3.19	3.19	0.36642	.	0.259523	0.20097	U	0.099311	T	0.32436	0.0829	N	0.19112	0.55	0.22317	N	0.999202	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.03493	-1.1031	10	0.87932	D	0	.	10.1262	0.42652	0.0:0.0:1.0:0.0	.	14;14	B8ZZJ3;Q8TCU4	.;ALMS1_HUMAN	Q	14	ENSP00000386627:E14Q;ENSP00000264448:E14Q;ENSP00000366944:E14Q	ENSP00000264448:E14Q	E	+	1	0	ALMS1	73466544	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	2.034000	0.41145	2.070000	0.61991	0.484000	0.47621	GAG	.	.	.	none		0.692	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
SEMA4C	54910	hgsc.bcm.edu	37	2	97532110	97532110	+	Silent	SNP	C	C	T			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr2:97532110C>T	ENST00000305476.5	-	3	300	c.168G>A	c.(166-168)ctG>ctA	p.L56L		NM_017789.4	NP_060259.4	Q9C0C4	SEM4C_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C	56	Dominant negative effect on myogenic differentiation. {ECO:0000250}.|Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell migration in hindbrain (GO:0021535)|cerebellum development (GO:0021549)|muscle cell differentiation (GO:0042692)|neural tube closure (GO:0001843)|positive regulation of stress-activated MAPK cascade (GO:0032874)|semaphorin-plexin signaling pathway (GO:0071526)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle membrane (GO:0030672)	receptor activity (GO:0004872)			NS(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	17						CCGTCAGCGTCAGTGTCAGGA	0.652																																					p.L56L		Atlas-SNP	.											.	SEMA4C	56	.	0			c.G168A						PASS	.						85.0	85.0	85.0					2																	97532110		2203	4300	6503	SO:0001819	synonymous_variant	54910	exon3			CAGCGTCAGTGTC	AB051526	CCDS2029.1	2q11.2	2013-01-11			ENSG00000168758	ENSG00000168758		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10731	protein-coding gene	gene with protein product	"""M-Sema F"""	604462		SEMAI		7656991	Standard	NM_017789		Approved	Semacl1, Semaf	uc002sxh.4	Q9C0C4	OTTHUMG00000130535	ENST00000305476.5:c.168G>A	chr2.hg19:g.97532110C>T		230.0	0.0	.		170.0	71.0	.	NM_017789	Q32MJ3|Q7Z5X0	Silent	SNP	ENST00000305476.5	hg19	CCDS2029.1																																																																																			.	.	.	none		0.652	SEMA4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252957.1	NM_017789	
TTN	7273	hgsc.bcm.edu	37	2	179474203	179474203	+	Silent	SNP	A	A	T			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr2:179474203A>T	ENST00000591111.1	-	223	47135	c.46911T>A	c.(46909-46911)acT>acA	p.T15637T	TTN_ENST00000342992.6_Silent_p.T14710T|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Silent_p.T8405T|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000359218.5_Silent_p.T8338T|TTN_ENST00000460472.2_Silent_p.T8213T|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Silent_p.T17278T			Q8WZ42	TITIN_HUMAN	titin	15637	Ig-like 98.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCATGTAATAGTTGGGTAAG	0.413																																					p.T17278T		Atlas-SNP	.											.	TTN	18412	.	0			c.T51834A						PASS	.						100.0	94.0	96.0					2																	179474203		1890	4114	6004	SO:0001819	synonymous_variant	7273	exon273			TGTAATAGTTGGG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.46911T>A	chr2.hg19:g.179474203A>T		62.0	0.0	.		79.0	40.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.	.	none		0.413	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179611761	179611761	+	Intron	SNP	T	T	A			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr2:179611761T>A	ENST00000591111.1	-	46	10585				TTN_ENST00000342992.6_Intron|TTN_ENST00000360870.5_Silent_p.G5122G|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000589042.1_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTTTGGTCCTCCAGTAGGAA	0.473																																					p.G5122G		Atlas-SNP	.											.	TTN	18412	.	0			c.A15366T						PASS	.						89.0	92.0	91.0					2																	179611761		2203	4300	6503	SO:0001627	intron_variant	7273	exon46			TGGTCCTCCAGTA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-5113A>T	chr2.hg19:g.179611761T>A		139.0	0.0	.		122.0	48.0	.	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.	.	none		0.473	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CREB1	1385	hgsc.bcm.edu	37	2	208420472	208420472	+	Splice_Site	SNP	A	A	G			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr2:208420472A>G	ENST00000432329.2	+	2	364	c.113A>G	c.(112-114)cAg>cGg	p.Q38R	CREB1_ENST00000374397.4_Splice_Site_p.Q38R|CREB1_ENST00000430624.1_Splice_Site_p.Q38R|CREB1_ENST00000353267.3_Splice_Site_p.Q38R|CREB1_ENST00000536726.1_Splice_Site_p.Q38R	NM_134442.3	NP_604391.1	P16220	CREB1_HUMAN	cAMP responsive element binding protein 1	38					activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|cellular response to zinc ion (GO:0071294)|circadian rhythm (GO:0007623)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|lactation (GO:0007595)|lung saccule development (GO:0060430)|memory (GO:0007613)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription by competitive promoter binding (GO:0010944)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|pituitary gland development (GO:0021983)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of hormone secretion (GO:0046887)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of cell size (GO:0008361)|response to drug (GO:0042493)|response to glucagon (GO:0033762)|response to organic substance (GO:0010033)|secretory granule organization (GO:0033363)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|Type I pneumocyte differentiation (GO:0060509)|viral process (GO:0016032)	nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	cAMP response element binding (GO:0035497)|enzyme binding (GO:0019899)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)		EWSR1/CREB1(44)	NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|upper_aerodigestive_tract(1)	5				LUSC - Lung squamous cell carcinoma(261;0.0768)|Epithelial(149;0.127)|Lung(261;0.145)	Adenosine monophosphate(DB00131)|Naloxone(DB01183)	ACATTAGCCCAGGTATAAAAT	0.418			T	EWSR1	"""clear cell sarcoma, angiomatoid fibrous histiocytoma"""																																p.Q38R		Atlas-SNP	.		Dom	yes		2	2q34	1385	cAMP responsive element binding protein 1		M	.	CREB1	21	.	0			c.A113G						PASS	.						56.0	51.0	53.0					2																	208420472		2203	4300	6503	SO:0001630	splice_region_variant	1385	exon2			TAGCCCAGGTATA	M27691	CCDS2374.1, CCDS2375.1	2q34	2013-01-10			ENSG00000118260	ENSG00000118260		"""basic leucine zipper proteins"""	2345	protein-coding gene	gene with protein product		123810					Standard	NM_134442		Approved		uc002vcc.3	P16220	OTTHUMG00000132936	ENST00000432329.2:c.114+1A>G	chr2.hg19:g.208420472A>G		126.0	0.0	.		125.0	15.0	.	NM_004379	P21934|Q6V963|Q9UMA7	Missense_Mutation	SNP	ENST00000432329.2	hg19	CCDS2375.1	.	.	.	.	.	.	.	.	.	.	A	18.37	3.609554	0.66558	.	.	ENSG00000118260	ENST00000430624;ENST00000432329;ENST00000353267;ENST00000445803;ENST00000536726;ENST00000374397;ENST00000452474;ENST00000414681	T;T;T;T;T;T;D	0.81499	0.36;0.18;0.36;-1.37;-1.3;-0.51;-1.5	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.85128	0.5626	M	0.64404	1.975	0.80722	D	1	D;P;P	0.52996	0.957;0.799;0.835	P;B;B	0.53954	0.738;0.214;0.275	D	0.85493	0.1186	10	0.48119	T	0.1	-7.8185	16.3197	0.82945	1.0:0.0:0.0:0.0	.	38;38;38	F5H0V3;Q53X93;P16220	.;.;CREB1_HUMAN	R	38	ENSP00000405539:Q38R;ENSP00000387699:Q38R;ENSP00000236995:Q38R;ENSP00000407227:Q38R;ENSP00000445892:Q38R;ENSP00000363518:Q38R;ENSP00000392428:Q38R	ENSP00000236995:Q38R	Q	+	2	0	CREB1	208128717	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.135000	0.89608	2.302000	0.77476	0.533000	0.62120	CAG	.	.	.	none		0.418	CREB1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256467.3	NM_134442	Missense_Mutation
ANKZF1	55139	hgsc.bcm.edu	37	2	220099756	220099756	+	Silent	SNP	A	A	G			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr2:220099756A>G	ENST00000323348.5	+	10	1587	c.1413A>G	c.(1411-1413)tcA>tcG	p.S471S	ANKZF1_ENST00000409849.1_Silent_p.S261S|ANKZF1_ENST00000410034.3_Silent_p.S471S|GLB1L_ENST00000497855.1_5'Flank	NM_018089.2	NP_060559.2	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing 1	471						membrane (GO:0016020)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	23		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCACACAGTCATCCCAGGCAG	0.572																																					p.S471S		Atlas-SNP	.											.	ANKZF1	45	.	0			c.A1413G						PASS	.						47.0	52.0	50.0					2																	220099756		1968	4157	6125	SO:0001819	synonymous_variant	55139	exon10			ACAGTCATCCCAG	AF364318	CCDS42821.1, CCDS63129.1	2q35	2013-01-10			ENSG00000163516	ENSG00000163516		"""Zinc fingers, C2H2-type"", ""Ankyrin repeat domain containing"""	25527	protein-coding gene	gene with protein product						12477932	Standard	NM_018089		Approved	FLJ10415, ZNF744	uc002vkg.3	Q9H8Y5	OTTHUMG00000154533	ENST00000323348.5:c.1413A>G	chr2.hg19:g.220099756A>G		100.0	0.0	.		96.0	51.0	.	NM_001042410	Q9NVZ4	Silent	SNP	ENST00000323348.5	hg19	CCDS42821.1																																																																																			.	.	.	none		0.572	ANKZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335790.1	NM_018089	
SPEG	10290	hgsc.bcm.edu	37	2	220336993	220336993	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr2:220336993G>A	ENST00000312358.7	+	15	4012	c.3880G>A	c.(3880-3882)Gtg>Atg	p.V1294M	SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1294	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		GGTGGTGGCTGTGACGGGGAG	0.652																																					p.V1294M		Atlas-SNP	.											.	SPEG	272	.	0			c.G3880A						PASS	.						50.0	56.0	54.0					2																	220336993		1987	4153	6140	SO:0001583	missense	10290	exon15			GTGGCTGTGACGG	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.3880G>A	chr2.hg19:g.220336993G>A	ENSP00000311684:p.Val1294Met	89.0	0.0	.		116.0	53.0	.	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	hg19	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.576553	0.45902	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.57595	0.39	4.61	4.61	0.57282	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.35040	N	0.003484	T	0.69788	0.3150	M	0.72894	2.215	0.80722	D	1	D	0.71674	0.998	D	0.64687	0.928	T	0.74203	-0.3741	10	0.62326	D	0.03	.	16.221	0.82258	0.0:0.0:1.0:0.0	.	1294	Q15772	SPEG_HUMAN	M	1294	ENSP00000311684:V1294M	ENSP00000265327:V1294M	V	+	1	0	SPEG	220045237	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	5.635000	0.67841	2.117000	0.64856	0.555000	0.69702	GTG	.	.	.	none		0.652	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
SCG2	7857	hgsc.bcm.edu	37	2	224463553	224463553	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr2:224463553C>T	ENST00000305409.2	-	2	680	c.448G>A	c.(448-450)Gat>Aat	p.D150N		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		GTCTCATAATCATCACTCATG	0.418																																					p.D150N		Atlas-SNP	.											.	SCG2	99	.	0			c.G448A						PASS	.						174.0	171.0	172.0					2																	224463553		2203	4300	6503	SO:0001583	missense	7857	exon2			CATAATCATCACT	M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.448G>A	chr2.hg19:g.224463553C>T	ENSP00000304133:p.Asp150Asn	58.0	0.0	.		75.0	26.0	.	NM_003469	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Missense_Mutation	SNP	ENST00000305409.2	hg19	CCDS2457.1	.	.	.	.	.	.	.	.	.	.	C	19.36	3.812797	0.70912	.	.	ENSG00000171951	ENST00000305409	T	0.02050	4.48	5.5	5.5	0.81552	.	0.226336	0.43919	D	0.000519	T	0.07548	0.0190	L	0.46157	1.445	0.49687	D	0.999817	D	0.53462	0.96	P	0.54460	0.753	T	0.04203	-1.0969	10	0.72032	D	0.01	.	19.775	0.96388	0.0:1.0:0.0:0.0	.	150	P13521	SCG2_HUMAN	N	150	ENSP00000304133:D150N	ENSP00000304133:D150N	D	-	1	0	SCG2	224171797	1.000000	0.71417	0.992000	0.48379	0.957000	0.61999	6.115000	0.71566	2.741000	0.93983	0.585000	0.79938	GAT	.	.	.	none		0.418	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256870.2	NM_003469	
C3orf20	84077	hgsc.bcm.edu	37	3	14803122	14803123	+	Splice_Site	DNP	GG	GG	AC			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr3:14803122_14803123GG>AC	ENST00000253697.3	+	15	2947	c.2495_2495GG>AC	c.(2494-2496)aGGg>aACgg	p.R832N	C3orf20_ENST00000412910.1_Splice_Site_p.R710N|C3orf20_ENST00000435614.1_Splice_Site_p.R710N	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	832						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						TACAAATTCAGGTAAAACAGGA	0.53																																					p.S832N|.		Atlas-SNP	.											.	C3orf20	109	.	0			c.G2495A|c.2495+1G>C						PASS	.																																			SO:0001630	splice_region_variant	84077	exon15			AATTCAGGTAAAA|ATTCAGGTAAAAC	AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	Exception_encountered	chr3.hg19:g.14803122_14803123delinsAC		83.0	0.0	.		60.0|58.0	25.0	.	NM_032137	Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation|Splice_Site	SNP	ENST00000253697.3	hg19	CCDS33706.1																																																																																			.	.	.	none		0.530	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137	Missense_Mutation
KBTBD8	84541	hgsc.bcm.edu	37	3	67053891	67053891	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr3:67053891T>C	ENST00000417314.2	+	3	549	c.500T>C	c.(499-501)cTc>cCc	p.L167P	KBTBD8_ENST00000460576.1_Intron|KBTBD8_ENST00000469661.1_Intron|KBTBD8_ENST00000295568.4_Missense_Mutation_p.L141P			Q8NFY9	KBTB8_HUMAN	kelch repeat and BTB (POZ) domain containing 8	167	BACK.					cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)	20		Lung NSC(201;0.0765)		BRCA - Breast invasive adenocarcinoma(55;6.02e-06)|KIRC - Kidney renal clear cell carcinoma(39;0.105)|Kidney(39;0.125)		CATCAGGAACTCGGAGATCGA	0.378																																					p.L167P		Atlas-SNP	.											.	KBTBD8	101	.	0			c.T500C						PASS	.						63.0	63.0	63.0					3																	67053891		2203	4300	6503	SO:0001583	missense	84541	exon3			AGGAACTCGGAGA	AF385438	CCDS2906.1, CCDS2906.2	3p14	2013-01-08			ENSG00000163376	ENSG00000163376		"""BTB/POZ domain containing"""	30691	protein-coding gene	gene with protein product	"""T-cell activation kelch repeat protein"""					11347906	Standard	NM_032505		Approved	TA-KRP, KIAA1842	uc003dmy.3	Q8NFY9	OTTHUMG00000158779	ENST00000417314.2:c.500T>C	chr3.hg19:g.67053891T>C	ENSP00000401878:p.Leu167Pro	162.0	0.0	.		133.0	64.0	.	NM_032505	B4DTW6|Q96JI5	Missense_Mutation	SNP	ENST00000417314.2	hg19	CCDS2906.2	.	.	.	.	.	.	.	.	.	.	T	18.91	3.723529	0.68959	.	.	ENSG00000163376	ENST00000295568;ENST00000484414;ENST00000417314;ENST00000460784	D;D;D;D	0.84370	-1.53;-1.53;-1.53;-1.84	5.01	5.01	0.66863	BTB/Kelch-associated (2);	0.066397	0.64402	D	0.000016	D	0.94545	0.8243	H	0.95224	3.64	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.96098	0.9067	10	0.87932	D	0	.	15.0085	0.71530	0.0:0.0:0.0:1.0	.	167	Q8NFY9	KBTB8_HUMAN	P	141;90;167;141	ENSP00000295568:L141P;ENSP00000417341:L90P;ENSP00000401878:L167P;ENSP00000418075:L141P	ENSP00000295568:L141P	L	+	2	0	KBTBD8	67136581	1.000000	0.71417	0.993000	0.49108	0.985000	0.73830	7.976000	0.88070	1.999000	0.58509	0.405000	0.27470	CTC	.	.	.	none		0.378	KBTBD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352189.1	NM_032505	
PIK3CA	5290	hgsc.bcm.edu	37	3	178943786	178943786	+	Missense_Mutation	SNP	G	G	T	rs371049193		TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr3:178943786G>T	ENST00000263967.3	+	17	2610	c.2453G>T	c.(2452-2454)cGt>cTt	p.R818L		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	818	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)			NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	CAAATTATTCGTATTATGGAA	0.348		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.R818L	Colon(199;1504 1750 3362 26421 31210 32040)	Atlas-SNP	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	.	PIK3CA	8460	.	0			c.G2453T						PASS	.						98.0	91.0	93.0					3																	178943786		1839	4090	5929	SO:0001583	missense	5290	exon17			TTATTCGTATTAT		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2453G>T	chr3.hg19:g.178943786G>T	ENSP00000263967:p.Arg818Leu	77.0	0.0	.		80.0	4.0	.	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	hg19	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.155593	0.78114	.	.	ENSG00000121879	ENST00000263967	T	0.79247	-1.25	5.46	5.46	0.80206	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.123751	0.52532	D	0.000078	T	0.82010	0.4944	M	0.74467	2.265	0.80722	D	1	B	0.33318	0.408	B	0.39339	0.297	T	0.82653	-0.0351	10	0.62326	D	0.03	-7.3047	19.3097	0.94182	0.0:0.0:1.0:0.0	.	818	P42336	PK3CA_HUMAN	L	818	ENSP00000263967:R818L	ENSP00000263967:R818L	R	+	2	0	PIK3CA	180426480	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.373000	0.59537	2.569000	0.86673	0.557000	0.71058	CGT	.	.	.	alt		0.348	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
DTHD1	401124	hgsc.bcm.edu	37	4	36345277	36345277	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr4:36345277T>G	ENST00000456874.2	+	9	2235	c.2177T>G	c.(2176-2178)tTt>tGt	p.F726C	RP11-431M7.2_ENST00000504344.1_RNA|DTHD1_ENST00000357504.3_Missense_Mutation_p.F561C|DTHD1_ENST00000507598.1_Missense_Mutation_p.F766C|DTHD1_ENST00000503528.1_3'UTR	NM_001170700.2	NP_001164171.1	Q6ZMT9	DTHD1_HUMAN	death domain containing 1	726	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				signal transduction (GO:0007165)					breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|stomach(1)	8						ATCCACGAGTTTCTTTGCTTC	0.488																																					p.F726C		Atlas-SNP	.											.	DTHD1	63	.	0			c.T2177G						PASS	.						61.0	58.0	59.0					4																	36345277		692	1591	2283	SO:0001583	missense	401124	exon9			ACGAGTTTCTTTG	AK094684	CCDS54754.1	4p14	2009-10-02			ENSG00000197057	ENSG00000197057			37261	protein-coding gene	gene with protein product							Standard	NM_001170700		Approved	FLJ16686	uc021xne.2	Q6ZMT9	OTTHUMG00000160371	ENST00000456874.2:c.2177T>G	chr4.hg19:g.36345277T>G	ENSP00000401597:p.Phe726Cys	163.0	0.0	.		159.0	83.0	.	NM_001170700	B2RXK4|B4E2N7	Missense_Mutation	SNP	ENST00000456874.2	hg19	CCDS54754.1	.	.	.	.	.	.	.	.	.	.	T	16.87	3.241898	0.58995	.	.	ENSG00000197057	ENST00000357504;ENST00000507598;ENST00000456874	D;D;D	0.85629	-2.01;-2.01;-2.01	4.42	4.42	0.53409	.	0.480369	0.21618	N	0.071685	D	0.83820	0.5337	L	0.36672	1.1	0.09310	N	1	P	0.51351	0.944	P	0.50192	0.634	T	0.78097	-0.2337	10	0.87932	D	0	-3.3812	13.8151	0.63287	0.0:0.0:0.0:1.0	.	561	Q6ZMT9-2	.	C	561;766;726	ENSP00000350103:F561C;ENSP00000424426:F766C;ENSP00000401597:F726C	ENSP00000350103:F561C	F	+	2	0	DTHD1	36021672	0.987000	0.35691	0.035000	0.18076	0.844000	0.47949	5.611000	0.67674	1.867000	0.54127	0.402000	0.26972	TTT	.	.	.	none		0.488	DTHD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001136536	
ATP10D	57205	hgsc.bcm.edu	37	4	47593159	47593159	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr4:47593159A>G	ENST00000273859.3	+	23	4311	c.4042A>G	c.(4042-4044)Aag>Gag	p.K1348E		NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	1348					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						TAAAGCTCTCAAGAAGTGGAG	0.473																																					p.K1348E		Atlas-SNP	.											.	ATP10D	168	.	0			c.A4042G						PASS	.						95.0	97.0	97.0					4																	47593159		2203	4299	6502	SO:0001583	missense	57205	exon23			GCTCTCAAGAAGT	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.4042A>G	chr4.hg19:g.47593159A>G	ENSP00000273859:p.Lys1348Glu	136.0	0.0	.		143.0	81.0	.	NM_020453	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	hg19	CCDS3476.1	.	.	.	.	.	.	.	.	.	.	A	17.60	3.429275	0.62844	.	.	ENSG00000145246	ENST00000273859	T	0.38722	1.12	4.62	4.62	0.57501	.	0.059193	0.64402	D	0.000002	T	0.42040	0.1185	M	0.69823	2.125	0.80722	D	1	B	0.21147	0.052	B	0.26864	0.074	T	0.30707	-0.9969	10	0.13108	T	0.6	-15.5389	13.3654	0.60680	1.0:0.0:0.0:0.0	.	1348	Q9P241	AT10D_HUMAN	E	1348	ENSP00000273859:K1348E	ENSP00000273859:K1348E	K	+	1	0	ATP10D	47287916	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	4.713000	0.61895	1.917000	0.55516	0.377000	0.23210	AAG	.	.	.	none		0.473	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	
LPHN3	23284	hgsc.bcm.edu	37	4	62936619	62936619	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr4:62936619G>T	ENST00000514591.1	+	25	4732	c.4403G>T	c.(4402-4404)aGt>aTt	p.S1468I	LPHN3_ENST00000512091.2_3'UTR|LPHN3_ENST00000507164.1_3'UTR|LPHN3_ENST00000507625.1_Missense_Mutation_p.S1527I|LPHN3_ENST00000506720.1_Missense_Mutation_p.S1579I|LPHN3_ENST00000514996.1_Missense_Mutation_p.S1502I|LPHN3_ENST00000514157.1_3'UTR|RP11-84A1.3_ENST00000504135.1_RNA|LPHN3_ENST00000545650.1_Missense_Mutation_p.S1468I|LPHN3_ENST00000506700.1_3'UTR|LPHN3_ENST00000506746.1_Missense_Mutation_p.S1570I|LPHN3_ENST00000508946.1_Missense_Mutation_p.S1511I|RP11-84A1.3_ENST00000509461.1_RNA|LPHN3_ENST00000504896.1_3'UTR|LPHN3_ENST00000511324.1_3'UTR|RP11-84A1.3_ENST00000506704.1_RNA|LPHN3_ENST00000508693.1_3'UTR|LPHN3_ENST00000509896.1_3'UTR			Q9HAR2	LPHN3_HUMAN	latrophilin 3	1446					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						TTGGTCACTAGTCTATAGAAG	0.448																																					p.S1468I		Atlas-SNP	.											.	LPHN3	800	.	0			c.G4403T						PASS	.						45.0	46.0	46.0					4																	62936619		692	1591	2283	SO:0001583	missense	23284	exon23			TCACTAGTCTATA	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.4403G>T	chr4.hg19:g.62936619G>T	ENSP00000422533:p.Ser1468Ile	64.0	0.0	.		77.0	34.0	.	NM_015236	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	hg19	CCDS54768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.44|18.44	3.624809|3.624809	0.66901|0.66901	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000514591;ENST00000545650;ENST00000295349;ENST00000507625;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996|ENST00000502815	D;D;D;T;T;T;T|.	0.84800|.	-1.83;-1.83;-1.9;-1.37;-1.41;-1.43;-1.39|.	5.5|5.5	5.5|5.5	0.81552|0.81552	GPCR, family 2, latrophilin, C-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.77384|.	0.4122|.	M|M	0.75777|0.75777	2.31|2.31	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.999;0.999|.	D;D|.	0.87578|.	0.998;0.998|.	T|.	0.76575|.	-0.2909|.	10|.	0.87932|.	D|.	0|.	.|.	19.4053|19.4053	0.94646|0.94646	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1468;1446|.	E9PE04;Q9HAR2|.	.;LPHN3_HUMAN|.	I|Y	1468;1468;1446;1527;1511;1579;1570;1502|916	ENSP00000422533:S1468I;ENSP00000439831:S1468I;ENSP00000421372:S1527I;ENSP00000421627:S1511I;ENSP00000420931:S1579I;ENSP00000425884:S1570I;ENSP00000424258:S1502I|.	ENSP00000295349:S1446I|.	S|X	+|+	2|3	0|2	LPHN3|LPHN3	62619214|62619214	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.965000|0.965000	0.64279|0.64279	9.370000|9.370000	0.97159|0.97159	2.607000|2.607000	0.88179|0.88179	0.591000|0.591000	0.81541|0.81541	AGT|TAG	.	.	.	none		0.448	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
SH3RF1	57630	hgsc.bcm.edu	37	4	170037559	170037559	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr4:170037559G>T	ENST00000284637.9	-	10	2341	c.2000C>A	c.(1999-2001)cCa>cAa	p.P667Q	SH3RF1_ENST00000508685.1_5'UTR	NM_020870.3	NP_065921.2	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	667					negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|protein ubiquitination (GO:0016567)|regulation of JNK cascade (GO:0046328)	cell projection (GO:0042995)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		GGTGATGCTTGGGGAAGTCAG	0.607																																					p.P667Q		Atlas-SNP	.											.	SH3RF1	60	.	0			c.C2000A						PASS	.						64.0	55.0	58.0					4																	170037559		2203	4300	6503	SO:0001583	missense	57630	exon10			ATGCTTGGGGAAG	BC033203	CCDS34099.1	4q32.3	2013-01-09	2006-02-13	2006-02-13	ENSG00000154447	ENSG00000154447		"""RING-type (C3HC4) zinc fingers"""	17650	protein-coding gene	gene with protein product	"""plenty of SH3 domains"""		"""SH3 multiple domains 2"""	SH3MD2		9482736	Standard	NM_020870		Approved	POSH, RNF142, KIAA1494	uc003isa.1	Q7Z6J0	OTTHUMG00000161010	ENST00000284637.9:c.2000C>A	chr4.hg19:g.170037559G>T	ENSP00000284637:p.Pro667Gln	83.0	0.0	.		93.0	4.0	.	NM_020870	Q05BT2|Q8IW46|Q9HAM2|Q9P234	Missense_Mutation	SNP	ENST00000284637.9	hg19	CCDS34099.1	.	.	.	.	.	.	.	.	.	.	G	11.12	1.544876	0.27652	.	.	ENSG00000154447	ENST00000284637	T	0.17691	2.26	5.49	3.75	0.43078	.	0.326104	0.37857	N	0.001901	T	0.29882	0.0747	L	0.60455	1.87	0.36906	D	0.890651	D	0.54047	0.964	P	0.52267	0.694	T	0.12041	-1.0563	10	0.37606	T	0.19	-2.4822	17.3497	0.87320	0.0:0.0:0.7757:0.2243	.	667	Q7Z6J0	SH3R1_HUMAN	Q	667	ENSP00000284637:P667Q	ENSP00000284637:P667Q	P	-	2	0	SH3RF1	170274134	1.000000	0.71417	0.003000	0.11579	0.000000	0.00434	5.877000	0.69675	0.279000	0.22186	-3.073000	0.00066	CCA	.	.	.	none		0.607	SH3RF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363382.3	NM_020870	
C6	729	hgsc.bcm.edu	37	5	41201803	41201803	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr5:41201803C>A	ENST00000263413.3	-	3	421	c.157G>T	c.(157-159)Gat>Tat	p.D53Y	C6_ENST00000337836.5_Missense_Mutation_p.D53Y	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	53	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.D53Y(1)		central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				TAGTACTTATCTACTACTATT	0.393																																					p.D53Y		Atlas-SNP	.											C6,NS,carcinoma,0,1	C6	197	.	1	Substitution - Missense(1)	lung(1)	c.G157T						PASS	.						91.0	92.0	91.0					5																	41201803		2203	4300	6503	SO:0001583	missense	729	exon3			ACTTATCTACTAC	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.157G>T	chr5.hg19:g.41201803C>A	ENSP00000263413:p.Asp53Tyr	78.0	0.0	.		79.0	37.0	.	NM_001115131		Missense_Mutation	SNP	ENST00000263413.3	hg19	CCDS3936.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.204041	0.79127	.	.	ENSG00000039537	ENST00000337836;ENST00000263413;ENST00000417809	T;T;T	0.53423	0.62;0.62;0.62	5.92	-1.99	0.07457	.	0.226533	0.51477	D	0.000094	T	0.65144	0.2663	M	0.82323	2.585	0.09310	N	0.999999	D	0.76494	0.999	D	0.72338	0.977	T	0.62067	-0.6932	10	0.87932	D	0	-4.1584	11.7594	0.51894	0.0:0.5428:0.0:0.4572	.	53	P13671	CO6_HUMAN	Y	53	ENSP00000338861:D53Y;ENSP00000263413:D53Y;ENSP00000396565:D53Y	ENSP00000263413:D53Y	D	-	1	0	C6	41237560	0.002000	0.14202	0.000000	0.03702	0.862000	0.49288	-0.031000	0.12287	-0.800000	0.04433	0.655000	0.94253	GAT	.	.	.	none		0.393	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1		
HCN1	348980	hgsc.bcm.edu	37	5	45462104	45462104	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr5:45462104G>T	ENST00000303230.4	-	3	912	c.855C>A	c.(853-855)ttC>ttA	p.F285L		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	285					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						ATGTCATGTGGAATATCTGTT	0.373																																					p.F285L		Atlas-SNP	.											.	HCN1	298	.	0			c.C855A						PASS	.						52.0	52.0	52.0					5																	45462104		2203	4300	6503	SO:0001583	missense	348980	exon3			CATGTGGAATATC	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.855C>A	chr5.hg19:g.45462104G>T	ENSP00000307342:p.Phe285Leu	231.0	0.0	.		208.0	97.0	.	NM_021072		Missense_Mutation	SNP	ENST00000303230.4	hg19	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.788182	0.70337	.	.	ENSG00000164588	ENST00000303230	D	0.98362	-4.89	5.53	4.66	0.58398	Ion transport (1);	0.000000	0.64402	D	0.000002	D	0.96661	0.8910	N	0.21324	0.655	0.58432	D	0.999996	P	0.38048	0.616	P	0.48334	0.574	D	0.96289	0.9212	10	0.45353	T	0.12	.	14.1403	0.65316	0.072:0.0:0.928:0.0	.	285	O60741	HCN1_HUMAN	L	285	ENSP00000307342:F285L	ENSP00000307342:F285L	F	-	3	2	HCN1	45497861	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.589000	0.53972	1.351000	0.45789	0.650000	0.86243	TTC	.	.	.	none		0.373	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072	
BDP1	55814	hgsc.bcm.edu	37	5	70793235	70793235	+	Silent	SNP	A	A	G			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr5:70793235A>G	ENST00000358731.4	+	13	2201	c.1938A>G	c.(1936-1938)tcA>tcG	p.S646S	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	646					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		ATTCACATTCAAAAACTTCAG	0.348																																					p.S646S		Atlas-SNP	.											.	BDP1	204	.	0			c.A1938G						PASS	.						75.0	69.0	71.0					5																	70793235		1806	4078	5884	SO:0001819	synonymous_variant	55814	exon13			ACATTCAAAAACT	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.1938A>G	chr5.hg19:g.70793235A>G		339.0	1.0	.		356.0	166.0	.	NM_018429	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Silent	SNP	ENST00000358731.4	hg19	CCDS43328.1																																																																																			.	.	.	none		0.348	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429	
AP3B1	8546	hgsc.bcm.edu	37	5	77511925	77511925	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr5:77511925A>G	ENST00000255194.6	-	7	915	c.740T>C	c.(739-741)aTg>aCg	p.M247T	AP3B1_ENST00000519295.1_Missense_Mutation_p.M198T	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	247					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		TCGAGTTAGCATGTGGATTAT	0.423									Hermansky-Pudlak syndrome																												p.M247T		Atlas-SNP	.											.	AP3B1	94	.	0			c.T740C						PASS	.						143.0	135.0	138.0					5																	77511925		2203	4300	6503	SO:0001583	missense	8546	exon7	Familial Cancer Database	HPS, HPS1-8	GTTAGCATGTGGA	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.740T>C	chr5.hg19:g.77511925A>G	ENSP00000255194:p.Met247Thr	78.0	0.0	.		80.0	29.0	.	NM_003664	E5RJ68|O00580|Q7Z393|Q9HD66	Missense_Mutation	SNP	ENST00000255194.6	hg19	CCDS4041.1	.	.	.	.	.	.	.	.	.	.	A	18.26	3.585230	0.66105	.	.	ENSG00000132842	ENST00000255194;ENST00000519295;ENST00000535760;ENST00000535667	T;T	0.25250	1.81;1.81	5.54	5.54	0.83059	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.37376	0.1001	L	0.50847	1.595	0.80722	D	1	B	0.32968	0.392	P	0.45276	0.475	T	0.25117	-1.0141	10	0.87932	D	0	-11.4846	15.6919	0.77461	1.0:0.0:0.0:0.0	.	247	O00203	AP3B1_HUMAN	T	247;198;247;151	ENSP00000255194:M247T;ENSP00000430597:M198T	ENSP00000255194:M247T	M	-	2	0	AP3B1	77547681	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.284000	0.95882	2.112000	0.64535	0.533000	0.62120	ATG	.	.	.	none		0.423	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000225548.2		
GPR98	84059	hgsc.bcm.edu	37	5	90016841	90016841	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr5:90016841A>G	ENST00000405460.2	+	45	9809	c.9713A>G	c.(9712-9714)cAg>cGg	p.Q3238R		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3238					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GTGAGTGTGCAGTGGGAGACA	0.368																																					p.Q3238R		Atlas-SNP	.											.	GPR98	605	.	0			c.A9713G						PASS	.						166.0	164.0	164.0					5																	90016841		1932	4157	6089	SO:0001583	missense	84059	exon45			GTGTGCAGTGGGA	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.9713A>G	chr5.hg19:g.90016841A>G	ENSP00000384582:p.Gln3238Arg	88.0	0.0	.		88.0	45.0	.	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	hg19	CCDS47246.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.95|18.95	3.732376|3.732376	0.69189|0.69189	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619|ENST00000509621	T|.	0.26373|.	1.74|.	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	0.142471|.	0.64402|.	D|.	0.000008|.	T|T	0.54711|0.54711	0.1875|0.1875	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	B;B|.	0.26195|.	0.144;0.057|.	B;B|.	0.18263|.	0.021;0.01|.	T|T	0.51521|0.51521	-0.8695|-0.8695	10|5	0.59425|.	D|.	0.04|.	.|.	15.9011|15.9011	0.79377|0.79377	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	3238;3238|.	E7ETI5;Q8WXG9|.	.;GPR98_HUMAN|.	R|G	3238|804	ENSP00000384582:Q3238R|.	ENSP00000296619:Q3238R|.	Q|S	+|+	2|1	0|0	GPR98|GPR98	90052597|90052597	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	6.532000|6.532000	0.73825|0.73825	2.158000|2.158000	0.67659|0.67659	0.528000|0.528000	0.53228|0.53228	CAG|AGT	.	.	.	none		0.368	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
DIAPH1	1729	hgsc.bcm.edu	37	5	140909206	140909206	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr5:140909206C>G	ENST00000398557.4	-	20	2780	c.2640G>C	c.(2638-2640)gaG>gaC	p.E880D	DIAPH1_ENST00000494967.1_5'UTR|DIAPH1_ENST00000389054.3_Missense_Mutation_p.E877D|DIAPH1_ENST00000398562.2_Missense_Mutation_p.E856D|DIAPH1_ENST00000520569.1_Missense_Mutation_p.E823D|DIAPH1_ENST00000253811.6_Missense_Mutation_p.E881D|DIAPH1_ENST00000398566.3_Missense_Mutation_p.E872D|DIAPH1_ENST00000518047.1_Missense_Mutation_p.E868D|DIAPH1_ENST00000389057.5_Missense_Mutation_p.E871D	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	880	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTCATTCACCTCCAGGATGA	0.483																																					p.E880D		Atlas-SNP	.											.	DIAPH1	64	.	0			c.G2640C						PASS	.						122.0	115.0	118.0					5																	140909206		1995	4191	6186	SO:0001583	missense	1729	exon20			ATTCACCTCCAGG	BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.2640G>C	chr5.hg19:g.140909206C>G	ENSP00000381565:p.Glu880Asp	90.0	0.0	.		84.0	35.0	.	NM_005219	A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Missense_Mutation	SNP	ENST00000398557.4	hg19	CCDS43374.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.252794	0.59212	.	.	ENSG00000131504	ENST00000389054;ENST00000520569;ENST00000398562;ENST00000389057;ENST00000398566;ENST00000398557;ENST00000253811;ENST00000518047	T;T;T;T;T;T;T;T	0.19105	2.17;2.17;2.17;2.17;2.17;2.17;2.17;2.17	5.06	2.88	0.33553	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.135356	0.47455	D	0.000228	T	0.27765	0.0683	M	0.73598	2.24	0.49915	D	0.999837	B;P;P	0.38167	0.345;0.621;0.621	B;B;B	0.41510	0.11;0.359;0.359	T	0.12811	-1.0533	10	0.87932	D	0	.	9.7631	0.40543	0.0:0.7815:0.0:0.2185	.	823;871;880	E7ERW8;E9PEZ2;O60610	.;.;DIAP1_HUMAN	D	877;823;856;871;872;880;881;868	ENSP00000373706:E877D;ENSP00000429282:E823D;ENSP00000381570:E856D;ENSP00000373709:E871D;ENSP00000381572:E872D;ENSP00000381565:E880D;ENSP00000253811:E881D;ENSP00000428268:E868D	ENSP00000253811:E881D	E	-	3	2	DIAPH1	140889390	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.497000	0.35649	1.267000	0.44247	0.650000	0.86243	GAG	.	.	.	none		0.483	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_005219	
SOX4	6659	hgsc.bcm.edu	37	6	21594835	21594835	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr6:21594835G>T	ENST00000244745.1	+	1	864	c.70G>T	c.(70-72)Gcc>Tcc	p.A24S	SOX4_ENST00000543472.1_Missense_Mutation_p.A24S	NM_003107.2	NP_003098.1	Q06945	SOX4_HUMAN	SRY (sex determining region Y)-box 4	24					ascending aorta morphogenesis (GO:0035910)|atrial septum primum morphogenesis (GO:0003289)|canonical Wnt signaling pathway (GO:0060070)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac ventricle formation (GO:0003211)|cellular response to glucose stimulus (GO:0071333)|DNA damage response, detection of DNA damage (GO:0042769)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endocrine pancreas development (GO:0031018)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|kidney morphogenesis (GO:0060993)|limb bud formation (GO:0060174)|mitral valve morphogenesis (GO:0003183)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of protein ubiquitination (GO:0031397)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|noradrenergic neuron differentiation (GO:0003357)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin secretion (GO:0032024)|positive regulation of N-terminal peptidyl-lysine acetylation (GO:2000761)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|positive regulation of Wnt signaling pathway (GO:0030177)|pro-B cell differentiation (GO:0002328)|protein stabilization (GO:0050821)|regulation of protein stability (GO:0031647)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spinal cord development (GO:0021510)|spinal cord motor neuron differentiation (GO:0021522)|sympathetic nervous system development (GO:0048485)|T cell differentiation (GO:0030217)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			kidney(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	6	Ovarian(93;0.163)		all cancers(50;0.0751)|Epithelial(50;0.155)			GGACTCGGGCGCCGGCCTCGA	0.731																																					p.A24S		Atlas-SNP	.											.	SOX4	11	.	0			c.G70T						PASS	.						8.0	10.0	10.0					6																	21594835		2161	4225	6386	SO:0001583	missense	6659	exon1			TCGGGCGCCGGCC	AF070669	CCDS4547.1	6p22.3	2008-02-05			ENSG00000124766	ENSG00000124766		"""SRY (sex determining region Y)-boxes"""	11200	protein-coding gene	gene with protein product		184430				8268656, 9730625	Standard	NM_003107		Approved		uc003ndi.3	Q06945	OTTHUMG00000016101	ENST00000244745.1:c.70G>T	chr6.hg19:g.21594835G>T	ENSP00000244745:p.Ala24Ser	92.0	0.0	.		91.0	4.0	.	NM_003107		Missense_Mutation	SNP	ENST00000244745.1	hg19	CCDS4547.1	.	.	.	.	.	.	.	.	.	.	G	14.49	2.549614	0.45383	.	.	ENSG00000124766	ENST00000244745;ENST00000543472	D;D	0.97906	-4.6;-4.6	5.12	3.32	0.38043	.	0.083581	0.47093	U	0.000254	D	0.90621	0.7059	L	0.55481	1.735	0.37428	D	0.913929	P	0.36974	0.576	B	0.33620	0.167	D	0.86855	0.2026	10	0.12430	T	0.62	.	7.3985	0.26950	0.0808:0.0:0.6231:0.2961	.	24	Q06945	SOX4_HUMAN	S	24	ENSP00000244745:A24S;ENSP00000438412:A24S	ENSP00000244745:A24S	A	+	1	0	SOX4	21702814	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.213000	0.42844	0.536000	0.28733	0.555000	0.69702	GCC	.	.	.	none		0.731	SOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043301.1	NM_003107	
TEAD3	7005	hgsc.bcm.edu	37	6	35443200	35443200	+	Silent	SNP	C	C	T			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr6:35443200C>T	ENST00000402886.3	-	10	1080	c.927G>A	c.(925-927)gaG>gaA	p.E309E	TEAD3_ENST00000338863.7_Silent_p.E369E			Q99594	TEAD3_HUMAN	TEA domain family member 3	369	Transcriptional activation. {ECO:0000255}.				female pregnancy (GO:0007565)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	10						TGATCATGTACTCGCACATGG	0.557																																					p.E369E		Atlas-SNP	.											.	TEAD3	52	.	0			c.G1107A						PASS	.						102.0	99.0	100.0					6																	35443200		2203	4300	6503	SO:0001819	synonymous_variant	7005	exon12			CATGTACTCGCAC	X94439	CCDS47414.1	6p21.2	2008-07-28			ENSG00000007866	ENSG00000007866			11716	protein-coding gene	gene with protein product		603170		TEAD5		9889009, 9148898	Standard	NM_003214		Approved	TEF-5, ETFR-1	uc003oku.4	Q99594	OTTHUMG00000014571	ENST00000402886.3:c.927G>A	chr6.hg19:g.35443200C>T		47.0	0.0	.		61.0	41.0	.	NM_003214	O95910|Q5BJG7|Q8N6Y4	Silent	SNP	ENST00000402886.3	hg19																																																																																				.	.	.	none		0.557	TEAD3-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316961.2		
TBCC	6903	hgsc.bcm.edu	37	6	42713428	42713428	+	Silent	SNP	G	G	T			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr6:42713428G>T	ENST00000372876.1	-	1	406	c.384C>A	c.(382-384)cgC>cgA	p.R128R	TBCC_ENST00000244625.2_Silent_p.R128R	NM_003192.2	NP_003183	Q15814	TBCC_HUMAN	tubulin folding cofactor C	128					'de novo' posttranslational protein folding (GO:0051084)|cell morphogenesis (GO:0000902)|cellular protein metabolic process (GO:0044267)|GTP catabolic process (GO:0006184)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)	chaperone binding (GO:0051087)|GTPase activity (GO:0003924)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(3)	14	Colorectal(47;0.196)		all cancers(41;0.00122)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.125)			GCAGCCCCCGGCGCCGCTCGG	0.627																																					p.R128R		Atlas-SNP	.											.	TBCC	31	.	0			c.C384A						PASS	.						16.0	20.0	19.0					6																	42713428		2183	4276	6459	SO:0001819	synonymous_variant	6903	exon1			CCCCCGGCGCCGC	U61234	CCDS4872.1	6p21.1	2008-02-05	2006-11-21		ENSG00000124659	ENSG00000124659			11580	protein-coding gene	gene with protein product		602971	"""tubulin-specific chaperone c"""			8706133, 11847227	Standard	NM_003192		Approved	CFC	uc003osl.3	Q15814	OTTHUMG00000014704	ENST00000372876.1:c.384C>A	chr6.hg19:g.42713428G>T		103.0	0.0	.		103.0	48.0	.	NM_003192	Q53Y43|Q5T787	Silent	SNP	ENST00000372876.1	hg19	CCDS4872.1																																																																																			.	.	.	none		0.627	TBCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040559.1	NM_003192	
MAP3K7	6885	hgsc.bcm.edu	37	6	91296573	91296573	+	Silent	SNP	G	G	C			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr6:91296573G>C	ENST00000369329.3	-	1	191	c.30C>G	c.(28-30)tcC>tcG	p.S10S	MAP3K7_ENST00000369327.3_Silent_p.S10S|MAP3K7_ENST00000369332.3_Silent_p.S10S|MAP3K7_ENST00000369325.3_Silent_p.S10S	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	10	Interaction with MAPK8IP1. {ECO:0000250}.|Poly-Ser.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		AAGACGAGGAGGAGGAGGAGG	0.647																																					p.S10S		Atlas-SNP	.											.	MAP3K7	100	.	0			c.C30G						PASS	.						39.0	39.0	39.0					6																	91296573		2203	4300	6503	SO:0001819	synonymous_variant	6885	exon1			CGAGGAGGAGGAG	AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.30C>G	chr6.hg19:g.91296573G>C		60.0	0.0	.		48.0	23.0	.	NM_145333	B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Silent	SNP	ENST00000369329.3	hg19	CCDS5028.1																																																																																			.	.	.	none		0.647	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041530.1	NM_145331	
AHI1	54806	hgsc.bcm.edu	37	6	135784363	135784363	+	Silent	SNP	A	A	G			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr6:135784363A>G	ENST00000367800.4	-	6	1047	c.831T>C	c.(829-831)caT>caC	p.H277H	AHI1_ENST00000457866.2_Silent_p.H277H|AHI1_ENST00000327035.6_Silent_p.H277H	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	277	Interaction with HAP1.				cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		CATCATCTTGATGAGAATCTG	0.343																																					p.H277H		Atlas-SNP	.											.	AHI1	81	.	0			c.T831C						PASS	.						150.0	139.0	143.0					6																	135784363		1873	4106	5979	SO:0001819	synonymous_variant	54806	exon7			ATCTTGATGAGAA	AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.831T>C	chr6.hg19:g.135784363A>G		47.0	0.0	.		43.0	20.0	.	NM_001134832	E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Silent	SNP	ENST00000367800.4	hg19	CCDS47483.1																																																																																			.	.	.	none		0.343	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391948.1	NM_017651	
FAM66D	100132923	hgsc.bcm.edu	37	8	11990259	11990259	+	RNA	SNP	C	C	T	rs528506213	byFrequency	TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr8:11990259C>T	ENST00000434078.2	+	0	608					NR_027425.1				family with sequence similarity 66, member D																		AGTGCTCGTCCAACTCGGGTA	0.542																																					p.L420L		Atlas-SNP	.											.	.	.	.	0			c.G1260A						PASS	.																																					392197	exon1			CTCGTCCAACTCG			8p23.1	2013-07-05			ENSG00000255052	ENSG00000255052		"""Long non-coding RNAs"""	24159	non-coding RNA	RNA, long non-coding							Standard	NR_027425		Approved				OTTHUMG00000165269		chr8.hg19:g.11990259C>T		123.0	0.0	.		120.0	25.0	.	NM_001256869		Silent	SNP	ENST00000434078.2	hg19																																																																																				.	.	.	none		0.542	FAM66D-201	KNOWN	basic	antisense	antisense		NR_027425	
TATDN1	83940	hgsc.bcm.edu	37	8	125499771	125499771	+	IGR	SNP	G	G	C			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr8:125499771G>C	ENST00000276692.6	-	0	1018				RNF139_ENST00000303545.3_Missense_Mutation_p.R627S|RP11-158K1.3_ENST00000518639.1_RNA	NM_032026.3	NP_114415.1	Q6P1N9	TATD1_HUMAN	TatD DNase domain containing 1						DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	15	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			AATCTGACAGGGAATTGAACG	0.393																																					p.R627S		Atlas-SNP	.											.	RNF139	57	.	0			c.G1881C						PASS	.						93.0	92.0	93.0					8																	125499771		2203	4300	6503	SO:0001628	intergenic_variant	11236	exon2			TGACAGGGAATTG	AF212250	CCDS6351.1, CCDS55273.1	8q24.13	2004-06-07			ENSG00000147687	ENSG00000147687			24220	protein-coding gene	gene with protein product						12477932	Standard	NM_032026		Approved	CDA11	uc003yrd.2	Q6P1N9	OTTHUMG00000165068		chr8.hg19:g.125499771G>C		136.0	0.0	.		88.0	42.0	.	NM_007218	B2R5J0|Q8TD02|Q9BY40	Missense_Mutation	SNP	ENST00000276692.6	hg19	CCDS6351.1	.	.	.	.	.	.	.	.	.	.	G	3.586	-0.084525	0.07097	.	.	ENSG00000170881	ENST00000303545	T	0.22945	1.93	5.64	2.65	0.31530	.	0.522447	0.21142	N	0.079461	T	0.08537	0.0212	N	0.03608	-0.345	0.29212	N	0.874533	B	0.06786	0.001	B	0.04013	0.001	T	0.33523	-0.9865	10	0.09084	T	0.74	-8.8311	5.7273	0.18020	0.1441:0.0965:0.6257:0.1336	.	627	Q8WU17	RN139_HUMAN	S	627	ENSP00000304051:R627S	ENSP00000304051:R627S	R	+	3	2	RNF139	125568952	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	1.109000	0.31135	0.408000	0.25621	-1.134000	0.01955	AGG	.	.	.	none		0.393	TATDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381655.1	NM_032026	
C9orf43	257169	hgsc.bcm.edu	37	9	116185621	116185621	+	Silent	SNP	C	C	T			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr9:116185621C>T	ENST00000288462.4	+	7	945	c.499C>T	c.(499-501)Ctg>Ttg	p.L167L	C9orf43_ENST00000374165.1_Silent_p.L167L	NM_152786.1	NP_689999.1	Q8TAL5	CI043_HUMAN	chromosome 9 open reading frame 43	167										breast(2)|large_intestine(6)|lung(2)|ovary(1)|pancreas(1)|prostate(3)	15						CAAGTCATTTCTGGGTCTCTC	0.453																																					p.L167L		Atlas-SNP	.											C9orf43,NS,carcinoma,0,1	C9orf43	49	.	0			c.C499T						PASS	.						80.0	76.0	77.0					9																	116185621		2203	4300	6503	SO:0001819	synonymous_variant	257169	exon7			TCATTTCTGGGTC	BC026884	CCDS6796.1	9q33.1	2012-03-15			ENSG00000157653	ENSG00000157653			23570	protein-coding gene	gene with protein product						12477932	Standard	NM_152786		Approved	MGC17358	uc004bhp.3	Q8TAL5	OTTHUMG00000020526	ENST00000288462.4:c.499C>T	chr9.hg19:g.116185621C>T		82.0	0.0	.		68.0	28.0	.	NM_152786		Silent	SNP	ENST00000288462.4	hg19	CCDS6796.1																																																																																			.	.	.	none		0.453	C9orf43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053739.1	NM_152786	
SEC16A	9919	hgsc.bcm.edu	37	9	139368591	139368591	+	Nonsense_Mutation	SNP	G	G	T			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr9:139368591G>T	ENST00000371706.3	-	1	2976	c.2943C>A	c.(2941-2943)taC>taA	p.Y981*	SEC16A_ENST00000431893.2_Nonsense_Mutation_p.Y981*|SEC16A_ENST00000290037.6_Nonsense_Mutation_p.Y981*|SEC16A_ENST00000313050.7_Nonsense_Mutation_p.Y1159*			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	981	Poly-Tyr.|Pro-rich.|Required for endoplasmic reticulum localization.				COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		GGTAGTAGTAGTAGGCGGCCA	0.652																																					p.Y1159X		Atlas-SNP	.											.	SEC16A	249	.	0			c.C3477A						PASS	.						50.0	57.0	55.0					9																	139368591		2034	4181	6215	SO:0001587	stop_gained	9919	exon3			GTAGTAGTAGGCG	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.2943C>A	chr9.hg19:g.139368591G>T	ENSP00000360771:p.Tyr981*	158.0	0.0	.		155.0	85.0	.	NM_014866	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Nonsense_Mutation	SNP	ENST00000371706.3	hg19		.	.	.	.	.	.	.	.	.	.	G	37	6.605004	0.97701	.	.	ENSG00000148396	ENST00000313050;ENST00000371706;ENST00000290037;ENST00000431893;ENST00000404925;ENST00000398348	.	.	.	5.38	0.014	0.14098	.	0.376195	0.26507	N	0.023987	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	-7.7001	9.9781	0.41797	0.4482:0.0:0.5518:0.0	.	.	.	.	X	1159;981;981;981;549;83	.	ENSP00000290037:Y981X	Y	-	3	2	SEC16A	138488412	1.000000	0.71417	0.941000	0.38009	0.285000	0.27093	1.404000	0.34623	0.026000	0.15269	0.462000	0.41574	TAC	.	.	.	none		0.652	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459	
PGBD3	267004	hgsc.bcm.edu	37	10	50723698	50723698	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr10:50723698A>G	ENST00000374127.3	-	2	1664	c.1463T>C	c.(1462-1464)tTg>tCg	p.L488S	ERCC6-PGBD3_ENST00000515869.1_Missense_Mutation_p.L956S|ERCC6_ENST00000355832.5_Intron|ERCC6-PGBD3_ENST00000447839.2_Missense_Mutation_p.L956S|PGBD3_ENST00000603152.1_Missense_Mutation_p.L956S|PGBD3_ENST00000508005.2_Missense_Mutation_p.L488S	NM_170753.2	NP_736609.2	Q8N328	PGBD3_HUMAN	piggyBac transposable element derived 3	488										breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(16)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	33						GAAACAGAACAAAAGAGGGCT	0.418																																					p.S488S		Atlas-SNP	.											.	PGBD3	58	.	0			c.C1463C						PASS	.						134.0	127.0	130.0					10																	50723698		2203	4300	6503	SO:0001583	missense	267004	exon2			CAGAACAAAAGAG	AK074682	CCDS7230.1	10q11	2011-03-24			ENSG00000243251	ENSG00000243251			19400	protein-coding gene	gene with protein product							Standard	NM_170753		Approved	FLJ90201		Q8N328	OTTHUMG00000018193	ENST00000374127.3:c.1463T>C	chr10.hg19:g.50723698A>G	ENSP00000363242:p.Leu488Ser	43.0	0.0	.		39.0	20.0	.	NM_170753	B3KQC4|Q5W0M0|Q6PIH0	Silent	SNP	ENST00000374127.3	hg19	CCDS7230.1	.	.	.	.	.	.	.	.	.	.	A	9.207	1.029955	0.19512	.	.	ENSG00000243251;ENSG00000243251;ENSG00000258838;ENSG00000258838	ENST00000374127;ENST00000508005;ENST00000515869;ENST00000447839	T;T;T;T	0.17528	2.27;2.27;2.27;2.27	0.706	-1.01	0.10169	.	.	.	.	.	T	0.06188	0.0160	N	0.00621	-1.32	0.19300	N	0.999975	D;P	0.63880	0.993;0.874	P;P	0.51355	0.667;0.663	T	0.17745	-1.0359	8	0.23302	T	0.38	-17.488	.	.	.	.	956;488	E7EV46;Q8N328	.;PGBD3_HUMAN	S	488;488;956;956	ENSP00000363242:L488S;ENSP00000426963:L488S;ENSP00000423550:L956S;ENSP00000387966:L956S	ENSP00000387966:L956S	L	-	2	0	PGBD3;RP11-123B3.6	50393704	0.469000	0.25846	0.276000	0.24689	0.965000	0.64279	-0.098000	0.11024	-0.361000	0.08125	0.402000	0.26972	TTG	.	.	.	none		0.418	PGBD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047988.1		
IFIT2	3433	hgsc.bcm.edu	37	10	91065753	91065753	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr10:91065753C>T	ENST00000371826.3	+	2	209	c.40C>T	c.(40-42)Cgg>Tgg	p.R14W	LIPA_ENST00000371837.1_Intron|LIPA_ENST00000487618.1_Intron	NM_001547.4	NP_001538.4	P09913	IFIT2_HUMAN	interferon-induced protein with tetratricopeptide repeats 2	14					apoptotic mitochondrial changes (GO:0008637)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|negative regulation of protein binding (GO:0032091)|positive regulation of apoptotic process (GO:0043065)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	12		Colorectal(252;0.0161)				GAGCAGCCTACGGCAACTAAA	0.408																																					p.R14W		Atlas-SNP	.											.	IFIT2	39	.	0			c.C40T						PASS	.						87.0	86.0	86.0					10																	91065753		1861	4104	5965	SO:0001583	missense	3433	exon2			AGCCTACGGCAAC	M14660	CCDS41548.1	10q23.31	2013-01-11			ENSG00000119922	ENSG00000119922		"""Tetratricopeptide (TTC) repeat domain containing"""	5409	protein-coding gene	gene with protein product		147040		IFI54, G10P2		3175763, 3360121	Standard	NM_001547		Approved	IFI-54, ISG-54K, cig42, GARG-39	uc009xts.3	P09913	OTTHUMG00000018707	ENST00000371826.3:c.40C>T	chr10.hg19:g.91065753C>T	ENSP00000360891:p.Arg14Trp	98.0	0.0	.		107.0	42.0	.	NM_001547	Q5T767	Missense_Mutation	SNP	ENST00000371826.3	hg19	CCDS41548.1	.	.	.	.	.	.	.	.	.	.	C	13.80	2.345071	0.41498	.	.	ENSG00000119922	ENST00000371826	T	0.50001	0.76	4.58	0.669	0.17918	.	0.949995	0.08725	N	0.902872	T	0.28797	0.0714	N	0.21448	0.665	0.09310	N	1	B	0.26445	0.149	B	0.15052	0.012	T	0.23691	-1.0181	10	0.62326	D	0.03	-0.004	3.4206	0.07392	0.1212:0.5514:0.1178:0.2096	.	14	P09913	IFIT2_HUMAN	W	14	ENSP00000360891:R14W	ENSP00000360891:R14W	R	+	1	2	IFIT2	91055733	0.000000	0.05858	0.000000	0.03702	0.945000	0.59286	-0.229000	0.09098	0.133000	0.18654	-0.126000	0.14955	CGG	.	.	.	none		0.408	IFIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049293.1	NM_001547	
BTRC	8945	hgsc.bcm.edu	37	10	103190124	103190124	+	Nonsense_Mutation	SNP	G	G	A			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr10:103190124G>A	ENST00000370187.3	+	2	189	c.71G>A	c.(70-72)tGg>tAg	p.W24*	BTRC_ENST00000393441.4_Nonsense_Mutation_p.W9*|BTRC_ENST00000408038.2_Intron	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	24					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		AGGTCTCTGTGGCTGGGCTGC	0.542																																					p.W24X		Atlas-SNP	.											.	BTRC	64	.	0			c.G71A						PASS	.						79.0	75.0	76.0					10																	103190124		2203	4300	6503	SO:0001587	stop_gained	8945	exon2			CTCTGTGGCTGGG	Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.71G>A	chr10.hg19:g.103190124G>A	ENSP00000359206:p.Trp24*	66.0	0.0	.		62.0	25.0	.	NM_001256856	B5MD49|Q5W141|Q5W142|Q9Y213	Nonsense_Mutation	SNP	ENST00000370187.3	hg19	CCDS7512.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.974959	0.92919	.	.	ENSG00000166167	ENST00000370187;ENST00000393441;ENST00000370183	.	.	.	5.72	5.72	0.89469	.	0.082898	0.52532	D	0.000065	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.1493	20.2406	0.98372	0.0:0.0:1.0:0.0	.	.	.	.	X	24;9;6	.	ENSP00000359202:W6X	W	+	2	0	BTRC	103180114	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.098000	0.76974	2.857000	0.98124	0.650000	0.86243	TGG	.	.	.	none		0.542	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049936.1	NM_033637	
MADD	8567	hgsc.bcm.edu	37	11	47305994	47305994	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr11:47305994C>A	ENST00000311027.5	+	12	2200	c.2035C>A	c.(2035-2037)Cag>Aag	p.Q679K	MADD_ENST00000402799.1_Missense_Mutation_p.Q679K|MADD_ENST00000406482.1_Missense_Mutation_p.Q679K|MADD_ENST00000342922.4_Missense_Mutation_p.Q679K|MADD_ENST00000402192.2_Missense_Mutation_p.Q679K|MADD_ENST00000407859.3_Missense_Mutation_p.Q679K|MADD_ENST00000349238.3_Missense_Mutation_p.Q679K|MADD_ENST00000395336.3_Missense_Mutation_p.Q679K|MADD_ENST00000395344.3_Missense_Mutation_p.Q679K	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		GCTGCAGAATCAGAAGGAAGC	0.592																																					p.Q679K		Atlas-SNP	.											.	MADD	172	.	0			c.C2035A						PASS	.						78.0	83.0	81.0					11																	47305994		2201	4298	6499	SO:0001583	missense	8567	exon12			CAGAATCAGAAGG	AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.2035C>A	chr11.hg19:g.47305994C>A	ENSP00000310933:p.Gln679Lys	91.0	0.0	.		96.0	54.0	.	NM_130474		Missense_Mutation	SNP	ENST00000311027.5	hg19	CCDS7930.1	.	.	.	.	.	.	.	.	.	.	C	12.62	1.993769	0.35131	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192	T;T;T;T;T;T;T;T;T	0.05649	3.56;3.45;3.45;3.56;3.56;3.41;3.45;3.56;3.56	5.96	5.96	0.96718	.	0.918311	0.09568	N	0.784571	T	0.03695	0.0105	N	0.08118	0	0.80722	D	1	B;B;B;B;B;B;B;B;B;B	0.15141	0.005;0.0;0.002;0.0;0.0;0.0;0.001;0.012;0.001;0.001	B;B;B;B;B;B;B;B;B;B	0.17979	0.006;0.0;0.014;0.001;0.001;0.0;0.007;0.02;0.006;0.007	T	0.47018	-0.9149	10	0.12103	T	0.63	-4.7229	7.8312	0.29344	0.0:0.8128:0.0:0.1872	.	679;679;679;679;679;679;679;679;679;679	B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;MADD_HUMAN;.	K	679	ENSP00000343902:Q679K;ENSP00000385585:Q679K;ENSP00000384435:Q679K;ENSP00000304505:Q679K;ENSP00000310933:Q679K;ENSP00000384204:Q679K;ENSP00000378753:Q679K;ENSP00000378745:Q679K;ENSP00000384287:Q679K	ENSP00000310933:Q679K	Q	+	1	0	MADD	47262570	1.000000	0.71417	0.966000	0.40874	0.968000	0.65278	4.541000	0.60670	2.832000	0.97577	0.655000	0.94253	CAG	.	.	.	none		0.592	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317746.1		
MAP3K12	7786	hgsc.bcm.edu	37	12	53877202	53877202	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr12:53877202T>C	ENST00000267079.2	-	11	1670	c.1445A>G	c.(1444-1446)cAt>cGt	p.H482R	MAP3K12_ENST00000547035.1_Missense_Mutation_p.H515R|MAP3K12_ENST00000547488.1_Missense_Mutation_p.H515R	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	482					histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						TGTGTTTCCATGCAGGAGGCC	0.542																																					p.H515R		Atlas-SNP	.											.	MAP3K12	160	.	0			c.A1544G						PASS	.						130.0	128.0	129.0					12																	53877202		2203	4300	6503	SO:0001583	missense	7786	exon10			TTTCCATGCAGGA	U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.1445A>G	chr12.hg19:g.53877202T>C	ENSP00000267079:p.His482Arg	92.0	0.0	.		150.0	44.0	.	NM_001193511	B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Missense_Mutation	SNP	ENST00000267079.2	hg19	CCDS8860.1	.	.	.	.	.	.	.	.	.	.	T	14.81	2.646194	0.47258	.	.	ENSG00000139625	ENST00000267079;ENST00000547488;ENST00000547035	T;T;T	0.16897	2.31;2.31;2.31	5.42	5.42	0.78866	.	0.000000	0.47093	D	0.000250	T	0.10252	0.0251	N	0.12746	0.255	0.44946	D	0.997963	B;B	0.19331	0.035;0.02	B;B	0.20577	0.03;0.021	T	0.24154	-1.0168	10	0.18710	T	0.47	.	13.2975	0.60305	0.0:0.0:0.0:1.0	.	515;482	G3V1Y2;Q12852	.;M3K12_HUMAN	R	482;515;515	ENSP00000267079:H482R;ENSP00000449038:H515R;ENSP00000448689:H515R	ENSP00000267079:H482R	H	-	2	0	MAP3K12	52163469	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.040000	0.64191	2.196000	0.70406	0.533000	0.62120	CAT	.	.	.	none		0.542	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301	
OTOGL	283310	hgsc.bcm.edu	37	12	80648329	80648329	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr12:80648329T>C	ENST00000547103.1	+	14	1399	c.1393T>C	c.(1393-1395)Tgc>Cgc	p.C465R	OTOGL_ENST00000458043.2_Missense_Mutation_p.C465R			Q3ZCN5	OTOGL_HUMAN	otogelin-like	465					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						AGTTTGGAACTGCACTGAGCA	0.303																																					p.C465R		Atlas-SNP	.											.	OTOGL	235	.	0			c.T1393C						PASS	.						114.0	106.0	109.0					12																	80648329		1793	4064	5857	SO:0001583	missense	283310	exon14			TGGAACTGCACTG	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.1393T>C	chr12.hg19:g.80648329T>C	ENSP00000447211:p.Cys465Arg	65.0	0.0	.		88.0	47.0	.	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	hg19		.	.	.	.	.	.	.	.	.	.	T	21.9	4.211483	0.79240	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.67345	-0.26;-0.26	5.68	5.68	0.88126	.	.	.	.	.	D	0.88028	0.6327	H	0.97131	3.945	0.80722	D	1	.	.	.	.	.	.	D	0.92025	0.5629	7	0.87932	D	0	.	15.9323	0.79672	0.0:0.0:0.0:1.0	.	.	.	.	R	465	ENSP00000447211:C465R;ENSP00000400895:C465R	ENSP00000400895:C465R	C	+	1	0	OTOGL	79172460	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.552000	0.82192	2.175000	0.68902	0.533000	0.62120	TGC	.	.	.	none		0.303	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
SYNE2	23224	hgsc.bcm.edu	37	14	64634024	64634024	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr14:64634024T>A	ENST00000344113.4	+	91	16891	c.16679T>A	c.(16678-16680)cTt>cAt	p.L5560H	SYNE2_ENST00000357395.3_Missense_Mutation_p.L1945H|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000358025.3_Missense_Mutation_p.L5560H|SYNE2_ENST00000554584.1_Missense_Mutation_p.L5435H|SYNE2_ENST00000394768.2_Missense_Mutation_p.L1945H|SYNE2_ENST00000555002.1_Missense_Mutation_p.L2194H	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5560					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAGCTCCCACTTAGTGACGTA	0.463																																					p.L5560H		Atlas-SNP	.											.	SYNE2	577	.	0			c.T16679A						PASS	.						63.0	60.0	61.0					14																	64634024		2203	4300	6503	SO:0001583	missense	23224	exon91			TCCCACTTAGTGA	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.16679T>A	chr14.hg19:g.64634024T>A	ENSP00000341781:p.Leu5560His	160.0	0.0	.		168.0	74.0	.	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	hg19	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	T	15.96	2.986805	0.53934	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.70282	0.28;3.56;0.27;-0.47;3.59;3.56	5.78	5.78	0.91487	.	0.000000	0.49916	D	0.000137	T	0.80670	0.4667	L	0.51914	1.62	0.80722	D	1	P;D;B;P	0.89917	0.698;1.0;0.405;0.671	P;D;B;B	0.91635	0.599;0.999;0.172;0.264	T	0.79852	-0.1628	10	0.42905	T	0.14	.	16.3971	0.83610	0.0:0.0:0.0:1.0	.	1945;5435;5560;5560	Q8WXH0-7;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;SYNE2_HUMAN;.	H	5560;1945;5560;5435;5441;2194;1945	ENSP00000350719:L5560H;ENSP00000349969:L1945H;ENSP00000341781:L5560H;ENSP00000452570:L5435H;ENSP00000450831:L2194H;ENSP00000378249:L1945H	ENSP00000261678:L5441H	L	+	2	0	SYNE2	63703777	0.958000	0.32768	0.953000	0.39169	0.505000	0.33919	4.070000	0.57548	2.330000	0.79161	0.533000	0.62120	CTT	.	.	.	none		0.463	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
SPTLC2	9517	hgsc.bcm.edu	37	14	78028818	78028818	+	Silent	SNP	C	C	G			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr14:78028818C>G	ENST00000216484.2	-	6	964	c.771G>C	c.(769-771)ctG>ctC	p.L257L		NM_004863.3	NP_004854.1	O15270	SPTC2_HUMAN	serine palmitoyltransferase, long chain base subunit 2	257					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(5)	19			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)	GTTCATCACTCAGAATCAGGC	0.433																																					p.L257L		Atlas-SNP	.											.	SPTLC2	55	.	0			c.G771C						PASS	.						100.0	84.0	89.0					14																	78028818		2203	4300	6503	SO:0001819	synonymous_variant	9517	exon6			ATCACTCAGAATC	AB011098	CCDS9865.1	14q24.3	2014-09-17			ENSG00000100596	ENSG00000100596	2.3.1.50		11278	protein-coding gene	gene with protein product		605713				8921873, 9363775	Standard	NM_004863		Approved	KIAA0526, LCB2, LCB2A, hLCB2a	uc001xub.3	O15270		ENST00000216484.2:c.771G>C	chr14.hg19:g.78028818C>G		79.0	0.0	.		80.0	41.0	.	NM_004863	Q16685	Silent	SNP	ENST00000216484.2	hg19	CCDS9865.1	.	.	.	.	.	.	.	.	.	.	C	5.462	0.270283	0.10349	.	.	ENSG00000100596	ENST00000554901	.	.	.	5.73	2.89	0.33648	.	.	.	.	.	T	0.57095	0.2030	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49437	-0.8940	4	.	.	.	-12.241	7.7474	0.28877	0.0:0.6152:0.2506:0.1341	.	.	.	.	Q	194	.	.	E	-	1	0	SPTLC2	77098571	0.997000	0.39634	1.000000	0.80357	0.702000	0.40608	0.578000	0.23773	0.430000	0.26230	-0.259000	0.10710	GAG	.	.	.	none		0.433	SPTLC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414030.1	NM_004863	
SPG11	80208	hgsc.bcm.edu	37	15	44955757	44955757	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr15:44955757A>G	ENST00000261866.7	-	1	105	c.89T>C	c.(88-90)tTg>tCg	p.L30S	SPG11_ENST00000427534.2_Missense_Mutation_p.L30S|SPG11_ENST00000558319.1_Missense_Mutation_p.L30S|SPG11_ENST00000559193.1_Missense_Mutation_p.L30S|SPG11_ENST00000535302.2_Missense_Mutation_p.L30S	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	30					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		GACTGGCACCAACAGCATCGG	0.736																																					p.L30S		Atlas-SNP	.											.	SPG11	207	.	0			c.T89C						PASS	.						6.0	8.0	7.0					15																	44955757		2085	4129	6214	SO:0001583	missense	80208	exon1			GGCACCAACAGCA		CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.89T>C	chr15.hg19:g.44955757A>G	ENSP00000261866:p.Leu30Ser	60.0	0.0	.		56.0	29.0	.	NM_025137	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	ENST00000261866.7	hg19	CCDS10112.1	.	.	.	.	.	.	.	.	.	.	A	17.62	3.434670	0.62955	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	D;T;T	0.83419	-1.72;-1.49;-1.48	5.53	5.53	0.82687	.	0.473484	0.17960	N	0.156202	D	0.89234	0.6657	M	0.64997	1.995	0.39216	D	0.963406	D;D;D;D	0.89917	1.0;0.986;0.986;1.0	D;P;P;D	0.91635	0.989;0.791;0.791;0.999	D	0.90279	0.4313	10	0.87932	D	0	.	12.0478	0.53489	1.0:0.0:0.0:0.0	.	30;30;30;30	C4B7M2;F5H3N6;B9EK60;Q96JI7	.;.;.;SPTCS_HUMAN	S	30	ENSP00000261866:L30S;ENSP00000445278:L30S;ENSP00000396110:L30S	ENSP00000261866:L30S	L	-	2	0	SPG11	42743049	1.000000	0.71417	0.993000	0.49108	0.068000	0.16541	4.217000	0.58547	2.103000	0.63969	0.533000	0.62120	TTG	.	.	.	none		0.736	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253927.1		
ST8SIA2	8128	hgsc.bcm.edu	37	15	92987941	92987941	+	Silent	SNP	G	G	A	rs533826176	byFrequency	TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr15:92987941G>A	ENST00000268164.3	+	5	861	c.624G>A	c.(622-624)tcG>tcA	p.S208S	ST8SIA2_ENST00000539113.1_Silent_p.S187S	NM_006011.3	NP_006002.1	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2	208					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	early endosome (GO:0005769)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|recycling endosome (GO:0055037)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			endometrium(2)|large_intestine(6)|lung(9)|skin(2)|urinary_tract(1)	20	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			TGAACCCCTCGGTCATCCAGC	0.592													G|||	4	0.000798722	0.0	0.0	5008	,	,		18491	0.0		0.0	False		,,,				2504	0.0041				p.S208S		Atlas-SNP	.											.	ST8SIA2	41	.	0			c.G624A						PASS	.						67.0	67.0	67.0					15																	92987941		2198	4298	6496	SO:0001819	synonymous_variant	8128	exon5			CCCCTCGGTCATC	U33551	CCDS10372.1	15q26	2013-03-01	2003-01-14	2005-02-07	ENSG00000140557	ENSG00000140557		"""Sialyltransferases"""	10870	protein-coding gene	gene with protein product		602546	"""sialyltransferase 8 (alpha-2, 8-sialytransferase) B"""	SIAT8B		7559389	Standard	NM_006011		Approved	STX, ST8SIA-II, HsT19690	uc002bra.3	Q92186	OTTHUMG00000149843	ENST00000268164.3:c.624G>A	chr15.hg19:g.92987941G>A		115.0	0.0	.		129.0	62.0	.	NM_006011	Q4VAZ0|Q92470|Q92746	Silent	SNP	ENST00000268164.3	hg19	CCDS10372.1																																																																																			.	.	.	none		0.592	ST8SIA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313526.1	NM_006011	
ACSM2A	123876	hgsc.bcm.edu	37	16	20476871	20476871	+	Missense_Mutation	SNP	G	G	T	rs199594429		TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr16:20476871G>T	ENST00000573854.1	+	3	324	c.210G>T	c.(208-210)tgG>tgT	p.W70C	ACSM2A_ENST00000575558.1_3'UTR|ACSM2A_ENST00000396104.2_Missense_Mutation_p.W70C|ACSM2A_ENST00000575690.1_Missense_Mutation_p.W70C|ACSM2A_ENST00000417235.2_5'UTR|ACSM2A_ENST00000536134.1_5'UTR|ACSM2A_ENST00000219054.6_Missense_Mutation_p.W70C|ACSM2A_ENST00000424070.1_Missense_Mutation_p.W70C	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	70					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						CAGCCCTGTGGTGGGTGAATG	0.547																																					p.W70C		Atlas-SNP	.											.	ACSM2A	120	.	0			c.G210T						PASS	.						36.0	37.0	36.0					16																	20476871		2203	4298	6501	SO:0001583	missense	123876	exon4			CCTGTGGTGGGTG	AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.210G>T	chr16.hg19:g.20476871G>T	ENSP00000459451:p.Trp70Cys	242.0	0.0	.		241.0	98.0	.	NM_001010845	B3KTT9|O75202	Missense_Mutation	SNP	ENST00000573854.1	hg19	CCDS32401.1	.	.	.	.	.	.	.	.	.	.	G	13.09	2.134248	0.37630	.	.	ENSG00000183747	ENST00000219054;ENST00000424070;ENST00000396104	T;T;T	0.40225	1.04;1.04;1.04	3.76	3.76	0.43208	.	0.000000	0.41605	D	0.000844	T	0.59390	0.2190	L	0.60067	1.865	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.63120	-0.6708	10	0.54805	T	0.06	-9.9549	14.7458	0.69490	0.0:0.0:1.0:0.0	.	70	Q08AH3	ACS2A_HUMAN	C	70	ENSP00000219054:W70C;ENSP00000394904:W70C;ENSP00000379411:W70C	ENSP00000219054:W70C	W	+	3	0	ACSM2A	20384372	1.000000	0.71417	1.000000	0.80357	0.103000	0.19146	7.394000	0.79862	1.809000	0.52856	0.298000	0.19748	TGG	.	G|1.000;A|0.000	.	alt		0.547	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436764.1	NM_001010845	
SMPD3	55512	hgsc.bcm.edu	37	16	68405808	68405808	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr16:68405808G>A	ENST00000219334.5	-	3	880	c.277C>T	c.(277-279)Cgg>Tgg	p.R93W	SMPD3_ENST00000566009.1_5'Flank|SMPD3_ENST00000563226.1_Missense_Mutation_p.R93W|SMPD3_ENST00000568373.1_Missense_Mutation_p.R93W	NM_018667.3	NP_061137.1	Q9NY59	NSMA2_HUMAN	sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II)	93					cell cycle (GO:0007049)|glycosphingolipid metabolic process (GO:0006687)|hematopoietic progenitor cell differentiation (GO:0002244)|peptide hormone secretion (GO:0030072)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	Golgi cis cisterna (GO:0000137)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	ATGTAGGGCCGGCGGGCCGAC	0.637																																					p.R93W		Atlas-SNP	.											.	SMPD3	52	.	0			c.C277T						PASS	.						12.0	15.0	14.0					16																	68405808		2173	4269	6442	SO:0001583	missense	55512	exon3			AGGGCCGGCGGGC	AJ250460	CCDS10867.1	16q22.1	2008-02-05			ENSG00000103056	ENSG00000103056			14240	protein-coding gene	gene with protein product		605777				10823942	Standard	NM_018667		Approved	NSMASE2	uc002ewa.3	Q9NY59	OTTHUMG00000137559	ENST00000219334.5:c.277C>T	chr16.hg19:g.68405808G>A	ENSP00000219334:p.Arg93Trp	171.0	0.0	.		129.0	54.0	.	NM_018667	B7ZL82|Q2M1S8	Missense_Mutation	SNP	ENST00000219334.5	hg19	CCDS10867.1	.	.	.	.	.	.	.	.	.	.	G	18.75	3.690967	0.68271	.	.	ENSG00000103056	ENST00000219334	T	0.58797	0.31	5.3	-0.865	0.10662	.	0.152827	0.56097	D	0.000027	T	0.47395	0.1443	L	0.57536	1.79	0.37982	D	0.933636	B;B;B	0.22541	0.071;0.071;0.071	B;B;B	0.14578	0.011;0.011;0.011	T	0.46162	-0.9211	10	0.87932	D	0	-24.3484	8.4591	0.32917	0.0792:0.0:0.2842:0.6365	.	93;93;93	B7ZL82;B7ZL84;Q9NY59	.;.;NSMA2_HUMAN	W	93	ENSP00000219334:R93W	ENSP00000219334:R93W	R	-	1	2	SMPD3	66963309	0.998000	0.40836	0.987000	0.45799	0.938000	0.57974	0.321000	0.19558	0.011000	0.14865	0.655000	0.94253	CGG	.	.	.	none		0.637	SMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268895.3	NM_018667	
GLG1	2734	hgsc.bcm.edu	37	16	74505131	74505131	+	Silent	SNP	C	C	T			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr16:74505131C>T	ENST00000422840.2	-	15	2168	c.2169G>A	c.(2167-2169)caG>caA	p.Q723Q	GLG1_ENST00000447066.2_Silent_p.Q712Q|GLG1_ENST00000205061.5_Silent_p.Q723Q	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	723					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						GGTGTTTGTTCTGTATCAGAC	0.483																																					p.Q723Q		Atlas-SNP	.											.	GLG1	106	.	0			c.G2169A						PASS	.						363.0	306.0	325.0					16																	74505131		2198	4300	6498	SO:0001819	synonymous_variant	2734	exon15			TTTGTTCTGTATC		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.2169G>A	chr16.hg19:g.74505131C>T		87.0	0.0	.		79.0	37.0	.	NM_001145667	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Silent	SNP	ENST00000422840.2	hg19	CCDS45527.1																																																																																			.	.	.	none		0.483	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201	
KRT10	3858	hgsc.bcm.edu	37	17	38975316	38975316	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr17:38975316G>A	ENST00000269576.5	-	7	1480	c.1471C>T	c.(1471-1473)Cac>Tac	p.H491Y	TMEM99_ENST00000301665.3_5'Flank	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	491	Gly-rich.|Ser-rich.|Tail.			Missing (in Ref. 1; AAA60544). {ECO:0000305}.	cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				ctgccgccgtggccgccgccg	0.801																																					p.H491Y		Atlas-SNP	.											.	KRT10	56	.	0			c.C1471T						PASS	.						1.0	1.0	1.0					17																	38975316		219	517	736	SO:0001583	missense	3858	exon7			CGCCGTGGCCGCC	J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1471C>T	chr17.hg19:g.38975316G>A	ENSP00000269576:p.His491Tyr	26.0	0.0	.		98.0	13.0	.	NM_000421	Q14664|Q8N175	Missense_Mutation	SNP	ENST00000269576.5	hg19	CCDS11377.1	.	.	.	.	.	.	.	.	.	.	g	15.09	2.731363	0.48939	.	.	ENSG00000186395	ENST00000269576	D	0.83591	-1.74	5.21	-9.23	0.00672	.	2.489830	0.01848	N	0.035767	T	0.64724	0.2624	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.59397	-0.7462	10	0.45353	T	0.12	.	9.3977	0.38412	0.3538:0.2897:0.3564:0.0	.	491	P13645	K1C10_HUMAN	Y	491	ENSP00000269576:H491Y	ENSP00000269576:H491Y	H	-	1	0	KRT10	36228842	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-4.792000	0.00185	-2.762000	0.00369	-2.316000	0.00254	CAC	.	.	.	none		0.801	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257875.1	NM_000421	
KRT10	3858	hgsc.bcm.edu	37	17	38975319	38975319	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr17:38975319C>T	ENST00000269576.5	-	7	1477	c.1468G>A	c.(1468-1470)Ggc>Agc	p.G490S	TMEM99_ENST00000301665.3_5'Flank	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	490	Gly-rich.|Ser-rich.|Tail.			Missing (in Ref. 8; AAA59199). {ECO:0000305}.	cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				ccgccgtggccgccgccgtgg	0.791																																					p.G490S		Atlas-SNP	.											.	KRT10	56	.	0			c.G1468A						PASS	.																																			SO:0001583	missense	3858	exon7			CGTGGCCGCCGCC	J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1468G>A	chr17.hg19:g.38975319C>T	ENSP00000269576:p.Gly490Ser	20.0	0.0	.		104.0	19.0	.	NM_000421	Q14664|Q8N175	Missense_Mutation	SNP	ENST00000269576.5	hg19	CCDS11377.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546565	0.86022	.	.	ENSG00000186395	ENST00000269576	D	0.96587	-4.06	4.38	4.38	0.52667	.	0.845686	0.09879	N	0.743932	D	0.94778	0.8314	N	0.08118	0	0.27860	N	0.940431	D	0.89917	1.0	D	0.76071	0.987	D	0.87790	0.2618	10	0.18710	T	0.47	.	12.7512	0.57310	0.0:1.0:0.0:0.0	.	490	P13645	K1C10_HUMAN	S	490	ENSP00000269576:G490S	ENSP00000269576:G490S	G	-	1	0	KRT10	36228845	0.019000	0.18553	0.876000	0.34364	0.184000	0.23303	0.448000	0.21726	2.739000	0.93911	0.603000	0.83216	GGC	.	.	.	none		0.791	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257875.1	NM_000421	
ACSF2	80221	hgsc.bcm.edu	37	17	48538115	48538115	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr17:48538115T>G	ENST00000300441.4	+	2	310	c.206T>G	c.(205-207)cTt>cGt	p.L69R	ACSF2_ENST00000427954.2_Missense_Mutation_p.L94R|ACSF2_ENST00000502667.1_Missense_Mutation_p.L69R|ACSF2_ENST00000504392.1_Missense_Mutation_p.L69R|ACSF2_ENST00000541920.1_Intron	NM_025149.4	NP_079425.3	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2	69					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ligase activity (GO:0016874)			endometrium(7)|kidney(3)|large_intestine(1)|lung(1)|stomach(1)	13	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			AAAAAGCATCTTAACAGCAAG	0.572																																					p.L69R		Atlas-SNP	.											.	ACSF2	46	.	0			c.T206G						PASS	.						112.0	89.0	97.0					17																	48538115		2203	4300	6503	SO:0001583	missense	80221	exon2			AGCATCTTAACAG	AK024573, BC012053	CCDS11567.1, CCDS74103.1, CCDS74104.1, CCDS74105.1	17q21.33	2007-10-17			ENSG00000167107	ENSG00000167107		"""Acyl-CoA synthetase family"""	26101	protein-coding gene	gene with protein product		610465				17762044	Standard	NM_001288968		Approved	FLJ20920, ACSMW	uc002iqu.2	Q96CM8	OTTHUMG00000162128	ENST00000300441.4:c.206T>G	chr17.hg19:g.48538115T>G	ENSP00000300441:p.Leu69Arg	92.0	0.0	.		161.0	106.0	.	NM_025149	B4DFQ6|B4DHT5|B4DUF5|Q9H7G2	Missense_Mutation	SNP	ENST00000300441.4	hg19	CCDS11567.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.437471	0.83885	.	.	ENSG00000167107	ENST00000300441;ENST00000506582;ENST00000504392;ENST00000427954;ENST00000502667	T;T;T;T;T	0.50813	0.73;2.72;0.73;1.01;0.73	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.74711	0.3752	M	0.89534	3.04	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.996;0.994;0.998	T	0.80578	-0.1320	10	0.72032	D	0.01	-11.7183	15.7252	0.77751	0.0:0.0:0.0:1.0	.	69;94;69;69	B4DHT5;B4DFQ6;E9PF16;Q96CM8	.;.;.;ACSF2_HUMAN	R	69;69;69;94;69	ENSP00000300441:L69R;ENSP00000424842:L69R;ENSP00000425964:L69R;ENSP00000401831:L94R;ENSP00000421884:L69R	ENSP00000300441:L69R	L	+	2	0	ACSF2	45893114	1.000000	0.71417	0.089000	0.20774	0.006000	0.05464	6.840000	0.75369	2.191000	0.70037	0.533000	0.62120	CTT	.	.	.	none		0.572	ACSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367423.3	NM_025149	
CNDP2	55748	hgsc.bcm.edu	37	18	72180835	72180835	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr18:72180835A>G	ENST00000324262.4	+	8	1100	c.784A>G	c.(784-786)Att>Gtt	p.I262V	CNDP2_ENST00000324301.8_Missense_Mutation_p.I178V|CNDP2_ENST00000579847.1_Missense_Mutation_p.I262V	NM_018235.2	NP_060705.2	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2 (metallopeptidase M20 family)	262					cellular nitrogen compound metabolic process (GO:0034641)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)			breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(5)|ovary(2)|skin(2)|stomach(3)	24		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		GATCCCCGGCATTAACGAGGC	0.602																																					p.I262V		Atlas-SNP	.											.	CNDP2	55	.	0			c.A784G						PASS	.						65.0	55.0	59.0					18																	72180835		2203	4300	6503	SO:0001583	missense	55748	exon8			CCCGGCATTAACG	AK001692	CCDS12006.1, CCDS54190.1	18q22.3	2014-07-14	2004-07-12		ENSG00000133313	ENSG00000133313	3.4.13.18		24437	protein-coding gene	gene with protein product	"""cytosolic nonspecific dipeptidase"""	169800	"""peptidase A"""	PEPA		12473676	Standard	NM_018235		Approved	FLJ10830, CN2, HsT2298, CPGL	uc002llm.2	Q96KP4	OTTHUMG00000132853	ENST00000324262.4:c.784A>G	chr18.hg19:g.72180835A>G	ENSP00000325548:p.Ile262Val	43.0	0.0	.		33.0	12.0	.	NM_018235	B3KUG4|Q8WY59|Q9BQ94|Q9NVB4	Missense_Mutation	SNP	ENST00000324262.4	hg19	CCDS12006.1	.	.	.	.	.	.	.	.	.	.	A	14.11	2.439001	0.43326	.	.	ENSG00000133313	ENST00000324262;ENST00000324301	T	0.18016	2.24	5.74	4.56	0.56223	Peptidase M20, dimerisation (1);	0.087910	0.85682	N	0.000000	T	0.12944	0.0314	L	0.31526	0.94	0.58432	D	0.999998	B;B	0.15930	0.001;0.015	B;B	0.26517	0.017;0.07	T	0.10776	-1.0615	10	0.26408	T	0.33	-0.029	8.8536	0.35214	0.8049:0.1279:0.0671:0.0	.	178;262	Q96KP4-2;Q96KP4	.;CNDP2_HUMAN	V	262;178	ENSP00000325548:I262V	ENSP00000325548:I262V	I	+	1	0	CNDP2	70331815	1.000000	0.71417	0.973000	0.42090	0.801000	0.45260	5.174000	0.65015	0.970000	0.38263	0.533000	0.62120	ATT	.	.	.	none		0.602	CNDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256327.1	NM_018235	
ZNF556	80032	hgsc.bcm.edu	37	19	2877876	2877876	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr19:2877876G>C	ENST00000307635.2	+	4	1007	c.920G>C	c.(919-921)aGa>aCa	p.R307T	ZNF556_ENST00000586426.1_Missense_Mutation_p.R306T	NM_024967.1	NP_079243.1	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	307					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(3)|skin(7)	31				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGACACGTGAGAATTCACAAC	0.502																																					p.R307T		Atlas-SNP	.											.	ZNF556	73	.	0			c.G920C						PASS	.						56.0	54.0	55.0					19																	2877876		2203	4300	6503	SO:0001583	missense	80032	exon4			ACGTGAGAATTCA	BC009374	CCDS12097.1, CCDS74254.1	19p13.3	2013-09-20			ENSG00000172000	ENSG00000172000		"""Zinc fingers, C2H2-type"", ""-"""	25669	protein-coding gene	gene with protein product						12477932	Standard	XM_005259647		Approved	FLJ11637	uc002lwp.1	Q9HAH1	OTTHUMG00000180501	ENST00000307635.2:c.920G>C	chr19.hg19:g.2877876G>C	ENSP00000302603:p.Arg307Thr	128.0	0.0	.		148.0	63.0	.	NM_024967	Q96GM3	Missense_Mutation	SNP	ENST00000307635.2	hg19	CCDS12097.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.519533	0.27211	.	.	ENSG00000172000	ENST00000307635	T	0.25414	1.8	2.3	1.18	0.20946	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25606	0.0623	M	0.62723	1.935	0.22096	N	0.999363	P	0.41624	0.757	B	0.40565	0.333	T	0.13124	-1.0521	9	0.66056	D	0.02	.	6.4298	0.21790	0.0:0.3097:0.6903:0.0	.	307	Q9HAH1	ZN556_HUMAN	T	307	ENSP00000302603:R307T	ENSP00000302603:R307T	R	+	2	0	ZNF556	2828876	0.000000	0.05858	0.002000	0.10522	0.155000	0.21991	0.438000	0.21559	0.137000	0.18759	0.407000	0.27541	AGA	.	.	.	none		0.502	ZNF556-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451638.2	NM_024967	
TMEM145	284339	hgsc.bcm.edu	37	19	42817621	42817621	+	Silent	SNP	C	C	T			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr19:42817621C>T	ENST00000301204.3	+	1	134	c.93C>T	c.(91-93)taC>taT	p.Y31Y	TMEM145_ENST00000598766.1_Silent_p.Y31Y	NM_173633.2	NP_775904.2	Q8NBT3	TM145_HUMAN	transmembrane protein 145	31					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	27		Prostate(69;0.00682)				GGGCCAAGTACGTGCGGGGCA	0.766																																					p.Y31Y		Atlas-SNP	.											.	TMEM145	55	.	0			c.C93T						PASS	.						3.0	4.0	4.0					19																	42817621		1445	2532	3977	SO:0001819	synonymous_variant	284339	exon1			CAAGTACGTGCGG	AK075286	CCDS12603.1	19q13.2	2008-02-05				ENSG00000167619			26912	protein-coding gene	gene with protein product							Standard	NM_173633		Approved	FLJ90805	uc002otk.1	Q8NBT3		ENST00000301204.3:c.93C>T	chr19.hg19:g.42817621C>T		79.0	0.0	.		82.0	31.0	.	NM_173633		Silent	SNP	ENST00000301204.3	hg19	CCDS12603.1																																																																																			.	.	.	none		0.766	TMEM145-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463737.1	NM_173633	
PPP1R13L	10848	hgsc.bcm.edu	37	19	45889399	45889399	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr19:45889399T>C	ENST00000418234.2	-	9	1933	c.1855A>G	c.(1855-1857)Aag>Gag	p.K619E	PPP1R13L_ENST00000360957.5_Missense_Mutation_p.K619E	NM_001142502.1	NP_001135974.1	Q8WUF5	IASPP_HUMAN	protein phosphatase 1, regulatory subunit 13 like	619					apoptotic process (GO:0006915)|cardiac muscle contraction (GO:0060048)|cardiac right ventricle morphogenesis (GO:0003215)|embryonic camera-type eye development (GO:0031076)|hair cycle (GO:0042633)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|ventricular cardiac muscle tissue development (GO:0003229)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0182)		CGGCGGGCCTTGCGCGGGGAG	0.677																																					p.K619E	Pancreas(61;1447 1663 31419 50578)	Atlas-SNP	.											.	PPP1R13L	66	.	0			c.A1855G						PASS	.						6.0	8.0	7.0					19																	45889399		2156	4212	6368	SO:0001583	missense	10848	exon9			GGGCCTTGCGCGG	AF078036	CCDS33050.1	19q13.32	2013-01-10	2011-10-04		ENSG00000104881	ENSG00000104881		"""Ankyrin repeat domain containing"""	18838	protein-coding gene	gene with protein product		607463	"""protein phosphatase 1, regulatory (inhibitor) subunit 13 like"""			10336463	Standard	NM_006663		Approved	RAI, IASPP	uc002pbo.3	Q8WUF5		ENST00000418234.2:c.1855A>G	chr19.hg19:g.45889399T>C	ENSP00000403902:p.Lys619Glu	41.0	0.0	.		30.0	16.0	.	NM_001142502	Q2PNZ9|Q5DU71|Q5I1X4|Q6P1R7|Q6PKF8|Q9Y290	Missense_Mutation	SNP	ENST00000418234.2	hg19	CCDS33050.1	.	.	.	.	.	.	.	.	.	.	T	16.38	3.106921	0.56291	.	.	ENSG00000104881	ENST00000418234;ENST00000360957;ENST00000221478	T;T	0.57752	0.38;0.38	4.99	4.99	0.66335	Src homology-3 domain (1);	0.103779	0.64402	D	0.000004	T	0.34250	0.0891	N	0.24115	0.695	0.38248	D	0.941515	P;P	0.48407	0.91;0.769	B;B	0.37015	0.239;0.094	T	0.29458	-1.0011	10	0.25106	T	0.35	.	12.6956	0.57001	0.0:0.0:0.0:1.0	.	619;198	Q8WUF5;A7YME7	IASPP_HUMAN;.	E	619;619;193	ENSP00000403902:K619E;ENSP00000354218:K619E	ENSP00000221478:K193E	K	-	1	0	PPP1R13L	50581239	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.812000	0.38952	2.102000	0.63906	0.459000	0.35465	AAG	.	.	.	none		0.677	PPP1R13L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457586.1	NM_006663	
CHD6	84181	hgsc.bcm.edu	37	20	40086018	40086018	+	Nonsense_Mutation	SNP	A	A	T			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr20:40086018A>T	ENST00000373233.3	-	18	2892	c.2715T>A	c.(2713-2715)taT>taA	p.Y905*	CHD6_ENST00000309279.7_Intron	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	905	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TGATGAGGCGATACACCTTCA	0.527																																					p.Y905X		Atlas-SNP	.											.	CHD6	312	.	0			c.T2715A						PASS	.						144.0	110.0	121.0					20																	40086018		2203	4300	6503	SO:0001587	stop_gained	84181	exon18			GAGGCGATACACC	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.2715T>A	chr20.hg19:g.40086018A>T	ENSP00000362330:p.Tyr905*	94.0	0.0	.		126.0	39.0	.	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Nonsense_Mutation	SNP	ENST00000373233.3	hg19	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	A	42	9.300881	0.99130	.	.	ENSG00000124177	ENST00000373233	.	.	.	5.42	3.18	0.36537	.	0.000000	0.51477	D	0.000085	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.8164	9.2947	0.37808	0.8543:0.0:0.1457:0.0	.	.	.	.	X	905	.	ENSP00000362330:Y905X	Y	-	3	2	CHD6	39519432	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.745000	0.38278	1.011000	0.39340	0.482000	0.46254	TAT	.	.	.	none		0.527	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
ADAMTS1	9510	hgsc.bcm.edu	37	21	28217050	28217050	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr21:28217050C>T	ENST00000284984.3	-	1	678	c.224G>A	c.(223-225)cGc>cAc	p.R75H		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	75					heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		CAGGCGGAGGCGCGTGGTCCC	0.706											OREG0026151	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R75H		Atlas-SNP	.											.	ADAMTS1	131	.	0			c.G224A						PASS	.						7.0	9.0	9.0					21																	28217050		2179	4262	6441	SO:0001583	missense	9510	exon1			CGGAGGCGCGTGG	AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.224G>A	chr21.hg19:g.28217050C>T	ENSP00000284984:p.Arg75His	69.0	0.0	.	800	68.0	27.0	.	NM_006988	D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Missense_Mutation	SNP	ENST00000284984.3	hg19	CCDS33524.1	.	.	.	.	.	.	.	.	.	.	C	11.39	1.625463	0.28889	.	.	ENSG00000154734	ENST00000284984	T	0.05786	3.39	4.06	-1.13	0.09775	Peptidase M12B, propeptide (1);	.	.	.	.	T	0.02193	0.0068	N	0.03324	-0.35	0.39418	D	0.966863	B	0.11235	0.004	B	0.09377	0.004	T	0.48896	-0.8994	9	0.09338	T	0.73	.	7.6505	0.28346	0.4991:0.4049:0.0:0.096	.	75	Q9UHI8	ATS1_HUMAN	H	75	ENSP00000284984:R75H	ENSP00000284984:R75H	R	-	2	0	ADAMTS1	27138921	0.366000	0.25014	0.967000	0.41034	0.769000	0.43574	0.373000	0.20484	-0.033000	0.13736	-0.410000	0.06199	CGC	.	.	.	none		0.706	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171650.2		
CECR6	27439	hgsc.bcm.edu	37	22	17600499	17600499	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr22:17600499G>T	ENST00000331437.3	-	1	1644	c.1519C>A	c.(1519-1521)Ctc>Atc	p.L507I	AC006946.15_ENST00000441544.1_5'Flank|CECR6_ENST00000399875.1_Missense_Mutation_p.L152I	NM_031890.3	NP_114096.1	Q9BXQ6	CECR6_HUMAN	cat eye syndrome chromosome region, candidate 6	507										haematopoietic_and_lymphoid_tissue(1)	1		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.221)		CGGCAGCCGAGGAAGAAGAGG	0.706																																					p.L507I		Atlas-SNP	.											.	CECR6	11	.	0			c.C1519A						PASS	.						4.0	5.0	5.0					22																	17600499		2090	4119	6209	SO:0001583	missense	27439	exon1			AGCCGAGGAAGAA	AF307451	CCDS13740.1, CCDS54494.1	22q11.2	2008-06-12			ENSG00000183307	ENSG00000183307			1844	protein-coding gene	gene with protein product						11381032	Standard	NM_031890		Approved		uc002zmb.2	Q9BXQ6	OTTHUMG00000030471	ENST00000331437.3:c.1519C>A	chr22.hg19:g.17600499G>T	ENSP00000329318:p.Leu507Ile	32.0	0.0	.		26.0	11.0	.	NM_031890	A8MYY1	Missense_Mutation	SNP	ENST00000331437.3	hg19	CCDS13740.1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.291089	0.40494	.	.	ENSG00000183307	ENST00000399875;ENST00000331437	.	.	.	4.63	4.63	0.57726	.	0.559654	0.15368	U	0.266033	T	0.41396	0.1157	L	0.29908	0.895	0.31742	N	0.635717	D	0.59767	0.986	P	0.53593	0.73	T	0.30851	-0.9964	9	0.22109	T	0.4	.	12.0274	0.53380	0.0:0.0:0.8275:0.1725	.	507	Q9BXQ6	CECR6_HUMAN	I	152;507	.	ENSP00000329318:L507I	L	-	1	0	CECR6	15980499	1.000000	0.71417	0.997000	0.53966	0.704000	0.40688	3.107000	0.50329	2.290000	0.77057	0.561000	0.74099	CTC	.	.	.	none		0.706	CECR6-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075359.4	NM_031890	
AR	367	hgsc.bcm.edu	37	X	66765229	66765229	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chrX:66765229G>C	ENST00000374690.3	+	1	765	c.241G>C	c.(241-243)Gag>Cag	p.E81Q	AR_ENST00000396044.3_Missense_Mutation_p.E81Q|AR_ENST00000504326.1_Missense_Mutation_p.E81Q|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	79	Gln-rich.|Modulating.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	gcagcagcaagagactagccc	0.642									Androgen Insensitivity Syndrome																												p.E81Q		Atlas-SNP	.											.	AR	249	.	0			c.G241C						PASS	.						11.0	10.0	10.0					X																	66765229		2156	4212	6368	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	CAGCAAGAGACTA	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.241G>C	chrX.hg19:g.66765229G>C	ENSP00000363822:p.Glu81Gln	125.0	0.0	.		119.0	9.0	.	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	hg19	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	N	0.251	-1.006630	0.02112	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.71934	-0.61;-0.61;-0.61	5.2	-5.32	0.02722	.	.	.	.	.	T	0.50120	0.1597	N	0.05280	-0.08	0.09310	N	1	B;B;B	0.34329	0.078;0.025;0.449	B;B;B	0.38921	0.026;0.016;0.285	T	0.36841	-0.9731	9	0.20046	T	0.44	.	17.1942	0.86888	0.0:0.7494:0.1481:0.1025	.	81;81;79	E7EVX6;D3YPQ2;P10275	.;.;ANDR_HUMAN	Q	81;81;81;73	ENSP00000363822:E81Q;ENSP00000421155:E81Q;ENSP00000379359:E81Q	ENSP00000363822:E81Q	E	+	1	0	AR	66681954	0.000000	0.05858	0.001000	0.08648	0.047000	0.14425	-2.343000	0.01099	-1.154000	0.02825	-0.206000	0.12725	GAG	.	.	.	none		0.642	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
CACNA2D4	93589	hgsc.bcm.edu	37	12	2027591	2027592	+	Frame_Shift_Ins	INS	-	-	G			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr12:2027591_2027592insG	ENST00000382722.5	-	1	410_411	c.48_49insC	c.(46-51)cccaccfs	p.T17fs	CACNA2D4_ENST00000586184.1_Frame_Shift_Ins_p.T17fs|CACNA2D4_ENST00000585732.1_Frame_Shift_Ins_p.T17fs|RP5-1096D14.3_ENST00000544163.1_RNA|CACNA2D4_ENST00000587995.1_Frame_Shift_Ins_p.T17fs	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	17					calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		GCAGGCATGGTGGGCCTGGGGT	0.644																																					p.T17fs	Colon(2;101 179 21030 23310 28141)	Atlas-INDEL	.											.	CACNA2D4	220	.	0			c.49_50insC						PASS	.																																			SO:0001589	frameshift_variant	93589	exon1			.	AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.49dupC	chr12.hg19:g.2027594_2027594dupG	ENSP00000372169:p.Thr17fs	82.0	0.0	0		136.0	10.0	0.0735294	NM_172364	Q7Z3S8|Q86XZ5|Q8IZS9	Frame_Shift_Ins	INS	ENST00000382722.5	hg19	CCDS44785.1																																																																																			.	.	.	none		0.644	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398230.2		
DZIP1	22873	hgsc.bcm.edu	37	13	96242581	96242581	+	Frame_Shift_Del	DEL	C	C	-			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr13:96242581delC	ENST00000376829.2	-	17	2646	c.1795delG	c.(1795-1797)gaafs	p.E599fs	DZIP1_ENST00000361156.3_Frame_Shift_Del_p.E580fs|DZIP1_ENST00000347108.3_Frame_Shift_Del_p.E599fs|DZIP1_ENST00000361396.2_Frame_Shift_Del_p.E580fs	NM_198968.3	NP_945319.1	Q86YF9	DZIP1_HUMAN	DAZ interacting zinc finger protein 1	599					cilium assembly (GO:0042384)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(20)|lung(11)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	38	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			ACTTGATGTTCAAGGAATTCT	0.353																																					p.E599fs		Atlas-Indel,Pindel	.											.	DZIP1	195	.	0			c.1796delA						PASS	.						196.0	176.0	183.0					13																	96242581		2203	4300	6503	SO:0001589	frameshift_variant	22873	exon17			.	AB023213	CCDS9477.1, CCDS9478.1	13q32.1	2013-05-22	2013-05-22		ENSG00000134874	ENSG00000134874		"""Zinc fingers, C2H2-type"""	20908	protein-coding gene	gene with protein product		608671	"""DAZ interacting protein 1"""				Standard	NM_014934		Approved	KIAA0996, DZIP	uc001vmk.4	Q86YF9	OTTHUMG00000017224	ENST00000376829.2:c.1795delG	chr13.hg19:g.96242581delC	ENSP00000366025:p.Glu599fs	106.0	0.0	0		80.0	40.0	0.5	NM_198968	Q5W078|Q5W079|Q8WY45|Q8WY46|Q9UGA5|Q9Y2K0	Frame_Shift_Del	DEL	ENST00000376829.2	hg19	CCDS9478.1																																																																																			.	.	.	none		0.353	DZIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045496.3	NM_014934	
UMPS	7372	hgsc.bcm.edu	37	3	124458913	124458913	+	Frame_Shift_Del	DEL	C	C	-			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr3:124458913delC	ENST00000232607.2	+	4	1131	c.1025delC	c.(1024-1026)gctfs	p.A342fs	UMPS_ENST00000413078.2_Intron|UMPS_ENST00000536109.1_Frame_Shift_Del_p.A250fs|UMPS_ENST00000538242.1_Frame_Shift_Del_p.A164fs	NM_000373.3	NP_000364.1	P11172	UMPS_HUMAN	uridine monophosphate synthetase	342	OMPdecase.				'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|cellular response to drug (GO:0035690)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|small molecule metabolic process (GO:0044281)|UMP biosynthetic process (GO:0006222)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	orotate phosphoribosyltransferase activity (GO:0004588)|orotidine-5'-phosphate decarboxylase activity (GO:0004590)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(114;0.146)	Fluorouracil(DB00544)	CTAGTAAATGCTCACGTGGTG	0.483																																					p.A342fs		Atlas-INDEL	.											.	UMPS	43	.	0			c.1024delG						PASS	.						98.0	100.0	99.0					3																	124458913		2203	4300	6503	SO:0001589	frameshift_variant	7372	exon4			.		CCDS3029.1	3q13	2008-02-04	2008-02-04		ENSG00000114491	ENSG00000114491	2.4.2.10, 4.1.1.23		12563	protein-coding gene	gene with protein product	"""orotate phosphoribosyl transferase and orotidine-5'-decarboxylase"""	613891				2767686	Standard	NM_000373		Approved		uc003ehl.4	P11172	OTTHUMG00000159431	ENST00000232607.2:c.1025delC	chr3.hg19:g.124458913delC	ENSP00000232607:p.Ala342fs	198.0	0.0	0		133.0	45.0	0.338346	NM_000373	B5LY68|B5LY72|O00758|O00759|O00760|Q16862|Q9H3Q2|Q9UG49	Frame_Shift_Del	DEL	ENST00000232607.2	hg19	CCDS3029.1																																																																																			.	.	.	none		0.483	UMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355271.1	NM_000373	
FMN1	342184	hgsc.bcm.edu	37	15	33261121	33261122	+	Frame_Shift_Ins	INS	-	-	G			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr15:33261121_33261122insG	ENST00000559047.1	-	5	2779_2780	c.2780_2781insC	c.(2779-2781)ccafs	p.P927fs	FMN1_ENST00000561249.1_Frame_Shift_Ins_p.P829fs|FMN1_ENST00000334528.9_Frame_Shift_Ins_p.P704fs|SNORD77_ENST00000391113.1_RNA			Q68DA7	FMN1_HUMAN	formin 1	927	FH1.|Pro-rich.				actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		GAAgtgggggtgggggtggggg	0.673																																					p.P704fs		Atlas-INDEL	.											FMN1_ENST00000334528,NS,carcinoma,0,2	FMN1	174	.	0			c.2112_2113insC						PASS	.																																			SO:0001589	frameshift_variant	342184	exon4			.	AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2781dupC	chr15.hg19:g.33261126_33261126dupG	ENSP00000454047:p.Pro927fs	19.0	0.0	0		30.0	10.0	0.333333	NM_001103184	Q3B7I6|Q3ZAR4|Q6ZSY1	Frame_Shift_Ins	INS	ENST00000559047.1	hg19																																																																																				.	.	.	none		0.673	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000417414.1	NM_001103184	
TNFSF8	944	hgsc.bcm.edu	37	9	117666251	117666257	+	Frame_Shift_Del	DEL	TCAAGAG	TCAAGAG	-			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	TCAAGAG	TCAAGAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr9:117666251_117666257delTCAAGAG	ENST00000223795.2	-	4	772_778	c.659_665delCTCTTGA	c.(658-666)cctcttgagfs	p.PLE220fs	TNFSF8_ENST00000474301.1_Intron	NM_001244.3	NP_001235.1	P32971	TNFL8_HUMAN	tumor necrosis factor (ligand) superfamily, member 8	220					apoptotic process (GO:0006915)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor binding (GO:0005102)			endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|skin(3)|urinary_tract(1)	12						CAACACATTCTCAAGAGGAAAGGTGCT	0.42																																					p.220_222del		Atlas-Indel,Pindel	.											.	TNFSF8	34	.	0			c.660_666del						PASS	.																																			SO:0001589	frameshift_variant	944	exon4			.	L09753	CCDS6810.1, CCDS75884.1	9q33	2008-02-05			ENSG00000106952	ENSG00000106952		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11938	protein-coding gene	gene with protein product		603875		CD30LG		8391931, 9349718	Standard	NM_001244		Approved	CD153	uc004bji.2	P32971	OTTHUMG00000021025	ENST00000223795.2:c.659_665delCTCTTGA	chr9.hg19:g.117666251_117666257delTCAAGAG	ENSP00000223795:p.Pro220fs	73.0	0.0	0		64.0	27.0	0.421875	NM_001244	O43404	Frame_Shift_Del	DEL	ENST00000223795.2	hg19	CCDS6810.1																																																																																			.	.	.	none		0.420	TNFSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055464.1		
GPALPP1	55425	hgsc.bcm.edu	37	13	45594477	45594477	+	Frame_Shift_Del	DEL	G	G	-			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr13:45594477delG	ENST00000379151.4	+	7	821	c.718delG	c.(718-720)gcafs	p.A240fs	RP11-321C24.1_ENST00000437748.2_lincRNA|GPALPP1_ENST00000357537.3_Frame_Shift_Del_p.A70fs|GPALPP1_ENST00000361121.2_Frame_Shift_Del_p.A240fs	NM_018559.2	NP_061029.2	Q8IXQ4	GPAM1_HUMAN	GPALPP motifs containing 1	240																	AACACAAGAAGCAAGGAAGTC	0.294																																					p.E239fs		Atlas-Indel,Pindel	.											.	KIAA1704	36	.	0			c.717delA						PASS	.						92.0	93.0	92.0					13																	45594477		2203	4300	6503	SO:0001589	frameshift_variant	55425	exon7			.	AB051491	CCDS9394.1	13q14.12	2013-08-13	2013-08-12	2013-08-12	ENSG00000133114	ENSG00000133114			20298	protein-coding gene	gene with protein product			"""KIAA1704"""	KIAA1704		11214970	Standard	NM_018559		Approved	bA245H20.2, AD029, LSR7	uc001uzq.3	Q8IXQ4	OTTHUMG00000016841	ENST00000379151.4:c.718delG	chr13.hg19:g.45594477delG	ENSP00000368447:p.Ala240fs	325.0	0.0	0		377.0	156.0	0.413793	NM_018559	A8K8X8|Q05BX8|Q05D87|Q5T3Z3|Q5T3Z5|Q9C0F9|Q9H2R0|Q9P0W6	Frame_Shift_Del	DEL	ENST00000379151.4	hg19	CCDS9394.1																																																																																			.	.	.	none		0.294	GPALPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044749.2	NM_018559	
LRIG3	121227	hgsc.bcm.edu	37	12	59282143	59282149	+	Frame_Shift_Del	DEL	ATCAGGG	ATCAGGG	-	rs369199158		TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	ATCAGGG	ATCAGGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr12:59282143_59282149delATCAGGG	ENST00000320743.3	-	7	1195_1201	c.909_915delCCCTGAT	c.(907-915)agccctgatfs	p.SPD303fs	LRIG3_ENST00000379141.4_Frame_Shift_Del_p.SPD243fs	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	303					otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			ACTCCCAGGCATCAGGGCTGATCCTGT	0.488			T	ROS1	NSCLC																																p.304_306del		Atlas-Indel,Pindel	.		Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	.	LRIG3	120	.	0			c.910_916del						PASS	.																																			SO:0001589	frameshift_variant	121227	exon7			.	AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.909_915delCCCTGAT	chr12.hg19:g.59282143_59282149delATCAGGG	ENSP00000326759:p.Ser303fs	65.0	0.0	0		90.0	22.0	0.244444	NM_153377	Q6UXL7|Q8NC72	Frame_Shift_Del	DEL	ENST00000320743.3	hg19	CCDS8960.1																																																																																			.	.	.	none		0.488	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377	
UQCRC1	7384	hgsc.bcm.edu	37	3	48637112	48637118	+	Frame_Shift_Del	DEL	CAGATCT	CAGATCT	-	rs3172495		TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	CAGATCT	CAGATCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr3:48637112_48637118delCAGATCT	ENST00000203407.5	-	12	1744_1750	c.1328_1334delAGATCTG	c.(1327-1335)gagatctgcfs	p.EIC443fs		NM_003365.2	NP_003356.2	P31930	QCR1_HUMAN	ubiquinol-cytochrome c reductase core protein I	443					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|oxidation-reduction process (GO:0055114)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|response to activity (GO:0014823)|response to alkaloid (GO:0043279)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GTACTTGGAGCAGATCTCACGTACCAC	0.565																																					p.443_445del	NSCLC(81;1112 1427 27031 32409 45529)	Atlas-Indel,Pindel	.											.	UQCRC1	42	.	0			c.1329_1335del						PASS	.																																			SO:0001589	frameshift_variant	7384	exon12			.	BC009586	CCDS2774.1	3p21	2011-07-04			ENSG00000010256	ENSG00000010256	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12585	protein-coding gene	gene with protein product		191328				8407948	Standard	NM_003365		Approved	D3S3191, QCR1, UQCR1	uc003cub.1	P31930	OTTHUMG00000133539	ENST00000203407.5:c.1328_1334delAGATCTG	chr3.hg19:g.48637112_48637118delCAGATCT	ENSP00000203407:p.Glu443fs	43.0	0.0	0		38.0	12.0	0.315789	NM_003365	B2R7R8|Q96DD2	Frame_Shift_Del	DEL	ENST00000203407.5	hg19	CCDS2774.1																																																																																			.	.	.	none		0.565	UQCRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257517.1	NM_003365	
MAPKBP1	23005	hgsc.bcm.edu	37	15	42107832	42107839	+	Frame_Shift_Del	DEL	AAATCATC	AAATCATC	-			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	AAATCATC	AAATCATC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr15:42107832_42107839delAAATCATC	ENST00000456763.2	+	13	1542_1549	c.1346_1353delAAATCATC	c.(1345-1353)aaaatcatcfs	p.KII449fs	MAPKBP1_ENST00000260357.7_Frame_Shift_Del_p.KII282fs|MAPKBP1_ENST00000514566.1_Frame_Shift_Del_p.KII443fs|MAPKBP1_ENST00000221214.6_Frame_Shift_Del_p.KII326fs|MAPKBP1_ENST00000457542.2_Frame_Shift_Del_p.KII443fs	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	449										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		GACCTCATTAAAATCATCTATGTGGATG	0.548																																					p.449_451del		Atlas-Indel,Pindel	.											.	MAPKBP1	120	.	0			c.1345_1352del						PASS	.																																			SO:0001589	frameshift_variant	23005	exon13			.	AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.1346_1353delAAATCATC	chr15.hg19:g.42107832_42107839delAAATCATC	ENSP00000393099:p.Lys449fs	67.0	0.0	0		60.0	26.0	0.433333	NM_001128608	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Frame_Shift_Del	DEL	ENST00000456763.2	hg19	CCDS45239.1																																																																																			.	.	.	none		0.548	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	NM_014994	
FLRT2	23768	hgsc.bcm.edu	37	14	86089469	86089469	+	Frame_Shift_Del	DEL	G	G	-			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr14:86089469delG	ENST00000330753.4	+	2	2378	c.1611delG	c.(1609-1611)atgfs	p.M537fs	FLRT2_ENST00000554746.1_Frame_Shift_Del_p.M537fs	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	537					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		CCCACAGCATGGGCTCCCCCT	0.572																																					p.M537fs		Atlas-Indel,Pindel	.											.	FLRT2	168	.	0			c.1610delT						PASS	.						94.0	96.0	96.0					14																	86089469		2203	4300	6503	SO:0001589	frameshift_variant	23768	exon2			.	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1611delG	chr14.hg19:g.86089469delG	ENSP00000332879:p.Met537fs	98.0	0.0	0		106.0	41.0	0.386792	NM_013231	A0AV84|B7ZLP3	Frame_Shift_Del	DEL	ENST00000330753.4	hg19	CCDS9877.1																																																																																			.	.	.	none		0.572	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
UMPS	7372	hgsc.bcm.edu	37	3	124458915	124458920	+	In_Frame_Del	DEL	CACGTG	CACGTG	-	rs374066947		TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	CACGTG	CACGTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr3:124458915_124458920delCACGTG	ENST00000232607.2	+	4	1133_1138	c.1027_1032delCACGTG	c.(1027-1032)cacgtgdel	p.HV343del	UMPS_ENST00000413078.2_Intron|UMPS_ENST00000536109.1_In_Frame_Del_p.HV251del|UMPS_ENST00000538242.1_In_Frame_Del_p.HV165del	NM_000373.3	NP_000364.1	P11172	UMPS_HUMAN	uridine monophosphate synthetase	343	OMPdecase.				'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|cellular response to drug (GO:0035690)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|small molecule metabolic process (GO:0044281)|UMP biosynthetic process (GO:0006222)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	orotate phosphoribosyltransferase activity (GO:0004588)|orotidine-5'-phosphate decarboxylase activity (GO:0004590)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(114;0.146)	Fluorouracil(DB00544)	AGTAAATGCTCACGTGGTGCCAGGCT	0.49																																					p.342_344del		Atlas-INDEL	.											.	UMPS	43	.	0			c.1026_1031del						PASS	.																																			SO:0001651	inframe_deletion	7372	exon4			.		CCDS3029.1	3q13	2008-02-04	2008-02-04		ENSG00000114491	ENSG00000114491	2.4.2.10, 4.1.1.23		12563	protein-coding gene	gene with protein product	"""orotate phosphoribosyl transferase and orotidine-5'-decarboxylase"""	613891				2767686	Standard	NM_000373		Approved		uc003ehl.4	P11172	OTTHUMG00000159431	ENST00000232607.2:c.1027_1032delCACGTG	chr3.hg19:g.124458915_124458920delCACGTG	ENSP00000232607:p.His343_Val344del	202.0	0.0	0		135.0	45.0	0.333333	NM_000373	B5LY68|B5LY72|O00758|O00759|O00760|Q16862|Q9H3Q2|Q9UG49	In_Frame_Del	DEL	ENST00000232607.2	hg19	CCDS3029.1																																																																																			.	.	.	none		0.490	UMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355271.1	NM_000373	
IRF2BPL	64207	hgsc.bcm.edu	37	14	77493645	77493656	+	In_Frame_Del	DEL	GCAGCGGCGGCG	GCAGCGGCGGCG	-	rs61991619|rs371633333	byFrequency	TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	GCAGCGGCGGCG	GCAGCGGCGGCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr14:77493645_77493656delGCAGCGGCGGCG	ENST00000238647.3	-	1	1378_1389	c.480_491delCGCCGCCGCTGC	c.(478-492)gccgccgccgctgcg>gcg	p.160_164AAAAA>A		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	160	Poly-Ala.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.A164delA(1)		endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						CTGTTCCACCgcagcggcggcggcggcggcgg	0.736																																					p.161_164del		Atlas-Indel,Pindel	.											.	IRF2BPL	40	.	1	Deletion - In frame(1)	prostate(1)	c.481_492del						PASS	.			376,2,122,3430		51,0,0,274,1,0,0,13,96,1530						-1.5	0.5			7	1144,6,542,5962		238,0,2,666,2,0,2,59,422,2436	no	codingComplex	IRF2BPL	NM_024496.2		289,0,2,940,3,0,2,72,518,3966	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		22.1061,12.7226,18.9227				1520,8,664,9392				SO:0001651	inframe_deletion	64207	exon1			.	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.480_491delCGCCGCCGCTGC	chr14.hg19:g.77493645_77493656delGCAGCGGCGGCG	ENSP00000238647:p.Ala160_Ala163del	24.0	0.0	0		31.0	11.0	0.354839	NM_024496	Q8NDQ2|Q96JG2|Q9H3I7	In_Frame_Del	DEL	ENST00000238647.3	hg19	CCDS9854.1																																																																																			.	.	.	none		0.736	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
SLCO1C1	53919	hgsc.bcm.edu	37	12	20854365	20854365	+	Frame_Shift_Del	DEL	G	G	-			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr12:20854365delG	ENST00000266509.2	+	3	611	c.243delG	c.(241-243)gtgfs	p.V81fs	SLCO1C1_ENST00000545102.1_Intron|SLCO1C1_ENST00000540354.1_Frame_Shift_Del_p.V81fs|SLCO1C1_ENST00000381552.1_Frame_Shift_Del_p.V81fs|SLCO1C1_ENST00000545604.1_Frame_Shift_Del_p.V81fs	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	81					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	CTTCACTGGTGGGAGTTATTG	0.408																																					p.V81fs		Atlas-Indel,Pindel	.											.	SLCO1C1	216	.	0			c.242delT						PASS	.						160.0	139.0	146.0					12																	20854365		2203	4299	6502	SO:0001589	frameshift_variant	53919	exon3			.	AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.243delG	chr12.hg19:g.20854365delG	ENSP00000266509:p.Val81fs	114.0	0.0	0		132.0	73.0	0.55303	NM_017435	B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Frame_Shift_Del	DEL	ENST00000266509.2	hg19	CCDS8683.1																																																																																			.	.	.	none		0.408	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401765.1	NM_017435	
PTK6	5753	hgsc.bcm.edu	37	20	62168498	62168499	+	Frame_Shift_Ins	INS	-	-	C			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr20:62168498_62168499insC	ENST00000217185.2	-	1	196_197	c.169_170insG	c.(169-171)gtgfs	p.V57fs	PTK6_ENST00000542869.1_5'UTR	NM_005975.3	NP_005966.1	Q13882	PTK6_HUMAN	protein tyrosine kinase 6	57	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|intestinal epithelial cell differentiation (GO:0060575)|negative regulation of growth (GO:0045926)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ruffle (GO:0001726)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(1)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	15	all_cancers(38;2.51e-11)		Epithelial(9;1.5e-08)|all cancers(9;8.67e-08)|BRCA - Breast invasive adenocarcinoma(10;6.43e-06)		Vandetanib(DB05294)	GCCCTGGGCCACGGCCCCACCC	0.688																																					p.V57fs		Atlas-INDEL	.											.	PTK6	33	.	0			c.170_171insG						PASS	.																																			SO:0001589	frameshift_variant	5753	exon1			.	U61412	CCDS13524.1, CCDS74750.1	20q13.3	2013-02-18	2013-02-18		ENSG00000101213	ENSG00000101213	2.7.10.1	"""SH2 domain containing"""	9617	protein-coding gene	gene with protein product		602004	"""PTK6 protein tyrosine kinase 6"""			8247543, 9284935	Standard	NM_005975		Approved	BRK	uc002yfg.4	Q13882	OTTHUMG00000033039	ENST00000217185.2:c.170dupG	chr20.hg19:g.62168499_62168499dupC	ENSP00000217185:p.Val57fs	67.0	0.0	0		98.0	10.0	0.102041	NM_001256358	B2RCR3|B4DW46|Q58F01	Frame_Shift_Ins	INS	ENST00000217185.2	hg19	CCDS13524.1																																																																																			.	.	.	none		0.688	PTK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080313.1		
FAM13B	51306	hgsc.bcm.edu	37	5	137295872	137295873	+	Frame_Shift_Ins	INS	-	-	T	rs149593352	byFrequency	TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr5:137295872_137295873insT	ENST00000033079.3	-	12	1726_1727	c.1275_1276insA	c.(1273-1278)aaattgfs	p.L426fs	FAM13B_ENST00000420893.2_Frame_Shift_Ins_p.L426fs|FAM13B_ENST00000425075.2_Frame_Shift_Ins_p.L308fs	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	426					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						AAGTGTGACAATTTATCACTGT	0.277																																					p.L426fs		Pindel	.											.	FAM13B	46	.	0			c.1276_1277insA						PASS	.																																			SO:0001589	frameshift_variant	51306	exon12			.	AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.1276dupA	chr5.hg19:g.137295875_137295875dupT	ENSP00000033079:p.Leu426fs	340.0	0.0	.		355.0	90.0	0.254	NM_001101800	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Frame_Shift_Ins	INS	ENST00000033079.3	hg19	CCDS4195.1																																																																																			.	.	.	none		0.277	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251279.1		
CCDC83	220047	hgsc.bcm.edu	37	11	85630396	85630397	+	Frame_Shift_Ins	INS	-	-	TG			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr11:85630396_85630397insTG	ENST00000342404.3	+	11	1301_1302	c.1085_1086insTG	c.(1084-1089)tatgtafs	p.YV362fs	CCDC83_ENST00000376067.1_Frame_Shift_Ins_p.YV262fs|CCDC83_ENST00000280245.4_Frame_Shift_Ins_p.YV393fs|RP11-90K17.2_ENST00000531414.1_RNA			Q8IWF9	CCD83_HUMAN	coiled-coil domain containing 83	362										breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|skin(3)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				CCATAGGATTATGTAAACTTGG	0.396																																					p.Y393fs		Pindel	.											.	CCDC83	48	.	0			c.1178_1179insTG						PASS	.																																			SO:0001589	frameshift_variant	220047	exon12			.	AK124113	CCDS8271.1, CCDS66196.1	11q14.1-q14.2	2014-01-21			ENSG00000150676	ENSG00000150676			28535	protein-coding gene	gene with protein product						12477932	Standard	XM_005273842		Approved	MGC34732, FLJ42119, CT148	uc001pbg.1	Q8IWF9	OTTHUMG00000166978	ENST00000342404.3:c.1086_1087dupTG	chr11.hg19:g.85630397_85630398dupTG	ENSP00000344512:p.Tyr362fs	194.0	0.0	.		187.0	53.0	0.283	NM_173556	B2RA49|Q6X7T2|Q6ZVT5|Q8N9Y1	Frame_Shift_Ins	INS	ENST00000342404.3	hg19																																																																																				.	.	.	none		0.396	CCDC83-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392215.1	NM_173556	
UMPS	7372	hgsc.bcm.edu	37	3	124458913	124458920	+	Frame_Shift_Del	DEL	CTCACGTG	CTCACGTG	-	rs374066947		TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	CTCACGTG	CTCACGTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr3:124458913_124458920delCTCACGTG	ENST00000232607.2	+	4	1131_1138	c.1025_1032delCTCACGTG	c.(1024-1032)gctcacgtgfs	p.AHV342fs	UMPS_ENST00000413078.2_Intron|UMPS_ENST00000536109.1_Frame_Shift_Del_p.AHV250fs|UMPS_ENST00000538242.1_Frame_Shift_Del_p.AHV164fs	NM_000373.3	NP_000364.1	P11172	UMPS_HUMAN	uridine monophosphate synthetase	342	OMPdecase.				'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|cellular response to drug (GO:0035690)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|small molecule metabolic process (GO:0044281)|UMP biosynthetic process (GO:0006222)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	orotate phosphoribosyltransferase activity (GO:0004588)|orotidine-5'-phosphate decarboxylase activity (GO:0004590)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(114;0.146)	Fluorouracil(DB00544)	CTAGTAAATGCTCACGTGGTGCCAGGCT	0.49																																					p.342_344del		Pindel	.											.	UMPS	43	.	0			c.1024_1031del						PASS	.																																			SO:0001589	frameshift_variant	7372	exon4			.		CCDS3029.1	3q13	2008-02-04	2008-02-04		ENSG00000114491	ENSG00000114491	2.4.2.10, 4.1.1.23		12563	protein-coding gene	gene with protein product	"""orotate phosphoribosyl transferase and orotidine-5'-decarboxylase"""	613891				2767686	Standard	NM_000373		Approved		uc003ehl.4	P11172	OTTHUMG00000159431	ENST00000232607.2:c.1025_1032delCTCACGTG	chr3.hg19:g.124458913_124458920delCTCACGTG	ENSP00000232607:p.Ala342fs	207.0	0.0	.		143.0	41.0	0.287	NM_000373	B5LY68|B5LY72|O00758|O00759|O00760|Q16862|Q9H3Q2|Q9UG49	Frame_Shift_Del	DEL	ENST00000232607.2	hg19	CCDS3029.1																																																																																			.	.	.	none		0.490	UMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355271.1	NM_000373	
SLC4A3	6508	hgsc.bcm.edu	37	2	220493130	220493131	+	Frame_Shift_Ins	INS	-	-	G			TCGA-UZ-A9PL-01A-11D-A382-10	TCGA-UZ-A9PL-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fd5fd508-d8c8-4630-9580-0c780b3202e1	6b5fdcae-db39-4f26-a632-d6da690b51ab	g.chr2:220493130_220493131insG	ENST00000358055.3	+	3	567_568	c.55_56insG	c.(55-57)cggfs	p.R19fs	SLC4A3_ENST00000317151.3_Frame_Shift_Ins_p.R19fs|SLC4A3_ENST00000373762.3_Frame_Shift_Ins_p.R19fs|SLC4A3_ENST00000273063.6_Frame_Shift_Ins_p.R19fs|SLC4A3_ENST00000373760.2_Frame_Shift_Ins_p.R19fs|AC009955.8_ENST00000455896.1_RNA			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	19					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCTGCAGGTCCGGGTGCCCTTG	0.639																																					p.R19fs		Pindel	.											.	SLC4A3	144	.	0			c.55_56insG						PASS	.																																			SO:0001589	frameshift_variant	6508	exon3			.		CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.58dupG	chr2.hg19:g.220493133_220493133dupG	ENSP00000350756:p.Arg19fs	154.0	0.0	.		152.0	49.0	0.322	NM_005070	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Frame_Shift_Ins	INS	ENST00000358055.3	hg19	CCDS2445.1																																																																																			.	.	.	none		0.639	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1	NM_005070	
