#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ATAD3B	83858	hgsc.bcm.edu	37	1	1426049	1426049	+	Nonsense_Mutation	SNP	C	C	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr1:1426049C>T	ENST00000308647.7	+	15	1728	c.1612C>T	c.(1612-1614)Cag>Tag	p.Q538*		NM_031921.4	NP_114127.3	Q5T9A4	ATD3B_HUMAN	ATPase family, AAA domain containing 3B	538						mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CGTGTCCTGGCAGGTGAGTCA	0.667																																					p.Q538X		Atlas-SNP	.											.	ATAD3B	68	.	0			c.C1612T						PASS	.						16.0	18.0	17.0					1																	1426049		2161	4212	6373	SO:0001587	stop_gained	83858	exon15			TCCTGGCAGGTGA	AL834179	CCDS30.1	1p36.33	2010-04-21		2007-02-08	ENSG00000160072	ENSG00000160072		"""ATPases / AAA-type"""	24007	protein-coding gene	gene with protein product		612317				10574462	Standard	XM_005244806		Approved	TOB3, KIAA1273	uc001afv.3	Q5T9A4	OTTHUMG00000000577	ENST00000308647.7:c.1612C>T	chr1.hg19:g.1426049C>T	ENSP00000311766:p.Gln538*	183.0	0.0	.		131.0	43.0	.	NM_031921	A8K3H1|Q6ZRB5|Q9BUK4|Q9ULE7	Nonsense_Mutation	SNP	ENST00000308647.7	hg19	CCDS30.1	.	.	.	.	.	.	.	.	.	.	c	24.8	4.566605	0.86439	.	.	ENSG00000160072	ENST00000378737;ENST00000308647	.	.	.	2.55	2.55	0.30701	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	12.43	0.55569	0.0:1.0:0.0:0.0	.	.	.	.	X	372;538	.	ENSP00000311766:Q538X	Q	+	1	0	ATAD3B	1415912	1.000000	0.71417	0.998000	0.56505	0.070000	0.16714	7.377000	0.79668	1.416000	0.47057	0.205000	0.17691	CAG	.	.	.	none		0.667	ATAD3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001369.2	NM_031921	
MYSM1	114803	hgsc.bcm.edu	37	1	59165666	59165666	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr1:59165666G>T	ENST00000472487.1	-	1	98	c.59C>A	c.(58-60)gCa>gAa	p.A20E		NM_001085487.2	NP_001078956.1	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1	20					chromatin remodeling (GO:0006338)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(7;9.36e-06)					CCCTGGCTGTGCCCCCGCCGC	0.662																																					p.A20E		Atlas-SNP	.											.	MYSM1	50	.	0			c.C59A						PASS	.						32.0	42.0	39.0					1																	59165666		1908	4114	6022	SO:0001583	missense	114803	exon1			GGCTGTGCCCCCG	AB067502	CCDS41343.1	1p32.1	2009-02-11	2009-02-11		ENSG00000162601	ENSG00000162601			29401	protein-coding gene	gene with protein product		612176				11572484, 17428495, 17707232	Standard	NM_001085487		Approved	KIAA1915	uc009wab.2	Q5VVJ2	OTTHUMG00000009533	ENST00000472487.1:c.59C>A	chr1.hg19:g.59165666G>T	ENSP00000418734:p.Ala20Glu	57.0	0.0	.		43.0	14.0	.	NM_001085487	A8KA54|B3KX65|Q68DD3|Q6AI53|Q7Z3G8|Q96PX3	Missense_Mutation	SNP	ENST00000472487.1	hg19	CCDS41343.1	.	.	.	.	.	.	.	.	.	.	G	4.008	-0.001209	0.07819	.	.	ENSG00000162601	ENST00000472487	T	0.22134	1.97	4.53	1.54	0.23209	.	1.367050	0.04456	N	0.373450	T	0.13457	0.0326	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26608	-1.0098	10	0.30854	T	0.27	-0.2712	4.2456	0.10670	0.2083:0.1914:0.6003:0.0	.	20	Q5VVJ2	MYSM1_HUMAN	E	20	ENSP00000418734:A20E	ENSP00000418734:A20E	A	-	2	0	MYSM1	58938254	0.995000	0.38212	0.098000	0.21074	0.449000	0.32228	2.129000	0.42055	0.597000	0.29811	0.561000	0.74099	GCA	.	.	.	none		0.662	MYSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026343.2	XM_055481	
FUBP1	8880	hgsc.bcm.edu	37	1	78426050	78426050	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr1:78426050C>G	ENST00000370768.2	-	15	1556	c.1475G>C	c.(1474-1476)gGa>gCa	p.G492A	FUBP1_ENST00000436586.2_Missense_Mutation_p.G513A|FUBP1_ENST00000370767.1_Missense_Mutation_p.G492A	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1	492	Pro-rich.				positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						GCCTGGTGGTCCAGGATTATA	0.532			"""F, N"""		oligodendroglioma																																p.G492A		Atlas-SNP	.		Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	.	FUBP1	112	.	0			c.G1475C						PASS	.						38.0	43.0	41.0					1																	78426050		2203	4300	6503	SO:0001583	missense	8880	exon15			GGTGGTCCAGGAT	U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.1475G>C	chr1.hg19:g.78426050C>G	ENSP00000359804:p.Gly492Ala	311.0	0.0	.		242.0	102.0	.	NM_003902	Q12828	Missense_Mutation	SNP	ENST00000370768.2	hg19	CCDS683.1	.	.	.	.	.	.	.	.	.	.	C	16.79	3.220035	0.58560	.	.	ENSG00000162613	ENST00000370773;ENST00000370767;ENST00000370768;ENST00000394922;ENST00000436586	T;T;T	0.34472	1.36;1.42;1.38	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.42381	0.1200	L	0.46741	1.465	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.73708	0.981;0.981	T	0.05920	-1.0856	10	0.12103	T	0.63	-15.6155	19.9795	0.97321	0.0:1.0:0.0:0.0	.	513;492	B4DT31;Q96AE4	.;FUBP1_HUMAN	A	491;492;492;477;513	ENSP00000359803:G492A;ENSP00000359804:G492A;ENSP00000389536:G513A	ENSP00000294623:G491A	G	-	2	0	FUBP1	78198638	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.818000	0.86416	2.720000	0.93068	0.650000	0.86243	GGA	.	.	.	none		0.532	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098030.3	NM_003902	
CCT3	7203	hgsc.bcm.edu	37	1	156303343	156303343	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr1:156303343A>G	ENST00000295688.3	-	5	579	c.299T>C	c.(298-300)aTt>aCt	p.I100T	CCT3_ENST00000368256.3_5'UTR|CCT3_ENST00000368261.3_Missense_Mutation_p.I55T|CCT3_ENST00000368259.2_Missense_Mutation_p.I62T|CCT3_ENST00000472765.2_Missense_Mutation_p.I55T	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	100					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					CTTACCAAGAATAATTACTGA	0.398																																					p.I100T		Atlas-SNP	.											.	CCT3	61	.	0			c.T299C						PASS	.						117.0	120.0	119.0					1																	156303343		2203	4300	6503	SO:0001583	missense	7203	exon5			CCAAGAATAATTA	BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.299T>C	chr1.hg19:g.156303343A>G	ENSP00000295688:p.Ile100Thr	65.0	0.0	.		47.0	23.0	.	NM_005998	A6NE14|Q5SZY1|Q9BR64	Missense_Mutation	SNP	ENST00000295688.3	hg19	CCDS1140.2	.	.	.	.	.	.	.	.	.	.	A	24.9	4.583526	0.86748	.	.	ENSG00000163468	ENST00000295688;ENST00000368259;ENST00000368261;ENST00000472765;ENST00000413555;ENST00000496684;ENST00000533194;ENST00000446905;ENST00000478640;ENST00000415548	D;D;D;D;D;D;D;D;D;D	0.91577	-1.56;-1.56;-1.56;-1.56;-1.56;-1.56;-1.56;-1.56;-1.56;-2.87	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.96658	0.8909	H	0.98005	4.125	0.80722	D	1	D;P;D	0.67145	0.996;0.916;0.99	D;P;D	0.71184	0.972;0.836;0.953	D	0.97801	1.0244	10	0.87932	D	0	-13.7794	12.6112	0.56552	1.0:0.0:0.0:0.0	.	62;100;100	P49368-2;E9PAQ6;P49368	.;.;TCPG_HUMAN	T	100;62;55;55;124;100;21;86;79;100	ENSP00000295688:I100T;ENSP00000357242:I62T;ENSP00000357244:I55T;ENSP00000431543:I55T;ENSP00000413308:I124T;ENSP00000434232:I100T;ENSP00000434481:I21T;ENSP00000388799:I86T;ENSP00000435026:I79T;ENSP00000413431:I100T	ENSP00000295688:I100T	I	-	2	0	CCT3	154569967	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.593000	0.90832	2.234000	0.73211	0.528000	0.53228	ATT	.	.	.	none		0.398	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060602.3	NM_005998	
SLAMF6	114836	hgsc.bcm.edu	37	1	160460386	160460386	+	Missense_Mutation	SNP	G	G	A	rs148686177		TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr1:160460386G>A	ENST00000368057.3	-	4	796	c.736C>T	c.(736-738)Ctt>Ttt	p.L246F	SLAMF6_ENST00000368059.3_Missense_Mutation_p.L246F|SLAMF6_ENST00000368055.1_Missense_Mutation_p.L135F			Q96DU3	SLAF6_HUMAN	SLAM family member 6	246						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(4)	22	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)			CTCAAAACAAGTAACAGCAGT	0.388																																					p.L246F		Atlas-SNP	.											.	SLAMF6	46	.	0			c.C736T						PASS	.	G	PHE/LEU,PHE/LEU,PHE/LEU,PHE/LEU	1,4405	2.1+/-5.4	0,1,2202	88.0	87.0	87.0		736,589,403,736	-6.6	0.0	1	dbSNP_134	87	0,8600		0,0,4300	no	missense,missense,missense,missense	SLAMF6	NM_001184714.1,NM_001184715.1,NM_001184716.1,NM_052931.4	22,22,22,22	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	246/333,197/283,135/222,246/332	160460386	1,13005	2203	4300	6503	SO:0001583	missense	114836	exon4			AAACAAGTAACAG	AL832854	CCDS1205.1, CCDS53393.1, CCDS53394.1	1q23.1	2013-01-29			ENSG00000162739	ENSG00000162739		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21392	protein-coding gene	gene with protein product		606446				11489943	Standard	NM_052931		Approved	KALI, NTBA, KALIb, Ly108, SF2000, NTB-A, CD352	uc001fwe.2	Q96DU3	OTTHUMG00000022729	ENST00000368057.3:c.736C>T	chr1.hg19:g.160460386G>A	ENSP00000357036:p.Leu246Phe	300.0	0.0	.		271.0	117.0	.	NM_052931	A6NMW2|B2R8X8|Q14CF0|Q5TAS4|Q5TAS6|Q5TAT3|Q96DV0	Missense_Mutation	SNP	ENST00000368057.3	hg19	CCDS53394.1	.	.	.	.	.	.	.	.	.	.	G	1.642	-0.516181	0.04200	2.27E-4	0.0	ENSG00000162739	ENST00000368059;ENST00000368057;ENST00000368055	T;T;T	0.39592	1.07;1.07;1.07	3.27	-6.55	0.01854	.	7.407340	0.00166	N	0.000000	T	0.05227	0.0139	N	0.12182	0.205	0.09310	N	1	B;B;B;B;B	0.24963	0.001;0.01;0.002;0.115;0.115	B;B;B;B;B	0.19666	0.001;0.007;0.001;0.026;0.026	T	0.08046	-1.0741	10	0.15066	T	0.55	8.6317	2.1038	0.03686	0.3812:0.1275:0.3644:0.1269	.	135;135;197;246;246	B7Z6A7;Q5TAS6;B4E1U5;Q96DU3;B2R8X8	.;.;.;SLAF6_HUMAN;.	F	246;246;135	ENSP00000357038:L246F;ENSP00000357036:L246F;ENSP00000357034:L135F	ENSP00000357034:L135F	L	-	1	0	SLAMF6	158727010	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.995000	0.00317	-1.752000	0.01325	-0.302000	0.09304	CTT	.	G|1.000;A|0.000	0.000	weak		0.388	SLAMF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059010.1	NM_052931	
RABGAP1L	9910	hgsc.bcm.edu	37	1	174247864	174247864	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr1:174247864T>C	ENST00000251507.4	+	10	1444	c.1270T>C	c.(1270-1272)Tgg>Cgg	p.W424R	RABGAP1L_ENST00000357444.6_Missense_Mutation_p.W387R|RABGAP1L_ENST00000367689.3_Missense_Mutation_p.W71R	NM_014857.4	NP_055672.3	B7ZAP0	RBG10_HUMAN	RAB GTPase activating protein 1-like	0										NS(1)|breast(2)|endometrium(4)|kidney(5)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(2)	45						TGAGCGATTTTGGTATTTCAG	0.423																																					p.W424R		Atlas-SNP	.											.	RABGAP1L	103	.	0			c.T1270C						PASS	.						151.0	154.0	153.0					1																	174247864		2203	4300	6503	SO:0001583	missense	9910	exon10			CGATTTTGGTATT	AF279778	CCDS1314.1, CCDS41437.1, CCDS55662.1, CCDS58046.1	1q24	2011-11-21			ENSG00000152061	ENSG00000152061			24663	protein-coding gene	gene with protein product		609238				10585558	Standard	NM_014857		Approved	HHL, TBC1D18, KIAA0471, FLJ38519	uc001gjx.3	B7ZAP0	OTTHUMG00000034899	ENST00000251507.4:c.1270T>C	chr1.hg19:g.174247864T>C	ENSP00000251507:p.Trp424Arg	100.0	0.0	.		103.0	44.0	.	NM_014857	B7ZAA4	Missense_Mutation	SNP	ENST00000251507.4	hg19	CCDS1314.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.070853	0.76301	.	.	ENSG00000152061	ENST00000357444;ENST00000367689;ENST00000251507;ENST00000457696;ENST00000367692	T;T;T	0.53206	0.63;3.24;0.64	5.2	4.08	0.47627	.	0.000000	0.85682	D	0.000000	T	0.67785	0.2930	M	0.80982	2.52	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.976;1.0;1.0;1.0	D;P;D;D;D	0.91635	0.998;0.694;0.999;0.999;0.999	T	0.70303	-0.4909	10	0.87932	D	0	.	10.7636	0.46279	0.0:0.0752:0.0:0.9248	.	436;71;424;424;387	B7WPG6;Q5JZA9;F1LJ00;Q5R372;Q5R372-2	.;.;.;RBG1L_HUMAN;.	R	387;71;424;436;436	ENSP00000350027:W387R;ENSP00000251507:W424R;ENSP00000403136:W436R	ENSP00000251507:W424R	W	+	1	0	RABGAP1L	172514487	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.660000	0.83776	0.834000	0.34852	0.254000	0.18369	TGG	.	.	.	none		0.423	RABGAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084497.1	NM_001243765	
TNN	63923	hgsc.bcm.edu	37	1	175087824	175087824	+	Silent	SNP	C	C	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr1:175087824C>T	ENST00000239462.4	+	11	2627	c.2514C>T	c.(2512-2514)acC>acT	p.T838T		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	838	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		ACGGAGAGACCAGGGAGGTTC	0.622																																					p.T838T		Atlas-SNP	.											.	TNN	297	.	0			c.C2514T						PASS	.						93.0	82.0	86.0					1																	175087824		2203	4300	6503	SO:0001819	synonymous_variant	63923	exon11			AGAGACCAGGGAG	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2514C>T	chr1.hg19:g.175087824C>T		387.0	0.0	.		312.0	135.0	.	NM_022093	B9EGP3|Q5R360	Silent	SNP	ENST00000239462.4	hg19	CCDS30943.1																																																																																			.	.	.	none		0.622	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
TNN	63923	hgsc.bcm.edu	37	1	175105980	175105980	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr1:175105980A>T	ENST00000239462.4	+	17	3564	c.3451A>T	c.(3451-3453)Acc>Tcc	p.T1151S		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	1151	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		ACACAACCTCACCACCGGCAC	0.453																																					p.T1151S		Atlas-SNP	.											.	TNN	297	.	0			c.A3451T						PASS	.						79.0	73.0	75.0					1																	175105980		2203	4300	6503	SO:0001583	missense	63923	exon17			AACCTCACCACCG	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.3451A>T	chr1.hg19:g.175105980A>T	ENSP00000239462:p.Thr1151Ser	121.0	0.0	.		82.0	34.0	.	NM_022093	B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	hg19	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	A	17.97	3.517376	0.64634	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	D	0.85088	-1.94	5.13	5.13	0.70059	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.105272	0.64402	D	0.000004	D	0.89787	0.6816	L	0.60067	1.865	0.41191	D	0.986309	D	0.60575	0.988	D	0.63488	0.915	D	0.90621	0.4559	10	0.56958	D	0.05	.	14.9007	0.70678	1.0:0.0:0.0:0.0	.	1151	Q9UQP3	TENN_HUMAN	S	1151;974	ENSP00000239462:T1151S	ENSP00000239462:T1151S	T	+	1	0	TNN	173372603	1.000000	0.71417	1.000000	0.80357	0.202000	0.24057	8.631000	0.90991	2.057000	0.61298	0.533000	0.62120	ACC	.	.	.	none		0.453	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
PPP1R15B	84919	hgsc.bcm.edu	37	1	204380034	204380034	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr1:204380034G>T	ENST00000367188.4	-	1	885	c.506C>A	c.(505-507)cCt>cAt	p.P169H	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	169					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			CTGTGCTGCAGGGTCCAAAGC	0.552																																					p.P169H		Atlas-SNP	.											.	PPP1R15B	67	.	0			c.C506A						PASS	.						88.0	90.0	89.0					1																	204380034		2203	4300	6503	SO:0001583	missense	84919	exon1			GCTGCAGGGTCCA	AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.506C>A	chr1.hg19:g.204380034G>T	ENSP00000356156:p.Pro169His	185.0	0.0	.		163.0	58.0	.	NM_032833	Q53GQ4|Q658M2|Q6P156|Q96SN1	Missense_Mutation	SNP	ENST00000367188.4	hg19	CCDS1445.1	.	.	.	.	.	.	.	.	.	.	G	11.77	1.737847	0.30774	.	.	ENSG00000158615	ENST00000367188;ENST00000543650	T	0.19250	2.16	4.81	2.9	0.33743	Protein phosphatase 1, regulatory subunit 15B, N-terminal (1);	0.675157	0.12952	N	0.425762	T	0.34658	0.0905	L	0.40543	1.245	0.22034	N	0.999405	D	0.71674	0.998	D	0.67382	0.951	T	0.12811	-1.0533	10	0.72032	D	0.01	-0.192	11.3319	0.49482	0.0:0.3548:0.6452:0.0	.	169	Q5SWA1	PR15B_HUMAN	H	169;79	ENSP00000356156:P169H	ENSP00000356156:P169H	P	-	2	0	PPP1R15B	202646657	0.974000	0.33945	0.047000	0.18901	0.010000	0.07245	2.242000	0.43106	0.593000	0.29745	-0.176000	0.13171	CCT	.	.	.	none		0.552	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087974.1	NM_032833	
EMILIN1	11117	hgsc.bcm.edu	37	2	27305967	27305967	+	Nonsense_Mutation	SNP	C	C	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr2:27305967C>T	ENST00000380320.4	+	4	2027	c.1528C>T	c.(1528-1530)Cag>Tag	p.Q510*		NM_007046.3	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1	510					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(14)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	26	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGTGAGGGGCAGCTGCGGCT	0.692																																					p.Q510X		Atlas-SNP	.											.	EMILIN1	75	.	0			c.C1528T						PASS	.						18.0	21.0	20.0					2																	27305967		2202	4300	6502	SO:0001587	stop_gained	11117	exon4			GAGGGGCAGCTGC	AF088916	CCDS1733.1	2p23.3-p23.2	2008-02-05			ENSG00000138080	ENSG00000138080		"""EMI domain containing"""	19880	protein-coding gene	gene with protein product		130660					Standard	NM_007046		Approved	DKFZp586M121, gp115	uc002rii.4	Q9Y6C2	OTTHUMG00000097069	ENST00000380320.4:c.1528C>T	chr2.hg19:g.27305967C>T	ENSP00000369677:p.Gln510*	94.0	0.0	.		58.0	6.0	.	NM_007046	A5PL03|H0Y7A0|Q53SY9|Q96G58|Q96IH6|Q9UG76	Nonsense_Mutation	SNP	ENST00000380320.4	hg19	CCDS1733.1	.	.	.	.	.	.	.	.	.	.	C	41	8.853643	0.98978	.	.	ENSG00000138080	ENST00000380320	.	.	.	5.28	5.28	0.74379	.	0.451866	0.23141	N	0.051461	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	-11.7746	14.3929	0.66991	0.0:1.0:0.0:0.0	.	.	.	.	X	510	.	ENSP00000369677:Q510X	Q	+	1	0	EMILIN1	27159471	0.154000	0.22792	0.998000	0.56505	0.954000	0.61252	1.807000	0.38902	2.493000	0.84123	0.561000	0.74099	CAG	.	.	.	none		0.692	EMILIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214185.1	NM_007046	
ERLEC1	27248	hgsc.bcm.edu	37	2	54040085	54040085	+	Splice_Site	SNP	G	G	C			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr2:54040085G>C	ENST00000185150.4	+	11	1232		c.e11-1		GPR75-ASB3_ENST00000352846.3_Intron|ERLEC1_ENST00000378239.5_Splice_Site|ASB3_ENST00000498475.2_Intron|ERLEC1_ENST00000405123.3_Splice_Site|ASB3_ENST00000406625.2_Intron	NM_015701.4	NP_056516.2	Q96DZ1	ERLEC_HUMAN	endoplasmic reticulum lectin 1						ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum lumen (GO:0005788)	glycoprotein binding (GO:0001948)			endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|stomach(1)|urinary_tract(1)	18						TCCCATATTAGGACAAGGATA	0.393																																					.		Atlas-SNP	.											.	ERLEC1	32	.	0			c.940-1G>C						PASS	.						88.0	83.0	85.0					2																	54040085		2203	4300	6503	SO:0001630	splice_region_variant	27248	exon10			ATATTAGGACAAG	AF131849	CCDS1848.1, CCDS46283.1, CCDS46284.1	2p16	2010-03-19	2009-08-26	2009-08-26	ENSG00000068912	ENSG00000068912			25222	protein-coding gene	gene with protein product	"""erlectin 1"""	611229	"""chromosome 2 open reading frame 30"""	C2orf30		9110174, 8619474, 16531414, 18264092	Standard	NM_015701		Approved	CL25084, XTP3TPB, XTP3-B, ERLECTIN	uc002rxl.3	Q96DZ1	OTTHUMG00000129281	ENST00000185150.4:c.1102-1G>C	chr2.hg19:g.54040085G>C		161.0	0.0	.		133.0	53.0	.	NM_001127398	B2RDB4|B5MC72|O95901|Q6UWN7|Q9NUY7|Q9UQL4	Splice_Site	SNP	ENST00000185150.4	hg19	CCDS1848.1	.	.	.	.	.	.	.	.	.	.	G	18.00	3.524487	0.64747	.	.	ENSG00000068912	ENST00000405123;ENST00000185150;ENST00000378239	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3626	0.98863	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ERLEC1	53893589	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	8.932000	0.92897	2.885000	0.99019	0.655000	0.94253	.	.	.	.	none		0.393	ERLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251404.1	NM_015701	Intron
DQX1	165545	hgsc.bcm.edu	37	2	74755400	74755400	+	5'Flank	SNP	C	C	T	rs377142567		TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr2:74755400C>T	ENST00000404568.3	-	0	0				DQX1_ENST00000393951.2_5'Flank|AUP1_ENST00000377526.3_Missense_Mutation_p.V216I|HTRA2_ENST00000352222.3_5'Flank|HTRA2_ENST00000258080.3_5'Flank	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1							nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						GTGAAAGGGACGAAAAGTGAC	0.537																																					p.V216I		Atlas-SNP	.											.	AUP1	29	.	0			c.G646A						PASS	.	C	ILE/VAL	0,4080		0,0,2040	74.0	80.0	78.0		646	5.1	1.0	2		78	1,8385		0,1,4192	no	missense	AUP1	NM_181575.3	29	0,1,6232	TT,TC,CC		0.0119,0.0,0.0080	benign	216/411	74755400	1,12465	2040	4193	6233	SO:0001631	upstream_gene_variant	550	exon6			AAGGGACGAAAAG	AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965		chr2.hg19:g.74755400C>T	Exception_encountered	86.0	0.0	.		70.0	39.0	.	NM_181575	Q6B017|Q8NAM8	Missense_Mutation	SNP	ENST00000404568.3	hg19	CCDS1949.2	.	.	.	.	.	.	.	.	.	.	C	14.05	2.420097	0.42918	0.0	1.19E-4	ENSG00000115307	ENST00000377526;ENST00000258081;ENST00000412627	D	0.92805	-3.11	5.1	5.1	0.69264	.	0.065407	0.64402	D	0.000010	D	0.83557	0.5280	N	0.25426	0.745	0.44485	D	0.997421	P;P;P	0.44429	0.835;0.835;0.75	B;B;B	0.35114	0.06;0.097;0.196	T	0.83241	-0.0058	10	0.41790	T	0.15	-14.846	9.4342	0.38628	0.0:0.9061:0.0:0.0939	.	273;282;216	E7EU18;Q9Y679;Q9Y679-2	.;AUP1_HUMAN;.	I	216;280;218	ENSP00000366748:V216I	ENSP00000258081:V280I	V	-	1	0	AUP1	74608908	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.606000	0.46291	2.655000	0.90218	0.462000	0.41574	GTC	.	.	.	weak		0.537	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252230.3	NM_133637	
POLR1A	25885	hgsc.bcm.edu	37	2	86327239	86327239	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr2:86327239G>A	ENST00000263857.6	-	2	512	c.134C>T	c.(133-135)cCa>cTa	p.P45L	POLR1A_ENST00000409681.1_Missense_Mutation_p.P45L			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	45					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						GTTTGCCGATGGGTTCCCCAG	0.498																																					p.P45L		Atlas-SNP	.											.	POLR1A	137	.	0			c.C134T						PASS	.						92.0	95.0	94.0					2																	86327239		1924	4149	6073	SO:0001583	missense	25885	exon2			GCCGATGGGTTCC	AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.134C>T	chr2.hg19:g.86327239G>A	ENSP00000263857:p.Pro45Leu	138.0	0.0	.		90.0	38.0	.	NM_015425	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	ENST00000263857.6	hg19	CCDS42706.1	.	.	.	.	.	.	.	.	.	.	G	19.03	3.748536	0.69533	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.39997	1.05;1.05	5.93	5.93	0.95920	RNA polymerase Rpb1, domain 1 (1);	0.109298	0.64402	D	0.000007	T	0.73024	0.3534	M	0.90483	3.12	0.80722	D	1	D;D	0.69078	0.997;0.991	D;D	0.72075	0.976;0.92	T	0.77517	-0.2558	10	0.87932	D	0	-13.9436	20.3363	0.98740	0.0:0.0:1.0:0.0	.	45;45	B9ZVN9;O95602	.;RPA1_HUMAN	L	45	ENSP00000263857:P45L;ENSP00000386300:P45L	ENSP00000263857:P45L	P	-	2	0	POLR1A	86180750	1.000000	0.71417	0.984000	0.44739	0.759000	0.43091	7.215000	0.77966	2.814000	0.96858	0.563000	0.77884	CCA	.	.	.	none		0.498	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425	
ITPR1	3708	hgsc.bcm.edu	37	3	4824382	4824382	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr3:4824382C>T	ENST00000443694.2	+	47	6422	c.6422C>T	c.(6421-6423)tCc>tTc	p.S2141F	ITPR1_ENST00000354582.6_Missense_Mutation_p.S2141F|ITPR1_ENST00000423119.2_Missense_Mutation_p.S2108F|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000302640.8_Missense_Mutation_p.S2141F|ITPR1_ENST00000357086.4_Missense_Mutation_p.S2108F|ITPR1_ENST00000456211.2_Missense_Mutation_p.S2093F			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	2156					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	GGGGCGGCGTCCCCCAGGAAC	0.527																																					p.S2141F		Atlas-SNP	.											.	ITPR1	659	.	0			c.C6422T						PASS	.						101.0	111.0	107.0					3																	4824382		2077	4182	6259	SO:0001583	missense	3708	exon49			CGGCGTCCCCCAG	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.6422C>T	chr3.hg19:g.4824382C>T	ENSP00000401671:p.Ser2141Phe	209.0	0.0	.		176.0	81.0	.	NM_001168272	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	hg19	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808639	0.90707	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000426160;ENST00000357086;ENST00000456211;ENST00000443694	D;D;D;D;D;D	0.92595	-3.06;-3.07;-3.07;-3.07;-3.05;-3.06	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.96809	0.8958	M	0.89534	3.04	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72625	0.959;0.978	D	0.97432	1.0016	10	0.66056	D	0.02	.	18.6589	0.91465	0.0:1.0:0.0:0.0	.	2156;2108	Q14643;G5E9P1	ITPR1_HUMAN;.	F	2156;2141;2141;2108;602;2108;2093;2141	ENSP00000306253:S2141F;ENSP00000346595:S2141F;ENSP00000405934:S2108F;ENSP00000349597:S2108F;ENSP00000397885:S2093F;ENSP00000401671:S2141F	ENSP00000306253:S2141F	S	+	2	0	ITPR1	4799382	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	7.752000	0.85141	2.402000	0.81655	0.650000	0.86243	TCC	.	.	.	none		0.527	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
QRICH1	54870	hgsc.bcm.edu	37	3	49114436	49114436	+	Silent	SNP	T	T	C			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr3:49114436T>C	ENST00000395443.2	-	2	487	c.15A>G	c.(13-15)ctA>ctG	p.L5L	QRICH1_ENST00000357496.2_Silent_p.L5L|QRICH1_ENST00000424300.1_Silent_p.L5L	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1	5	CARD.					nucleus (GO:0005634)				breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		TGGTGTTCTCTAGGGAATTAT	0.433																																					p.L5L		Atlas-SNP	.											.	QRICH1	48	.	0			c.A15G						PASS	.						100.0	100.0	100.0					3																	49114436		2203	4300	6503	SO:0001819	synonymous_variant	54870	exon2			GTTCTCTAGGGAA		CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772	ENST00000395443.2:c.15A>G	chr3.hg19:g.49114436T>C		93.0	0.0	.		83.0	36.0	.	NM_198880	Q4G0F7|Q7L621|Q8TEA5	Silent	SNP	ENST00000395443.2	hg19	CCDS2787.1																																																																																			.	.	.	none		0.433	QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345669.1	NM_017730	
PTPRG	5793	hgsc.bcm.edu	37	3	62278935	62278935	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr3:62278935A>T	ENST00000474889.1	+	30	4668	c.4291A>T	c.(4291-4293)Att>Ttt	p.I1431F	PTPRG-AS1_ENST00000474795.1_RNA|PTPRG-AS1_ENST00000479018.1_RNA|PTPRG-AS1_ENST00000498655.1_RNA|PTPRG-AS1_ENST00000475371.1_RNA|PTPRG_ENST00000295874.10_Missense_Mutation_p.I1402F|PTPRG-AS1_ENST00000495542.1_RNA|PTPRG-AS1_ENST00000462497.1_RNA|PTPRG-AS1_ENST00000490916.1_RNA|PTPRG-AS1_ENST00000466893.1_RNA	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	1431					brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		TGCTGTTCTTATTGCAGATGA	0.413																																					p.I1431F		Atlas-SNP	.											.	PTPRG	153	.	0			c.A4291T						PASS	.						135.0	128.0	130.0					3																	62278935		2203	4299	6502	SO:0001583	missense	5793	exon30			GTTCTTATTGCAG	L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.4291A>T	chr3.hg19:g.62278935A>T	ENSP00000418112:p.Ile1431Phe	259.0	0.0	.		232.0	107.0	.	NM_002841	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	ENST00000474889.1	hg19	CCDS2895.1	.	.	.	.	.	.	.	.	.	.	A	11.94	1.787350	0.31593	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	T;T	0.52983	0.64;0.71	5.45	5.45	0.79879	.	0.330007	0.36972	N	0.002320	T	0.33206	0.0855	N	0.22421	0.69	0.09310	N	0.999999	B;B;B	0.27264	0.037;0.173;0.024	B;B;B	0.28709	0.006;0.093;0.038	T	0.29458	-1.0011	10	0.62326	D	0.03	.	8.2166	0.31516	0.8808:0.0:0.1192:0.0	.	677;1402;1431	B7Z3T1;P23470-2;P23470	.;.;PTPRG_HUMAN	F	1431;1402	ENSP00000418112:I1431F;ENSP00000295874:I1402F	ENSP00000295874:I1402F	I	+	1	0	PTPRG	62253975	0.044000	0.20184	0.193000	0.23327	0.955000	0.61496	1.731000	0.38135	2.086000	0.62901	0.528000	0.53228	ATT	.	.	.	none		0.413	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841	
CADPS	8618	hgsc.bcm.edu	37	3	62739258	62739258	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr3:62739258T>C	ENST00000383710.4	-	3	1095	c.746A>G	c.(745-747)gAg>gGg	p.E249G	CADPS_ENST00000357948.3_Missense_Mutation_p.E249G|CADPS_ENST00000283269.9_Missense_Mutation_p.E249G|CADPS_ENST00000490353.2_Missense_Mutation_p.E249G	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	249					catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		CCGCGGGTCCTCTTCTCCACG	0.572																																					p.E249G		Atlas-SNP	.											.	CADPS	387	.	0			c.A746G						PASS	.						62.0	63.0	63.0					3																	62739258		2203	4300	6503	SO:0001583	missense	8618	exon3			GGGTCCTCTTCTC	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.746A>G	chr3.hg19:g.62739258T>C	ENSP00000373215:p.Glu249Gly	149.0	0.0	.		149.0	51.0	.	NM_003716	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	ENST00000383710.4	hg19	CCDS46858.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.849507	0.91277	.	.	ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269;ENST00000490353	D;D;D;D	0.89617	-2.54;-2.54;-2.54;-2.54	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.93710	0.7990	M	0.77103	2.36	0.80722	D	1	D;P;P	0.59767	0.986;0.873;0.799	P;P;B	0.61201	0.885;0.461;0.214	D	0.94364	0.7590	10	0.87932	D	0	.	16.2824	0.82697	0.0:0.0:0.0:1.0	.	249;249;249	Q9ULU8-2;Q9ULU8-3;Q9ULU8	.;.;CAPS1_HUMAN	G	249	ENSP00000373215:E249G;ENSP00000350632:E249G;ENSP00000283269:E249G;ENSP00000418736:E249G	ENSP00000283269:E249G	E	-	2	0	CADPS	62714298	1.000000	0.71417	0.998000	0.56505	0.882000	0.50991	8.040000	0.89188	2.250000	0.74265	0.533000	0.62120	GAG	.	.	.	none		0.572	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
ATP13A4	84239	hgsc.bcm.edu	37	3	193175211	193175211	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr3:193175211G>A	ENST00000342695.4	-	15	2040	c.1718C>T	c.(1717-1719)cCg>cTg	p.P573L	ATP13A4_ENST00000392443.3_Missense_Mutation_p.P554L	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	573						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		GGCATGTGCCGGCACTCCCTT	0.458																																					p.P573L		Atlas-SNP	.											ATP13A4,NS,adenocarcinoma,0,1	ATP13A4	154	.	0			c.C1718T						PASS	.						173.0	171.0	172.0					3																	193175211		2203	4300	6503	SO:0001583	missense	84239	exon15			TGTGCCGGCACTC	AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.1718C>T	chr3.hg19:g.193175211G>A	ENSP00000339182:p.Pro573Leu	150.0	0.0	.		128.0	55.0	.	NM_032279	B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Missense_Mutation	SNP	ENST00000342695.4	hg19	CCDS3304.2	.	.	.	.	.	.	.	.	.	.	G	11.28	1.591176	0.28357	.	.	ENSG00000127249	ENST00000392443;ENST00000342695	D;D	0.86627	-1.88;-2.15	5.03	4.15	0.48705	ATPase, cation-transporting, domain N (1);ATPase, P-type, cytoplasmic domain N (1);	0.295841	0.29587	N	0.011729	T	0.66655	0.2811	N	0.01800	-0.715	0.80722	D	1	B;B;B	0.19073	0.008;0.003;0.033	B;B;B	0.15484	0.009;0.005;0.013	T	0.59878	-0.7371	10	0.21540	T	0.41	-22.0958	8.9035	0.35510	0.1058:0.0:0.8942:0.0	.	554;573;573	B7WPN9;Q4VNC1-2;Q4VNC1	.;.;AT134_HUMAN	L	554;573	ENSP00000376238:P554L;ENSP00000339182:P573L	ENSP00000339182:P573L	P	-	2	0	ATP13A4	194657905	0.774000	0.28592	0.794000	0.32065	0.608000	0.37181	2.473000	0.45145	1.223000	0.43536	0.655000	0.94253	CCG	.	.	.	none		0.458	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157244.4	NM_032279	
SLC4A4	8671	hgsc.bcm.edu	37	4	72423545	72423545	+	Silent	SNP	T	T	C			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr4:72423545T>C	ENST00000264485.5	+	22	2997	c.2880T>C	c.(2878-2880)tgT>tgC	p.C960C	SLC4A4_ENST00000351898.6_Silent_p.C876C|SLC4A4_ENST00000340595.3_Silent_p.C916C|SLC4A4_ENST00000425175.1_Silent_p.C960C	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	960					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	AGGTGTTGTGTCTGGCCCTGC	0.483																																					p.C960C		Atlas-SNP	.											.	SLC4A4	269	.	0			c.T2880C						PASS	.						152.0	119.0	130.0					4																	72423545		2203	4300	6503	SO:0001819	synonymous_variant	8671	exon22			GTTGTGTCTGGCC	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.2880T>C	chr4.hg19:g.72423545T>C		109.0	0.0	.		91.0	36.0	.	NM_001098484	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Silent	SNP	ENST00000264485.5	hg19	CCDS43236.1																																																																																			.	.	.	none		0.483	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
LPCAT1	79888	hgsc.bcm.edu	37	5	1501608	1501608	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr5:1501608C>A	ENST00000283415.3	-	2	378	c.246G>T	c.(244-246)aaG>aaT	p.K82N		NM_024830.3	NP_079106.3	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	82					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|negative regulation of phosphatidylcholine biosynthetic process (GO:2001246)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein catabolic process (GO:0045732)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|surfactant homeostasis (GO:0043129)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphocholine O-acyltransferase activity (GO:0047159)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|1-alkylglycerophosphocholine O-acyltransferase activity (GO:0047191)|calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		GCTCGGGTTCCTTCTCCGCAG	0.667																																					p.K82N		Atlas-SNP	.											.	LPCAT1	70	.	0			c.G246T						PASS	.						34.0	37.0	36.0					5																	1501608		2199	4299	6498	SO:0001583	missense	79888	exon2			GGGTTCCTTCTCC	BC020166	CCDS3864.1	5p15.33	2013-01-10	2007-12-17	2007-12-17	ENSG00000153395	ENSG00000153395		"""EF-hand domain containing"""	25718	protein-coding gene	gene with protein product		610472	"""acyltransferase like 2"""	AYTL2		8619474, 16704971	Standard	NM_024830		Approved	FLJ12443	uc003jcm.3	Q8NF37	OTTHUMG00000131017	ENST00000283415.3:c.246G>T	chr5.hg19:g.1501608C>A	ENSP00000283415:p.Lys82Asn	200.0	0.0	.		161.0	76.0	.	NM_024830	Q1HAQ1|Q7Z4G6|Q8N3U7|Q8WUL8|Q9GZW6	Missense_Mutation	SNP	ENST00000283415.3	hg19	CCDS3864.1	.	.	.	.	.	.	.	.	.	.	C	6.293	0.422250	0.11928	.	.	ENSG00000153395	ENST00000283415	T	0.71698	-0.59	4.35	2.07	0.26955	.	0.437567	0.24851	N	0.035086	T	0.60157	0.2247	L	0.54323	1.7	0.30348	N	0.785034	B	0.10296	0.003	B	0.21708	0.036	T	0.53229	-0.8468	10	0.27785	T	0.31	-13.6788	6.1162	0.20127	0.0:0.5524:0.0:0.4476	.	82	Q8NF37	PCAT1_HUMAN	N	82	ENSP00000283415:K82N	ENSP00000283415:K82N	K	-	3	2	LPCAT1	1554608	0.329000	0.24696	0.207000	0.23584	0.024000	0.10985	0.425000	0.21346	0.793000	0.33875	0.491000	0.48974	AAG	.	.	.	none		0.667	LPCAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304032.1	NM_024830	
NR2F1	7025	hgsc.bcm.edu	37	5	92923881	92923881	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr5:92923881C>T	ENST00000327111.3	+	2	2409	c.722C>T	c.(721-723)cCg>cTg	p.P241L	NR2F1-AS1_ENST00000513055.1_RNA	NM_005654.4	NP_005645.1	P10589	COT1_HUMAN	nuclear receptor subfamily 2, group F, member 1	241					cerebral cortex regionalization (GO:0021796)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|retinoic acid-responsive element binding (GO:0044323)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|large_intestine(6)|lung(2)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	21		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0416)|all cancers(79;9.57e-18)		CCCTTCTTCCCGGATCTGCAG	0.637																																					p.P241L		Atlas-SNP	.											.	NR2F1	56	.	0			c.C722T						PASS	.						84.0	80.0	81.0					5																	92923881		2203	4300	6503	SO:0001583	missense	7025	exon2			TCTTCCCGGATCT	BC004154	CCDS4068.1	5q14	2013-01-16			ENSG00000175745	ENSG00000175745		"""Nuclear hormone receptors"""	7975	protein-coding gene	gene with protein product		132890		ERBAL3, TFCOUP1		8530078	Standard	NM_005654		Approved	EAR-3, COUP-TFI, TCFCOUP1, SVP44	uc003kkj.3	P10589	OTTHUMG00000119079	ENST00000327111.3:c.722C>T	chr5.hg19:g.92923881C>T	ENSP00000325819:p.Pro241Leu	121.0	0.0	.		113.0	11.0	.	NM_005654		Missense_Mutation	SNP	ENST00000327111.3	hg19	CCDS4068.1	.	.	.	.	.	.	.	.	.	.	C	33	5.201256	0.94997	.	.	ENSG00000175745	ENST00000327111	D	0.96334	-3.98	4.54	4.54	0.55810	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.96558	0.8877	L	0.28649	0.875	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97507	1.0064	10	0.66056	D	0.02	.	17.0631	0.86552	0.0:1.0:0.0:0.0	.	241	P10589	COT1_HUMAN	L	241	ENSP00000325819:P241L	ENSP00000325819:P241L	P	+	2	0	NR2F1	92949637	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.606000	0.82863	2.327000	0.79052	0.462000	0.41574	CCG	.	.	.	none		0.637	NR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239293.2	NM_005654	
PCDHB16	57717	hgsc.bcm.edu	37	5	140563836	140563836	+	Missense_Mutation	SNP	G	G	A	rs535302272	byFrequency	TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr5:140563836G>A	ENST00000361016.2	+	1	2857	c.1702G>A	c.(1702-1704)Ggc>Agc	p.G568S		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	568	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTGCAGAACGGCTCCGCGCC	0.711													G|||	2	0.000399361	0.0008	0.0	5008	,	,		13663	0.0		0.0	False		,,,				2504	0.001				p.G568S		Atlas-SNP	.											PCDHB16,NS,carcinoma,0,1	PCDHB16	159	.	0			c.G1702A						PASS	.						14.0	17.0	16.0					5																	140563836		1969	3923	5892	SO:0001583	missense	57717	exon1			CAGAACGGCTCCG	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1702G>A	chr5.hg19:g.140563836G>A	ENSP00000354293:p.Gly568Ser	49.0	0.0	.		41.0	2.0	.	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	hg19	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	g	12.66	2.005258	0.35415	.	.	ENSG00000196963	ENST00000361016	T	0.60797	0.16	4.12	2.28	0.28536	Cadherin (1);Cadherin-like (1);	1.832600	0.03875	N	0.276324	T	0.41719	0.1171	N	0.20807	0.61	0.09310	N	1	B	0.22003	0.063	B	0.17979	0.02	T	0.27123	-1.0083	10	0.45353	T	0.12	.	3.1416	0.06457	0.2646:0.0:0.4112:0.3242	.	568	Q9NRJ7	PCDBG_HUMAN	S	568	ENSP00000354293:G568S	ENSP00000354293:G568S	G	+	1	0	PCDHB16	140544020	0.000000	0.05858	0.984000	0.44739	0.978000	0.69477	0.941000	0.29005	0.212000	0.20703	0.479000	0.44913	GGC	.	.	.	none		0.711	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
SH3TC2	79628	hgsc.bcm.edu	37	5	148421039	148421039	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr5:148421039G>A	ENST00000515425.1	-	6	772	c.671C>T	c.(670-672)aCa>aTa	p.T224I	SH3TC2_ENST00000538184.1_5'UTR|SH3TC2_ENST00000512049.1_Missense_Mutation_p.T217I|SH3TC2_ENST00000394358.2_Missense_Mutation_p.T109I	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	224					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGCTGACCTGTCACCAAAGA	0.562																																					p.T224I		Atlas-SNP	.											.	SH3TC2	178	.	0			c.C671T						PASS	.						86.0	70.0	76.0					5																	148421039		2203	4300	6503	SO:0001583	missense	79628	exon6			TGACCTGTCACCA	AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.671C>T	chr5.hg19:g.148421039G>A	ENSP00000423660:p.Thr224Ile	176.0	0.0	.		142.0	66.0	.	NM_024577	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	ENST00000515425.1	hg19	CCDS4293.1	.	.	.	.	.	.	.	.	.	.	G	19.50	3.839329	0.71488	.	.	ENSG00000169247	ENST00000515425;ENST00000512049;ENST00000394358	T;T;T	0.32988	1.43;1.43;1.43	5.59	3.74	0.42951	.	0.545786	0.17852	N	0.159814	T	0.40956	0.1138	L	0.29908	0.895	0.38988	D	0.959097	D;D;D	0.63880	0.993;0.992;0.992	P;P;P	0.60949	0.881;0.851;0.851	T	0.39761	-0.9598	10	0.72032	D	0.01	-1.1698	15.1929	0.73060	0.0:0.4049:0.5951:0.0	.	109;217;224	C9JLC3;Q14CC0;Q8TF17	.;.;S3TC2_HUMAN	I	224;217;109	ENSP00000423660:T224I;ENSP00000421860:T217I;ENSP00000377886:T109I	ENSP00000313025:T224I	T	-	2	0	SH3TC2	148401232	1.000000	0.71417	0.627000	0.29227	0.978000	0.69477	3.194000	0.51005	0.662000	0.31006	0.650000	0.86243	ACA	.	.	.	none		0.562	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	NM_024577	
ZBED9	114821	hgsc.bcm.edu	37	6	28539881	28539881	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr6:28539881T>C	ENST00000452236.2	-	4	4402	c.3785A>G	c.(3784-3786)gAg>gGg	p.E1262G		NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						taaagcaatctcagcaagctc	0.358																																					p.E1262G		Atlas-SNP	.											.	SCAND3	156	.	0			c.A3785G						PASS	.						69.0	72.0	71.0					6																	28539881		2203	4300	6503	SO:0001583	missense	114821	exon4			GCAATCTCAGCAA																												ENST00000452236.2:c.3785A>G	chr6.hg19:g.28539881T>C	ENSP00000395259:p.Glu1262Gly	308.0	1.0	.		231.0	79.0	.	NM_052923		Missense_Mutation	SNP	ENST00000452236.2	hg19	CCDS34355.1	.	.	.	.	.	.	.	.	.	.	T	15.46	2.839296	0.51057	.	.	ENSG00000232040	ENST00000452236	T	0.23348	1.91	2.53	2.53	0.30540	HAT dimerisation (1);Ribonuclease H-like (1);	1.392160	0.05202	U	0.505216	T	0.28134	0.0694	L	0.53249	1.67	0.26555	N	0.973832	D	0.69078	0.997	D	0.79108	0.992	T	0.09250	-1.0683	10	0.35671	T	0.21	.	6.9733	0.24660	0.0:0.0:0.0:1.0	.	1262	Q6R2W3	SCND3_HUMAN	G	1262	ENSP00000395259:E1262G	ENSP00000395259:E1262G	E	-	2	0	SCAND3	28647860	0.994000	0.37717	0.999000	0.59377	0.952000	0.60782	1.895000	0.39778	1.405000	0.46838	0.533000	0.62120	GAG	.	.	.	none		0.358	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3		
C6orf222	389384	hgsc.bcm.edu	37	6	36298150	36298150	+	Silent	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr6:36298150G>A	ENST00000437635.2	-	2	495	c.318C>T	c.(316-318)ttC>ttT	p.F106F		NM_001010903.4	NP_001010903.3	P0C671	CF222_HUMAN	chromosome 6 open reading frame 222	106										breast(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(4)|urinary_tract(4)	26						TCCTCACGAAGAAGTTCAGCA	0.627																																					p.F106F		Atlas-SNP	.											.	C6orf222	72	.	0			c.C318T						PASS	.						73.0	70.0	71.0					6																	36298150		2203	4300	6503	SO:0001819	synonymous_variant	389384	exon2			CACGAAGAAGTTC		CCDS34439.1	6p21.31	2012-02-22			ENSG00000189325	ENSG00000189325			33769	protein-coding gene	gene with protein product							Standard	NM_001010903		Approved	DKFZp779B1540	uc003oly.3	P0C671	OTTHUMG00000014591	ENST00000437635.2:c.318C>T	chr6.hg19:g.36298150G>A		48.0	0.0	.		42.0	16.0	.	NM_001010903	B2RTY8	Silent	SNP	ENST00000437635.2	hg19	CCDS34439.1																																																																																			.	.	.	none		0.627	C6orf222-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040338.2	NM_001010903	
IBTK	25998	hgsc.bcm.edu	37	6	82950058	82950058	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr6:82950058T>C	ENST00000306270.7	-	2	695	c.146A>G	c.(145-147)gAt>gGt	p.D49G	IBTK_ENST00000503631.1_Missense_Mutation_p.D49G|IBTK_ENST00000510291.1_Missense_Mutation_p.D49G	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	49					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)			central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		GCCAAAAACATCCTTGATAGT	0.443																																					p.D49G		Atlas-SNP	.											.	IBTK	128	.	0			c.A146G						PASS	.						148.0	139.0	142.0					6																	82950058		2203	4300	6503	SO:0001583	missense	25998	exon2			AAAACATCCTTGA	AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.146A>G	chr6.hg19:g.82950058T>C	ENSP00000305721:p.Asp49Gly	153.0	0.0	.		105.0	44.0	.	NM_015525	Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Missense_Mutation	SNP	ENST00000306270.7	hg19	CCDS34490.1	.	.	.	.	.	.	.	.	.	.	T	19.33	3.806574	0.70682	.	.	ENSG00000005700	ENST00000306270;ENST00000503631;ENST00000510291	T;T;T	0.59638	0.25;0.25;0.25	5.78	5.78	0.91487	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.73009	0.3532	M	0.80183	2.485	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.77752	-0.2470	10	0.72032	D	0.01	-23.4179	16.0962	0.81127	0.0:0.0:0.0:1.0	.	49;49;49;49	E9PDR5;E7EPI0;Q9P2D0-2;Q9P2D0	.;.;.;IBTK_HUMAN	G	49	ENSP00000305721:D49G;ENSP00000422762:D49G;ENSP00000426405:D49G	ENSP00000305721:D49G	D	-	2	0	IBTK	83006777	1.000000	0.71417	1.000000	0.80357	0.501000	0.33797	7.671000	0.83941	2.207000	0.71202	0.459000	0.35465	GAT	.	.	.	none		0.443	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041337.2	NM_015525	
SMPDL3A	10924	hgsc.bcm.edu	37	6	123124850	123124850	+	Silent	SNP	A	A	C			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr6:123124850A>C	ENST00000368440.4	+	5	787	c.610A>C	c.(610-612)Agg>Cgg	p.R204R	SMPDL3A_ENST00000539041.1_Silent_p.R73R	NM_006714.3	NP_006705.1	Q92484	ASM3A_HUMAN	sphingomyelin phosphodiesterase, acid-like 3A	204					sphingomyelin catabolic process (GO:0006685)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|cervix(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	10				GBM - Glioblastoma multiforme(226;0.236)		TCCAAACCTTAGGATCATCAG	0.343																																					p.R204R		Atlas-SNP	.											.	SMPDL3A	31	.	0			c.A610C						PASS	.						127.0	122.0	124.0					6																	123124850		2203	4300	6503	SO:0001819	synonymous_variant	10924	exon5			AACCTTAGGATCA	AK000184	CCDS5128.1, CCDS69190.1	6q22.32	2006-04-12			ENSG00000172594	ENSG00000172594			17389	protein-coding gene	gene with protein product	"""acid sphingomyelinase-like phosphodiesterase 3a"""	610728				12442002	Standard	XM_005266798		Approved	FLJ20177, ASM3A, ASML3a, yR36GH4.1	uc003pzg.3	Q92484	OTTHUMG00000015490	ENST00000368440.4:c.610A>C	chr6.hg19:g.123124850A>C		174.0	0.0	.		143.0	50.0	.	NM_006714	B7Z729|Q8WV13	Silent	SNP	ENST00000368440.4	hg19	CCDS5128.1																																																																																			.	.	.	none		0.343	SMPDL3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042039.1	NM_006714	
SYNE1	23345	hgsc.bcm.edu	37	6	152510469	152510469	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr6:152510469G>A	ENST00000367255.5	-	128	23820	c.23219C>T	c.(23218-23220)gCc>gTc	p.A7740V	SYNE1_ENST00000448038.1_Missense_Mutation_p.A7669V|SYNE1_ENST00000423061.1_Missense_Mutation_p.A7669V|SYNE1_ENST00000356820.4_Missense_Mutation_p.A2264V|SYNE1_ENST00000341594.5_Missense_Mutation_p.A7352V|SYNE1_ENST00000265368.4_Missense_Mutation_p.A7740V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7740					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ACTGATATAGGCAGAGAGGGT	0.423										HNSCC(10;0.0054)																											p.A7740V		Atlas-SNP	.											.	SYNE1	3227	.	0			c.C23219T						PASS	.						154.0	150.0	152.0					6																	152510469		2203	4300	6503	SO:0001583	missense	23345	exon128			ATATAGGCAGAGA	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.23219C>T	chr6.hg19:g.152510469G>A	ENSP00000356224:p.Ala7740Val	74.0	0.0	.		88.0	44.0	.	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	9.442	1.088347	0.20390	.	.	ENSG00000131018	ENST00000367255;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000367251	T;T;T;T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25	5.99	5.11	0.69529	.	0.270973	0.28042	N	0.016838	T	0.06234	0.0161	N	0.04043	-0.29	0.09310	N	1	B;B;B;B	0.09022	0.001;0.001;0.002;0.001	B;B;B;B	0.11329	0.003;0.003;0.006;0.003	T	0.21348	-1.0248	10	0.30078	T	0.28	.	8.3176	0.32111	0.1333:0.0:0.7401:0.1266	.	7740;7740;7669;7669	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9	SYNE1_HUMAN;.;.;.	V	7740;386;7669;7740;7669;7352;2264;662	ENSP00000356224:A7740V;ENSP00000356226:A386V;ENSP00000396024:A7669V;ENSP00000265368:A7740V;ENSP00000390975:A7669V;ENSP00000341887:A7352V;ENSP00000349276:A2264V;ENSP00000356220:A662V	ENSP00000265368:A7740V	A	-	2	0	SYNE1	152552162	0.254000	0.23992	0.845000	0.33349	0.831000	0.47069	1.811000	0.38942	1.509000	0.48786	0.655000	0.94253	GCC	.	.	.	none		0.423	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
UPP1	7378	hgsc.bcm.edu	37	7	48139322	48139322	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr7:48139322C>A	ENST00000331803.4	+	5	723	c.100C>A	c.(100-102)Ctc>Atc	p.L34I	UPP1_ENST00000482015.1_Intron|UPP1_ENST00000429491.2_Intron|UPP1_ENST00000395564.4_Missense_Mutation_p.L34I|UPP1_ENST00000341253.4_Missense_Mutation_p.L34I			Q16831	UPP1_HUMAN	uridine phosphorylase 1	34					cellular response to glucose starvation (GO:0042149)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)	uridine phosphorylase activity (GO:0004850)			breast(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	18					Fluorouracil(DB00544)	AGAAGATATTCTCTATCATTT	0.398																																					p.L34I		Atlas-SNP	.											.	UPP1	35	.	0			c.C100A						PASS	.						137.0	135.0	136.0					7																	48139322		2203	4300	6503	SO:0001583	missense	7378	exon4			GATATTCTCTATC	AK096167	CCDS5507.1	7p12.3	2012-10-02	2003-08-28	2003-08-29	ENSG00000183696	ENSG00000183696	2.4.2.3		12576	protein-coding gene	gene with protein product		191730	"""uridine phosphorylase"""	UP		752472, 11807789	Standard	NM_003364		Approved	UPASE, UPP, UDRPASE	uc003toj.3	Q16831	OTTHUMG00000129253	ENST00000331803.4:c.100C>A	chr7.hg19:g.48139322C>A	ENSP00000330032:p.Leu34Ile	59.0	0.0	.		94.0	24.0	.	NM_003364	D3DVM4|Q15362	Missense_Mutation	SNP	ENST00000331803.4	hg19	CCDS5507.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.182020	0.78677	.	.	ENSG00000183696	ENST00000416681;ENST00000331803;ENST00000341253;ENST00000395564;ENST00000436673	T;T;T;T;T	0.60797	0.46;0.16;0.16;0.16;0.47	5.43	4.52	0.55395	.	0.132798	0.48767	D	0.000165	T	0.74442	0.3717	M	0.83774	2.66	0.80722	D	1	D;D	0.71674	0.998;0.991	D;D	0.83275	0.996;0.949	T	0.76315	-0.3004	10	0.87932	D	0	-13.8768	8.0456	0.30547	0.0:0.806:0.0:0.194	.	34;34	B4DND0;Q16831	.;UPP1_HUMAN	I	34	ENSP00000405209:L34I;ENSP00000330032:L34I;ENSP00000342878:L34I;ENSP00000378931:L34I;ENSP00000390118:L34I	ENSP00000330032:L34I	L	+	1	0	UPP1	48105847	0.984000	0.35163	0.755000	0.31263	0.864000	0.49448	2.384000	0.44362	1.188000	0.43014	0.563000	0.77884	CTC	.	.	.	none		0.398	UPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251360.1	NM_003364	
NPTX2	4885	hgsc.bcm.edu	37	7	98257796	98257796	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr7:98257796G>A	ENST00000265634.3	+	5	1316	c.1151G>A	c.(1150-1152)cGc>cAc	p.R384H		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	384	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			CGCGTCCTTCGCGCACAAGAA	0.567																																					p.R384H		Atlas-SNP	.											.	NPTX2	45	.	0			c.G1151A						PASS	.						98.0	77.0	84.0					7																	98257796		2203	4300	6503	SO:0001583	missense	4885	exon5			TCCTTCGCGCACA		CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.1151G>A	chr7.hg19:g.98257796G>A	ENSP00000265634:p.Arg384His	159.0	0.0	.		242.0	49.0	.	NM_002523	A4D267|Q86XV7|Q96G70	Missense_Mutation	SNP	ENST00000265634.3	hg19	CCDS5657.1	.	.	.	.	.	.	.	.	.	.	G	18.83	3.707444	0.68615	.	.	ENSG00000106236	ENST00000265634	T	0.58797	0.31	5.94	4.88	0.63580	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.142653	0.64402	D	0.000014	T	0.56381	0.1981	L	0.36672	1.1	0.09310	N	0.999998	D	0.57571	0.98	P	0.52758	0.708	T	0.53158	-0.8478	10	0.62326	D	0.03	-27.9605	10.4311	0.44409	0.1933:0.0:0.8067:0.0	.	384	P47972	NPTX2_HUMAN	H	384	ENSP00000265634:R384H	ENSP00000265634:R384H	R	+	2	0	NPTX2	98095732	0.088000	0.21588	0.292000	0.24919	0.792000	0.44763	1.644000	0.37228	2.826000	0.97356	0.561000	0.74099	CGC	.	.	.	none		0.567	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334982.1	NM_002523	
TNPO3	23534	hgsc.bcm.edu	37	7	128626881	128626881	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr7:128626881C>A	ENST00000265388.5	-	12	1735	c.1592G>T	c.(1591-1593)cGa>cTa	p.R531L	TNPO3_ENST00000482320.1_Missense_Mutation_p.R465L|TNPO3_ENST00000471166.1_Missense_Mutation_p.R565L|TNPO3_ENST00000471234.1_Intron|TNPO3_ENST00000393245.1_Missense_Mutation_p.R565L			Q9Y5L0	TNPO3_HUMAN	transportin 3	531					splicing factor protein import into nucleus (GO:0035048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(3)	22						CATGTGATCTCGGCAGACAGA	0.507																																					p.R531L	Pancreas(147;583 2585 39696 52331)	Atlas-SNP	.											.	TNPO3	148	.	0			c.G1592T						PASS	.						116.0	113.0	114.0					7																	128626881		2203	4300	6503	SO:0001583	missense	23534	exon12			TGATCTCGGCAGA	AF145029	CCDS5809.1, CCDS55162.1	7q32.2	2014-02-03			ENSG00000064419	ENSG00000064419		"""Importins"""	17103	protein-coding gene	gene with protein product	"""importin 12"""	610032	"""limb girdle muscular dystrophy 1F (autosomal dominant)"""	LGMD1F		10366588, 10713112, 23543484, 23667635	Standard	NM_012470		Approved	TRN-SR, MTR10A, TRN-SR2, IPO12	uc003vol.2	Q9Y5L0	OTTHUMG00000158409	ENST00000265388.5:c.1592G>T	chr7.hg19:g.128626881C>A	ENSP00000265388:p.Arg531Leu	253.0	0.0	.		408.0	95.0	.	NM_012470	A4D1K9|C9IZM0|Q6NUM1|Q96G71|Q96GU9|Q9Y3R2	Missense_Mutation	SNP	ENST00000265388.5	hg19	CCDS5809.1	.	.	.	.	.	.	.	.	.	.	C	33	5.209311	0.95069	.	.	ENSG00000064419	ENST00000393245;ENST00000265388;ENST00000482320;ENST00000471166	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	6.17	6.17	0.99709	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.75064	0.3799	L	0.58101	1.795	0.80722	D	1	D;B	0.59767	0.986;0.426	P;B	0.54759	0.76;0.175	T	0.72327	-0.4327	10	0.40728	T	0.16	.	18.3732	0.90420	0.0:1.0:0.0:0.0	.	565;531	C9J7E5;Q9Y5L0	.;TNPO3_HUMAN	L	565;531;465;565	ENSP00000376936:R565L;ENSP00000265388:R531L;ENSP00000420089:R465L;ENSP00000418267:R565L	ENSP00000265388:R531L	R	-	2	0	TNPO3	128414117	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.685000	0.84117	2.941000	0.99782	0.655000	0.94253	CGA	.	.	.	none		0.507	TNPO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350929.1	NM_012470	
PRSS55	203074	hgsc.bcm.edu	37	8	10396206	10396206	+	Missense_Mutation	SNP	G	G	A	rs200907557	byFrequency	TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr8:10396206G>A	ENST00000328655.3	+	5	1002	c.962G>A	c.(961-963)gGc>gAc	p.G321D	PRSS55_ENST00000522210.1_Intron|PRSS51_ENST00000523024.1_RNA	NM_198464.3	NP_940866.2	Q6UWB4	PRS55_HUMAN	protease, serine, 55	321						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)	31						AAACCTATGGGCTCCCCAGTC	0.532																																					p.G321D		Atlas-SNP	.											.	PRSS55	67	.	0			c.G962A						PASS	.						98.0	111.0	107.0					8																	10396206		2203	4300	6503	SO:0001583	missense	203074	exon5			CTATGGGCTCCCC	AY358867	CCDS5976.1, CCDS56523.1	8p23.1	2014-01-21			ENSG00000184647	ENSG00000184647		"""Serine peptidases / Serine peptidases"""	30824	protein-coding gene	gene with protein product		615144				12975309, 18844450	Standard	NM_198464		Approved	T-SP1, UNQ9391, CT153	uc003wta.3	Q6UWB4	OTTHUMG00000129345	ENST00000328655.3:c.962G>A	chr8.hg19:g.10396206G>A	ENSP00000333003:p.Gly321Asp	145.0	0.0	.		94.0	44.0	.	NM_198464	E5RJX5	Missense_Mutation	SNP	ENST00000328655.3	hg19	CCDS5976.1	.	.	.	.	.	.	.	.	.	.	G	0.578	-0.838381	0.02692	.	.	ENSG00000184647	ENST00000328655	D	0.88277	-2.36	3.64	-1.68	0.08212	.	1.695820	0.03580	N	0.229930	T	0.75598	0.3871	N	0.14661	0.345	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.61496	-0.7051	10	0.13470	T	0.59	.	2.6794	0.05089	0.3215:0.0:0.3306:0.3479	.	321	Q6UWB4	PRS55_HUMAN	D	321	ENSP00000333003:G321D	ENSP00000333003:G321D	G	+	2	0	PRSS55	10433616	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.489000	0.06490	-0.380000	0.07894	0.655000	0.94253	GGC	.	G|0.999;C|0.001	.	alt		0.532	PRSS55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251493.3	NM_198464	
RP1L1	94137	hgsc.bcm.edu	37	8	10468692	10468692	+	Silent	SNP	T	T	C			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr8:10468692T>C	ENST00000382483.3	-	4	3139	c.2916A>G	c.(2914-2916)acA>acG	p.T972T		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	972					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CCAACTCATATGTCATGAGTA	0.627																																					p.T972T		Atlas-SNP	.											.	RP1L1	453	.	0			c.A2916G						PASS	.						53.0	58.0	56.0					8																	10468692		1955	4146	6101	SO:0001819	synonymous_variant	94137	exon4			CTCATATGTCATG	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.2916A>G	chr8.hg19:g.10468692T>C		121.0	0.0	.		86.0	41.0	.	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	hg19	CCDS43708.1																																																																																			.	.	.	none		0.627	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
DOCK5	80005	hgsc.bcm.edu	37	8	25177162	25177162	+	Silent	SNP	C	C	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr8:25177162C>T	ENST00000276440.7	+	15	1556	c.1512C>T	c.(1510-1512)gtC>gtT	p.V504V		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	504	DHR-1.				positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		ATTACCAAGTCAAGCAGCCCT	0.398																																					p.V504V	Pancreas(145;34 1887 3271 10937 30165)	Atlas-SNP	.											.	DOCK5	167	.	0			c.C1512T						PASS	.						99.0	91.0	94.0					8																	25177162		2197	4285	6482	SO:0001819	synonymous_variant	80005	exon15			CCAAGTCAAGCAG		CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.1512C>T	chr8.hg19:g.25177162C>T		63.0	0.0	.		57.0	25.0	.	NM_024940	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Silent	SNP	ENST00000276440.7	hg19	CCDS6047.1	.	.	.	.	.	.	.	.	.	.	C	10.13	1.266657	0.23136	.	.	ENSG00000147459	ENST00000444569	.	.	.	5.78	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2778	0.73756	0.0:0.7126:0.2873:0.0	.	.	.	.	X	276	.	.	Q	+	1	0	DOCK5	25233079	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.182000	0.42556	1.554000	0.49487	0.655000	0.94253	CAA	.	.	.	none		0.398	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2	NM_024940	
ADAM2	2515	hgsc.bcm.edu	37	8	39691500	39691500	+	Missense_Mutation	SNP	T	T	A	rs150036296		TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr8:39691500T>A	ENST00000265708.4	-	3	254	c.151A>T	c.(151-153)Att>Ttt	p.I51F	ADAM2_ENST00000379853.2_Missense_Mutation_p.I51F|ADAM2_ENST00000523181.1_5'UTR|ADAM2_ENST00000521880.1_Missense_Mutation_p.I51F|ADAM2_ENST00000347580.4_Missense_Mutation_p.I51F	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	51					adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		TTCCCTTCAATTACAATTTTG	0.279																																					p.I51F		Atlas-SNP	.											.	ADAM2	124	.	0			c.A151T						PASS	.						66.0	68.0	67.0					8																	39691500		2203	4288	6491	SO:0001583	missense	2515	exon3			CTTCAATTACAAT	U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.151A>T	chr8.hg19:g.39691500T>A	ENSP00000265708:p.Ile51Phe	52.0	0.0	.		84.0	29.0	.	NM_001464	P78326|Q9UQQ8	Missense_Mutation	SNP	ENST00000265708.4	hg19	CCDS34884.1	.	.	.	.	.	.	.	.	.	.	T	14.35	2.509966	0.44660	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	T;T;T;T	0.06608	3.28;3.28;3.28;3.28	4.72	4.72	0.59763	Peptidase M12B, propeptide (1);	.	.	.	.	T	0.16514	0.0397	L	0.48935	1.535	0.39409	D	0.96672	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.91635	0.997;0.999;0.997;0.998	T	0.01413	-1.1361	8	.	.	.	.	10.7702	0.46319	0.0:0.0:0.0:1.0	.	51;51;51;51	B4DWY7;Q6P2G0;Q99965-2;Q99965	.;.;.;ADAM2_HUMAN	F	51	ENSP00000343854:I51F;ENSP00000369182:I51F;ENSP00000265708:I51F;ENSP00000429352:I51F	.	I	-	1	0	ADAM2	39810657	0.958000	0.32768	0.882000	0.34594	0.043000	0.13939	2.930000	0.48924	2.104000	0.64026	0.528000	0.53228	ATT	.	T|0.999;G|0.001	.	alt		0.279	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	NM_001464	
SLC20A2	6575	hgsc.bcm.edu	37	8	42275393	42275393	+	Silent	SNP	G	G	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr8:42275393G>T	ENST00000342228.3	-	11	2256	c.1887C>A	c.(1885-1887)acC>acA	p.T629T	SLC20A2_ENST00000520262.1_Silent_p.T629T|SLC20A2_ENST00000520179.1_Silent_p.T629T	NM_006749.4	NP_006740.1	Q08357	S20A2_HUMAN	solute carrier family 20 (phosphate transporter), member 2	629					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|sodium:phosphate symporter activity (GO:0005436)|virus receptor activity (GO:0001618)			breast(1)|endometrium(6)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|stomach(1)	26	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			CCACAGGGACGGTCACGAACC	0.587																																					p.T629T		Atlas-SNP	.											.	SLC20A2	64	.	0			c.C1887A						PASS	.						79.0	72.0	74.0					8																	42275393		2203	4300	6503	SO:0001819	synonymous_variant	6575	exon11			AGGGACGGTCACG		CCDS6132.1	8p11.21	2013-05-22			ENSG00000168575	ENSG00000168575		"""Solute carriers"""	10947	protein-coding gene	gene with protein product		158378		MLVAR, GLVR2		7745689, 16790504	Standard	NM_001257180		Approved	PiT-2, Glvr-2	uc010lxm.4	Q08357	OTTHUMG00000164169	ENST00000342228.3:c.1887C>A	chr8.hg19:g.42275393G>T		180.0	0.0	.		164.0	76.0	.	NM_001257181		Silent	SNP	ENST00000342228.3	hg19	CCDS6132.1																																																																																			.	.	.	none		0.587	SLC20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377578.1		
CHD7	55636	hgsc.bcm.edu	37	8	61778469	61778469	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr8:61778469G>A	ENST00000423902.2	+	38	9450	c.8971G>A	c.(8971-8973)Gaa>Aaa	p.E2991K	CHD7_ENST00000524602.1_Missense_Mutation_p.E942K	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2991					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GGATGAAATAGAAAACAATGA	0.423																																					p.E2991K		Atlas-SNP	.											.	CHD7	534	.	0			c.G8971A						PASS	.						17.0	18.0	18.0					8																	61778469		1897	4123	6020	SO:0001583	missense	55636	exon38			GAAATAGAAAACA	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.8971G>A	chr8.hg19:g.61778469G>A	ENSP00000392028:p.Glu2991Lys	132.0	0.0	.		104.0	43.0	.	NM_017780	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	hg19	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	G	14.02	2.411068	0.42817	.	.	ENSG00000171316	ENST00000307121;ENST00000423902;ENST00000524602	D;T	0.83755	-1.76;1.77	4.47	4.47	0.54385	.	0.000000	0.47852	D	0.000205	T	0.73393	0.3581	N	0.22421	0.69	0.45403	D	0.998385	B	0.30914	0.3	B	0.23275	0.045	T	0.75693	-0.3229	10	0.72032	D	0.01	-17.0826	17.4855	0.87687	0.0:0.0:1.0:0.0	.	2991	Q9P2D1	CHD7_HUMAN	K	2991;2991;942	ENSP00000392028:E2991K;ENSP00000437061:E942K	ENSP00000307304:E2991K	E	+	1	0	CHD7	61941023	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.536000	0.67180	2.169000	0.68431	0.655000	0.94253	GAA	.	.	.	none		0.423	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
C8orf37	157657	hgsc.bcm.edu	37	8	96259954	96259954	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr8:96259954T>A	ENST00000286688.5	-	6	526	c.515A>T	c.(514-516)aAg>aTg	p.K172M		NM_177965.3	NP_808880.1	Q96NL8	CH037_HUMAN	chromosome 8 open reading frame 37	172						cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.K172M(1)		kidney(1)|large_intestine(1)|lung(5)	7	Breast(36;3.41e-05)					TCCTTTCTTCTTTATCAACTT	0.398																																					p.K172M		Atlas-SNP	.											C8orf37,colon,carcinoma,0,1	C8orf37	15	.	1	Substitution - Missense(1)	large_intestine(1)	c.A515T						PASS	.						174.0	157.0	163.0					8																	96259954		2203	4300	6503	SO:0001583	missense	157657	exon6			TTCTTCTTTATCA	AK055162	CCDS6268.1	8q22.1	2014-01-28			ENSG00000156172	ENSG00000156172			27232	protein-coding gene	gene with protein product		614477				22177090	Standard	NM_177965		Approved	FLJ30600, CORD16, RP64	uc003yho.2	Q96NL8	OTTHUMG00000164663	ENST00000286688.5:c.515A>T	chr8.hg19:g.96259954T>A	ENSP00000286688:p.Lys172Met	99.0	0.0	.		91.0	47.0	.	NM_177965		Missense_Mutation	SNP	ENST00000286688.5	hg19	CCDS6268.1	.	.	.	.	.	.	.	.	.	.	T	15.83	2.949731	0.53186	.	.	ENSG00000156172	ENST00000286688	D	0.83419	-1.72	5.42	2.98	0.34508	.	0.169978	0.50627	D	0.000105	D	0.85906	0.5806	M	0.69823	2.125	0.31460	N	0.669699	D	0.69078	0.997	P	0.58873	0.847	D	0.84150	0.0422	10	0.87932	D	0	-11.6379	5.4681	0.16654	0.0:0.1483:0.1478:0.7039	.	172	Q96NL8	CH037_HUMAN	M	172	ENSP00000286688:K172M	ENSP00000286688:K172M	K	-	2	0	C8orf37	96329130	1.000000	0.71417	0.489000	0.27452	0.730000	0.41778	2.446000	0.44908	0.352000	0.24053	0.459000	0.35465	AAG	.	.	.	none		0.398	C8orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379672.1	NM_177965	
POP1	10940	hgsc.bcm.edu	37	8	99168546	99168546	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr8:99168546G>T	ENST00000401707.2	+	15	2407	c.2326G>T	c.(2326-2328)Ggg>Tgg	p.G776W	POP1_ENST00000349693.3_Missense_Mutation_p.G776W	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	776					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			AATGGATGCAGGGTGTCAAGA	0.547																																					p.G776W		Atlas-SNP	.											.	POP1	85	.	0			c.G2326T						PASS	.						126.0	124.0	125.0					8																	99168546		2203	4300	6503	SO:0001583	missense	10940	exon15			GATGCAGGGTGTC	D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.2326G>T	chr8.hg19:g.99168546G>T	ENSP00000385787:p.Gly776Trp	128.0	0.0	.		97.0	41.0	.	NM_001145860	A8K5W9|Q15037	Missense_Mutation	SNP	ENST00000401707.2	hg19	CCDS6277.1	.	.	.	.	.	.	.	.	.	.	G	11.27	1.590008	0.28357	.	.	ENSG00000104356	ENST00000401707;ENST00000349693	T;T	0.36520	1.25;1.25	5.19	4.31	0.51392	.	1.118330	0.06500	N	0.736162	T	0.26159	0.0638	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.22034	-1.0228	10	0.66056	D	0.02	-6.2211	4.6366	0.12527	0.1876:0.0:0.6369:0.1755	.	776	Q99575	POP1_HUMAN	W	776	ENSP00000385787:G776W;ENSP00000339529:G776W	ENSP00000339529:G776W	G	+	1	0	POP1	99237722	0.724000	0.28038	0.719000	0.30619	0.043000	0.13939	1.668000	0.37481	1.170000	0.42753	0.591000	0.81541	GGG	.	.	.	none		0.547	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379470.1	NM_015029	
BAI1	575	hgsc.bcm.edu	37	8	143558843	143558843	+	Silent	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr8:143558843G>A	ENST00000517894.1	+	6	2214	c.1320G>A	c.(1318-1320)caG>caA	p.Q440Q	BAI1_ENST00000323289.5_Silent_p.Q440Q			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	440	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GGCCCCCCCAGTTTGGGGGCA	0.657																																					p.Q440Q		Atlas-SNP	.											.	BAI1	146	.	0			c.G1320A						PASS	.						44.0	51.0	49.0					8																	143558843		1978	4152	6130	SO:0001819	synonymous_variant	575	exon5			CCCCCAGTTTGGG	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.1320G>A	chr8.hg19:g.143558843G>A		80.0	0.0	.		65.0	25.0	.	NM_001702		Silent	SNP	ENST00000517894.1	hg19																																																																																				.	.	.	none		0.657	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	
VCP	7415	hgsc.bcm.edu	37	9	35066717	35066717	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr9:35066717A>T	ENST00000358901.6	-	4	1295	c.400T>A	c.(400-402)Tac>Aac	p.Y134N		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	134					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GGCTTAAGGTATACCTCGAAG	0.473																																					p.Y134N		Atlas-SNP	.											.	VCP	64	.	0			c.T400A						PASS	.						134.0	111.0	119.0					9																	35066717		2203	4300	6503	SO:0001583	missense	7415	exon4			TAAGGTATACCTC	AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.400T>A	chr9.hg19:g.35066717A>T	ENSP00000351777:p.Tyr134Asn	107.0	0.0	.		92.0	37.0	.	NM_007126	B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Missense_Mutation	SNP	ENST00000358901.6	hg19	CCDS6573.1	.	.	.	.	.	.	.	.	.	.	A	28.8	4.952555	0.92660	.	.	ENSG00000165280	ENST00000358901;ENST00000448530;ENST00000417448	D;D;D	0.96745	-4.11;-4.11;-4.11	5.79	5.79	0.91817	Cell division protein 48, Cdc48, domain 2 (1);	0.000000	0.85682	D	0.000000	D	0.98764	0.9584	H	0.96208	3.785	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99609	1.0980	10	0.62326	D	0.03	-0.0218	16.1376	0.81497	1.0:0.0:0.0:0.0	.	134	P55072	TERA_HUMAN	N	134;89;89	ENSP00000351777:Y134N;ENSP00000392088:Y89N;ENSP00000399456:Y89N	ENSP00000351777:Y134N	Y	-	1	0	VCP	35056717	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	9.066000	0.93949	2.212000	0.71576	0.533000	0.62120	TAC	.	.	.	none		0.473	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052290.1	NM_007126	
NPR2	4882	hgsc.bcm.edu	37	9	35805967	35805967	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr9:35805967G>C	ENST00000342694.2	+	14	2443	c.2188G>C	c.(2188-2190)Gac>Cac	p.D730H		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	730	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	GGAGGGCCTGGACCTCAGCCC	0.522																																					p.D730H		Atlas-SNP	.											.	NPR2	162	.	0			c.G2188C						PASS	.						65.0	68.0	67.0					9																	35805967		2203	4300	6503	SO:0001583	missense	4882	exon14			GGCCTGGACCTCA	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.2188G>C	chr9.hg19:g.35805967G>C	ENSP00000341083:p.Asp730His	79.0	0.0	.		75.0	25.0	.	NM_003995	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	ENST00000342694.2	hg19	CCDS6590.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.40|11.40	1.626506|1.626506	0.28978|0.28978	.|.	.|.	ENSG00000159899|ENSG00000159899	ENST00000342694|ENST00000421267	T|.	0.63744|.	-0.06|.	5.82|5.82	5.82|5.82	0.92795|0.92795	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.46145|.	D|.	0.000309|.	T|T	0.57140|0.57140	0.2033|0.2033	N|N	0.26092|0.26092	0.79|0.79	0.58432|0.58432	D|D	0.999998|0.999998	B;P|.	0.37158|.	0.291;0.585|.	B;B|.	0.35353|.	0.1;0.201|.	T|T	0.49960|0.49960	-0.8883|-0.8883	10|5	0.49607|.	T|.	0.09|.	.|.	18.6867|18.6867	0.91567|0.91567	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	730;730|.	P20594-2;P20594|.	.;ANPRB_HUMAN|.	H|C	730|76	ENSP00000341083:D730H|.	ENSP00000341083:D730H|.	D|W	+|+	1|3	0|0	NPR2|NPR2	35795967|35795967	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	5.608000|5.608000	0.67654|0.67654	2.756000|2.756000	0.94617|0.94617	0.563000|0.563000	0.77884|0.77884	GAC|TGG	.	.	.	none		0.522	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1		
PAX5	5079	hgsc.bcm.edu	37	9	36966620	36966620	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr9:36966620C>T	ENST00000358127.4	-	6	780	c.706G>A	c.(706-708)Gtg>Atg	p.V236M	PAX5_ENST00000523145.1_Missense_Mutation_p.V128M|PAX5_ENST00000522003.1_Missense_Mutation_p.V128M|PAX5_ENST00000520154.1_Missense_Mutation_p.V236M|PAX5_ENST00000523241.1_Missense_Mutation_p.V236M|PAX5_ENST00000414447.1_Missense_Mutation_p.V193M|PAX5_ENST00000377847.2_Missense_Mutation_p.V236M|PAX5_ENST00000377852.2_Missense_Mutation_p.V236M|PAX5_ENST00000520281.1_Missense_Mutation_p.V193M|PAX5_ENST00000446742.1_Missense_Mutation_p.V170M|PAX5_ENST00000377853.2_Missense_Mutation_p.V236M	NM_001280554.1|NM_001280556.1|NM_016734.1	NP_001267483.1|NP_001267485.1|NP_057953.1	Q02548	PAX5_HUMAN	paired box 5	236					humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|skeletal muscle cell differentiation (GO:0035914)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.?(41)	PAX5/JAK2(18)	NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(151)|kidney(1)|lung(10)|prostate(1)|skin(1)	171		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)		CGGTCCAGCACCTCCAGCTGC	0.607			"""T, Mis, D, F, S"""	"""IGH@, ETV6, PML, FOXP1, ZNF521, ELN"""	"""NHL, ALL, B-ALL"""																																p.V236M		Atlas-SNP	.		Dom	yes		9	9p13	5079	paired box gene 5 (B-cell lineage specific activator protein)		L	.	PAX5	250	.	41	Unknown(41)	haematopoietic_and_lymphoid_tissue(41)	c.G706A						PASS	.						121.0	97.0	105.0					9																	36966620		2203	4300	6503	SO:0001583	missense	5079	exon6			CCAGCACCTCCAG		CCDS6607.1, CCDS65039.1, CCDS65040.1, CCDS65041.1, CCDS65042.1, CCDS65043.1, CCDS65044.1, CCDS65045.1, CCDS65046.1, CCDS65047.1, CCDS65048.1	9p13.2	2011-06-20	2007-07-12		ENSG00000196092	ENSG00000196092		"""Paired boxes"", ""Homeoboxes / PRD class"""	8619	protein-coding gene	gene with protein product	"""B-cell lineage specific activator"""	167414	"""paired box gene 5 (B-cell lineage specific activator protein)"", ""paired box gene 5 (B-cell lineage specific activator)"""			1516825, 8431641	Standard	NM_016734		Approved	BSAP	uc003zzo.1	Q02548	OTTHUMG00000019907	ENST00000358127.4:c.706G>A	chr9.hg19:g.36966620C>T	ENSP00000350844:p.Val236Met	119.0	0.0	.		85.0	40.0	.	NM_016734	A3QVP6|A3QVP7|A3QVP8|C0KTF6|C0KTF7|C0KTF8|C0KTF9|C0KTG0|O75933|Q5SFM2|Q6S728|Q6S729|Q6S730|Q6S731|Q6S732	Missense_Mutation	SNP	ENST00000358127.4	hg19	CCDS6607.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.015018	0.93404	.	.	ENSG00000196092	ENST00000358127;ENST00000377849;ENST00000377853;ENST00000377852;ENST00000523241;ENST00000520154;ENST00000520281;ENST00000446742;ENST00000522003;ENST00000523145;ENST00000414447;ENST00000377847;ENST00000524340	D;D;D;D;D;D;D;D;D;D;D;T	0.97811	-4.06;-4.05;-4.05;-4.55;-4.55;-4.51;-3.73;-1.79;-2.38;-4.52;-4.54;1.42	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.98153	0.9390	L	0.46885	1.475	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.71674	0.971;0.996;0.998;0.99;0.998;0.975;0.988;0.971;0.99;0.99	P;P;D;P;D;P;P;P;P;P	0.79784	0.543;0.823;0.949;0.675;0.993;0.805;0.862;0.543;0.675;0.675	D	0.99640	1.0988	10	0.72032	D	0.01	.	19.4277	0.94751	0.0:1.0:0.0:0.0	.	193;193;170;236;44;236;236;236;236;236	C0KTF8;C0KTF7;C0KTF9;C0KTF6;C0KTE2;E7ERW5;E7EQT0;Q6S730;Q6S731;Q02548	.;.;.;.;.;.;.;.;.;PAX5_HUMAN	M	236;128;236;236;236;236;193;170;128;128;193;236;44	ENSP00000350844:V236M;ENSP00000367084:V236M;ENSP00000367083:V236M;ENSP00000429637:V236M;ENSP00000429291:V236M;ENSP00000430773:V193M;ENSP00000404687:V170M;ENSP00000429359:V128M;ENSP00000429197:V128M;ENSP00000412188:V193M;ENSP00000367078:V236M;ENSP00000429404:V44M	ENSP00000350844:V236M	V	-	1	0	PAX5	36956620	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.398000	0.79919	2.568000	0.86640	0.655000	0.94253	GTG	.	.	.	none		0.607	PAX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052433.1		
USP20	10868	hgsc.bcm.edu	37	9	132630512	132630512	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr9:132630512G>C	ENST00000315480.4	+	11	1077	c.919G>C	c.(919-921)Gcc>Ccc	p.A307P	USP20_ENST00000372429.3_Missense_Mutation_p.A307P|USP20_ENST00000358355.1_Missense_Mutation_p.A307P			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	307	USP.				endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				CAGCTCGCAGGCCGAGACGGA	0.647																																					p.A307P		Atlas-SNP	.											.	USP20	186	.	0			c.G919C						PASS	.						42.0	53.0	49.0					9																	132630512		2074	4201	6275	SO:0001583	missense	10868	exon11			TCGCAGGCCGAGA	AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.919G>C	chr9.hg19:g.132630512G>C	ENSP00000313811:p.Ala307Pro	150.0	0.0	.		95.0	37.0	.	NM_001008563	Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Missense_Mutation	SNP	ENST00000315480.4	hg19	CCDS43892.1	.	.	.	.	.	.	.	.	.	.	G	11.66	1.705110	0.30232	.	.	ENSG00000136878	ENST00000372429;ENST00000315480;ENST00000358355	T;T;T	0.18657	2.2;2.2;2.2	4.95	4.95	0.65309	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	2.873660	0.01084	N	0.005051	T	0.22322	0.0538	L	0.29908	0.895	0.52501	D	0.999959	B	0.20459	0.045	B	0.18871	0.023	T	0.05533	-1.0879	10	0.40728	T	0.16	.	12.3196	0.54977	0.0:0.0:0.8311:0.1689	.	307	Q9Y2K6	UBP20_HUMAN	P	307	ENSP00000361506:A307P;ENSP00000313811:A307P;ENSP00000351122:A307P	ENSP00000313811:A307P	A	+	1	0	USP20	131670333	1.000000	0.71417	0.999000	0.59377	0.342000	0.28953	2.433000	0.44793	2.291000	0.77112	0.561000	0.74099	GCC	.	.	.	none		0.647	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054604.2		
SEC24C	9632	hgsc.bcm.edu	37	10	75526876	75526876	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr10:75526876G>A	ENST00000339365.2	+	15	2120	c.1958G>A	c.(1957-1959)gGg>gAg	p.G653E	SEC24C_ENST00000411652.2_Missense_Mutation_p.G534E|SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000345254.4_Missense_Mutation_p.G653E|SEC24C_ENST00000540668.1_Intron	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	653					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					GAGGCCCCAGGGAAACTGAAG	0.468																																					p.G653E		Atlas-SNP	.											.	SEC24C	86	.	0			c.G1958A						PASS	.						89.0	88.0	88.0					10																	75526876		2203	4300	6503	SO:0001583	missense	9632	exon14			CCCCAGGGAAACT	D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.1958G>A	chr10.hg19:g.75526876G>A	ENSP00000343405:p.Gly653Glu	123.0	0.0	.		103.0	44.0	.	NM_198597	B4DZT4|Q8WV25	Missense_Mutation	SNP	ENST00000339365.2	hg19	CCDS7332.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.550641	0.86127	.	.	ENSG00000176986	ENST00000345254;ENST00000339365;ENST00000411652	D;D;D	0.82344	-1.6;-1.6;-1.6	5.57	5.57	0.84162	Sec23/Sec24, trunk domain (1);	0.000000	0.85682	D	0.000000	D	0.94251	0.8154	H	0.95679	3.705	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.95471	0.8551	10	0.87932	D	0	-9.8933	19.6032	0.95572	0.0:0.0:1.0:0.0	.	534;653;653	E7EP00;G5EA31;P53992	.;.;SC24C_HUMAN	E	653;653;534	ENSP00000321845:G653E;ENSP00000343405:G653E;ENSP00000402913:G534E	ENSP00000343405:G653E	G	+	2	0	SEC24C	75196882	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.643000	0.89663	0.555000	0.69702	GGG	.	.	.	none		0.468	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048679.1		
FGFBP3	143282	hgsc.bcm.edu	37	10	93667973	93667973	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr10:93667973A>C	ENST00000311575.5	-	2	917	c.754T>G	c.(754-756)Ttt>Gtt	p.F252V	RP11-402D21.2_ENST00000610263.1_RNA	NM_152429.4	NP_689642.3	Q8TAT2	FGFP3_HUMAN	fibroblast growth factor binding protein 3	252					positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of vascular permeability (GO:0043117)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	fibroblast growth factor binding (GO:0017134)|heparin binding (GO:0008201)			large_intestine(1)|prostate(1)	2		Colorectal(252;0.162)				AAATTGACAAAGAAGTTGCAG	0.647																																					p.F252V		Atlas-SNP	.											.	FGFBP3	6	.	0			c.T754G						PASS	.						48.0	51.0	50.0					10																	93667973		2203	4299	6502	SO:0001583	missense	143282	exon2			TGACAAAGAAGTT	AK075410	CCDS7418.1	10q23.33	2006-12-14	2006-12-14	2006-12-14	ENSG00000174721	ENSG00000174721			23428	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 13"""	C10orf13			Standard	NM_152429		Approved	MGC39320	uc001khq.4	Q8TAT2	OTTHUMG00000018751	ENST00000311575.5:c.754T>G	chr10.hg19:g.93667973A>C	ENSP00000339067:p.Phe252Val	47.0	0.0	.		40.0	16.0	.	NM_152429	B2RD68|Q8NBN0	Missense_Mutation	SNP	ENST00000311575.5	hg19	CCDS7418.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.631498	0.87660	.	.	ENSG00000174721	ENST00000311575	T	0.20200	2.09	4.45	4.45	0.53987	.	0.000000	0.64402	D	0.000001	T	0.44829	0.1312	M	0.74258	2.255	0.48236	D	0.999614	D	0.89917	1.0	D	0.91635	0.999	T	0.45906	-0.9229	10	0.87932	D	0	-3.1889	11.6122	0.51066	1.0:0.0:0.0:0.0	.	252	Q8TAT2	FGFP3_HUMAN	V	252	ENSP00000339067:F252V	ENSP00000339067:F252V	F	-	1	0	FGFBP3	93657953	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.802000	0.55553	1.988000	0.58038	0.533000	0.62120	TTT	.	.	.	none		0.647	FGFBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049379.1	NM_152429	
C11orf40	143501	hgsc.bcm.edu	37	11	4599028	4599028	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr11:4599028A>G	ENST00000307616.1	-	1	22	c.23T>C	c.(22-24)gTg>gCg	p.V8A		NM_144663.1	NP_653264.1	Q8WZ69	CK040_HUMAN	chromosome 11 open reading frame 40	8										large_intestine(3)|lung(1)|ovary(2)|stomach(1)	7		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;4.28e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		ttctctgggcaccagcgcctg	0.498																																					p.V8A		Atlas-SNP	.											.	C11orf40	37	.	0			c.T23C						PASS	.						36.0	31.0	32.0					11																	4599028		2191	4276	6467	SO:0001583	missense	143501	exon1			CTGGGCACCAGCG		CCDS31354.1	11p15.5	2005-10-03			ENSG00000171987	ENSG00000171987			23986	protein-coding gene	gene with protein product							Standard	NM_144663		Approved	NOV1	uc010qyg.2	Q8WZ69	OTTHUMG00000165345	ENST00000307616.1:c.23T>C	chr11.hg19:g.4599028A>G	ENSP00000302918:p.Val8Ala	64.0	0.0	.		40.0	10.0	.	NM_144663		Missense_Mutation	SNP	ENST00000307616.1	hg19	CCDS31354.1	.	.	.	.	.	.	.	.	.	.	A	0.010	-1.754303	0.00663	.	.	ENSG00000171987	ENST00000307616	T	0.54866	0.55	0.235	-0.47	0.12131	.	.	.	.	.	T	0.25754	0.0627	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.15752	-1.0426	8	0.87932	D	0	.	.	.	.	.	8	Q8WZ69	CK040_HUMAN	A	8	ENSP00000302918:V8A	ENSP00000302918:V8A	V	-	2	0	C11orf40	4555604	0.003000	0.15002	0.001000	0.08648	0.001000	0.01503	-0.597000	0.05713	-2.313000	0.00648	-2.381000	0.00232	GTG	.	.	.	none		0.498	C11orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383529.1	NM_144663	
PRRG4	79056	hgsc.bcm.edu	37	11	32858352	32858352	+	Silent	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr11:32858352G>A	ENST00000257836.3	+	3	505	c.252G>A	c.(250-252)gtG>gtA	p.V84V		NM_024081.5	NP_076986.1	Q9BZD6	TMG4_HUMAN	proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane)	84	Gla. {ECO:0000255|PROSITE- ProRule:PRU00463}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	7	Breast(20;0.206)					AGATTTTTGTGGATGAAGATA	0.358																																					p.V84V		Atlas-SNP	.											.	PRRG4	15	.	0			c.G252A						PASS	.						72.0	73.0	73.0					11																	32858352		2202	4299	6501	SO:0001819	synonymous_variant	79056	exon3			TTTTGTGGATGAA	AF326351	CCDS7881.1	11p13	2008-02-05			ENSG00000135378	ENSG00000135378			30799	protein-coding gene	gene with protein product		611690				11171957	Standard	NM_024081		Approved	TMG4	uc001mtx.3	Q9BZD6	OTTHUMG00000166219	ENST00000257836.3:c.252G>A	chr11.hg19:g.32858352G>A		150.0	0.0	.		96.0	35.0	.	NM_024081		Silent	SNP	ENST00000257836.3	hg19	CCDS7881.1																																																																																			.	.	.	none		0.358	PRRG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388446.1	NM_024081	
ADAMTS8	11095	hgsc.bcm.edu	37	11	130281414	130281414	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr11:130281414G>A	ENST00000257359.6	-	6	2354	c.1648C>T	c.(1648-1650)Cac>Tac	p.H550Y		NM_007037.4	NP_008968.4	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 8	550	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				negative regulation of cell proliferation (GO:0008285)|phosphate ion transmembrane transport (GO:0035435)	proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)|low-affinity phosphate transmembrane transporter activity (GO:0009673)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		CACTCACGGTGTGAAAACTGT	0.597																																					p.H550Y		Atlas-SNP	.											.	ADAMTS8	172	.	0			c.C1648T						PASS	.						76.0	81.0	79.0					11																	130281414		2017	4162	6179	SO:0001583	missense	11095	exon6			CACGGTGTGAAAA	AF060153	CCDS41732.1	11q25	2008-07-18	2005-08-19		ENSG00000134917	ENSG00000134917		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	224	protein-coding gene	gene with protein product		605175	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 8"""			10438512	Standard	NM_007037		Approved	METH2, FLJ41712, ADAM-TS8	uc001qgg.4	Q9UP79	OTTHUMG00000165656	ENST00000257359.6:c.1648C>T	chr11.hg19:g.130281414G>A	ENSP00000257359:p.His550Tyr	105.0	0.0	.		98.0	46.0	.	NM_007037	Q9NZS0	Missense_Mutation	SNP	ENST00000257359.6	hg19	CCDS41732.1	.	.	.	.	.	.	.	.	.	.	G	2.888	-0.230363	0.05983	.	.	ENSG00000134917	ENST00000257359;ENST00000414575	T	0.52754	0.65	5.58	-2.86	0.05717	.	0.619078	0.19024	N	0.124760	T	0.16599	0.0399	N	0.10664	0.02	0.22562	N	0.998988	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.001	T	0.29971	-0.9994	10	0.05351	T	0.99	.	5.4963	0.16805	0.4596:0.0:0.324:0.2164	.	550;31	Q9UP79;B3KVX9	ATS8_HUMAN;.	Y	550;579	ENSP00000257359:H550Y	ENSP00000257359:H550Y	H	-	1	0	ADAMTS8	129786624	0.000000	0.05858	0.560000	0.28344	0.982000	0.71751	-0.457000	0.06745	-0.431000	0.07307	0.591000	0.81541	CAC	.	.	.	none		0.597	ADAMTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385636.1	NM_007037	
CACNA2D4	93589	hgsc.bcm.edu	37	12	1995492	1995492	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr12:1995492T>G	ENST00000382722.5	-	8	1252	c.890A>C	c.(889-891)gAc>gCc	p.D297A	CACNA2D4_ENST00000585708.1_Missense_Mutation_p.D233A|CACNA2D4_ENST00000586184.1_Missense_Mutation_p.D297A|CACNA2D4_ENST00000588077.1_Missense_Mutation_p.D233A|CACNA2D4_ENST00000587995.1_Missense_Mutation_p.D297A|CACNA2D4_ENST00000585732.1_Intron	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	297	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		GCCGCTCACGTCCACCAAAAT	0.483																																					p.D297A	Colon(2;101 179 21030 23310 28141)	Atlas-SNP	.											.	CACNA2D4	220	.	0			c.A890C						PASS	.						117.0	114.0	115.0					12																	1995492		2088	4212	6300	SO:0001583	missense	93589	exon8			CTCACGTCCACCA	AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.890A>C	chr12.hg19:g.1995492T>G	ENSP00000372169:p.Asp297Ala	163.0	0.0	.		144.0	22.0	.	NM_172364	Q7Z3S8|Q86XZ5|Q8IZS9	Missense_Mutation	SNP	ENST00000382722.5	hg19	CCDS44785.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.434780	0.83885	.	.	ENSG00000151062	ENST00000456077;ENST00000280663;ENST00000382722	T	0.62788	0.0	5.17	5.17	0.71159	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	T	0.80737	0.4680	M	0.90759	3.145	0.80722	D	1	D	0.55605	0.972	P	0.60012	0.867	D	0.85404	0.1133	10	0.87932	D	0	.	15.0248	0.71659	0.0:0.0:0.0:1.0	.	297	Q7Z3S7	CA2D4_HUMAN	A	233;297;297	ENSP00000372169:D297A	ENSP00000280663:D297A	D	-	2	0	CACNA2D4	1865753	1.000000	0.71417	0.287000	0.24848	0.983000	0.72400	7.867000	0.87062	1.959000	0.56917	0.533000	0.62120	GAC	.	.	.	none		0.483	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398230.2		
A2M	2	hgsc.bcm.edu	37	12	9221412	9221412	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr12:9221412G>C	ENST00000318602.7	-	34	4597	c.4290C>G	c.(4288-4290)ttC>ttG	p.F1430L	A2M-AS1_ENST00000499762.1_RNA	NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	1430					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	GAACCGTGAAGAACAAGCTCA	0.403																																					p.F1430L		Atlas-SNP	.											.	A2M	180	.	0			c.C4290G						PASS	.						72.0	69.0	70.0					12																	9221412		1889	4108	5997	SO:0001583	missense	2	exon34			CGTGAAGAACAAG	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.4290C>G	chr12.hg19:g.9221412G>C	ENSP00000323929:p.Phe1430Leu	87.0	0.0	.		68.0	25.0	.	NM_000014	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	ENST00000318602.7	hg19	CCDS44827.1	.	.	.	.	.	.	.	.	.	.	G	12.85	2.062257	0.36373	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	T	0.21031	2.03	4.39	2.55	0.30701	Alpha-macroglobulin, receptor-binding (3);	0.976288	0.08422	N	0.948210	T	0.11922	0.0290	N	0.12746	0.255	0.30277	N	0.791725	B	0.14012	0.009	B	0.19148	0.024	T	0.25779	-1.0122	10	0.87932	D	0	.	3.9445	0.09343	0.2917:0.1798:0.5285:0.0	.	1430	P01023	A2MG_HUMAN	L	1430;1445	ENSP00000323929:F1430L	ENSP00000323929:F1430L	F	-	3	2	A2M	9112679	0.993000	0.37304	0.882000	0.34594	0.755000	0.42902	0.316000	0.19469	0.587000	0.29643	0.655000	0.94253	TTC	.	.	.	none		0.403	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014	
PRICKLE1	144165	hgsc.bcm.edu	37	12	42860028	42860028	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr12:42860028G>T	ENST00000455697.1	-	6	1028	c.743C>A	c.(742-744)gCg>gAg	p.A248E	RP11-328C8.4_ENST00000547824.1_RNA|PRICKLE1_ENST00000345127.3_Missense_Mutation_p.A248E|PRICKLE1_ENST00000548696.1_Missense_Mutation_p.A248E|PRICKLE1_ENST00000445766.2_Missense_Mutation_p.A248E|PRICKLE1_ENST00000552240.1_Missense_Mutation_p.A248E	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	248	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.A248V(1)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		ACAGTACTCCGCATAGAGAGA	0.522																																					p.A248E		Atlas-SNP	.											PRICKLE1,rectum,carcinoma,0,1	PRICKLE1	105	.	1	Substitution - Missense(1)	large_intestine(1)	c.C743A						PASS	.						76.0	73.0	74.0					12																	42860028		2203	4300	6503	SO:0001583	missense	144165	exon6			TACTCCGCATAGA	AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.743C>A	chr12.hg19:g.42860028G>T	ENSP00000401060:p.Ala248Glu	141.0	0.0	.		118.0	5.0	.	NM_001144882	Q14C83|Q71QF8|Q96N00	Missense_Mutation	SNP	ENST00000455697.1	hg19	CCDS8742.1	.	.	.	.	.	.	.	.	.	.	G	35	5.519420	0.96416	.	.	ENSG00000139174	ENST00000455697;ENST00000445766;ENST00000548696;ENST00000345127;ENST00000552240	D;D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38;-2.38	5.18	5.18	0.71444	Zinc finger, LIM-type (2);	0.094019	0.64402	D	0.000001	D	0.95589	0.8566	M	0.93462	3.42	0.80722	D	1	P	0.51240	0.943	P	0.59546	0.859	D	0.96420	0.9311	10	0.72032	D	0.01	-4.697	19.0641	0.93103	0.0:0.0:1.0:0.0	.	248	Q96MT3	PRIC1_HUMAN	E	248	ENSP00000401060:A248E;ENSP00000398947:A248E;ENSP00000448359:A248E;ENSP00000345064:A248E;ENSP00000449819:A248E	ENSP00000345064:A248E	A	-	2	0	PRICKLE1	41146295	1.000000	0.71417	0.663000	0.29738	0.994000	0.84299	9.813000	0.99286	2.590000	0.87494	0.561000	0.74099	GCG	.	.	.	none		0.522	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404069.1		
KMT2D	8085	hgsc.bcm.edu	37	12	49427988	49427988	+	Silent	SNP	T	T	G			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr12:49427988T>G	ENST00000301067.7	-	38	10601	c.10602A>C	c.(10600-10602)gtA>gtC	p.V3534V	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3534	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										ACTTGCGGTGTACACCAATCT	0.557																																					p.V3534V		Atlas-SNP	.											.	MLL2	1173	.	0			c.A10602C						PASS	.						107.0	107.0	107.0					12																	49427988		2036	4195	6231	SO:0001819	synonymous_variant	8085	exon38			GCGGTGTACACCA	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.10602A>C	chr12.hg19:g.49427988T>G		50.0	0.0	.		47.0	19.0	.	NM_003482	O14687	Silent	SNP	ENST00000301067.7	hg19	CCDS44873.1																																																																																			.	.	.	none		0.557	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
ARHGEF25	115557	hgsc.bcm.edu	37	12	58009476	58009476	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr12:58009476T>C	ENST00000286494.4	+	12	1680	c.1220T>C	c.(1219-1221)gTa>gCa	p.V407A	AC025165.8_ENST00000444467.1_RNA|ARHGEF25_ENST00000333972.7_Missense_Mutation_p.V446A|AC025165.8_ENST00000593846.1_RNA|AC025165.8_ENST00000610219.1_RNA|AC025165.8_ENST00000356672.3_RNA	NM_182947.3	NP_891992	Q86VW2	ARHGP_HUMAN	Rho guanine nucleotide exchange factor (GEF) 25	407	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytosol (GO:0005829)|myofibril (GO:0030016)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	28						CCTGGATATGTATACAAGAAC	0.557																																					p.V446A		Atlas-SNP	.											.	ARHGEF25	111	.	0			c.T1337C						PASS	.						86.0	82.0	84.0					12																	58009476		2203	4300	6503	SO:0001583	missense	115557	exon13			GATATGTATACAA		CCDS8947.1, CCDS44931.1	12q13.3	2011-11-16			ENSG00000240771	ENSG00000240771		"""Rho guanine nucleotide exchange factors"""	30275	protein-coding gene	gene with protein product	"""RAC/CDC42 exchange factor"""	610215				12547822	Standard	NM_182947		Approved	GEFT, p63RhoGEF	uc009zpy.4	Q86VW2	OTTHUMG00000152516	ENST00000286494.4:c.1220T>C	chr12.hg19:g.58009476T>C	ENSP00000286494:p.Val407Ala	141.0	0.0	.		111.0	48.0	.	NM_001111270	A6NJH5|A9CQZ6|F8W7Z4|Q8WV84|Q96E63	Missense_Mutation	SNP	ENST00000286494.4	hg19	CCDS8947.1	.	.	.	.	.	.	.	.	.	.	t	18.73	3.686721	0.68157	.	.	ENSG00000240771	ENST00000333972;ENST00000300189;ENST00000286494	T;T	0.12255	2.7;2.7	4.91	4.91	0.64330	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.34460	N	0.003949	T	0.21509	0.0518	L	0.34521	1.04	0.41536	D	0.988484	P;P;P	0.49961	0.93;0.786;0.606	P;P;B	0.56865	0.808;0.574;0.165	T	0.00844	-1.1543	10	0.59425	D	0.04	.	12.823	0.57704	0.0:0.0:0.0:1.0	.	446;407;255	F8W7Z4;Q86VW2;Q96M35	.;ARHGP_HUMAN;.	A	446;255;407	ENSP00000335560:V446A;ENSP00000286494:V407A	ENSP00000286494:V407A	V	+	2	0	ARHGEF25	56295743	0.992000	0.36948	0.998000	0.56505	0.967000	0.64934	2.333000	0.43912	2.200000	0.70718	0.459000	0.35465	GTA	.	.	.	none		0.557	ARHGEF25-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000326561.1	NM_133483	
AMDHD1	144193	hgsc.bcm.edu	37	12	96354188	96354188	+	Silent	SNP	T	T	C			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr12:96354188T>C	ENST00000266736.2	+	5	706	c.600T>C	c.(598-600)gcT>gcC	p.A200A		NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	200					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						GAAAAACTGCTACTGAAGCTG	0.413																																					p.A200A		Atlas-SNP	.											.	AMDHD1	56	.	0			c.T600C						PASS	.						72.0	68.0	69.0					12																	96354188		2203	4300	6503	SO:0001819	synonymous_variant	144193	exon5			AACTGCTACTGAA	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.600T>C	chr12.hg19:g.96354188T>C		144.0	0.0	.		121.0	56.0	.	NM_152435	A8K463|Q68CI8	Silent	SNP	ENST00000266736.2	hg19	CCDS9057.1																																																																																			.	.	.	none		0.413	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
UHRF1BP1L	23074	hgsc.bcm.edu	37	12	100452754	100452754	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr12:100452754C>G	ENST00000279907.7	-	14	2513	c.2301G>C	c.(2299-2301)aaG>aaC	p.K767N	UHRF1BP1L_ENST00000545232.2_Missense_Mutation_p.K417N	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	767										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						CCTTCAAGAGCTTCTTCCGCT	0.423																																					p.K767N		Atlas-SNP	.											.	UHRF1BP1L	144	.	0			c.G2301C						PASS	.						90.0	95.0	93.0					12																	100452754		2203	4300	6503	SO:0001583	missense	23074	exon14			CAAGAGCTTCTTC		CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.2301G>C	chr12.hg19:g.100452754C>G	ENSP00000279907:p.Lys767Asn	133.0	0.0	.		93.0	36.0	.	NM_015054	A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	ENST00000279907.7	hg19	CCDS31882.1	.	.	.	.	.	.	.	.	.	.	C	13.01	2.109066	0.37242	.	.	ENSG00000111647	ENST00000279907;ENST00000545232	T;T	0.11712	2.78;2.75	6.02	1.02	0.19986	.	0.050512	0.85682	D	0.000000	T	0.27933	0.0688	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.01218	-1.1415	10	0.72032	D	0.01	-14.4859	11.2229	0.48866	0.0:0.5744:0.0:0.4256	.	767	A0JNW5	UH1BL_HUMAN	N	767;417	ENSP00000279907:K767N;ENSP00000444824:K417N	ENSP00000279907:K767N	K	-	3	2	UHRF1BP1L	98976885	0.914000	0.31030	0.999000	0.59377	0.772000	0.43724	0.021000	0.13489	0.138000	0.18790	-0.813000	0.03139	AAG	.	.	.	none		0.423	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407875.1	NM_001006947	
ACACB	32	hgsc.bcm.edu	37	12	109687792	109687792	+	Nonsense_Mutation	SNP	C	C	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr12:109687792C>A	ENST00000338432.7	+	41	5792	c.5673C>A	c.(5671-5673)taC>taA	p.Y1891*	ACACB_ENST00000543201.1_Nonsense_Mutation_p.Y557*|ACACB_ENST00000377854.5_Nonsense_Mutation_p.Y1821*|ACACB_ENST00000377848.3_Nonsense_Mutation_p.Y1891*			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1891	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	TTTGAAGATACATGATCACGG	0.517																																					p.Y1891X		Atlas-SNP	.											.	ACACB	330	.	0			c.C5673A						PASS	.						138.0	132.0	134.0					12																	109687792		2203	4300	6503	SO:0001587	stop_gained	32	exon40			AAGATACATGATC	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.5673C>A	chr12.hg19:g.109687792C>A	ENSP00000341044:p.Tyr1891*	53.0	0.0	.		40.0	20.0	.	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Nonsense_Mutation	SNP	ENST00000338432.7	hg19	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	C	41	8.656271	0.98903	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027;ENST00000543201	.	.	.	5.57	-5.5	0.02576	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.864	0.86025	0.0:0.3736:0.0:0.6264	.	.	.	.	X	1891;1891;1821;1122;557	.	ENSP00000341044:Y1891X	Y	+	3	2	ACACB	108172175	0.029000	0.19370	0.082000	0.20525	0.002000	0.02628	-0.588000	0.05774	-1.142000	0.02869	-0.808000	0.03180	TAC	.	.	.	none		0.517	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
HTR2A	3356	hgsc.bcm.edu	37	13	47408978	47408978	+	Silent	SNP	A	A	G			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr13:47408978A>G	ENST00000378688.4	-	3	1541	c.1410T>C	c.(1408-1410)tgT>tgC	p.C470C	HTR2A_ENST00000543956.1_Silent_p.C386C|HTR2A_ENST00000542664.1_Silent_p.C470C			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	470					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CCTATCACACACAGCTCACCT	0.413																																					p.C470C		Atlas-SNP	.											.	HTR2A	98	.	0			c.T1410C						PASS	.						102.0	99.0	100.0					13																	47408978		2203	4300	6503	SO:0001819	synonymous_variant	3356	exon4			TCACACACAGCTC	X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.1410T>C	chr13.hg19:g.47408978A>G		68.0	0.0	.		66.0	25.0	.	NM_000621	B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Silent	SNP	ENST00000378688.4	hg19	CCDS9405.1																																																																																			.	.	.	none		0.413	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044835.3	NM_000621	
OR4K2	390431	hgsc.bcm.edu	37	14	20345243	20345243	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr14:20345243G>C	ENST00000298642.2	+	1	853	c.817G>C	c.(817-819)Gtg>Ctg	p.V273L		NM_001005501.1	NP_001005501.1	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K, member 2	273						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(16)|ovary(2)|skin(9)|upper_aerodigestive_tract(2)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GATTCTGTCTGTGTTTTATAC	0.383																																					p.V273L		Atlas-SNP	.											.	OR4K2	97	.	0			c.G817C						PASS	.						142.0	143.0	143.0					14																	20345243		2203	4300	6503	SO:0001583	missense	390431	exon1			CTGTCTGTGTTTT		CCDS32023.1	14q11.2	2013-09-23			ENSG00000165762	ENSG00000165762		"""GPCR / Class A : Olfactory receptors"""	14728	protein-coding gene	gene with protein product							Standard	NM_001005501		Approved		uc001vwh.1	Q8NGD2	OTTHUMG00000170624	ENST00000298642.2:c.817G>C	chr14.hg19:g.20345243G>C	ENSP00000298642:p.Val273Leu	12.0	0.0	.		15.0	8.0	.	NM_001005501	B2RNK8|Q6IFA5	Missense_Mutation	SNP	ENST00000298642.2	hg19	CCDS32023.1	.	.	.	.	.	.	.	.	.	.	.	16.88	3.243649	0.58995	.	.	ENSG00000165762	ENST00000298642	T	0.00245	8.45	5.16	4.27	0.50696	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44688	D	0.000435	T	0.00241	0.0007	L	0.28344	0.845	0.30016	N	0.81477	P	0.51147	0.942	P	0.55508	0.777	T	0.63047	-0.6724	10	0.49607	T	0.09	.	11.2916	0.49254	0.0883:0.0:0.9117:0.0	.	273	Q8NGD2	OR4K2_HUMAN	L	273	ENSP00000298642:V273L	ENSP00000298642:V273L	V	+	1	0	OR4K2	19415083	0.002000	0.14202	1.000000	0.80357	0.956000	0.61745	0.041000	0.13927	1.407000	0.46875	0.591000	0.81541	GTG	.	.	.	none		0.383	OR4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409864.1		
LTB4R2	56413	hgsc.bcm.edu	37	14	24780907	24780907	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr14:24780907G>A	ENST00000528054.1	+	1	2747	c.1130G>A	c.(1129-1131)gGg>gAg	p.G377E	LTB4R_ENST00000396789.4_5'Flank|LTB4R2_ENST00000533293.1_Missense_Mutation_p.G346E|LTB4R2_ENST00000543919.1_Missense_Mutation_p.G346E|CIDEB_ENST00000258807.5_5'Flank|LTB4R_ENST00000345363.3_5'UTR|LTB4R_ENST00000396782.2_5'Flank|CIDEB_ENST00000555817.1_5'Flank|CIDEB_ENST00000336557.5_5'Flank			Q9NPC1	LT4R2_HUMAN	leukotriene B4 receptor 2	377					chemotaxis (GO:0006935)|keratinocyte migration (GO:0051546)|negative regulation of adenylate cyclase activity (GO:0007194)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene B4 receptor activity (GO:0001632)|leukotriene receptor activity (GO:0004974)			endometrium(1)|lung(1)|ovary(1)	3				GBM - Glioblastoma multiforme(265;0.018)		GGAGACCCGGGGGGTGGGATG	0.667																																					p.G346E		Atlas-SNP	.											.	LTB4R2	18	.	0			c.G1037A						PASS	.						33.0	40.0	38.0					14																	24780907		2192	4259	6451	SO:0001583	missense	56413	exon2			ACCCGGGGGGTGG	AB008193	CCDS9625.1, CCDS9625.2	14q12	2014-04-11			ENSG00000213906	ENSG00000213906		"""GPCR / Class A : Leukotriene receptors"""	19260	protein-coding gene	gene with protein product		605773				11006272, 10934229	Standard	NM_001164692		Approved	BLTR2, BLT2, JULF2, NOP9	uc001wor.3	Q9NPC1	OTTHUMG00000186500	ENST00000528054.1:c.1130G>A	chr14.hg19:g.24780907G>A	ENSP00000432146:p.Gly377Glu	68.0	0.0	.		44.0	21.0	.	NM_019839	Q5KU28|Q9NPE5	Missense_Mutation	SNP	ENST00000528054.1	hg19		.	.	.	.	.	.	.	.	.	.	G	31	5.073887	0.94000	.	.	ENSG00000213906	ENST00000528054;ENST00000533293;ENST00000543919	T;T;T	0.71103	-0.54;-0.48;-0.48	4.19	4.19	0.49359	.	0.730840	0.11363	U	0.571663	T	0.59252	0.2180	N	0.19112	0.55	0.80722	D	1	B	0.18461	0.028	B	0.12156	0.007	T	0.56950	-0.7894	10	0.87932	D	0	.	14.4001	0.67037	0.0:0.0:1.0:0.0	.	377	Q9NPC1	LT4R2_HUMAN	E	377;346;346	ENSP00000432146:G377E;ENSP00000433290:G346E;ENSP00000445772:G346E	ENSP00000337731:G377E	G	+	2	0	LTB4R2	23850747	0.087000	0.21565	0.925000	0.36789	0.935000	0.57460	1.180000	0.32005	2.059000	0.61396	0.467000	0.42956	GGG	.	.	.	none		0.667	LTB4R2-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding	OTTHUMT00000073194.4		
FANCM	57697	hgsc.bcm.edu	37	14	45654450	45654450	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr14:45654450G>A	ENST00000267430.5	+	18	4631	c.4546G>A	c.(4546-4548)Gca>Aca	p.A1516T	FANCM_ENST00000555013.1_3'UTR|FANCM_ENST00000542564.2_Missense_Mutation_p.A1490T	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1516					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						AGATGATGAAGCAGAACTTTC	0.294								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.A1516T		Atlas-SNP	.											.	FANCM	225	.	0			c.G4546A						PASS	.						62.0	66.0	65.0					14																	45654450		2203	4293	6496	SO:0001583	missense	57697	exon18	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GATGAAGCAGAAC	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.4546G>A	chr14.hg19:g.45654450G>A	ENSP00000267430:p.Ala1516Thr	350.0	0.0	.		294.0	121.0	.	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	hg19	CCDS32070.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.4|27.4	4.823629|4.823629	0.90873|0.90873	.|.	.|.	ENSG00000187790|ENSG00000187790	ENST00000267430;ENST00000542564;ENST00000556250|ENST00000554809	T;T;T|.	0.75704|.	-0.96;-0.96;-0.96|.	5.77|5.77	5.77|5.77	0.91146|0.91146	.|.	0.540042|.	0.20546|.	N|.	0.090204|.	D|D	0.82318|0.82318	0.5011|0.5011	M|M	0.83953|0.83953	2.67|2.67	0.45621|0.45621	D|D	0.998559|0.998559	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.83275|.	0.996;0.996|.	T|T	0.83003|0.83003	-0.0176|-0.0176	10|5	0.87932|.	D|.	0|.	.|.	18.5433|18.5433	0.91037|0.91037	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1490;1516|.	B2RTQ9;Q8IYD8|.	.;FANCM_HUMAN|.	T|N	1516;1490;1032|448	ENSP00000267430:A1516T;ENSP00000442493:A1490T;ENSP00000452033:A1032T|.	ENSP00000267430:A1516T|.	A|S	+|+	1|2	0|0	FANCM|FANCM	44724200|44724200	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.926000|0.926000	0.56050|0.56050	6.146000|6.146000	0.71777|0.71777	2.720000|2.720000	0.93068|0.93068	0.650000|0.650000	0.86243|0.86243	GCA|AGC	.	.	.	none		0.294	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
RDH12	145226	hgsc.bcm.edu	37	14	68191956	68191956	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr14:68191956G>A	ENST00000551171.1	+	5	652	c.328G>A	c.(328-330)Gag>Aag	p.E110K	RDH12_ENST00000267502.3_Missense_Mutation_p.E110K|RDH12_ENST00000539142.1_Missense_Mutation_p.E110K	NM_152443.2	NP_689656.2	Q96NR8	RDH12_HUMAN	retinol dehydrogenase 12 (all-trans/9-cis/11-cis)	110					photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	intracellular (GO:0005622)|photoreceptor inner segment membrane (GO:0060342)	retinol dehydrogenase activity (GO:0004745)			large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(4)	12				all cancers(60;0.000704)|OV - Ovarian serous cystadenocarcinoma(108;0.00161)|BRCA - Breast invasive adenocarcinoma(234;0.00953)	Vitamin A(DB00162)	AGCCTTTGCTGAGGGCTTTCT	0.527																																					p.E110K		Atlas-SNP	.											.	RDH12	43	.	0			c.G328A						PASS	.						81.0	77.0	78.0					14																	68191956		2203	4300	6503	SO:0001583	missense	145226	exon5			TTTGCTGAGGGCT	AK054835	CCDS9787.1	14q24.1	2013-02-14	2006-05-09		ENSG00000139988	ENSG00000139988	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19977	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 2"""	608830	"""retinol dehydrogenase 12 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_152443		Approved	FLJ30273, SDR7C2, LCA13, RP53	uc001xjz.4	Q96NR8		ENST00000551171.1:c.328G>A	chr14.hg19:g.68191956G>A	ENSP00000449079:p.Glu110Lys	154.0	0.0	.		102.0	39.0	.	NM_152443	B2RDA2|Q8TAW6	Missense_Mutation	SNP	ENST00000551171.1	hg19	CCDS9787.1	.	.	.	.	.	.	.	.	.	.	G	11.76	1.736183	0.30774	.	.	ENSG00000139988	ENST00000551171;ENST00000267502;ENST00000539142	D;D;D	0.89875	-2.58;-2.58;-2.58	5.52	5.52	0.82312	NAD(P)-binding domain (1);	0.230531	0.45867	D	0.000327	T	0.81187	0.4770	N	0.21448	0.665	0.35066	D	0.762009	B	0.14805	0.011	B	0.26864	0.074	T	0.76735	-0.2850	10	0.11794	T	0.64	.	13.1381	0.59421	0.0755:0.0:0.9245:0.0	.	110	Q96NR8	RDH12_HUMAN	K	110	ENSP00000449079:E110K;ENSP00000267502:E110K;ENSP00000438715:E110K	ENSP00000267502:E110K	E	+	1	0	RDH12	67261709	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	2.700000	0.47085	2.873000	0.98535	0.563000	0.77884	GAG	.	.	.	none		0.527	RDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406918.1		
PCNX	22990	hgsc.bcm.edu	37	14	71568714	71568714	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr14:71568714T>A	ENST00000304743.2	+	31	6043	c.5597T>A	c.(5596-5598)tTt>tAt	p.F1866Y	PCNX_ENST00000556272.1_3'UTR|PCNX_ENST00000439984.3_Missense_Mutation_p.F1755Y|PCNX_ENST00000238570.5_Missense_Mutation_p.F1794Y	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1866						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		TAGGATCATTTTACTTCTCCA	0.333																																					p.F1866Y		Atlas-SNP	.											.	PCNX	198	.	0			c.T5597A						PASS	.						48.0	48.0	48.0					14																	71568714		2203	4300	6503	SO:0001583	missense	22990	exon31			ATCATTTTACTTC	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.5597T>A	chr14.hg19:g.71568714T>A	ENSP00000304192:p.Phe1866Tyr	77.0	0.0	.		92.0	48.0	.	NM_014982	B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	ENST00000304743.2	hg19	CCDS9806.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	27.7|27.7	4.852501|4.852501	0.91355|0.91355	.|.	.|.	ENSG00000100731|ENSG00000100731	ENST00000304743;ENST00000238570;ENST00000439984|ENST00000554691	T;T;T|.	0.50813|.	0.73;0.73;0.73|.	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	0.043971|.	0.85682|.	D|.	0.000000|.	T|T	0.81716|0.81716	0.4881|0.4881	M|M	0.91196|0.91196	3.185|3.185	0.34571|0.34571	D|D	0.713417|0.713417	D;D;D|.	0.76494|.	0.989;0.999;0.999|.	D;D;D|.	0.91635|.	0.969;0.999;0.994|.	D|D	0.90107|0.90107	0.4189|0.4189	10|5	0.66056|.	D|.	0.02|.	.|.	15.598|15.598	0.76602|0.76602	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1794;1755;1866|.	Q96RV3-3;B2RTR6;Q96RV3|.	.;.;PCX1_HUMAN|.	Y|I	1866;1794;1755|853	ENSP00000304192:F1866Y;ENSP00000238570:F1794Y;ENSP00000396617:F1755Y|.	ENSP00000238570:F1794Y|.	F|L	+|+	2|1	0|2	PCNX|PCNX	70638467|70638467	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	7.655000|7.655000	0.83696|0.83696	2.094000|2.094000	0.63399|0.63399	0.533000|0.533000	0.62120|0.62120	TTT|TTA	.	.	.	none		0.333	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982	
DDX24	57062	hgsc.bcm.edu	37	14	94528900	94528900	+	Silent	SNP	A	A	G			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr14:94528900A>G	ENST00000330836.5	-	3	917	c.786T>C	c.(784-786)aaT>aaC	p.N262N	DDX24_ENST00000555054.1_Silent_p.N219N|DDX24_ENST00000544005.1_Silent_p.N12N	NM_020414.3	NP_065147.1	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 24	262	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				RNA metabolic process (GO:0016070)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			cervix(3)|endometrium(4)|kidney(4)|large_intestine(5)|lung(3)|ovary(2)|skin(1)|urinary_tract(1)	23		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		GAGGGGCAGCATTCCTCTTCT	0.488																																					p.N262N		Atlas-SNP	.											.	DDX24	82	.	0			c.T786C						PASS	.						100.0	91.0	94.0					14																	94528900		2203	4300	6503	SO:0001819	synonymous_variant	57062	exon3			GGCAGCATTCCTC	AF214731	CCDS9918.1	14q32	2013-07-16	2013-07-16			ENSG00000089737		"""DEAD-boxes"""	13266	protein-coding gene	gene with protein product		606181	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 24"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 24"""			10936056, 18289627	Standard	NM_020414		Approved		uc001ycj.3	Q9GZR7		ENST00000330836.5:c.786T>C	chr14.hg19:g.94528900A>G		77.0	0.0	.		68.0	32.0	.	NM_020414	E7EMJ4|Q4V9L5	Silent	SNP	ENST00000330836.5	hg19	CCDS9918.1																																																																																			.	.	.	none		0.488	DDX24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412861.1	NM_020414	
SLC24A5	283652	hgsc.bcm.edu	37	15	48429007	48429007	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr15:48429007G>A	ENST00000341459.3	+	6	791	c.718G>A	c.(718-720)Gag>Aag	p.E240K	SLC24A5_ENST00000449382.2_Missense_Mutation_p.E180K	NM_205850.2	NP_995322.1	Q71RS6	NCKX5_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 5	240					ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|negative regulation of melanin biosynthetic process (GO:0048022)|response to stimulus (GO:0050896)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|skin(1)|upper_aerodigestive_tract(1)	27		all_lung(180;0.00217)		all cancers(107;3.29e-10)|GBM - Glioblastoma multiforme(94;7.32e-07)		CAAAGCTATGGAGAGAAGTGA	0.388																																					p.E240K		Atlas-SNP	.											.	SLC24A5	64	.	0			c.G718A						PASS	.						76.0	74.0	75.0					15																	48429007		2198	4297	6495	SO:0001583	missense	283652	exon6			GCTATGGAGAGAA	AF348468	CCDS10128.1	15q21.1	2014-01-28	2013-07-18		ENSG00000188467	ENSG00000188467		"""Solute carriers"""	20611	protein-coding gene	gene with protein product	"""oculocutaneous albinism 6 (autosomal recessive)"""	609802	"""solute carrier family 24, member 5"""			23364476	Standard	XM_005254308		Approved	JSX, OCA6	uc001zwe.3	Q71RS6	OTTHUMG00000131494	ENST00000341459.3:c.718G>A	chr15.hg19:g.48429007G>A	ENSP00000341550:p.Glu240Lys	197.0	0.0	.		115.0	48.0	.	NM_205850	A5X8Z8|A5X8Z9|Q14CT4|Q6DKH3	Missense_Mutation	SNP	ENST00000341459.3	hg19	CCDS10128.1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.994782	0.54041	.	.	ENSG00000188467	ENST00000341459;ENST00000449382	T;T	0.75260	-0.92;-0.92	5.42	5.42	0.78866	.	0.417747	0.28021	N	0.016905	T	0.68677	0.3027	L	0.50333	1.59	0.32783	N	0.502204	P;B	0.35077	0.483;0.22	B;B	0.24974	0.057;0.039	T	0.75004	-0.3470	10	0.39692	T	0.17	.	19.5924	0.95520	0.0:0.0:1.0:0.0	.	180;240	A5X8Z9;Q71RS6	.;NCKX5_HUMAN	K	240;180	ENSP00000341550:E240K;ENSP00000389966:E180K	ENSP00000341550:E240K	E	+	1	0	SLC24A5	46216299	1.000000	0.71417	0.972000	0.41901	0.640000	0.38277	4.436000	0.59948	2.689000	0.91719	0.655000	0.94253	GAG	.	.	.	none		0.388	SLC24A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254340.2	NM_205850	
ZNF609	23060	hgsc.bcm.edu	37	15	64972427	64972427	+	Silent	SNP	C	C	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr15:64972427C>T	ENST00000326648.3	+	6	3941	c.3813C>T	c.(3811-3813)agC>agT	p.S1271S		NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	1271						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CATATGGCAGCAAGGTCTCAG	0.517																																					p.S1271S		Atlas-SNP	.											.	ZNF609	106	.	0			c.C3813T						PASS	.						102.0	94.0	97.0					15																	64972427		2202	4299	6501	SO:0001819	synonymous_variant	23060	exon6			TGGCAGCAAGGTC	BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.3813C>T	chr15.hg19:g.64972427C>T		131.0	0.0	.		80.0	38.0	.	NM_015042	Q0D2I2	Silent	SNP	ENST00000326648.3	hg19	CCDS32270.1																																																																																			.	.	.	none		0.517	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418130.1	XM_042833	
MYO9A	4649	hgsc.bcm.edu	37	15	72175994	72175994	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr15:72175994G>A	ENST00000356056.5	-	28	5811	c.5339C>T	c.(5338-5340)tCa>tTa	p.S1780L	MYO9A_ENST00000444904.1_Missense_Mutation_p.S1761L|MYO9A_ENST00000564571.1_Missense_Mutation_p.S1780L|MYO9A_ENST00000424560.1_Missense_Mutation_p.S1851L	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1780	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						CGAAACCTCTGACTGGGTAGT	0.438																																					p.S1780L		Atlas-SNP	.											.	MYO9A	203	.	0			c.C5339T						PASS	.						224.0	220.0	221.0					15																	72175994		2199	4297	6496	SO:0001583	missense	4649	exon28			ACCTCTGACTGGG	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.5339C>T	chr15.hg19:g.72175994G>A	ENSP00000348349:p.Ser1780Leu	166.0	0.0	.		132.0	69.0	.	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	hg19	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	G	11.87	1.766171	0.31228	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	D;D;D	0.85339	-1.95;-1.97;-1.94	5.08	3.1	0.35709	.	.	.	.	.	D	0.89674	0.6783	M	0.64997	1.995	0.09310	N	0.999998	D;D	0.76494	0.999;0.999	D;D	0.72075	0.962;0.976	T	0.79888	-0.1613	9	0.41790	T	0.15	.	10.7053	0.45952	0.0728:0.1322:0.7949:0.0	.	1851;1780	B2RTY4-4;B2RTY4	.;MYO9A_HUMAN	L	1780;1851;1761	ENSP00000348349:S1780L;ENSP00000399162:S1851L;ENSP00000398250:S1761L	ENSP00000348349:S1780L	S	-	2	0	MYO9A	69963048	0.440000	0.25618	0.001000	0.08648	0.044000	0.14063	3.725000	0.54970	0.572000	0.29383	0.557000	0.71058	TCA	.	.	.	none		0.438	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
IQGAP1	8826	hgsc.bcm.edu	37	15	91017793	91017793	+	Silent	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr15:91017793G>A	ENST00000268182.5	+	23	2776	c.2652G>A	c.(2650-2652)caG>caA	p.Q884Q	IQGAP1_ENST00000560020.1_3'UTR|IQGAP1_ENST00000560738.1_Silent_p.Q312Q	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	884					cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			AGGATTTTCAGGAGGAGCTTG	0.453																																					p.Q884Q		Atlas-SNP	.											.	IQGAP1	140	.	0			c.G2652A						PASS	.						102.0	91.0	94.0					15																	91017793		2198	4298	6496	SO:0001819	synonymous_variant	8826	exon23			TTTTCAGGAGGAG	D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.2652G>A	chr15.hg19:g.91017793G>A		128.0	0.0	.		109.0	54.0	.	NM_003870	A7MBM3	Silent	SNP	ENST00000268182.5	hg19	CCDS10362.1																																																																																			.	.	.	none		0.453	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1	NM_003870	
ZKSCAN2	342357	hgsc.bcm.edu	37	16	25255502	25255502	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr16:25255502T>C	ENST00000328086.7	-	6	2388	c.1585A>G	c.(1585-1587)Aaa>Gaa	p.K529E		NM_001012981.4	NP_001012999.3	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	529					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	36				GBM - Glioblastoma multiforme(48;0.0378)		CCATACAATTTGCTCTTCCGA	0.512																																					p.K529E		Atlas-SNP	.											.	ZKSCAN2	90	.	0			c.A1585G						PASS	.						68.0	68.0	68.0					16																	25255502		2197	4300	6497	SO:0001583	missense	342357	exon6			ACAATTTGCTCTT	AK026852	CCDS32410.1	16p12.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000155592		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	25677	protein-coding gene	gene with protein product			"""zinc finger protein 694"""	ZNF694			Standard	NM_001012981		Approved	FLJ23199, ZSCAN34	uc002dod.4	Q63HK3		ENST00000328086.7:c.1585A>G	chr16.hg19:g.25255502T>C	ENSP00000331626:p.Lys529Glu	121.0	0.0	.		96.0	39.0	.	NM_001012981	A1L3B4|Q6ZN77	Missense_Mutation	SNP	ENST00000328086.7	hg19	CCDS32410.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.168672	0.78339	.	.	ENSG00000155592	ENST00000328086;ENST00000536768	T	0.41065	1.01	5.48	4.31	0.51392	SANT domain, DNA binding (1);	0.088025	0.49305	D	0.000148	T	0.28034	0.0691	N	0.17474	0.49	0.31663	N	0.645383	P;P	0.45348	0.856;0.856	B;B	0.42462	0.388;0.388	T	0.36720	-0.9736	10	0.87932	D	0	-31.0046	9.086	0.36581	0.0:0.0:0.1848:0.8152	.	325;529	B4DYF0;Q63HK3	.;ZKSC2_HUMAN	E	529	ENSP00000331626:K529E	ENSP00000331626:K529E	K	-	1	0	ZKSCAN2	25163003	0.998000	0.40836	0.995000	0.50966	0.996000	0.88848	1.341000	0.33907	2.205000	0.71048	0.533000	0.62120	AAA	.	.	.	none		0.512	ZKSCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435739.1	NM_001012981	
XPO6	23214	hgsc.bcm.edu	37	16	28164063	28164063	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr16:28164063C>A	ENST00000304658.5	-	8	1641	c.1141G>T	c.(1141-1143)Gtt>Ttt	p.V381F	XPO6_ENST00000565698.1_Missense_Mutation_p.V367F|XPO6_ENST00000561488.1_5'Flank	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	381					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						CTTAGGTGAACACTCACAAAG	0.408																																					p.V381F		Atlas-SNP	.											.	XPO6	177	.	0			c.G1141T						PASS	.						79.0	71.0	73.0					16																	28164063		1860	4092	5952	SO:0001583	missense	23214	exon8			GGTGAACACTCAC	AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.1141G>T	chr16.hg19:g.28164063C>A	ENSP00000302790:p.Val381Phe	170.0	0.0	.		125.0	56.0	.	NM_015171	A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Missense_Mutation	SNP	ENST00000304658.5	hg19	CCDS42135.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.515668	0.85389	.	.	ENSG00000169180	ENST00000304658	T	0.47177	0.85	5.91	5.91	0.95273	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.61602	0.2360	L	0.60455	1.87	0.80722	D	1	D;D	0.64830	0.978;0.994	P;P	0.56916	0.573;0.809	T	0.60727	-0.7206	10	0.54805	T	0.06	-12.4721	17.7923	0.88558	0.0:1.0:0.0:0.0	.	381;381	B7ZM10;Q96QU8	.;XPO6_HUMAN	F	381	ENSP00000302790:V381F	ENSP00000302790:V381F	V	-	1	0	XPO6	28071564	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.629000	0.83207	2.793000	0.96121	0.655000	0.94253	GTT	.	.	.	none		0.408	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433732.1	XM_055195	
WDR81	124997	hgsc.bcm.edu	37	17	1628392	1628392	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr17:1628392C>T	ENST00000409644.1	+	1	139	c.139C>T	c.(139-141)Ccg>Tcg	p.P47S	RP11-961A15.1_ENST00000576540.1_RNA|WDR81_ENST00000437219.2_Intron|WDR81_ENST00000446363.1_Intron|WDR81_ENST00000309182.5_Intron|WDR81_ENST00000419248.1_Intron	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	47					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GCAGCTGGCTCCGGCCCCGGG	0.741																																					p.P47S		Atlas-SNP	.											.	WDR81	180	.	0			c.C139T						PASS	.						3.0	5.0	5.0					17																	1628392		625	1502	2127	SO:0001583	missense	124997	exon1			CTGGCTCCGGCCC	AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.139C>T	chr17.hg19:g.1628392C>T	ENSP00000386609:p.Pro47Ser	59.0	0.0	.		63.0	17.0	.	NM_001163809	B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Missense_Mutation	SNP	ENST00000409644.1	hg19	CCDS54062.1	.	.	.	.	.	.	.	.	.	.	C	12.29	1.894622	0.33442	.	.	ENSG00000167716	ENST00000409644	T	0.48522	0.81	5.73	1.3	0.21679	.	.	.	.	.	T	0.43787	0.1263	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	T	0.36065	-0.9763	6	0.49607	T	0.09	.	8.0818	0.30750	0.1074:0.3321:0.4923:0.0682	.	.	.	.	S	47	ENSP00000386609:P47S	ENSP00000386609:P47S	P	+	1	0	WDR81	1575142	0.000000	0.05858	0.041000	0.18516	0.942000	0.58702	0.243000	0.18106	0.304000	0.22809	0.650000	0.86243	CCG	.	.	.	none		0.741	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333118.2	NM_152348	
CLUH	23277	hgsc.bcm.edu	37	17	2598316	2598316	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr17:2598316G>A	ENST00000570628.2	-	16	2675	c.2570C>T	c.(2569-2571)gCc>gTc	p.A857V	CLUH_ENST00000538975.1_Missense_Mutation_p.A857V|CLUH_ENST00000435359.1_Missense_Mutation_p.A857V			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	857					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											GGGCAGGTGGGCCACGGGGTT	0.637																																					p.A857V		Atlas-SNP	.											.	.	.	.	0			c.C2570T						PASS	.						36.0	44.0	41.0					17																	2598316		1974	4160	6134	SO:0001583	missense	23277	exon16			AGGTGGGCCACGG	AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.2570C>T	chr17.hg19:g.2598316G>A	ENSP00000458986:p.Ala857Val	76.0	0.0	.		103.0	31.0	.	NM_015229	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Missense_Mutation	SNP	ENST00000570628.2	hg19	CCDS45572.1	.	.	.	.	.	.	.	.	.	.	g	20.9	4.065557	0.76187	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	D;D	0.81499	-1.5;-1.5	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.75598	0.3871	L	0.38838	1.175	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.12837	0.008;0.008	T	0.69472	-0.5136	10	0.46703	T	0.11	.	18.6994	0.91615	0.0:0.0:1.0:0.0	.	857;858	O75153;C9J6D7	K0664_HUMAN;.	V	857;858;857	ENSP00000388872:A857V;ENSP00000439628:A857V	ENSP00000320468:A858V	A	-	2	0	KIAA0664	2545066	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	9.472000	0.97709	2.663000	0.90544	0.556000	0.70494	GCC	.	.	.	none		0.637	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437807.2	NM_015229	
NOS2	4843	hgsc.bcm.edu	37	17	26096089	26096089	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr17:26096089C>G	ENST00000313735.6	-	17	2181	c.1948G>C	c.(1948-1950)Gcc>Ccc	p.A650P		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	650	Flavodoxin-like. {ECO:0000255|PROSITE- ProRule:PRU00088}.				arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	AGCTGAGAGGCCCCCAGGTGG	0.622																																					p.A650P		Atlas-SNP	.											NOS2,NS,adenocarcinoma,0,1	NOS2	113	.	0			c.G1948C						PASS	.						38.0	37.0	37.0					17																	26096089		2203	4299	6502	SO:0001583	missense	4843	exon17			GAGAGGCCCCCAG	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.1948G>C	chr17.hg19:g.26096089C>G	ENSP00000327251:p.Ala650Pro	51.0	1.0	.		52.0	30.0	.	NM_000625	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	ENST00000313735.6	hg19	CCDS11223.1	.	.	.	.	.	.	.	.	.	.	C	32	5.113167	0.94339	.	.	ENSG00000007171	ENST00000313735;ENST00000379105;ENST00000302153	T	0.68624	-0.34	5.16	5.16	0.70880	Flavodoxin/nitric oxide synthase (2);	0.000000	0.85682	D	0.000000	D	0.89262	0.6665	H	0.98370	4.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.93452	0.6803	10	0.72032	D	0.01	.	17.6452	0.88146	0.0:1.0:0.0:0.0	.	615;650	F8WEM3;P35228	.;NOS2_HUMAN	P	650;611;615	ENSP00000327251:A650P	ENSP00000305638:A615P	A	-	1	0	NOS2	23120216	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.818000	0.86416	2.397000	0.81536	0.462000	0.41574	GCC	.	.	.	none		0.622	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625	
PEX12	5193	hgsc.bcm.edu	37	17	33903054	33903054	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr17:33903054A>G	ENST00000225873.4	-	3	1434	c.827T>C	c.(826-828)tTg>tCg	p.L276S	SNORD7_ENST00000384567.1_RNA|RP11-1094M14.11_ENST00000592381.1_lincRNA	NM_000286.2	NP_000277.1	O00623	PEX12_HUMAN	peroxisomal biogenesis factor 12	276					peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	integral component of peroxisomal membrane (GO:0005779)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(8)	18				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CAGGGCAGTCAATGACTTGAT	0.468																																					p.L276S		Atlas-SNP	.											.	PEX12	36	.	0			c.T827C						PASS	.						200.0	161.0	174.0					17																	33903054		2203	4300	6503	SO:0001583	missense	5193	exon3			GCAGTCAATGACT	U91521	CCDS11296.1	17q21.1	2011-02-10			ENSG00000108733	ENSG00000108733			8854	protein-coding gene	gene with protein product		601758				9090384	Standard	NM_000286		Approved		uc002hjp.3	O00623	OTTHUMG00000132951	ENST00000225873.4:c.827T>C	chr17.hg19:g.33903054A>G	ENSP00000225873:p.Leu276Ser	172.0	0.0	.		238.0	63.0	.	NM_000286	B2R6M2	Missense_Mutation	SNP	ENST00000225873.4	hg19	CCDS11296.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.008782	0.75046	.	.	ENSG00000108733	ENST00000424525;ENST00000225873	D	0.84800	-1.9	5.04	5.04	0.67666	.	0.071674	0.56097	D	0.000026	D	0.84906	0.5576	M	0.67953	2.075	0.47094	D	0.99931	D	0.54601	0.967	P	0.47573	0.55	T	0.82641	-0.0357	10	0.15066	T	0.55	-9.1479	14.1306	0.65250	1.0:0.0:0.0:0.0	.	276	O00623	PEX12_HUMAN	S	276	ENSP00000225873:L276S	ENSP00000225873:L276S	L	-	2	0	PEX12	30927167	1.000000	0.71417	0.010000	0.14722	0.982000	0.71751	8.533000	0.90617	2.114000	0.64651	0.533000	0.62120	TTG	.	.	.	none		0.468	PEX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256489.2	NM_000286	
MED13	9969	hgsc.bcm.edu	37	17	60043908	60043908	+	Silent	SNP	T	T	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr17:60043908T>A	ENST00000397786.2	-	19	4372	c.4296A>T	c.(4294-4296)gcA>gcT	p.A1432A		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1432					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						AAAACCATTCTGCTACCAACT	0.393																																					p.A1432A		Atlas-SNP	.											.	MED13	181	.	0			c.A4296T						PASS	.						153.0	137.0	142.0					17																	60043908		1872	4114	5986	SO:0001819	synonymous_variant	9969	exon19			CCATTCTGCTACC	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.4296A>T	chr17.hg19:g.60043908T>A		135.0	0.0	.		135.0	36.0	.	NM_005121	B2RU05|O60334	Silent	SNP	ENST00000397786.2	hg19	CCDS42366.1																																																																																			.	.	.	none		0.393	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121	
LAMA3	3909	hgsc.bcm.edu	37	18	21523876	21523876	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr18:21523876G>A	ENST00000313654.9	+	69	9392	c.9151G>A	c.(9151-9153)Gat>Aat	p.D3051N	LAMA3_ENST00000399516.3_Missense_Mutation_p.D2995N|LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000269217.6_Missense_Mutation_p.D1442N|LAMA3_ENST00000587184.1_Missense_Mutation_p.D1386N	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	3051	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					ACTGGGGACAGATGGGAAAAA	0.473																																					p.D3051N		Atlas-SNP	.											.	LAMA3	397	.	0			c.G9151A						PASS	.						104.0	94.0	98.0					18																	21523876		2203	4300	6503	SO:0001583	missense	3909	exon69			GGGACAGATGGGA	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.9151G>A	chr18.hg19:g.21523876G>A	ENSP00000324532:p.Asp3051Asn	108.0	0.0	.		85.0	43.0	.	NM_198129	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	hg19	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	G	7.994	0.753846	0.15778	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;T;T	0.63096	-0.02;-0.02;-0.02	5.23	3.46	0.39613	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.58466	0.2124	L	0.53249	1.67	0.09310	N	1	B;P;P;P	0.36392	0.285;0.551;0.525;0.525	B;B;B;B	0.40285	0.131;0.325;0.245;0.245	T	0.47420	-0.9119	9	0.34782	T	0.22	.	9.2006	0.37256	0.2181:0.0:0.7819:0.0	.	1386;1442;2995;3051	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	N	3051;2995;1442	ENSP00000324532:D3051N;ENSP00000382432:D2995N;ENSP00000269217:D1442N	ENSP00000269217:D1442N	D	+	1	0	LAMA3	19777874	0.944000	0.32072	0.003000	0.11579	0.061000	0.15899	3.534000	0.53568	0.793000	0.33875	-0.793000	0.03317	GAT	.	.	.	none		0.473	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
HDHD2	84064	hgsc.bcm.edu	37	18	44635149	44635149	+	Nonsense_Mutation	SNP	A	A	C			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr18:44635149A>C	ENST00000300605.6	-	7	836	c.684T>G	c.(682-684)taT>taG	p.Y228*	RP11-49K24.8_ENST00000591183.1_RNA|HDHD2_ENST00000587841.1_5'UTR	NM_032124.4	NP_115500.1	Q9H0R4	HDHD2_HUMAN	haloacid dehalogenase-like hydrolase domain containing 2	228						extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			kidney(2)|large_intestine(2)|lung(1)|skin(1)	6						CTGATGCTCGATATTTCCCTG	0.443																																					p.Y228X		Atlas-SNP	.											.	HDHD2	12	.	0			c.T684G						PASS	.						151.0	129.0	136.0					18																	44635149		2203	4300	6503	SO:0001587	stop_gained	84064	exon7			TGCTCGATATTTC	AL136681	CCDS32829.1	18q21.1	2008-02-05				ENSG00000167220			25364	protein-coding gene	gene with protein product						11230166	Standard	NM_032124		Approved	DKFZP564D1378	uc002lcs.3	Q9H0R4		ENST00000300605.6:c.684T>G	chr18.hg19:g.44635149A>C	ENSP00000300605:p.Tyr228*	89.0	0.0	.		86.0	43.0	.	NM_032124	A8K7T3|Q96NV4	Nonsense_Mutation	SNP	ENST00000300605.6	hg19	CCDS32829.1	.	.	.	.	.	.	.	.	.	.	A	7.137	0.581046	0.13686	.	.	ENSG00000167220	ENST00000300605	.	.	.	5.93	-8.84	0.00803	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-21.4898	20.0742	0.97736	0.7148:0.0:0.2852:0.0	.	.	.	.	X	228	.	ENSP00000300605:Y228X	Y	-	3	2	HDHD2	42889147	0.067000	0.21026	0.202000	0.23494	0.198000	0.23893	-0.733000	0.04898	-1.956000	0.01022	-1.934000	0.00508	TAT	.	.	.	none		0.443	HDHD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450668.2	NM_032124	
TMEM147	10430	hgsc.bcm.edu	37	19	36037600	36037600	+	Silent	SNP	G	G	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr19:36037600G>T	ENST00000222284.5	+	4	379	c.234G>T	c.(232-234)gtG>gtT	p.V78V	AD000090.2_ENST00000590717.1_RNA|TMEM147_ENST00000392205.1_Silent_p.V78V|AD000090.2_ENST00000589137.1_RNA|TMEM147_ENST00000392204.2_Silent_p.V29V|AD000090.2_ENST00000444728.1_RNA|AD000090.2_ENST00000588286.1_RNA	NM_032635.3	NP_116024.1	Q9BVK8	TM147_HUMAN	transmembrane protein 147	78						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(2)|prostate(1)	6	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GCGTGGATGTGGCAGACCTGA	0.572																																					p.V78V		Atlas-SNP	.											.	TMEM147	13	.	0			c.G234T						PASS	.						119.0	106.0	111.0					19																	36037600		2203	4300	6503	SO:0001819	synonymous_variant	10430	exon4			GGATGTGGCAGAC	BC001118	CCDS12466.1, CCDS56091.1	19q13.12	2010-08-13			ENSG00000105677	ENSG00000105677			30414	protein-coding gene	gene with protein product		613585				20538592	Standard	NM_032635		Approved	NIFIE14, MGC1936	uc002oaj.2	Q9BVK8	OTTHUMG00000048105	ENST00000222284.5:c.234G>T	chr19.hg19:g.36037600G>T		88.0	0.0	.		80.0	31.0	.	NM_032635	A8MWW0|O75790	Silent	SNP	ENST00000222284.5	hg19	CCDS12466.1																																																																																			.	.	.	none		0.572	TMEM147-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109469.2	NM_032635	
TMEM147	10430	hgsc.bcm.edu	37	19	36037611	36037612	+	Missense_Mutation	DNP	TA	TA	AT			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T|A	T|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr19:36037611_36037612TA>AT	ENST00000222284.5	+	4	390_391	c.245_246TA>AT	c.(244-246)aTA>aAT	p.I82N	AD000090.2_ENST00000590717.1_RNA|TMEM147_ENST00000392205.1_Missense_Mutation_p.I82N|AD000090.2_ENST00000589137.1_RNA|TMEM147_ENST00000392204.2_Missense_Mutation_p.I33N|AD000090.2_ENST00000444728.1_RNA|AD000090.2_ENST00000588286.1_RNA	NM_032635.3	NP_116024.1	Q9BVK8	TM147_HUMAN	transmembrane protein 147	82						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(2)|prostate(1)	6	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GCAGACCTGATAGGTCTAAACC	0.569																																					p.I82K|p.I82I		Atlas-SNP	.											.	TMEM147	13	.	0			c.T245A|c.A246T						PASS	.																																			SO:0001583	missense	10430	exon4			ACCTGATAGGTCT|CCTGATAGGTCTA	BC001118	CCDS12466.1, CCDS56091.1	19q13.12	2010-08-13			ENSG00000105677	ENSG00000105677			30414	protein-coding gene	gene with protein product		613585				20538592	Standard	NM_032635		Approved	NIFIE14, MGC1936	uc002oaj.2	Q9BVK8	OTTHUMG00000048105	Exception_encountered	chr19.hg19:g.36037611_36037612delinsAT	ENSP00000222284:p.Ile82Asn	82.0|84.0	0.0	.		81.0	30.0	.	NM_032635	A8MWW0|O75790	Missense_Mutation|Silent	SNP	ENST00000222284.5	hg19	CCDS12466.1																																																																																			.	.	.	none		0.569	TMEM147-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109469.2	NM_032635	
TSKS	60385	hgsc.bcm.edu	37	19	50243159	50243159	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr19:50243159G>T	ENST00000246801.3	-	11	1735	c.1653C>A	c.(1651-1653)caC>caA	p.H551Q	TSKS_ENST00000358830.3_Missense_Mutation_p.H351Q	NM_021733.1	NP_068379.1	Q9UJT2	TSKS_HUMAN	testis-specific serine kinase substrate	551					negative regulation of phosphatase activity (GO:0010923)	centriole (GO:0005814)	protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|prostate(3)|skin(3)	38		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		ACATCTTCAAGTGTAGATGGT	0.592																																					p.H551Q		Atlas-SNP	.											.	TSKS	97	.	0			c.C1653A						PASS	.						102.0	93.0	96.0					19																	50243159		2203	4300	6503	SO:0001583	missense	60385	exon11			CTTCAAGTGTAGA	BC058862	CCDS12780.1	19q13.3	2014-06-13							30719	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 161"""	608253				11444856, 18495105	Standard	NM_021733		Approved	TSSKS, PPP1R161	uc002ppm.3	Q9UJT2		ENST00000246801.3:c.1653C>A	chr19.hg19:g.50243159G>T	ENSP00000246801:p.His551Gln	82.0	0.0	.		56.0	26.0	.	NM_021733	Q8WXJ0	Missense_Mutation	SNP	ENST00000246801.3	hg19	CCDS12780.1	.	.	.	.	.	.	.	.	.	.	G	8.131	0.783184	0.16189	.	.	ENSG00000126467	ENST00000246801;ENST00000358830	T;T	0.29397	1.57;1.57	5.44	0.262	0.15597	.	0.000000	0.49916	D	0.000129	T	0.34687	0.0906	N	0.24115	0.695	0.24288	N	0.995176	D	0.69078	0.997	D	0.78314	0.991	T	0.16335	-1.0406	10	0.66056	D	0.02	-21.087	8.6712	0.34152	0.4246:0.0:0.5754:0.0	.	551	Q9UJT2	TSKS_HUMAN	Q	551;351	ENSP00000246801:H551Q;ENSP00000351691:H351Q	ENSP00000246801:H551Q	H	-	3	2	TSKS	54934971	0.983000	0.35010	0.349000	0.25694	0.037000	0.13140	0.292000	0.19011	-0.097000	0.12307	-0.921000	0.02739	CAC	.	.	.	none		0.592	TSKS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465795.1	NM_021733	
SIGLEC11	114132	hgsc.bcm.edu	37	19	50461600	50461600	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr19:50461600G>A	ENST00000447370.2	-	8	1681	c.1591C>T	c.(1591-1593)Cgc>Tgc	p.R531C	SIGLEC11_ENST00000426971.2_Intron|CTC-326K19.6_ENST00000451973.1_Missense_Mutation_p.R17C	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	531					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		GCCTTACAGCGGAGCCTGAGG	0.667																																					p.R531C		Atlas-SNP	.											.	SIGLEC11	70	.	0			c.C1591T						PASS	.						34.0	40.0	38.0					19																	50461600		2203	4300	6503	SO:0001583	missense	114132	exon8			TACAGCGGAGCCT	AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.1591C>T	chr19.hg19:g.50461600G>A	ENSP00000412361:p.Arg531Cys	164.0	0.0	.		118.0	13.0	.	NM_052884		Missense_Mutation	SNP	ENST00000447370.2	hg19	CCDS12790.2	.	.	.	.	.	.	.	.	.	.	T	19.39	3.819248	0.71028	.	.	ENSG00000161640	ENST00000447370	D	0.86769	-2.17	3.0	0.352	0.16051	.	0.523323	0.19200	N	0.120203	D	0.85788	0.5778	L	0.42245	1.32	0.23966	N	0.996325	D	0.62365	0.991	P	0.54706	0.759	T	0.77835	-0.2440	10	0.66056	D	0.02	.	8.643	0.33989	0.0:0.0:0.6364:0.3636	.	531	Q96RL6	SIG11_HUMAN	C	531	ENSP00000412361:R531C	ENSP00000412361:R531C	R	-	1	0	SIGLEC11	55153412	0.000000	0.05858	0.287000	0.24848	0.128000	0.20619	-1.909000	0.01586	-0.055000	0.13244	-0.371000	0.07208	CGC	.	.	.	none		0.667	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347382.1	NM_052884	
PLCB1	23236	hgsc.bcm.edu	37	20	8626784	8626784	+	Silent	SNP	C	C	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr20:8626784C>T	ENST00000338037.6	+	5	447	c.420C>T	c.(418-420)aaC>aaT	p.N140N	PLCB1_ENST00000378637.2_Silent_p.N140N|PLCB1_ENST00000378641.3_Silent_p.N140N	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	140					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						TGGCAACAAACCTGCTGGCCC	0.388																																					p.Q140H		Atlas-SNP	.											.	PLCB1	394	.	0			c.A420T						PASS	.						130.0	124.0	126.0					20																	8626784		2203	4300	6503	SO:0001819	synonymous_variant	23236	exon5			AACAAACCTGCTG	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.420C>T	chr20.hg19:g.8626784C>T		86.0	0.0	.		66.0	37.0	.	NM_015192	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	hg19	CCDS13102.1																																																																																			.	.	.	none		0.388	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		
APMAP	57136	hgsc.bcm.edu	37	20	24964632	24964632	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr20:24964632C>T	ENST00000217456.2	-	2	409	c.119G>A	c.(118-120)cGa>cAa	p.R40Q	APMAP_ENST00000447138.1_Missense_Mutation_p.R40Q	NM_020531.2	NP_065392.1	Q9HDC9	APMAP_HUMAN	adipocyte plasma membrane associated protein	40					biosynthetic process (GO:0009058)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	arylesterase activity (GO:0004064)|strictosidine synthase activity (GO:0016844)										GAAGGTCACTCGGAAAACTCT	0.517																																					p.R40Q		Atlas-SNP	.											.	APMAP	3	.	0			c.G119A						PASS	.						76.0	77.0	77.0					20																	24964632		2203	4300	6503	SO:0001583	missense	57136	exon2			GTCACTCGGAAAA	AB033767	CCDS13166.1	20p11.2	2012-07-20	2012-07-20	2012-07-20	ENSG00000101474	ENSG00000101474			13238	protein-coding gene	gene with protein product		615884	"""chromosome 20 open reading frame 3"""	C20orf3		10945474, 11583587, 20552250	Standard	NM_020531		Approved	BSCv	uc002wty.3	Q9HDC9	OTTHUMG00000032107	ENST00000217456.2:c.119G>A	chr20.hg19:g.24964632C>T	ENSP00000217456:p.Arg40Gln	87.0	0.0	.		55.0	23.0	.	NM_020531	A8K514|B4DXG1|Q6UVZ8|Q9GZS8|Q9NUB2	Missense_Mutation	SNP	ENST00000217456.2	hg19	CCDS13166.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.80|14.80	2.642456|2.642456	0.47153|0.47153	.|.	.|.	ENSG00000101474|ENSG00000101474	ENST00000451442|ENST00000217456;ENST00000447138	.|T;T	.|0.29397	.|2.0;1.57	6.08|6.08	3.82|3.82	0.43975|0.43975	.|.	.|0.284309	.|0.34652	.|N	.|0.003795	T|T	0.19846|0.19846	0.0477|0.0477	L|L	0.28740|0.28740	0.885|0.885	0.42535|0.42535	D|D	0.993057|0.993057	.|B;B;B	.|0.15473	.|0.013;0.007;0.004	.|B;B;B	.|0.10450	.|0.005;0.002;0.001	T|T	0.06356|0.06356	-1.0831|-1.0831	5|10	.|0.27785	.|T	.|0.31	-3.365|-3.365	7.9026|7.9026	0.29744|0.29744	0.1637:0.7461:0.0:0.0902|0.1637:0.7461:0.0:0.0902	.|.	.|40;24;40	.|Q9HDC9-2;A2A2F9;Q9HDC9	.|.;.;APMAP_HUMAN	K|Q	25|40	.|ENSP00000217456:R40Q;ENSP00000415373:R40Q	.|ENSP00000217456:R40Q	E|R	-|-	1|2	0|0	C20orf3|C20orf3	24912632|24912632	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	1.986000|1.986000	0.40677|0.40677	1.568000|1.568000	0.49683|0.49683	0.655000|0.655000	0.94253|0.94253	GAG|CGA	.	.	.	none		0.517	APMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078380.2	NM_020531	
TMPRSS15	5651	hgsc.bcm.edu	37	21	19701538	19701538	+	Silent	SNP	A	A	G			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr21:19701538A>G	ENST00000284885.3	-	15	1761	c.1728T>C	c.(1726-1728)atT>atC	p.I576I		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	576	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						CTACATCGTTAATATTTTCTA	0.294																																					p.I576I		Atlas-SNP	.											.	TMPRSS15	189	.	0			c.T1728C						PASS	.						86.0	84.0	84.0					21																	19701538		2203	4297	6500	SO:0001819	synonymous_variant	5651	exon15			ATCGTTAATATTT		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.1728T>C	chr21.hg19:g.19701538A>G		312.0	1.0	.		229.0	117.0	.	NM_002772	Q2NKL7	Silent	SNP	ENST00000284885.3	hg19	CCDS13571.1																																																																																			.	.	.	none		0.294	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772	
TMPRSS15	5651	hgsc.bcm.edu	37	21	19701570	19701570	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr21:19701570G>A	ENST00000284885.3	-	15	1729	c.1696C>T	c.(1696-1698)Ctt>Ttt	p.L566F		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	566	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TGAAAATGAAGTTGTATATTC	0.308																																					p.L566F		Atlas-SNP	.											.	TMPRSS15	189	.	0			c.C1696T						PASS	.						70.0	68.0	69.0					21																	19701570		2202	4297	6499	SO:0001583	missense	5651	exon15			AATGAAGTTGTAT		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.1696C>T	chr21.hg19:g.19701570G>A	ENSP00000284885:p.Leu566Phe	325.0	1.0	.		226.0	95.0	.	NM_002772	Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	hg19	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	G	18.07	3.541595	0.65085	.	.	ENSG00000154646	ENST00000284885	T	0.33865	1.39	5.4	4.49	0.54785	CUB (5);	0.000000	0.64402	D	0.000002	T	0.65270	0.2675	M	0.88031	2.925	0.45227	D	0.998237	D	0.89917	1.0	D	0.97110	1.0	T	0.72411	-0.4302	9	.	.	.	.	14.0641	0.64817	0.0:0.1523:0.8477:0.0	.	566	P98073	ENTK_HUMAN	F	566	ENSP00000284885:L566F	.	L	-	1	0	TMPRSS15	18623441	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	4.205000	0.58466	1.371000	0.46172	0.561000	0.74099	CTT	.	.	.	none		0.308	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772	
GART	2618	hgsc.bcm.edu	37	21	34901233	34901234	+	Missense_Mutation	DNP	TC	TC	AT	rs376223183		TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr21:34901233_34901234TC>AT	ENST00000381831.3	-	8	996_997	c.733_734GA>AT	c.(733-735)GAt>ATt	p.D245I	GART_ENST00000381815.4_Missense_Mutation_p.D245I|GART_ENST00000361093.5_Missense_Mutation_p.D245I|GART_ENST00000381839.3_Missense_Mutation_p.D245I|GART_ENST00000497313.1_5'Flank	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	245	ATP-grasp.				'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)			NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	TAGTAATAGATCATTAGAAACC	0.396																																					p.D245V|p.D245N		Atlas-SNP	.											.	GART	81	.	0			c.A734T|c.G733A						PASS	.																																			SO:0001583	missense	2618	exon8			AATAGATCATTAG|ATAGATCATTAGA	M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.733_734delinsAT	chr21.hg19:g.34901233_34901234delinsAT	ENSP00000371253:p.Asp245Ile	62.0|60.0	0.0	.		41.0	12.0	.	NM_001136005	A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Missense_Mutation	SNP	ENST00000381831.3	hg19	CCDS13627.1																																																																																			.	.	.	alt|none		0.396	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140626.3	NM_000819	
COL6A2	1292	hgsc.bcm.edu	37	21	47538955	47538955	+	Silent	SNP	C	C	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr21:47538955C>T	ENST00000300527.4	+	14	1295	c.1191C>T	c.(1189-1191)ggC>ggT	p.G397G	COL6A2_ENST00000397763.1_Silent_p.G397G|COL6A2_ENST00000357838.4_Silent_p.G397G|COL6A2_ENST00000310645.5_Silent_p.G397G|COL6A2_ENST00000409416.1_Silent_p.G397G	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	397	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GGTATCAAGGCAACAGTGGAG	0.662																																					p.G397G		Atlas-SNP	.											.	COL6A2	351	.	0			c.C1191T						PASS	.						47.0	42.0	44.0					21																	47538955		2201	4298	6499	SO:0001819	synonymous_variant	1292	exon14			TCAAGGCAACAGT	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.1191C>T	chr21.hg19:g.47538955C>T		356.0	1.0	.		273.0	88.0	.	NM_058175	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Silent	SNP	ENST00000300527.4	hg19	CCDS13728.1																																																																																			.	.	.	none		0.662	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1		
DIP2A	23181	hgsc.bcm.edu	37	21	47917012	47917012	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr21:47917012C>T	ENST00000417564.2	+	4	416	c.395C>T	c.(394-396)aCc>aTc	p.T132I	DIP2A_ENST00000427143.2_Missense_Mutation_p.T68I|DIP2A_ENST00000466639.1_Missense_Mutation_p.T132I|DIP2A_ENST00000435722.3_Missense_Mutation_p.T132I|DIP2A_ENST00000457905.3_Missense_Mutation_p.T132I|DIP2A_ENST00000318711.7_Missense_Mutation_p.T132I|DIP2A_ENST00000400274.1_Missense_Mutation_p.T132I			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	132					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		GAAACCTACACCCCTCCAGGT	0.448																																					p.T132I		Atlas-SNP	.											.	DIP2A	332	.	0			c.C395T						PASS	.						121.0	113.0	115.0					21																	47917012		1965	4139	6104	SO:0001583	missense	23181	exon4			CCTACACCCCTCC	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.395C>T	chr21.hg19:g.47917012C>T	ENSP00000392066:p.Thr132Ile	129.0	0.0	.		109.0	41.0	.	NM_206891	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	hg19	CCDS46655.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.383169	0.82792	.	.	ENSG00000160305	ENST00000400274;ENST00000427143;ENST00000318711;ENST00000358985;ENST00000457905;ENST00000466639;ENST00000435722;ENST00000417564	T;T;T;T;T;T;T	0.31247	1.77;1.77;1.8;1.74;1.5;1.74;1.8	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.59224	0.2178	M	0.80746	2.51	0.80722	D	1	P;P;D;P;D;D	0.89917	0.929;0.753;1.0;0.825;0.995;0.992	P;P;D;P;D;P	0.87578	0.821;0.456;0.998;0.739;0.959;0.908	T	0.57382	-0.7821	10	0.35671	T	0.21	-25.05	18.4623	0.90743	0.0:1.0:0.0:0.0	.	132;68;132;132;132;132	E9PER1;E7EMA5;Q14689-3;Q14689;Q14689-4;Q14689-2	.;.;.;DIP2A_HUMAN;.;.	I	132;68;132;132;132;132;132;132	ENSP00000383133:T132I;ENSP00000400528:T68I;ENSP00000323633:T132I;ENSP00000393434:T132I;ENSP00000430249:T132I;ENSP00000415089:T132I;ENSP00000392066:T132I	ENSP00000323633:T132I	T	+	2	0	DIP2A	46741440	1.000000	0.71417	0.847000	0.33407	0.992000	0.81027	7.680000	0.84062	2.595000	0.87683	0.655000	0.94253	ACC	.	.	.	none		0.448	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151	
PI4KA	5297	hgsc.bcm.edu	37	22	21153483	21153483	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr22:21153483C>A	ENST00000572273.1	-	16	1958	c.1728G>T	c.(1726-1728)atG>atT	p.M576I	PI4KA_ENST00000255882.6_Missense_Mutation_p.M634I			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	576					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			GAATGGGCTCCATGACCTTCG	0.562																																					p.M634I	GBM(136;1332 1831 3115 23601 50806)	Atlas-SNP	.											.	PI4KA	313	.	0			c.G1902T						PASS	.						90.0	78.0	82.0					22																	21153483		2203	4300	6503	SO:0001583	missense	5297	exon16			GGGCTCCATGACC	L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.1728G>T	chr22.hg19:g.21153483C>A	ENSP00000458238:p.Met576Ile	69.0	0.0	.		57.0	23.0	.	NM_058004	Q7Z625|Q9UPG2	Missense_Mutation	SNP	ENST00000572273.1	hg19		.	.	.	.	.	.	.	.	.	.	C	17.03	3.285111	0.59867	.	.	ENSG00000241973	ENST00000255882	.	.	.	4.55	4.55	0.56014	.	0.000000	0.85682	D	0.000000	T	0.58104	0.2099	L	0.54323	1.7	0.80722	D	1	B;B	0.24768	0.111;0.067	B;B	0.22601	0.025;0.04	T	0.55749	-0.8092	9	0.25751	T	0.34	-35.0254	17.4787	0.87667	0.0:1.0:0.0:0.0	.	634;576	D3DX33;P42356	.;PI4KA_HUMAN	I	576	.	ENSP00000255882:M576I	M	-	3	0	PI4KA	19483483	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	7.651000	0.83577	2.348000	0.79779	0.491000	0.48974	ATG	.	.	.	none		0.562	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004	
DRICH1	51233	hgsc.bcm.edu	37	22	23964292	23964292	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr22:23964292C>A	ENST00000317749.5	-	4	667	c.370G>T	c.(370-372)Gat>Tat	p.D124Y		NM_016449.3	NP_057533.2	Q6PGQ1	DRIC1_HUMAN		124	Asp-rich.									endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|skin(1)	11						Gcatcatcatcatcatcatca	0.428																																					p.D124Y		Atlas-SNP	.											.	C22orf43	18	.	0			c.G370T						PASS	.						91.0	77.0	82.0					22																	23964292		1980	4156	6136	SO:0001583	missense	51233	exon4			CATCATCATCATC																												ENST00000317749.5:c.370G>T	chr22.hg19:g.23964292C>A	ENSP00000316137:p.Asp124Tyr	64.0	0.0	.		56.0	15.0	.	NM_016449	Q6ICJ8|Q6P4I3|Q9NU31	Missense_Mutation	SNP	ENST00000317749.5	hg19	CCDS42985.1	.	.	.	.	.	.	.	.	.	.	c	4.413	0.076434	0.08485	.	.	ENSG00000189269	ENST00000317749	T	0.40756	1.02	0.333	-0.666	0.11399	.	.	.	.	.	T	0.36690	0.0976	N	0.08118	0	0.09310	N	1	D	0.76494	0.999	D	0.72982	0.979	T	0.25710	-1.0124	8	0.87932	D	0	.	.	.	.	.	124	Q6PGQ1	CV043_HUMAN	Y	124	ENSP00000316137:D124Y	ENSP00000316137:D124Y	D	-	1	0	C22orf43	22294292	0.004000	0.15560	0.001000	0.08648	0.001000	0.01503	-0.994000	0.03716	-0.537000	0.06290	-0.524000	0.04348	GAT	.	.	.	none		0.428	C22orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319708.2		
DRG1	4733	hgsc.bcm.edu	37	22	31816283	31816283	+	Silent	SNP	C	C	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr22:31816283C>T	ENST00000331457.4	+	5	615	c.454C>T	c.(454-456)Ctg>Ttg	p.L152L	DRG1_ENST00000433341.1_3'UTR	NM_004147.3	NP_004138.1	Q9Y295	DRG1_HUMAN	developmentally regulated GTP binding protein 1	152	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|polysome (GO:0005844)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|transcription factor binding (GO:0008134)	p.L152M(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|urinary_tract(1)	11						TCTGGATGTCCTGAAACCTTT	0.403																																					p.L152L		Atlas-SNP	.											DRG1,bladder,carcinoma,-2,1	DRG1	28	.	1	Substitution - Missense(1)	endometrium(1)	c.C454T						PASS	.						87.0	82.0	84.0					22																	31816283		2203	4300	6503	SO:0001819	synonymous_variant	4733	exon5			GATGTCCTGAAAC	AJ005940	CCDS13897.1	22q12.2	2010-02-26	2001-11-28		ENSG00000185721	ENSG00000185721			3029	protein-coding gene	gene with protein product		603952	"""developmentally regulated GTP-binding protein 1"""	NEDD3		7929244, 1449490	Standard	NM_004147		Approved		uc003aku.3	Q9Y295	OTTHUMG00000030792	ENST00000331457.4:c.454C>T	chr22.hg19:g.31816283C>T		129.0	0.0	.		102.0	53.0	.	NM_004147	B2RDS8|Q6FGP8|Q8WW69|Q9UGF2	Silent	SNP	ENST00000331457.4	hg19	CCDS13897.1																																																																																			.	.	.	none		0.403	DRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075680.5	NM_004147	
EFHC2	80258	hgsc.bcm.edu	37	X	44008117	44008117	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chrX:44008117A>T	ENST00000420999.1	-	15	2257	c.2174T>A	c.(2173-2175)aTg>aAg	p.M725K	EFHC2_ENST00000343571.3_5'UTR	NM_025184.3	NP_079460.2	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	725							calcium ion binding (GO:0005509)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	29						AGGTGATGGCATACCAAGCCA	0.378																																					p.M725K		Atlas-SNP	.											.	EFHC2	81	.	0			c.T2174A						PASS	.						81.0	68.0	72.0					X																	44008117		1873	4089	5962	SO:0001583	missense	80258	exon15			GATGGCATACCAA	AK026254	CCDS55405.1	Xp11	2014-01-31			ENSG00000183690	ENSG00000183690		"""EF-hand domain containing"""	26233	protein-coding gene	gene with protein product		300817	"""mental retardation, X-linked 74"""	MRX74		17221867	Standard	NM_025184		Approved	FLJ22843	uc004dgb.4	Q5JST6	OTTHUMG00000021393	ENST00000420999.1:c.2174T>A	chrX.hg19:g.44008117A>T	ENSP00000404232:p.Met725Lys	263.0	1.0	.		157.0	143.0	.	NM_025184	Q5JST8|Q68DK4|Q8NEI0|Q9H653	Missense_Mutation	SNP	ENST00000420999.1	hg19	CCDS55405.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	4.147|4.147	0.025585|0.025585	0.08054|0.08054	.|.	.|.	ENSG00000183690|ENSG00000183690	ENST00000343571;ENST00000333807;ENST00000420999|ENST00000441230	T;T|.	0.65916|.	-0.17;-0.18|.	5.52|5.52	-0.196|-0.196	0.13232|0.13232	.|.	0.626150|.	0.16544|.	N|.	0.209813|.	T|.	0.36717|.	0.0977|.	L|L	0.57536|0.57536	1.79|1.79	0.09310|0.09310	N|N	1|1	B|.	0.10296|.	0.003|.	B|.	0.06405|.	0.002|.	T|.	0.34900|.	-0.9810|.	10|.	0.07175|.	T|.	0.84|.	-5.6211|-5.6211	1.4427|1.4427	0.02357|0.02357	0.3921:0.1429:0.0876:0.3774|0.3921:0.1429:0.0876:0.3774	.|.	725|.	Q5JST6|.	EFHC2_HUMAN|.	K|X	138;725;753|705	ENSP00000333823:M725K;ENSP00000404232:M753K|.	ENSP00000333823:M725K|.	M|Y	-|-	2|3	0|2	EFHC2|EFHC2	43893061|43893061	0.585000|0.585000	0.26774|0.26774	0.358000|0.358000	0.25811|0.25811	0.080000|0.080000	0.17528|0.17528	0.391000|0.391000	0.20784|0.20784	-0.049000|-0.049000	0.13379|0.13379	0.412000|0.412000	0.27726|0.27726	ATG|TAT	.	.	.	none		0.378	EFHC2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056312.2	NM_025184	
SUV39H1	6839	hgsc.bcm.edu	37	X	48558807	48558807	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chrX:48558807A>G	ENST00000376687.3	+	3	681	c.491A>G	c.(490-492)aAt>aGt	p.N164S	SUV39H1_ENST00000453214.2_Intron|SUV39H1_ENST00000337852.6_Missense_Mutation_p.N175S|AF196970.3_ENST00000416061.1_RNA	NM_003173.2	NP_003164.1	O43463	SUV91_HUMAN	suppressor of variegation 3-9 homolog 1 (Drosophila)	164					cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chromatin organization (GO:0006325)|chromatin silencing at rDNA (GO:0000183)|histone H3-K9 dimethylation (GO:0036123)|histone H3-K9 trimethylation (GO:0036124)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin silencing complex (GO:0005677)|chromosome, centromeric region (GO:0000775)|condensed nuclear chromosome (GO:0000794)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|rDNA heterochromatin (GO:0033553)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|protein N-terminus binding (GO:0047485)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						GTGTACATCAATGAGTACCGT	0.632																																					p.N164S		Atlas-SNP	.											.	SUV39H1	36	.	0			c.A491G						PASS	.						62.0	47.0	52.0					X																	48558807		2203	4300	6503	SO:0001583	missense	6839	exon3			ACATCAATGAGTA	AF019968	CCDS14304.1, CCDS65252.1	Xp11.23	2011-07-01	2001-11-28		ENSG00000101945	ENSG00000101945		"""Chromatin-modifying enzymes / K-methyltransferases"""	11479	protein-coding gene	gene with protein product		300254	"""suppressor of variegation 3-9 (Drosophila) homolog 1"""	SUV39H		10202156	Standard	NM_001282166		Approved	KMT1A	uc004dkn.3	O43463	OTTHUMG00000022701	ENST00000376687.3:c.491A>G	chrX.hg19:g.48558807A>G	ENSP00000365877:p.Asn164Ser	93.0	0.0	.		81.0	76.0	.	NM_003173	B2R6E8|B4DST0|Q53G60|Q6FHK6	Missense_Mutation	SNP	ENST00000376687.3	hg19	CCDS14304.1	.	.	.	.	.	.	.	.	.	.	A	20.5	3.994484	0.74703	.	.	ENSG00000101945	ENST00000337852;ENST00000376687;ENST00000448548;ENST00000422496	D;D	0.89196	-2.48;-2.48	4.61	4.61	0.57282	Pre-SET zinc-binding sub-group (1);Pre-SET domain (1);	0.000000	0.85682	D	0.000000	D	0.88009	0.6322	L	0.46614	1.455	0.80722	D	1	P;P	0.42123	0.771;0.771	P;P	0.48488	0.475;0.579	D	0.86401	0.1742	10	0.38643	T	0.18	.	11.0625	0.47955	1.0:0.0:0.0:0.0	.	175;164	B4DST0;O43463	.;SUV91_HUMAN	S	175;164;162;22	ENSP00000337976:N175S;ENSP00000365877:N164S	ENSP00000337976:N175S	N	+	2	0	SUV39H1	48443751	1.000000	0.71417	0.993000	0.49108	0.987000	0.75469	9.297000	0.96120	1.505000	0.48720	0.409000	0.27619	AAT	.	.	.	none		0.632	SUV39H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058909.1	NM_003173	
LIMCH1	22998	hgsc.bcm.edu	37	4	41621302	41621303	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr4:41621302_41621303delGA	ENST00000313860.7	+	8	834_835	c.780_781delGA	c.(778-783)ccgaaafs	p.K261fs	LIMCH1_ENST00000509277.1_Frame_Shift_Del_p.K107fs|LIMCH1_ENST00000513024.1_Frame_Shift_Del_p.K102fs|LIMCH1_ENST00000396595.3_Frame_Shift_Del_p.K107fs|LIMCH1_ENST00000512820.1_Frame_Shift_Del_p.K261fs|LIMCH1_ENST00000511496.1_Frame_Shift_Del_p.K102fs|LIMCH1_ENST00000503057.1_Frame_Shift_Del_p.K102fs|LIMCH1_ENST00000514096.1_Frame_Shift_Del_p.K114fs|LIMCH1_ENST00000381753.4_Frame_Shift_Del_p.K107fs|LIMCH1_ENST00000512632.1_Frame_Shift_Del_p.K261fs|LIMCH1_ENST00000509454.1_Frame_Shift_Del_p.K109fs|LIMCH1_ENST00000508501.1_Frame_Shift_Del_p.K261fs|LIMCH1_ENST00000512946.1_Frame_Shift_Del_p.K261fs|LIMCH1_ENST00000509638.1_Frame_Shift_Del_p.K102fs	NM_014988.2	NP_055803.2	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1	261					actomyosin structure organization (GO:0031032)		zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(5)	41						ATGGTGAGCCGAAATCAGCAGT	0.53																																					p.260_260del		Atlas-Indel,Pindel	.											LIMCH1_ENST00000503057,NS,carcinoma,-1,2	LIMCH1	233	.	0			c.779_780del						PASS	.																																			SO:0001589	frameshift_variant	22998	exon8			.	AB029025	CCDS33977.1, CCDS47047.1, CCDS54763.1, CCDS54764.1, CCDS54765.1, CCDS75119.1, CCDS75121.1	4p13	2007-06-14		2008-01-09	ENSG00000064042	ENSG00000064042			29191	protein-coding gene	gene with protein product						10470851	Standard	XM_005248057		Approved	DKFZP686A01247, LIMCH1A, LMO7B	uc003gvz.4	Q9UPQ0	OTTHUMG00000160575	ENST00000313860.7:c.780_781delGA	chr4.hg19:g.41621302_41621303delGA	ENSP00000316891:p.Lys261fs	119.0	0.0	0		112.0	52.0	0.464286	NM_014988	A8MXC3|E9PHM7|Q503B5|Q5CZB1|Q5CZB6|Q5H9S8|Q68E07|Q6PJ44|Q7Z3G5|Q8N3S9|Q8N6M2	Frame_Shift_Del	DEL	ENST00000313860.7	hg19	CCDS33977.1																																																																																			.	.	.	none		0.530	LIMCH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361249.2	NM_014988	
KRT13	3860	hgsc.bcm.edu	37	17	39659323	39659323	+	Frame_Shift_Del	DEL	C	C	-			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr17:39659323delC	ENST00000246635.3	-	4	809	c.763delG	c.(763-765)gtcfs	p.V255fs	KRT13_ENST00000587544.1_Frame_Shift_Del_p.V255fs|AC019349.5_ENST00000411759.1_RNA|KRT13_ENST00000336861.3_Frame_Shift_Del_p.V255fs|KRT13_ENST00000587118.1_5'Flank	NM_153490.2	NP_705694	P13646	K1C13_HUMAN	keratin 13	255	Linker 12.|Rod.				cellular response to retinoic acid (GO:0071300)|cytoskeleton organization (GO:0007010)|response to radiation (GO:0009314)|tongue morphogenesis (GO:0043587)	extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	33		Breast(137;0.000286)				ACCTGGCCGACCACCTGGTTG	0.577																																					p.V255fs		Atlas-Indel,Pindel	.											.	KRT13	72	.	0			c.764delT						PASS	.						205.0	199.0	201.0					17																	39659323		2203	4300	6503	SO:0001589	frameshift_variant	3860	exon4			.		CCDS11396.1, CCDS11397.1	17q21.2	2013-06-20			ENSG00000171401	ENSG00000171401		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6415	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 13"", ""cytokeratin 13"""	148065				16831889	Standard	NM_153490		Approved	K13, CK13, MGC3781, MGC161462	uc002hwu.1	P13646	OTTHUMG00000133434	ENST00000246635.3:c.763delG	chr17.hg19:g.39659323delC	ENSP00000246635:p.Val255fs	77.0	0.0	0		93.0	23.0	0.247312	NM_002274	Q53G54|Q6AZK5|Q8N240	Frame_Shift_Del	DEL	ENST00000246635.3	hg19	CCDS11396.1																																																																																			.	.	.	none		0.577	KRT13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257297.1	NM_153490	
CP	1356	hgsc.bcm.edu	37	3	148930300	148930300	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr3:148930300delT	ENST00000264613.6	-	2	594	c.332delA	c.(331-333)aacfs	p.N111fs		NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	111	F5/8 type A 1.|Plastocyanin-like 1.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	AGAGGCAAGGTTTTTTAAGTG	0.388																																					p.N111fs		Atlas-Indel,Pindel	.											.	CP	112	.	0			c.333delC						PASS	.						118.0	120.0	119.0					3																	148930300		2203	4300	6503	SO:0001589	frameshift_variant	1356	exon2			.	M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.332delA	chr3.hg19:g.148930300delT	ENSP00000264613:p.Asn111fs	104.0	0.0	0		91.0	39.0	0.428571	NM_000096	Q14063|Q2PP18|Q9UKS4	Frame_Shift_Del	DEL	ENST00000264613.6	hg19	CCDS3141.1																																																																																			.	.	.	none		0.388	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317498.1	NM_000096	
TIGD6	81789	hgsc.bcm.edu	37	5	149375763	149375765	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	TCC	TCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr5:149375763_149375765delTCC	ENST00000296736.3	-	2	921_923	c.147_149delGGA	c.(145-150)aaggat>aat	p.49_50KD>N	TIGD6_ENST00000515406.2_In_Frame_Del_p.49_50KD>N	NM_030953.3	NP_112215.1	Q17RP2	TIGD6_HUMAN	tigger transposable element derived 6	49	HTH psq-type. {ECO:0000255|PROSITE- ProRule:PRU00320}.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|stomach(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TTTGGTGCGATCCTTTAAGAATG	0.443																																					p.50_50del		Atlas-Indel,Pindel	.											.	TIGD6	29	.	0			c.148_150del						PASS	.																																			SO:0001651	inframe_deletion	81789	exon2			.	AK056604	CCDS4301.1	5q33.1	2008-02-05			ENSG00000164296	ENSG00000164296			18332	protein-coding gene	gene with protein product						11230166	Standard	NM_030953		Approved	DKFZp761E2110	uc003lrj.3	Q17RP2	OTTHUMG00000130045	ENST00000296736.3:c.147_149delGGA	chr5.hg19:g.149375763_149375765delTCC	ENSP00000296736:p.Lys49_Asp50delinsAsn	110.0	0.0	0		95.0	33.0	0.347368	NM_001243253	B3KTZ8|Q96MQ4|Q9H0X7	In_Frame_Del	DEL	ENST00000296736.3	hg19	CCDS4301.1																																																																																			.	.	.	none		0.443	TIGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252324.1	NM_030953	
N4BP2	55728	hgsc.bcm.edu	37	4	40122134	40122134	+	Frame_Shift_Del	DEL	A	A	-			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr4:40122134delA	ENST00000261435.6	+	9	2819	c.2403delA	c.(2401-2403)acafs	p.T801fs		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	801					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						GTCAGAGGACAAAAAGGAACA	0.358																																					p.T801fs		Atlas-Indel,Pindel	.											.	N4BP2	166	.	0			c.2402delC						PASS	.						55.0	55.0	55.0					4																	40122134		2203	4300	6503	SO:0001589	frameshift_variant	55728	exon9			.	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.2403delA	chr4.hg19:g.40122134delA	ENSP00000261435:p.Thr801fs	229.0	0.0	0		184.0	71.0	0.38587	NM_018177	A0AVR3|Q9NVK2|Q9P2D4	Frame_Shift_Del	DEL	ENST00000261435.6	hg19	CCDS3457.1																																																																																			.	.	.	none		0.358	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177	
KDM5A	5927	hgsc.bcm.edu	37	12	427414	427417	+	Frame_Shift_Del	DEL	AAGT	AAGT	-	rs542998005		TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	AAGT	AAGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr12:427414_427417delAAGT	ENST00000399788.2	-	19	3114_3117	c.2752_2755delACTT	c.(2752-2757)actttgfs	p.TL918fs	KDM5A_ENST00000382815.4_Frame_Shift_Del_p.TL918fs	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	918					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						ATGACATCCAAAGTGACTTGTTGC	0.5			T	NUP98	AML																																p.918_919del		Atlas-Indel,Pindel	.		Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	.	KDM5A	307	.	0			c.2753_2756del						PASS	.																																			SO:0001589	frameshift_variant	5927	exon19			.		CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.2752_2755delACTT	chr12.hg19:g.427414_427417delAAGT	ENSP00000382688:p.Thr918fs	107.0	0.0	0		85.0	27.0	0.317647	NM_001042603	A8MV76|Q4LE72|Q86XZ1	Frame_Shift_Del	DEL	ENST00000399788.2	hg19	CCDS41736.1																																																																																			.	.	.	none		0.500	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397812.1	NM_005056	
TBC1D22A	25771	hgsc.bcm.edu	37	22	47287237	47287248	+	In_Frame_Del	DEL	GAGCACTATTAC	GAGCACTATTAC	-	rs117270140	byFrequency	TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	GAGCACTATTAC	GAGCACTATTAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr22:47287237_47287248delGAGCACTATTAC	ENST00000337137.4	+	6	950_961	c.784_795delGAGCACTATTAC	c.(784-795)gagcactattacdel	p.EHYY262del	TBC1D22A_ENST00000406733.1_In_Frame_Del_p.EHYY215del|TBC1D22A_ENST00000355704.3_In_Frame_Del_p.EHYY184del|TBC1D22A_ENST00000407381.3_In_Frame_Del_p.EHYY203del|TBC1D22A_ENST00000380995.1_In_Frame_Del_p.EHYY215del	NM_001284304.1|NM_001284305.1|NM_014346.2	NP_001271233.1|NP_001271234.1|NP_055161.1	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	262	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						protein homodimerization activity (GO:0042803)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(3)|large_intestine(10)|lung(5)|ovary(2)|prostate(1)	22		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		TGCATTTATTGAGCACTATTACGATTCTAGGA	0.41																																					p.261_265del		Atlas-Indel,Pindel	.											.	TBC1D22A	54	.	0			c.783_794del						PASS	.																																			SO:0001651	inframe_deletion	25771	exon6			.	AK125705	CCDS14078.1, CCDS63511.1, CCDS63512.1, CCDS74877.1	22q13	2008-01-22	2005-01-05	2005-01-05	ENSG00000054611	ENSG00000054611			1309	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 4"""	C22orf4			Standard	XM_005261496		Approved		uc003bib.3	Q8WUA7	OTTHUMG00000150332	ENST00000337137.4:c.784_795delGAGCACTATTAC	chr22.hg19:g.47287237_47287248delGAGCACTATTAC	ENSP00000336724:p.Glu262_Tyr265del	278.0	0.0	0		176.0	31.0	0.176136	NM_014346	B0QYI2|B0QYI3|B9A6M3|Q5TE47|Q6ZUH2|Q92680|Q9BVD6|Q9UGG0|Q9UGT2|Q9UGU6|Q9UH25|Q9Y4W5	In_Frame_Del	DEL	ENST00000337137.4	hg19	CCDS14078.1																																																																																			.	.	.	none		0.410	TBC1D22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317600.3	NM_014346	
CCDC149	91050	hgsc.bcm.edu	37	4	24878300	24878300	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr4:24878300delT	ENST00000389609.4	-	3	226	c.83delA	c.(82-84)aagfs	p.K28fs	CCDC149_ENST00000428116.2_5'UTR|CCDC149_ENST00000504487.1_Frame_Shift_Del_p.K28fs|CCDC149_ENST00000502801.1_Frame_Shift_Del_p.K28fs	NM_173463.4	NP_775734.2	Q6ZUS6	CC149_HUMAN	coiled-coil domain containing 149	108										cervix(1)|endometrium(1)|large_intestine(2)|lung(3)	7		Breast(46;0.173)				ACTCTCCAGCTTCCTCTTACA	0.507																																					p.K28fs		Atlas-Indel,Pindel	.											.	CCDC149	41	.	0			c.84delG						PASS	.						107.0	88.0	94.0					4																	24878300		692	1591	2283	SO:0001589	frameshift_variant	91050	exon3			.		CCDS33967.1, CCDS47036.1, CCDS33967.2	4p15.2	2008-03-03				ENSG00000181982			25405	protein-coding gene	gene with protein product						17457313	Standard	NM_173463		Approved	DKFZp761B107	uc003grc.3	Q6ZUS6		ENST00000389609.4:c.83delA	chr4.hg19:g.24878300delT	ENSP00000374260:p.Lys28fs	82.0	0.0	0		55.0	18.0	0.327273	NM_173463	A6NJE7|B4DK90|B4DZG3|G5EA04|Q6NW41|Q8N3K8	Frame_Shift_Del	DEL	ENST00000389609.4	hg19	CCDS33967.2																																																																																			.	.	.	none		0.507	CCDC149-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000360157.1	NM_173463	
SNRK	54861	hgsc.bcm.edu	37	3	43389082	43389082	+	Frame_Shift_Del	DEL	G	G	-			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr3:43389082delG	ENST00000296088.7	+	7	1635	c.1331delG	c.(1330-1332)aggfs	p.R444fs	SNRK-AS1_ENST00000422681.1_RNA|RP11-188P20.3_ENST00000607513.1_RNA|SNRK_ENST00000429705.2_Frame_Shift_Del_p.R444fs|SNRK_ENST00000437827.1_Frame_Shift_Del_p.R238fs|SNRK_ENST00000454177.1_Frame_Shift_Del_p.R444fs	NM_017719.4	NP_060189.3			SNF related kinase											breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(5)|prostate(1)|skin(2)|stomach(1)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0636)|Kidney(284;0.0792)		TGTCTGTTCAGGGTGGAAGAA	0.542																																					p.R444fs		Atlas-Indel,Pindel	.											.	SNRK	118	.	0			c.1330delA						PASS	.						103.0	111.0	108.0					3																	43389082		2019	4191	6210	SO:0001589	frameshift_variant	54861	exon6			.	D43636	CCDS43075.1	3p22.1	2005-08-09			ENSG00000163788	ENSG00000163788			30598	protein-coding gene	gene with protein product		612760				8654423, 7788527	Standard	NM_017719		Approved	FLJ20224, HSNFRK, KIAA0096	uc003cmt.4	Q9NRH2	OTTHUMG00000156491	ENST00000296088.7:c.1331delG	chr3.hg19:g.43389082delG	ENSP00000296088:p.Arg444fs	85.0	0.0	0		83.0	44.0	0.53012	NM_001100594		Frame_Shift_Del	DEL	ENST00000296088.7	hg19	CCDS43075.1																																																																																			.	.	.	none		0.542	SNRK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344325.1	NM_017719	
WFDC6	140870	hgsc.bcm.edu	37	20	44163124	44163139	+	Frame_Shift_Del	DEL	ATGGTATAAAGTAAGG	ATGGTATAAAGTAAGG	-	rs181120845		TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	ATGGTATAAAGTAAGG	ATGGTATAAAGTAAGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr20:44163124_44163139delATGGTATAAAGTAAGG	ENST00000372670.3	-	3	315_330	c.228_243delCCTTACTTTATACCAT	c.(226-243)agccttactttataccatfs	p.SLTLYH76fs	WFDC6_ENST00000600168.1_Frame_Shift_Del_p.ALLYTI134fs	NM_080827.1	NP_543017.1	Q9BQY6	WFDC6_HUMAN	WAP four-disulfide core domain 6	76	BPTI/Kunitz inhibitor. {ECO:0000255|PROSITE-ProRule:PRU00031}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|kidney(1)|large_intestine(2)|lung(2)	6		Myeloproliferative disorder(115;0.0122)				GCTCCTCCTTATGGTATAAAGTAAGGCTGACCTGTG	0.477																																					p.77_82del	Ovarian(123;591 1661 9833 14622 45877)	Atlas-Indel,Pindel	.											.	WFDC6	13	.	0			c.229_244del						PASS	.																																			SO:0001589	frameshift_variant	140870	exon3			.	AL031663	CCDS13358.1	20q13.11	2013-01-21	2003-02-21	2003-02-21	ENSG00000243543	ENSG00000243543		"""WAP four-disulfide core domain containing"""	16164	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 171"""	C20orf171		12206714	Standard	NM_080827		Approved	dJ461P17.11, WAP6		Q9BQY6	OTTHUMG00000046354	ENST00000372670.3:c.228_243delCCTTACTTTATACCAT	chr20.hg19:g.44163124_44163139delATGGTATAAAGTAAGG	ENSP00000361755:p.Ser76fs	102.0	0.0	0		75.0	27.0	0.36	NM_080827	Q3MJ23|Q5JYQ4|Q8NFV6	Frame_Shift_Del	DEL	ENST00000372670.3	hg19	CCDS13358.1																																																																																			.	.	.	none		0.477	WFDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000107008.2		
C6orf222	389384	hgsc.bcm.edu	37	6	36298147	36298148	+	Frame_Shift_Ins	INS	-	-	A			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr6:36298147_36298148insA	ENST00000437635.2	-	2	497_498	c.320_321insT	c.(319-321)ttcfs	p.F107fs		NM_001010903.4	NP_001010903.3	P0C671	CF222_HUMAN	chromosome 6 open reading frame 222	107										breast(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(4)|urinary_tract(4)	26						CCGTCCTCACGAAGAAGTTCAG	0.634																																					p.F107fs		Atlas-INDEL	.											C6orf222,NS,carcinoma,0,1	C6orf222	72	.	0			c.321_322insT						PASS	.																																			SO:0001589	frameshift_variant	389384	exon2			.		CCDS34439.1	6p21.31	2012-02-22			ENSG00000189325	ENSG00000189325			33769	protein-coding gene	gene with protein product							Standard	NM_001010903		Approved	DKFZp779B1540	uc003oly.3	P0C671	OTTHUMG00000014591	ENST00000437635.2:c.321dupT	chr6.hg19:g.36298149_36298149dupA	ENSP00000418983:p.Phe107fs	48.0	0.0	0		39.0	15.0	0.384615	NM_001010903	B2RTY8	Frame_Shift_Ins	INS	ENST00000437635.2	hg19	CCDS34439.1																																																																																			.	.	.	none		0.634	C6orf222-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040338.2	NM_001010903	
POM121L2	94026	hgsc.bcm.edu	37	6	27278778	27278779	+	Frame_Shift_Del	DEL	GG	GG	-	rs386469230	byFrequency	TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr6:27278778_27278779delGG	ENST00000444565.1	-	1	1170_1171	c.1171_1172delCC	c.(1171-1173)cctfs	p.P391fs	POM121L2_ENST00000377451.2_Intron	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	391										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						TTCTGAAGAAGGCAGAGCAAGA	0.48																																					p.391_391del		Atlas-Indel,Pindel	.											.	POM121L2	61	.	0			c.1172_1173del						PASS	.																																			SO:0001589	frameshift_variant	94026	exon1			.	AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.1171_1172delCC	chr6.hg19:g.27278778_27278779delGG	ENSP00000392726:p.Pro391fs	121.0	0.0	0		101.0	38.0	0.376238	NM_033482	C9J1I7	Frame_Shift_Del	DEL	ENST00000444565.1	hg19	CCDS59497.1																																																																																			.	.	.	none		0.480	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040143.2	NM_033482	
LPHN3	23284	hgsc.bcm.edu	37	4	62598714	62598715	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-UZ-A9PR-01A-11D-A42J-10	TCGA-UZ-A9PR-10A-01D-A42M-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	22f04597-4f4f-47c4-9d69-6b3b3f20701d	f568a26d-8461-430f-82d6-b31750f9addc	g.chr4:62598714_62598715delGT	ENST00000514591.1	+	7	966_967	c.637_638delGT	c.(637-639)gtgfs	p.V213fs	LPHN3_ENST00000512091.2_Frame_Shift_Del_p.V213fs|LPHN3_ENST00000509896.1_Frame_Shift_Del_p.V281fs|LPHN3_ENST00000506720.1_Frame_Shift_Del_p.V281fs|LPHN3_ENST00000504896.1_Frame_Shift_Del_p.V213fs|LPHN3_ENST00000514996.1_Frame_Shift_Del_p.V213fs|LPHN3_ENST00000545650.1_Frame_Shift_Del_p.V213fs|LPHN3_ENST00000506746.1_Frame_Shift_Del_p.V281fs|LPHN3_ENST00000508946.1_Frame_Shift_Del_p.V213fs|LPHN3_ENST00000514157.1_Frame_Shift_Del_p.V213fs|LPHN3_ENST00000507164.1_Frame_Shift_Del_p.V281fs|LPHN3_ENST00000507625.1_Frame_Shift_Del_p.V281fs|LPHN3_ENST00000511324.1_Frame_Shift_Del_p.V281fs|LPHN3_ENST00000508693.1_Frame_Shift_Del_p.V281fs|LPHN3_ENST00000506700.1_Frame_Shift_Del_p.V213fs			Q9HAR2	LPHN3_HUMAN	latrophilin 3	213	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						AGGATTTGTAGTGTATGATGGA	0.441																																					p.212_213del		Atlas-Indel,Pindel	.											.	LPHN3	800	.	0			c.636_637del						PASS	.																																			SO:0001589	frameshift_variant	23284	exon5			.	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.637_638delGT	chr4.hg19:g.62598716_62598717delGT	ENSP00000422533:p.Val213fs	107.0	0.0	0		98.0	45.0	0.459184	NM_015236	E9PE04|O94867|Q9NWK5	Frame_Shift_Del	DEL	ENST00000514591.1	hg19	CCDS54768.1																																																																																			.	.	.	none		0.441	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
