#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PABPC4	8761	hgsc.bcm.edu	37	1	40031014	40031014	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr1:40031014A>C	ENST00000372857.3	-	8	1801	c.1009T>G	c.(1009-1011)Ttc>Gtc	p.F337V	RP11-69E11.8_ENST00000415255.1_RNA|PABPC4_ENST00000372862.3_Missense_Mutation_p.F337V|PABPC4_ENST00000372858.3_Missense_Mutation_p.F337V|PABPC4_ENST00000372856.3_Missense_Mutation_p.F337V|SNORA55_ENST00000364587.1_RNA	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	337	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AAGCAGACGAAGCCAAACCCT	0.502																																					p.F337V		Atlas-SNP	.											.	PABPC4	56	.	0			c.T1009G						PASS	.						74.0	71.0	72.0					1																	40031014		2203	4300	6503	SO:0001583	missense	8761	exon8			AGACGAAGCCAAA	U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.1009T>G	chr1.hg19:g.40031014A>C	ENSP00000361948:p.Phe337Val	55.0	0.0	.		59.0	19.0	.	NM_001135653	B1ANQ8|Q4VC03|Q6P0N3	Missense_Mutation	SNP	ENST00000372857.3	hg19	CCDS438.1	.	.	.	.	.	.	.	.	.	.	A	33	5.223893	0.95139	.	.	ENSG00000090621	ENST00000372862;ENST00000372858;ENST00000372857;ENST00000372856	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	6.16	6.16	0.99307	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.68915	0.3053	H	0.95114	3.625	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.984;0.999	T	0.79024	-0.1972	10	0.87932	D	0	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	337;337;337	Q13310;Q13310-2;Q4VC03	PABP4_HUMAN;.;.	V	337	ENSP00000361953:F337V;ENSP00000361949:F337V;ENSP00000361948:F337V;ENSP00000361947:F337V	ENSP00000361947:F337V	F	-	1	0	PABPC4	39803601	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	9.307000	0.96226	2.367000	0.80283	0.528000	0.53228	TTC	.	.	.	none		0.502	PABPC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025220.1	NM_001135653	
SLC6A9	6536	hgsc.bcm.edu	37	1	44475672	44475672	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr1:44475672C>T	ENST00000360584.2	-	4	694	c.503G>A	c.(502-504)tGc>tAc	p.C168Y	SLC6A9_ENST00000475075.2_Intron|SLC6A9_ENST00000492434.2_5'UTR|SLC6A9_ENST00000372306.3_Missense_Mutation_p.C95Y|SLC6A9_ENST00000537678.1_Missense_Mutation_p.C30Y|SLC6A9_ENST00000372310.3_Missense_Mutation_p.C95Y|SLC6A9_ENST00000357730.2_Missense_Mutation_p.C114Y|SLC6A9_ENST00000372307.3_Missense_Mutation_p.C30Y	NM_201649.3	NP_964012.2	P48067	SC6A9_HUMAN	solute carrier family 6 (neurotransmitter transporter, glycine), member 9	168					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(2)	22	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)	GACCCCCAGGCACCCCTGGCT	0.602																																					p.C168Y		Atlas-SNP	.											.	SLC6A9	109	.	0			c.G503A						PASS	.						67.0	72.0	70.0					1																	44475672		2203	4300	6503	SO:0001583	missense	6536	exon4			CCCAGGCACCCCT	S70609	CCDS30695.1, CCDS41316.1, CCDS41317.1	1p33	2013-05-22			ENSG00000196517	ENSG00000196517		"""Solute carriers"""	11056	protein-coding gene	gene with protein product		601019				8183239, 7587377	Standard	NM_006934		Approved	GLYT1	uc001cll.4	P48067	OTTHUMG00000008294	ENST00000360584.2:c.503G>A	chr1.hg19:g.44475672C>T	ENSP00000353791:p.Cys168Tyr	193.0	0.0	.		212.0	54.0	.	NM_201649	A6NDH1|A6NII2|A6NNZ8|Q5TAB8|Q5TAB9|Q5TAC0	Missense_Mutation	SNP	ENST00000360584.2	hg19	CCDS41317.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.446464	0.84101	.	.	ENSG00000196517	ENST00000372307;ENST00000372306;ENST00000372310;ENST00000360584;ENST00000357730;ENST00000537678;ENST00000528803	T;T;T;T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86	5.4	5.4	0.78164	.	0.046641	0.85682	D	0.000000	D	0.88455	0.6441	M	0.87097	2.86	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;0.997;0.995;0.996;0.996;1.0	D;D;D;D;D;D	0.91635	0.994;0.95;0.95;0.946;0.946;0.999	D	0.89341	0.3654	10	0.62326	D	0.03	.	18.9633	0.92685	0.0:1.0:0.0:0.0	.	99;95;30;95;114;168	B7Z3W8;B7Z8W5;B7Z3A9;P48067-2;P48067-3;P48067	.;.;.;.;.;SC6A9_HUMAN	Y	30;95;95;168;114;30;114	ENSP00000361381:C30Y;ENSP00000361380:C95Y;ENSP00000361384:C95Y;ENSP00000353791:C168Y;ENSP00000350362:C114Y;ENSP00000442523:C30Y;ENSP00000435652:C114Y	ENSP00000350362:C114Y	C	-	2	0	SLC6A9	44248259	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.018000	0.40991	2.813000	0.96785	0.561000	0.74099	TGC	.	.	.	none		0.602	SLC6A9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000022825.2	NM_201649	
CYP4A11	1579	hgsc.bcm.edu	37	1	47403742	47403742	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr1:47403742T>C	ENST00000310638.4	-	2	294	c.263A>G	c.(262-264)cAt>cGt	p.H88R	CYP4A11_ENST00000371905.1_Missense_Mutation_p.H88R|CYP4A11_ENST00000457840.2_5'UTR|CYP4A11_ENST00000462347.1_Missense_Mutation_p.H88R|CYP4A11_ENST00000371904.4_Missense_Mutation_p.H88R	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	88					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)			endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	CCATAGCCAATGAGGACAGGC	0.507																																					p.H88R		Atlas-SNP	.											.	CYP4A11	77	.	0			c.A263G						PASS	.						226.0	178.0	195.0					1																	47403742		2203	4300	6503	SO:0001583	missense	1579	exon2			AGCCAATGAGGAC	L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.263A>G	chr1.hg19:g.47403742T>C	ENSP00000311095:p.His88Arg	132.0	0.0	.		122.0	40.0	.	NM_000778	Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Missense_Mutation	SNP	ENST00000310638.4	hg19	CCDS543.1	.	.	.	.	.	.	.	.	.	.	-	4.775	0.144108	0.09134	.	.	ENSG00000187048	ENST00000310638;ENST00000371904;ENST00000371905	T;T;T	0.67865	-0.29;-0.29;-0.29	5.51	-6.14	0.02111	.	0.665630	0.13942	N	0.352126	T	0.23649	0.0572	N	0.00648	-1.295	0.09310	N	0.999998	B	0.02656	0.0	B	0.04013	0.001	T	0.38735	-0.9647	10	0.17369	T	0.5	.	6.3399	0.21316	0.5397:0.1961:0.0:0.2642	.	88	Q02928	CP4AB_HUMAN	R	88	ENSP00000311095:H88R;ENSP00000360971:H88R;ENSP00000360972:H88R	ENSP00000311095:H88R	H	-	2	0	CYP4A11	47176329	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-1.790000	0.01759	-1.037000	0.03283	-0.451000	0.05528	CAT	.	.	.	none		0.507	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022022.1	NM_000778	
MYSM1	114803	hgsc.bcm.edu	37	1	59127169	59127169	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr1:59127169A>G	ENST00000472487.1	-	18	2218	c.2179T>C	c.(2179-2181)Ttt>Ctt	p.F727L	MYSM1_ENST00000493821.1_5'UTR	NM_001085487.2	NP_001078956.1	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1	727					chromatin remodeling (GO:0006338)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(7;9.36e-06)					TGTACTTCAAATTTGTAAGGT	0.343																																					p.F727L		Atlas-SNP	.											.	MYSM1	50	.	0			c.T2179C						PASS	.						134.0	120.0	124.0					1																	59127169		1832	4080	5912	SO:0001583	missense	114803	exon18			CTTCAAATTTGTA	AB067502	CCDS41343.1	1p32.1	2009-02-11	2009-02-11		ENSG00000162601	ENSG00000162601			29401	protein-coding gene	gene with protein product		612176				11572484, 17428495, 17707232	Standard	NM_001085487		Approved	KIAA1915	uc009wab.2	Q5VVJ2	OTTHUMG00000009533	ENST00000472487.1:c.2179T>C	chr1.hg19:g.59127169A>G	ENSP00000418734:p.Phe727Leu	67.0	0.0	.		58.0	15.0	.	NM_001085487	A8KA54|B3KX65|Q68DD3|Q6AI53|Q7Z3G8|Q96PX3	Missense_Mutation	SNP	ENST00000472487.1	hg19	CCDS41343.1	.	.	.	.	.	.	.	.	.	.	A	18.42	3.619113	0.66787	.	.	ENSG00000162601	ENST00000472487	T	0.24350	1.86	5.13	5.13	0.70059	.	0.104089	0.64402	D	0.000002	T	0.43700	0.1259	M	0.63843	1.955	0.44694	D	0.997685	D	0.69078	0.997	D	0.75020	0.985	T	0.23655	-1.0182	10	0.15952	T	0.53	-16.8799	12.8107	0.57637	1.0:0.0:0.0:0.0	.	727	Q5VVJ2	MYSM1_HUMAN	L	727	ENSP00000418734:F727L	ENSP00000418734:F727L	F	-	1	0	MYSM1	58899757	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.045000	0.64220	2.158000	0.67659	0.377000	0.23210	TTT	.	.	.	none		0.343	MYSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026343.2	XM_055481	
CCDC18	343099	hgsc.bcm.edu	37	1	93671122	93671122	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr1:93671122A>G	ENST00000343253.7	+	8	1353	c.851A>G	c.(850-852)aAt>aGt	p.N284S	CCDC18_ENST00000401026.3_Missense_Mutation_p.N284S|CCDC18_ENST00000338949.4_Missense_Mutation_p.N83S|CCDC18_ENST00000334652.5_5'UTR|CCDC18_ENST00000557479.1_Missense_Mutation_p.N402S			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	284										breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		GAAAAAGAAAATAAAAGGCTA	0.289																																					p.N284S		Atlas-SNP	.											.	CCDC18	93	.	0			c.A851G						PASS	.						61.0	61.0	61.0					1																	93671122		1800	4053	5853	SO:0001583	missense	343099	exon8			AAGAAAATAAAAG			1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.851A>G	chr1.hg19:g.93671122A>G	ENSP00000343377:p.Asn284Ser	351.0	0.0	.		334.0	95.0	.	NM_206886	Q6ZU17	Missense_Mutation	SNP	ENST00000343253.7	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.67|15.67	2.902271|2.902271	0.52227|0.52227	.|.	.|.	ENSG00000122483|ENSG00000122483	ENST00000370276|ENST00000343253;ENST00000401026;ENST00000557479;ENST00000338949;ENST00000455267	.|.	.|.	.|.	5.84|5.84	5.84|5.84	0.93424|0.93424	.|.	.|0.169095	.|0.50627	.|D	.|0.000110	T|T	0.30293|0.30293	0.0760|0.0760	L|L	0.51422|0.51422	1.61|1.61	0.80722|0.80722	D|D	1|1	.|P	.|0.47910	.|0.902	.|B	.|0.43301	.|0.415	T|T	0.19484|0.19484	-1.0304|-1.0304	5|9	.|0.09084	.|T	.|0.74	.|.	12.0845|12.0845	0.53690|0.53690	0.9314:0.0:0.0686:0.0|0.9314:0.0:0.0686:0.0	.|.	.|402	.|G3V388	.|.	V|S	338|284;284;402;83;4	.|.	.|ENSP00000344380:N83S	I|N	+|+	1|2	0|0	CCDC18|CCDC18	93443710|93443710	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.918000|0.918000	0.54935|0.54935	2.192000|2.192000	0.42649|0.42649	2.234000|2.234000	0.73211|0.73211	0.528000|0.528000	0.53228|0.53228	ATA|AAT	.	.	.	none		0.289	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000382327.1	NM_206886	
OLFML2B	25903	hgsc.bcm.edu	37	1	161989728	161989728	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr1:161989728G>T	ENST00000294794.3	-	2	842	c.419C>A	c.(418-420)gCa>gAa	p.A140E	OLFML2B_ENST00000367940.2_Missense_Mutation_p.A140E	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	140					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			CTGGCTGTCTGCCTCCCGCAG	0.577																																					p.A140E		Atlas-SNP	.											.	OLFML2B	114	.	0			c.C419A						PASS	.						52.0	51.0	51.0					1																	161989728		2203	4300	6503	SO:0001583	missense	25903	exon2			CTGTCTGCCTCCC	BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.419C>A	chr1.hg19:g.161989728G>T	ENSP00000294794:p.Ala140Glu	68.0	0.0	.		64.0	13.0	.	NM_015441	B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Missense_Mutation	SNP	ENST00000294794.3	hg19	CCDS1236.1	.	.	.	.	.	.	.	.	.	.	G	12.71	2.018710	0.35606	.	.	ENSG00000162745	ENST00000294794;ENST00000367940	T;T	0.49139	0.79;0.79	4.64	3.72	0.42706	.	.	.	.	.	T	0.39009	0.1062	L	0.43923	1.385	0.32334	N	0.560703	D;D	0.59767	0.961;0.986	P;P	0.53062	0.454;0.717	T	0.39702	-0.9601	8	0.56958	D	0.05	.	13.9466	0.64089	0.084:0.0:0.916:0.0	.	140;140	F2Z3N3;Q68BL8	.;OLM2B_HUMAN	E	140	ENSP00000294794:A140E;ENSP00000356917:A140E	ENSP00000294794:A140E	A	-	2	0	OLFML2B	160256352	1.000000	0.71417	0.739000	0.30968	0.577000	0.36160	7.202000	0.77856	0.694000	0.31654	-1.134000	0.01955	GCA	.	.	.	none		0.577	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060552.2	NM_015441	
DYRK3	8444	hgsc.bcm.edu	37	1	206821237	206821237	+	Silent	SNP	C	C	A			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr1:206821237C>A	ENST00000367109.2	+	3	862	c.694C>A	c.(694-696)Cga>Aga	p.R232R	DYRK3_ENST00000367106.1_Silent_p.R212R|DYRK3_ENST00000367108.3_Silent_p.R212R|DYRK3_ENST00000489878.1_Intron	NM_003582.2	NP_003573.2	O43781	DYRK3_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3	232	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				erythrocyte differentiation (GO:0030218)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)|skin(1)|stomach(2)	25	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			TCACAAACTTCGACAGTACGT	0.468																																					p.R232R	Melanoma(164;427 2622 26826 51707)	Atlas-SNP	.											DYRK3_ENST00000367109,NS,carcinoma,0,3	DYRK3	146	.	0			c.C694A						PASS	.						72.0	68.0	69.0					1																	206821237		2203	4300	6503	SO:0001819	synonymous_variant	8444	exon3			AAACTTCGACAGT	Y12735	CCDS30999.1, CCDS31000.1	1q32	2008-07-18			ENSG00000143479	ENSG00000143479	2.7.12.1		3094	protein-coding gene	gene with protein product	"""regulatory erythroid kinase"", ""dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 5"", ""protein kinase Dyrk3"""	603497				9748265	Standard	NM_003582		Approved	RED, REDK, hYAK3-2	uc001hej.3	O43781	OTTHUMG00000036339	ENST00000367109.2:c.694C>A	chr1.hg19:g.206821237C>A		138.0	0.0	.		152.0	42.0	.	NM_003582	D3DT79|Q7Z752|Q9HBY6|Q9HBY7	Silent	SNP	ENST00000367109.2	hg19	CCDS30999.1																																																																																			.	.	.	none		0.468	DYRK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088458.1	NM_003582	
IHH	3549	hgsc.bcm.edu	37	2	219920563	219920563	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr2:219920563C>A	ENST00000295731.6	-	3	601	c.602G>T	c.(601-603)gGc>gTc	p.G201V	MIR3131_ENST00000583592.1_RNA	NM_002181.3	NP_002172.2	Q14623	IHH_HUMAN	indian hedgehog	201					bone resorption (GO:0045453)|camera-type eye photoreceptor cell fate commitment (GO:0060220)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-cell signaling (GO:0007267)|chondrocyte proliferation (GO:0035988)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint development (GO:0072498)|epithelial cell morphogenesis (GO:0003382)|epithelial cell-cell adhesion (GO:0090136)|head morphogenesis (GO:0060323)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|intein-mediated protein splicing (GO:0016539)|maternal process involved in female pregnancy (GO:0060135)|multicellular organism growth (GO:0035264)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of eye pigmentation (GO:0048074)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell differentiation in thymus (GO:0033085)|neuron development (GO:0048666)|osteoblast differentiation (GO:0001649)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteoglycan metabolic process (GO:0006029)|regulation of growth (GO:0040008)|response to estradiol (GO:0032355)|retinal pigment epithelium development (GO:0003406)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|smoothened signaling pathway (GO:0007224)|somite development (GO:0061053)|vitelline membrane formation (GO:0030704)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|patched binding (GO:0005113)|peptidase activity (GO:0008233)			breast(1)|endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	14		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000188)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAAGCAGCCGCCCGTCTTGGC	0.667																																					p.G201V		Atlas-SNP	.											.	IHH	33	.	0			c.G602T						PASS	.						17.0	18.0	18.0					2																	219920563		2198	4295	6493	SO:0001583	missense	3549	exon3			CAGCCGCCCGTCT	L38517	CCDS33380.1	2q33-q35	2013-02-15	2013-02-15		ENSG00000163501	ENSG00000163501			5956	protein-coding gene	gene with protein product		600726	"""Indian hedgehog (Drosophila) homolog"", ""Indian hedgehog homolog (Drosophila)"""			7590746, 14770182	Standard	NM_002181		Approved	HHG2, BDA1	uc002vjo.2	Q14623	OTTHUMG00000154631	ENST00000295731.6:c.602G>T	chr2.hg19:g.219920563C>A	ENSP00000295731:p.Gly201Val	44.0	0.0	.		37.0	13.0	.	NM_002181	B9EGM5|O43322|Q8N4B9	Missense_Mutation	SNP	ENST00000295731.6	hg19	CCDS33380.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.783324	0.90282	.	.	ENSG00000163501	ENST00000295731	D	0.99483	-5.99	5.29	5.29	0.74685	Hedgehog/intein hint, N-terminal (1);Peptidase C46, hedgehog protein, hint region (1);	0.155258	0.56097	D	0.000023	D	0.99569	0.9845	M	0.87456	2.885	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.98302	1.0519	10	0.66056	D	0.02	-7.1352	18.5642	0.91112	0.0:1.0:0.0:0.0	.	201	Q14623	IHH_HUMAN	V	201	ENSP00000295731:G201V	ENSP00000295731:G201V	G	-	2	0	IHH	219628807	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	7.729000	0.84864	2.469000	0.83416	0.561000	0.74099	GGC	.	.	.	none		0.667	IHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336408.2	NM_002181	
ATG4B	23192	hgsc.bcm.edu	37	2	242611647	242611647	+	Nonsense_Mutation	SNP	G	G	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr2:242611647G>T	ENST00000404914.3	+	13	1253	c.1150G>T	c.(1150-1152)Gaa>Taa	p.E384*	ATG4B_ENST00000396411.3_Nonsense_Mutation_p.E310*|ATG4B_ENST00000402096.1_Nonsense_Mutation_p.E322*|ATG4B_ENST00000405546.3_3'UTR|ATG4B_ENST00000474739.2_Nonsense_Mutation_p.E370*	NM_013325.4|NM_178326.2	NP_037457.3|NP_847896.1	Q9Y4P1	ATG4B_HUMAN	autophagy related 4B, cysteine peptidase	384					autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|positive regulation of autophagy (GO:0010508)|positive regulation of protein catabolic process (GO:0045732)|protein transport (GO:0015031)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	cysteine-type peptidase activity (GO:0008234)|endopeptidase activity (GO:0004175)			breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.44e-33)|all cancers(36;5.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.75e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0848)		CTTCGACTCAGAAGATGAAGA	0.537																																					p.E384X	Melanoma(78;458 1323 6342 12171 39523)	Atlas-SNP	.											.	ATG4B	35	.	0			c.G1150T						PASS	.						94.0	92.0	93.0					2																	242611647		1916	4102	6018	SO:0001587	stop_gained	23192	exon13			GACTCAGAAGATG	AB023160	CCDS46564.1, CCDS46565.1	2q37.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000168397	ENSG00000168397			20790	protein-coding gene	gene with protein product		611338	"""APG4 autophagy 4 homolog B (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog B (S. cerevisiae)"""	APG4B		12446702	Standard	NM_013325		Approved	Apg4B, KIAA0943, DKFZp586D1822, AUTL1	uc002wbv.3	Q9Y4P1	OTTHUMG00000151514	ENST00000404914.3:c.1150G>T	chr2.hg19:g.242611647G>T	ENSP00000384259:p.Glu384*	73.0	0.0	.		89.0	20.0	.	NM_013325	B7WNK2|Q53NU4|Q6ZUV8|Q8WYM9|Q96K07|Q96K96|Q96SZ1|Q9Y2F2	Nonsense_Mutation	SNP	ENST00000404914.3	hg19	CCDS46564.1	.	.	.	.	.	.	.	.	.	.	G	38	7.119008	0.98077	.	.	ENSG00000168397	ENST00000337606;ENST00000402096;ENST00000404914;ENST00000474739;ENST00000396411	.	.	.	5.55	4.66	0.58398	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-3.9894	15.725	0.77747	0.0:0.0:0.8623:0.1377	.	.	.	.	X	501;322;384;370;310	.	ENSP00000336547:E501X	E	+	1	0	ATG4B	242260320	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.660000	0.91121	1.326000	0.45319	0.655000	0.94253	GAA	.	.	.	none		0.537	ATG4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322967.3	NM_013325	
FBLN2	2199	hgsc.bcm.edu	37	3	13672240	13672240	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr3:13672240G>A	ENST00000295760.7	+	14	2938	c.2869G>A	c.(2869-2871)Gcc>Acc	p.A957T	FBLN2_ENST00000535798.1_Missense_Mutation_p.A983T|FBLN2_ENST00000404922.3_Missense_Mutation_p.A1004T|FBLN2_ENST00000492059.1_Missense_Mutation_p.A1004T	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	957	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CCAGGAGTGTGCCAACATCTA	0.632																																					p.A1004T		Atlas-SNP	.											.	FBLN2	137	.	0			c.G3010A						PASS	.						34.0	40.0	38.0					3																	13672240		2196	4299	6495	SO:0001583	missense	2199	exon15			GAGTGTGCCAACA	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.2869G>A	chr3.hg19:g.13672240G>A	ENSP00000295760:p.Ala957Thr	111.0	0.0	.		109.0	25.0	.	NM_001004019	B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	ENST00000295760.7	hg19	CCDS46762.1	.	.	.	.	.	.	.	.	.	.	G	16.61	3.171629	0.57584	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000492059	D;D;D;D	0.86956	-2.19;-2.17;-2.13;-2.17	5.26	3.42	0.39159	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.115243	0.64402	N	0.000016	T	0.63546	0.2520	N	0.00677	-1.265	0.53688	D	0.999973	B;B;B	0.18166	0.016;0.013;0.026	B;B;B	0.22601	0.04;0.034;0.025	T	0.55398	-0.8147	10	0.34782	T	0.22	.	8.5938	0.33703	0.2416:0.0:0.7584:0.0	.	957;1004;983	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	T	983;1004;957;1004	ENSP00000445705:A983T;ENSP00000384169:A1004T;ENSP00000295760:A957T;ENSP00000420042:A1004T	ENSP00000295760:A957T	A	+	1	0	FBLN2	13647241	1.000000	0.71417	0.928000	0.36995	0.989000	0.77384	4.954000	0.63631	0.573000	0.29400	0.561000	0.74099	GCC	.	.	.	none		0.632	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019	
CMC1	152100	hgsc.bcm.edu	37	3	28361046	28361046	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr3:28361046A>G	ENST00000466830.1	+	4	446	c.247A>G	c.(247-249)Aag>Gag	p.K83E	AZI2_ENST00000295748.3_5'Flank|CMC1_ENST00000469102.1_3'UTR|CMC1_ENST00000423894.1_Missense_Mutation_p.K53E	NM_182523.1	NP_872329.1	Q7Z7K0	COXM1_HUMAN	C-x(9)-C motif containing 1	83						mitochondrion (GO:0005739)	metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)	5						GGAATACCTGAAGGAAAGGGA	0.343																																					p.K83E		Atlas-SNP	.											.	CMC1	9	.	0			c.A247G						PASS	.						77.0	79.0	78.0					3																	28361046		2203	4298	6501	SO:0001583	missense	152100	exon4			TACCTGAAGGAAA	BC052644	CCDS33722.1	3p24.1	2013-10-18	2013-10-18	2008-06-20	ENSG00000187118	ENSG00000187118			28783	protein-coding gene	gene with protein product		615166	"""chromosome 3 open reading frame 68"", ""COX assembly mitochondrial protein 1 homolog (S. cerevisiae)"""	C3orf68		18443040	Standard	NM_182523		Approved	MGC61571	uc003cea.3	Q7Z7K0	OTTHUMG00000155660	ENST00000466830.1:c.247A>G	chr3.hg19:g.28361046A>G	ENSP00000418348:p.Lys83Glu	405.0	0.0	.		356.0	106.0	.	NM_182523	Q68DJ7	Missense_Mutation	SNP	ENST00000466830.1	hg19	CCDS33722.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.64|13.64	2.296267|2.296267	0.40594|0.40594	.|.	.|.	ENSG00000187118|ENSG00000187118	ENST00000418849|ENST00000466830;ENST00000423894	.|T;T	.|0.42513	.|0.97;0.97	5.72|5.72	4.54|4.54	0.55810|0.55810	.|.	.|0.257041	.|0.44483	.|D	.|0.000450	T|T	0.36468|0.36468	0.0968|0.0968	L|L	0.41356|0.41356	1.27|1.27	0.80722|0.80722	D|D	1|1	.|B	.|0.21905	.|0.062	.|B	.|0.27715	.|0.082	T|T	0.09796|0.09796	-1.0658|-1.0658	5|10	.|0.37606	.|T	.|0.19	-11.3586|-11.3586	12.8107|12.8107	0.57637|0.57637	0.8632:0.1368:0.0:0.0|0.8632:0.1368:0.0:0.0	.|.	.|83	.|Q7Z7K0	.|COXAM_HUMAN	G|E	89|83;53	.|ENSP00000418348:K83E;ENSP00000404581:K53E	.|ENSP00000404581:K53E	E|K	+|+	2|1	0|0	CMC1|CMC1	28336050|28336050	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	5.951000|5.951000	0.70273|0.70273	0.960000|0.960000	0.38005|0.38005	0.460000|0.460000	0.39030|0.39030	GAA|AAG	.	.	.	none		0.343	CMC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341087.1	NM_182523	
C3orf67	200844	hgsc.bcm.edu	37	3	58817468	58817468	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr3:58817468C>T	ENST00000482387.1	-	10	1840	c.1744G>A	c.(1744-1746)Gtc>Atc	p.V582I	RP11-147N17.1_ENST00000463703.1_RNA|RP11-147N17.1_ENST00000482372.1_RNA|RP11-147N17.1_ENST00000493123.1_RNA|RP11-147N17.1_ENST00000492031.1_RNA|C3orf67_ENST00000295966.7_Missense_Mutation_p.V456I			Q6ZVT6	CC067_HUMAN	chromosome 3 open reading frame 67	582										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(3)|prostate(2)|skin(1)	19		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		CTTATGCTGACATTACAGTTG	0.537																																					p.V456I		Atlas-SNP	.											.	C3orf67	45	.	0			c.G1366A						PASS	.						189.0	148.0	161.0					3																	58817468		2203	4300	6503	SO:0001583	missense	200844	exon13			TGCTGACATTACA	AK124920	CCDS33776.1	3p14.2	2011-01-25			ENSG00000163689	ENSG00000163689			24763	protein-coding gene	gene with protein product							Standard	NM_198463		Approved	FLJ42117, FLJ42930	uc003dkt.1	Q6ZVT6	OTTHUMG00000159151	ENST00000482387.1:c.1744G>A	chr3.hg19:g.58817468C>T	ENSP00000417122:p.Val582Ile	151.0	0.0	.		147.0	43.0	.	NM_198463	B9EKV6|Q6ZV69	Missense_Mutation	SNP	ENST00000482387.1	hg19		.	.	.	.	.	.	.	.	.	.	C	17.87	3.494293	0.64186	.	.	ENSG00000163689	ENST00000295966;ENST00000482387	T;T	0.20881	2.1;2.04	5.92	5.04	0.67666	.	0.071801	0.56097	D	0.000033	T	0.23532	0.0569	L	0.52759	1.655	0.80722	D	1	P;P	0.51537	0.724;0.946	B;P	0.45610	0.292;0.487	T	0.00402	-1.1762	9	.	.	.	-11.6553	11.7693	0.51949	0.0:0.8666:0.0:0.1334	.	456;582	Q6ZVT6-2;Q6ZVT6	.;CC067_HUMAN	I	456;582	ENSP00000295966:V456I;ENSP00000417122:V582I	.	V	-	1	0	C3orf67	58792508	0.985000	0.35326	0.993000	0.49108	0.996000	0.88848	2.410000	0.44592	2.809000	0.96659	0.467000	0.42956	GTC	.	.	.	none		0.537	C3orf67-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000353803.1	NM_198463	
CASR	846	hgsc.bcm.edu	37	3	121976017	121976017	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr3:121976017C>A	ENST00000490131.1	+	3	647	c.275C>A	c.(274-276)aCg>aAg	p.T92K	CASR_ENST00000296154.5_Missense_Mutation_p.T92K|CASR_ENST00000498619.1_Missense_Mutation_p.T92K	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	92					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.T92M(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CCCAACTTGACGCTGGGATAC	0.443																																					p.T92K		Atlas-SNP	.											CASR,colon,carcinoma,0,2	CASR	190	.	1	Substitution - Missense(1)	lung(1)	c.C275A						PASS	.						118.0	119.0	118.0					3																	121976017		2203	4300	6503	SO:0001583	missense	846	exon3			ACTTGACGCTGGG	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.275C>A	chr3.hg19:g.121976017C>A	ENSP00000418685:p.Thr92Lys	146.0	0.0	.		134.0	48.0	.	NM_001178065	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	hg19	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	C	17.93	3.509339	0.64522	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.83335	-1.71;-1.71;-1.71	5.84	5.84	0.93424	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.89128	0.6627	L	0.58969	1.84	0.80722	D	1	D;D	0.62365	0.991;0.984	P;P	0.62435	0.902;0.779	D	0.89049	0.3454	10	0.62326	D	0.03	.	19.1433	0.93455	0.0:1.0:0.0:0.0	.	92;92	E7ENE0;P41180	.;CASR_HUMAN	K	92	ENSP00000418685:T92K;ENSP00000420194:T92K;ENSP00000296154:T92K	ENSP00000296154:T92K	T	+	2	0	CASR	123458707	1.000000	0.71417	0.992000	0.48379	0.163000	0.22366	5.999000	0.70665	2.760000	0.94817	0.655000	0.94253	ACG	.	.	.	none		0.443	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388	
MAGEF1	64110	hgsc.bcm.edu	37	3	184428718	184428718	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr3:184428718C>A	ENST00000317897.3	-	1	1118	c.892G>T	c.(892-894)Gcc>Tcc	p.A298S		NM_022149.4	NP_071432.2	Q9HAY2	MAGF1_HUMAN	melanoma antigen family F, 1	298						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|urinary_tract(1)	11	all_cancers(143;4.61e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;5.64e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.56e-22)			ctagcactggccctggccctc	0.607																																					p.A298S		Atlas-SNP	.											.	MAGEF1	27	.	0			c.G892T						PASS	.						43.0	42.0	43.0					3																	184428718		2203	4300	6503	SO:0001583	missense	64110	exon1			CACTGGCCCTGGC	AF295378	CCDS3269.1	3q13	2008-02-05			ENSG00000177383	ENSG00000177383			29639	protein-coding gene	gene with protein product		609267				11313144	Standard	NM_022149		Approved		uc003fpa.3	Q9HAY2	OTTHUMG00000156712	ENST00000317897.3:c.892G>T	chr3.hg19:g.184428718C>A	ENSP00000315064:p.Ala298Ser	65.0	0.0	.		72.0	23.0	.	NM_022149	Q9H215	Missense_Mutation	SNP	ENST00000317897.3	hg19	CCDS3269.1	.	.	.	.	.	.	.	.	.	.	C	9.883	1.202224	0.22121	.	.	ENSG00000177383	ENST00000317897	T	0.04406	3.63	3.3	2.42	0.29668	.	1.672500	0.04158	N	0.322526	T	0.06280	0.0162	L	0.48218	1.51	0.09310	N	1	P	0.40970	0.734	B	0.37015	0.239	T	0.36311	-0.9753	10	0.46703	T	0.11	.	6.1885	0.20510	0.0:0.861:0.0:0.139	.	298	Q9HAY2	MAGF1_HUMAN	S	298	ENSP00000315064:A298S	ENSP00000315064:A298S	A	-	1	0	MAGEF1	185911412	0.002000	0.14202	0.005000	0.12908	0.038000	0.13279	1.110000	0.31147	0.968000	0.38212	0.561000	0.74099	GCC	.	.	.	none		0.607	MAGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345417.1	NM_022149	
DGKQ	1609	hgsc.bcm.edu	37	4	960305	960305	+	Silent	SNP	C	C	T	rs373354724		TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr4:960305C>T	ENST00000273814.3	-	12	1450	c.1377G>A	c.(1375-1377)acG>acA	p.T459T	DGKQ_ENST00000502309.1_5'UTR	NM_001347.3	NP_001338.2	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta 110kDa	459	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|protein kinase C signaling (GO:0070528)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to ATP (GO:0033198)|thrombin receptor signaling pathway (GO:0070493)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|phospholipase binding (GO:0043274)			breast(1)|endometrium(2)|kidney(2)|lung(2)|prostate(2)	9			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			CCATCAGCATCGTCCGCTGGA	0.701																																					p.T459T	Esophageal Squamous(17;537 645 4447 26373)	Atlas-SNP	.											.	DGKQ	29	.	0			c.G1377A						PASS	.	C		1,4403	2.1+/-5.4	0,1,2201	45.0	46.0	45.0		1377	-4.7	0.1	4		45	0,8596		0,0,4298	no	coding-synonymous	DGKQ	NM_001347.2		0,1,6499	TT,TC,CC		0.0,0.0227,0.0077		459/943	960305	1,12999	2202	4298	6500	SO:0001819	synonymous_variant	1609	exon12			CAGCATCGTCCGC	L38707	CCDS3342.1	4p16.3	2008-08-29	2002-08-29		ENSG00000145214	ENSG00000145214			2856	protein-coding gene	gene with protein product		601207	"""diacylglycerol kinase, theta (110kD)"""	DAGK4		8617502, 9099683	Standard	NM_001347		Approved	DAGK, DAGK7	uc003gbw.4	P52824	OTTHUMG00000088629	ENST00000273814.3:c.1377G>A	chr4.hg19:g.960305C>T		95.0	0.0	.		103.0	23.0	.	NM_001347	Q6P3W4	Silent	SNP	ENST00000273814.3	hg19	CCDS3342.1	.	.	.	.	.	.	.	.	.	.	C	0.112	-1.137407	0.01742	2.27E-4	0.0	ENSG00000145214	ENST00000509465	.	.	.	3.92	-4.66	0.03329	.	.	.	.	.	T	0.29458	0.0734	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27971	-1.0058	4	.	.	.	.	8.4341	0.32775	0.0:0.6571:0.1026:0.2404	.	.	.	.	Q	406	.	.	R	-	2	0	DGKQ	950305	0.000000	0.05858	0.050000	0.19076	0.016000	0.09150	-3.570000	0.00427	-1.914000	0.01078	-1.851000	0.00568	CGA	.	.	.	weak		0.701	DGKQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000200888.1		
HGFAC	3083	hgsc.bcm.edu	37	4	3443797	3443797	+	Silent	SNP	C	C	G	rs538844201	byFrequency	TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr4:3443797C>G	ENST00000382774.3	+	1	184	c.69C>G	c.(67-69)ctC>ctG	p.L23L	HGFAC_ENST00000511533.1_Silent_p.L23L	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	23					proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		TCCTCCTCCTCCTGCTGCTGC	0.716													C|||	2	0.000399361	0.0008	0.0	5008	,	,		13350	0.0		0.0	False		,,,				2504	0.001				p.L23L		Atlas-SNP	.											HGFAC,NS,carcinoma,0,2	HGFAC	69	.	0			c.C69G						PASS	.						13.0	16.0	15.0					4																	3443797		1723	3604	5327	SO:0001819	synonymous_variant	3083	exon1			CCTCCTCCTGCTG	D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.69C>G	chr4.hg19:g.3443797C>G		57.0	0.0	.		52.0	6.0	.	NM_001528	Q14726|Q2M1W7|Q53X47	Silent	SNP	ENST00000382774.3	hg19	CCDS3369.1																																																																																			.	.	.	none		0.716	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206607.3		
SORCS2	57537	hgsc.bcm.edu	37	4	7691237	7691237	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr4:7691237C>G	ENST00000507866.2	+	11	1622	c.1513C>G	c.(1513-1515)Ctg>Gtg	p.L505V	SORCS2_ENST00000329016.9_Missense_Mutation_p.L333V	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2	505					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						GCACCTGCACCTGCGCTGGGC	0.562																																					p.L505V		Atlas-SNP	.											.	SORCS2	98	.	0			c.C1513G						PASS	.						33.0	37.0	35.0					4																	7691237		2130	4246	6376	SO:0001583	missense	57537	exon11			CTGCACCTGCGCT	AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.1513C>G	chr4.hg19:g.7691237C>G	ENSP00000422185:p.Leu505Val	33.0	0.0	.		26.0	11.0	.	NM_020777	Q9P2L7	Missense_Mutation	SNP	ENST00000507866.2	hg19	CCDS47008.1	.	.	.	.	.	.	.	.	.	.	C	17.16	3.319262	0.60524	.	.	ENSG00000184985	ENST00000507866;ENST00000329016	T;T	0.39406	1.08;1.08	3.24	2.36	0.29203	VPS10 (1);	0.000000	0.64402	D	0.000019	T	0.43233	0.1238	M	0.83223	2.63	0.48087	D	0.999589	P;P	0.48694	0.748;0.914	B;B	0.38842	0.247;0.283	T	0.53401	-0.8444	10	0.66056	D	0.02	.	10.9698	0.47432	0.0:0.9033:0.0:0.0967	.	333;505	B5MED8;Q96PQ0	.;SORC2_HUMAN	V	505;333	ENSP00000422185:L505V;ENSP00000329124:L333V	ENSP00000329124:L333V	L	+	1	2	SORCS2	7742137	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.097000	0.50251	0.655000	0.30866	0.557000	0.71058	CTG	.	.	.	none		0.562	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358685.4	NM_020777	
BOD1L1	259282	hgsc.bcm.edu	37	4	13603230	13603230	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr4:13603230T>C	ENST00000040738.5	-	10	5429	c.5294A>G	c.(5293-5295)aAt>aGt	p.N1765S		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1765						nucleus (GO:0005634)	DNA binding (GO:0003677)										TGGTGCATCATTATCTCCCAG	0.522																																					p.N1765S		Atlas-SNP	.											.	.	.	.	0			c.A5294G						PASS	.						270.0	259.0	263.0					4																	13603230		2203	4300	6503	SO:0001583	missense	259282	exon10			GCATCATTATCTC	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.5294A>G	chr4.hg19:g.13603230T>C	ENSP00000040738:p.Asn1765Ser	77.0	0.0	.		61.0	17.0	.	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	hg19	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	T	6.387	0.439432	0.12104	.	.	ENSG00000038219	ENST00000040738	T	0.09538	2.97	4.81	-3.17	0.05202	.	1.190080	0.05960	N	0.640395	T	0.07369	0.0186	L	0.27053	0.805	0.09310	N	1	B	0.25667	0.131	B	0.25140	0.058	T	0.40961	-0.9535	10	0.38643	T	0.18	-0.5436	5.7719	0.18257	0.0:0.2174:0.396:0.3865	.	1765	Q8NFC6	BOD1L_HUMAN	S	1765	ENSP00000040738:N1765S	ENSP00000040738:N1765S	N	-	2	0	BOD1L	13212328	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.224000	0.17738	-0.717000	0.04955	0.459000	0.35465	AAT	.	.	.	none		0.522	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
STAP1	26228	hgsc.bcm.edu	37	4	68442967	68442967	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr4:68442967C>T	ENST00000265404.2	+	4	435	c.353C>T	c.(352-354)aCa>aTa	p.T118I	STAP1_ENST00000396225.1_Missense_Mutation_p.T118I	NM_012108.2	NP_036240.1	Q9ULZ2	STAP1_HUMAN	signal transducing adaptor family member 1	118	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)				NS(1)|large_intestine(1)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	12						TTCATTCTTACAGTAACAGAG	0.378																																					p.T118I		Atlas-SNP	.											.	STAP1	46	.	0			c.C353T						PASS	.						81.0	74.0	76.0					4																	68442967		2203	4300	6503	SO:0001583	missense	26228	exon4			TTCTTACAGTAAC	AB023483	CCDS3515.1	4q13.2	2013-02-14	2007-08-09		ENSG00000035720	ENSG00000035720		"""SH2 domain containing"""	24133	protein-coding gene	gene with protein product	"""BCR downstream signaling 1"""	604298				10518561, 10679268	Standard	NM_012108		Approved	STAP-1, BRDG1	uc003hde.4	Q9ULZ2	OTTHUMG00000129304	ENST00000265404.2:c.353C>T	chr4.hg19:g.68442967C>T	ENSP00000265404:p.Thr118Ile	261.0	0.0	.		355.0	74.0	.	NM_012108	B2R980	Missense_Mutation	SNP	ENST00000265404.2	hg19	CCDS3515.1	.	.	.	.	.	.	.	.	.	.	C	17.92	3.507469	0.64410	.	.	ENSG00000035720	ENST00000265404;ENST00000396225	T;T	0.30714	1.52;1.52	5.01	5.01	0.66863	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.56262	0.1973	M	0.77103	2.36	0.48762	D	0.999709	D	0.89917	1.0	D	0.87578	0.998	T	0.59547	-0.7434	10	0.87932	D	0	-18.0375	14.0103	0.64493	0.0:1.0:0.0:0.0	.	118	Q9ULZ2	STAP1_HUMAN	I	118	ENSP00000265404:T118I;ENSP00000379527:T118I	ENSP00000265404:T118I	T	+	2	0	STAP1	68125562	1.000000	0.71417	0.998000	0.56505	0.793000	0.44817	3.789000	0.55454	2.764000	0.94973	0.655000	0.94253	ACA	.	.	.	none		0.378	STAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251434.1	NM_012108	
YTHDC1	91746	hgsc.bcm.edu	37	4	69203170	69203170	+	Splice_Site	SNP	T	T	C			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr4:69203170T>C	ENST00000344157.4	-	4	795		c.e4-2		YTHDC1_ENST00000355665.3_Splice_Site|YTHDC1_ENST00000579690.1_Splice_Site	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1						mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						CCCAATTCTCTGATGTTTAAA	0.403																																					.		Atlas-SNP	.											.	YTHDC1	81	.	0			c.460-2A>G						PASS	.						73.0	69.0	70.0					4																	69203170		2203	4300	6503	SO:0001630	splice_region_variant	91746	exon5			ATTCTCTGATGTT	AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.460-2A>G	chr4.hg19:g.69203170T>C		66.0	0.0	.		96.0	24.0	.	NM_133370	Q4W5Q3|Q7Z622|Q8TF35	Splice_Site	SNP	ENST00000344157.4	hg19	CCDS33992.1	.	.	.	.	.	.	.	.	.	.	T	17.67	3.446512	0.63178	.	.	ENSG00000083896	ENST00000344157;ENST00000355665	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8641	0.70401	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	YTHDC1	68885765	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.367000	0.73099	2.097000	0.63578	0.377000	0.23210	.	.	.	.	none		0.403	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370	Intron
FSTL5	56884	hgsc.bcm.edu	37	4	162307261	162307261	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr4:162307261G>T	ENST00000306100.5	-	16	2618	c.2182C>A	c.(2182-2184)Cag>Aag	p.Q728K	FSTL5_ENST00000536695.1_Missense_Mutation_p.Q727K|FSTL5_ENST00000427802.2_Missense_Mutation_p.Q718K|RP11-234O6.2_ENST00000508189.1_RNA|FSTL5_ENST00000379164.4_Missense_Mutation_p.Q727K	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	728						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		AAAGCCTCCTGTATTTCTCCT	0.418																																					p.Q728K		Atlas-SNP	.											.	FSTL5	207	.	0			c.C2182A						PASS	.						87.0	83.0	84.0					4																	162307261		2203	4300	6503	SO:0001583	missense	56884	exon16			CCTCCTGTATTTC	BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.2182C>A	chr4.hg19:g.162307261G>T	ENSP00000305334:p.Gln728Lys	92.0	0.0	.		109.0	49.0	.	NM_020116	E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	hg19	CCDS3802.1	.	.	.	.	.	.	.	.	.	.	G	13.58	2.278192	0.40294	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.28255	1.62;1.62;1.62;1.62	5.76	5.76	0.90799	WD40/YVTN repeat-like-containing domain (1);	0.637840	0.17348	N	0.177509	T	0.18923	0.0454	N	0.16656	0.425	0.22457	N	0.999086	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.13072	-1.0523	10	0.09843	T	0.71	.	13.876	0.63653	0.0:0.0:0.8477:0.1523	.	718;727;728	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	K	728;727;718;727	ENSP00000305334:Q728K;ENSP00000368462:Q727K;ENSP00000389270:Q718K;ENSP00000440409:Q727K	ENSP00000305334:Q728K	Q	-	1	0	FSTL5	162526711	1.000000	0.71417	0.501000	0.27601	0.994000	0.84299	4.802000	0.62539	2.702000	0.92279	0.655000	0.94253	CAG	.	.	.	none		0.418	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116	
MAP3K1	4214	hgsc.bcm.edu	37	5	56161247	56161247	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr5:56161247C>G	ENST00000399503.3	+	5	1116	c.1116C>G	c.(1114-1116)gaC>gaG	p.D372E		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	372					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		AACCTTCAGACCCAATGTTAT	0.318																																					p.D372E		Atlas-SNP	.											.	MAP3K1	355	.	0			c.C1116G						PASS	.						81.0	73.0	75.0					5																	56161247		1806	4073	5879	SO:0001583	missense	4214	exon5			TTCAGACCCAATG	U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.1116C>G	chr5.hg19:g.56161247C>G	ENSP00000382423:p.Asp372Glu	145.0	0.0	.		132.0	29.0	.	NM_005921		Missense_Mutation	SNP	ENST00000399503.3	hg19	CCDS43318.1	.	.	.	.	.	.	.	.	.	.	C	15.18	2.758012	0.49468	.	.	ENSG00000095015	ENST00000399503	T	0.68479	-0.33	5.42	0.882	0.19172	.	0.056041	0.64402	D	0.000002	T	0.72961	0.3526	L	0.52573	1.65	0.44531	D	0.997488	D	0.64830	0.994	D	0.72625	0.978	T	0.72178	-0.4369	10	0.87932	D	0	.	9.7787	0.40634	0.0:0.5535:0.0:0.4465	.	372	Q13233	M3K1_HUMAN	E	372	ENSP00000382423:D372E	ENSP00000382423:D372E	D	+	3	2	MAP3K1	56197004	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	0.513000	0.22770	0.305000	0.22832	0.650000	0.86243	GAC	.	.	.	none		0.318	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132309.2	XM_042066	
MAP3K1	4214	hgsc.bcm.edu	37	5	56161266	56161266	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr5:56161266A>C	ENST00000399503.3	+	5	1135	c.1135A>C	c.(1135-1137)Act>Cct	p.T379P		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	379					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		ATGGAGAAAAACTTTAAAGAA	0.328																																					p.T379P		Atlas-SNP	.											.	MAP3K1	355	.	0			c.A1135C						PASS	.						63.0	57.0	59.0					5																	56161266		1794	4064	5858	SO:0001583	missense	4214	exon5			AGAAAAACTTTAA	U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.1135A>C	chr5.hg19:g.56161266A>C	ENSP00000382423:p.Thr379Pro	140.0	0.0	.		117.0	28.0	.	NM_005921		Missense_Mutation	SNP	ENST00000399503.3	hg19	CCDS43318.1	.	.	.	.	.	.	.	.	.	.	A	14.83	2.651480	0.47362	.	.	ENSG00000095015	ENST00000399503	T	0.69175	-0.38	5.42	5.42	0.78866	.	0.189699	0.44688	N	0.000429	T	0.57902	0.2085	L	0.43152	1.355	0.47819	D	0.999526	D	0.54397	0.966	B	0.41860	0.368	T	0.64339	-0.6431	10	0.87932	D	0	.	10.1654	0.42877	0.9252:0.0:0.0748:0.0	.	379	Q13233	M3K1_HUMAN	P	379	ENSP00000382423:T379P	ENSP00000382423:T379P	T	+	1	0	MAP3K1	56197023	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.286000	0.72665	2.176000	0.68965	0.528000	0.53228	ACT	.	.	.	none		0.328	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132309.2	XM_042066	
ERAP1	51752	hgsc.bcm.edu	37	5	96130824	96130824	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr5:96130824A>T	ENST00000443439.2	-	5	906	c.840T>A	c.(838-840)gaT>gaA	p.D280E	ERAP1_ENST00000296754.3_Missense_Mutation_p.D280E	NM_001040458.1|NM_001198541.1	NP_001035548.1|NP_001185470.1	Q9NZ08	ERAP1_HUMAN	endoplasmic reticulum aminopeptidase 1	280					angiogenesis (GO:0001525)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|fat cell differentiation (GO:0045444)|membrane protein ectodomain proteolysis (GO:0006509)|positive regulation of angiogenesis (GO:0045766)|regulation of blood pressure (GO:0008217)|regulation of innate immune response (GO:0045088)|response to bacterium (GO:0009617)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|interleukin-1, Type II receptor binding (GO:0005151)|interleukin-6 receptor binding (GO:0005138)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|stomach(2)	19		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		CCAGTGCATAATCTGCTTGAT	0.398																																					p.D280E		Atlas-SNP	.											.	ERAP1	59	.	0			c.T840A						PASS	.						74.0	68.0	70.0					5																	96130824		2203	4300	6503	SO:0001583	missense	51752	exon5			TGCATAATCTGCT	AB011097	CCDS4085.1, CCDS47250.1	5q15	2014-04-07			ENSG00000164307	ENSG00000164307			18173	protein-coding gene	gene with protein product	"""aminopeptidase regulator of TNFR1 shedding"", ""adipocyte-derived leucine aminopeptidase"", ""puromycin-insensitive leucyl-specific aminopeptidase"""	606832				10220586, 12189246, 16286653	Standard	NM_001198541		Approved	ARTS-1, A-LAP, PILS-AP, KIAA0525, ERAAP1	uc003kml.3	Q9NZ08	OTTHUMG00000128721	ENST00000443439.2:c.840T>A	chr5.hg19:g.96130824A>T	ENSP00000406304:p.Asp280Glu	91.0	0.0	.		64.0	18.0	.	NM_001198541	O60278|Q6UWY6|Q8NEL4|Q8TAD0|Q9UHF8|Q9UKY2	Missense_Mutation	SNP	ENST00000443439.2	hg19	CCDS47250.1	.	.	.	.	.	.	.	.	.	.	A	5.737	0.320456	0.10845	.	.	ENSG00000164307	ENST00000296754;ENST00000443439;ENST00000414384	T;T	0.02421	4.3;4.3	5.91	2.3	0.28687	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.495676	0.24708	N	0.036252	T	0.01592	0.0051	N	0.16098	0.37	0.29821	N	0.830791	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.09377	0.004;0.004;0.004	T	0.43637	-0.9379	10	0.11182	T	0.66	.	5.5807	0.17248	0.5888:0.1402:0.2711:0.0	.	280;280;280	A8K6H1;Q9NZ08;Q9NZ08-2	.;ERAP1_HUMAN;.	E	280	ENSP00000296754:D280E;ENSP00000406304:D280E	ENSP00000296754:D280E	D	-	3	2	ERAP1	96156580	0.005000	0.15991	0.960000	0.40013	0.987000	0.75469	0.017000	0.13399	0.501000	0.28013	0.528000	0.53228	GAT	.	.	.	none		0.398	ERAP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370699.1	NM_016442	
PCDHB8	56128	hgsc.bcm.edu	37	5	140559171	140559171	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr5:140559171C>G	ENST00000239444.2	+	1	1801	c.1556C>G	c.(1555-1557)tCg>tGg	p.S519W	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	519	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCCTCAGGTCGCTGGACTAC	0.687																																					p.S519W		Atlas-SNP	.											.	PCDHB8	199	.	0			c.C1556G						PASS	.						85.0	138.0	120.0					5																	140559171		2202	4298	6500	SO:0001583	missense	56128	exon1			TCAGGTCGCTGGA	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1556C>G	chr5.hg19:g.140559171C>G	ENSP00000239444:p.Ser519Trp	311.0	0.0	.		381.0	50.0	.	NM_019120	B9EGV1	Missense_Mutation	SNP	ENST00000239444.2	hg19	CCDS4250.1	.	.	.	.	.	.	.	.	.	.	C	12.77	2.037758	0.35989	.	.	ENSG00000120322	ENST00000239444	T	0.01918	4.56	4.22	4.22	0.49857	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.21307	0.0513	H	0.96805	3.885	0.42207	D	0.991799	D	0.76494	0.999	D	0.71414	0.973	T	0.45977	-0.9224	9	0.87932	D	0	.	16.2834	0.82708	0.0:1.0:0.0:0.0	.	519	Q9UN66	PCDB8_HUMAN	W	519	ENSP00000239444:S519W	ENSP00000239444:S519W	S	+	2	0	PCDHB8	140539355	0.544000	0.26441	0.160000	0.22671	0.174000	0.22865	5.765000	0.68834	1.915000	0.55452	0.298000	0.19748	TCG	.	.	.	none		0.687	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120	
PCDHGA3	56112	hgsc.bcm.edu	37	5	140725344	140725344	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr5:140725344G>A	ENST00000253812.6	+	1	1744	c.1744G>A	c.(1744-1746)Gca>Aca	p.A582T	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	582	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCTCGCTCCGCAGAGCCCGG	0.682																																					p.A582T		Atlas-SNP	.											.	PCDHGA3	246	.	0			c.G1744A						PASS	.						77.0	86.0	83.0					5																	140725344		2203	4299	6502	SO:0001583	missense	56112	exon1			CGCTCCGCAGAGC	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1744G>A	chr5.hg19:g.140725344G>A	ENSP00000253812:p.Ala582Thr	121.0	0.0	.		112.0	29.0	.	NM_032011	Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	hg19	CCDS47290.1	.	.	.	.	.	.	.	.	.	.	.	19.07	3.754999	0.69648	.	.	ENSG00000254245	ENST00000253812	T	0.55413	0.52	5.27	5.27	0.74061	Cadherin (3);Cadherin-like (1);	0.000000	0.33005	U	0.005383	T	0.62612	0.2442	M	0.71036	2.16	0.31719	N	0.638499	P;D	0.60160	0.955;0.987	P;P	0.53224	0.538;0.721	T	0.71955	-0.4436	10	0.66056	D	0.02	.	12.3063	0.54904	0.0:0.0:0.7209:0.2791	.	582;582	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	T	582	ENSP00000253812:A582T	ENSP00000253812:A582T	A	+	1	0	PCDHGA3	140705528	0.934000	0.31675	0.999000	0.59377	0.968000	0.65278	1.731000	0.38135	2.636000	0.89361	0.558000	0.71614	GCA	.	.	.	none		0.682	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916	
MXD3	83463	hgsc.bcm.edu	37	5	176734952	176734952	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr5:176734952T>C	ENST00000439742.2	-	5	813	c.335A>G	c.(334-336)cAg>cGg	p.Q112R	MXD3_ENST00000427908.2_Missense_Mutation_p.Q112R|MXD3_ENST00000513063.1_Missense_Mutation_p.Q112R|MXD3_ENST00000423571.2_Missense_Mutation_p.Q112R	NM_031300.3	NP_112590.1	Q9BW11	MAD3_HUMAN	MAX dimerization protein 3	112					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)					all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCGCTGCTCCTGATCCTCCAG	0.711																																					p.Q112R		Atlas-SNP	.											.	MXD3	13	.	0			c.A335G						PASS	.						5.0	5.0	5.0					5																	176734952		2039	4057	6096	SO:0001583	missense	83463	exon5			TGCTCCTGATCCT	BC000745	CCDS4416.1, CCDS47347.1	5q35.3	2013-03-20			ENSG00000213347	ENSG00000213347		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	14008	protein-coding gene	gene with protein product		609450					Standard	NM_031300		Approved	MAD3, bHLHc13	uc003mgb.2	Q9BW11	OTTHUMG00000130854	ENST00000439742.2:c.335A>G	chr5.hg19:g.176734952T>C	ENSP00000401867:p.Gln112Arg	77.0	0.0	.		78.0	26.0	.	NM_001142935	B4E0J1|Q53HK1|Q7Z4Y0|Q8NDJ7|Q96ME3	Missense_Mutation	SNP	ENST00000439742.2	hg19	CCDS4416.1	.	.	.	.	.	.	.	.	.	.	T	19.07	3.756279	0.69648	.	.	ENSG00000213347	ENST00000427908;ENST00000423571;ENST00000439742;ENST00000303165;ENST00000513063;ENST00000513169;ENST00000502529	D;D;D;D;T;T	0.88431	-2.38;-2.38;-2.38;-2.38;0.86;0.86	5.0	5.0	0.66597	Helix-loop-helix DNA-binding (3);	0.000000	0.85682	D	0.000000	D	0.92990	0.7769	M	0.68593	2.085	0.58432	D	0.999999	D;D;D;D	0.71674	0.992;0.998;0.997;0.979	D;D;D;P	0.80764	0.979;0.994;0.986;0.867	D	0.91821	0.5467	10	0.30078	T	0.28	-0.4458	15.0117	0.71555	0.0:0.0:0.0:1.0	.	112;103;112;112	Q9BW11-3;F8W9D2;Q9BW11;B4E0J1	.;.;MAD3_HUMAN;.	R	112;112;112;103;112;29;102	ENSP00000416921:Q112R;ENSP00000389716:Q112R;ENSP00000401867:Q112R;ENSP00000421463:Q112R;ENSP00000427104:Q29R;ENSP00000425029:Q102R	ENSP00000307720:Q103R	Q	-	2	0	MXD3	176667558	1.000000	0.71417	1.000000	0.80357	0.755000	0.42902	4.827000	0.62723	2.007000	0.58848	0.459000	0.35465	CAG	.	.	.	none		0.711	MXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253427.1		
BRD2	6046	hgsc.bcm.edu	37	6	32942389	32942389	+	Missense_Mutation	SNP	C	C	A	rs562023725		TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr6:32942389C>A	ENST00000374825.4	+	3	1881	c.180C>A	c.(178-180)aaC>aaA	p.N60K	BRD2_ENST00000374831.4_Missense_Mutation_p.N60K|BRD2_ENST00000449085.2_Missense_Mutation_p.N13K|BRD2_ENST00000395289.2_Missense_Mutation_p.N60K|BRD2_ENST00000443797.2_5'UTR|BRD2_ENST00000395287.1_Missense_Mutation_p.N60K|XXbac-BPG181M17.6_ENST00000580587.1_RNA	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	60					chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						CCCCTGCCAACCCACCACCCC	0.537																																					p.N60K		Atlas-SNP	.											.	BRD2	70	.	0			c.C180A						PASS	.						79.0	76.0	77.0					6																	32942389		2203	4300	6503	SO:0001583	missense	6046	exon3			TGCCAACCCACCA	X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.180C>A	chr6.hg19:g.32942389C>A	ENSP00000363958:p.Asn60Lys	112.0	0.0	.		132.0	38.0	.	NM_005104	A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Missense_Mutation	SNP	ENST00000374825.4	hg19	CCDS4762.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.33|15.33	2.800419|2.800419	0.50315|0.50315	.|.	.|.	ENSG00000204256|ENSG00000204256	ENST00000374825;ENST00000374831;ENST00000395289;ENST00000395287;ENST00000449085|ENST00000456339;ENST00000449025	T;T;T;T;T|.	0.18174|.	2.23;2.23;2.23;2.23;2.23|.	5.36|5.36	0.465|0.465	0.16711|0.16711	Bromodomain (1);|.	0.000000|.	0.51477|.	D|.	0.000084|.	T|T	0.58821|0.58821	0.2149|0.2149	M|M	0.78344|0.78344	2.41|2.41	0.80722|0.80722	D|D	1|1	P;D|.	0.53885|.	0.828;0.963|.	B;B|.	0.44224|.	0.3;0.444|.	T|T	0.60495|0.60495	-0.7252|-0.7252	10|5	0.19590|.	T|.	0.45|.	-24.1895|-24.1895	9.5375|9.5375	0.39231|0.39231	0.0:0.6248:0.0:0.3752|0.0:0.6248:0.0:0.3752	.|.	60;60|.	A2AAU0;P25440|.	.;BRD2_HUMAN|.	K|N	60;60;60;60;13|62;66	ENSP00000363958:N60K;ENSP00000363964:N60K;ENSP00000378704:N60K;ENSP00000378702:N60K;ENSP00000409145:N13K|.	ENSP00000363958:N60K|.	N|T	+|+	3|2	2|0	BRD2|BRD2	33050367|33050367	0.920000|0.920000	0.31207|0.31207	0.999000|0.999000	0.59377|0.59377	0.933000|0.933000	0.57130|0.57130	0.060000|0.060000	0.14342|0.14342	0.108000|0.108000	0.17862|0.17862	0.643000|0.643000	0.83706|0.83706	AAC|ACC	.	.	.	alt		0.537	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076503.2		
AARS2	57505	hgsc.bcm.edu	37	6	44279883	44279883	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr6:44279883C>T	ENST00000244571.4	-	2	363	c.361G>A	c.(361-363)Gtg>Atg	p.V121M	RP11-444E17.6_ENST00000505802.1_Intron	NM_020745.3	NP_065796			alanyl-tRNA synthetase 2, mitochondrial									p.V121M(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(2)|stomach(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TCTCGACCCACATCTTCCAGG	0.527																																					p.V121M		Atlas-SNP	.											AARS2,NS,carcinoma,0,1	AARS2	77	.	1	Substitution - Missense(1)	prostate(1)	c.G361A						PASS	.						190.0	150.0	163.0					6																	44279883		2203	4300	6503	SO:0001583	missense	57505	exon2			GACCCACATCTTC	AB033096	CCDS34464.1	6p21.1	2012-10-26	2012-10-26	2007-02-23	ENSG00000124608	ENSG00000124608	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	21022	protein-coding gene	gene with protein product	"""alanine tRNA ligase 2, mitochondrial"""	612035	"""alanyl-tRNA synthetase like"", ""alanyl-tRNA synthetase 2, mitochondrial (putative)"""	AARSL		15779907, 21549344	Standard	NM_020745		Approved	KIAA1270, bA444E17.1	uc010jza.1	Q5JTZ9	OTTHUMG00000014766	ENST00000244571.4:c.361G>A	chr6.hg19:g.44279883C>T	ENSP00000244571:p.Val121Met	102.0	0.0	.		108.0	33.0	.	NM_020745		Missense_Mutation	SNP	ENST00000244571.4	hg19	CCDS34464.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.815634	0.90790	.	.	ENSG00000124608	ENST00000244571	D	0.84944	-1.92	4.9	4.9	0.64082	Alanyl-tRNA synthetase, class IIc, core domain (1);Alanyl-tRNA synthetase, class IIc, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95554	0.8555	H	0.98407	4.225	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97295	0.9927	10	0.87932	D	0	-19.9207	18.2752	0.90080	0.0:1.0:0.0:0.0	.	121	Q5JTZ9	SYAM_HUMAN	M	121	ENSP00000244571:V121M	ENSP00000244571:V121M	V	-	1	0	AARS2	44387861	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.651000	0.83577	2.540000	0.85666	0.436000	0.28706	GTG	.	.	.	none		0.527	AARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040741.2	NM_020745	
CDK19	23097	hgsc.bcm.edu	37	6	110943359	110943359	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr6:110943359C>T	ENST00000368911.3	-	11	1221	c.1042G>A	c.(1042-1044)Ggc>Agc	p.G348S	CDK19_ENST00000413605.2_Missense_Mutation_p.G224S|CDK19_ENST00000323817.3_Missense_Mutation_p.G288S	NM_015076.3	NP_055891.1	Q9BWU1	CDK19_HUMAN	cyclin-dependent kinase 19	348							ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)	p.G348C(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)	22						ATCTGGCAGCCGGCAAATACA	0.313																																					p.G348S		Atlas-SNP	.											CDK19,NS,carcinoma,0,1	CDK19	51	.	1	Substitution - Missense(1)	lung(1)	c.G1042A						PASS	.						138.0	144.0	142.0					6																	110943359		2203	4300	6503	SO:0001583	missense	23097	exon11			GGCAGCCGGCAAA	AL122055	CCDS5085.1, CCDS75503.1	6q21	2011-10-25	2009-12-16	2009-12-16	ENSG00000155111	ENSG00000155111		"""Cyclin-dependent kinases"""	19338	protein-coding gene	gene with protein product		614720	"""cyclin-dependent kinase (CDC2-like) 11"", ""cell division cycle 2-like 6 (CDK8-like)"""	CDK11, CDC2L6		10470851, 19884882	Standard	XM_005266871		Approved	KIAA1028, bA346C16.3	uc003puh.1	Q9BWU1	OTTHUMG00000015365	ENST00000368911.3:c.1042G>A	chr6.hg19:g.110943359C>T	ENSP00000357907:p.Gly348Ser	93.0	0.0	.		76.0	22.0	.	NM_015076	Q5JQZ7|Q5JR00|Q8TC78|Q9UPX2	Missense_Mutation	SNP	ENST00000368911.3	hg19	CCDS5085.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.068014	0.76301	.	.	ENSG00000155111	ENST00000368911;ENST00000323817;ENST00000392576;ENST00000413605	T;T;T	0.62639	0.11;0.01;0.41	5.56	5.56	0.83823	Protein kinase-like domain (1);	0.090722	0.85682	D	0.000000	T	0.53433	0.1796	M	0.75615	2.305	0.80722	D	1	B;B	0.33073	0.396;0.343	B;B	0.25614	0.042;0.062	T	0.59899	-0.7367	10	0.51188	T	0.08	-18.5719	19.8942	0.96945	0.0:1.0:0.0:0.0	.	224;348	B4DUB1;Q9BWU1	.;CDK19_HUMAN	S	348;288;287;224	ENSP00000357907:G348S;ENSP00000317665:G288S;ENSP00000410604:G224S	ENSP00000317665:G288S	G	-	1	0	CDK19	111050052	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.367000	0.79558	2.778000	0.95560	0.557000	0.71058	GGC	.	.	.	none		0.313	CDK19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041804.1	NM_015076	
UPP1	7378	hgsc.bcm.edu	37	7	48146603	48146603	+	Silent	SNP	G	G	C	rs567267997		TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr7:48146603G>C	ENST00000331803.4	+	8	1193	c.570G>C	c.(568-570)ctG>ctC	p.L190L	UPP1_ENST00000482015.1_3'UTR|UPP1_ENST00000395564.4_Silent_p.L190L|UPP1_ENST00000429491.2_Silent_p.L53L|UPP1_ENST00000341253.4_Silent_p.L190L			Q16831	UPP1_HUMAN	uridine phosphorylase 1	190					cellular response to glucose starvation (GO:0042149)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)	uridine phosphorylase activity (GO:0004850)			breast(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	18					Fluorouracil(DB00544)	TGCAGGAGCTGTTGCTGTGTT	0.552													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21337	0.0		0.0	False		,,,				2504	0.0				p.L190L		Atlas-SNP	.											.	UPP1	35	.	0			c.G570C						PASS	.						128.0	117.0	121.0					7																	48146603		2203	4300	6503	SO:0001819	synonymous_variant	7378	exon7			GGAGCTGTTGCTG	AK096167	CCDS5507.1	7p12.3	2012-10-02	2003-08-28	2003-08-29	ENSG00000183696	ENSG00000183696	2.4.2.3		12576	protein-coding gene	gene with protein product		191730	"""uridine phosphorylase"""	UP		752472, 11807789	Standard	NM_003364		Approved	UPASE, UPP, UDRPASE	uc003toj.3	Q16831	OTTHUMG00000129253	ENST00000331803.4:c.570G>C	chr7.hg19:g.48146603G>C		50.0	0.0	.		87.0	23.0	.	NM_003364	D3DVM4|Q15362	Silent	SNP	ENST00000331803.4	hg19	CCDS5507.1																																																																																			.	.	.	none		0.552	UPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251360.1	NM_003364	
C7orf72	100130988	hgsc.bcm.edu	37	7	50175730	50175730	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr7:50175730T>G	ENST00000297001.6	+	5	954	c.904T>G	c.(904-906)Tct>Gct	p.S302A		NM_001161834.2	NP_001155306	A4D263	CG072_HUMAN	chromosome 7 open reading frame 72	302										NS(1)|breast(1)|endometrium(2)|kidney(1)|lung(1)|ovary(1)|prostate(2)	9						TCAAACAAGATCTTTCTTGGC	0.338																																					p.S302A		Atlas-SNP	.											.	C7orf72	26	.	0			c.T904G						PASS	.						328.0	282.0	296.0					7																	50175730		692	1591	2283	SO:0001583	missense	100130988	exon5			ACAAGATCTTTCT		CCDS47585.1	7p12.2	2009-10-15			ENSG00000164500	ENSG00000164500			22564	protein-coding gene	gene with protein product							Standard	NM_001161834		Approved		uc011kcj.2	A4D263	OTTHUMG00000155883	ENST00000297001.6:c.904T>G	chr7.hg19:g.50175730T>G	ENSP00000297001:p.Ser302Ala	104.0	0.0	.		128.0	21.0	.	NM_001161834	A6NDX9	Missense_Mutation	SNP	ENST00000297001.6	hg19	CCDS47585.1	.	.	.	.	.	.	.	.	.	.	T	11.11	1.543560	0.27563	.	.	ENSG00000164500	ENST00000297001	.	.	.	5.87	3.55	0.40652	.	1.203520	0.05947	N	0.638184	T	0.27063	0.0663	L	0.38175	1.15	0.20196	N	0.999929	P	0.35872	0.525	B	0.36092	0.217	T	0.16041	-1.0416	9	0.07813	T	0.8	.	6.6576	0.22996	0.0:0.1794:0.0:0.8206	.	302	A4D263	CG072_HUMAN	A	302	.	ENSP00000297001:S302A	S	+	1	0	C7orf72	50146276	0.737000	0.28175	0.998000	0.56505	0.907000	0.53573	0.753000	0.26376	1.049000	0.40321	0.523000	0.50628	TCT	.	.	.	none		0.338	C7orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342124.1	NM_001161834	
UPK3B	80761	hgsc.bcm.edu	37	7	76140096	76140096	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr7:76140096G>T	ENST00000257632.5	+	1	255	c.127G>T	c.(127-129)Ggg>Tgg	p.G43W	UPK3B_ENST00000419923.2_Missense_Mutation_p.G43W|UPK3B_ENST00000334348.3_Intron|UPK3B_ENST00000394849.1_Intron|UPK3B_ENST00000443097.2_Intron|UPK3B_ENST00000448265.3_Missense_Mutation_p.G43W			Q9BT76	UPK3B_HUMAN	uroplakin 3B	43					negative regulation of gene expression (GO:0010629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(1)|skin(2)	8		Myeloproliferative disorder(862;0.204)				CCAGACCCAAGGGGCTGGGGG	0.706																																					p.G43W		Atlas-SNP	.											.	UPK3B	15	.	0			c.G127T						PASS	.						13.0	16.0	15.0					7																	76140096		2196	4298	6494	SO:0001583	missense	80761	exon1			ACCCAAGGGGCTG	BC004304	CCDS5588.1, CCDS5589.1, CCDS64693.1	7q11.2	2003-07-29			ENSG00000243566	ENSG00000243566			21444	protein-coding gene	gene with protein product	"""uroplakin IIIb"""	611887				12446744	Standard	XM_005250612		Approved	MGC10902, p35, UPIIIb, FLJ32198	uc003ufq.3	Q9BT76	OTTHUMG00000149929	ENST00000257632.5:c.127G>T	chr7.hg19:g.76140096G>T	ENSP00000257632:p.Gly43Trp	152.0	0.0	.		174.0	51.0	.	NM_030570	A6NHH5|A8K231|A8MZA8|B3KPU5|Q75MM5|Q86W06	Missense_Mutation	SNP	ENST00000257632.5	hg19	CCDS5588.1	.	.	.	.	.	.	.	.	.	.	.	19.45	3.829710	0.71258	.	.	ENSG00000243566	ENST00000419923;ENST00000448265;ENST00000257632	T;T;T	0.44482	0.92;0.92;0.92	4.3	0.385	0.16249	.	.	.	.	.	T	0.38931	0.1059	N	0.08118	0	0.09310	N	0.999999	D	0.89917	1.0	D	0.78314	0.991	T	0.27400	-1.0075	9	0.87932	D	0	-1.0315	7.1484	0.25595	0.4081:0.0:0.5919:0.0	.	43	Q9BT76	UPK3B_HUMAN	W	43	ENSP00000441602:G43W;ENSP00000441284:G43W;ENSP00000257632:G43W	ENSP00000257632:G43W	G	+	1	0	UPK3B	75978032	0.005000	0.15991	0.002000	0.10522	0.697000	0.40408	-0.267000	0.08619	0.167000	0.19631	0.407000	0.27541	GGG	.	.	.	none		0.706	UPK3B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000313978.2	NM_030570	
CSMD1	64478	hgsc.bcm.edu	37	8	3046428	3046428	+	Missense_Mutation	SNP	G	G	A	rs374772217		TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr8:3046428G>A	ENST00000520002.1	-	36	6062	c.5507C>T	c.(5506-5508)aCg>aTg	p.T1836M	CSMD1_ENST00000539096.1_Missense_Mutation_p.T1835M|CSMD1_ENST00000542608.1_Missense_Mutation_p.T1835M|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000537824.1_Missense_Mutation_p.T1835M|CSMD1_ENST00000602723.1_Missense_Mutation_p.T1836M|CSMD1_ENST00000602557.1_Missense_Mutation_p.T1836M|CSMD1_ENST00000400186.3_Missense_Mutation_p.T1836M			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1836	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CGAGCCCTCCGTAACTATGAT	0.483																																					p.T1835M		Atlas-SNP	.											CSMD1_ENST00000537824,NS,carcinoma,0,2	CSMD1	1469	.	0			c.C5504T						PASS	.						59.0	56.0	57.0					8																	3046428		1884	4103	5987	SO:0001583	missense	64478	exon35			CCCTCCGTAACTA			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.5507C>T	chr8.hg19:g.3046428G>A	ENSP00000430733:p.Thr1836Met	129.0	1.0	.		134.0	9.0	.	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	hg19		.	.	.	.	.	.	.	.	.	.	G	11.59	1.683295	0.29872	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.60548	0.18;0.18;0.18;0.18;0.18	5.53	5.53	0.82687	CUB (5);	0.136796	0.49305	D	0.000155	T	0.69708	0.3141	L	0.46614	1.455	0.09310	N	0.999999	D;B;D	0.61697	0.99;0.133;0.976	P;B;P	0.61397	0.888;0.425;0.888	T	0.64428	-0.6410	10	0.66056	D	0.02	.	19.4679	0.94950	0.0:0.0:1.0:0.0	.	1836;1836;1836	E5RIG2;Q96PZ7;Q96PZ7-4	.;CSMD1_HUMAN;.	M	1836;1836;1698;1835;1835;1835	ENSP00000383047:T1836M;ENSP00000430733:T1836M;ENSP00000441462:T1835M;ENSP00000446243:T1835M;ENSP00000441675:T1835M	ENSP00000320445:T1698M	T	-	2	0	CSMD1	3033835	1.000000	0.71417	0.006000	0.13384	0.054000	0.15201	5.984000	0.70548	2.582000	0.87167	0.637000	0.83480	ACG	.	.	.	alt		0.483	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
BHLHE22	27319	hgsc.bcm.edu	37	8	65494023	65494023	+	Missense_Mutation	SNP	A	A	G	rs62519837		TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr8:65494023A>G	ENST00000321870.1	+	1	1210	c.676A>G	c.(676-678)Agc>Ggc	p.S226G	RP11-21C4.1_ENST00000517909.1_RNA	NM_152414.4	NP_689627.1	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix family, member e22	226	Ser-rich.				anterior commissure morphogenesis (GO:0021960)|cerebral cortex regionalization (GO:0021796)|corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|retinal bipolar neuron differentiation (GO:0060040)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.S234delS(1)|p.S226G(1)		NS(1)|central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	5						cagcggcggcagcagcagcag	0.706																																					p.S226G	Colon(113;104 1586 2865 9855 18065)	Atlas-SNP	.											BHLHE22,extremity,malignant_melanoma,0,1	BHLHE22	21	.	2	Substitution - Missense(1)|Deletion - In frame(1)	central_nervous_system(1)|skin(1)	c.A676G						PASS	.						3.0	4.0	4.0					8																	65494023		1652	3428	5080	SO:0001583	missense	27319	exon1			GGCGGCAGCAGCA	U80755	CCDS6179.1	8q12.1	2009-01-12	2009-01-12	2009-01-12		ENSG00000180828		"""Basic helix-loop-helix proteins"""	11963	protein-coding gene	gene with protein product		613483	"""trinucleotide repeat containing 20"", ""basic helix-loop-helix domain containing, class B, 5"""	TNRC20, BHLHB5		9225980, 12213201, 18557763	Standard	NM_152414		Approved	CAGL85, Beta3, bHLHe22	uc003xvi.3	Q8NFJ8		ENST00000321870.1:c.676A>G	chr8.hg19:g.65494023A>G	ENSP00000318799:p.Ser226Gly	24.0	1.0	.		26.0	5.0	.	NM_152414		Missense_Mutation	SNP	ENST00000321870.1	hg19	CCDS6179.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-3.714868	0.00005	.	.	ENSG00000180828	ENST00000321870	T	0.80033	-1.33	0.79	-1.26	0.09376	.	.	.	.	.	T	0.48642	0.1511	N	0.00926	-1.1	0.09310	N	1	B	0.26041	0.14	B	0.32805	0.153	T	0.47368	-0.9123	9	0.15499	T	0.54	.	3.5404	0.07809	0.3747:0.0:0.6253:0.0	rs62519837	226	Q8NFJ8	BHE22_HUMAN	G	226	ENSP00000318799:S226G	ENSP00000318799:S226G	S	+	1	0	BHLHE22	65656577	0.273000	0.24181	0.215000	0.23724	0.107000	0.19398	-0.535000	0.06142	-0.333000	0.08476	0.136000	0.15936	AGC	.	G|1.000;|0.000	1.000	weak		0.706	BHLHE22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378549.1	NM_152414	
RECK	8434	hgsc.bcm.edu	37	9	36058855	36058855	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr9:36058855A>T	ENST00000377966.3	+	3	757	c.191A>T	c.(190-192)aAa>aTa	p.K64I	RECK_ENST00000479053.1_3'UTR	NM_021111.2	NP_066934.1	O95980	RECK_HUMAN	reversion-inducing-cysteine-rich protein with kazal motifs	64	5 X Knot repeats.				blood vessel maturation (GO:0001955)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			TCCCGACTAAAACATCTGTTG	0.328																																					p.K64I		Atlas-SNP	.											.	RECK	73	.	0			c.A191T						PASS	.						73.0	76.0	75.0					9																	36058855		2203	4300	6503	SO:0001583	missense	8434	exon3			GACTAAAACATCT	E13833	CCDS6597.1	9p13.3	2008-05-15			ENSG00000122707	ENSG00000122707			11345	protein-coding gene	gene with protein product		605227		ST15		9789069	Standard	NM_021111		Approved	hRECK	uc003zyv.3	O95980	OTTHUMG00000019898	ENST00000377966.3:c.191A>T	chr9.hg19:g.36058855A>T	ENSP00000367202:p.Lys64Ile	69.0	0.0	.		51.0	15.0	.	NM_021111	B2RNS1|Q5W0K6|Q8WX37	Missense_Mutation	SNP	ENST00000377966.3	hg19	CCDS6597.1	.	.	.	.	.	.	.	.	.	.	A	15.70	2.911043	0.52439	.	.	ENSG00000122707	ENST00000377966	T	0.47528	0.84	5.75	4.41	0.53225	.	0.053124	0.64402	D	0.000001	T	0.40040	0.1101	N	0.14661	0.345	0.38896	D	0.957211	P;P;P	0.52316	0.952;0.61;0.911	P;B;P	0.52267	0.694;0.265;0.653	T	0.45041	-0.9288	10	0.66056	D	0.02	-20.6618	10.0337	0.42116	0.9083:0.0:0.0917:0.0	.	64;64;64	B2RCE6;O95980;Q6P9E2	.;RECK_HUMAN;.	I	64	ENSP00000367202:K64I	ENSP00000367202:K64I	K	+	2	0	RECK	36048855	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.883000	0.56168	2.196000	0.70406	0.402000	0.26972	AAA	.	.	.	none		0.328	RECK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052409.1		
DOLK	22845	hgsc.bcm.edu	37	9	131709023	131709023	+	Missense_Mutation	SNP	C	C	T	rs377658203		TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr9:131709023C>T	ENST00000372586.3	-	1	875	c.560G>A	c.(559-561)cGc>cAc	p.R187H	RP11-101E3.5_ENST00000482796.1_Intron|NUP188_ENST00000372577.2_5'Flank	NM_014908.3	NP_055723.1	Q9UPQ8	DOLK_HUMAN	dolichol kinase	187					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|dolichyl monophosphate biosynthetic process (GO:0043048)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	dolichol kinase activity (GO:0004168)	p.R187H(1)		breast(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	11						GGTGAAGCAGCGGGGCAGCAG	0.542																																					p.R187H		Atlas-SNP	.											DOLK,caecum,carcinoma,0,1	DOLK	39	.	1	Substitution - Missense(1)	large_intestine(1)	c.G560A						PASS	.						83.0	81.0	82.0					9																	131709023		2203	4300	6503	SO:0001583	missense	22845	exon1			AAGCAGCGGGGCA	AB029017	CCDS6915.1	9q34.13	2014-09-17	2007-02-09	2007-02-09	ENSG00000175283	ENSG00000175283			23406	protein-coding gene	gene with protein product	"""dolichol kinase 1"""	610746	"""transmembrane protein 15"""	TMEM15		12975309, 16923818	Standard	NM_014908		Approved	KIAA1094, DK1	uc004bwr.3	Q9UPQ8	OTTHUMG00000020765	ENST00000372586.3:c.560G>A	chr9.hg19:g.131709023C>T	ENSP00000361667:p.Arg187His	51.0	0.0	.		40.0	9.0	.	NM_014908	Q5SRE6	Missense_Mutation	SNP	ENST00000372586.3	hg19	CCDS6915.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.375916	0.82682	.	.	ENSG00000175283	ENST00000372586;ENST00000515348	D	0.90620	-2.7	5.07	5.07	0.68467	.	0.000000	0.64402	D	0.000005	D	0.94430	0.8208	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.93720	0.7032	10	0.38643	T	0.18	-0.0738	17.4448	0.87575	0.0:1.0:0.0:0.0	.	187	Q9UPQ8	DOLK_HUMAN	H	187	ENSP00000361667:R187H	ENSP00000361667:R187H	R	-	2	0	DOLK	130748844	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.487000	0.81328	2.327000	0.79052	0.462000	0.41574	CGC	.	.	.	alt		0.542	DOLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054515.1	NM_014908	
GTF3C4	9329	hgsc.bcm.edu	37	9	135546223	135546223	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr9:135546223G>C	ENST00000372146.4	+	1	802	c.238G>C	c.(238-240)Gtg>Ctg	p.V80L	DDX31_ENST00000372153.1_5'Flank|DDX31_ENST00000544003.1_5'Flank|DDX31_ENST00000480876.1_5'Flank|DDX31_ENST00000372159.3_5'Flank|DDX31_ENST00000310532.2_5'Flank|GTF3C4_ENST00000483873.2_Missense_Mutation_p.V80L	NM_012204.2	NP_036336.2	Q9UKN8	TF3C4_HUMAN	general transcription factor IIIC, polypeptide 4, 90kDa	80					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|positive regulation of catalytic activity (GO:0043085)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)|enzyme activator activity (GO:0008047)|histone acetyltransferase activity (GO:0004402)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;8.15e-07)|Epithelial(140;2.6e-05)		CCGCGTGTCTGTGTCCACGGC	0.677																																					p.V80L	Pancreas(142;417 1875 11086 31973 47667)	Atlas-SNP	.											.	GTF3C4	53	.	0			c.G238C						PASS	.						23.0	26.0	25.0					9																	135546223		2200	4297	6497	SO:0001583	missense	9329	exon1			GTGTCTGTGTCCA	AF142328	CCDS6953.1	9q34.3	2011-07-01	2002-08-29		ENSG00000125484	ENSG00000125484		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""General transcription factors"""	4667	protein-coding gene	gene with protein product		604892	"""general transcription factor IIIC, polypeptide 4 (90kD)"""			10523658	Standard	NM_012204		Approved	TFIIIC90, KAT12	uc010mzv.3	Q9UKN8	OTTHUMG00000020842	ENST00000372146.4:c.238G>C	chr9.hg19:g.135546223G>C	ENSP00000361219:p.Val80Leu	62.0	0.0	.		74.0	18.0	.	NM_012204	Q5VZJ7	Missense_Mutation	SNP	ENST00000372146.4	hg19	CCDS6953.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.963035	0.74016	.	.	ENSG00000125484	ENST00000372146	T	0.59906	0.23	3.64	3.64	0.41730	Transcription factor IIIC, 90kDa subunit, N-terminal (1);	0.081587	0.48286	D	0.000197	T	0.49098	0.1537	N	0.14661	0.345	0.39940	D	0.974402	P	0.47034	0.889	P	0.48704	0.587	T	0.60944	-0.7162	10	0.72032	D	0.01	-8.035	14.8255	0.70107	0.0:0.0:1.0:0.0	.	80	Q9UKN8	TF3C4_HUMAN	L	80	ENSP00000361219:V80L	ENSP00000361219:V80L	V	+	1	0	GTF3C4	134536044	1.000000	0.71417	0.931000	0.37212	0.159000	0.22180	7.975000	0.88055	2.011000	0.59026	0.455000	0.32223	GTG	.	.	.	none		0.677	GTF3C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054792.1		
ANXA7	310	hgsc.bcm.edu	37	10	75147485	75147485	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr10:75147485G>T	ENST00000372921.5	-	7	651	c.595C>A	c.(595-597)Caa>Aaa	p.Q199K	ANXA7_ENST00000492380.1_5'UTR|ANXA7_ENST00000535178.1_Missense_Mutation_p.Q69K	NM_001156.3	NP_001147.1	P20073	ANXA7_HUMAN	annexin A7	221					autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular calcium ion homeostasis (GO:0006874)|cellular water homeostasis (GO:0009992)|epithelial cell differentiation (GO:0030855)|hemostasis (GO:0007599)|membrane fusion (GO:0061025)|negative regulation of gene expression (GO:0010629)|regulation of cell shape (GO:0008360)|response to calcium ion (GO:0051592)|response to organic cyclic compound (GO:0014070)|response to salt stress (GO:0009651)|social behavior (GO:0035176)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|integrin binding (GO:0005178)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	26	Prostate(51;0.0119)					TTAATTTTTTGCCTCTGATCA	0.448																																					p.Q221K		Atlas-SNP	.											.	ANXA7	50	.	0			c.C661A						PASS	.						230.0	217.0	221.0					10																	75147485		2203	4300	6503	SO:0001583	missense	310	exon8			TTTTTTGCCTCTG	J04543	CCDS7325.1, CCDS7326.1	10q22.2	2005-11-09			ENSG00000138279	ENSG00000138279		"""Annexins"""	545	protein-coding gene	gene with protein product		186360		ANX7		7515686	Standard	NM_001156		Approved		uc001jtz.2	P20073	OTTHUMG00000018463	ENST00000372921.5:c.595C>A	chr10.hg19:g.75147485G>T	ENSP00000362012:p.Gln199Lys	87.0	0.0	.		89.0	26.0	.	NM_004034	Q5F2H3|Q5T0M6|Q5T0M7	Missense_Mutation	SNP	ENST00000372921.5	hg19	CCDS7325.1	.	.	.	.	.	.	.	.	.	.	G	32	5.149064	0.94645	.	.	ENSG00000138279	ENST00000372921;ENST00000372919;ENST00000535178	T;T;T	0.03580	3.88;3.88;3.88	5.96	5.96	0.96718	Annexin repeat, conserved site (1);	0.000000	0.64402	D	0.000001	T	0.11750	0.0286	L	0.44542	1.39	0.58432	D	0.999999	D;D;D;D;D	0.64830	0.966;0.994;0.977;0.977;0.981	P;P;P;P;P	0.59357	0.66;0.856;0.696;0.529;0.76	T	0.00142	-1.1997	10	0.66056	D	0.02	.	17.913	0.88940	0.0:0.0:1.0:0.0	.	199;199;126;199;221	Q53HM8;B2R7L2;B4DWU2;P20073-2;P20073	.;.;.;.;ANXA7_HUMAN	K	199;221;69	ENSP00000362012:Q199K;ENSP00000362010:Q221K;ENSP00000442864:Q69K	ENSP00000362010:Q221K	Q	-	1	0	ANXA7	74817491	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.569000	0.82380	2.831000	0.97527	0.650000	0.86243	CAA	.	.	.	none		0.448	ANXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048646.2	NM_001156	
HSPA12A	259217	hgsc.bcm.edu	37	10	118434763	118434763	+	Silent	SNP	G	G	A			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr10:118434763G>A	ENST00000369209.3	-	12	1661	c.1557C>T	c.(1555-1557)gtC>gtT	p.V519V	RP11-498B4.5_ENST00000433600.1_RNA	NM_025015.2	NP_079291.2	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	519						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32				all cancers(201;0.0158)		GGCCAAAGAGGACGGCACCCT	0.682																																					p.V519V		Atlas-SNP	.											.	HSPA12A	81	.	0			c.C1557T						PASS	.						38.0	44.0	42.0					10																	118434763		2045	4187	6232	SO:0001819	synonymous_variant	259217	exon12			AAAGAGGACGGCA	AB007877	CCDS41569.1	10q25.3	2011-09-02	2002-08-29		ENSG00000165868	ENSG00000165868		"""Heat shock proteins / HSP70"""	19022	protein-coding gene	gene with protein product		610701	"""heat shock 70kD protein 12A"""			12552099	Standard	NM_025015		Approved	FLJ13874, KIAA0417	uc001lct.3	O43301	OTTHUMG00000019107	ENST00000369209.3:c.1557C>T	chr10.hg19:g.118434763G>A		131.0	0.0	.		155.0	48.0	.	NM_025015		Silent	SNP	ENST00000369209.3	hg19	CCDS41569.1																																																																																			.	.	.	none		0.682	HSPA12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050530.1	NM_025015	
TSSC4	10078	hgsc.bcm.edu	37	11	2427988	2427988	+	IGR	SNP	C	C	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr11:2427988C>T	ENST00000333256.6	+	0	1686				TRPM5_ENST00000452833.1_Missense_Mutation_p.V1054I|TRPM5_ENST00000528453.1_Missense_Mutation_p.V1052I|AC124057.5_ENST00000433035.1_RNA|TRPM5_ENST00000155858.6_Missense_Mutation_p.V1052I|TRPM5_ENST00000533060.1_Missense_Mutation_p.V1052I			Q9Y5U2	TSSC4_HUMAN	tumor suppressing subtransferable candidate 4											endometrium(3)|large_intestine(1)|lung(4)	8		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.00145)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCCCAGGTGACGACCTTCTGG	0.622																																					p.V1052I		Atlas-SNP	.											.	TRPM5	86	.	0			c.G3154A						PASS	.						79.0	77.0	77.0					11																	2427988		2202	4299	6501	SO:0001628	intergenic_variant	29850	exon21			AGGTGACGACCTT	AF125568	CCDS7735.1, CCDS73241.1	11p15.5	2008-02-05			ENSG00000184281	ENSG00000184281			12386	protein-coding gene	gene with protein product		603852				10072438	Standard	XM_005252722		Approved		uc001lwl.3	Q9Y5U2	OTTHUMG00000009895		chr11.hg19:g.2427988C>T		67.0	0.0	.		80.0	9.0	.	NM_014555	C9JS66|Q86VL2|Q9BRS6	Missense_Mutation	SNP	ENST00000333256.6	hg19	CCDS7735.1	.	.	.	.	.	.	.	.	.	.	c	0.390	-0.923796	0.02377	.	.	ENSG00000070985	ENST00000533881;ENST00000155858;ENST00000452833;ENST00000533060;ENST00000528453	T;T;T;T;T	0.60797	0.33;0.27;0.27;0.16;0.27	3.96	0.932	0.19466	.	0.266195	0.35124	N	0.003423	T	0.30070	0.0753	N	0.12182	0.205	0.09310	N	0.999991	B;B;B	0.12013	0.005;0.005;0.005	B;B;B	0.12837	0.006;0.006;0.008	T	0.07731	-1.0757	10	0.25106	T	0.35	-23.707	3.527	0.07762	0.0:0.4529:0.196:0.3511	.	1052;1054;1052	E9PRW0;Q9NZQ8-2;Q9NZQ8	.;.;TRPM5_HUMAN	I	1046;1052;1054;1052;1052	ENSP00000434383:V1046I;ENSP00000155858:V1052I;ENSP00000387965:V1054I;ENSP00000434121:V1052I;ENSP00000436809:V1052I	ENSP00000155858:V1052I	V	-	1	0	TRPM5	2384564	0.134000	0.22483	0.788000	0.31933	0.012000	0.07955	0.380000	0.20602	0.271000	0.22005	-0.215000	0.12644	GTC	.	.	.	none		0.622	TSSC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027369.3	NM_005706	
SMPD1	6609	hgsc.bcm.edu	37	11	6411941	6411941	+	Missense_Mutation	SNP	C	C	T	rs550365194|rs550067660|rs71467507|rs78250081|rs558809956|rs3838786	byFrequency	TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr11:6411941C>T	ENST00000342245.4	+	1	281	c.113C>T	c.(112-114)gCg>gTg	p.A38V	SMPD1_ENST00000527275.1_Missense_Mutation_p.A38V|SMPD1_ENST00000533196.1_3'UTR|SMPD1_ENST00000299397.3_Missense_Mutation_p.A38V|SMPD1_ENST00000356761.2_Missense_Mutation_p.A38V	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	38					cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	ctggtgctggcgctggcgctg	0.711																																					p.A38V		Atlas-SNP	.											.	SMPD1	108	.	0			c.C113T						PASS	.						11.0	14.0	13.0					11																	6411941		2185	4258	6443	SO:0001583	missense	6609	exon1			TGCTGGCGCTGGC	AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.113C>T	chr11.hg19:g.6411941C>T	ENSP00000340409:p.Ala38Val	69.0	0.0	.		101.0	9.0	.	NM_000543	A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	Missense_Mutation	SNP	ENST00000342245.4	hg19	CCDS44531.1	.	.	.	.	.	.	.	.	.	.	C	13.43	2.234305	0.39498	.	.	ENSG00000166311	ENST00000299397;ENST00000356761;ENST00000342245;ENST00000527275	T;T;T;T	0.09723	2.95;2.95;2.95;2.95	4.54	-1.08	0.09936	.	.	.	.	.	T	0.04363	0.0120	N	0.08118	0	0.09310	N	1	B;B	0.15473	0.002;0.013	B;B	0.10450	0.002;0.005	T	0.47275	-0.9130	9	0.12103	T	0.63	.	6.8659	0.24093	0.0:0.5614:0.262:0.1766	.	38;38	E9PKS3;G3XAB5	.;.	V	38	ENSP00000299397:A38V;ENSP00000349203:A38V;ENSP00000340409:A38V;ENSP00000435350:A38V	ENSP00000299397:A38V	A	+	2	0	SMPD1	6368517	0.000000	0.05858	0.130000	0.21974	0.033000	0.12548	-2.110000	0.01334	-0.479000	0.06813	-1.305000	0.01319	GCG	.	.	.	weak		0.711	SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384205.1	NM_000543	
KIF5A	3798	hgsc.bcm.edu	37	12	57968953	57968953	+	Silent	SNP	G	G	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr12:57968953G>T	ENST00000455537.2	+	16	2077	c.1803G>T	c.(1801-1803)gtG>gtT	p.V601V	KIF5A_ENST00000286452.5_Silent_p.V512V	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	601					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						TCAAGTCTGTGGTCAAGCGGT	0.557																																					p.V601V		Atlas-SNP	.											.	KIF5A	143	.	0			c.G1803T						PASS	.						62.0	52.0	55.0					12																	57968953		2203	4300	6503	SO:0001819	synonymous_variant	3798	exon16			GTCTGTGGTCAAG	U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.1803G>T	chr12.hg19:g.57968953G>T		101.0	0.0	.		153.0	36.0	.	NM_004984	A6H8M5|Q4LE26	Silent	SNP	ENST00000455537.2	hg19	CCDS8945.1																																																																																			.	.	.	none		0.557	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407634.1	NM_004984	
DDX54	79039	hgsc.bcm.edu	37	12	113602055	113602055	+	Silent	SNP	C	C	G			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr12:113602055C>G	ENST00000306014.5	-	15	1782	c.1755G>C	c.(1753-1755)ctG>ctC	p.L585L	DDX54_ENST00000549271.1_5'Flank|DDX54_ENST00000314045.7_Silent_p.L585L	NM_024072.3	NP_076977.3	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	585					ATP catabolic process (GO:0006200)|intracellular estrogen receptor signaling pathway (GO:0030520)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CCTGGCTGCACAGGTCTCGGC	0.642																																					p.L585L		Atlas-SNP	.											.	DDX54	73	.	0			c.G1755C						PASS	.						39.0	35.0	37.0					12																	113602055		2203	4299	6502	SO:0001819	synonymous_variant	79039	exon15			GCTGCACAGGTCT	AF144056	CCDS31907.1, CCDS44984.1	12q24.11	2006-01-30				ENSG00000123064		"""DEAD-boxes"""	20084	protein-coding gene	gene with protein product		611665				12466272	Standard	NM_001111322		Approved	MGC2835, APR-5, DP97	uc001tuq.4	Q8TDD1	OTTHUMG00000169676	ENST00000306014.5:c.1755G>C	chr12.hg19:g.113602055C>G		47.0	0.0	.		54.0	21.0	.	NM_024072	Q86YT8|Q9BRZ1	Silent	SNP	ENST00000306014.5	hg19	CCDS31907.1																																																																																			.	.	.	none		0.642	DDX54-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405435.1	NM_024072	
CCDC64	92558	hgsc.bcm.edu	37	12	120530940	120530940	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr12:120530940T>C	ENST00000397558.2	+	9	1697	c.1697T>C	c.(1696-1698)cTc>cCc	p.L566P	CCDC64_ENST00000257583.4_Missense_Mutation_p.L263P|CCDC64_ENST00000546857.1_3'UTR|CCDC64_ENST00000446727.2_Missense_Mutation_p.L237P	NM_207311.2	NP_997194.2	Q6ZP65	BICR1_HUMAN	coiled-coil domain containing 64	566					Golgi to secretory granule transport (GO:0055107)|neuron projection development (GO:0031175)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	dynactin binding (GO:0034452)|Rab GTPase binding (GO:0017137)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGCAAACGACTCTTCTCATTC	0.612																																					p.L566P		Atlas-SNP	.											.	CCDC64	40	.	0			c.T1697C						PASS	.						27.0	32.0	30.0					12																	120530940		2008	4157	6165	SO:0001583	missense	92558	exon9			AACGACTCTTCTC	U88834, AK129960	CCDS41845.1	12q24.23	2006-01-24				ENSG00000135127			28095	protein-coding gene	gene with protein product							Standard	NM_207311		Approved	FLJ26450	uc001txl.1	Q6ZP65	OTTHUMG00000169311	ENST00000397558.2:c.1697T>C	chr12.hg19:g.120530940T>C	ENSP00000380690:p.Leu566Pro	94.0	0.0	.		106.0	19.0	.	NM_207311	A8MUC8|B4DWL0|B5MDJ0|O95000	Missense_Mutation	SNP	ENST00000397558.2	hg19	CCDS41845.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.199926	0.79015	.	.	ENSG00000135127	ENST00000397558;ENST00000446727;ENST00000548673;ENST00000257583	T;T	0.62364	0.61;0.03	4.9	4.9	0.64082	.	1.075700	0.07390	U	0.888905	T	0.76371	0.3978	L	0.50333	1.59	0.80722	D	1	D;D;D	0.71674	0.993;0.998;0.998	P;D;D	0.69142	0.858;0.962;0.914	T	0.67887	-0.5554	10	0.72032	D	0.01	-0.4316	14.6842	0.69037	0.0:0.0:0.0:1.0	.	263;237;566	B4DWL0;B4DNE7;Q6ZP65	.;.;BICR1_HUMAN	P	566;237;284;263	ENSP00000380690:L566P;ENSP00000399658:L237P	ENSP00000257583:L263P	L	+	2	0	CCDC64	119015323	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.852000	0.69488	2.054000	0.61138	0.459000	0.35465	CTC	.	.	.	none		0.612	CCDC64-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403390.2	NM_207311	
EP400	57634	hgsc.bcm.edu	37	12	132547068	132547068	+	Missense_Mutation	SNP	G	G	A	rs68030464|rs367737531|rs60930033		TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr12:132547068G>A	ENST00000333577.4	+	48	8373	c.8264G>A	c.(8263-8265)aGg>aAg	p.R2755K	EP400_ENST00000389562.2_Missense_Mutation_p.R2718K|EP400_ENST00000332482.4_Missense_Mutation_p.R2682K|EP400_ENST00000330386.6_Missense_Mutation_p.R2638K|EP400_ENST00000389561.2_Missense_Mutation_p.R2719K			Q96L91	EP400_HUMAN	E1A binding protein p400	2755	Interaction with ZNF42. {ECO:0000250}.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.R2718K(2)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CAGCTTCTCAGgcagcagcag	0.567																																					p.R2719K		Atlas-SNP	.											EP400,NS,carcinoma,0,2	EP400	370	.	2	Substitution - Missense(2)	lung(2)	c.G8156A						PASS	.						48.0	48.0	48.0					12																	132547068		2203	4300	6503	SO:0001583	missense	57634	exon47			TTCTCAGGCAGCA	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8264G>A	chr12.hg19:g.132547068G>A	ENSP00000333602:p.Arg2755Lys	77.0	0.0	.		100.0	4.0	.	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	hg19		.	.	.	.	.	.	.	.	.	.	G	15.46	2.840128	0.51057	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296	D;D;D;D;D	0.90133	-2.62;-2.62;-2.62;-2.62;-2.62	4.89	4.89	0.63831	.	0.266539	0.31542	N	0.007465	D	0.91264	0.7246	L	0.27053	0.805	0.26223	N	0.97913	D;D;D	0.53312	0.959;0.959;0.959	D;D;D	0.65684	0.937;0.937;0.937	D	0.84986	0.0891	10	0.29301	T	0.29	.	17.0403	0.86487	0.0:0.0:1.0:0.0	.	2719;2638;2718	Q96L91-2;Q96L91-4;Q96L91-5	.;.;.	K	2755;2719;2718;2682;2638;2719	ENSP00000333602:R2755K;ENSP00000374212:R2719K;ENSP00000374213:R2718K;ENSP00000331737:R2682K;ENSP00000330620:R2638K	ENSP00000330620:R2638K	R	+	2	0	EP400	131113021	1.000000	0.71417	0.878000	0.34440	0.286000	0.27126	5.957000	0.70323	2.236000	0.73375	0.561000	0.74099	AGG	.	.	.	none		0.567	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
FRY	10129	hgsc.bcm.edu	37	13	32813948	32813948	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr13:32813948A>G	ENST00000380250.3	+	46	7113	c.6617A>G	c.(6616-6618)aAt>aGt	p.N2206S		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	2206						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		ACGTGGGTCAATGTGGTCTGT	0.408																																					p.N2206S		Atlas-SNP	.											.	FRY	312	.	0			c.A6617G						PASS	.						93.0	93.0	93.0					13																	32813948		1959	4159	6118	SO:0001583	missense	10129	exon46			GGGTCAATGTGGT	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.6617A>G	chr13.hg19:g.32813948A>G	ENSP00000369600:p.Asn2206Ser	128.0	0.0	.		96.0	24.0	.	NM_023037	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	hg19	CCDS41875.1	.	.	.	.	.	.	.	.	.	.	A	12.39	1.922762	0.33908	.	.	ENSG00000073910	ENST00000380250;ENST00000380257	T	0.20738	2.05	6.07	0.907	0.19321	.	0.127673	0.64402	N	0.000001	T	0.12347	0.0300	L	0.28556	0.865	0.80722	D	1	B	0.23128	0.08	B	0.26864	0.074	T	0.18840	-1.0324	10	0.07482	T	0.82	.	9.8227	0.40891	0.7452:0.0:0.2548:0.0	.	2206	Q5TBA9	FRY_HUMAN	S	2206;1043	ENSP00000369600:N2206S	ENSP00000369600:N2206S	N	+	2	0	FRY	31711948	0.945000	0.32115	0.180000	0.23079	0.989000	0.77384	1.981000	0.40628	-0.046000	0.13446	0.533000	0.62120	AAT	.	.	.	none		0.408	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037	
UGGT2	55757	hgsc.bcm.edu	37	13	96508522	96508522	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr13:96508522G>T	ENST00000376747.3	-	34	3968	c.3898C>A	c.(3898-3900)Ctt>Att	p.L1300I		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	1300	Glucosyltransferase.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						TGTTGACGAAGCCAACGGGGC	0.378																																					p.L1300I		Atlas-SNP	.											.	UGGT2	127	.	0			c.C3898A						PASS	.						137.0	143.0	141.0					13																	96508522		2203	4300	6503	SO:0001583	missense	55757	exon34			GACGAAGCCAACG	AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.3898C>A	chr13.hg19:g.96508522G>T	ENSP00000365938:p.Leu1300Ile	208.0	0.0	.		195.0	61.0	.	NM_020121	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	ENST00000376747.3	hg19	CCDS9480.1	.	.	.	.	.	.	.	.	.	.	G	18.60	3.659435	0.67586	.	.	ENSG00000102595	ENST00000376747	T	0.48201	0.82	5.18	4.33	0.51752	.	0.000000	0.85682	D	0.000000	T	0.74658	0.3745	M	0.92555	3.32	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81180	-0.1050	10	0.87932	D	0	-5.3529	13.4302	0.61051	0.076:0.0:0.924:0.0	.	1300	Q9NYU1	UGGG2_HUMAN	I	1300	ENSP00000365938:L1300I	ENSP00000365938:L1300I	L	-	1	0	UGGT2	95306523	1.000000	0.71417	1.000000	0.80357	0.492000	0.33523	7.654000	0.83653	1.159000	0.42565	0.655000	0.94253	CTT	.	.	.	none		0.378	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045507.1	NM_020121	
CHD8	57680	hgsc.bcm.edu	37	14	21875030	21875030	+	Silent	SNP	G	G	C			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr14:21875030G>C	ENST00000557364.1	-	14	3155	c.2892C>G	c.(2890-2892)ctC>ctG	p.L964L	CHD8_ENST00000555962.1_Intron|CHD8_ENST00000430710.3_Silent_p.L685L|CHD8_ENST00000399982.2_Silent_p.L964L			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	964	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		CCATGTGCTTGAGACTATCAA	0.428																																					p.L964L		Atlas-SNP	.											.	CHD8	339	.	0			c.C2892G						PASS	.						82.0	76.0	78.0					14																	21875030		1955	4150	6105	SO:0001819	synonymous_variant	57680	exon13			GTGCTTGAGACTA	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.2892C>G	chr14.hg19:g.21875030G>C		82.0	0.0	.		86.0	29.0	.	NM_001170629	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Silent	SNP	ENST00000557364.1	hg19	CCDS53885.1	.	.	.	.	.	.	.	.	.	.	G	7.953	0.745301	0.15710	.	.	ENSG00000100888	ENST00000555935	.	.	.	5.21	-0.0436	0.13859	.	.	.	.	.	T	0.50309	0.1608	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34725	-0.9817	4	.	.	.	-14.3711	4.8051	0.13316	0.0697:0.3534:0.3354:0.2416	.	.	.	.	E	190	.	.	Q	-	1	0	CHD8	20944870	0.870000	0.30015	0.995000	0.50966	0.981000	0.71138	-0.125000	0.10579	-0.171000	0.10797	-0.254000	0.11334	CAA	.	.	.	none		0.428	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920	
SLC8A3	6547	hgsc.bcm.edu	37	14	70634950	70634950	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr14:70634950A>T	ENST00000381269.2	-	2	943	c.190T>A	c.(190-192)Tac>Aac	p.Y64N	SLC8A3_ENST00000528359.1_Missense_Mutation_p.Y64N|SLC8A3_ENST00000356921.2_Missense_Mutation_p.Y64N|SLC8A3_ENST00000357887.3_Missense_Mutation_p.Y64N|SLC8A3_ENST00000534137.1_Missense_Mutation_p.Y64N	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	64					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		TTCTCCGGGTACCAGATTGGC	0.552																																					p.Y64N		Atlas-SNP	.											.	SLC8A3	234	.	0			c.T190A						PASS	.						72.0	61.0	65.0					14																	70634950		2203	4300	6503	SO:0001583	missense	6547	exon2			CCGGGTACCAGAT	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.190T>A	chr14.hg19:g.70634950A>T	ENSP00000370669:p.Tyr64Asn	123.0	0.0	.		143.0	39.0	.	NM_183002	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	ENST00000381269.2	hg19	CCDS35498.1	.	.	.	.	.	.	.	.	.	.	A	11.21	1.571033	0.28003	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000534137;ENST00000528359	T;T;T;T;T	0.32988	1.5;1.43;1.57;1.5;1.57	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.39600	0.1084	N	0.26042	0.785	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.995;0.998	D;D;D;D	0.85130	0.997;0.997;0.979;0.986	T	0.10359	-1.0633	10	0.15952	T	0.53	.	14.5806	0.68288	1.0:0.0:0.0:0.0	.	64;64;64;64	P57103-2;P57103;Q96QG2;Q96QG1	.;NAC3_HUMAN;.;.	N	64	ENSP00000349392:Y64N;ENSP00000370669:Y64N;ENSP00000350560:Y64N;ENSP00000436688:Y64N;ENSP00000433531:Y64N	ENSP00000349392:Y64N	Y	-	1	0	SLC8A3	69704703	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.989000	0.63870	2.030000	0.59900	0.460000	0.39030	TAC	.	.	.	none		0.552	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1		
TECPR2	9895	hgsc.bcm.edu	37	14	102880977	102880977	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr14:102880977T>C	ENST00000359520.7	+	5	711	c.485T>C	c.(484-486)cTc>cCc	p.L162P	TECPR2_ENST00000558678.1_Missense_Mutation_p.L162P|TECPR2_ENST00000561228.1_3'UTR	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	162					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						TGCCAGGGGCTCTGTAACTCC	0.527																																					p.L162P		Atlas-SNP	.											.	TECPR2	114	.	0			c.T485C						PASS	.						141.0	129.0	133.0					14																	102880977		2203	4300	6503	SO:0001583	missense	9895	exon5			AGGGGCTCTGTAA	AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.485T>C	chr14.hg19:g.102880977T>C	ENSP00000352510:p.Leu162Pro	82.0	0.0	.		84.0	17.0	.	NM_001172631	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	ENST00000359520.7	hg19	CCDS32162.1	.	.	.	.	.	.	.	.	.	.	T	11.18	1.563760	0.27915	.	.	ENSG00000196663	ENST00000359520;ENST00000380088	T	0.22336	1.96	4.89	3.74	0.42951	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.718657	0.12822	N	0.436353	T	0.18841	0.0452	L	0.48642	1.525	0.54753	D	0.99998	B;P;P	0.48998	0.087;0.918;0.836	B;B;B	0.38106	0.091;0.265;0.203	T	0.02093	-1.1215	10	0.66056	D	0.02	.	10.3322	0.43829	0.0:0.0779:0.0:0.9221	.	162;162;162	B4DK51;A5PKY3;O15040	.;.;TCPR2_HUMAN	P	162	ENSP00000352510:L162P	ENSP00000352510:L162P	L	+	2	0	TECPR2	101950730	0.978000	0.34361	0.519000	0.27824	0.122000	0.20287	2.546000	0.45778	0.707000	0.31934	0.459000	0.35465	CTC	.	.	.	none		0.527	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415056.2	NM_014844	
C15orf39	56905	hgsc.bcm.edu	37	15	75498964	75498964	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr15:75498964G>A	ENST00000360639.2	+	2	895	c.575G>A	c.(574-576)cGg>cAg	p.R192Q	C15orf39_ENST00000567617.1_Missense_Mutation_p.R192Q|C15orf39_ENST00000394987.4_Missense_Mutation_p.R192Q			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	192						cytoplasm (GO:0005737)		p.V194fs*132(1)		autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						ACCTTCTTGCGGGGGGTGCCA	0.627																																					p.R192Q		Atlas-SNP	.											.,1	C15orf39	64	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.G575A						PASS	.						37.0	41.0	40.0					15																	75498964		2197	4291	6488	SO:0001583	missense	56905	exon2			TCTTGCGGGGGGT	AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.575G>A	chr15.hg19:g.75498964G>A	ENSP00000353854:p.Arg192Gln	58.0	1.0	.		41.0	7.0	.	NM_015492	B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	Missense_Mutation	SNP	ENST00000360639.2	hg19	CCDS10276.1	.	.	.	.	.	.	.	.	.	.	G	11.04	1.523013	0.27211	.	.	ENSG00000167173	ENST00000360639;ENST00000394987	T;T	0.65178	-0.14;-0.14	5.13	1.38	0.22167	.	0.643074	0.13616	N	0.374763	T	0.49558	0.1564	L	0.57536	1.79	0.09310	N	1	P	0.41673	0.759	B	0.35859	0.212	T	0.34925	-0.9809	10	0.33940	T	0.23	-2.3691	5.3924	0.16251	0.2698:0.2193:0.5109:0.0	.	192	Q6ZRI6	CO039_HUMAN	Q	192	ENSP00000353854:R192Q;ENSP00000378438:R192Q	ENSP00000353854:R192Q	R	+	2	0	C15orf39	73286017	0.002000	0.14202	0.569000	0.28460	0.861000	0.49209	0.198000	0.17217	0.410000	0.25675	0.561000	0.74099	CGG	.	.	.	none		0.627	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286410.1	NM_015492	
CASKIN1	57524	hgsc.bcm.edu	37	16	2228947	2228947	+	Silent	SNP	C	C	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr16:2228947C>T	ENST00000343516.6	-	19	4247	c.4155G>A	c.(4153-4155)caG>caA	p.Q1385Q	CASKIN1_ENST00000564289.1_5'Flank	NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	1385					signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28						CCTCCACCGCCTGCAGCGCCG	0.796																																					p.Q1385Q		Atlas-SNP	.											.	CASKIN1	130	.	0			c.G4155A						PASS	.						4.0	4.0	4.0					16																	2228947		1175	2788	3963	SO:0001819	synonymous_variant	57524	exon19			CACCGCCTGCAGC	AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184				12040031	Standard	NM_020764		Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.4155G>A	chr16.hg19:g.2228947C>T		1.0	0.0	.		5.0	4.0	.	NM_020764	Q9P2P0	Silent	SNP	ENST00000343516.6	hg19	CCDS42103.1																																																																																			.	.	.	none		0.796	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435055.1	NM_020764	
SRRM2	23524	hgsc.bcm.edu	37	16	2815043	2815043	+	Missense_Mutation	SNP	T	T	C	rs541886234	byFrequency	TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr16:2815043T>C	ENST00000301740.8	+	11	5063	c.4514T>C	c.(4513-4515)cTc>cCc	p.L1505P		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1505	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						TCCCCAGAGCTCAACAACAAG	0.532																																					p.L1505P		Atlas-SNP	.											SRRM2,colon,carcinoma,0,1	SRRM2	263	.	0			c.T4514C						PASS	.						134.0	137.0	136.0					16																	2815043		2198	4300	6498	SO:0001583	missense	23524	exon11			CAGAGCTCAACAA	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.4514T>C	chr16.hg19:g.2815043T>C	ENSP00000301740:p.Leu1505Pro	72.0	0.0	.		84.0	26.0	.	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	hg19	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	T	11.18	1.562907	0.27915	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.26957	1.7	5.9	4.8	0.61643	.	0.229124	0.31113	N	0.008221	T	0.22360	0.0539	L	0.36672	1.1	0.45930	D	0.998763	P	0.42039	0.769	B	0.42343	0.384	T	0.01753	-1.1281	10	0.39692	T	0.17	-1.9891	9.9236	0.41478	0.0:0.0:0.1788:0.8212	.	1505	Q9UQ35	SRRM2_HUMAN	P	1505;1505;757	ENSP00000301740:L1505P	ENSP00000301740:L1505P	L	+	2	0	SRRM2	2755044	0.987000	0.35691	1.000000	0.80357	0.990000	0.78478	0.820000	0.27323	1.045000	0.40225	0.533000	0.62120	CTC	.	.	.	none		0.532	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
CLDN6	9074	hgsc.bcm.edu	37	16	3065429	3065429	+	Silent	SNP	G	G	A			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr16:3065429G>A	ENST00000396925.1	-	3	1022	c.594C>T	c.(592-594)gcC>gcT	p.A198A	CLDN6_ENST00000328796.4_Silent_p.A198A|CLDN6_ENST00000572154.1_Intron			P56747	CLD6_HUMAN	claudin 6	198					calcium-independent cell-cell adhesion (GO:0016338)|cell-cell junction organization (GO:0045216)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	10						TTGAGTAGCGGGCCATGTAAT	0.652																																					p.A198A		Atlas-SNP	.											.	CLDN6	31	.	0			c.C594T						PASS	.						43.0	49.0	47.0					16																	3065429		2198	4300	6498	SO:0001819	synonymous_variant	9074	exon2			GTAGCGGGCCATG	AJ249735	CCDS10488.1	16p13.3	2008-08-01			ENSG00000184697	ENSG00000184697		"""Claudins"""	2048	protein-coding gene	gene with protein product		615798				9892664, 18234789	Standard	NM_021195		Approved		uc002csu.4	P56747	OTTHUMG00000128999	ENST00000396925.1:c.594C>T	chr16.hg19:g.3065429G>A		93.0	0.0	.		117.0	28.0	.	NM_021195	B3KQP9|D3DUA5	Silent	SNP	ENST00000396925.1	hg19	CCDS10488.1																																																																																			.	.	.	none		0.652	CLDN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250988.1	NM_021195	
UQCRC2	7385	hgsc.bcm.edu	37	16	21974187	21974187	+	Silent	SNP	C	C	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr16:21974187C>T	ENST00000268379.4	+	6	1259	c.495C>T	c.(493-495)gcC>gcT	p.A165A	UQCRC2_ENST00000561553.1_Silent_p.A165A	NM_003366.2	NP_003357.2	P22695	QCR2_HUMAN	ubiquinol-cytochrome c reductase core protein II	165					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(48;0.0264)		AAGCTGTGGCCTTTCAGAATC	0.398																																					p.A165A	Colon(123;450 1645 12841 25393 45623)	Atlas-SNP	.											.	UQCRC2	46	.	0			c.C495T						PASS	.						85.0	76.0	79.0					16																	21974187		2198	4300	6498	SO:0001819	synonymous_variant	7385	exon6			TGTGGCCTTTCAG	J04973	CCDS10601.1	16p12	2011-07-04			ENSG00000140740	ENSG00000140740	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12586	protein-coding gene	gene with protein product		191329				8288258, 2547763	Standard	NM_003366		Approved	QCR2, UQCR2	uc002djx.3	P22695	OTTHUMG00000131585	ENST00000268379.4:c.495C>T	chr16.hg19:g.21974187C>T		80.0	0.0	.		97.0	48.0	.	NM_003366	B3KSN4|Q9BQ05	Silent	SNP	ENST00000268379.4	hg19	CCDS10601.1																																																																																			.	.	.	none		0.398	UQCRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254466.1	NM_003366	
ERN2	10595	hgsc.bcm.edu	37	16	23711991	23711991	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr16:23711991G>A	ENST00000457008.2	-	12	1276	c.1238C>T	c.(1237-1239)aCc>aTc	p.T413I	ERN2_ENST00000256797.4_Missense_Mutation_p.T513I					endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		TGCCAGGGGGGTCTCCTGCTG	0.627																																					p.T513I		Atlas-SNP	.											.	ERN2	131	.	0			c.C1538T						PASS	.						58.0	59.0	59.0					16																	23711991		2197	4300	6497	SO:0001583	missense	10595	exon13			AGGGGGGTCTCCT	AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.1238C>T	chr16.hg19:g.23711991G>A	ENSP00000413812:p.Thr413Ile	79.0	0.0	.		96.0	43.0	.	NM_033266		Missense_Mutation	SNP	ENST00000457008.2	hg19		.	.	.	.	.	.	.	.	.	.	G	7.968	0.748362	0.15710	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.60424	0.19;0.23	4.27	-2.79	0.05841	.	1.458410	0.04022	N	0.299985	T	0.33933	0.0880	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.08617	-1.0713	10	0.37606	T	0.19	.	0.7973	0.01068	0.1835:0.2906:0.247:0.2789	.	413;465	E7ETG2;A5YM65	.;.	I	513;413	ENSP00000256797:T513I;ENSP00000413812:T413I	ENSP00000256797:T513I	T	-	2	0	ERN2	23619492	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.286000	0.08399	-0.459000	0.07013	-0.258000	0.10820	ACC	.	.	.	none		0.627	ERN2-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000434886.1		
MBTPS1	8720	hgsc.bcm.edu	37	16	84132688	84132688	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr16:84132688T>G	ENST00000343411.3	-	3	886	c.391A>C	c.(391-393)Aaa>Caa	p.K131Q		NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	131					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						CGAAAGACTTTTCGTTGGGGC	0.413																																					p.K131Q		Atlas-SNP	.											.	MBTPS1	85	.	0			c.A391C						PASS	.						172.0	162.0	166.0					16																	84132688		2200	4300	6500	SO:0001583	missense	8720	exon3			AGACTTTTCGTTG	D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.391A>C	chr16.hg19:g.84132688T>G	ENSP00000344223:p.Lys131Gln	160.0	0.0	.		172.0	29.0	.	NM_003791	A8K6V8|Q24JQ2|Q9UF67	Missense_Mutation	SNP	ENST00000343411.3	hg19	CCDS10941.1	.	.	.	.	.	.	.	.	.	.	T	11.86	1.763541	0.31228	.	.	ENSG00000140943	ENST00000343411	T	0.42900	0.96	5.61	5.61	0.85477	.	0.259036	0.44902	D	0.000407	T	0.26882	0.0658	N	0.20685	0.6	0.32674	N	0.516437	B	0.10296	0.003	B	0.06405	0.002	T	0.30031	-0.9992	10	0.17369	T	0.5	-13.823	11.7501	0.51843	0.0:0.0:0.1471:0.8529	.	131	Q14703	MBTP1_HUMAN	Q	131	ENSP00000344223:K131Q	ENSP00000344223:K131Q	K	-	1	0	MBTPS1	82690189	1.000000	0.71417	0.994000	0.49952	0.833000	0.47200	5.752000	0.68728	2.139000	0.66308	0.528000	0.53228	AAA	.	.	.	none		0.413	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269080.2	NM_003791	
PPM1E	22843	hgsc.bcm.edu	37	17	56833454	56833454	+	Silent	SNP	G	G	A	rs77856248		TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr17:56833454G>A	ENST00000308249.2	+	1	225	c.96G>A	c.(94-96)gaG>gaA	p.E32E		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			Gcgagccggagccggaacccg	0.667																																					p.E32E		Atlas-SNP	.											PPM1E,colon,carcinoma,0,1	PPM1E	97	.	0			c.G96A						PASS	.						14.0	20.0	18.0					17																	56833454		2185	4284	6469	SO:0001819	synonymous_variant	22843	exon1			GCCGGAGCCGGAA	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.96G>A	chr17.hg19:g.56833454G>A		206.0	0.0	.		298.0	34.0	.	NM_014906	Q8N8J9|Q96DB8	Silent	SNP	ENST00000308249.2	hg19	CCDS11613.1																																																																																			.	.	.	weak		0.667	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
PPM1E	22843	hgsc.bcm.edu	37	17	56833457	56833457	+	Silent	SNP	G	G	C	rs3834568|rs201186780|rs74256772	byFrequency	TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr17:56833457G>C	ENST00000308249.2	+	1	228	c.99G>C	c.(97-99)ccG>ccC	p.P33P		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			agccggagccggaacccgaac	0.672																																					p.P33P		Atlas-SNP	.											PPM1E,colon,carcinoma,0,1	PPM1E	97	.	0			c.G99C						PASS	.						14.0	20.0	18.0					17																	56833457		2188	4284	6472	SO:0001819	synonymous_variant	22843	exon1			GGAGCCGGAACCC	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.99G>C	chr17.hg19:g.56833457G>C		202.0	2.0	.		294.0	41.0	.	NM_014906	Q8N8J9|Q96DB8	Silent	SNP	ENST00000308249.2	hg19	CCDS11613.1																																																																																			.	.	.	weak		0.672	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
PPM1E	22843	hgsc.bcm.edu	37	17	56833490	56833490	+	Silent	SNP	G	G	A	rs59676153		TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr17:56833490G>A	ENST00000308249.2	+	1	261	c.132G>A	c.(130-132)gaG>gaA	p.E44E		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			ccgaacccgagtccgagcccg	0.706																																					p.E44E		Atlas-SNP	.											PPM1E,colon,carcinoma,0,1	PPM1E	97	.	0			c.G132A						PASS	.																																			SO:0001819	synonymous_variant	22843	exon1			ACCCGAGTCCGAG	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.132G>A	chr17.hg19:g.56833490G>A		206.0	0.0	.		307.0	35.0	.	NM_014906	Q8N8J9|Q96DB8	Silent	SNP	ENST00000308249.2	hg19	CCDS11613.1																																																																																			.	.	.	weak		0.706	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
PPM1E	22843	hgsc.bcm.edu	37	17	56833497	56833497	+	Missense_Mutation	SNP	C	C	T	rs61052860		TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr17:56833497C>T	ENST00000308249.2	+	1	268	c.139C>T	c.(139-141)Ccc>Tcc	p.P47S		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			cgagtccgagcccgagcccga	0.701																																					p.P47S		Atlas-SNP	.											PPM1E,colon,carcinoma,0,1	PPM1E	97	.	0			c.C139T						PASS	.						15.0	17.0	16.0					17																	56833497		2188	4270	6458	SO:0001583	missense	22843	exon1			TCCGAGCCCGAGC	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.139C>T	chr17.hg19:g.56833497C>T	ENSP00000312411:p.Pro47Ser	204.0	0.0	.		317.0	16.0	.	NM_014906	Q8N8J9|Q96DB8	Missense_Mutation	SNP	ENST00000308249.2	hg19	CCDS11613.1	.	.	.	.	.	.	.	.	.	.	C	9.492	1.100828	0.20552	.	.	ENSG00000175175	ENST00000308249	T	0.22336	1.96	4.15	3.1	0.35709	.	.	.	.	.	T	0.09202	0.0227	N	0.14661	0.345	0.23192	N	0.998149	P	0.36909	0.573	B	0.32342	0.144	T	0.08452	-1.0721	9	0.02654	T	1	1.9125	10.3339	0.43839	0.0:0.7991:0.2009:0.0	rs61052860	47	Q8WY54-2	.	S	47	ENSP00000312411:P47S	ENSP00000312411:P47S	P	+	1	0	PPM1E	54188496	0.741000	0.28217	1.000000	0.80357	0.229000	0.25112	1.208000	0.32345	2.017000	0.59298	0.462000	0.41574	CCC	.	C|0.900;T|0.100	0.100	weak		0.701	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
MGAT5B	146664	hgsc.bcm.edu	37	17	74943970	74943970	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr17:74943970T>C	ENST00000569840.2	+	17	2556	c.1982T>C	c.(1981-1983)tTt>tCt	p.F661S	MGAT5B_ENST00000428789.2_Missense_Mutation_p.F670S|RP11-87G24.3_ENST00000564292.1_RNA|MGAT5B_ENST00000301618.4_Missense_Mutation_p.F659S	NM_001199172.1	NP_001186101.1	Q3V5L5	MGT5B_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B	661					protein N-linked glycosylation (GO:0006487)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(15)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CAGAGCCCCTTTGTCCTGGCC	0.706																																					p.F670S		Atlas-SNP	.											.	MGAT5B	98	.	0			c.T2009C						PASS	.						34.0	33.0	34.0					17																	74943970		2202	4300	6502	SO:0001583	missense	146664	exon15			GCCCCTTTGTCCT	AB109185	CCDS11751.1, CCDS45788.1, CCDS59299.1	17q25.3	2013-02-25	2005-11-16		ENSG00000167889	ENSG00000167889		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	24140	protein-coding gene	gene with protein product		612441	"""mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isoenzyme B"""			14617637, 14623122	Standard	NM_001199172		Approved	GnT-IX, FLJ25132, GnT-VB	uc002jth.3	Q3V5L5	OTTHUMG00000177278	ENST00000569840.2:c.1982T>C	chr17.hg19:g.74943970T>C	ENSP00000456037:p.Phe661Ser	112.0	0.0	.		141.0	25.0	.	NM_198955	Q6P3S8|Q6P6B3|Q766X5|Q76D04|Q96LS2	Missense_Mutation	SNP	ENST00000569840.2	hg19	CCDS59299.1	.	.	.	.	.	.	.	.	.	.	T	6.753	0.507770	0.12883	.	.	ENSG00000167889	ENST00000301618;ENST00000428789	T;T	0.42900	0.97;0.96	4.66	3.34	0.38264	.	0.269957	0.36167	N	0.002753	T	0.28466	0.0704	L	0.34521	1.04	0.09310	N	0.999997	B;B;B	0.16802	0.019;0.004;0.001	B;B;B	0.17722	0.019;0.002;0.001	T	0.10753	-1.0616	10	0.32370	T	0.25	-9.8741	7.6968	0.28600	0.0:0.1868:0.0:0.8132	.	66;670;659	Q3V5L5-4;Q3V5L5-2;Q3V5L5-5	.;.;.	S	659;670	ENSP00000301618:F659S;ENSP00000391227:F670S	ENSP00000301618:F659S	F	+	2	0	MGAT5B	72455565	0.108000	0.22018	0.935000	0.37517	0.286000	0.27126	2.066000	0.41452	1.731000	0.51592	0.455000	0.32223	TTT	.	.	.	none		0.706	MGAT5B-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460624.2	NM_144677	
LPIN2	9663	hgsc.bcm.edu	37	18	2931299	2931299	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr18:2931299G>C	ENST00000261596.4	-	9	1649	c.1411C>G	c.(1411-1413)Ctc>Gtc	p.L471V		NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	471					cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		CAAAGGGAGAGGGTAACGTCA	0.542																																					p.L471V		Atlas-SNP	.											.	LPIN2	75	.	0			c.C1411G						PASS	.						68.0	61.0	63.0					18																	2931299		2203	4300	6503	SO:0001583	missense	9663	exon9			GGGAGAGGGTAAC	D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.1411C>G	chr18.hg19:g.2931299G>C	ENSP00000261596:p.Leu471Val	49.0	0.0	.		41.0	15.0	.	NM_014646	A7MD25|D3DUH3	Missense_Mutation	SNP	ENST00000261596.4	hg19	CCDS11829.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.465248	0.84425	.	.	ENSG00000101577	ENST00000261596	D	0.84730	-1.89	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.92993	0.7770	M	0.87269	2.87	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	D	0.93312	0.6685	10	0.62326	D	0.03	-22.4301	14.5421	0.68002	0.0695:0.0:0.9305:0.0	.	471	Q92539	LPIN2_HUMAN	V	471	ENSP00000261596:L471V	ENSP00000261596:L471V	L	-	1	0	LPIN2	2921299	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.252000	0.72447	2.815000	0.96918	0.650000	0.86243	CTC	.	.	.	none		0.542	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254363.2	NM_014646	
EPB41L3	23136	hgsc.bcm.edu	37	18	5395104	5395104	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr18:5395104T>C	ENST00000341928.2	-	21	3455	c.3115A>G	c.(3115-3117)Ata>Gta	p.I1039V	EPB41L3_ENST00000542146.1_Missense_Mutation_p.I344V|EPB41L3_ENST00000540638.2_Missense_Mutation_p.I817V|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000427684.2_Missense_Mutation_p.I336V|EPB41L3_ENST00000400111.3_Missense_Mutation_p.I817V|EPB41L3_ENST00000342933.3_Missense_Mutation_p.I1039V|EPB41L3_ENST00000544123.1_Missense_Mutation_p.I870V	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	1039	C-terminal (CTD).				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						GTGATGACTATTCGCTTCTCA	0.453																																					p.I1039V		Atlas-SNP	.											.	EPB41L3	222	.	0			c.A3115G						PASS	.						148.0	126.0	134.0					18																	5395104		2203	4300	6503	SO:0001583	missense	23136	exon21			TGACTATTCGCTT	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.3115A>G	chr18.hg19:g.5395104T>C	ENSP00000343158:p.Ile1039Val	80.0	0.0	.		79.0	24.0	.	NM_012307	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	hg19	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	T	28.5	4.926796	0.92319	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000427684;ENST00000542146;ENST00000342933;ENST00000400111	D;D;D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57;-1.57;-1.57	5.93	5.93	0.95920	Band 4.1, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90590	0.7050	M	0.72479	2.2	0.80722	D	1	P;P;D;D;D;P;D;D	0.71674	0.858;0.943;0.995;0.962;0.993;0.923;0.998;0.998	P;D;D;P;D;P;D;D	0.87578	0.856;0.946;0.992;0.883;0.987;0.54;0.998;0.991	D	0.91479	0.5203	10	0.87932	D	0	.	16.3943	0.83563	0.0:0.0:0.0:1.0	.	870;336;344;431;708;817;1039;274	F5GX05;E7EUF8;F5H7W5;B7Z8M8;A8K968;Q9Y2J2-2;Q9Y2J2;B3KT50	.;.;.;.;.;.;E41L3_HUMAN;.	V	1039;708;870;708;336;344;1039;817	ENSP00000343158:I1039V;ENSP00000441174:I870V;ENSP00000392195:I336V;ENSP00000442233:I344V;ENSP00000341138:I1039V;ENSP00000382981:I817V	ENSP00000343158:I1039V	I	-	1	0	EPB41L3	5385104	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	7.991000	0.88244	2.281000	0.76405	0.533000	0.62120	ATA	.	.	.	none		0.453	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
PTPRM	5797	hgsc.bcm.edu	37	18	8244180	8244180	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr18:8244180A>G	ENST00000332175.8	+	15	3462	c.2425A>G	c.(2425-2427)Atg>Gtg	p.M809V	PTPRM_ENST00000580170.1_Missense_Mutation_p.M809V|PTPRM_ENST00000400053.4_Missense_Mutation_p.M747V|PTPRM_ENST00000444013.1_Missense_Mutation_p.M596V|PTPRM_ENST00000400060.4_Missense_Mutation_p.M809V	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	809					homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				TTTCTCATTCATGGACACGCA	0.483																																					p.M809V		Atlas-SNP	.											.	PTPRM	185	.	0			c.A2425G						PASS	.						153.0	134.0	141.0					18																	8244180		2203	4300	6503	SO:0001583	missense	5797	exon15			TCATTCATGGACA	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.2425A>G	chr18.hg19:g.8244180A>G	ENSP00000331418:p.Met809Val	125.0	0.0	.		135.0	42.0	.	NM_001105244	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	hg19	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	A	13.14	2.147098	0.37923	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.44881	1.3;1.23;1.05;0.91	5.71	4.56	0.56223	.	0.080339	0.85682	D	0.000000	T	0.40272	0.1110	M	0.62723	1.935	0.52501	D	0.999953	B;B;B	0.18461	0.028;0.0;0.0	B;B;B	0.17722	0.019;0.0;0.001	T	0.19031	-1.0318	10	0.35671	T	0.21	.	11.5687	0.50822	0.9303:0.0:0.0697:0.0	.	596;809;809	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	V	809;809;747;596	ENSP00000331418:M809V;ENSP00000382933:M809V;ENSP00000382927:M747V;ENSP00000387608:M596V	ENSP00000331418:M809V	M	+	1	0	PTPRM	8234180	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.121000	0.71602	1.003000	0.39130	0.455000	0.32223	ATG	.	.	.	none		0.483	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
PTPRM	5797	hgsc.bcm.edu	37	18	8380303	8380303	+	Nonsense_Mutation	SNP	C	C	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr18:8380303C>T	ENST00000332175.8	+	27	4794	c.3757C>T	c.(3757-3759)Cag>Tag	p.Q1253*	PTPRM_ENST00000580170.1_Nonsense_Mutation_p.Q1266*|PTPRM_ENST00000400053.4_Nonsense_Mutation_p.Q1191*|PTPRM_ENST00000444013.1_Nonsense_Mutation_p.Q1040*|PTPRM_ENST00000400060.4_Nonsense_Mutation_p.Q1267*	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1253	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GAGCTATAAACAGCCTTCAGC	0.423																																					p.Q1266X		Atlas-SNP	.											.	PTPRM	185	.	0			c.C3796T						PASS	.						85.0	78.0	80.0					18																	8380303		2203	4300	6503	SO:0001587	stop_gained	5797	exon29			TATAAACAGCCTT	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.3757C>T	chr18.hg19:g.8380303C>T	ENSP00000331418:p.Gln1253*	75.0	0.0	.		58.0	22.0	.	NM_001105244	A7MBN1|D3DUH8|J3QL11	Nonsense_Mutation	SNP	ENST00000332175.8	hg19	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	C	51	17.626486	0.99890	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	.	.	.	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	20.1184	0.97949	0.0:1.0:0.0:0.0	.	.	.	.	X	1253;1267;1191;1040	.	ENSP00000331418:Q1253X	Q	+	1	0	PTPRM	8370303	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.769000	0.95229	0.655000	0.94253	CAG	.	.	.	none		0.423	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
KDSR	2531	hgsc.bcm.edu	37	18	61018276	61018276	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr18:61018276G>T	ENST00000406396.3	-	6	845	c.454C>A	c.(454-456)Ccc>Acc	p.P152T	KDSR_ENST00000326575.5_Intron	NM_002035.2	NP_002026.1	Q06136	KDSR_HUMAN	3-ketodihydrosphingosine reductase	152					3-keto-sphinganine metabolic process (GO:0006666)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3-dehydrosphinganine reductase activity (GO:0047560)			endometrium(2)|large_intestine(2)|lung(3)|skin(1)|stomach(1)	9						GCCCGGCTGGGGTACACGCTG	0.552																																					p.P152T		Atlas-SNP	.											.	KDSR	17	.	0			c.C454A						PASS	.						75.0	74.0	75.0					18																	61018276		2203	4300	6503	SO:0001583	missense	2531	exon6			GGCTGGGGTACAC		CCDS11982.1	18q21	2011-09-20	2008-02-20	2008-02-20	ENSG00000119537	ENSG00000119537	1.1.1.102	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	4021	protein-coding gene	gene with protein product	"""3-dehydrosphinganine reductase"", ""short chain dehydrogenase/reductase family 35C, member 1"""	136440	"""follicular lymphoma variant translocation 1"""	FVT1		8417785, 15328338, 17420465, 19027726	Standard	NM_002035		Approved	DHSR, SDR35C1	uc010dpw.3	Q06136	OTTHUMG00000132792	ENST00000406396.3:c.454C>A	chr18.hg19:g.61018276G>T	ENSP00000385083:p.Pro152Thr	100.0	0.0	.		102.0	32.0	.	NM_002035	B2R5Y1|B4DMX0	Missense_Mutation	SNP	ENST00000406396.3	hg19	CCDS11982.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.987666	0.74589	.	.	ENSG00000119537	ENST00000406396	D	0.86769	-2.17	5.95	5.95	0.96441	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.76026	0.3930	N	0.00560	-1.38	0.80722	D	1	D	0.58970	0.984	P	0.54815	0.761	T	0.78558	-0.2158	10	0.10377	T	0.69	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	152	Q06136	KDSR_HUMAN	T	152	ENSP00000385083:P152T	ENSP00000385083:P152T	P	-	1	0	KDSR	59169256	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.617000	0.67716	2.824000	0.97209	0.655000	0.94253	CCC	.	.	.	none		0.552	KDSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256200.2		
JSRP1	126306	hgsc.bcm.edu	37	19	2254452	2254452	+	Missense_Mutation	SNP	C	C	T	rs566252055		TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr19:2254452C>T	ENST00000300961.6	-	3	203	c.139G>A	c.(139-141)Gtg>Atg	p.V47M	JSRP1_ENST00000586471.2_Missense_Mutation_p.V47M	NM_144616.3	NP_653217.1	Q96MG2	JSPR1_HUMAN	junctional sarcoplasmic reticulum protein 1	47	Mediates interaction with CACNA1S. {ECO:0000250}.				protein localization to membrane (GO:0072657)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|skeletal muscle contraction (GO:0003009)	membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|pancreas(1)|urinary_tract(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACGTGGGGCACGCTGCCGGAG	0.667													C|||	1	0.000199681	0.0	0.0	5008	,	,		15668	0.0		0.0	False		,,,				2504	0.001				p.V47M		Atlas-SNP	.											.	JSRP1	18	.	0			c.G139A						PASS	.						42.0	39.0	40.0					19																	2254452		2201	4300	6501	SO:0001583	missense	126306	exon3			GGGGCACGCTGCC	AK056978	CCDS12086.1	19p13.3	2010-03-23			ENSG00000167476	ENSG00000167476			24963	protein-coding gene	gene with protein product	"""homolog of mouse skeletal muscle sarcoplasmic reticulum protein JP-45"""	608743				12871958	Standard	NM_144616		Approved	JP-45, FLJ32416	uc002lvj.2	Q96MG2		ENST00000300961.6:c.139G>A	chr19.hg19:g.2254452C>T	ENSP00000300961:p.Val47Met	103.0	0.0	.		110.0	36.0	.	NM_144616		Missense_Mutation	SNP	ENST00000300961.6	hg19	CCDS12086.1	.	.	.	.	.	.	.	.	.	.	c	6.447	0.450553	0.12223	.	.	ENSG00000167476	ENST00000300961	T	0.18338	2.22	3.23	-4.87	0.03123	.	3.543170	0.00710	N	0.000821	T	0.06962	0.0177	N	0.08118	0	0.09310	N	1	P	0.36712	0.566	B	0.27887	0.084	T	0.16808	-1.0390	10	0.30854	T	0.27	0.0	6.6524	0.22969	0.2046:0.311:0.4844:0.0	.	47	Q96MG2	JSPR1_HUMAN	M	47	ENSP00000300961:V47M	ENSP00000300961:V47M	V	-	1	0	JSRP1	2205452	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.189000	0.09629	-1.280000	0.02402	-2.474000	0.00201	GTG	.	.	.	none		0.667	JSRP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451266.2	NM_144616	
PRAM1	84106	hgsc.bcm.edu	37	19	8563902	8563902	+	Missense_Mutation	SNP	G	G	T	rs564707710		TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr19:8563902G>T	ENST00000423345.4	-	2	1310	c.790C>A	c.(790-792)Cgc>Agc	p.R264S	PRAM1_ENST00000255612.3_Missense_Mutation_p.R264S			Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1	312	Pro-rich.				integrin-mediated signaling pathway (GO:0007229)|regulation of neutrophil degranulation (GO:0043313)		lipid binding (GO:0008289)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)	19						CTGGAGTCGCGCTTCGGCTCG	0.647																																					p.R264S		Atlas-SNP	.											.	PRAM1	53	.	0			c.C790A						PASS	.						35.0	40.0	38.0					19																	8563902		2177	4280	6457	SO:0001583	missense	84106	exon2			AGTCGCGCTTCGG	BC028012	CCDS45954.1, CCDS45954.2	19p13.2	2009-01-21				ENSG00000133246			30091	protein-coding gene	gene with protein product		606466				11301322, 15572693	Standard	NM_032152		Approved	PML-RAR	uc002mkd.3	Q96QH2		ENST00000423345.4:c.790C>A	chr19.hg19:g.8563902G>T	ENSP00000408342:p.Arg264Ser	89.0	0.0	.		71.0	4.0	.	NM_032152	Q8N6W7	Missense_Mutation	SNP	ENST00000423345.4	hg19	CCDS45954.2	.	.	.	.	.	.	.	.	.	.	G	2.680	-0.275657	0.05679	.	.	ENSG00000133246	ENST00000255612;ENST00000423345	T;T	0.13089	2.62;2.62	3.91	1.63	0.23807	.	.	.	.	.	T	0.06554	0.0168	N	0.08118	0	0.09310	N	1	B;B	0.25563	0.012;0.129	B;B	0.28385	0.089;0.049	T	0.42716	-0.9435	9	0.09590	T	0.72	.	9.9374	0.41559	0.0:0.4064:0.5936:0.0	.	264;312	Q96QH2-2;Q96QH2	.;PRAM_HUMAN	S	264	ENSP00000255612:R264S;ENSP00000408342:R264S	ENSP00000255612:R264S	R	-	1	0	PRAM1	8469902	0.001000	0.12720	0.009000	0.14445	0.002000	0.02628	0.646000	0.24797	0.558000	0.29135	0.591000	0.81541	CGC	.	.	.	none		0.647	PRAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397040.3	NM_032152	
ATG4D	84971	hgsc.bcm.edu	37	19	10662945	10662945	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr19:10662945G>A	ENST00000309469.4	+	9	1360	c.1187G>A	c.(1186-1188)gGc>gAc	p.G396D	MIR1238_ENST00000408483.1_RNA|ATG4D_ENST00000540862.1_Missense_Mutation_p.G63D|RNU7-140P_ENST00000459546.1_RNA	NM_032885.4	NP_116274.3	Q86TL0	ATG4D_HUMAN	autophagy related 4D, cysteine peptidase	396					apoptotic process (GO:0006915)|autophagy (GO:0006914)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	19			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			TGTACCGTGGGCTTCTATGCT	0.612																																					p.G396D		Atlas-SNP	.											.	ATG4D	47	.	0			c.G1187A						PASS	.						72.0	64.0	66.0					19																	10662945		2203	4300	6503	SO:0001583	missense	84971	exon9			CCGTGGGCTTCTA	AJ312332	CCDS12241.1	19p13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000130734	ENSG00000130734			20789	protein-coding gene	gene with protein product		611340	"""AUT-like 4, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog D (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog D (S. cerevisiae)"""	AUTL4, APG4D		12446702	Standard	NM_032885		Approved	APG4-D	uc002mov.3	Q86TL0	OTTHUMG00000180582	ENST00000309469.4:c.1187G>A	chr19.hg19:g.10662945G>A	ENSP00000311318:p.Gly396Asp	48.0	0.0	.		49.0	18.0	.	NM_032885	Q969K0	Missense_Mutation	SNP	ENST00000309469.4	hg19	CCDS12241.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.820094	0.90873	.	.	ENSG00000130734	ENST00000309469;ENST00000540862	T	0.56776	0.44	5.28	5.28	0.74379	.	0.049049	0.85682	D	0.000000	T	0.77438	0.4130	M	0.91768	3.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.82238	-0.0556	10	0.87932	D	0	-24.6618	13.7396	0.62840	0.0:0.1548:0.8452:0.0	.	333;396	B4DGM8;Q86TL0	.;ATG4D_HUMAN	D	396;63	ENSP00000311318:G396D	ENSP00000311318:G396D	G	+	2	0	ATG4D	10523945	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.438000	0.80431	2.635000	0.89317	0.561000	0.74099	GGC	.	.	.	none		0.612	ATG4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452022.1	NM_032885	
DOCK6	57572	hgsc.bcm.edu	37	19	11358812	11358812	+	Missense_Mutation	SNP	G	G	A	rs546562962		TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr19:11358812G>A	ENST00000294618.7	-	7	747	c.736C>T	c.(736-738)Cgc>Tgc	p.R246C		NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	246					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						CGGCTACAGCGTTCCACGGCT	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		16037	0.001		0.0	False		,,,				2504	0.0				p.R246C		Atlas-SNP	.											.	DOCK6	104	.	0			c.C736T						PASS	.						29.0	33.0	31.0					19																	11358812		1940	4127	6067	SO:0001583	missense	57572	exon7			TACAGCGTTCCAC		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.736C>T	chr19.hg19:g.11358812G>A	ENSP00000294618:p.Arg246Cys	44.0	0.0	.		51.0	17.0	.	NM_020812	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	ENST00000294618.7	hg19	CCDS45975.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.960106	0.53400	.	.	ENSG00000130158	ENST00000294618	T	0.18502	2.21	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.43033	0.1229	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.66351	0.943	T	0.46247	-0.9205	10	0.66056	D	0.02	-27.3549	15.4991	0.75680	0.0:0.0:1.0:0.0	.	246	Q96HP0	DOCK6_HUMAN	C	246	ENSP00000294618:R246C	ENSP00000294618:R246C	R	-	1	0	DOCK6	11219812	1.000000	0.71417	0.998000	0.56505	0.431000	0.31685	2.251000	0.43187	2.240000	0.73641	0.462000	0.41574	CGC	.	.	.	none		0.592	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	
ZNF799	90576	hgsc.bcm.edu	37	19	12502155	12502155	+	Missense_Mutation	SNP	T	T	G	rs201335235		TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr19:12502155T>G	ENST00000430385.3	-	4	1257	c.1057A>C	c.(1057-1059)Aaa>Caa	p.K353Q	ZNF799_ENST00000419318.1_Missense_Mutation_p.K321Q|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	353					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						TCATGACTTTTCAGTGAACTA	0.413																																					p.K353Q		Atlas-SNP	.											.	ZNF799	111	.	0			c.A1057C						PASS	.						160.0	156.0	157.0					19																	12502155		2203	4300	6503	SO:0001583	missense	90576	exon4			GACTTTTCAGTGA	BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1057A>C	chr19.hg19:g.12502155T>G	ENSP00000411084:p.Lys353Gln	98.0	0.0	.		77.0	6.0	.	NM_001080821		Missense_Mutation	SNP	ENST00000430385.3	hg19	CCDS45989.1	.	.	.	.	.	.	.	.	.	.	G	0.033	-1.323810	0.01309	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	T;T	0.04406	3.63;3.63	1.31	-1.61	0.08399	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02418	0.0074	N	0.12527	0.23	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.49041	-0.8980	9	0.14252	T	0.57	.	6.8386	0.23951	0.0:0.0:0.2963:0.7037	.	353	Q96GE5	ZN799_HUMAN	Q	321;353	ENSP00000415278:K321Q;ENSP00000411084:K353Q	ENSP00000415278:K321Q	K	-	1	0	ZNF799	12363155	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.687000	0.05156	-0.936000	0.03723	-1.919000	0.00516	AAA	.	.	.	weak		0.413	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344099.2	NM_001080821	
COLGALT1	79709	hgsc.bcm.edu	37	19	17670124	17670124	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr19:17670124G>A	ENST00000252599.4	+	2	385	c.265G>A	c.(265-267)Gct>Act	p.A89T		NM_024656.2	NP_078932.2	Q8NBJ5	GT251_HUMAN	collagen beta(1-O)galactosyltransferase 1	89					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	procollagen galactosyltransferase activity (GO:0050211)										CTGCAGGGTGGCTACGGACCA	0.612																																					p.A89T		Atlas-SNP	.											.	.	.	.	0			c.G265A						PASS	.						133.0	97.0	109.0					19																	17670124		2129	4145	6274	SO:0001583	missense	79709	exon2			AGGGTGGCTACGG	AK075541	CCDS12363.1	19p13.11	2013-02-27	2013-02-27	2013-02-27	ENSG00000130309	ENSG00000130309			26182	protein-coding gene	gene with protein product			"""glycosyltransferase 25 domain containing 1"""	GLT25D1		19075007	Standard	NM_024656		Approved	FLJ22329	uc002nhc.1	Q8NBJ5		ENST00000252599.4:c.265G>A	chr19.hg19:g.17670124G>A	ENSP00000252599:p.Ala89Thr	81.0	0.0	.		88.0	25.0	.	NM_024656	Q8NC64	Missense_Mutation	SNP	ENST00000252599.4	hg19	CCDS12363.1	.	.	.	.	.	.	.	.	.	.	G	19.36	3.811846	0.70797	.	.	ENSG00000130309	ENST00000252599	D	0.85171	-1.95	3.65	3.65	0.41850	.	0.116516	0.56097	D	0.000023	D	0.90140	0.6919	M	0.74546	2.27	0.58432	D	0.999999	D	0.56287	0.975	D	0.65573	0.936	D	0.88542	0.3110	10	0.27082	T	0.32	-16.0455	13.2343	0.59961	0.0:0.0:1.0:0.0	.	89	Q8NBJ5	GT251_HUMAN	T	89	ENSP00000252599:A89T	ENSP00000252599:A89T	A	+	1	0	GLT25D1	17531124	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.636000	0.98440	1.773000	0.52216	0.423000	0.28283	GCT	.	.	.	none		0.612	COLGALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464216.1	NM_024656	
ZNF536	9745	hgsc.bcm.edu	37	19	31039335	31039335	+	Nonsense_Mutation	SNP	A	A	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr19:31039335A>T	ENST00000355537.3	+	4	2956	c.2809A>T	c.(2809-2811)Aag>Tag	p.K937*		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	937					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GAAGGACATGAAGGACAAAGC	0.507																																					p.K937X		Atlas-SNP	.											.	ZNF536	424	.	0			c.A2809T						PASS	.						154.0	162.0	159.0					19																	31039335		2203	4300	6503	SO:0001587	stop_gained	9745	exon4			GACATGAAGGACA		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2809A>T	chr19.hg19:g.31039335A>T	ENSP00000347730:p.Lys937*	48.0	0.0	.		70.0	16.0	.	NM_014717	A2RU18	Nonsense_Mutation	SNP	ENST00000355537.3	hg19	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	A	36	5.608908	0.96637	.	.	ENSG00000198597	ENST00000355537	.	.	.	5.42	4.41	0.53225	.	0.210674	0.50627	D	0.000108	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-32.4704	11.24	0.48964	0.9279:0.0:0.0721:0.0	.	.	.	.	X	937	.	ENSP00000347730:K937X	K	+	1	0	ZNF536	35731175	1.000000	0.71417	0.897000	0.35233	0.918000	0.54935	4.613000	0.61176	0.890000	0.36211	0.402000	0.26972	AAG	.	.	.	none		0.507	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
GPATCH1	55094	hgsc.bcm.edu	37	19	33597758	33597758	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr19:33597758T>G	ENST00000170564.2	+	10	1552	c.1238T>G	c.(1237-1239)cTg>cGg	p.L413R		NM_018025.2	NP_060495.2	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	413					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|prostate(4)|skin(4)	40	Esophageal squamous(110;0.137)					AAGCACCAACTGAATGCCTCC	0.493																																					p.L413R	Pancreas(67;88 1713 4567 18227)	Atlas-SNP	.											.	GPATCH1	79	.	0			c.T1238G						PASS	.						102.0	78.0	86.0					19																	33597758		2203	4300	6503	SO:0001583	missense	55094	exon10			ACCAACTGAATGC	AF434677	CCDS12428.1	19q13.12	2013-01-28		2006-12-13		ENSG00000076650		"""G patch domain containing"""	24658	protein-coding gene	gene with protein product	"""evolutionarily conserved G patch domain containing"""			GPATC1		12477932	Standard	NM_018025		Approved	ECGP, FLJ10206, FLJ38686	uc002nug.1	Q9BRR8		ENST00000170564.2:c.1238T>G	chr19.hg19:g.33597758T>G	ENSP00000170564:p.Leu413Arg	113.0	0.0	.		137.0	51.0	.	NM_018025	Q8IZV6|Q8N3B7|Q9NW94	Missense_Mutation	SNP	ENST00000170564.2	hg19	CCDS12428.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.411269	0.83340	.	.	ENSG00000076650	ENST00000170564	T	0.37915	1.17	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.65322	0.2680	M	0.87381	2.88	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.72117	-0.4387	10	0.72032	D	0.01	-9.9437	14.873	0.70474	0.0:0.0:0.0:1.0	.	413	Q9BRR8	GPTC1_HUMAN	R	413	ENSP00000170564:L413R	ENSP00000170564:L413R	L	+	2	0	GPATCH1	38289598	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	6.656000	0.74396	2.175000	0.68902	0.533000	0.62120	CTG	.	.	.	none		0.493	GPATCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450834.1	NM_018025	
ZNF790	388536	hgsc.bcm.edu	37	19	37314679	37314679	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr19:37314679C>T	ENST00000356725.4	-	3	143	c.23G>A	c.(22-24)aGg>aAg	p.R8K	CTD-2162K18.5_ENST00000587278.1_RNA|CTD-2162K18.5_ENST00000588906.1_RNA	NM_001242802.1|NM_206894.3	NP_001229731.1|NP_996777.2	Q6PG37	ZN790_HUMAN	zinc finger protein 790	8	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	32	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			AGCCACATCCCTGAACATCAT	0.388																																					p.R8K		Atlas-SNP	.											.	ZNF790	89	.	0			c.G23A						PASS	.						76.0	75.0	75.0					19																	37314679		2203	4300	6503	SO:0001583	missense	388536	exon3			ACATCCCTGAACA	BC057245	CCDS12496.1	19q13.12	2013-01-08			ENSG00000197863	ENSG00000197863		"""Zinc fingers, C2H2-type"", ""-"""	33114	protein-coding gene	gene with protein product							Standard	NM_206894		Approved	MGC62100, FLJ20350	uc021utm.1	Q6PG37	OTTHUMG00000165616	ENST00000356725.4:c.23G>A	chr19.hg19:g.37314679C>T	ENSP00000349161:p.Arg8Lys	113.0	0.0	.		78.0	12.0	.	NM_206894		Missense_Mutation	SNP	ENST00000356725.4	hg19	CCDS12496.1	.	.	.	.	.	.	.	.	.	.	C	15.12	2.739068	0.49045	.	.	ENSG00000197863	ENST00000356725;ENST00000528994;ENST00000525288;ENST00000527645	T;T;T;T	0.01369	4.97;4.97;4.97;4.97	3.53	-0.991	0.10235	Krueppel-associated box (4);	.	.	.	.	T	0.01029	0.0034	N	0.25286	0.73	0.22127	N	0.999348	B	0.14012	0.009	B	0.18561	0.022	T	0.48422	-0.9037	9	0.10902	T	0.67	.	5.9232	0.19094	0.0:0.4735:0.0:0.5265	.	8	Q6PG37	ZN790_HUMAN	K	8	ENSP00000349161:R8K;ENSP00000435944:R8K;ENSP00000433389:R8K;ENSP00000434537:R8K	ENSP00000349161:R8K	R	-	2	0	ZNF790	42006519	0.025000	0.19082	0.467000	0.27180	0.667000	0.39255	-0.407000	0.07178	0.006000	0.14734	0.585000	0.79938	AGG	.	.	.	none		0.388	ZNF790-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385341.2	NM_206894	
PLD3	23646	hgsc.bcm.edu	37	19	40883752	40883752	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr19:40883752C>G	ENST00000409587.1	+	12	1642	c.1245C>G	c.(1243-1245)aaC>aaG	p.N415K	PLD3_ENST00000409419.1_Missense_Mutation_p.N415K|PLD3_ENST00000409281.1_Missense_Mutation_p.N415K|PLD3_ENST00000356508.5_Missense_Mutation_p.N415K|PLD3_ENST00000409735.4_Missense_Mutation_p.N415K			Q8IV08	PLD3_HUMAN	phospholipase D family, member 3	415	PLD phosphodiesterase 2. {ECO:0000255|PROSITE-ProRule:PRU00153}.				cell death (GO:0008219)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phospholipase D activity (GO:0004630)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20			Lung(22;0.000636)|LUSC - Lung squamous cell carcinoma(20;0.00248)			CCCGTGTCAACCACAACAAGT	0.602																																					p.N415K		Atlas-SNP	.											.	PLD3	71	.	0			c.C1245G						PASS	.						85.0	68.0	74.0					19																	40883752		2203	4300	6503	SO:0001583	missense	23646	exon12			TGTCAACCACAAC	BC000553	CCDS33027.1	19q13.2	2014-03-14	2005-05-20		ENSG00000105223	ENSG00000105223			17158	protein-coding gene	gene with protein product		615698	"""phospholipase D3"""			9140189, 15794758	Standard	XM_005258704		Approved	HU-K4	uc002onj.4	Q8IV08	OTTHUMG00000152736	ENST00000409587.1:c.1245C>G	chr19.hg19:g.40883752C>G	ENSP00000387050:p.Asn415Lys	125.0	0.0	.		117.0	39.0	.	NM_012268	Q92853|Q9BW87	Missense_Mutation	SNP	ENST00000409587.1	hg19	CCDS33027.1	.	.	.	.	.	.	.	.	.	.	C	19.81	3.896740	0.72639	.	.	ENSG00000105223	ENST00000409419;ENST00000409587;ENST00000356508;ENST00000409735;ENST00000409281	T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59	4.96	1.68	0.24146	Phospholipase D/Transphosphatidylase (2);	0.047083	0.85682	D	0.000000	T	0.68229	0.2978	M	0.92833	3.35	0.58432	D	0.999999	P	0.50819	0.939	P	0.55087	0.768	T	0.69480	-0.5134	10	0.72032	D	0.01	-12.6506	6.2698	0.20949	0.0:0.6146:0.0:0.3854	.	415	Q8IV08	PLD3_HUMAN	K	415	ENSP00000386293:N415K;ENSP00000387050:N415K;ENSP00000348901:N415K;ENSP00000386938:N415K;ENSP00000387022:N415K	ENSP00000348901:N415K	N	+	3	2	PLD3	45575592	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	1.648000	0.37271	0.609000	0.30018	-0.136000	0.14681	AAC	.	.	.	none		0.602	PLD3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327721.1	NM_012268	
PAFAH1B3	5050	hgsc.bcm.edu	37	19	42804227	42804227	+	Silent	SNP	C	C	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr19:42804227C>T	ENST00000262890.3	-	4	564	c.303G>A	c.(301-303)gtG>gtA	p.V101V	PRR19_ENST00000341747.3_5'Flank|PRR19_ENST00000598490.1_5'Flank|PAFAH1B3_ENST00000538771.1_Silent_p.V101V	NM_002573.3	NP_002564.1	Q15102	PA1B3_HUMAN	platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)	101					brain development (GO:0007420)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)			breast(1)|large_intestine(2)|ovary(1)	4		Prostate(69;0.0704)				TGTTGGTGCCCACCCAGACCA	0.587																																					p.V101V		Atlas-SNP	.											.	PAFAH1B3	12	.	0			c.G303A						PASS	.						112.0	103.0	106.0					19																	42804227		2203	4300	6503	SO:0001819	synonymous_variant	5050	exon5			GGTGCCCACCCAG	D63391	CCDS12602.1	19q13.1	2011-10-24	2010-02-10			ENSG00000079462			8576	protein-coding gene	gene with protein product	"""PAF-AH1b alpha 1 subunit"""	603074	"""platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit (29kD)"", ""platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa"", ""platelet-activating factor acetylhydrolase, isoform Ib, subunit 3 (29kDa)"""			7669037	Standard	NM_002573		Approved		uc010xwj.1	Q15102		ENST00000262890.3:c.303G>A	chr19.hg19:g.42804227C>T		61.0	0.0	.		91.0	20.0	.	NM_001145940	Q53X88	Silent	SNP	ENST00000262890.3	hg19	CCDS12602.1																																																																																			.	.	.	none		0.587	PAFAH1B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463726.1	NM_002573	
MEGF8	1954	hgsc.bcm.edu	37	19	42873075	42873075	+	Missense_Mutation	SNP	G	G	A	rs374088709		TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr19:42873075G>A	ENST00000251268.6	+	37	6562	c.6562G>A	c.(6562-6564)Gac>Aac	p.D2188N	MEGF8_ENST00000334370.4_Missense_Mutation_p.D2121N|MEGF8_ENST00000378073.4_5'Flank	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2188	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CGGGCACCACGACTGCAACGA	0.647																																					p.D2188N		Atlas-SNP	.											.	MEGF8	358	.	0			c.G6562A						PASS	.	G	ASN/ASP	0,4406		0,0,2203	85.0	88.0	87.0		6361	4.8	1.0	19		87	1,8599	1.2+/-3.3	0,1,4299	no	missense	MEGF8	NM_001410.2	23	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	2121/2779	42873075	1,13005	2203	4300	6503	SO:0001583	missense	1954	exon37			CACCACGACTGCA	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.6562G>A	chr19.hg19:g.42873075G>A	ENSP00000251268:p.Asp2188Asn	74.0	0.0	.		76.0	26.0	.	NM_001271938	A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	hg19		.	.	.	.	.	.	.	.	.	.	G	8.552	0.875736	0.17395	0.0	1.16E-4	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.40756	1.02;1.02	4.76	4.76	0.60689	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.168758	0.39475	N	0.001349	T	0.17874	0.0429	N	0.01817	-0.705	0.80722	D	1	P;P	0.46327	0.499;0.876	B;B	0.39738	0.048;0.308	T	0.16958	-1.0385	10	0.08837	T	0.75	-29.0533	16.9259	0.86176	0.0:0.0:1.0:0.0	.	2188;2121	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	N	2121;2188	ENSP00000334219:D2121N;ENSP00000251268:D2188N	ENSP00000251268:D2188N	D	+	1	0	MEGF8	47564915	1.000000	0.71417	0.989000	0.46669	0.248000	0.25809	4.142000	0.58044	2.375000	0.81037	0.561000	0.74099	GAC	.	.	.	weak		0.647	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
PTH2	113091	hgsc.bcm.edu	37	19	49926468	49926468	+	Splice_Site	SNP	C	C	A			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr19:49926468C>A	ENST00000270631.1	-	1	230		c.e1+1		CTD-3148I10.1_ENST00000576655.1_5'Flank	NM_178449.3	NP_848544.1	Q96A98	TIP39_HUMAN	parathyroid hormone 2						neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(262;0.0015)|GBM - Glioblastoma multiforme(486;0.044)|Lung(386;0.0785)|LUSC - Lung squamous cell carcinoma(496;0.0836)		CTGGCACCTACCTGAGGACCC	0.647																																					.		Atlas-SNP	.											.	PTH2	20	.	0			c.128+1G>T						PASS	.						25.0	32.0	30.0					19																	49926468		2203	4298	6501	SO:0001630	splice_region_variant	113091	exon2			CACCTACCTGAGG	AY037555	CCDS12763.1	19q13.33	2013-02-28				ENSG00000142538		"""Endogenous ligands"""	30828	protein-coding gene	gene with protein product	"""tuberoinfundibular 39 residues"""	608386				11861531	Standard	NM_178449		Approved	TIP39	uc002pnn.1	Q96A98		ENST00000270631.1:c.128+1G>T	chr19.hg19:g.49926468C>A		158.0	0.0	.		182.0	21.0	.	NM_178449	Q96DJ4	Splice_Site	SNP	ENST00000270631.1	hg19	CCDS12763.1	.	.	.	.	.	.	.	.	.	.	C	13.36	2.213488	0.39102	.	.	ENSG00000142538	ENST00000270631	.	.	.	4.17	3.04	0.35103	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6353	0.45560	0.1924:0.8076:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PTH2	54618280	1.000000	0.71417	0.901000	0.35422	0.274000	0.26718	1.941000	0.40233	2.047000	0.60756	0.306000	0.20318	.	.	.	.	none		0.647	PTH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465366.1	NM_178449	Intron
SCAF1	58506	hgsc.bcm.edu	37	19	50161046	50161046	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr19:50161046G>T	ENST00000360565.3	+	10	3771	c.3647G>T	c.(3646-3648)cGg>cTg	p.R1216L	IRF3_ENST00000599680.1_5'Flank	NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	1216	Necessary for interaction with the CTD domain of POLR2A.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		ACGCAGGAGCGGGCGGTGGAG	0.587																																					p.R1216L		Atlas-SNP	.											.	SCAF1	78	.	0			c.G3647T						PASS	.						68.0	49.0	56.0					19																	50161046		2203	4300	6503	SO:0001583	missense	58506	exon10			AGGAGCGGGCGGT	AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.3647G>T	chr19.hg19:g.50161046G>T	ENSP00000353769:p.Arg1216Leu	137.0	0.0	.		138.0	34.0	.	NM_021228	Q7Z5V7|Q8WVA1|Q9NR59	Missense_Mutation	SNP	ENST00000360565.3	hg19	CCDS33074.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.159295	0.78226	.	.	ENSG00000126461	ENST00000360565	T	0.56103	0.48	5.2	4.16	0.48862	.	0.105611	0.36591	N	0.002502	T	0.65302	0.2678	M	0.62088	1.915	0.52501	D	0.999958	D	0.61080	0.989	P	0.60789	0.879	T	0.69487	-0.5132	10	0.87932	D	0	-18.7043	12.7901	0.57528	0.0803:0.0:0.9197:0.0	.	1216	Q9H7N4	SFR19_HUMAN	L	1216	ENSP00000353769:R1216L	ENSP00000353769:R1216L	R	+	2	0	SCAF1	54852858	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.326000	0.72905	1.426000	0.47256	0.637000	0.83480	CGG	.	.	.	none		0.587	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465764.1	NM_021228	
PTOV1	53635	hgsc.bcm.edu	37	19	50357983	50357983	+	Silent	SNP	C	C	T	rs149977568		TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr19:50357983C>T	ENST00000601675.1	+	3	488	c.384C>T	c.(382-384)ggC>ggT	p.G128G	PTOV1_ENST00000391842.1_Silent_p.G128G|PTOV1_ENST00000599732.1_Silent_p.G128G|PTOV1_ENST00000221557.9_Silent_p.G96G|AC018766.6_ENST00000601211.1_RNA|PTOV1_ENST00000601638.1_Silent_p.G96G|MIR4749_ENST00000578197.1_RNA|PTOV1_ENST00000598325.1_3'UTR|PTOV1_ENST00000600603.1_Silent_p.G96G|AC018766.5_ENST00000593654.1_RNA			Q86YD1	PTOV1_HUMAN	prostate tumor overexpressed 1	128					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(5)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)	16		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.0132)		TGAACCAAGGCGAGAACCTGT	0.667																																					p.G128G		Atlas-SNP	.											PTOV1,colon,carcinoma,0,1	PTOV1	41	.	0			c.C384T						PASS	.	C		0,4406		0,0,2203	41.0	41.0	41.0		384	0.8	1.0	19	dbSNP_134	41	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PTOV1	NM_017432.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		128/417	50357983	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	53635	exon3			CCAAGGCGAGAAC	AF238381	CCDS12782.1	19q13.33	2014-08-28	2008-09-12		ENSG00000104960	ENSG00000104960			9632	protein-coding gene	gene with protein product		610195				12598323, 15713644	Standard	XM_005258998		Approved		uc002pqf.1	Q86YD1	OTTHUMG00000183162	ENST00000601675.1:c.384C>T	chr19.hg19:g.50357983C>T		83.0	0.0	.		81.0	27.0	.	NM_017432	Q6UXX7|Q96BU3|Q9HBN4|Q9NYL1	Silent	SNP	ENST00000601675.1	hg19	CCDS12782.1																																																																																			.	C|1.000;T|0.000	0.000	weak		0.667	PTOV1-007	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465347.1	NM_017432	
ZNF468	90333	hgsc.bcm.edu	37	19	53344638	53344638	+	Silent	SNP	T	T	C			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr19:53344638T>C	ENST00000595646.1	-	4	1029	c.909A>G	c.(907-909)gaA>gaG	p.E303E	ZNF468_ENST00000243639.4_3'UTR|ZNF468_ENST00000390651.4_Silent_p.E250E|ZNF468_ENST00000396409.4_Silent_p.E250E|ZNF28_ENST00000594602.1_Intron			Q5VIY5	ZN468_HUMAN	zinc finger protein 468	303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(3)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(134;0.0358)		CTTTGTCACATTCTTCACATT	0.393																																					p.E303E		Atlas-SNP	.											.	ZNF468	46	.	0			c.A909G						PASS	.						124.0	124.0	124.0					19																	53344638		2203	4300	6503	SO:0001819	synonymous_variant	90333	exon4			GTCACATTCTTCA	AK023558	CCDS33094.1, CCDS62781.1	19q13.41	2013-01-08				ENSG00000204604		"""Zinc fingers, C2H2-type"", ""-"""	33105	protein-coding gene	gene with protein product						16144304	Standard	NM_001277120		Approved		uc002qaf.3	Q5VIY5		ENST00000595646.1:c.909A>G	chr19.hg19:g.53344638T>C		64.0	0.0	.		57.0	17.0	.	NM_001008801	A8MV20|Q5CZB8|Q5VIY4|Q68DI7	Silent	SNP	ENST00000595646.1	hg19	CCDS33094.1																																																																																			.	.	.	none		0.393	ZNF468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463098.1	NM_001008801	
C20orf96	140680	hgsc.bcm.edu	37	20	270903	270903	+	Silent	SNP	A	A	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr20:270903A>T	ENST00000360321.2	-	2	204	c.66T>A	c.(64-66)gtT>gtA	p.V22V	C20orf96_ENST00000400269.3_Intron|C20orf96_ENST00000382369.5_Missense_Mutation_p.S27T	NM_080571.1|NM_153269.2	NP_542138.1|NP_695001.2	Q9NUD7	CT096_HUMAN	chromosome 20 open reading frame 96	22										endometrium(3)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	12		all_cancers(10;0.00959)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			GACTCACCGGAACCTGGAACT	0.602																																					p.V22V		Atlas-SNP	.											.	C20orf96	28	.	0			c.T66A						PASS	.						43.0	35.0	38.0					20																	270903		2203	4299	6502	SO:0001819	synonymous_variant	140680	exon2			CACCGGAACCTGG	AL034548	CCDS12994.1, CCDS74685.1	20p13	2012-10-30			ENSG00000196476	ENSG00000196476			16227	protein-coding gene	gene with protein product							Standard	NM_153269		Approved	dJ1103G7.2	uc002wde.2	Q9NUD7	OTTHUMG00000031626	ENST00000360321.2:c.66T>A	chr20.hg19:g.270903A>T		93.0	0.0	.		133.0	47.0	.	NM_153269	A3KPE0|B2RPH9|Q8N840|Q8NAX5	Silent	SNP	ENST00000360321.2	hg19	CCDS12994.1	.	.	.	.	.	.	.	.	.	.	A	9.570	1.120835	0.20877	.	.	ENSG00000196476	ENST00000382369	T	0.48201	0.82	3.72	1.3	0.21679	.	.	.	.	.	T	0.31199	0.0789	.	.	.	0.09310	N	0.999993	B;B	0.18461	0.028;0.028	B;B	0.19148	0.024;0.013	T	0.22556	-1.0213	8	0.45353	T	0.12	-8.7257	4.0059	0.09600	0.5699:0.2091:0.0:0.221	.	27;27	B7Z971;Q5JYC3	.;.	T	27	ENSP00000371806:S27T	ENSP00000371806:S27T	S	-	1	0	C20orf96	218903	0.042000	0.20092	0.001000	0.08648	0.004000	0.04260	0.982000	0.29539	0.240000	0.21263	0.454000	0.30748	TCC	.	.	.	none		0.602	C20orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077439.2	NM_153269	
PI3	5266	hgsc.bcm.edu	37	20	43804687	43804687	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr20:43804687C>A	ENST00000243924.3	+	2	312	c.265C>A	c.(265-267)Cct>Act	p.P89T		NM_002638.3	NP_002629.1	P19957	ELAF_HUMAN	peptidase inhibitor 3, skin-derived	89	WAP. {ECO:0000255|PROSITE- ProRule:PRU00722}.				copulation (GO:0007620)|negative regulation of endopeptidase activity (GO:0010951)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			large_intestine(1)|lung(5)|skin(1)	7		Myeloproliferative disorder(115;0.0122)				GTTGAATCCCCCTAACCGCTG	0.527																																					p.P89T		Atlas-SNP	.											.	PI3	21	.	0			c.C265A						PASS	.						125.0	111.0	115.0					20																	43804687		2203	4300	6503	SO:0001583	missense	5266	exon2			AATCCCCCTAACC	D13156	CCDS13344.1	20q13.12	2013-01-21	2008-10-03		ENSG00000124102	ENSG00000124102		"""WAP four-disulfide core domain containing"""	8947	protein-coding gene	gene with protein product	"""skin-derived antileukoproteinase"", ""trappin-2"""	182257	"""protease inhibitor 3, skin-derived (SKALP)"""			8287685, 12206714	Standard	NM_002638		Approved	ESI, SKALP, ELAFIN, WAP3, WFDC14, cementoin	uc002xng.3	P19957	OTTHUMG00000032567	ENST00000243924.3:c.265C>A	chr20.hg19:g.43804687C>A	ENSP00000243924:p.Pro89Thr	120.0	0.0	.		152.0	64.0	.	NM_002638	E1P618|Q6FG74	Missense_Mutation	SNP	ENST00000243924.3	hg19	CCDS13344.1	.	.	.	.	.	.	.	.	.	.	C	13.89	2.371223	0.42003	.	.	ENSG00000124102	ENST00000243924	T	0.21543	2.0	4.49	0.108	0.14548	Whey acidic protein, 4-disulphide core (5);	0.000000	0.42682	D	0.000668	T	0.28699	0.0711	M	0.77103	2.36	0.09310	N	1	D	0.52996	0.957	P	0.52646	0.705	T	0.11792	-1.0573	10	0.51188	T	0.08	.	3.0572	0.06188	0.3109:0.4474:0.1512:0.0906	.	89	P19957	ELAF_HUMAN	T	89	ENSP00000243924:P89T	ENSP00000243924:P89T	P	+	1	0	PI3	43238101	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	0.424000	0.21330	-0.037000	0.13646	0.650000	0.86243	CCT	.	.	.	none		0.527	PI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079418.3	NM_002638	
CASS4	57091	hgsc.bcm.edu	37	20	55028020	55028020	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr20:55028020G>C	ENST00000360314.3	+	6	2013	c.1788G>C	c.(1786-1788)gaG>gaC	p.E596D	CASS4_ENST00000371336.3_Missense_Mutation_p.E596D|CASS4_ENST00000434344.1_Intron	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	596					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)			breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						AAAAGGAAGAGACTGTGCAGT	0.453																																					p.E596D		Atlas-SNP	.											.	CASS4	121	.	0			c.G1788C						PASS	.						83.0	85.0	84.0					20																	55028020		2203	4300	6503	SO:0001583	missense	57091	exon5			GGAAGAGACTGTG	AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.1788G>C	chr20.hg19:g.55028020G>C	ENSP00000353462:p.Glu596Asp	105.0	0.0	.		129.0	29.0	.	NM_020356	E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Missense_Mutation	SNP	ENST00000360314.3	hg19	CCDS33492.1	.	.	.	.	.	.	.	.	.	.	G	8.770	0.925662	0.18056	.	.	ENSG00000087589	ENST00000360314;ENST00000371336	T;T	0.14640	2.49;2.49	6.08	0.544	0.17185	.	0.532223	0.21203	N	0.078421	T	0.08980	0.0222	L	0.29908	0.895	0.19775	N	0.999955	B;B;B	0.25048	0.011;0.096;0.117	B;B;B	0.31812	0.022;0.083;0.136	T	0.35871	-0.9771	10	0.23891	T	0.37	-13.133	5.4087	0.16336	0.0614:0.1971:0.2921:0.4494	.	542;596;596	B4DII4;Q9NQ75-2;Q9NQ75	.;.;CASS4_HUMAN	D	596	ENSP00000353462:E596D;ENSP00000360387:E596D	ENSP00000353462:E596D	E	+	3	2	CASS4	54461427	0.006000	0.16342	0.003000	0.11579	0.431000	0.31685	-0.032000	0.12266	-0.097000	0.12307	0.591000	0.81541	GAG	.	.	.	none		0.453	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356	
CTCFL	140690	hgsc.bcm.edu	37	20	56098318	56098318	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr20:56098318T>C	ENST00000608263.1	-	2	1221	c.560A>G	c.(559-561)gAg>gGg	p.E187G	CTCFL_ENST00000502686.2_Intron|CTCFL_ENST00000608425.1_Missense_Mutation_p.E187G|CTCFL_ENST00000608158.1_Missense_Mutation_p.E187G|CTCFL_ENST00000608858.1_Intron|CTCFL_ENST00000432255.2_Missense_Mutation_p.E187G|CTCFL_ENST00000422869.2_Missense_Mutation_p.E187G|CTCFL_ENST00000609232.1_Missense_Mutation_p.E187G|CTCFL_ENST00000608903.1_Intron|CTCFL_ENST00000539382.1_5'UTR|CTCFL_ENST00000608440.1_Missense_Mutation_p.E187G|CTCFL_ENST00000371196.2_Missense_Mutation_p.E187G|CTCFL_ENST00000429804.3_Missense_Mutation_p.E187G|CTCFL_ENST00000243914.3_Missense_Mutation_p.E187G|CTCFL_ENST00000423479.3_Missense_Mutation_p.E187G|CTCFL_ENST00000481655.2_Missense_Mutation_p.E187G|CTCFL_ENST00000433949.3_5'UTR	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	187					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			CTGGTTCTTCTCCTGCTCTTC	0.353																																					p.E187G		Atlas-SNP	.											.	CTCFL	97	.	0			c.A560G						PASS	.						109.0	107.0	108.0					20																	56098318		2202	4300	6502	SO:0001583	missense	140690	exon2			TTCTTCTCCTGCT		CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.560A>G	chr20.hg19:g.56098318T>C	ENSP00000476783:p.Glu187Gly	99.0	0.0	.		104.0	46.0	.	NM_001269044	A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Missense_Mutation	SNP	ENST00000608263.1	hg19	CCDS13459.1	.	.	.	.	.	.	.	.	.	.	T	15.18	2.758101	0.49468	.	.	ENSG00000124092	ENST00000423479;ENST00000243914;ENST00000371196;ENST00000429804;ENST00000433949;ENST00000422109;ENST00000426658;ENST00000432255;ENST00000422869	T;T;T;T;T;T;T;T;T	0.12569	2.67;2.69;2.69;2.85;2.73;3.0;2.71;3.3;2.74	4.43	-1.1	0.09872	.	0.000000	0.36665	N	0.002471	T	0.18299	0.0439	M	0.64997	1.995	0.09310	N	1	B;D;D;D;B;D;B;B	0.64830	0.005;0.994;0.986;0.988;0.006;0.986;0.006;0.006	B;P;P;P;B;P;B;B	0.57204	0.004;0.755;0.617;0.815;0.002;0.722;0.008;0.005	T	0.10086	-1.0645	10	0.30078	T	0.28	-5.3288	3.0409	0.06138	0.3026:0.1863:0.0:0.5111	.	187;187;187;187;187;187;187;187	A6XGM3;A6XGM0;A6XGM9;A6XGM8;A6XGM2;E7EUE3;A6XGL8;Q8NI51	.;.;.;.;.;.;.;CTCFL_HUMAN	G	187	ENSP00000415579:E187G;ENSP00000243914:E187G;ENSP00000360239:E187G;ENSP00000415329:E187G;ENSP00000392034:E187G;ENSP00000413713:E187G;ENSP00000403369:E187G;ENSP00000409344:E187G;ENSP00000399061:E187G	ENSP00000243914:E187G	E	-	2	0	CTCFL	55531724	0.001000	0.12720	0.001000	0.08648	0.003000	0.03518	0.332000	0.19751	0.112000	0.17975	-0.353000	0.07706	GAG	.	.	.	none		0.353	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472040.1	NM_080618	
USP25	29761	hgsc.bcm.edu	37	21	17250242	17250242	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr21:17250242A>T	ENST00000285679.6	+	23	3296	c.2927A>T	c.(2926-2928)gAa>gTa	p.E976V	USP25_ENST00000351097.5_Missense_Mutation_p.E371V|USP25_ENST00000400183.2_Missense_Mutation_p.E1046V|USP25_ENST00000285681.2_Missense_Mutation_p.E1008V	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	976					cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		GAAATGGAAGAAAAGGATATA	0.373																																					p.E976V		Atlas-SNP	.											.	USP25	156	.	0			c.A2927T						PASS	.						109.0	111.0	110.0					21																	17250242		2203	4300	6503	SO:0001583	missense	29761	exon23			TGGAAGAAAAGGA	AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.2927A>T	chr21.hg19:g.17250242A>T	ENSP00000285679:p.Glu976Val	189.0	0.0	.		175.0	43.0	.	NM_013396	C0LSZ0|Q6DHZ9|Q9H9W1	Missense_Mutation	SNP	ENST00000285679.6	hg19	CCDS33515.1	.	.	.	.	.	.	.	.	.	.	A	16.80	3.222083	0.58560	.	.	ENSG00000155313	ENST00000285681;ENST00000285679;ENST00000351097;ENST00000400183	T;T;T;T	0.34472	1.77;1.78;1.36;1.77	5.67	4.52	0.55395	.	0.138081	0.64402	D	0.000004	T	0.49029	0.1533	L	0.51422	1.61	0.49483	D	0.999797	P;D;P;P	0.61697	0.868;0.99;0.696;0.938	B;P;B;B	0.61477	0.408;0.889;0.283;0.446	T	0.47302	-0.9128	10	0.62326	D	0.03	-14.8111	11.4049	0.49892	0.9285:0.0:0.0715:0.0	.	1046;371;1008;976	Q9UHP3-3;Q96B65;Q9UHP3-1;Q9UHP3	.;.;.;UBP25_HUMAN	V	1008;976;371;1046	ENSP00000285681:E1008V;ENSP00000285679:E976V;ENSP00000299574:E371V;ENSP00000383044:E1046V	ENSP00000285679:E976V	E	+	2	0	USP25	16172113	1.000000	0.71417	1.000000	0.80357	0.195000	0.23768	5.898000	0.69838	0.982000	0.38575	-0.297000	0.09499	GAA	.	.	.	none		0.373	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1		
TRPM2	7226	hgsc.bcm.edu	37	21	45789155	45789155	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr21:45789155G>C	ENST00000397928.1	+	5	1145	c.700G>C	c.(700-702)Ggc>Cgc	p.G234R	TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000397932.2_Missense_Mutation_p.G234R|TRPM2_ENST00000300481.9_Missense_Mutation_p.G234R|TRPM2_ENST00000300482.5_Missense_Mutation_p.G234R	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	234					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						CTACAAGGAAGGCGAGCTCAT	0.682																																					p.G234R		Atlas-SNP	.											.	TRPM2	196	.	0			c.G700C						PASS	.						55.0	47.0	50.0					21																	45789155		2203	4300	6503	SO:0001583	missense	7226	exon5			AAGGAAGGCGAGC	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.700G>C	chr21.hg19:g.45789155G>C	ENSP00000381023:p.Gly234Arg	223.0	0.0	.		229.0	78.0	.	NM_003307	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	hg19	CCDS13710.1	.	.	.	.	.	.	.	.	.	.	G	16.42	3.116916	0.56505	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.04317	3.65;3.65;3.65;3.65	3.51	2.62	0.31277	.	0.137153	0.48286	U	0.000189	T	0.10637	0.0260	L	0.41236	1.265	0.36762	D	0.883366	D;D	0.76494	0.999;0.998	D;P	0.65684	0.937;0.901	T	0.09975	-1.0650	10	0.72032	D	0.01	-14.17	7.6316	0.28243	0.1987:0.0:0.8013:0.0	.	234;234	E9PGK7;O94759	.;TRPM2_HUMAN	R	234	ENSP00000300482:G234R;ENSP00000381023:G234R;ENSP00000300481:G234R;ENSP00000381026:G234R	ENSP00000300481:G234R	G	+	1	0	TRPM2	44613583	0.104000	0.21937	0.028000	0.17463	0.829000	0.46940	0.627000	0.24506	0.803000	0.34113	0.467000	0.42956	GGC	.	.	.	none		0.682	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307	
PIWIL3	440822	hgsc.bcm.edu	37	22	25158388	25158388	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr22:25158388G>T	ENST00000332271.5	-	2	495	c.79C>A	c.(79-81)Ccc>Acc	p.P27T	PIWIL3_ENST00000527701.1_5'UTR|PIWIL3_ENST00000532537.2_5'UTR|PIWIL3_ENST00000533313.1_5'UTR	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	Q7Z3Z3	PIWL3_HUMAN	piwi-like RNA-mediated gene silencing 3	27					cell differentiation (GO:0030154)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(15)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						GGTGCTCTGGGTCCCCCAGGT	0.557																																					p.P27T		Atlas-SNP	.											.	PIWIL3	115	.	0			c.C79A						PASS	.						101.0	89.0	93.0					22																	25158388		2203	4300	6503	SO:0001583	missense	440822	exon2			CTCTGGGTCCCCC	AB079368	CCDS33623.1	22q11.23	2013-02-15	2013-02-15		ENSG00000184571	ENSG00000184571		"""Argonaute/PIWI family"""	18443	protein-coding gene	gene with protein product		610314	"""piwi-like 3 (Drosophila)"""			12906857	Standard	NM_001008496		Approved	HIWI3	uc003abd.2	Q7Z3Z3	OTTHUMG00000150788	ENST00000332271.5:c.79C>A	chr22.hg19:g.25158388G>T	ENSP00000330031:p.Pro27Thr	50.0	0.0	.		79.0	27.0	.	NM_001008496		Missense_Mutation	SNP	ENST00000332271.5	hg19	CCDS33623.1	.	.	.	.	.	.	.	.	.	.	G	7.407	0.633980	0.14322	.	.	ENSG00000184571	ENST00000332271	T	0.04406	3.63	1.01	-0.0703	0.13748	.	2.009740	0.03872	N	0.275757	T	0.02380	0.0073	N	0.16478	0.41	0.09310	N	0.999996	P;B	0.45531	0.86;0.347	B;B	0.28991	0.097;0.032	T	0.40270	-0.9572	10	0.25751	T	0.34	-1.0153	3.3689	0.07213	0.2945:0.0:0.7055:0.0	.	27;27	B4DYF7;Q7Z3Z3	.;PIWL3_HUMAN	T	27	ENSP00000330031:P27T	ENSP00000330031:P27T	P	-	1	0	PIWIL3	23488388	0.004000	0.15560	0.007000	0.13788	0.042000	0.13812	0.226000	0.17776	0.001000	0.14605	0.563000	0.77884	CCC	.	.	.	none		0.557	PIWIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320084.2	NM_001008496	
KCTD17	79734	hgsc.bcm.edu	37	22	37458580	37458581	+	Missense_Mutation	DNP	GG	GG	CT	rs377601872		TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr22:37458580_37458581GG>CT	ENST00000403888.3	+	9	913_914	c.912_913GG>CT	c.(910-915)gaGGca>gaCTca	p.304_305EA>DS	KCTD17_ENST00000402077.3_Missense_Mutation_p.280_281EA>DS	NM_001282684.1	NP_001269613.1	Q8N5Z5	KCD17_HUMAN	potassium channel tetramerization domain containing 17	304	Pro-rich.				protein homooligomerization (GO:0051260)		identical protein binding (GO:0042802)			NS(1)|breast(1)|endometrium(1)|lung(1)|prostate(1)	5						ACAAGCCAGAGGCACCCGGATG	0.604																																					p.E280D|p.A281S		Atlas-SNP	.											.	KCTD17	17	.	0			c.G840C|c.G841T						PASS	.																																			SO:0001583	missense	79734	exon8			GCCAGAGGCACCC|CCAGAGGCACCCG	BC025403	CCDS13940.2, CCDS74854.1, CCDS74855.1	22q12.3	2013-06-20	2013-06-20		ENSG00000100379	ENSG00000100379			25705	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 17"""			12477932	Standard	XM_005261741		Approved	FLJ12242	uc011amv.2	Q8N5Z5	OTTHUMG00000150532	Exception_encountered	chr22.hg19:g.37458580_37458581delinsCT	ENSP00000385096:p.E304_A305delinsDS	36.0	0.0	.		54.0	12.0|11.0	.	NM_024681	B0QYA9|B0QYB0|O95517	Missense_Mutation	SNP	ENST00000403888.3	hg19																																																																																				.	.	.	none|alt		0.604	KCTD17-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000318781.1	NM_024681	
TLR7	51284	hgsc.bcm.edu	37	X	12905654	12905654	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chrX:12905654A>G	ENST00000380659.3	+	3	2166	c.2027A>G	c.(2026-2028)aAt>aGt	p.N676S		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	676					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	ATGCCTCCAAATCTAAAGAAT	0.373																																					p.N676S		Atlas-SNP	.											.	TLR7	125	.	0			c.A2027G						PASS	.						78.0	86.0	83.0					X																	12905654		2203	4300	6503	SO:0001583	missense	51284	exon3			CTCCAAATCTAAA	AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.2027A>G	chrX.hg19:g.12905654A>G	ENSP00000370034:p.Asn676Ser	81.0	0.0	.		95.0	52.0	.	NM_016562	D1CS69|Q9NR98	Missense_Mutation	SNP	ENST00000380659.3	hg19	CCDS14151.1	.	.	.	.	.	.	.	.	.	.	A	0.013	-1.631507	0.00813	.	.	ENSG00000196664	ENST00000380659	T	0.58210	0.35	5.46	3.07	0.35406	.	0.358388	0.28203	N	0.016219	T	0.20700	0.0498	N	0.03253	-0.375	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.31081	-0.9956	10	0.02654	T	1	.	5.7284	0.18026	0.6453:0.1306:0.2241:0.0	.	676	Q9NYK1	TLR7_HUMAN	S	676	ENSP00000370034:N676S	ENSP00000370034:N676S	N	+	2	0	TLR7	12815575	0.000000	0.05858	0.049000	0.19019	0.968000	0.65278	0.793000	0.26944	0.250000	0.21479	0.430000	0.28490	AAT	.	.	.	none		0.373	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055769.1	NM_016562	
MAGED2	10916	hgsc.bcm.edu	37	X	54841870	54841870	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chrX:54841870T>G	ENST00000375068.1	+	12	1809	c.1576T>G	c.(1576-1578)Tgg>Ggg	p.W526G	MAGED2_ENST00000375058.1_Missense_Mutation_p.W526G|MAGED2_ENST00000375062.4_Missense_Mutation_p.W441G|MAGED2_ENST00000347546.4_Missense_Mutation_p.W508G|MAGED2_ENST00000375053.2_Missense_Mutation_p.W526G|MAGED2_ENST00000396224.1_Missense_Mutation_p.W526G|MAGED2_ENST00000218439.4_Missense_Mutation_p.W526G|MAGED2_ENST00000375060.1_Missense_Mutation_p.W441G|SNORA11_ENST00000408789.1_RNA			Q9UNF1	MAGD2_HUMAN	melanoma antigen family D, 2	526						membrane (GO:0016020)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26						TATCGGACCCTGGGCCAAAGC	0.602																																					p.W526G		Atlas-SNP	.											.	MAGED2	74	.	0			c.T1576G						PASS	.						24.0	23.0	24.0					X																	54841870		2202	4300	6502	SO:0001583	missense	10916	exon12			GGACCCTGGGCCA	AF128527	CCDS14362.1	Xp11.2	2008-08-01			ENSG00000102316	ENSG00000102316			16353	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated protein"", ""breast cancer associated gene 1"", ""melanoma-associated antigen D2"", ""hepatocellular carcinoma-associated protein HCA10"""	300470					Standard	NM_014599		Approved	JCL-1, BCG1, 11B6, MAGE-D2, HCA10, MAGED, MGC8386	uc004dtk.1	Q9UNF1	OTTHUMG00000021638	ENST00000375068.1:c.1576T>G	chrX.hg19:g.54841870T>G	ENSP00000364209:p.Trp526Gly	192.0	0.0	.		165.0	104.0	.	NM_201222	A6NMX0|O76058|Q5BJF3|Q8NAL6|Q9H218|Q9P0U9|Q9UM52	Missense_Mutation	SNP	ENST00000375068.1	hg19	CCDS14362.1	.	.	.	.	.	.	.	.	.	.	T	12.57	1.977243	0.34848	.	.	ENSG00000102316	ENST00000375068;ENST00000375053;ENST00000347546;ENST00000343474;ENST00000375062;ENST00000218439;ENST00000375058;ENST00000375060;ENST00000396224	T;T;T;T;T;T;T;T;T	0.42131	3.95;3.95;3.99;3.95;0.98;3.95;3.95;0.98;3.95	4.73	4.73	0.59995	.	0.000000	0.42682	D	0.000669	T	0.41073	0.1143	N	0.22421	0.69	0.33869	D	0.634786	D;D	0.65815	0.995;0.99	P;P	0.59115	0.795;0.852	T	0.49551	-0.8928	10	0.22109	T	0.4	.	9.941	0.41580	0.0:0.0:0.0:1.0	.	441;526	Q5H907;Q9UNF1	.;MAGD2_HUMAN	G	526;526;470;508;441;526;526;441;526	ENSP00000364209:W526G;ENSP00000364193:W526G;ENSP00000336962:W470G;ENSP00000340290:W508G;ENSP00000364202:W441G;ENSP00000218439:W526G;ENSP00000364198:W526G;ENSP00000364200:W441G;ENSP00000379526:W526G	ENSP00000218439:W526G	W	+	1	0	MAGED2	54858595	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.231000	0.43009	1.682000	0.51000	0.417000	0.27973	TGG	.	.	.	none		0.602	MAGED2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056821.2	NM_014599	
ABCD1	215	hgsc.bcm.edu	37	X	153005611	153005611	+	Silent	SNP	G	G	T			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chrX:153005611G>T	ENST00000218104.3	+	6	1953	c.1554G>T	c.(1552-1554)cgG>cgT	p.R518R	U52111.14_ENST00000434284.1_RNA	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	518	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.		R -> Q (in ALD; CALD-type). {ECO:0000269|PubMed:11438993, ECO:0000269|PubMed:21700483}.|R -> W (in ALD; CALD-type). {ECO:0000269|PubMed:8040304}.		alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCCTGTTCCGGATCCTGGGTG	0.647																																					p.R518R		Atlas-SNP	.											.	ABCD1	59	.	0			c.G1554T						PASS	.						96.0	87.0	90.0					X																	153005611		2203	4300	6503	SO:0001819	synonymous_variant	215	exon6			GTTCCGGATCCTG	Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.1554G>T	chrX.hg19:g.153005611G>T		39.0	0.0	.		42.0	26.0	.	NM_000033	Q6GTZ2	Silent	SNP	ENST00000218104.3	hg19	CCDS14728.1	.	.	.	.	.	.	.	.	.	.	G	4.664	0.123534	0.08931	.	.	ENSG00000101986	ENST00000443684	.	.	.	4.93	-0.346	0.12620	.	.	.	.	.	T	0.50017	0.1591	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32877	-0.9890	4	.	.	.	-23.4028	4.8323	0.13447	0.0853:0.4009:0.3745:0.1392	.	.	.	.	V	186	.	.	G	+	2	0	ABCD1	152658805	0.998000	0.40836	0.989000	0.46669	0.475000	0.33008	0.355000	0.20163	-0.429000	0.07329	-0.563000	0.04171	GGA	.	.	.	none		0.647	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061041.1	NM_000033	
MT-CO1	4512	hgsc.bcm.edu	37	M	5979	5979	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chrM:5979G>A	ENST00000361624.2	+	1	76	c.76G>A	c.(76-78)Gct>Act	p.A26T	MT-ATP6_ENST00000361899.2_5'Flank|MT-CO2_ENST00000361739.1_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TM_ENST00000387377.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TK_ENST00000387421.1_RNA|MT-TD_ENST00000387419.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	26					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TCGGCGCATGAGCTGGAGTCC	0.502																																					p.A26T		Atlas-SNP	.											.	.	.	.	0			c.G76A						PASS	.																																			SO:0001583	missense	5742	exon1			GCATGAGCTGGAG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.76G>A	chrM.hg19:g.5979G>A	ENSP00000354499:p.Ala26Thr	47.0	0.0	.		117.0	29.0	.	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.	.	none		0.502	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
MT-ND5	4540	hgsc.bcm.edu	37	M	13031	13031	+	Silent	SNP	G	G	A			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chrM:13031G>A	ENST00000361567.2	+	1	695	c.695G>A	c.(694-696)tGa>tAa	p.*232*	MT-TR_ENST00000387439.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TP_ENST00000387461.2_RNA|MT-TG_ENST00000387429.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	232					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TCTCCACCCCTGACTCCCCTC	0.537																																					p.W232X		Atlas-SNP	.											.	.	.	.	0			c.G695A						PASS	.																																			SO:0001819	synonymous_variant	0	exon1			ACCCCTGACTCCC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.695G>A	chrM.hg19:g.13031G>A		29.0	0.0	.		87.0	6.0	.	ENST00000361567	Q34773|Q8WCY3	Nonsense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.	.	none		0.537	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
COL4A3BP	10087	hgsc.bcm.edu	37	5	74676981	74676981	+	Frame_Shift_Del	DEL	A	A	-			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr5:74676981delA	ENST00000405807.4	-	16	2084	c.1663delT	c.(1663-1665)tgtfs	p.C555fs	COL4A3BP_ENST00000508692.1_5'UTR|COL4A3BP_ENST00000380494.5_Frame_Shift_Del_p.C683fs|COL4A3BP_ENST00000261415.7_Frame_Shift_Del_p.C529fs	NM_005713.2	NP_005704.1	Q9Y5P4	C43BP_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen) binding protein	555	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|ceramide metabolic process (GO:0006672)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi ceramide transport (GO:0035621)|heart morphogenesis (GO:0003007)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lipid homeostasis (GO:0055088)|mitochondrion morphogenesis (GO:0070584)|muscle contraction (GO:0006936)|protein phosphorylation (GO:0006468)|response to endoplasmic reticulum stress (GO:0034976)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ceramide binding (GO:0097001)|ceramide transporter activity (GO:0035620)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein kinase activity (GO:0004672)			breast(1)|kidney(1)|large_intestine(5)|lung(4)|skin(3)|stomach(1)|urinary_tract(1)	16		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;1e-53)		AAGGTTTGACAAATCATAGCA	0.378																																					p.C683fs		Atlas-Indel,Pindel	.											.	COL4A3BP	72	.	0			c.2048delG						PASS	.						204.0	184.0	191.0					5																	74676981		2203	4300	6503	SO:0001589	frameshift_variant	10087	exon17			.	AF136450	CCDS4028.1, CCDS4029.1, CCDS47235.1	5q13.3	2013-01-10	2007-06-08	2007-06-08	ENSG00000113163	ENSG00000113163		"""StAR-related lipid transfer (START) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2205	protein-coding gene	gene with protein product	"""ceramide transporter"", ""StAR-related lipid transfer (START) domain containing 11"""	604677				10212244	Standard	NM_001130105		Approved	GPBP, STARD11, CERT	uc003kdt.3	Q9Y5P4	OTTHUMG00000102068	ENST00000405807.4:c.1663delT	chr5.hg19:g.74676981delA	ENSP00000383996:p.Cys555fs	83.0	0.0	0		73.0	22.0	0.30137	NM_001130105	A8K7S2|B3KUB7|Q53YV1|Q53YV2|Q96Q85|Q96Q88|Q9H2S7|Q9H2S8	Frame_Shift_Del	DEL	ENST00000405807.4	hg19	CCDS4028.1																																																																																			.	.	.	none		0.378	COL4A3BP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219875.2	NM_005713	
NPTX1	4884	hgsc.bcm.edu	37	17	78450218	78450227	+	Frame_Shift_Del	DEL	CAGGTGCGCG	CAGGTGCGCG	-			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	CAGGTGCGCG	CAGGTGCGCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr17:78450218_78450227delCAGGTGCGCG	ENST00000306773.4	-	1	177_186	c.20_29delCGCGCACCTG	c.(19-30)gcgcgcacctgtfs	p.ARTC7fs	NPTX1_ENST00000575212.1_Intron	NM_002522.3	NP_002513.2	Q15818	NPTX1_HUMAN	neuronal pentraxin I	7				Missing (in Ref. 1; AAC50727). {ECO:0000305}.	axonogenesis involved in innervation (GO:0060385)|cellular response to glucose stimulus (GO:0071333)|cellular response to potassium ion (GO:0035865)|central nervous system development (GO:0007417)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial transport (GO:0006839)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)	11	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			GAGCAGCGCACAGGTgcgcgcggcgcggcc	0.79																																					p.7_10del		Atlas-INDEL	.											.	NPTX1	28	.	0			c.21_30del						PASS	.																																			SO:0001589	frameshift_variant	4884	exon1			.	U61849	CCDS32762.1	17q25.3	2008-05-14				ENSG00000171246			7952	protein-coding gene	gene with protein product		602367				8884281	Standard	NM_002522		Approved		uc002jyp.1	Q15818		ENST00000306773.4:c.20_29delCGCGCACCTG	chr17.hg19:g.78450218_78450227delCAGGTGCGCG	ENSP00000307549:p.Ala7fs	24.0	0.0	0		38.0	15.0	0.394737	NM_002522	B3KXH3|Q5FWE6	Frame_Shift_Del	DEL	ENST00000306773.4	hg19	CCDS32762.1																																																																																			.	.	.	none		0.790	NPTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438051.1		
SLC16A8	23539	hgsc.bcm.edu	37	22	38476908	38476913	+	In_Frame_Del	DEL	ACTGGG	ACTGGG	-			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	ACTGGG	ACTGGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr22:38476908_38476913delACTGGG	ENST00000320521.5	-	4	1240_1245	c.1132_1137delCCCAGT	c.(1132-1137)cccagtdel	p.PS378del	SLC16A8_ENST00000469516.1_Intron	NM_013356.2	NP_037488.2	O95907	MOT3_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 8	378					blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|lactate transmembrane transport (GO:0035873)|lactate transport (GO:0015727)|leukocyte migration (GO:0050900)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lactate transmembrane transporter activity (GO:0015129)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			kidney(1)|large_intestine(1)|prostate(1)	3	Melanoma(58;0.045)				Pyruvic acid(DB00119)	GGCCCAGCGCACTGGGGAAGCGGGGC	0.723																																					p.378_380del		Atlas-Indel,Pindel	.											.	SLC16A8	13	.	0			c.1133_1138del						PASS	.																																			SO:0001651	inframe_deletion	23539	exon4			.	AF132610	CCDS13966.1	22q12.3-q13.2	2013-07-18	2013-07-18		ENSG00000100156	ENSG00000100156		"""Solute carriers"""	16270	protein-coding gene	gene with protein product	"""monocarboxylate transporter 3"""	610409	"""solute carrier 16 (monocarboxylic acid transporters), member 8"""			10493836	Standard	NM_013356		Approved	MCT3, REMP	uc003auu.3	O95907	OTTHUMG00000151196	ENST00000320521.5:c.1132_1137delCCCAGT	chr22.hg19:g.38476908_38476913delACTGGG	ENSP00000321735:p.Pro378_Ser379del	87.0	0.0	0		68.0	10.0	0.147059	NM_013356	Q9UBE2	In_Frame_Del	DEL	ENST00000320521.5	hg19	CCDS13966.1																																																																																			.	.	.	none		0.723	SLC16A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321724.1	NM_013356	
SMEK2	57223	hgsc.bcm.edu	37	2	55795473	55795473	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr2:55795473delT	ENST00000345102.5	-	13	2093	c.1792delA	c.(1792-1794)attfs	p.I598fs	SMEK2_ENST00000407823.3_Frame_Shift_Del_p.I566fs|SNORA12_ENST00000390873.1_RNA|SMEK2_ENST00000272313.5_Frame_Shift_Del_p.I513fs	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	598					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TTAAGTCCAATTATCCGCCTC	0.318																																					p.I598fs		Atlas-Indel,Pindel	.											.	SMEK2	86	.	0			c.1793delT						PASS	.						58.0	62.0	61.0					2																	55795473		2203	4297	6500	SO:0001589	frameshift_variant	57223	exon13			.	AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.1792delA	chr2.hg19:g.55795473delT	ENSP00000339769:p.Ile598fs	160.0	0.0	0		144.0	34.0	0.236111	NM_001122964	Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Frame_Shift_Del	DEL	ENST00000345102.5	hg19	CCDS46289.1																																																																																			.	.	.	none		0.318	SMEK2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251483.1	NM_020463	
MSANTD4	84437	hgsc.bcm.edu	37	11	105880566	105880567	+	Frame_Shift_Ins	INS	-	-	TG			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr11:105880566_105880567insTG	ENST00000301919.4	-	3	2148_2149	c.733_734insCA	c.(733-735)atgfs	p.M245fs	MSANTD4_ENST00000529805.1_5'Flank	NM_032424.1	NP_115800.1	Q8NCY6	MSD4_HUMAN	Myb/SANT-like DNA-binding domain containing 4 with coiled-coils	245						nucleus (GO:0005634)											CTCATGTTCCATGTCTAAATGC	0.465																																					p.M245fs		Atlas-Indel,Pindel	.											.	.	.	.	0			c.734_735insCA						PASS	.																																			SO:0001589	frameshift_variant	84437	exon3			.	AB058729	CCDS31663.1	11q22	2012-03-13	2012-03-13	2012-03-13	ENSG00000170903	ENSG00000170903			29383	protein-coding gene	gene with protein product			"""KIAA1826"""	KIAA1826			Standard	XM_005271697		Approved		uc001piz.3	Q8NCY6	OTTHUMG00000166240	ENST00000301919.4:c.732_733dupCA	chr11.hg19:g.105880567_105880568dupTG	ENSP00000304713:p.Met245fs	84.0	0.0	0		87.0	25.0	0.287356	NM_032424	Q96JK1|Q96JZ3|Q9H2N4	Frame_Shift_Ins	INS	ENST00000301919.4	hg19	CCDS31663.1																																																																																			.	.	.	none		0.465	MSANTD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388619.1	NM_032424	
GABRG3	2567	hgsc.bcm.edu	37	15	27773100	27773105	+	In_Frame_Del	DEL	AGATGG	AGATGG	-	rs200568627		TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	AGATGG	AGATGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr15:27773100_27773105delAGATGG	ENST00000333743.6	+	9	1338_1343	c.1084_1089delAGATGG	c.(1084-1089)agatggdel	p.RW362del	RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	362					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.R362T(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AGATTCCTCAAGATGGATTCCTGAGC	0.374																																					p.361_363del	NSCLC(114;800 1656 7410 37729 45293)	Atlas-Indel,Pindel	.											.	GABRG3	115	.	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.1083_1088del						PASS	.																																			SO:0001651	inframe_deletion	2567	exon9			.		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.1084_1089delAGATGG	chr15.hg19:g.27773100_27773105delAGATGG	ENSP00000331912:p.Arg362_Trp363del	64.0	0.0	0		53.0	12.0	0.226415	NM_033223	G3V594|Q9HD46|Q9NYT2	In_Frame_Del	DEL	ENST00000333743.6	hg19	CCDS45195.1																																																																																			.	.	.	none		0.374	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2		
SCAMP2	10066	hgsc.bcm.edu	37	15	75140977	75141001	+	Frame_Shift_Del	DEL	ATGTAGATCCCTATTTGACAAAAAA	ATGTAGATCCCTATTTGACAAAAAA	-			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	ATGTAGATCCCTATTTGACAAAAAA	ATGTAGATCCCTATTTGACAAAAAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr15:75140977_75141001delATGTAGATCCCTATTTGACAAAAAA	ENST00000268099.9	-	7	783_807	c.674_698delTTTTTTGTCAAATAGGGATCTACAT	c.(673-699)tttttttgtcaaatagggatctacatcfs	p.FFCQIGIYI225fs		NM_005697.3	NP_005688.2	O15127	SCAM2_HUMAN	secretory carrier membrane protein 2	225					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|recycling endosome membrane (GO:0055038)|trans-Golgi network membrane (GO:0032588)|transport vesicle (GO:0030133)		p.C227fs*3(1)		kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	9						CAACTGGATGATGTAGATCCCTATTTGACAAAAAAATACAAAGAA	0.498																																					p.225_233del		Atlas-Indel,Pindel	.											.	SCAMP2	18	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.675_699del						PASS	.																																			SO:0001589	frameshift_variant	10066	exon7			.	AF005038	CCDS10271.1	15q23-q25	2013-02-21			ENSG00000140497	ENSG00000140497		"""Secretory carrier membrane proteins"""	10564	protein-coding gene	gene with protein product		606912				9378760	Standard	NM_005697		Approved		uc002azb.1	O15127	OTTHUMG00000142817	ENST00000268099.9:c.674_698delTTTTTTGTCAAATAGGGATCTACAT	chr15.hg19:g.75140977_75141001delATGTAGATCCCTATTTGACAAAAAA	ENSP00000268099:p.Phe225fs	79.0	0.0	0		86.0	13.0	0.151163	NM_005697	B2RDF0|Q9BQE8	Frame_Shift_Del	DEL	ENST00000268099.9	hg19	CCDS10271.1																																																																																			.	.	.	none		0.498	SCAMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286403.3	NM_005697	
GOLGA4	2803	hgsc.bcm.edu	37	3	37368460	37368460	+	Frame_Shift_Del	DEL	C	C	-			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr3:37368460delC	ENST00000361924.2	+	14	5457	c.5083delC	c.(5083-5085)cttfs	p.L1695fs	GOLGA4_ENST00000356847.4_Frame_Shift_Del_p.L1717fs|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	1695	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						GGAAGAAAAACTTAAGTCAGT	0.368																																					p.K1716fs		Atlas-Indel,Pindel	.											.	GOLGA4	173	.	0			c.5148delA						PASS	.						106.0	116.0	113.0					3																	37368460		2201	4296	6497	SO:0001589	frameshift_variant	2803	exon15			.	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.5083delC	chr3.hg19:g.37368460delC	ENSP00000354486:p.Leu1695fs	278.0	0.0	0		271.0	85.0	0.313653	NM_001172713	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Frame_Shift_Del	DEL	ENST00000361924.2	hg19	CCDS2666.1																																																																																			.	.	.	none		0.368	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	
FASTKD1	79675	hgsc.bcm.edu	37	2	170403017	170403017	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr2:170403017delT	ENST00000453153.2	-	8	1758	c.1412delA	c.(1411-1413)aatfs	p.N471fs	FASTKD1_ENST00000453929.2_Frame_Shift_Del_p.N471fs	NM_024622.3	NP_078898.3	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	471					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(5)|large_intestine(10)|lung(9)|ovary(4)|prostate(3)	37						CGCAGTCATATTATCCAAATA	0.383																																					p.N471fs		Atlas-Indel,Pindel	.											.	FASTKD1	86	.	0			c.1413delT						PASS	.						120.0	105.0	110.0					2																	170403017		2203	4300	6503	SO:0001589	frameshift_variant	79675	exon8			.	AL832058	CCDS33318.1, CCDS63051.1	2q31.1	2008-02-05			ENSG00000138399	ENSG00000138399			26150	protein-coding gene	gene with protein product						11347906	Standard	NM_024622		Approved	FLJ21901	uc002uev.4	Q53R41	OTTHUMG00000154953	ENST00000453153.2:c.1412delA	chr2.hg19:g.170403017delT	ENSP00000400513:p.Asn471fs	265.0	0.0	0		248.0	66.0	0.266129	NM_024622	Q8N583|Q8TEA9|Q96JM5|Q96N71|Q9H6T4	Frame_Shift_Del	DEL	ENST00000453153.2	hg19	CCDS33318.1																																																																																			.	.	.	none		0.383	FASTKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337788.2	NM_024622	
COL16A1	1307	hgsc.bcm.edu	37	1	32149737	32149737	+	Frame_Shift_Del	DEL	G	G	-	rs373053106		TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr1:32149737delG	ENST00000373672.3	-	32	2772	c.2256delC	c.(2254-2256)cccfs	p.P752fs	COL16A1_ENST00000373668.3_Frame_Shift_Del_p.P752fs|COL16A1_ENST00000271069.6_Frame_Shift_Del_p.P751fs	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	752	Triple-helical region 5 (COL5) with 3 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CCACGCCTTCGGGGCCCTGCT	0.682																																					p.E753fs	Colon(143;498 1786 21362 25193 36625)	Atlas-Indel,Pindel	.											.	COL16A1	137	.	0			c.2257delG						PASS	.						16.0	21.0	20.0					1																	32149737		1978	4128	6106	SO:0001589	frameshift_variant	1307	exon32			.	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.2256delC	chr1.hg19:g.32149737delG	ENSP00000362776:p.Pro752fs	184.0	0.0	0		205.0	72.0	0.35122	NM_001856	Q16593|Q59F89|Q71RG9	Frame_Shift_Del	DEL	ENST00000373672.3	hg19	CCDS41297.1																																																																																			.	.	.	none		0.682	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
UNKL	64718	hgsc.bcm.edu	37	16	1417847	1417848	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr16:1417847_1417848delAC	ENST00000389221.4	-	13	1587_1588	c.1588_1589delGT	c.(1588-1590)gtcfs	p.V530fs	UNKL_ENST00000403703.1_Frame_Shift_Del_p.V32fs|UNKL_ENST00000508903.2_Frame_Shift_Del_p.V533fs|UNKL_ENST00000391893.2_Frame_Shift_Del_p.V29fs|UNKL_ENST00000248104.7_Frame_Shift_Del_p.V29fs|UNKL_ENST00000402641.2_Frame_Shift_Del_p.V32fs|UNKL_ENST00000397464.1_Frame_Shift_Del_p.V32fs	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like	530	Ser-rich.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				GCTCCCGGGGACACCGTTCAAA	0.649																																					p.533_533del		Atlas-Indel,Pindel	.											.	UNKL	46	.	0			c.1598_1599del						PASS	.																																			SO:0001589	frameshift_variant	64718	exon13			.	BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.1588_1589delGT	chr16.hg19:g.1417849_1417850delAC	ENSP00000373873:p.Val530fs	151.0	0.0	0		193.0	65.0	0.336788	NM_001193388	B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Frame_Shift_Del	DEL	ENST00000389221.4	hg19	CCDS53981.1																																																																																			.	.	.	none		0.649	UNKL-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001037125	
WIPF2	147179	hgsc.bcm.edu	37	17	38430244	38430244	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr17:38430244delT	ENST00000323571.4	+	6	1413	c.1173delT	c.(1171-1173)tctfs	p.S391fs	WIPF2_ENST00000585043.1_Frame_Shift_Del_p.S391fs|WIPF2_ENST00000583130.1_Frame_Shift_Del_p.S391fs|WIPF2_ENST00000494757.1_3'UTR|WIPF2_ENST00000394103.3_Frame_Shift_Del_p.S133fs|WIPF2_ENST00000536600.1_Frame_Shift_Del_p.S133fs	NM_133264.4	NP_573571.1	Q8TF74	WIPF2_HUMAN	WAS/WASL interacting protein family, member 2	391					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	30						CTGTCCGGTCTTTCTTGGGTG	0.592										HNSCC(43;0.11)																											p.S391fs		Atlas-Indel,Pindel	.											.	WIPF2	55	.	0			c.1172delC						PASS	.						135.0	110.0	119.0					17																	38430244		2203	4300	6503	SO:0001589	frameshift_variant	147179	exon6			.	BC025965	CCDS11364.1	17q21.2	2006-10-12			ENSG00000171475	ENSG00000171475			30923	protein-coding gene	gene with protein product		609692				12213210, 11829459	Standard	XM_005257083		Approved	WICH, WIRE	uc002hug.1	Q8TF74	OTTHUMG00000133331	ENST00000323571.4:c.1173delT	chr17.hg19:g.38430244delT	ENSP00000320924:p.Ser391fs	113.0	0.0	0		130.0	57.0	0.438462	NM_133264	A8K0L3|Q658J8|Q71RE1|Q8TE44	Frame_Shift_Del	DEL	ENST00000323571.4	hg19	CCDS11364.1																																																																																			.	.	.	none		0.592	WIPF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257157.2	NM_133264	
PCDHGB3	56102	hgsc.bcm.edu	37	5	140777735	140777740	+	Intron	DEL	TGCCAG	TGCCAG	-			TCGA-UZ-A9PO-01A-11D-A382-10	TCGA-UZ-A9PO-10A-01D-A385-10	TGCCAG	TGCCAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	72b12c65-5631-49f5-843b-4bc9f58ce902	41481a6b-9b6c-44cb-8db2-6b911dab119d	g.chr5:140777735_140777740delTGCCAG	ENST00000576222.1	+	1	2546				PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGAGAGGCTGCCAGTGCTCTTTCT	0.612											OREG0016860	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.14_15del		Pindel	.											.	.	.	.	0			c.40_45del						PASS	.																																			SO:0001627	intron_variant	56101	exon1			.	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2415+25359TGCCAG>-	chr5.hg19:g.140777735_140777740delTGCCAG		323.0	0.0	.	1659	305.0	38.0	0.125	NM_032099	A7E229|Q9Y5C7	In_Frame_Del	DEL	ENST00000576222.1	hg19	CCDS58980.1																																																																																			.	.	.	none		0.612	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924	
