#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AGTRAP	57085	hgsc.bcm.edu	37	1	11810188	11810188	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr1:11810188A>C	ENST00000314340.5	+	5	473	c.419A>C	c.(418-420)gAg>gCg	p.E140A	AGTRAP_ENST00000376627.2_3'UTR|AGTRAP_ENST00000491346.1_3'UTR|AGTRAP_ENST00000376629.4_Missense_Mutation_p.E133A|AGTRAP_ENST00000452018.2_3'UTR|AGTRAP_ENST00000510878.1_Silent_p.R105R|AGTRAP_ENST00000376637.3_3'UTR|AGTRAP_ENST00000400895.2_3'UTR	NM_020350.4	NP_065083.3	Q6RW13	ATRAP_HUMAN	angiotensin II receptor-associated protein	140					regulation of blood pressure (GO:0008217)|response to hypoxia (GO:0001666)	cell cortex (GO:0005938)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)		AGTRAP/BRAF(2)	endometrium(1)|lung(3)|prostate(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.46e-06)|COAD - Colon adenocarcinoma(227;0.000256)|BRCA - Breast invasive adenocarcinoma(304;0.0003)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		GACTCAGCAGAGGCGCCCGCA	0.607																																					p.E140A		Atlas-SNP	.											.	AGTRAP	9	.	0			c.A419C						PASS	.						67.0	63.0	65.0					1																	11810188		2203	4300	6503	SO:0001583	missense	57085	exon5			CAGCAGAGGCGCC	AF165187	CCDS136.1, CCDS30585.1, CCDS30586.1, CCDS41248.1, CCDS44056.1	1p36.22	2008-02-05			ENSG00000177674	ENSG00000177674			13539	protein-coding gene	gene with protein product		608729				11733189	Standard	NM_001040194		Approved	ATRAP	uc001asv.3	Q6RW13	OTTHUMG00000002230	ENST00000314340.5:c.419A>C	chr1.hg19:g.11810188A>C	ENSP00000319713:p.Glu140Ala	75.0	0.0	.		60.0	11.0	.	NM_020350	A8MVQ5|Q5SNV4|Q5SNV5|Q96AC0|Q96PL4|Q9NRW9	Missense_Mutation	SNP	ENST00000314340.5	hg19	CCDS136.1	.	.	.	.	.	.	.	.	.	.	A	13.02	2.113706	0.37339	.	.	ENSG00000177674	ENST00000376629;ENST00000314340	T;T	0.50001	0.76;0.76	5.0	2.56	0.30785	.	0.549006	0.14015	U	0.347205	T	0.38772	0.1053	L	0.48362	1.52	0.09310	N	0.999995	B;B	0.15141	0.01;0.012	B;B	0.14578	0.004;0.011	T	0.25606	-1.0127	10	0.33940	T	0.23	.	8.9656	0.35874	0.632:0.368:0.0:0.0	.	133;140	Q6RW13-2;Q6RW13	.;ATRAP_HUMAN	A	133;140	ENSP00000365816:E133A;ENSP00000319713:E140A	ENSP00000319713:E140A	E	+	2	0	AGTRAP	11732775	0.796000	0.28864	0.007000	0.13788	0.104000	0.19210	2.023000	0.41040	0.330000	0.23485	0.459000	0.35465	GAG	.	.	.	none		0.607	AGTRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006335.1	NM_020350	
KIAA2013	90231	hgsc.bcm.edu	37	1	11985315	11985315	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr1:11985315G>A	ENST00000376572.3	-	1	1165	c.980C>T	c.(979-981)gCg>gTg	p.A327V	KIAA2013_ENST00000376576.3_Missense_Mutation_p.A327V	NM_138346.2	NP_612355.1	Q8IYS2	K2013_HUMAN	KIAA2013	327						integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	7	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00149)|all_lung(284;0.00189)|Breast(348;0.00586)|Colorectal(325;0.0062)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0556)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CAGCTCCGCCGCTGGCATGTC	0.597																																					p.A327V		Atlas-SNP	.											.	KIAA2013	25	.	0			c.C980T						PASS	.						38.0	39.0	38.0					1																	11985315		2203	4300	6503	SO:0001583	missense	90231	exon1			TCCGCCGCTGGCA	AB095933	CCDS141.1	1p36.22	2011-02-09			ENSG00000116685	ENSG00000116685			28513	protein-coding gene	gene with protein product						12477932	Standard	NM_138346		Approved	MGC33867, RP5-1077B9.1	uc001atk.3	Q8IYS2	OTTHUMG00000002391	ENST00000376572.3:c.980C>T	chr1.hg19:g.11985315G>A	ENSP00000365756:p.Ala327Val	135.0	0.0	.		150.0	25.0	.	NM_138346	Q5JXC1|Q8IVF8|Q8NDI7|Q9BSY1	Missense_Mutation	SNP	ENST00000376572.3	hg19	CCDS141.1	.	.	.	.	.	.	.	.	.	.	G	2.727	-0.265373	0.05754	.	.	ENSG00000116685	ENST00000376572;ENST00000376576	.	.	.	3.9	0.917	0.19380	.	0.346810	0.27522	N	0.018998	T	0.07234	0.0183	N	0.00707	-1.245	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.08055	0.003;0.003	T	0.31280	-0.9949	9	0.24483	T	0.36	-22.5578	4.5612	0.12161	0.2713:0.185:0.5437:0.0	.	327;327	Q8IYS2-2;Q8IYS2	.;K2013_HUMAN	V	327	.	ENSP00000365756:A327V	A	-	2	0	KIAA2013	11907902	0.897000	0.30589	0.001000	0.08648	0.003000	0.03518	3.278000	0.51662	0.413000	0.25759	-0.346000	0.07831	GCG	.	.	.	none		0.597	KIAA2013-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006858.1	NM_138346	
MACF1	23499	hgsc.bcm.edu	37	1	39901268	39901268	+	Silent	SNP	T	T	A			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr1:39901268T>A	ENST00000372915.3	+	68	17598	c.17511T>A	c.(17509-17511)atT>atA	p.I5837I	MACF1_ENST00000539005.1_Silent_p.I3749I|MACF1_ENST00000567887.1_Silent_p.I5978I|MACF1_ENST00000317713.7_Silent_p.I3879I|MACF1_ENST00000289893.4_Silent_p.I4381I|MACF1_ENST00000564288.1_Silent_p.I5941I|MACF1_ENST00000361689.2_Silent_p.I3879I|MACF1_ENST00000545844.1_Silent_p.I3879I			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5837					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AACCTCATATTGACAAACTAC	0.343																																					p.I3879I		Atlas-SNP	.											.	MACF1	909	.	0			c.T11637A						PASS	.						90.0	90.0	90.0					1																	39901268		2203	4300	6503	SO:0001819	synonymous_variant	23499	exon66			TCATATTGACAAA	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.17511T>A	chr1.hg19:g.39901268T>A		187.0	0.0	.		229.0	45.0	.	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	ENST00000372915.3	hg19		.	.	.	.	.	.	.	.	.	.	T	9.384	1.073667	0.20147	.	.	ENSG00000127603	ENST00000372925	.	.	.	5.9	2.37	0.29283	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.2174	0.37355	0.0:0.2811:0.0:0.7189	.	.	.	.	R	2883	.	.	X	+	1	0	MACF1	39673855	0.985000	0.35326	1.000000	0.80357	0.840000	0.47671	0.184000	0.16939	0.488000	0.27723	-0.263000	0.10527	TGA	.	.	.	none		0.343	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
SMAP2	64744	hgsc.bcm.edu	37	1	40880943	40880943	+	Splice_Site	SNP	G	G	T			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr1:40880943G>T	ENST00000487871.1	+	2	264		c.e2-1		SMAP2_ENST00000539317.1_Splice_Site			Q8WU79	SMAP2_HUMAN	small ArfGAP2						regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			central_nervous_system(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24	Lung NSC(20;1.56e-05)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.04e-17)			TCTCTTTCTAGATGCTCCTGT	0.463																																					.		Atlas-SNP	.											.	SMAP2	48	.	0			c.572-1G>T						PASS	.						219.0	211.0	214.0					1																	40880943		2203	4300	6503	SO:0001630	splice_region_variant	64744	exon7			TTTCTAGATGCTC	AL137764	CCDS451.1, CCDS55592.1, CCDS55593.1, CCDS72763.1	1p35.3-p34.1	2008-09-22	2008-09-05	2008-01-09	ENSG00000084070	ENSG00000084070		"""ADP-ribosylation factor GTPase activating proteins"""	25082	protein-coding gene	gene with protein product			"""stromal membrane-associated protein 1-like"", ""stromal membrane-associated GTPase-activating protein 2"""	SMAP1L		16571680	Standard	NM_001198978		Approved		uc001cfj.3	Q8WU79	OTTHUMG00000007301	ENST00000487871.1:c.265-1G>T	chr1.hg19:g.40880943G>T		106.0	0.0	.		105.0	9.0	.	NM_022733	B2R7T1|B7Z5B5|B7Z8V2|D3DPV2|Q5QPL2|Q96C93|Q9NST2|Q9UJL8	Splice_Site	SNP	ENST00000487871.1	hg19		.	.	.	.	.	.	.	.	.	.	G	21.3	4.131745	0.77662	.	.	ENSG00000084070	ENST00000435168;ENST00000372718;ENST00000372708;ENST00000539317	.	.	.	6.08	6.08	0.98989	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1573	0.89696	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SMAP2	40653530	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	6.291000	0.72719	2.894000	0.99253	0.655000	0.94253	.	.	.	.	none		0.463	SMAP2-004	KNOWN	mRNA_end_NF|basic	processed_transcript	protein_coding	OTTHUMT00000019077.1	NM_022733	Intron
S100A7L2	645922	hgsc.bcm.edu	37	1	153410759	153410759	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr1:153410759A>T	ENST00000368725.2	-	2	79	c.80T>A	c.(79-81)aTg>aAg	p.M27K		NM_001045479.1	NP_001038944.2	Q5SY68	S1A7B_HUMAN	S100 calcium binding protein A7-like 2	16	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			NS(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	8	all_lung(78;2.4e-33)|Lung NSC(65;8.13e-32)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTGGCGAAACATCGCGACTAT	0.433																																					p.M27K		Atlas-SNP	.											.	S100A7L2	36	.	0			c.T80A						PASS	.						197.0	161.0	173.0					1																	153410759		2203	4300	6503	SO:0001583	missense	645922	exon2			CGAAACATCGCGA			1q21.3	2013-01-10			ENSG00000197364	ENSG00000197364		"""EF-hand domain containing"""	21655	protein-coding gene	gene with protein product							Standard	NM_001045479		Approved	s100a7b	uc010pdx.2	Q5SY68	OTTHUMG00000013129	ENST00000368725.2:c.80T>A	chr1.hg19:g.153410759A>T	ENSP00000357714:p.Met27Lys	91.0	0.0	.		88.0	18.0	.	NM_001045479		Missense_Mutation	SNP	ENST00000368725.2	hg19		.	.	.	.	.	.	.	.	.	.	.	7.736	0.700320	0.15106	.	.	ENSG00000197364	ENST00000368725;ENST00000368724;ENST00000453814	T;T;T	0.06528	3.29;3.29;3.29	2.01	-0.664	0.11406	EF-hand-like domain (1);	.	.	.	.	T	0.01730	0.0055	L	0.44542	1.39	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.44922	-0.9296	9	0.72032	D	0.01	.	4.5322	0.12011	0.6351:0.0:0.3649:0.0	.	16	Q5SY68	S1A7B_HUMAN	K	16;16;27	ENSP00000357714:M16K;ENSP00000357713:M16K;ENSP00000405610:M27K	ENSP00000357713:M16K	M	-	2	0	S100A7L2	151677383	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	1.141000	0.31528	-0.166000	0.10890	0.416000	0.27883	ATG	.	.	.	none		0.433	S100A7L2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000036797.2	NM_001045479	
CD1D	912	hgsc.bcm.edu	37	1	158152692	158152692	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr1:158152692G>A	ENST00000368171.3	+	5	1131	c.632G>A	c.(631-633)cGt>cAt	p.R211H		NM_001766.3	NP_001757.1	P15813	CD1D_HUMAN	CD1d molecule	211	Ig-like.				antigen processing and presentation, endogenous lipid antigen via MHC class Ib (GO:0048006)|detection of bacterium (GO:0016045)|heterotypic cell-cell adhesion (GO:0034113)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of T cell proliferation (GO:0042102)|T cell selection (GO:0045058)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	beta-2-microglobulin binding (GO:0030881)|cell adhesion molecule binding (GO:0050839)|exogenous lipid antigen binding (GO:0030884)|histone binding (GO:0042393)|lipid antigen binding (GO:0030882)|receptor activity (GO:0004872)			endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(1)|prostate(3)|urinary_tract(2)	30	all_hematologic(112;0.0378)					TGGCTGTCCCGTGGCCCCAGT	0.572																																					p.R211H		Atlas-SNP	.											.	CD1D	60	.	0			c.G632A						PASS	.						77.0	80.0	79.0					1																	158152692		2203	4300	6503	SO:0001583	missense	912	exon5			TGTCCCGTGGCCC	BC027926	CCDS1173.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158473	ENSG00000158473		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1637	protein-coding gene	gene with protein product		188410	"""CD1D antigen, d polypeptide"", ""CD1d antigen"""			2463622	Standard	NM_001766		Approved		uc001frr.3	P15813	OTTHUMG00000022436	ENST00000368171.3:c.632G>A	chr1.hg19:g.158152692G>A	ENSP00000357153:p.Arg211His	123.0	0.0	.		140.0	22.0	.	NM_001766	D3DVD5|Q5W0J3|Q9UMM3|Q9Y5M4	Missense_Mutation	SNP	ENST00000368171.3	hg19	CCDS1173.1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.370682	0.42003	.	.	ENSG00000158473	ENST00000368171	T	0.14022	2.54	4.66	1.73	0.24493	Immunoglobulin-like (1);MHC class I-like antigen recognition (1);	1.035360	0.07603	N	0.923929	T	0.02610	0.0079	L	0.33189	0.99	0.09310	N	0.999999	D	0.55172	0.97	B	0.38458	0.274	T	0.34254	-0.9836	10	0.22706	T	0.39	0.2225	4.2364	0.10627	0.2121:0.2105:0.5773:0.0	.	211	P15813	CD1D_HUMAN	H	211	ENSP00000357153:R211H	ENSP00000357153:R211H	R	+	2	0	CD1D	156419316	0.003000	0.15002	0.721000	0.30653	0.981000	0.71138	0.290000	0.18975	0.664000	0.31047	0.655000	0.94253	CGT	.	.	.	none		0.572	CD1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058340.1	NM_001766	
KLHL29	114818	hgsc.bcm.edu	37	2	23918521	23918521	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr2:23918521G>T	ENST00000486442.1	+	9	2288	c.1571G>T	c.(1570-1572)cGc>cTc	p.R524L		NM_052920.1	NP_443152.1	Q96CT2	KLH29_HUMAN	kelch-like family member 29	524										breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|lung(1)|ovary(3)	10						GCCGTGGTCCGCCTCCCCTTC	0.562																																					p.R524L		Atlas-SNP	.											KLHL29_ENST00000486442,caecum,carcinoma,0,2	KLHL29	47	.	0			c.G1571T						PASS	.						45.0	44.0	44.0					2																	23918521		692	1591	2283	SO:0001583	missense	114818	exon9			TGGTCCGCCTCCC		CCDS54335.1	2p23.3	2013-09-27	2013-02-22	2007-01-09	ENSG00000119771	ENSG00000119771		"""Kelch-like"", ""BTB/POZ domain containing"""	29404	protein-coding gene	gene with protein product			"""kelch repeat and BTB (POZ) domain containing 9"", ""kelch-like 29 (Drosophila)"""	KBTBD9		11572484	Standard	NM_052920		Approved	KIAA1921	uc010ykg.2	Q96CT2	OTTHUMG00000151899	ENST00000486442.1:c.1571G>T	chr2.hg19:g.23918521G>T	ENSP00000420659:p.Arg524Leu	53.0	0.0	.		45.0	2.0	.	NM_052920	Q8N388|Q96BF0|Q96PW7	Missense_Mutation	SNP	ENST00000486442.1	hg19	CCDS54335.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.0|22.0	4.232293|4.232293	0.79688|0.79688	.|.	.|.	ENSG00000119771|ENSG00000119771	ENST00000288548|ENST00000486442	.|T	.|0.80994	.|-1.44	4.43|4.43	3.55|3.55	0.40652|0.40652	.|BTB/Kelch-associated (2);	.|0.053021	.|0.85682	.|D	.|0.000000	D|D	0.91088|0.91088	0.7195|0.7195	M|M	0.92738|0.92738	3.34|3.34	0.80722|0.80722	D|D	1|1	.|P;D	.|0.89917	.|0.79;1.0	.|B;D	.|0.97110	.|0.408;1.0	D|D	0.92289|0.92289	0.5840|0.5840	5|10	.|0.87932	.|D	.|0	.|.	12.3592|12.3592	0.55192|0.55192	0.0826:0.0:0.9174:0.0|0.0826:0.0:0.9174:0.0	.|.	.|304;304	.|Q96CT2;Q96CT2-2	.|KLH29_HUMAN;.	S|L	364|524	.|ENSP00000420659:R524L	.|ENSP00000420659:R524L	A|R	+|+	1|2	0|0	KLHL29|KLHL29	23772026|23772026	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.940000|0.940000	0.58332|0.58332	9.864000|9.864000	0.99589|0.99589	0.984000|0.984000	0.38629|0.38629	0.561000|0.561000	0.74099|0.74099	GCC|CGC	.	.	.	none		0.562	KLHL29-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324315.3	NM_052920	
CCT4	10575	hgsc.bcm.edu	37	2	62099619	62099619	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr2:62099619A>C	ENST00000394440.3	-	11	1526	c.1230T>G	c.(1228-1230)tgT>tgG	p.C410W	CCT4_ENST00000538252.1_Missense_Mutation_p.C354W|AC107081.5_ENST00000425779.1_RNA|CCT4_ENST00000544185.1_Missense_Mutation_p.C260W|CCT4_ENST00000461540.2_Intron|CCT4_ENST00000544079.1_Missense_Mutation_p.C380W	NM_006430.3	NP_006421.2	P50991	TCPD_HUMAN	chaperonin containing TCP1, subunit 4 (delta)	410					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(6)|ovary(2)	11	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;6.5e-06)|Epithelial(17;0.0647)|all cancers(80;0.221)			AACGAATAACACATAGGGCAT	0.343																																					p.C410W		Atlas-SNP	.											.	CCT4	38	.	0			c.T1230G						PASS	.						74.0	69.0	71.0					2																	62099619		2203	4300	6503	SO:0001583	missense	10575	exon11			AATAACACATAGG		CCDS33206.1, CCDS58711.1	2p15	2011-09-02			ENSG00000115484	ENSG00000115484		"""Heat Shock Proteins / Chaperonins"""	1617	protein-coding gene	gene with protein product		605142				9819444	Standard	NM_001256721		Approved	Cctd	uc002sbo.4	P50991	OTTHUMG00000152166	ENST00000394440.3:c.1230T>G	chr2.hg19:g.62099619A>C	ENSP00000377958:p.Cys410Trp	177.0	0.0	.		188.0	27.0	.	NM_006430	B2R6I3|B7Z8B1|F5H5W3|O14870|Q53QP9|Q96C51	Missense_Mutation	SNP	ENST00000394440.3	hg19	CCDS33206.1	.	.	.	.	.	.	.	.	.	.	A	16.28	3.079180	0.55753	.	.	ENSG00000115484	ENST00000394440;ENST00000544079;ENST00000544185;ENST00000538252	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.77	3.4	0.38934	.	0.000000	0.85682	D	0.000000	D	0.90964	0.7159	H	0.97516	4.02	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.90431	0.4424	10	0.66056	D	0.02	-9.4227	9.3135	0.37919	0.79:0.0:0.21:0.0	.	380;410	F5H5W3;P50991	.;TCPD_HUMAN	W	410;380;260;354	ENSP00000377958:C410W;ENSP00000443061:C380W;ENSP00000443451:C260W;ENSP00000442174:C354W	ENSP00000377958:C410W	C	-	3	2	CCT4	61953123	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	3.544000	0.53640	0.539000	0.28788	-0.250000	0.11733	TGT	.	.	.	none		0.343	CCT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325548.2		
VWA3B	200403	hgsc.bcm.edu	37	2	98736067	98736067	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr2:98736067G>A	ENST00000477737.1	+	4	587	c.383G>A	c.(382-384)aGc>aAc	p.S128N	VWA3B_ENST00000435344.1_Missense_Mutation_p.S128N|VWA3B_ENST00000451075.2_Intron	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	128										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TGGCTCACCAGCAAGAGCCGG	0.483																																					p.S128N		Atlas-SNP	.											.	VWA3B	138	.	0			c.G383A						PASS	.						152.0	148.0	149.0					2																	98736067		1966	4147	6113	SO:0001583	missense	200403	exon4			TCACCAGCAAGAG	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.383G>A	chr2.hg19:g.98736067G>A	ENSP00000417955:p.Ser128Asn	119.0	0.0	.		137.0	6.0	.	NM_144992	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	hg19	CCDS42718.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.408008	0.83340	.	.	ENSG00000168658	ENST00000435344;ENST00000477737	T;T	0.38401	1.14;1.14	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.53786	0.1818	M	0.70842	2.15	0.80722	D	1	D;D	0.58970	0.966;0.984	B;P	0.55824	0.376;0.785	T	0.52749	-0.8534	10	0.54805	T	0.06	.	15.466	0.75400	0.0:0.1391:0.8609:0.0	.	128;128	Q502W6;Q502W6-8	VWA3B_HUMAN;.	N	128	ENSP00000401959:S128N;ENSP00000417955:S128N	ENSP00000411168:S128N	S	+	2	0	VWA3B	98102499	1.000000	0.71417	0.983000	0.44433	0.975000	0.68041	5.358000	0.66064	2.865000	0.98341	0.655000	0.94253	AGC	.	.	.	none		0.483	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992	
DNAH7	56171	hgsc.bcm.edu	37	2	196825319	196825319	+	Silent	SNP	C	C	T			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr2:196825319C>T	ENST00000312428.6	-	18	2656	c.2556G>A	c.(2554-2556)agG>agA	p.R852R		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	852	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CCTCCCAGTGCCTGGGGCGCA	0.443																																					p.R852R		Atlas-SNP	.											.	DNAH7	512	.	0			c.G2556A						PASS	.						118.0	120.0	119.0					2																	196825319		1932	4123	6055	SO:0001819	synonymous_variant	56171	exon18			CCAGTGCCTGGGG	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.2556G>A	chr2.hg19:g.196825319C>T		88.0	0.0	.		73.0	12.0	.	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	hg19	CCDS42794.1																																																																																			.	.	.	none		0.443	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
ZFYVE20	64145	hgsc.bcm.edu	37	3	15132018	15132018	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr3:15132018C>G	ENST00000253699.3	-	5	790	c.177G>C	c.(175-177)aaG>aaC	p.K59N	ZFYVE20_ENST00000435849.3_Missense_Mutation_p.K59N|ZFYVE20_ENST00000476527.2_Missense_Mutation_p.K59N|ZFYVE20_ENST00000449964.2_5'UTR	NM_022340.2	NP_071735.2	Q9H1K0	RBNS5_HUMAN	zinc finger, FYVE domain containing 20	59					blood coagulation (GO:0007596)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	endosome (GO:0005768)|endosome membrane (GO:0010008)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|skin(3)|stomach(1)|urinary_tract(2)	26						ACAACCTGTCCTTTGCTTTTT	0.423																																					p.K59N		Atlas-SNP	.											.	ZFYVE20	61	.	0			c.G177C						PASS	.						193.0	166.0	175.0					3																	15132018		2203	4300	6503	SO:0001583	missense	64145	exon5			CCTGTCCTTTGCT	AY009133	CCDS2623.1	3p25.1	2014-01-15			ENSG00000131381	ENSG00000131381		"""Zinc fingers, FYVE domain containing"""	20759	protein-coding gene	gene with protein product		609511				11062261	Standard	XR_427283		Approved	Rabenosyn-5	uc003bzm.1	Q9H1K0	OTTHUMG00000129860	ENST00000253699.3:c.177G>C	chr3.hg19:g.15132018C>G	ENSP00000253699:p.Lys59Asn	94.0	0.0	.		109.0	15.0	.	NM_022340	B4DWY8|C9J4P5|Q3KP30|Q59EY8|Q8NAQ1	Missense_Mutation	SNP	ENST00000253699.3	hg19	CCDS2623.1	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911580	0.72983	.	.	ENSG00000131381	ENST00000253699;ENST00000476527;ENST00000435849	T;T;T	0.73469	0.44;0.44;-0.75	5.7	3.93	0.45458	.	0.048887	0.85682	D	0.000000	T	0.81064	0.4745	L	0.56769	1.78	0.46609	D	0.999126	P;D	0.76494	0.718;0.999	B;D	0.68765	0.109;0.96	T	0.79907	-0.1605	10	0.54805	T	0.06	-39.4085	9.7229	0.40313	0.0:0.7889:0.0:0.2111	.	59;59	B4DWY8;Q9H1K0	.;RBNS5_HUMAN	N	59	ENSP00000253699:K59N;ENSP00000422551:K59N;ENSP00000391039:K59N	ENSP00000253699:K59N	K	-	3	2	ZFYVE20	15107022	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	2.534000	0.45676	0.774000	0.33427	-0.237000	0.12165	AAG	.	.	.	none		0.423	ZFYVE20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252102.2	NM_022340	
PARP14	54625	hgsc.bcm.edu	37	3	122437700	122437701	+	Missense_Mutation	DNP	GA	GA	AT			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr3:122437700_122437701GA>AT	ENST00000474629.2	+	14	4968_4969	c.4702_4703GA>AT	c.(4702-4704)GAt>ATt	p.D1568I	PARP14_ENST00000475640.1_3'UTR	NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1568	WWE. {ECO:0000255|PROSITE- ProRule:PRU00248}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		AAAAACAGTTGATGTCAAAATT	0.376																																					p.D1568N|p.D1568V		Atlas-SNP	.											.	PARP14	242	.	0			c.G4702A|c.A4703T						PASS	.																																			SO:0001583	missense	54625	exon14			ACAGTTGATGTCA|CAGTTGATGTCAA	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	Exception_encountered	chr3.hg19:g.122437700_122437701delinsAT	ENSP00000418194:p.Asp1568Ile	113.0|111.0	0.0	.		163.0|161.0	25.0	.	NM_017554	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Missense_Mutation	SNP	ENST00000474629.2	hg19	CCDS46894.1																																																																																			.	.	.	none		0.376	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	NM_017554	
PLXND1	23129	hgsc.bcm.edu	37	3	129285459	129285459	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr3:129285459C>T	ENST00000324093.4	-	23	4280	c.4102G>A	c.(4102-4104)Gaa>Aaa	p.E1368K	PLXND1_ENST00000393239.1_Missense_Mutation_p.E1368K	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1368					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						TAACGCTCTTCATAAAGGGAG	0.617																																					p.E1368K	Ovarian(97;366 1484 3738 22084 39045)	Atlas-SNP	.											.	PLXND1	149	.	0			c.G4102A						PASS	.						69.0	62.0	64.0					3																	129285459		2203	4300	6503	SO:0001583	missense	23129	exon23			GCTCTTCATAAAG	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.4102G>A	chr3.hg19:g.129285459C>T	ENSP00000317128:p.Glu1368Lys	44.0	0.0	.		53.0	18.0	.	NM_015103	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	hg19	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.755199	0.89843	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.35048	1.38;1.33	4.97	4.09	0.47781	Plexin, cytoplasmic RasGAP domain (1);	35.924200	0.00757	U	0.001109	T	0.51261	0.1664	L	0.40543	1.245	0.58432	D	0.999992	D	0.53619	0.961	P	0.54629	0.757	T	0.07539	-1.0767	10	0.87932	D	0	.	13.5873	0.61940	0.0:0.924:0.0:0.076	.	1368	Q9Y4D7	PLXD1_HUMAN	K	1368	ENSP00000317128:E1368K;ENSP00000376931:E1368K	ENSP00000317128:E1368K	E	-	1	0	PLXND1	130768149	1.000000	0.71417	0.994000	0.49952	0.919000	0.55068	4.423000	0.59861	1.061000	0.40601	0.563000	0.77884	GAA	.	.	.	none		0.617	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	
PLOD2	5352	hgsc.bcm.edu	37	3	145841934	145841934	+	Silent	SNP	A	A	G			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr3:145841934A>G	ENST00000360060.3	-	2	369	c.192T>C	c.(190-192)taT>taC	p.Y64Y	PLOD2_ENST00000494950.1_Silent_p.Y9Y|PLOD2_ENST00000282903.5_Silent_p.Y64Y	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	64					cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	CCTTCACAGTATAATTGAAAT	0.328																																					p.Y64Y		Atlas-SNP	.											.	PLOD2	81	.	0			c.T192C						PASS	.						143.0	139.0	140.0					3																	145841934		2202	4300	6502	SO:0001819	synonymous_variant	5352	exon2			CACAGTATAATTG	U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.192T>C	chr3.hg19:g.145841934A>G		57.0	0.0	.		72.0	11.0	.	NM_182943	B3KWS3|Q59ED2|Q8N170	Silent	SNP	ENST00000360060.3	hg19	CCDS3131.1																																																																																			.	.	.	none		0.328	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355185.1	NM_000935	
OTUD4	54726	hgsc.bcm.edu	37	4	146071985	146071985	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr4:146071985T>A	ENST00000447906.2	-	12	1228	c.1041A>T	c.(1039-1041)aaA>aaT	p.K347N	OTUD4_ENST00000455611.2_5'UTR|Y_RNA_ENST00000459374.1_RNA|OTUD4_ENST00000454497.2_Missense_Mutation_p.K282N			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	347					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					AAGTGGAAGGTTTTTTCATCT	0.433																																					p.K282N		Atlas-SNP	.											.	OTUD4	120	.	0			c.A846T						PASS	.						80.0	75.0	77.0					4																	146071985		2203	4300	6503	SO:0001583	missense	54726	exon12			GGAAGGTTTTTTC		CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.1041A>T	chr4.hg19:g.146071985T>A	ENSP00000395487:p.Lys347Asn	95.0	0.0	.		86.0	18.0	.	NM_001102653	B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Missense_Mutation	SNP	ENST00000447906.2	hg19		.	.	.	.	.	.	.	.	.	.	T	20.7	4.030197	0.75504	.	.	ENSG00000164164	ENST00000454497;ENST00000447906;ENST00000514973	T;T;T	0.34667	1.35;1.35;1.4	5.84	0.973	0.19710	.	0.000000	0.85682	D	0.000000	T	0.47154	0.1430	L	0.55481	1.735	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.978	T	0.30563	-0.9974	10	0.27785	T	0.31	-23.5677	8.8141	0.34985	0.0:0.4241:0.0:0.5759	.	347;346	G3V0I6;Q01804	.;OTUD4_HUMAN	N	282;347;281	ENSP00000409279:K282N;ENSP00000395487:K347N;ENSP00000425972:K281N	ENSP00000395487:K347N	K	-	3	2	OTUD4	146291435	0.864000	0.29904	0.992000	0.48379	0.995000	0.86356	-0.169000	0.09911	0.491000	0.27793	0.533000	0.62120	AAA	.	.	.	none		0.433	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000365117.2	NM_017493	
RXFP1	59350	hgsc.bcm.edu	37	4	159568062	159568062	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr4:159568062G>C	ENST00000307765.5	+	16	1716	c.1465G>C	c.(1465-1467)Gga>Cga	p.G489R	RXFP1_ENST00000460056.2_Missense_Mutation_p.G408R|RXFP1_ENST00000343542.5_Missense_Mutation_p.G441R|RXFP1_ENST00000470033.1_Missense_Mutation_p.G456R|RXFP1_ENST00000448688.2_Missense_Mutation_p.G384R	NM_001253727.1|NM_001253728.1|NM_001253730.1|NM_001253732.1|NM_001253733.1|NM_021634.3	NP_001240656.1|NP_001240657.1|NP_001240659.1|NP_001240661.1|NP_001240662.1|NP_067647.2	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	489					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|lung connective tissue development (GO:0060427)|nipple morphogenesis (GO:0060658)|parturition (GO:0007567)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)	p.G489R(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|liver(2)|lung(22)|prostate(1)|skin(10)	49	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		TCAGCTTGTAGGATCTTTGGC	0.388																																					p.G516R		Atlas-SNP	.											RXFP1,NS,carcinoma,-1,1	RXFP1	98	.	1	Substitution - Missense(1)	lung(1)	c.G1546C						PASS	.						138.0	128.0	131.0					4																	159568062		1915	4142	6057	SO:0001583	missense	59350	exon16			CTTGTAGGATCTT	AF190500	CCDS43276.1, CCDS58929.1, CCDS58930.1, CCDS75204.1, CCDS75205.1, CCDS75206.1	4q31.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000171509	ENSG00000171509		"""GPCR / Class A : Relaxin family peptide receptors"""	19718	protein-coding gene	gene with protein product		606654	"""leucine-rich repeat-containing G protein-coupled receptor 7"""	LGR7		15956688, 16507880	Standard	NM_021634		Approved	RXFPR1	uc003ipz.3	Q9HBX9	OTTHUMG00000149973	ENST00000307765.5:c.1465G>C	chr4.hg19:g.159568062G>C	ENSP00000303248:p.Gly489Arg	127.0	1.0	.		108.0	16.0	.	NM_001253727	B4DHD1|B4DTV2|Q2M215|Q3KU24|Q3KU25|Q3KU26	Missense_Mutation	SNP	ENST00000307765.5	hg19	CCDS43276.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.646174	0.87958	.	.	ENSG00000171509	ENST00000460056;ENST00000307765;ENST00000448688;ENST00000343542;ENST00000470033;ENST00000440678	T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08	5.74	5.74	0.90152	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.73202	0.3557	M	0.90814	3.15	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	0.998;1.0;1.0;0.997;0.996;0.996;0.998;1.0	T	0.78316	-0.2251	10	0.87932	D	0	.	19.9294	0.97114	0.0:0.0:1.0:0.0	.	500;516;384;441;456;408;359;489	B3KV27;B4DGP2;B4DHD1;Q9HBX9-4;Q9HBX9-2;E9PCA3;Q59H16;Q9HBX9	.;.;.;.;.;.;.;RXFP1_HUMAN	R	408;489;384;441;456;359	ENSP00000423306:G408R;ENSP00000303248:G489R;ENSP00000414885:G384R;ENSP00000345889:G441R;ENSP00000420712:G456R	ENSP00000303248:G489R	G	+	1	0	RXFP1	159787512	1.000000	0.71417	0.624000	0.29186	0.684000	0.39900	9.777000	0.99008	2.701000	0.92244	0.650000	0.86243	GGA	.	.	.	none		0.388	RXFP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314865.1	NM_021634	
FNIP2	57600	hgsc.bcm.edu	37	4	159690401	159690401	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr4:159690401A>G	ENST00000264433.6	+	1	112	c.37A>G	c.(37-39)Agg>Ggg	p.R13G		NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	13					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		CTTCAACAAAAGGGGCAGCAG	0.741																																					p.R13G		Atlas-SNP	.											.	FNIP2	90	.	0			c.A37G						PASS	.						3.0	4.0	4.0					4																	159690401		1502	3576	5078	SO:0001583	missense	57600	exon1			AACAAAAGGGGCA	AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.37A>G	chr4.hg19:g.159690401A>G	ENSP00000264433:p.Arg13Gly	63.0	0.0	.		86.0	4.0	.	NM_020840	Q05DC3|Q96I31|Q9H994	Missense_Mutation	SNP	ENST00000264433.6	hg19	CCDS47155.1	.	.	.	.	.	.	.	.	.	.	A	15.71	2.912811	0.52439	.	.	ENSG00000052795	ENST00000264433	T	0.27402	1.67	2.95	2.95	0.34219	.	.	.	.	.	T	0.26231	0.0640	L	0.29908	0.895	0.80722	D	1	P	0.46142	0.873	P	0.46659	0.523	T	0.02766	-1.1113	9	0.52906	T	0.07	.	8.6275	0.33899	1.0:0.0:0.0:0.0	.	13	Q9P278	FNIP2_HUMAN	G	13	ENSP00000264433:R13G	ENSP00000264433:R13G	R	+	1	2	FNIP2	159909851	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	3.809000	0.55606	1.210000	0.43336	0.459000	0.35465	AGG	.	.	.	none		0.741	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1	NM_020840	
KCTD16	57528	hgsc.bcm.edu	37	5	143586905	143586905	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr5:143586905A>T	ENST00000507359.3	+	2	1719	c.628A>T	c.(628-630)Aat>Tat	p.N210Y	KCTD16_ENST00000512467.1_Missense_Mutation_p.N210Y	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	210					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)				large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			AGAAACTTTGAATGAAAGCAG	0.463																																					p.N210Y		Atlas-SNP	.											.	KCTD16	70	.	0			c.A628T						PASS	.						60.0	65.0	63.0					5																	143586905		2203	4300	6503	SO:0001583	missense	57528	exon3			ACTTTGAATGAAA	AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.628A>T	chr5.hg19:g.143586905A>T	ENSP00000426548:p.Asn210Tyr	149.0	0.0	.		167.0	31.0	.	NM_020768	Q9P2M9	Missense_Mutation	SNP	ENST00000507359.3	hg19	CCDS34260.1	.	.	.	.	.	.	.	.	.	.	A	17.29	3.352573	0.61293	.	.	ENSG00000183775	ENST00000512467;ENST00000507359	T;T	0.61859	0.07;0.07	5.69	4.51	0.55191	.	0.043674	0.85682	D	0.000000	T	0.77445	0.4131	M	0.85945	2.785	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.80589	-0.1315	10	0.87932	D	0	.	12.9381	0.58327	0.8645:0.1355:0.0:0.0	.	210	Q68DU8	KCD16_HUMAN	Y	210	ENSP00000424151:N210Y;ENSP00000426548:N210Y	ENSP00000426548:N210Y	N	+	1	0	KCTD16	143567098	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.281000	0.95811	0.968000	0.38212	0.459000	0.35465	AAT	.	.	.	none		0.463	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371898.3	XM_098368	
SFXN1	94081	hgsc.bcm.edu	37	5	174937182	174937182	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr5:174937182A>G	ENST00000321442.5	+	4	660	c.406A>G	c.(406-408)Aga>Gga	p.R136G	SFXN1_ENST00000502393.1_Missense_Mutation_p.R136G	NM_022754.5	NP_073591.2	Q9H9B4	SFXN1_HUMAN	sideroflexin 1	136					erythrocyte differentiation (GO:0030218)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)			endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|skin(3)	15	all_cancers(89;0.00922)|Renal(175;0.000269)|Lung NSC(126;0.00515)|all_lung(126;0.00873)	Medulloblastoma(196;0.0399)|all_neural(177;0.0663)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			TTACACCAACAGAAGTGGAGA	0.488																																					p.R136G		Atlas-SNP	.											.	SFXN1	23	.	0			c.A406G						PASS	.						145.0	111.0	122.0					5																	174937182		2203	4300	6503	SO:0001583	missense	94081	exon4			ACCAACAGAAGTG	AF327346	CCDS4394.1	5q35.3	2008-02-05			ENSG00000164466	ENSG00000164466		"""Sideroflexins"""	16085	protein-coding gene	gene with protein product		615569					Standard	NM_022754		Approved	FLJ12876	uc003mda.2	Q9H9B4	OTTHUMG00000130555	ENST00000321442.5:c.406A>G	chr5.hg19:g.174937182A>G	ENSP00000316905:p.Arg136Gly	79.0	0.0	.		105.0	18.0	.	NM_022754	B3KPW3|D3DQN2|Q9HA53	Missense_Mutation	SNP	ENST00000321442.5	hg19	CCDS4394.1	.	.	.	.	.	.	.	.	.	.	A	17.22	3.333836	0.60853	.	.	ENSG00000164466	ENST00000507017;ENST00000321442;ENST00000506963	T;T;T	0.38560	1.13;1.13;1.13	5.48	-0.0886	0.13672	.	0.000000	0.85682	D	0.000000	T	0.68568	0.3015	M	0.92691	3.335	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.992;1.0	T	0.72484	-0.4279	10	0.42905	T	0.14	-25.9016	14.118	0.65167	0.4683:0.5317:0.0:0.0	.	136;136	D6RFI0;Q9H9B4	.;SFXN1_HUMAN	G	136	ENSP00000420961:R136G;ENSP00000316905:R136G;ENSP00000421467:R136G	ENSP00000316905:R136G	R	+	1	2	SFXN1	174869788	0.997000	0.39634	0.478000	0.27316	0.523000	0.34469	0.631000	0.24568	-0.233000	0.09797	0.533000	0.62120	AGA	.	.	.	none		0.488	SFXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252980.2	NM_022754	
ZNF318	24149	hgsc.bcm.edu	37	6	43316086	43316086	+	Silent	SNP	C	C	T			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr6:43316086C>T	ENST00000361428.2	-	6	3125	c.3048G>A	c.(3046-3048)tcG>tcA	p.S1016S	ZNF318_ENST00000318149.3_Silent_p.S1016S	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1016					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.S1016S(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			AGTTTGAGAACGATGACACTT	0.378																																					p.S1016S		Atlas-SNP	.											ZNF318,NS,carcinoma,-1,1	ZNF318	175	.	1	Substitution - coding silent(1)	lung(1)	c.G3048A						PASS	.						214.0	219.0	217.0					6																	43316086		2203	4300	6503	SO:0001819	synonymous_variant	24149	exon6			TGAGAACGATGAC	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.3048G>A	chr6.hg19:g.43316086C>T		109.0	0.0	.		126.0	18.0	.	NM_014345	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Silent	SNP	ENST00000361428.2	hg19	CCDS4895.2																																																																																			.	.	.	none		0.378	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345	
AP4M1	9179	hgsc.bcm.edu	37	7	99702504	99702504	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr7:99702504T>A	ENST00000359593.4	+	8	772	c.614T>A	c.(613-615)cTg>cAg	p.L205Q	MCM7_ENST00000303887.5_5'Flank|MCM7_ENST00000343023.6_5'Flank|AP4M1_ENST00000429084.1_Missense_Mutation_p.L212Q|AP4M1_ENST00000421755.1_Missense_Mutation_p.L205Q|AP4M1_ENST00000422582.1_Missense_Mutation_p.L77Q	NM_004722.3	NP_004713.2	O00189	AP4M1_HUMAN	adaptor-related protein complex 4, mu 1 subunit	205	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|Golgi trans cisterna (GO:0000138)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CAGGGATCCCTGCTGAAGGTG	0.567																																					p.L205Q	Pancreas(174;1182 2812 29595 49511)	Atlas-SNP	.											AP4M1,NS,carcinoma,0,1	AP4M1	39	.	0			c.T614A						PASS	.						114.0	112.0	113.0					7																	99702504		2203	4300	6503	SO:0001583	missense	9179	exon8			GATCCCTGCTGAA	Y08387	CCDS5685.1	7q22.1	2012-06-29			ENSG00000221838	ENSG00000221838			574	protein-coding gene	gene with protein product	"""mu-adaptin-related protein-2"", ""mu subunit of AP-4"", ""AP-4 adapter complex mu subunit"", ""adaptor-related protein complex AP-4 mu4 subunit"""	602296				9013859, 10066790, 21620353	Standard	NM_004722		Approved	MU-ARP2, MU-4, SPG50	uc003utb.4	O00189	OTTHUMG00000154722	ENST00000359593.4:c.614T>A	chr7.hg19:g.99702504T>A	ENSP00000352603:p.Leu205Gln	102.0	1.0	.		115.0	29.0	.	NM_004722	D6W5U1|Q8WV65|Q9UHK9	Missense_Mutation	SNP	ENST00000359593.4	hg19	CCDS5685.1	.	.	.	.	.	.	.	.	.	.	T	14.92	2.679179	0.47886	.	.	ENSG00000221838	ENST00000438383;ENST00000429084;ENST00000359593;ENST00000439416;ENST00000421755;ENST00000422582	T;T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86;1.86	4.53	2.09	0.27110	Clathrin adaptor, mu subunit, C-terminal (3);	0.158542	0.42548	D	0.000695	T	0.30510	0.0767	L	0.49350	1.555	0.41749	D	0.989653	D;P;P;P	0.62365	0.991;0.792;0.76;0.466	P;B;P;P	0.54544	0.755;0.42;0.51;0.51	T	0.05869	-1.0859	10	0.87932	D	0	-40.5241	4.6856	0.12755	0.1682:0.0948:0.0:0.737	.	161;157;212;205	C9JMG3;B4DKN7;C9JC87;O00189	.;.;.;AP4M1_HUMAN	Q	137;212;205;161;205;77	ENSP00000401613:L137Q;ENSP00000403663:L212Q;ENSP00000352603:L205Q;ENSP00000414286:L161Q;ENSP00000412185:L205Q;ENSP00000406676:L77Q	ENSP00000352603:L205Q	L	+	2	0	AP4M1	99540440	1.000000	0.71417	0.278000	0.24718	0.652000	0.38707	3.109000	0.50345	0.245000	0.21373	0.459000	0.35465	CTG	.	.	.	none		0.567	AP4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336772.4	NM_004722	
ACHE	43	hgsc.bcm.edu	37	7	100488697	100488697	+	Intron	SNP	G	G	T			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr7:100488697G>T	ENST00000412389.1	-	3	1879				ACHE_ENST00000428317.1_Intron|ACHE_ENST00000419336.2_Intron|ACHE_ENST00000241069.5_Intron|ACHE_ENST00000411582.1_Missense_Mutation_p.P579H|UFSP1_ENST00000388761.2_5'Flank|ACHE_ENST00000302913.4_Missense_Mutation_p.P579H			P22303	ACES_HUMAN	acetylcholinesterase (Yt blood group)						acetylcholine catabolic process (GO:0006581)|acetylcholine catabolic process in synaptic cleft (GO:0001507)|amyloid precursor protein metabolic process (GO:0042982)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|choline metabolic process (GO:0019695)|DNA replication (GO:0006260)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|negative regulation of synaptic transmission, cholinergic (GO:0032223)|nervous system development (GO:0007399)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter receptor biosynthetic process (GO:0045212)|osteoblast development (GO:0002076)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of protein secretion (GO:0050714)|protein tetramerization (GO:0051262)|receptor internalization (GO:0031623)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of receptor recycling (GO:0001919)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|cholinesterase activity (GO:0004104)|collagen binding (GO:0005518)|hydrolase activity (GO:0016787)|laminin binding (GO:0043236)|protein homodimerization activity (GO:0042803)|serine hydrolase activity (GO:0017171)			large_intestine(3)|lung(7)|skin(3)|urinary_tract(3)	16	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium(DB00944)|Dipivefrin(DB00449)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Minaprine(DB00805)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pralidoxime(DB00733)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tubocurarine(DB01199)	GCAGGTGCTGGGAGCCTCCGA	0.711																																					p.P579H		Atlas-SNP	.											.	ACHE	80	.	0			c.C1736A						PASS	.						6.0	6.0	6.0					7																	100488697		2052	4096	6148	SO:0001627	intron_variant	43	exon5			GTGCTGGGAGCCT		CCDS5709.1, CCDS5710.1, CCDS64736.1	7q22	2014-07-19	2014-01-02		ENSG00000087085	ENSG00000087085	3.1.1.7	"""Blood group antigens"""	108	protein-coding gene	gene with protein product	"""Yt blood group"""	100740	"""acetylcholinesterase (YT blood group)"", ""acetylcholinesterase (Yt blood group)"", ""acetylcholinesterase"""	YT		1380483	Standard	XM_005250357		Approved		uc003uxe.3	P22303	OTTHUMG00000157033	ENST00000412389.1:c.1723+92C>A	chr7.hg19:g.100488697G>T		203.0	0.0	.		253.0	23.0	.	NM_015831	A4D2E2|B7ZKZ0|D6W5X7|Q16169|Q29S23|Q2M324|Q504V3|Q53F46|Q86TM9|Q86YX9|Q9BXP7	Missense_Mutation	SNP	ENST00000412389.1	hg19	CCDS5709.1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.531760	0.64972	.	.	ENSG00000087085	ENST00000302913;ENST00000411582	T;T	0.66638	-0.22;-0.22	4.33	4.33	0.51752	.	.	.	.	.	T	0.55909	0.1950	N	0.08118	0	0.23238	N	0.998064	D	0.58268	0.982	P	0.50490	0.642	T	0.52426	-0.8577	9	0.62326	D	0.03	.	12.6808	0.56920	0.0:0.0:1.0:0.0	.	579	P22303-2	.	H	579	ENSP00000303211:P579H;ENSP00000404865:P579H	ENSP00000303211:P579H	P	-	2	0	ACHE	100326633	1.000000	0.71417	0.993000	0.49108	0.842000	0.47809	2.750000	0.47500	2.117000	0.64856	0.448000	0.29417	CCC	.	.	.	none		0.711	ACHE-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347201.1	NM_015831	
CUX1	1523	hgsc.bcm.edu	37	7	101882669	101882669	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr7:101882669A>C	ENST00000292535.7	+	23	3730	c.3692A>C	c.(3691-3693)gAg>gCg	p.E1231A	CUX1_ENST00000360264.3_Missense_Mutation_p.E1242A|CUX1_ENST00000556210.1_Missense_Mutation_p.E1073A|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000292538.4_Intron|AC005088.1_ENST00000580604.1_RNA|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000550008.2_Missense_Mutation_p.E1175A|CUX1_ENST00000546411.2_Missense_Mutation_p.E1129A|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000549414.2_Missense_Mutation_p.E1209A|CUX1_ENST00000560541.1_Intron	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	1231					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						GTCGGCACCGAGTACAGCCAG	0.647																																					p.E1242A		Atlas-SNP	.											.	CUX1	253	.	0			c.A3725C						PASS	.						26.0	29.0	28.0					7																	101882669		2203	4300	6503	SO:0001583	missense	1523	exon23			GCACCGAGTACAG	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.3692A>C	chr7.hg19:g.101882669A>C	ENSP00000292535:p.Glu1231Ala	81.0	0.0	.		96.0	24.0	.	NM_001202543	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	hg19	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	A	16.06	3.015092	0.54468	.	.	ENSG00000257923	ENST00000360264;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T	0.62639	0.01;0.02;0.01;0.01;0.01;0.02	5.04	5.04	0.67666	.	0.168540	0.50627	D	0.000107	T	0.48714	0.1515	N	0.19112	0.55	0.80722	D	1	B;B	0.22211	0.039;0.066	B;B	0.20767	0.008;0.031	T	0.47249	-0.9132	10	0.51188	T	0.08	-14.4248	14.7647	0.69629	1.0:0.0:0.0:0.0	.	1231;1242	P39880;P39880-3	CUX1_HUMAN;.	A	1242;1231;1209;1175;1129;1073	ENSP00000353401:E1242A;ENSP00000292535:E1231A;ENSP00000446630:E1209A;ENSP00000447373:E1175A;ENSP00000450125:E1129A;ENSP00000451558:E1073A	ENSP00000292535:E1231A	E	+	2	0	CUX1	101669389	1.000000	0.71417	0.988000	0.46212	0.885000	0.51271	7.431000	0.80335	1.902000	0.55061	0.459000	0.35465	GAG	.	.	.	none		0.647	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
EFCAB1	79645	hgsc.bcm.edu	37	8	49644024	49644024	+	Missense_Mutation	SNP	A	A	T	rs201126478		TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr8:49644024A>T	ENST00000262103.3	-	2	177	c.97T>A	c.(97-99)Tat>Aat	p.Y33N	EFCAB1_ENST00000521002.1_Intron|EFCAB1_ENST00000433756.1_Intron|EFCAB1_ENST00000523092.1_Intron	NM_024593.3	NP_078869.1	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1	33							calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(2)	14		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)				ACCAAGTCATAAAAAAGCTTT	0.328																																					p.Y33N		Atlas-SNP	.											.	EFCAB1	27	.	0			c.T97A						PASS	.						77.0	73.0	75.0					8																	49644024		2203	4300	6503	SO:0001583	missense	79645	exon2			AGTCATAAAAAAG		CCDS6145.1, CCDS47853.1	8q11.21	2013-01-10			ENSG00000034239	ENSG00000034239		"""EF-hand domain containing"""	25678	protein-coding gene	gene with protein product						12477932	Standard	NM_024593		Approved	FLJ11767	uc003xqo.2	Q9HAE3	OTTHUMG00000164203	ENST00000262103.3:c.97T>A	chr8.hg19:g.49644024A>T	ENSP00000262103:p.Tyr33Asn	118.0	0.0	.		93.0	15.0	.	NM_024593	B4DSB4|E7EVN7	Missense_Mutation	SNP	ENST00000262103.3	hg19	CCDS6145.1	.	.	.	.	.	.	.	.	.	.	A	1.323	-0.598936	0.03744	.	.	ENSG00000034239	ENST00000262103;ENST00000450553	T	0.66638	-0.22	4.77	3.61	0.41365	EF-hand-like domain (1);	0.212638	0.48767	D	0.000174	T	0.44371	0.1290	N	0.17082	0.46	0.36437	D	0.865288	B	0.06786	0.001	B	0.04013	0.001	T	0.36792	-0.9733	10	0.24483	T	0.36	.	6.1507	0.20310	0.8034:0.0:0.1966:0.0	.	33	Q9HAE3	EFCB1_HUMAN	N	33	ENSP00000262103:Y33N	ENSP00000262103:Y33N	Y	-	1	0	EFCAB1	49806577	1.000000	0.71417	0.810000	0.32431	0.051000	0.14879	2.404000	0.44539	0.957000	0.37930	0.528000	0.53228	TAT	.	A|0.999;G|0.001	.	alt		0.328	EFCAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377778.1	NM_024593	
TMEM65	157378	hgsc.bcm.edu	37	8	125335567	125335567	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr8:125335567A>G	ENST00000297632.6	-	4	1001	c.467T>C	c.(466-468)aTg>aCg	p.M156T		NM_194291.2	NP_919267.2	Q6PI78	TMM65_HUMAN	transmembrane protein 65	156						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|prostate(1)	6	Lung NSC(37;1.18e-11)|Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			AATACCTGCCATAGTTGAAAT	0.259																																					p.M156T		Atlas-SNP	.											.	TMEM65	14	.	0			c.T467C						PASS	.						29.0	33.0	31.0					8																	125335567		2168	4228	6396	SO:0001583	missense	157378	exon4			CCTGCCATAGTTG	BC032396	CCDS6348.1	8q24.13	2006-11-24			ENSG00000164983	ENSG00000164983			25203	protein-coding gene	gene with protein product						12477932	Standard	NM_194291		Approved		uc010mdl.3	Q6PI78	OTTHUMG00000165021	ENST00000297632.6:c.467T>C	chr8.hg19:g.125335567A>G	ENSP00000297632:p.Met156Thr	339.0	0.0	.		368.0	90.0	.	NM_194291	Q8N5G8|Q8WVK5	Missense_Mutation	SNP	ENST00000297632.6	hg19	CCDS6348.1	.	.	.	.	.	.	.	.	.	.	A	14.30	2.493605	0.44352	.	.	ENSG00000164983	ENST00000297632	T	0.56444	0.46	5.9	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.60932	0.2307	M	0.88450	2.955	0.54753	D	0.999989	B	0.18310	0.027	B	0.24701	0.055	T	0.62473	-0.6847	10	0.87932	D	0	.	11.9759	0.53091	0.9322:0.0:0.0678:0.0	.	156	Q6PI78	TMM65_HUMAN	T	156	ENSP00000297632:M156T	ENSP00000297632:M156T	M	-	2	0	TMEM65	125404748	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.854000	0.86942	1.054000	0.40438	0.472000	0.43445	ATG	.	.	.	none		0.259	TMEM65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381464.1	NM_194291	
COL27A1	85301	hgsc.bcm.edu	37	9	116931634	116931634	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr9:116931634C>T	ENST00000356083.3	+	3	2190	c.1799C>T	c.(1798-1800)tCc>tTc	p.S600F		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	600	Pro-rich.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						TTCCTGTCCTCCAGCCCCCGG	0.652																																					p.S600F		Atlas-SNP	.											.	COL27A1	200	.	0			c.C1799T						PASS	.						54.0	64.0	60.0					9																	116931634		2203	4300	6503	SO:0001583	missense	85301	exon3			TGTCCTCCAGCCC	AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.1799C>T	chr9.hg19:g.116931634C>T	ENSP00000348385:p.Ser600Phe	36.0	0.0	.		38.0	8.0	.	NM_032888	Q66K43|Q96JF7	Missense_Mutation	SNP	ENST00000356083.3	hg19	CCDS6802.1	.	.	.	.	.	.	.	.	.	.	C	14.62	2.589711	0.46214	.	.	ENSG00000196739	ENST00000356083;ENST00000357257;ENST00000374106;ENST00000451716	D;D	0.91843	-2.63;-2.92	5.41	5.41	0.78517	.	.	.	.	.	D	0.93135	0.7814	L	0.32530	0.975	0.46678	D	0.999156	D;D	0.89917	0.997;1.0	D;D	0.80764	0.98;0.994	D	0.92621	0.6108	9	0.41790	T	0.15	.	14.6955	0.69118	0.0:1.0:0.0:0.0	.	600;547	Q8IZC6;Q5T1U7	CORA1_HUMAN;.	F	600;600;547;547	ENSP00000348385:S600F;ENSP00000391328:S547F	ENSP00000348385:S600F	S	+	2	0	COL27A1	115971455	1.000000	0.71417	0.999000	0.59377	0.929000	0.56500	3.639000	0.54339	2.537000	0.85549	0.563000	0.77884	TCC	.	.	.	none		0.652	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888	
C5	727	hgsc.bcm.edu	37	9	123738998	123738998	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr9:123738998C>T	ENST00000223642.1	-	29	3873	c.3844G>A	c.(3844-3846)Ggt>Agt	p.G1282S		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	1282					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	TAAAAGCCACCTCCATACCTC	0.413																																					p.G1282S		Atlas-SNP	.											.	C5	124	.	0			c.G3844A						PASS	.						143.0	142.0	143.0					9																	123738998		2203	4300	6503	SO:0001583	missense	727	exon29			AGCCACCTCCATA	M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.3844G>A	chr9.hg19:g.123738998C>T	ENSP00000223642:p.Gly1282Ser	152.0	0.0	.		157.0	38.0	.	NM_001735	Q14CJ0|Q27I61	Missense_Mutation	SNP	ENST00000223642.1	hg19	CCDS6826.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.789232	0.90367	.	.	ENSG00000106804	ENST00000223642	T	0.66995	-0.24	5.38	5.38	0.77491	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.155990	0.56097	D	0.000025	D	0.87099	0.6093	H	0.94306	3.52	0.58432	D	0.999997	D	0.76494	0.999	D	0.79108	0.992	D	0.90526	0.4492	10	0.72032	D	0.01	.	18.1225	0.89576	0.0:1.0:0.0:0.0	.	1282	P01031	CO5_HUMAN	S	1282	ENSP00000223642:G1282S	ENSP00000223642:G1282S	G	-	1	0	C5	122778819	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	5.446000	0.66600	2.501000	0.84356	0.563000	0.77884	GGT	.	.	.	none		0.413	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735	
ANK3	288	hgsc.bcm.edu	37	10	61956291	61956291	+	Silent	SNP	A	A	G			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr10:61956291A>G	ENST00000280772.2	-	15	1973	c.1782T>C	c.(1780-1782)gcT>gcC	p.A594A	ANK3_ENST00000503366.1_Silent_p.A577A|ANK3_ENST00000373827.2_Silent_p.A588A	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	594					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TTACCTTCCCAGCAGCATCTG	0.433																																					p.A594A		Atlas-SNP	.											.	ANK3	703	.	0			c.T1782C						PASS	.						73.0	66.0	69.0					10																	61956291		2203	4300	6503	SO:0001819	synonymous_variant	288	exon15			CTTCCCAGCAGCA	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.1782T>C	chr10.hg19:g.61956291A>G		56.0	0.0	.		58.0	13.0	.	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Silent	SNP	ENST00000280772.2	hg19	CCDS7258.1																																																																																			.	.	.	none		0.433	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
COX15	1355	hgsc.bcm.edu	37	10	101480822	101480822	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr10:101480822G>C	ENST00000016171.5	-	6	804	c.754C>G	c.(754-756)Cct>Gct	p.P252A	CUTC_ENST00000493385.1_Intron|COX15_ENST00000370483.5_Missense_Mutation_p.P252A			Q7KZN9	COX15_HUMAN	cytochrome c oxidase assembly homolog 15 (yeast)	252					cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)|oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Colorectal(252;0.234)		Epithelial(162;3.08e-10)|all cancers(201;2.43e-08)		TGGGTTTCAGGCAACTAAATA	0.433																																					p.P252A		Atlas-SNP	.											.	COX15	25	.	0			c.C754G						PASS	.						95.0	82.0	86.0					10																	101480822		2203	4300	6503	SO:0001583	missense	1355	exon6			TTTCAGGCAACTA	AF044323	CCDS7481.1, CCDS7482.1	10q24	2014-09-17	2012-10-15		ENSG00000014919	ENSG00000014919		"""Mitochondrial respiratory chain complex assembly factors"""	2263	protein-coding gene	gene with protein product		603646	"""COX15 (yeast) homolog, cytochrome c oxidase assembly protein"", ""COX15 homolog, cytochrome c oxidase assembly protein (yeast)"""			9878253	Standard	NM_078470		Approved		uc001kqb.4	Q7KZN9	OTTHUMG00000018893	ENST00000016171.5:c.754C>G	chr10.hg19:g.101480822G>C	ENSP00000016171:p.Pro252Ala	116.0	0.0	.		121.0	14.0	.	NM_078470	A8K6I9|O60556|O75878|Q5TD00|Q5TD01|Q7Z3Q3|Q9NTN0	Missense_Mutation	SNP	ENST00000016171.5	hg19	CCDS7482.1	.	.	.	.	.	.	.	.	.	.	G	4.012	-0.000496	0.07819	.	.	ENSG00000014919	ENST00000370483;ENST00000016171	D;D	0.81996	-1.56;-1.56	4.93	4.93	0.64822	.	0.232381	0.43747	D	0.000531	T	0.73410	0.3583	L	0.33189	0.99	0.50632	D	0.999881	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.002	T	0.68416	-0.5414	10	0.02654	T	1	-13.3644	18.1574	0.89696	0.0:0.0:1.0:0.0	.	252;252	Q7KZN9-2;Q7KZN9	.;COX15_HUMAN	A	252	ENSP00000359514:P252A;ENSP00000016171:P252A	ENSP00000016171:P252A	P	-	1	0	COX15	101470812	1.000000	0.71417	1.000000	0.80357	0.279000	0.26890	3.666000	0.54540	2.274000	0.75844	0.555000	0.69702	CCT	.	.	.	none		0.433	COX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049818.1	NP_510870	
GDPD5	81544	hgsc.bcm.edu	37	11	75160942	75160942	+	Silent	SNP	C	C	A			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr11:75160942C>A	ENST00000336898.3	-	7	1299	c.462G>T	c.(460-462)ctG>ctT	p.L154L	GDPD5_ENST00000376282.3_Intron|GDPD5_ENST00000443276.2_3'UTR|GDPD5_ENST00000529721.1_Silent_p.L154L|GDPD5_ENST00000526177.1_Silent_p.L16L|GDPD5_ENST00000533805.1_5'UTR|GDPD5_ENST00000533784.1_Intron	NM_030792.6	NP_110419.5	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain containing 5	154					cerebral cortex neuron differentiation (GO:0021895)|glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)|negative regulation of Notch signaling pathway (GO:0045746)|neuron projection development (GO:0031175)|positive regulation of neuron differentiation (GO:0045666)|regulation of timing of cell differentiation (GO:0048505)|spinal cord motor neuron differentiation (GO:0021522)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|skin(2)	20						GCAGGGAGATCAGCAGCACCT	0.627																																					p.L154L		Atlas-SNP	.											.	GDPD5	49	.	0			c.G462T						PASS	.						50.0	47.0	48.0					11																	75160942		2200	4293	6493	SO:0001819	synonymous_variant	81544	exon7			GGAGATCAGCAGC	AF318377	CCDS8238.1	11q13.4-q13.5	2011-01-25				ENSG00000158555			28804	protein-coding gene	gene with protein product		609632				18667693, 17275818	Standard	NM_030792		Approved	PP1665, GDE2	uc001owp.4	Q8WTR4		ENST00000336898.3:c.462G>T	chr11.hg19:g.75160942C>A		103.0	0.0	.		106.0	22.0	.	NM_030792	Q49AQ5|Q6UX76|Q7Z4S0|Q8N781|Q8NCB7|Q8TB77	Silent	SNP	ENST00000336898.3	hg19	CCDS8238.1																																																																																			.	.	.	none		0.627	GDPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384409.1	NM_030792	
LRP6	4040	hgsc.bcm.edu	37	12	12279762	12279762	+	Missense_Mutation	SNP	A	A	G	rs373215297		TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr12:12279762A>G	ENST00000261349.4	-	20	4251	c.4175T>C	c.(4174-4176)tTt>tCt	p.F1392S	LRP6_ENST00000543091.1_Missense_Mutation_p.F1347S|BCL2L14_ENST00000396369.1_Intron|LRP6_ENST00000540415.1_Intron	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	1392					anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				CTGGCAGATAAAGTATACAGT	0.438																																					p.F1392S		Atlas-SNP	.											.	LRP6	170	.	0			c.T4175C						PASS	.	A	SER/PHE	0,4406		0,0,2203	153.0	133.0	140.0		4175	5.7	1.0	12		140	1,8599	1.2+/-3.3	0,1,4299	no	missense	LRP6	NM_002336.2	155	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging	1392/1614	12279762	1,13005	2203	4300	6503	SO:0001583	missense	4040	exon20			CAGATAAAGTATA	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.4175T>C	chr12.hg19:g.12279762A>G	ENSP00000261349:p.Phe1392Ser	135.0	0.0	.		104.0	8.0	.	NM_002336	Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	hg19	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.721771	0.89298	0.0	1.16E-4	ENSG00000070018	ENST00000261349;ENST00000543091	T;T	0.39787	1.06;1.06	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000005	T	0.61173	0.2326	M	0.62723	1.935	0.80722	D	1	P;D	0.76494	0.95;0.999	P;D	0.87578	0.648;0.998	T	0.57081	-0.7872	10	0.26408	T	0.33	.	16.0143	0.80425	1.0:0.0:0.0:0.0	.	1347;1392	F5H7J9;O75581	.;LRP6_HUMAN	S	1392;1347	ENSP00000261349:F1392S;ENSP00000442472:F1347S	ENSP00000261349:F1392S	F	-	2	0	LRP6	12171029	1.000000	0.71417	0.996000	0.52242	0.963000	0.63663	8.870000	0.92336	2.174000	0.68829	0.460000	0.39030	TTT	.	.	.	weak		0.438	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
RBMS2	5939	hgsc.bcm.edu	37	12	56975290	56975290	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr12:56975290A>G	ENST00000262031.5	+	7	825	c.730A>G	c.(730-732)Atg>Gtg	p.M244V	RBMS2_ENST00000550726.1_Missense_Mutation_p.M119V|RBMS2_ENST00000552247.2_Missense_Mutation_p.M244V|RBMS2_ENST00000542360.1_Missense_Mutation_p.M99V	NM_002898.3	NP_002889.1	Q15434	RBMS2_HUMAN	RNA binding motif, single stranded interacting protein 2	244					RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(3)|skin(2)|urinary_tract(1)	18						GAATGCAGACATGGTAAGAGG	0.468																																					p.M244V		Atlas-SNP	.											.	RBMS2	29	.	0			c.A730G						PASS	.						51.0	45.0	47.0					12																	56975290		2203	4300	6503	SO:0001583	missense	5939	exon7			GCAGACATGGTAA	D28483	CCDS8923.1	12q13.13	2013-02-12			ENSG00000076067	ENSG00000076067		"""RNA binding motif (RRM) containing"""	9909	protein-coding gene	gene with protein product		602387				8041632	Standard	NM_002898		Approved	SCR3	uc001sln.2	Q15434	OTTHUMG00000170488	ENST00000262031.5:c.730A>G	chr12.hg19:g.56975290A>G	ENSP00000262031:p.Met244Val	80.0	0.0	.		78.0	15.0	.	NM_002898		Missense_Mutation	SNP	ENST00000262031.5	hg19	CCDS8923.1	.	.	.	.	.	.	.	.	.	.	A	9.246	1.039458	0.19669	.	.	ENSG00000076067	ENST00000262031;ENST00000552247;ENST00000550726;ENST00000542360	T;T;T	0.19938	2.84;2.75;2.11	5.21	1.4	0.22301	.	0.291510	0.31577	N	0.007408	T	0.10637	0.0260	L	0.27053	0.805	0.26901	N	0.967112	B;B;B	0.24675	0.035;0.0;0.109	B;B;B	0.20767	0.013;0.004;0.031	T	0.30563	-0.9974	10	0.14252	T	0.57	.	5.7609	0.18199	0.7203:0.0:0.1514:0.1282	.	99;119;244	F5H5C8;F8VV01;Q15434	.;.;RBMS2_HUMAN	V	244;244;119;99	ENSP00000262031:M244V;ENSP00000447426:M244V;ENSP00000449678:M119V	ENSP00000262031:M244V	M	+	1	0	RBMS2	55261557	0.853000	0.29707	1.000000	0.80357	0.993000	0.82548	1.763000	0.38461	0.363000	0.24346	0.533000	0.62120	ATG	.	.	.	none		0.468	RBMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409366.2	NM_002898	
BEST3	144453	hgsc.bcm.edu	37	12	70072597	70072597	+	Silent	SNP	G	G	A			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr12:70072597G>A	ENST00000330891.5	-	5	784	c.558C>T	c.(556-558)atC>atT	p.I186I	BEST3_ENST00000476098.1_Silent_p.I24I|BEST3_ENST00000553096.1_Silent_p.I80I|BEST3_ENST00000488961.1_Silent_p.I24I|BEST3_ENST00000331471.4_Silent_p.I186I	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	186					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			TTCCAAACCAGATGAATGGAA	0.343																																					p.I186I		Atlas-SNP	.											.	BEST3	129	.	0			c.C558T						PASS	.						112.0	105.0	107.0					12																	70072597		1870	4104	5974	SO:0001819	synonymous_variant	144453	exon5			AAACCAGATGAAT	AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.558C>T	chr12.hg19:g.70072597G>A		96.0	0.0	.		74.0	6.0	.	NM_032735	B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Silent	SNP	ENST00000330891.5	hg19	CCDS8992.2																																																																																			.	.	.	none		0.343	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313908.2	NM_152439	
GIT2	9815	hgsc.bcm.edu	37	12	110403363	110403363	+	Silent	SNP	A	A	G	rs570446364		TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr12:110403363A>G	ENST00000355312.3	-	9	783	c.784T>C	c.(784-786)Ttg>Ctg	p.L262L	GIT2_ENST00000547815.1_Silent_p.L262L|GIT2_ENST00000356259.4_Silent_p.L262L|GIT2_ENST00000320063.9_Silent_p.L262L|GIT2_ENST00000553118.1_Silent_p.L262L|TCHP_ENST00000550780.1_Intron|GIT2_ENST00000343646.5_Silent_p.L262L|GIT2_ENST00000338373.5_Silent_p.L262L|GIT2_ENST00000354574.4_Silent_p.L264L|GIT2_ENST00000551209.1_Silent_p.L261L|GIT2_ENST00000361006.5_Silent_p.L262L|GIT2_ENST00000360185.4_Silent_p.L262L|GIT2_ENST00000457474.2_Silent_p.L264L	NM_057169.3	NP_476510.1	Q14161	GIT2_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 2	262					behavioral response to pain (GO:0048266)|regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|skin(4)	27						GCTTTTGCCAATTCAGACAAA	0.378													A|||	1	0.000199681	0.0	0.0	5008	,	,		19792	0.0		0.0	False		,,,				2504	0.001				p.L264L		Atlas-SNP	.											.	GIT2	81	.	0			c.T790C						PASS	.						56.0	54.0	55.0					12																	110403363		2202	4299	6501	SO:0001819	synonymous_variant	9815	exon10			TTGCCAATTCAGA	AF124491	CCDS9138.1, CCDS9139.1, CCDS44968.1, CCDS44969.1, CCDS55884.1	12q24.1	2013-01-10	2008-09-05			ENSG00000139436		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4273	protein-coding gene	gene with protein product		608564	"""G protein-coupled receptor kinase interactor 2"""			9826657, 10896954	Standard	NM_139201		Approved	KIAA0148	uc001tps.2	Q14161	OTTHUMG00000169313	ENST00000355312.3:c.784T>C	chr12.hg19:g.110403363A>G		183.0	0.0	.		187.0	8.0	.	NM_001135213	Q86U59|Q96CI2|Q9BV91|Q9Y5V2	Silent	SNP	ENST00000355312.3	hg19	CCDS9138.1																																																																																			.	.	.	none		0.378	GIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403407.1	NM_057169	
ZIC2	7546	hgsc.bcm.edu	37	13	100637680	100637680	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr13:100637680A>G	ENST00000376335.3	+	3	1636	c.1343A>G	c.(1342-1344)cAg>cGg	p.Q448R	ZIC2_ENST00000477213.1_3'UTR	NM_007129.3	NP_009060.2	O95409	ZIC2_HUMAN	Zic family member 2	448					brain development (GO:0007420)|developmental pigmentation (GO:0048066)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal ganglion cell axon guidance (GO:0031290)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|liver(2)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GCCGAGCCCCAGAGCAGCTCC	0.786																																					p.Q448R	Pancreas(97;119 1522 31925 44771 48764)	Atlas-SNP	.											.	ZIC2	25	.	0			c.A1343G						PASS	.						7.0	9.0	9.0					13																	100637680		1854	4010	5864	SO:0001583	missense	7546	exon3			AGCCCCAGAGCAG	AF104902	CCDS9495.1	13q32	2013-01-08	2011-05-19		ENSG00000043355	ENSG00000043355		"""Zinc fingers, C2H2-type"""	12873	protein-coding gene	gene with protein product	"""Zinc finger protein of the cerebellum 2"""	603073	"""Zic family member 2 (odd-paired Drosophila homolog)"", ""Zic family member 2 (odd-paired homolog, Drosophila)"""			9771712	Standard	NM_007129		Approved	HPE5	uc001von.3	O95409	OTTHUMG00000017279	ENST00000376335.3:c.1343A>G	chr13.hg19:g.100637680A>G	ENSP00000365514:p.Gln448Arg	274.0	0.0	.		249.0	35.0	.	NM_007129	Q5VYA9|Q9H309	Missense_Mutation	SNP	ENST00000376335.3	hg19	CCDS9495.1	.	.	.	.	.	.	.	.	.	.	A	1.938	-0.444304	0.04604	.	.	ENSG00000043355	ENST00000376335	T	0.66638	-0.22	3.33	2.14	0.27477	.	0.199334	0.43919	N	0.000508	T	0.52224	0.1721	L	0.46157	1.445	0.49687	D	0.999818	B	0.02656	0.0	B	0.01281	0.0	T	0.34254	-0.9836	10	0.17832	T	0.49	.	7.3557	0.26717	0.8867:0.0:0.1133:0.0	.	448	O95409	ZIC2_HUMAN	R	448	ENSP00000365514:Q448R	ENSP00000365514:Q448R	Q	+	2	0	ZIC2	99435681	1.000000	0.71417	0.998000	0.56505	0.311000	0.27955	3.628000	0.54259	0.466000	0.27193	0.260000	0.18958	CAG	.	.	.	none		0.786	ZIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045618.2	NM_007129	
NEO1	4756	hgsc.bcm.edu	37	15	73562439	73562439	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr15:73562439G>C	ENST00000339362.5	+	18	3030	c.2583G>C	c.(2581-2583)caG>caC	p.Q861H	NEO1_ENST00000560262.1_Missense_Mutation_p.Q861H|NEO1_ENST00000261908.6_Missense_Mutation_p.Q861H|NEO1_ENST00000558964.1_Missense_Mutation_p.Q861H			Q92859	NEO1_HUMAN	neogenin 1	861	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						TGGGAGTTCAGGCTTCCATTC	0.483																																					p.Q861H		Atlas-SNP	.											.	NEO1	102	.	0			c.G2583C						PASS	.						169.0	177.0	174.0					15																	73562439		2198	4297	6495	SO:0001583	missense	4756	exon17			AGTTCAGGCTTCC	U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.2583G>C	chr15.hg19:g.73562439G>C	ENSP00000341198:p.Gln861His	124.0	0.0	.		101.0	17.0	.	NM_001172623	B7ZKM9|B7ZKN0|O00340|Q17RX1	Missense_Mutation	SNP	ENST00000339362.5	hg19	CCDS10247.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.152137	0.78001	.	.	ENSG00000067141	ENST00000339362;ENST00000379842;ENST00000261908	T;T	0.57107	0.42;0.42	5.41	5.41	0.78517	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.68174	0.2972	M	0.65320	2	0.80722	D	1	D;D;D;D	0.89917	0.999;0.992;0.996;1.0	D;D;D;D	0.85130	0.997;0.96;0.98;0.984	T	0.67503	-0.5654	10	0.48119	T	0.1	-10.4247	12.8567	0.57890	0.0749:0.0:0.9251:0.0	.	861;861;583;861	B7ZKM9;B7ZKN0;E7EUX3;Q92859	.;.;.;NEO1_HUMAN	H	861;583;861	ENSP00000341198:Q861H;ENSP00000261908:Q861H	ENSP00000261908:Q861H	Q	+	3	2	NEO1	71349492	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.773000	0.75006	2.697000	0.92050	0.563000	0.77884	CAG	.	.	.	none		0.483	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257472.2	NM_002499	
TBC1D2B	23102	hgsc.bcm.edu	37	15	78316564	78316564	+	Silent	SNP	G	G	T	rs527349478		TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr15:78316564G>T	ENST00000300584.3	-	6	1403	c.1404C>A	c.(1402-1404)acC>acA	p.T468T	TBC1D2B_ENST00000409931.3_Silent_p.T468T	NM_015079.5|NM_144572.1	NP_055894.6|NP_653173.1	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B	468							Rab GTPase activator activity (GO:0005097)			breast(3)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26						TGGGCGCCACGGTGGGAGGAG	0.617																																					p.T468T		Atlas-SNP	.											.	TBC1D2B	104	.	0			c.C1404A						PASS	.						63.0	51.0	55.0					15																	78316564		2196	4293	6489	SO:0001819	synonymous_variant	23102	exon6			CGCCACGGTGGGA	AB028978	CCDS32301.2, CCDS45314.1	15q24.3-q25.1	2005-11-29			ENSG00000167202	ENSG00000167202			29183	protein-coding gene	gene with protein product						10470851	Standard	NM_015079		Approved	KIAA1055	uc002bcy.4	Q9UPU7	OTTHUMG00000152885	ENST00000300584.3:c.1404C>A	chr15.hg19:g.78316564G>T		55.0	0.0	.		56.0	4.0	.	NM_144572	A7MD42|Q8N1F9|Q9NXM0	Silent	SNP	ENST00000300584.3	hg19	CCDS45314.1	.	.	.	.	.	.	.	.	.	.	G	3.403	-0.121820	0.06838	.	.	ENSG00000167202	ENST00000418039	.	.	.	4.28	-8.56	0.00904	.	.	.	.	.	T	0.14141	0.0342	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.18398	-1.0338	4	.	.	.	.	0.2637	0.00222	0.3539:0.1785:0.2125:0.2551	.	.	.	.	Q	350	.	.	P	-	2	0	TBC1D2B	76103619	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.300000	0.02751	-2.233000	0.00716	-2.916000	0.00090	CCG	.	.	.	none		0.617	TBC1D2B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000328369.3	NM_015079	
C16orf62	57020	hgsc.bcm.edu	37	16	19576253	19576253	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr16:19576253A>G	ENST00000251143.5	+	2	110	c.98A>G	c.(97-99)cAc>cGc	p.H33R	C16orf62_ENST00000538853.1_Missense_Mutation_p.H122R|C16orf62_ENST00000417362.2_Missense_Mutation_p.H33R|C16orf62_ENST00000542263.1_Missense_Mutation_p.H122R|C16orf62_ENST00000438132.3_Missense_Mutation_p.H122R			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	33						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						GGGGACTATCACCCTCTGAAA	0.418																																					p.H122R		Atlas-SNP	.											.	C16orf62	164	.	0			c.A365G						PASS	.						120.0	104.0	109.0					16																	19576253		2197	4300	6497	SO:0001583	missense	57020	exon2			ACTATCACCCTCT		CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.98A>G	chr16.hg19:g.19576253A>G	ENSP00000251143:p.His33Arg	166.0	0.0	.		142.0	25.0	.	NM_020314	A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Missense_Mutation	SNP	ENST00000251143.5	hg19		.	.	.	.	.	.	.	.	.	.	A	20.4	3.979057	0.74360	.	.	ENSG00000103544	ENST00000438132;ENST00000538853;ENST00000542263;ENST00000251143;ENST00000417362	T;T;T;T;T	0.59364	0.27;0.27;0.27;0.27;0.27	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.76126	0.3944	M	0.79011	2.435	0.80722	D	1	D;D;D	0.89917	0.96;0.996;1.0	D;D;D	0.83275	0.923;0.99;0.996	T	0.79155	-0.1920	10	0.62326	D	0.03	-29.32	14.632	0.68663	1.0:0.0:0.0:0.0	.	122;33;122	F5H7K1;Q7Z3J2;E7EWW0	.;CP062_HUMAN;.	R	122;122;122;33;33	ENSP00000400815:H122R;ENSP00000444363:H122R;ENSP00000442468:H122R;ENSP00000251143:H33R;ENSP00000395973:H33R	ENSP00000251143:H33R	H	+	2	0	C16orf62	19483754	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.725000	0.84808	2.056000	0.61249	0.374000	0.22700	CAC	.	.	.	none		0.418	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_020314	
ITGAD	3681	hgsc.bcm.edu	37	16	31424561	31424561	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr16:31424561C>A	ENST00000389202.2	+	16	2039	c.1990C>A	c.(1990-1992)Cag>Aag	p.Q664K		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	664					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CTCACTGGACCAGCTAGGTGT	0.597																																					p.Q664K		Atlas-SNP	.											.	ITGAD	154	.	0			c.C1990A						PASS	.						79.0	74.0	76.0					16																	31424561		2197	4300	6497	SO:0001583	missense	3681	exon16			CTGGACCAGCTAG	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.1990C>A	chr16.hg19:g.31424561C>A	ENSP00000373854:p.Gln664Lys	78.0	0.0	.		83.0	10.0	.	NM_005353	Q15575|Q15576	Missense_Mutation	SNP	ENST00000389202.2	hg19	CCDS32438.1	.	.	.	.	.	.	.	.	.	.	C	4.269	0.048941	0.08243	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	T	0.45276	0.9	5.24	4.29	0.51040	Integrin alpha-2 (1);	.	.	.	.	T	0.32224	0.0822	L	0.46157	1.445	0.09310	N	1	B;B	0.16166	0.016;0.016	B;B	0.21360	0.034;0.034	T	0.33007	-0.9885	9	0.06494	T	0.89	.	9.7171	0.40281	0.0:0.904:0.0:0.096	.	680;664	Q59H14;Q13349	.;ITAD_HUMAN	K	680;664	ENSP00000373854:Q664K	ENSP00000373854:Q664K	Q	+	1	0	ITGAD	31332062	0.026000	0.19158	0.003000	0.11579	0.005000	0.04900	0.687000	0.25407	1.223000	0.43536	0.604000	0.83254	CAG	.	.	.	none		0.597	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353	
ZNF423	23090	hgsc.bcm.edu	37	16	49764694	49764694	+	Missense_Mutation	SNP	G	G	A	rs146233664		TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr16:49764694G>A	ENST00000561648.1	-	3	318	c.265C>T	c.(265-267)Cgc>Tgc	p.R89C	ZNF423_ENST00000562520.1_Missense_Mutation_p.R29C|ZNF423_ENST00000262383.2_Missense_Mutation_p.R89C|ZNF423_ENST00000563137.2_Missense_Mutation_p.R29C|ZNF423_ENST00000562871.1_Missense_Mutation_p.R29C	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	89					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				CCAGGACAGCGGTGGGCCCGG	0.517																																					p.R89C		Atlas-SNP	.											.	ZNF423	463	.	0			c.C265T						PASS	.	G	CYS/ARG	0,4396		0,0,2198	158.0	136.0	143.0		265	5.2	1.0	16	dbSNP_134	143	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZNF423	NM_015069.2	180	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	89/1285	49764694	1,12995	2198	4300	6498	SO:0001583	missense	23090	exon3			GACAGCGGTGGGC	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.265C>T	chr16.hg19:g.49764694G>A	ENSP00000455426:p.Arg89Cys	99.0	0.0	.		98.0	27.0	.	NM_015069	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	hg19	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.860384	0.51482	0.0	1.16E-4	ENSG00000102935	ENST00000262383	T	0.29917	1.55	5.15	5.15	0.70609	.	0.199102	0.43416	D	0.000570	T	0.23330	0.0564	N	0.08118	0	0.40060	D	0.975881	P	0.49253	0.921	P	0.49301	0.606	T	0.06391	-1.0829	9	.	.	.	.	14.4984	0.67704	0.0:0.0:0.7833:0.2167	.	89	Q2M1K9	ZN423_HUMAN	C	89	ENSP00000262383:R89C	.	R	-	1	0	ZNF423	48322195	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.272000	0.58908	2.558000	0.86282	0.313000	0.20887	CGC	.	G|1.000;A|0.000	0.000	weak		0.517	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
POLR2C	5432	hgsc.bcm.edu	37	16	57499934	57499934	+	Splice_Site	SNP	G	G	C			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr16:57499934G>C	ENST00000219252.5	+	3	543		c.e3+1		POLR2C_ENST00000564651.1_Splice_Site	NM_032940.2	NP_116558.1	P19387	RPB3_HUMAN	polymerase (RNA) II (DNA directed) polypeptide C, 33kDa						7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	10						CACAGGCTTGGTGAGTACTCC	0.478																																					.		Atlas-SNP	.											.	POLR2C	24	.	0			c.205+1G>C						PASS	.						151.0	144.0	147.0					16																	57499934		2198	4300	6498	SO:0001630	splice_region_variant	5432	exon3			GGCTTGGTGAGTA		CCDS10782.1	16q13-q21	2013-01-21	2002-08-29		ENSG00000102978	ENSG00000102978		"""RNA polymerase subunits"""	9189	protein-coding gene	gene with protein product	"""RNA polymerase II subunit 3"""	180663	"""polymerase (RNA) II (DNA directed) polypeptide C (33kD)"""			8034326	Standard	NM_032940		Approved	RPB3	uc002elt.1	P19387	OTTHUMG00000133464	ENST00000219252.5:c.205+1G>C	chr16.hg19:g.57499934G>C		125.0	0.0	.		133.0	15.0	.	NM_032940	O15161	Splice_Site	SNP	ENST00000219252.5	hg19	CCDS10782.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.053137	0.75960	.	.	ENSG00000102978	ENST00000219252	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3397	0.90300	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	POLR2C	56057435	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	9.869000	0.99810	2.593000	0.87608	0.561000	0.74099	.	.	.	.	none		0.478	POLR2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257340.3	NM_032940	Intron
C17orf104	284071	hgsc.bcm.edu	37	17	42744973	42744973	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr17:42744973T>C	ENST00000409122.2	+	5	1836	c.1694T>C	c.(1693-1695)cTa>cCa	p.L565P	C17orf104_ENST00000409464.1_Missense_Mutation_p.L399P|C17orf104_ENST00000359945.3_Missense_Mutation_p.L565P	NM_001145080.2	NP_001138552.2	A2RUB1	CQ104_HUMAN	chromosome 17 open reading frame 104	565										autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|skin(1)	24						ATAGAAGGACTAACAAAGCCT	0.348																																					p.L565P		Atlas-SNP	.											.	C17orf104	75	.	0			c.T1694C						PASS	.						29.0	31.0	30.0					17																	42744973		2200	4297	6497	SO:0001583	missense	284071	exon5			AAGGACTAACAAA		CCDS45703.1, CCDS45703.2	17q21.31	2009-09-08			ENSG00000180336	ENSG00000180336			26670	protein-coding gene	gene with protein product							Standard	NM_001145080		Approved	FLJ35848	uc002iha.3	A2RUB1	OTTHUMG00000153039	ENST00000409122.2:c.1694T>C	chr17.hg19:g.42744973T>C	ENSP00000386452:p.Leu565Pro	96.0	0.0	.		118.0	50.0	.	NM_001145080	B4DXJ2|B5MD93|B9EGQ6|C4AM97|Q4G0Y1|Q8IVZ7|Q8NA45	Missense_Mutation	SNP	ENST00000409122.2	hg19	CCDS45703.2	.	.	.	.	.	.	.	.	.	.	T	11.86	1.763636	0.31228	.	.	ENSG00000180336	ENST00000359945;ENST00000409122;ENST00000409464	T;T;T	0.37411	1.2;1.2;1.22	5.66	4.51	0.55191	.	0.136458	0.33753	N	0.004589	T	0.44414	0.1292	L	0.34521	1.04	0.58432	D	0.999999	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.71656	0.974;0.974;0.974	T	0.29701	-1.0003	10	0.44086	T	0.13	-19.4828	9.8411	0.40999	0.2645:0.0:0.0:0.7355	.	565;565;399	A2RUB1-5;A2RUB1;A2RUB1-1	.;CQ104_HUMAN;.	P	565;565;399	ENSP00000353028:L565P;ENSP00000386452:L565P;ENSP00000386586:L399P	ENSP00000353028:L565P	L	+	2	0	C17orf104	40100499	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.526000	0.35964	2.151000	0.67156	0.533000	0.62120	CTA	.	.	.	none		0.348	C17orf104-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329171.2	NM_001145080	
MUC16	94025	hgsc.bcm.edu	37	19	9075997	9075997	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr19:9075997G>A	ENST00000397910.4	-	3	11652	c.11449C>T	c.(11449-11451)Ctt>Ttt	p.L3817F		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3818	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGGTGGGAAGCTGAGTGGAA	0.507																																					p.L3817F		Atlas-SNP	.											.	MUC16	4315	.	0			c.C11449T						PASS	.						230.0	219.0	223.0					19																	9075997		2074	4222	6296	SO:0001583	missense	94025	exon3			TGGGAAGCTGAGT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.11449C>T	chr19.hg19:g.9075997G>A	ENSP00000381008:p.Leu3817Phe	117.0	0.0	.		127.0	22.0	.	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	4.495	0.091754	0.08632	.	.	ENSG00000181143	ENST00000397910	T	0.03124	4.04	1.74	-0.625	0.11548	.	.	.	.	.	T	0.02083	0.0065	N	0.08118	0	.	.	.	B	0.31383	0.321	B	0.34301	0.179	T	0.43669	-0.9377	8	0.87932	D	0	.	2.8375	0.05519	0.2006:0.3036:0.4958:0.0	.	3817	B5ME49	.	F	3817	ENSP00000381008:L3817F	ENSP00000381008:L3817F	L	-	1	0	MUC16	8936997	0.000000	0.05858	0.001000	0.08648	0.231000	0.25187	-1.717000	0.01876	-0.091000	0.12440	0.313000	0.20887	CTT	.	.	.	none		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF493	284443	hgsc.bcm.edu	37	19	21607521	21607521	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr19:21607521G>T	ENST00000355504.4	+	2	1942	c.1676G>T	c.(1675-1677)tGt>tTt	p.C559F	ZNF493_ENST00000392288.2_Missense_Mutation_p.C687F|CTD-2561J22.3_ENST00000600810.1_Intron	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	559					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						CCCTACAAATGTGAAAAATGT	0.343																																					p.C687F		Atlas-SNP	.											.	ZNF493	178	.	0			c.G2060T						PASS	.						33.0	37.0	35.0					19																	21607521		2202	4296	6498	SO:0001583	missense	284443	exon4			ACAAATGTGAAAA	AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.1676G>T	chr19.hg19:g.21607521G>T	ENSP00000347691:p.Cys559Phe	216.0	0.0	.		247.0	36.0	.	NM_001076678	G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Missense_Mutation	SNP	ENST00000355504.4	hg19	CCDS12412.1	.	.	.	.	.	.	.	.	.	.	N	13.82	2.349952	0.41599	.	.	ENSG00000196268	ENST00000392288;ENST00000355504	D;D	0.85088	-1.94;-1.94	1.06	1.06	0.20224	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93271	0.7856	H	0.95437	3.67	0.80722	D	1	D;D	0.89917	1.0;0.997	D;P	0.85130	0.997;0.789	D	0.92138	0.5718	9	0.87932	D	0	.	8.9275	0.35650	0.0:0.0:1.0:0.0	.	559;687	Q6ZR52;Q6ZR52-2	ZN493_HUMAN;.	F	687;559	ENSP00000376110:C687F;ENSP00000347691:C559F	ENSP00000347691:C559F	C	+	2	0	ZNF493	21399361	1.000000	0.71417	0.047000	0.18901	0.046000	0.14306	4.613000	0.61176	0.458000	0.26988	0.467000	0.42956	TGT	.	.	.	none		0.343	ZNF493-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280563.1	NM_175910	
ERCC2	2068	hgsc.bcm.edu	37	19	45867362	45867362	+	Silent	SNP	G	G	A	rs547544775		TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr19:45867362G>A	ENST00000391945.4	-	10	908	c.831C>T	c.(829-831)gaC>gaT	p.D277D	ERCC2_ENST00000221481.6_3'UTR|ERCC2_ENST00000391940.4_Silent_p.D253D|ERCC2_ENST00000485403.2_Silent_p.D253D|ERCC2_ENST00000391944.3_Silent_p.D199D	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	277	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		GGCGCTGCTCGTCTGTCTCTT	0.721			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum				G|||	1	0.000199681	0.0	0.0	5008	,	,		11449	0.0		0.0	False		,,,				2504	0.001				p.D277D		Atlas-SNP	.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2	78	.	0			c.C831T						PASS	.						8.0	11.0	10.0					19																	45867362		2115	4221	6336	SO:0001819	synonymous_variant	2068	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTGCTCGTCTGTC		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.831C>T	chr19.hg19:g.45867362G>A		81.0	0.0	.		91.0	17.0	.	NM_000400	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Silent	SNP	ENST00000391945.4	hg19	CCDS33049.1																																																																																			.	.	.	none		0.721	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
NXT1	29107	hgsc.bcm.edu	37	20	23334728	23334728	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr20:23334728C>A	ENST00000254998.2	+	2	437	c.50C>A	c.(49-51)gCt>gAt	p.A17D	RP3-322G13.5_ENST00000444981.1_RNA|RP3-322G13.7_ENST00000442884.1_RNA|AL096677.1_ENST00000596205.1_5'Flank|RP3-322G13.5_ENST00000452395.1_RNA|RP3-322G13.5_ENST00000442440.1_RNA	NM_013248.2	NP_037380.1	Q9UKK6	NXT1_HUMAN	nuclear transport factor 2-like export factor 1	17	NTF2. {ECO:0000255|PROSITE- ProRule:PRU00137}.				protein export from nucleus (GO:0006611)|RNA export from nucleus (GO:0006405)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)				NS(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	6	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					TGCAGAGCTGCTGAGGAGTTT	0.547																																					p.A17D		Atlas-SNP	.											.	NXT1	12	.	0			c.C50A						PASS	.						96.0	92.0	93.0					20																	23334728		2203	4300	6503	SO:0001583	missense	29107	exon2			GAGCTGCTGAGGA	AF156957	CCDS13150.1	20p12-p11.2	2014-05-12	2014-05-12		ENSG00000132661	ENSG00000132661			15913	protein-coding gene	gene with protein product		605811	"""NTX2-like export factor1"", ""NTF2-like export factor 1"""			10567585, 11259602	Standard	NM_013248		Approved	P15, MTR2	uc002wsx.1	Q9UKK6	OTTHUMG00000032059	ENST00000254998.2:c.50C>A	chr20.hg19:g.23334728C>A	ENSP00000254998:p.Ala17Asp	113.0	0.0	.		108.0	17.0	.	NM_013248		Missense_Mutation	SNP	ENST00000254998.2	hg19	CCDS13150.1	.	.	.	.	.	.	.	.	.	.	C	19.82	3.897600	0.72639	.	.	ENSG00000132661	ENST00000254998	.	.	.	5.32	4.37	0.52481	Nuclear transport factor 2, Eukaryote (1);Nuclear transport factor 2 (1);	0.060915	0.64402	D	0.000002	T	0.80949	0.4722	M	0.90019	3.08	0.43152	D	0.994922	D	0.69078	0.997	D	0.70935	0.971	D	0.85059	0.0933	9	0.87932	D	0	.	12.1184	0.53878	0.0:0.8279:0.1721:0.0	.	17	Q9UKK6	NXT1_HUMAN	D	17	.	ENSP00000254998:A17D	A	+	2	0	NXT1	23282728	1.000000	0.71417	0.018000	0.16275	0.958000	0.62258	6.916000	0.75776	1.604000	0.50143	0.655000	0.94253	GCT	.	.	.	none		0.547	NXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078313.2	NM_013248	
CLIC6	54102	hgsc.bcm.edu	37	21	36042470	36042470	+	Silent	SNP	A	A	G	rs557556798|rs62213790	byFrequency	TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr21:36042470A>G	ENST00000360731.3	+	1	783	c.783A>G	c.(781-783)gaA>gaG	p.E261E	CLIC6_ENST00000349499.2_Silent_p.E261E			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	261	13 X 10 AA tandem repeat of G-D-[SNG]- [VIM]-[DEQ]-A-[EAG]-[GDVE]-[PRG]-[LAVP].					chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						ACGGCGTAGAAGCGGGGGTCC	0.761																																					p.E261E		Atlas-SNP	.											CLIC6,NS,carcinoma,0,1	CLIC6	49	.	0			c.A783G						PASS	.						1.0	2.0	2.0					21																	36042470		755	1897	2652	SO:0001819	synonymous_variant	54102	exon1			CGTAGAAGCGGGG	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.783A>G	chr21.hg19:g.36042470A>G		14.0	2.0	.		29.0	3.0	.	NM_053277	A8K0U8|Q8IX31	Silent	SNP	ENST00000360731.3	hg19																																																																																				.	.	.	weak		0.761	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
SEC14L3	266629	hgsc.bcm.edu	37	22	30860885	30860885	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr22:30860885T>C	ENST00000215812.4	-	8	676	c.586A>G	c.(586-588)Aaa>Gaa	p.K196E	SEC14L3_ENST00000539629.1_Missense_Mutation_p.K137E|SEC14L3_ENST00000401751.1_Missense_Mutation_p.K137E|SEC14L3_ENST00000403066.1_Missense_Mutation_p.K137E|SEC14L3_ENST00000402286.1_Missense_Mutation_p.K119E|SEC14L3_ENST00000540910.1_Missense_Mutation_p.K119E|SEC14L3_ENST00000415957.2_Missense_Mutation_p.K137E	NM_174975.4	NP_777635.1	Q9UDX4	S14L3_HUMAN	SEC14-like 3 (S. cerevisiae)	196	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	19					Vitamin E(DB00163)	GGGAACAGTTTGGTAGCTGGA	0.438																																					p.K196E	Esophageal Squamous(108;290 1516 3584 23771 37333)	Atlas-SNP	.											.	SEC14L3	46	.	0			c.A586G						PASS	.						129.0	117.0	121.0					22																	30860885		2203	4300	6503	SO:0001583	missense	266629	exon8			ACAGTTTGGTAGC	AY158086	CCDS13877.1, CCDS58800.1, CCDS58801.1	22q12.2	2013-09-23			ENSG00000100012	ENSG00000100012			18655	protein-coding gene	gene with protein product		612824					Standard	NM_174975		Approved	TAP2	uc003ahy.3	Q9UDX4	OTTHUMG00000151259	ENST00000215812.4:c.586A>G	chr22.hg19:g.30860885T>C	ENSP00000215812:p.Lys196Glu	79.0	0.0	.		66.0	10.0	.	NM_174975	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Missense_Mutation	SNP	ENST00000215812.4	hg19	CCDS13877.1	.	.	.	.	.	.	.	.	.	.	T	15.27	2.784925	0.49997	.	.	ENSG00000100012	ENST00000403066;ENST00000415957;ENST00000215812;ENST00000402286;ENST00000401751;ENST00000539629;ENST00000540910	T;T;T;T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08;-1.08;-1.08;-1.08	5.4	4.35	0.52113	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.092809	0.64402	D	0.000001	D	0.87924	0.6300	M	0.91196	3.185	0.80722	D	1	D;B	0.58970	0.984;0.068	P;B	0.59221	0.854;0.155	D	0.89075	0.3472	10	0.87932	D	0	-13.0241	11.3853	0.49782	0.1359:0.0:0.0:0.8641	.	119;196	E9PE57;Q9UDX4	.;S14L3_HUMAN	E	137;137;196;119;137;137;119	ENSP00000385941:K137E;ENSP00000401864:K137E;ENSP00000215812:K196E;ENSP00000385004:K119E;ENSP00000383896:K137E;ENSP00000444691:K137E;ENSP00000439752:K119E	ENSP00000215812:K196E	K	-	1	0	SEC14L3	29190885	1.000000	0.71417	0.989000	0.46669	0.024000	0.10985	7.561000	0.82288	0.866000	0.35629	-0.336000	0.08194	AAA	.	.	.	none		0.438	SEC14L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321950.4	NM_174975	
APOBEC3G	60489	hgsc.bcm.edu	37	22	39479829	39479829	+	Silent	SNP	G	G	A			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr22:39479829G>A	ENST00000407997.3	+	5	1032	c.675G>A	c.(673-675)gaG>gaA	p.E225E	APOBEC3G_ENST00000461827.1_3'UTR|APOBEC3G_ENST00000452957.2_Silent_p.E225E	NM_021822.3	NP_068594.1	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G	225	Necessary for homooligomerization.				base conversion or substitution editing (GO:0016553)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral process (GO:0048525)|positive regulation of defense response to virus by host (GO:0002230)|viral process (GO:0016032)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|ribonucleoprotein complex (GO:0030529)	cytidine deaminase activity (GO:0004126)|deoxycytidine deaminase activity (GO:0047844)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|large_intestine(4)|lung(5)|skin(1)|stomach(1)	12	Melanoma(58;0.04)					ATGAGGTGGAGCGCATGCACA	0.552																																					p.E225E		Atlas-SNP	.											.	APOBEC3G	69	.	0			c.G675A						PASS	.						121.0	99.0	106.0					22																	39479829		2203	4300	6503	SO:0001819	synonymous_variant	60489	exon5			GGTGGAGCGCATG	AF182420	CCDS13984.1	22q13.1-q13.2	2008-05-15			ENSG00000239713	ENSG00000239713		"""Apolipoprotein B mRNA editing enzymes"""	17357	protein-coding gene	gene with protein product		607113				11863358	Standard	NM_021822		Approved	CEM15, MDS019, dJ494G10.1, FLJ12740, bK150C2.7		Q9HC16	OTTHUMG00000151081	ENST00000407997.3:c.675G>A	chr22.hg19:g.39479829G>A		88.0	0.0	.		89.0	16.0	.	NM_021822	B2RDR9|Q45F02|Q5TF77|Q7Z2N1|Q7Z2N4|Q9H9H8	Silent	SNP	ENST00000407997.3	hg19	CCDS13984.1																																																																																			.	.	.	none		0.552	APOBEC3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321219.1	NM_021822	
PPP6R2	9701	hgsc.bcm.edu	37	22	50876323	50876323	+	Silent	SNP	G	G	A			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr22:50876323G>A	ENST00000216061.5	+	18	2203	c.1833G>A	c.(1831-1833)gaG>gaA	p.E611E	PPP6R2_ENST00000395741.3_Silent_p.E585E|PPP6R2_ENST00000359139.3_Silent_p.E584E|PPP6R2_ENST00000395744.3_Silent_p.E584E			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	611						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						ACGCTGACGAGGACAGTGTGA	0.627																																					p.E611E		Atlas-SNP	.											.	PPP6R2	71	.	0			c.G1833A						PASS	.						43.0	30.0	35.0					22																	50876323		2180	4247	6427	SO:0001819	synonymous_variant	9701	exon17			TGACGAGGACAGT	AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.1833G>A	chr22.hg19:g.50876323G>A		34.0	0.0	.		38.0	6.0	.	NM_001242898	A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Silent	SNP	ENST00000216061.5	hg19																																																																																				.	.	.	none		0.627	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316809.1	NM_014678	
HUWE1	10075	hgsc.bcm.edu	37	X	53641606	53641606	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chrX:53641606C>G	ENST00000342160.3	-	22	2607	c.2150G>C	c.(2149-2151)aGg>aCg	p.R717T	HUWE1_ENST00000218328.8_Missense_Mutation_p.R717T|HUWE1_ENST00000262854.6_Missense_Mutation_p.R717T			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	717					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						ATGATTAGACCTTGGGGGAGG	0.478																																					p.R717T		Atlas-SNP	.											.	HUWE1	724	.	0			c.G2150C						PASS	.						151.0	130.0	137.0					X																	53641606		2203	4300	6503	SO:0001583	missense	10075	exon23			TTAGACCTTGGGG	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.2150G>C	chrX.hg19:g.53641606C>G	ENSP00000340648:p.Arg717Thr	68.0	0.0	.		51.0	11.0	.	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	hg19	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	C	17.49	3.403533	0.62288	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328	T;T;T	0.44482	0.92;0.92;0.92	5.46	5.46	0.80206	E3 ubiquitin ligase, domain of unknown function DUF913 (1);	0.506668	0.20511	N	0.090900	T	0.45256	0.1333	L	0.46157	1.445	0.58432	D	0.999999	P	0.48503	0.911	P	0.47827	0.558	T	0.20806	-1.0264	10	0.21014	T	0.42	.	16.9953	0.86366	0.0:1.0:0.0:0.0	.	717	Q7Z6Z7	HUWE1_HUMAN	T	717	ENSP00000340648:R717T;ENSP00000262854:R717T;ENSP00000218328:R717T	ENSP00000218328:R717T	R	-	2	0	HUWE1	53658331	1.000000	0.71417	0.997000	0.53966	0.830000	0.47004	7.090000	0.76916	2.275000	0.75901	0.600000	0.82982	AGG	.	.	.	none		0.478	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
ARR3	407	hgsc.bcm.edu	37	X	69500417	69500417	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chrX:69500417G>C	ENST00000307959.8	+	14	1049	c.998G>C	c.(997-999)gGa>gCa	p.G333A	ARR3_ENST00000374495.3_Missense_Mutation_p.G333A|RAB41_ENST00000276066.4_5'Flank|RAB41_ENST00000374473.2_5'Flank	NM_004312.2	NP_004303.2	P36575	ARRC_HUMAN	arrestin 3, retinal (X-arrestin)	333					endocytosis (GO:0006897)|regulation of protein phosphorylation (GO:0001932)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)				endometrium(3)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	16						AGCATCCTAGGAGACCTGACA	0.498																																					p.G333A		Atlas-SNP	.											.	ARR3	41	.	0			c.G998C						PASS	.						64.0	61.0	62.0					X																	69500417		2203	4300	6503	SO:0001583	missense	407	exon14			TCCTAGGAGACCT		CCDS14399.1	Xq13.1	2013-10-11			ENSG00000120500	ENSG00000120500			710	protein-coding gene	gene with protein product	"""arrestin 4"""	301770				8224247	Standard	NM_004312		Approved	ARRX	uc004dyb.2	P36575	OTTHUMG00000021768	ENST00000307959.8:c.998G>C	chrX.hg19:g.69500417G>C	ENSP00000311538:p.Gly333Ala	25.0	0.0	.		25.0	12.0	.	NM_004312	B5B0B9|Q5JT23|Q5JT24|Q6IBF5|Q96EN2	Missense_Mutation	SNP	ENST00000307959.8	hg19	CCDS14399.1	.	.	.	.	.	.	.	.	.	.	G	17.94	3.511400	0.64522	.	.	ENSG00000120500	ENST00000374495;ENST00000374480;ENST00000307959	T;T	0.18338	2.22;2.22	5.21	4.34	0.51931	Immunoglobulin E-set (1);Arrestin, C-terminal (1);Arrestin-like, C-terminal (1);	0.227351	0.45361	D	0.000374	T	0.38746	0.1052	M	0.89840	3.065	0.33699	D	0.614329	P;D	0.55172	0.882;0.97	B;P	0.53593	0.281;0.73	T	0.62238	-0.6896	10	0.87932	D	0	-7.5091	10.158	0.42833	0.0946:0.0:0.9054:0.0	.	333;333	P36575;P36575-2	ARRC_HUMAN;.	A	333	ENSP00000363619:G333A;ENSP00000311538:G333A	ENSP00000311538:G333A	G	+	2	0	ARR3	69417142	1.000000	0.71417	0.791000	0.31998	0.990000	0.78478	4.957000	0.63652	0.965000	0.38133	0.600000	0.82982	GGA	.	.	.	none		0.498	ARR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057055.2	NM_004312	
NHSL2	340527	hgsc.bcm.edu	37	X	71354534	71354534	+	5'UTR	SNP	T	T	A			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chrX:71354534T>A	ENST00000373677.1	+	0	1036				NHSL2_ENST00000540800.1_Missense_Mutation_p.I247N|NHSL2_ENST00000535692.1_5'UTR|RGAG4_ENST00000609883.1_5'Flank|RGAG4_ENST00000545866.1_5'Flank|NHSL2_ENST00000510661.1_Missense_Mutation_p.I60N			Q5HYW2	NHSL2_HUMAN	NHS-like 2											NS(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(10)|lung(7)|stomach(1)	28	Renal(35;0.156)					CAGTCTGACATTGTGCCCATC	0.527																																					p.I247N		Atlas-SNP	.											.	NHSL2	148	.	0			c.T740A						PASS	.						97.0	75.0	81.0					X																	71354534		692	1591	2283	SO:0001623	5_prime_UTR_variant	340527	exon4			CTGACATTGTGCC			Xq13.1	2009-02-18			ENSG00000204131	ENSG00000204131			33737	protein-coding gene	gene with protein product							Standard	NM_001013627		Approved		uc011mqa.2	Q5HYW2	OTTHUMG00000021807	ENST00000373677.1:c.-227T>A	chrX.hg19:g.71354534T>A		44.0	0.0	.		44.0	13.0	.	NM_001013627	B2RN94	Missense_Mutation	SNP	ENST00000373677.1	hg19		.	.	.	.	.	.	.	.	.	.	t	17.20	3.329482	0.60743	.	.	ENSG00000204131	ENST00000540800;ENST00000510661	T;T	0.56776	0.71;0.44	5.27	5.27	0.74061	.	.	.	.	.	T	0.53045	0.1772	L	0.34521	1.04	0.80722	D	1	P;P	0.52692	0.955;0.955	P;P	0.54312	0.643;0.748	T	0.50423	-0.8830	8	.	.	.	.	12.1115	0.53842	0.0:0.0:0.0:1.0	.	247;60	F5H593;D6RBM4	.;.	N	247;60	ENSP00000444617:I247N;ENSP00000424079:I60N	.	I	+	2	0	NHSL2	71271259	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.634000	0.83273	1.763000	0.52060	0.378000	0.23410	ATT	.	.	.	none		0.527	NHSL2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000057170.1	NM_001013627	
VAMP7	6845	hgsc.bcm.edu	37	X	155171620	155171620	+	3'UTR	SNP	G	G	T			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chrX:155171620G>T	ENST00000286448.6	+	0	833				VAMP7_ENST00000460621.1_3'UTR|VAMP7_ENST00000262640.6_Missense_Mutation_p.K200N	NM_001145149.2|NM_005638.5	NP_001138621.1|NP_005629.1	P51809	VAMP7_HUMAN	vesicle-associated membrane protein 7						calcium ion-dependent exocytosis (GO:0017156)|endosome to lysosome transport (GO:0008333)|eosinophil degranulation (GO:0043308)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi to plasma membrane protein transport (GO:0043001)|membrane organization (GO:0061024)|neutrophil degranulation (GO:0043312)|phagocytosis, engulfment (GO:0006911)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of protein targeting to vacuolar membrane (GO:1900483)|SNARE complex assembly (GO:0035493)|triglyceride transport (GO:0034197)|vesicle fusion (GO:0006906)|vesicle fusion with Golgi apparatus (GO:0048280)|vesicle-mediated transport (GO:0016192)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|synapse (GO:0045202)				large_intestine(1)|lung(8)	9	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AAATAGGAAAGAAGAAGTTAC	0.413																																					p.K200N		Atlas-SNP	.											.	VAMP7	39	.	0			c.G600T						PASS	.						220.0	211.0	214.0					X																	155171620		2203	4296	6499	SO:0001624	3_prime_UTR_variant	6845	exon7			AGGAAAGAAGAAG	AJ295938	CCDS14770.4, CCDS48199.1, CCDS55548.1	Xq28 and Yq12	2013-02-13	2007-12-05	2007-12-05	ENSG00000124333	ENSG00000124333		"""Pseudoautosomal regions / PAR2"", ""Vesicle-associated membrane proteins"""	11486	protein-coding gene	gene with protein product		300053	"""synaptobrevin-like 1"""	SYBL1		8640232, 11440841	Standard	NM_001145149		Approved	VAMP-7, TI-VAMP	uc004fns.3	P51809	OTTHUMG00000022679	ENST00000286448.6:c.*5G>T	chrX.hg19:g.155171620G>T		476.0	0.0	.		339.0	83.0	.	NM_001185183	Q53GY7|Q7Z409|Q9H4A7	Missense_Mutation	SNP	ENST00000286448.6	hg19	CCDS14770.4	.	.	.	.	.	.	.	.	.	.	G	6.602	0.479414	0.12581	.	.	ENSG00000124333	ENST00000262640	T	0.24350	1.86	2.6	-0.913	0.10500	.	44.072800	0.00166	N	0.000001	T	0.17916	0.0430	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.26189	-1.0110	9	0.59425	D	0.04	.	2.8345	0.05510	0.1657:0.0:0.3548:0.4795	.	200	P51809-2	.	N	200	ENSP00000262640:K200N	ENSP00000262640:K200N	K	+	3	2	VAMP7	154824814	0.926000	0.31397	0.025000	0.17156	0.147000	0.21601	0.598000	0.24074	-0.055000	0.13244	0.279000	0.19357	AAG	.	.	.	none		0.413	VAMP7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058843.1	NM_005638	
MT-ND6	4541	hgsc.bcm.edu	37	M	14671	14671	+	Start_Codon_SNP	SNP	C	C	T			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chrM:14671C>T	ENST00000361681.2	-	1	2	c.3G>A	c.(1-3)atG>atA	p.M1I	MT-TE_ENST00000387459.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	1					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						AAAGCATACATCATTATTCTC	0.393																																					p.M1M		Atlas-SNP	.											.	.	.	.	0			c.G3A						PASS	.																																			SO:0001582	initiator_codon_variant	0	exon1			ATACATCATTATT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.3G>A	chrM.hg19:g.14671C>T	ENSP00000354665:p.Met1Ile	285.0	0.0	.		407.0	43.0	.	ENST00000361681	Q34774|Q8HG30	Silent	SNP	ENST00000361681.2	hg19																																																																																				.	.	.	none		0.393	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024037	Missense_Mutation
POU3F4	5456	hgsc.bcm.edu	37	X	82763464	82763464	+	Frame_Shift_Del	DEL	G	G	-			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chrX:82763464delG	ENST00000373200.2	+	1	196	c.132delG	c.(130-132)cagfs	p.Q44fs	RP3-326L13.3_ENST00000607789.1_lincRNA|RP3-326L13.2_ENST00000607095.1_RNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	44					cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						ATTACTTGCAGGGAGTTCCCA	0.612																																					p.Q44fs		Atlas-Indel,Pindel	.											.	POU3F4	136	.	0			c.131delA						PASS	.						38.0	30.0	33.0					X																	82763464		2203	4300	6503	SO:0001589	frameshift_variant	5456	exon1			.	X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.132delG	chrX.hg19:g.82763464delG	ENSP00000362296:p.Gln44fs	93.0	0.0	0		87.0	33.0	0.37931	NM_000307	B2RC71|Q5H9G9|Q99410	Frame_Shift_Del	DEL	ENST00000373200.2	hg19	CCDS14450.1																																																																																			.	.	.	none		0.612	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057368.2	NM_000307	
SETBP1	26040	hgsc.bcm.edu	37	18	42643077	42643077	+	Frame_Shift_Del	DEL	G	G	-	rs371946489		TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr18:42643077delG	ENST00000282030.5	+	6	4501	c.4205delG	c.(4204-4206)cggfs	p.R1402fs		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1402						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		TTCAAGCGGCGGGAGATCGAA	0.537									Schinzel-Giedion syndrome																												p.R1402fs		Atlas-Indel,Pindel	.											.	SETBP1	577	.	0			c.4204delC						PASS	.						49.0	48.0	48.0					18																	42643077		2203	4300	6503	SO:0001589	frameshift_variant	26040	exon6	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	.	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.4205delG	chr18.hg19:g.42643077delG	ENSP00000282030:p.Arg1402fs	139.0	0.0	0		140.0	22.0	0.157143	NM_015559	A6H8W5|Q6P6C3|Q9UEF3	Frame_Shift_Del	DEL	ENST00000282030.5	hg19	CCDS11923.2																																																																																			.	.	.	none		0.537	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110	
KHDRBS1	10657	hgsc.bcm.edu	37	1	32479924	32479929	+	In_Frame_Del	DEL	GAGAAG	GAGAAG	-			TCGA-UZ-A9PM-01A-21D-A382-10	TCGA-UZ-A9PM-10A-01D-A385-10	GAGAAG	GAGAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3dfef537-01d1-4b16-a21d-4e9503040705	0ec588cf-97a6-49af-a772-c55a2af2cf9b	g.chr1:32479924_32479929delGAGAAG	ENST00000327300.7	+	1	495_500	c.328_333delGAGAAG	c.(328-333)gagaagdel	p.EK110del	KHDRBS1_ENST00000492989.1_In_Frame_Del_p.EK110del|KHDRBS1_ENST00000307714.8_3'UTR	NM_006559.1	NP_006550.1			KH domain containing, RNA binding, signal transduction associated 1											endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				ACTCATGGCCGAGAAGGACTCGCTCG	0.684																																					p.109_111del	Ovarian(173;401 1982 12359 31110 42403)	Atlas-Indel,Pindel	.											.	KHDRBS1	34	.	0			c.327_332del						PASS	.																																			SO:0001651	inframe_deletion	10657	exon1			.	U78971	CCDS350.1, CCDS60067.1	1p32	2008-07-18			ENSG00000121774	ENSG00000121774			18116	protein-coding gene	gene with protein product	"""GAP-associated tyrosine phosphoprotein p62 (Sam68)"""	602489				1374686, 10564820	Standard	NM_006559		Approved	Sam68, p62, FLJ34027	uc001bub.4	Q07666	OTTHUMG00000003921	ENST00000327300.7:c.328_333delGAGAAG	chr1.hg19:g.32479924_32479929delGAGAAG	ENSP00000313829:p.Glu110_Lys111del	98.0	0.0	0		131.0	12.0	0.0916031	NM_006559		In_Frame_Del	DEL	ENST00000327300.7	hg19	CCDS350.1																																																																																			.	.	.	none		0.684	KHDRBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011199.4	NM_006559	
