#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
C1orf86	199990	hgsc.bcm.edu	37	1	2125123	2125123	+	Missense_Mutation	SNP	G	G	T	rs200185087	byFrequency	TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr1:2125123G>T	ENST00000378546.4	-	3	449	c.425C>A	c.(424-426)gCg>gAg	p.A142E	C1orf86_ENST00000400919.3_5'UTR|C1orf86_ENST00000487186.1_5'UTR|C1orf86_ENST00000378545.3_Missense_Mutation_p.A245E	NM_182533.2	NP_872339	Q6NZ36	FAP20_HUMAN	chromosome 1 open reading frame 86	142					cellular response to DNA damage stimulus (GO:0006974)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	cell junction (GO:0030054)|chromosome (GO:0005694)|Fanconi anaemia nuclear complex (GO:0043240)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|metal ion binding (GO:0046872)|polyubiquitin binding (GO:0031593)|ubiquitin binding (GO:0043130)			central_nervous_system(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4	all_cancers(77;0.000134)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.09e-37)|OV - Ovarian serous cystadenocarcinoma(86;1.5e-23)|GBM - Glioblastoma multiforme(42;1.61e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00437)|STAD - Stomach adenocarcinoma(132;0.0134)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		GCGCAGGGCCGCGGCACCCTC	0.711																																					p.A142E		Atlas-SNP	.											.	C1orf86	20	.	0			c.C425A						PASS	.						17.0	23.0	21.0					1																	2125123		2043	4103	6146	SO:0001583	missense	199990	exon3			AGGGCCGCGGCAC	AK126870	CCDS38.2, CCDS57965.1, CCDS72686.1, CCDS72687.1	1p36.33	2013-05-22			ENSG00000162585	ENSG00000162585			26428	protein-coding gene	gene with protein product		615183				14702039	Standard	NM_182533		Approved	FLJ31031, FAAP20	uc031pkt.1	Q6NZ36	OTTHUMG00000001404	ENST00000378546.4:c.425C>A	chr1.hg19:g.2125123G>T	ENSP00000367808:p.Ala142Glu	88.0	0.0	.		102.0	42.0	.	NM_001256946	A6PW39|A6PW40|A6PW41|A8MQT6|F2Z2L4|Q6ZT64|Q71M24|Q96ND7	Missense_Mutation	SNP	ENST00000378546.4	hg19	CCDS38.2	.	.	.	.	.	.	.	.	.	.	G	12.57	1.978697	0.34942	.	.	ENSG00000162585	ENST00000400918;ENST00000378546;ENST00000378545	T;T;T	0.44881	0.92;0.95;0.91	4.05	-5.63	0.02474	.	1.543580	0.04329	N	0.352089	T	0.22205	0.0535	.	.	.	0.09310	N	1	B	0.11235	0.004	B	0.12837	0.008	T	0.11446	-1.0587	9	0.33141	T	0.24	6.0E-4	2.3251	0.04221	0.5065:0.2024:0.172:0.1192	.	142	Q6NZ36	CA086_HUMAN	E	142;142;245	ENSP00000383709:A142E;ENSP00000367808:A142E;ENSP00000367807:A245E	ENSP00000367807:A245E	A	-	2	0	C1orf86	2114983	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.396000	0.07278	-0.914000	0.03827	-0.367000	0.07326	GCG	.	.	.	alt		0.711	C1orf86-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316541.1	NM_182533	
C1orf127	148345	hgsc.bcm.edu	37	1	11009850	11009850	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr1:11009850G>A	ENST00000377008.4	-	10	1066	c.620C>T	c.(619-621)gCc>gTc	p.A207V	C1orf127_ENST00000377004.4_Missense_Mutation_p.A374V			Q8N9H9	CA127_HUMAN	chromosome 1 open reading frame 127	207										NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(5)	32	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		AGCAGTTGAGGCAGGCGACTC	0.602																																					p.A374V		Atlas-SNP	.											.	C1orf127	134	.	0			c.C1121T						PASS	.						50.0	48.0	49.0					1																	11009850		2197	4291	6488	SO:0001583	missense	148345	exon11			GTTGAGGCAGGCG	AK094437	CCDS53267.1	1p36.22	2008-02-05			ENSG00000175262	ENSG00000175262			26730	protein-coding gene	gene with protein product						14702039	Standard	NM_001170754		Approved	FLJ37118	uc010oao.2	Q8N9H9	OTTHUMG00000002032	ENST00000377008.4:c.620C>T	chr1.hg19:g.11009850G>A	ENSP00000366207:p.Ala207Val	96.0	0.0	.		102.0	40.0	.	NM_001170754	A0AVG8|A6NKM7|Q5VXJ2	Missense_Mutation	SNP	ENST00000377008.4	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.97|18.97	3.735300|3.735300	0.69189|0.69189	.|.	.|.	ENSG00000175262|ENSG00000175262	ENST00000377004;ENST00000377008|ENST00000418570;ENST00000520253	T;T|.	0.25579|.	1.79;1.79|.	4.33|4.33	-0.909|-0.909	0.10514|0.10514	.|.	1.285140|.	0.05693|.	N|.	0.592657|.	T|T	0.21590|0.21590	0.0520|0.0520	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	P;P;P|.	0.35745|.	0.518;0.518;0.518|.	B;B;B|.	0.36464|.	0.225;0.225;0.225|.	T|T	0.30794|0.30794	-0.9966|-0.9966	10|5	0.16896|.	T|.	0.51|.	-0.5709|-0.5709	7.1323|7.1323	0.25508|0.25508	0.5857:0.0:0.4143:0.0|0.5857:0.0:0.4143:0.0	.|.	225;225;207|.	B7ZLG7;Q8N9H9-2;Q8N9H9|.	.;.;CA127_HUMAN|.	V|S	374;207|209;352	ENSP00000366203:A374V;ENSP00000366207:A207V|.	ENSP00000366203:A374V|.	A|P	-|-	2|1	0|0	C1orf127|C1orf127	10932437|10932437	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.790000|0.790000	0.44656|0.44656	0.275000|0.275000	0.18698|0.18698	-0.069000|-0.069000	0.12931|0.12931	0.467000|0.467000	0.42956|0.42956	GCC|CCT	.	.	.	none		0.602	C1orf127-202	KNOWN	basic	protein_coding	protein_coding		NM_173507	
PRDM2	7799	hgsc.bcm.edu	37	1	14105779	14105779	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr1:14105779A>G	ENST00000235372.7	+	8	2345	c.1489A>G	c.(1489-1491)Aat>Gat	p.N497D	PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000343137.4_Missense_Mutation_p.N296D|PRDM2_ENST00000311066.5_Missense_Mutation_p.N497D|PRDM2_ENST00000413440.1_Missense_Mutation_p.N296D|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000503842.1_Intron	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	497					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		AACTCATACTAATATGAGACG	0.438																																					p.N497D		Atlas-SNP	.											.	PRDM2	147	.	0			c.A1489G						PASS	.						40.0	38.0	39.0					1																	14105779		2203	4300	6503	SO:0001583	missense	7799	exon8			CATACTAATATGA	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.1489A>G	chr1.hg19:g.14105779A>G	ENSP00000235372:p.Asn497Asp	273.0	0.0	.		299.0	12.0	.	NM_015866	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	hg19	CCDS150.1	.	.	.	.	.	.	.	.	.	.	A	15.30	2.791949	0.50102	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93	5.62	5.62	0.85841	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	T	0.80099	0.4561	L	0.32530	0.975	0.53688	D	0.999976	D;D;D;D	0.89917	0.999;1.0;0.989;0.999	D;D;D;D	0.91635	0.998;0.999;0.969;0.997	T	0.81904	-0.0719	10	0.62326	D	0.03	.	14.651	0.68797	1.0:0.0:0.0:0.0	.	497;355;497;497	A8MW16;Q5THJ0;Q13029;Q13029-2	.;.;PRDM2_HUMAN;.	D	497;497;497;296;296	ENSP00000235372:N497D;ENSP00000312352:N497D;ENSP00000411103:N296D;ENSP00000341621:N296D	ENSP00000235372:N497D	N	+	1	0	PRDM2	13978366	1.000000	0.71417	0.065000	0.19835	0.710000	0.40934	8.962000	0.93254	2.129000	0.65627	0.533000	0.62120	AAT	.	.	.	none		0.438	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
OTUD3	23252	hgsc.bcm.edu	37	1	20220906	20220906	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr1:20220906T>C	ENST00000375120.3	+	3	417	c.416T>C	c.(415-417)aTt>aCt	p.I139T	OTUD3_ENST00000466697.1_3'UTR	NM_015207.1	NP_056022.1	Q5T2D3	OTUD3_HUMAN	OTU deubiquitinase 3	139	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				protein K11-linked deubiquitination (GO:0035871)|protein K6-linked deubiquitination (GO:0044313)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|kidney(2)|large_intestine(4)|lung(1)|skin(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000276)|Lung NSC(340;0.000338)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.12e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.000408)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		AATGATGCAATTGTAGCCTTT	0.383																																					p.I139T		Atlas-SNP	.											.	OTUD3	25	.	0			c.T416C						PASS	.						158.0	148.0	151.0					1																	20220906		1883	4117	6000	SO:0001583	missense	23252	exon3			ATGCAATTGTAGC	AB007928	CCDS41279.1	1p36.13	2014-02-24	2014-02-24		ENSG00000169914	ENSG00000169914		"""OTU domain containing"""	29038	protein-coding gene	gene with protein product		611758	"""OTU domain containing 3"""			9455484, 23827681	Standard	NM_015207		Approved	KIAA0459, DUBA4	uc001bcs.4	Q5T2D3	OTTHUMG00000002696	ENST00000375120.3:c.416T>C	chr1.hg19:g.20220906T>C	ENSP00000364261:p.Ile139Thr	69.0	0.0	.		73.0	35.0	.	NM_015207	O75047	Missense_Mutation	SNP	ENST00000375120.3	hg19	CCDS41279.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.652050	0.88056	.	.	ENSG00000169914	ENST00000375120	T	0.55588	0.51	5.92	5.92	0.95590	Ovarian tumour, otubain (2);	0.000000	0.85682	D	0.000000	T	0.78923	0.4360	M	0.92604	3.325	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.84259	0.0482	10	0.87932	D	0	.	15.1888	0.73025	0.0:0.0:0.0:1.0	.	139	Q5T2D3	OTUD3_HUMAN	T	139	ENSP00000364261:I139T	ENSP00000364261:I139T	I	+	2	0	OTUD3	20093493	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.019000	0.76412	2.263000	0.75096	0.533000	0.62120	ATT	.	.	.	none		0.383	OTUD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007655.1		
OTUD3	23252	hgsc.bcm.edu	37	1	20220910	20220910	+	Silent	SNP	A	A	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr1:20220910A>G	ENST00000375120.3	+	3	421	c.420A>G	c.(418-420)gtA>gtG	p.V140V	OTUD3_ENST00000466697.1_3'UTR	NM_015207.1	NP_056022.1	Q5T2D3	OTUD3_HUMAN	OTU deubiquitinase 3	140	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				protein K11-linked deubiquitination (GO:0035871)|protein K6-linked deubiquitination (GO:0044313)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|kidney(2)|large_intestine(4)|lung(1)|skin(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000276)|Lung NSC(340;0.000338)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.12e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.000408)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		ATGCAATTGTAGCCTTTGCAA	0.378																																					p.V140V		Atlas-SNP	.											.	OTUD3	25	.	0			c.A420G						PASS	.						156.0	148.0	150.0					1																	20220910		1879	4117	5996	SO:0001819	synonymous_variant	23252	exon3			AATTGTAGCCTTT	AB007928	CCDS41279.1	1p36.13	2014-02-24	2014-02-24		ENSG00000169914	ENSG00000169914		"""OTU domain containing"""	29038	protein-coding gene	gene with protein product		611758	"""OTU domain containing 3"""			9455484, 23827681	Standard	NM_015207		Approved	KIAA0459, DUBA4	uc001bcs.4	Q5T2D3	OTTHUMG00000002696	ENST00000375120.3:c.420A>G	chr1.hg19:g.20220910A>G		72.0	0.0	.		75.0	37.0	.	NM_015207	O75047	Silent	SNP	ENST00000375120.3	hg19	CCDS41279.1																																																																																			.	.	.	none		0.378	OTUD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007655.1		
USP48	84196	hgsc.bcm.edu	37	1	22041910	22041910	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr1:22041910A>T	ENST00000308271.9	-	15	2583	c.1935T>A	c.(1933-1935)aaT>aaA	p.N645K	USP48_ENST00000529637.1_Missense_Mutation_p.N644K|USP48_ENST00000374732.3_Missense_Mutation_p.N183K|USP48_ENST00000400301.1_Missense_Mutation_p.N645K	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	645	DUSP 2. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		CTTCATTAAAATTTAATTCCT	0.303																																					p.N645K		Atlas-SNP	.											.	USP48	91	.	0			c.T1935A						PASS	.						71.0	74.0	73.0					1																	22041910		2202	4298	6500	SO:0001583	missense	84196	exon15			ATTAAAATTTAAT	AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.1935T>A	chr1.hg19:g.22041910A>T	ENSP00000309262:p.Asn645Lys	502.0	1.0	.		512.0	200.0	.	NM_032236	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000308271.9	hg19	CCDS30623.1	.	.	.	.	.	.	.	.	.	.	A	13.67	2.307579	0.40795	.	.	ENSG00000090686	ENST00000400301;ENST00000308271;ENST00000374732;ENST00000529637	T;T;T;T	0.40756	1.02;1.02;1.02;1.17	5.17	4.04	0.47022	Peptidase C19, ubiquitin-specific peptidase, DUSP domain (1);	0.360545	0.33161	N	0.005218	T	0.29783	0.0744	L	0.53249	1.67	0.42183	D	0.991695	B;B;B;B;B	0.23249	0.059;0.006;0.01;0.006;0.082	B;B;B;B;B	0.21708	0.02;0.01;0.022;0.01;0.036	T	0.13202	-1.0518	10	0.02654	T	1	.	6.0987	0.20035	0.7524:0.1629:0.0847:0.0	.	644;645;645;645;183	B7ZKS7;B7ZKS3;Q86UV5-2;Q86UV5;Q86UV5-5	.;.;.;UBP48_HUMAN;.	K	645;645;183;644	ENSP00000383157:N645K;ENSP00000309262:N645K;ENSP00000363864:N183K;ENSP00000431949:N644K	ENSP00000309262:N645K	N	-	3	2	USP48	21914497	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.387000	0.34430	0.820000	0.34516	0.533000	0.62120	AAT	.	.	.	none		0.303	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236	
SZT2	23334	hgsc.bcm.edu	37	1	43906920	43906920	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr1:43906920A>T	ENST00000562955.1	+	52	7209	c.7209A>T	c.(7207-7209)aaA>aaT	p.K2403N	SZT2_ENST00000372442.1_Missense_Mutation_p.K1561N	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	2460					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						GTTCCCCCAAAACAACTGATG	0.572																																					p.K2403N		Atlas-SNP	.											.	SZT2	383	.	0			c.A7209T						PASS	.						119.0	129.0	125.0					1																	43906920		2203	4300	6503	SO:0001583	missense	23334	exon52			CCCCAAAACAACT	AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.7209A>T	chr1.hg19:g.43906920A>T	ENSP00000457168:p.Lys2403Asn	114.0	0.0	.		112.0	54.0	.	NM_015284	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	hg19	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	A	18.79	3.698115	0.68386	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.41	4.28	0.50868	.	0.106321	0.64402	D	0.000004	T	0.52058	0.1711	L	0.46157	1.445	0.27018	N	0.964522	D	0.89917	1.0	D	0.91635	0.999	T	0.42430	-0.9452	9	0.62326	D	0.03	.	6.8705	0.24119	0.8287:0.0:0.1713:0.0	.	2403	Q5T011-5	.	N	1561	.	ENSP00000361519:K1561N	K	+	3	2	SZT2	43679507	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.179000	0.42528	2.186000	0.69663	0.482000	0.46254	AAA	.	.	.	none		0.572	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3	NM_015284	
BTBD19	149478	hgsc.bcm.edu	37	1	45278689	45278689	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr1:45278689G>A	ENST00000450269.1	+	5	775	c.436G>A	c.(436-438)Ggg>Agg	p.G146R	BTBD19_ENST00000453418.1_3'UTR|BTBD19_ENST00000409335.2_Missense_Mutation_p.G108R	NM_001136537.1	NP_001130009.1	C9JJ37	BTBDJ_HUMAN	BTB (POZ) domain containing 19	146	BACK.									breast(1)|endometrium(1)	2						CTTTGGCCTGGGGCAGCTGCA	0.622																																					p.G146R		Atlas-SNP	.											.	BTBD19	16	.	0			c.G436A						PASS	.						80.0	71.0	74.0					1																	45278689		692	1591	2283	SO:0001583	missense	149478	exon5			GGCCTGGGGCAGC			1p34.1	2013-01-08			ENSG00000222009	ENSG00000222009		"""BTB/POZ domain containing"""	27145	protein-coding gene	gene with protein product							Standard	NM_001136537		Approved		uc010ole.1	C9JJ37	OTTHUMG00000008493	ENST00000450269.1:c.436G>A	chr1.hg19:g.45278689G>A	ENSP00000395461:p.Gly146Arg	67.0	0.0	.		102.0	39.0	.	NM_001136537	B4E384|B7ZC36|B7ZC37	Missense_Mutation	SNP	ENST00000450269.1	hg19		.	.	.	.	.	.	.	.	.	.	G	9.729	1.161802	0.21538	.	.	ENSG00000222009	ENST00000450269;ENST00000409335	T;T	0.70045	-0.26;-0.45	4.86	1.68	0.24146	BTB/Kelch-associated (2);	.	.	.	.	T	0.37293	0.0998	N	0.02539	-0.55	0.09310	N	0.999994	B	0.11235	0.004	B	0.08055	0.003	T	0.23368	-1.0190	9	0.28530	T	0.3	-7.578	8.0618	0.30638	0.0945:0.3271:0.5784:0.0	.	146	C9JJ37	BTBDJ_HUMAN	R	146;108	ENSP00000395461:G146R;ENSP00000386506:G108R	ENSP00000386506:G108R	G	+	1	0	BTBD19	45051276	0.954000	0.32549	0.654000	0.29608	0.985000	0.73830	0.718000	0.25866	1.007000	0.39238	0.462000	0.41574	GGG	.	.	.	none		0.622	BTBD19-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001136537	
RPRD2	23248	hgsc.bcm.edu	37	1	150337371	150337371	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr1:150337371C>A	ENST00000369068.4	+	1	185	c.181C>A	c.(181-183)Cat>Aat	p.H61N	RPRD2_ENST00000539519.1_Missense_Mutation_p.H61N|RPRD2_ENST00000492220.1_Intron|RPRD2_ENST00000369067.3_Missense_Mutation_p.H61N|RPRD2_ENST00000401000.4_Missense_Mutation_p.H61N	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	61	CID. {ECO:0000255|PROSITE- ProRule:PRU00724}.					DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						TATCGTCTATCATTGGATGAA	0.483																																					p.H61N		Atlas-SNP	.											.	RPRD2	189	.	0			c.C181A						PASS	.						111.0	108.0	109.0					1																	150337371		1960	4155	6115	SO:0001583	missense	23248	exon1			GTCTATCATTGGA	BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.181C>A	chr1.hg19:g.150337371C>A	ENSP00000358064:p.His61Asn	129.0	0.0	.		136.0	46.0	.	NM_015203	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Missense_Mutation	SNP	ENST00000369068.4	hg19	CCDS44216.1	.	.	.	.	.	.	.	.	.	.	C	17.41	3.383325	0.61845	.	.	ENSG00000163125	ENST00000401000;ENST00000539519;ENST00000369067;ENST00000369068	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	4.42	4.42	0.53409	ENTH/VHS (2);RNA polymerase II, large subunit, CTD (2);	0.175243	0.50627	D	0.000104	T	0.37461	0.1004	L	0.44542	1.39	0.43095	D	0.994776	D;D;D	0.56968	0.967;0.967;0.978	P;P;P	0.53649	0.637;0.537;0.731	T	0.04900	-1.0919	10	0.28530	T	0.3	-9.375	17.1984	0.86900	0.0:1.0:0.0:0.0	.	61;61;61	B4E2Q6;Q5VT52;Q5VT52-3	.;RPRD2_HUMAN;.	N	61	ENSP00000383785:H61N;ENSP00000445482:H61N;ENSP00000358063:H61N;ENSP00000358064:H61N	ENSP00000358063:H61N	H	+	1	0	RPRD2	148603995	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	2.209000	0.42806	2.449000	0.82847	0.655000	0.94253	CAT	.	.	.	none		0.483	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000035844.1	NM_015203	
CACNA1E	777	hgsc.bcm.edu	37	1	181765855	181765855	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr1:181765855A>C	ENST00000367573.2	+	47	6260	c.6260A>C	c.(6259-6261)aAa>aCa	p.K2087T	CACNA1E_ENST00000367567.4_Missense_Mutation_p.K1651T|CACNA1E_ENST00000357570.5_Missense_Mutation_p.K2038T|CACNA1E_ENST00000526775.1_Missense_Mutation_p.K2025T|CACNA1E_ENST00000367570.1_Missense_Mutation_p.K2044T|CACNA1E_ENST00000360108.3_Missense_Mutation_p.K2068T|CACNA1E_ENST00000358338.5_Missense_Mutation_p.K1976T	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2087					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GGACGATCAAAAGAGCGAAAG	0.572																																					p.K2087T		Atlas-SNP	.											.	CACNA1E	778	.	0			c.A6260C						PASS	.						48.0	51.0	50.0					1																	181765855		1979	4168	6147	SO:0001583	missense	777	exon47			GATCAAAAGAGCG	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6260A>C	chr1.hg19:g.181765855A>C	ENSP00000356545:p.Lys2087Thr	115.0	0.0	.		128.0	47.0	.	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	hg19	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.447471	0.84101	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.97328	-4.25;-4.25;-4.17;-4.24;-4.34;-4.17;-4.17	5.91	5.91	0.95273	.	0.676128	0.14977	N	0.287490	D	0.97666	0.9235	L	0.42245	1.32	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.937;0.996	D	0.97817	1.0254	10	0.72032	D	0.01	.	16.0098	0.80391	1.0:0.0:0.0:0.0	.	2025;2044	Q15878-2;Q15878-3	.;.	T	2044;2025;2038;1976;1651;2068;2087	ENSP00000356542:K2044T;ENSP00000434814:K2025T;ENSP00000350183:K2038T;ENSP00000351101:K1976T;ENSP00000356539:K1651T;ENSP00000353222:K2068T;ENSP00000356545:K2087T	ENSP00000350183:K2038T	K	+	2	0	CACNA1E	180032478	1.000000	0.71417	0.994000	0.49952	0.984000	0.73092	6.736000	0.74811	2.254000	0.74563	0.533000	0.62120	AAA	.	.	.	none		0.572	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
USH2A	7399	hgsc.bcm.edu	37	1	215853630	215853630	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr1:215853630A>C	ENST00000307340.3	-	62	12541	c.12155T>G	c.(12154-12156)aTt>aGt	p.I4052S	USH2A_ENST00000366943.2_Missense_Mutation_p.I4052S	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4052	Fibronectin type-III 25. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGGGCTTAAAATTTCTCCTGC	0.438										HNSCC(13;0.011)																											p.I4052S		Atlas-SNP	.											.	USH2A	1168	.	0			c.T12155G						PASS	.						123.0	126.0	125.0					1																	215853630		2203	4300	6503	SO:0001583	missense	7399	exon62			CTTAAAATTTCTC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12155T>G	chr1.hg19:g.215853630A>C	ENSP00000305941:p.Ile4052Ser	129.0	0.0	.		98.0	46.0	.	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	hg19	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	A	15.16	2.751331	0.49257	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.44083	0.93;0.93	5.25	5.25	0.73442	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.360514	0.19602	N	0.110361	T	0.16214	0.0390	N	0.02345	-0.59	0.25312	N	0.989196	B	0.27625	0.183	B	0.25614	0.062	T	0.18713	-1.0328	10	0.07990	T	0.79	.	9.6563	0.39928	0.9223:0.0:0.0777:0.0	.	4052	O75445	USH2A_HUMAN	S	4052	ENSP00000305941:I4052S;ENSP00000355910:I4052S	ENSP00000305941:I4052S	I	-	2	0	USH2A	213920253	1.000000	0.71417	0.994000	0.49952	0.983000	0.72400	4.018000	0.57174	1.987000	0.57996	0.528000	0.53228	ATT	.	.	.	none		0.438	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
OBSCN	84033	hgsc.bcm.edu	37	1	228525744	228525744	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr1:228525744G>A	ENST00000422127.1	+	67	16944	c.16900G>A	c.(16900-16902)Gca>Aca	p.A5634T	OBSCN_ENST00000570156.2_Missense_Mutation_p.A6591T|OBSCN_ENST00000366709.4_Missense_Mutation_p.A2753T|OBSCN_ENST00000366707.4_Missense_Mutation_p.A3268T|OBSCN_ENST00000284548.11_Missense_Mutation_p.A5634T	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5634	SH3.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGTCCTGGATGCAGCCCACCC	0.632																																					p.A6591T		Atlas-SNP	.											.	OBSCN	2142	.	0			c.G19771A						PASS	.						35.0	36.0	36.0					1																	228525744		2182	4279	6461	SO:0001583	missense	84033	exon78			CTGGATGCAGCCC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.16900G>A	chr1.hg19:g.228525744G>A	ENSP00000409493:p.Ala5634Thr	53.0	0.0	.		58.0	16.0	.	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.56|15.56	2.869835|2.869835	0.51588|0.51588	.|.	.|.	ENSG00000154358|ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709|ENST00000441106	T;T;T;T|.	0.30981|.	1.51;1.51;1.51;1.51|.	4.35|4.35	1.93|1.93	0.25924|0.25924	Src homology-3 domain (2);|.	0.094130|.	0.45126|.	D|.	0.000387|.	T|T	0.27697|0.27697	0.0681|0.0681	N|N	0.14661|0.14661	0.345|0.345	0.29310|0.29310	N|N	0.868084|0.868084	B;B|.	0.29988|.	0.172;0.264|.	B;B|.	0.28011|.	0.039;0.085|.	T|T	0.25047|0.25047	-1.0143|-1.0143	10|5	0.54805|.	T|.	0.06|.	.|.	11.1252|11.1252	0.48315|0.48315	0.0:0.0:0.3104:0.6896|0.0:0.0:0.3104:0.6896	.|.	5634;5634|.	Q5VST9;Q5VST9-3|.	OBSCN_HUMAN;.|.	T|Y	5634;5634;3268;2753|249	ENSP00000284548:A5634T;ENSP00000409493:A5634T;ENSP00000355668:A3268T;ENSP00000355670:A2753T|.	ENSP00000284548:A5634T|.	A|C	+|+	1|2	0|0	OBSCN|OBSCN	226592367|226592367	1.000000|1.000000	0.71417|0.71417	0.267000|0.267000	0.24556|0.24556	0.522000|0.522000	0.34438|0.34438	4.088000|4.088000	0.57678|0.57678	0.292000|0.292000	0.22492|0.22492	-0.500000|-0.500000	0.04577|0.04577	GCA|TGC	.	.	.	none		0.632	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
NUP133	55746	hgsc.bcm.edu	37	1	229606482	229606482	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr1:229606482A>T	ENST00000261396.3	-	15	2012	c.1921T>A	c.(1921-1923)Tgt>Agt	p.C641S	NUP133_ENST00000537506.1_Missense_Mutation_p.C625S	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	641					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				GCATGCTCACAGAGCAACAGT	0.478																																					p.C641S		Atlas-SNP	.											.	NUP133	111	.	0			c.T1921A						PASS	.						104.0	94.0	97.0					1																	229606482		2203	4300	6503	SO:0001583	missense	55746	exon15			GCTCACAGAGCAA		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.1921T>A	chr1.hg19:g.229606482A>T	ENSP00000261396:p.Cys641Ser	171.0	0.0	.		138.0	65.0	.	NM_018230	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Missense_Mutation	SNP	ENST00000261396.3	hg19	CCDS1579.1	.	.	.	.	.	.	.	.	.	.	A	14.30	2.495539	0.44352	.	.	ENSG00000069248	ENST00000366681;ENST00000261396;ENST00000366679;ENST00000537506	T;T;T	0.23754	1.89;1.89;1.9	5.56	5.56	0.83823	Nucleoporin, Nup133/Nup155-like, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.29850	0.0746	M	0.73598	2.24	0.80722	D	1	B	0.14438	0.01	B	0.17433	0.018	T	0.06826	-1.0805	10	0.27785	T	0.31	-21.0231	11.7266	0.51712	0.8679:0.0:0.0:0.132	.	641	Q8WUM0	NU133_HUMAN	S	641;641;641;625	ENSP00000261396:C641S;ENSP00000355640:C641S;ENSP00000443496:C625S	ENSP00000261396:C641S	C	-	1	0	NUP133	227673105	1.000000	0.71417	0.999000	0.59377	0.922000	0.55478	5.911000	0.69939	2.240000	0.73641	0.533000	0.62120	TGT	.	.	.	none		0.478	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	
SH3YL1	26751	hgsc.bcm.edu	37	2	253096	253096	+	Silent	SNP	G	G	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr2:253096G>A	ENST00000405430.1	-	4	397	c.21C>T	c.(19-21)tcC>tcT	p.S7S	SH3YL1_ENST00000468321.1_5'UTR|SH3YL1_ENST00000356150.5_Silent_p.S7S|SH3YL1_ENST00000402632.1_Silent_p.S7S|SH3YL1_ENST00000403657.1_5'UTR|SH3YL1_ENST00000403712.2_Silent_p.S7S|SH3YL1_ENST00000403658.1_5'UTR			Q96HL8	SH3Y1_HUMAN	SH3 and SYLF domain containing 1	7					phosphatidylinositol biosynthetic process (GO:0006661)|regulation of ruffle assembly (GO:1900027)	ruffle membrane (GO:0032587)	phosphatase binding (GO:0019902)|phosphatidylinositol binding (GO:0035091)	p.S7S(1)		large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	7	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.034)		all cancers(51;0.000647)|Epithelial(75;0.0043)|OV - Ovarian serous cystadenocarcinoma(76;0.00871)|GBM - Glioblastoma multiforme(21;0.148)		ATTTCAAATTGGAAGGTATAG	0.289																																					p.S7S		Atlas-SNP	.											SH3YL1_ENST00000405430,NS,carcinoma,0,2	SH3YL1	49	.	1	Substitution - coding silent(1)	endometrium(1)	c.C21T						PASS	.						187.0	150.0	161.0					2																	253096		692	1591	2283	SO:0001819	synonymous_variant	26751	exon2			CAAATTGGAAGGT		CCDS42646.1, CCDS42646.2, CCDS54332.1, CCDS62841.1	2p25.3	2013-10-18	2013-10-18		ENSG00000035115	ENSG00000035115			29546	protein-coding gene	gene with protein product			"""SH3 domain containing, Ysc84-like 1 (S. cerevisiae)"""			21624956	Standard	NM_001282687		Approved	Ray, DKFZP586F1318	uc002qvx.3	Q96HL8	OTTHUMG00000151359	ENST00000405430.1:c.21C>T	chr2.hg19:g.253096G>A		51.0	0.0	.		64.0	24.0	.	NM_001159597	A8K8E7|B7WNJ4|B7WPL6|Q8NEL2|Q9H5X4|Q9Y3V5	Silent	SNP	ENST00000405430.1	hg19																																																																																				.	.	.	none		0.289	SH3YL1-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322352.1	NM_015677	
GPR113	165082	hgsc.bcm.edu	37	2	26537464	26537464	+	Missense_Mutation	SNP	T	T	A	rs148640513		TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr2:26537464T>A	ENST00000311519.1	-	7	949	c.950A>T	c.(949-951)cAg>cTg	p.Q317L	GPR113_ENST00000541401.1_Intron|GPR113_ENST00000333478.6_Missense_Mutation_p.Q118L|GPR113_ENST00000421160.2_Missense_Mutation_p.Q248L|GPR113_ENST00000459892.1_Intron	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	317					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTGAAGCCCTGGGCCTCGAA	0.592																																					p.Q317L		Atlas-SNP	.											.	GPR113	134	.	0			c.A950T						PASS	.						117.0	92.0	101.0					2																	26537464		2203	4300	6503	SO:0001583	missense	165082	exon7			AAGCCCTGGGCCT	AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.950A>T	chr2.hg19:g.26537464T>A	ENSP00000307831:p.Gln317Leu	160.0	0.0	.		167.0	70.0	.	NM_001145168	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Missense_Mutation	SNP	ENST00000311519.1	hg19	CCDS46239.1	.	.	.	.	.	.	.	.	.	.	T	15.86	2.957123	0.53293	.	.	ENSG00000173567	ENST00000333478;ENST00000421160;ENST00000311519	T;T;T	0.28895	1.59;3.13;3.13	5.43	1.65	0.23941	.	.	.	.	.	T	0.26448	0.0646	L	0.58101	1.795	0.80722	D	1	B;P;B	0.42248	0.138;0.774;0.038	B;B;B	0.39299	0.131;0.296;0.024	T	0.02909	-1.1095	8	.	.	.	-17.5326	7.2931	0.26376	0.0:0.3383:0.0:0.6617	.	248;118;317	E9PEV1;Q8IZF5-2;Q8IZF5	.;.;GP113_HUMAN	L	118;248;317	ENSP00000327396:Q118L;ENSP00000388537:Q248L;ENSP00000307831:Q317L	.	Q	-	2	0	GPR113	26390968	0.995000	0.38212	1.000000	0.80357	0.816000	0.46133	-0.005000	0.12855	0.359000	0.24239	0.459000	0.35465	CAG	.	T|1.000;C|0.000	.	alt		0.592	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316892.1	NM_153835	
C2orf71	388939	hgsc.bcm.edu	37	2	29296881	29296881	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr2:29296881A>C	ENST00000331664.5	-	1	246	c.247T>G	c.(247-249)Tca>Gca	p.S83A		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	83					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						CTTTTGCCTGAAGCAGGATCT	0.512																																					p.S83A		Atlas-SNP	.											.	C2orf71	146	.	0			c.T247G						PASS	.						192.0	177.0	182.0					2																	29296881		1924	4149	6073	SO:0001583	missense	388939	exon1			TGCCTGAAGCAGG		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.247T>G	chr2.hg19:g.29296881A>C	ENSP00000332809:p.Ser83Ala	137.0	0.0	.		158.0	56.0	.	NM_001029883		Missense_Mutation	SNP	ENST00000331664.5	hg19	CCDS42669.1	.	.	.	.	.	.	.	.	.	.	A	3.559	-0.090111	0.07053	.	.	ENSG00000179270	ENST00000331664	T	0.19669	2.13	3.98	-3.53	0.04667	.	0.256680	0.27509	N	0.019056	T	0.07234	0.0183	N	0.05383	-0.06	0.09310	N	1	B	0.11235	0.004	B	0.16289	0.015	T	0.15780	-1.0425	10	0.33141	T	0.24	-2.444	4.4009	0.11386	0.4215:0.399:0.0761:0.1033	.	83	A6NGG8	CB071_HUMAN	A	83	ENSP00000332809:S83A	ENSP00000332809:S83A	S	-	1	0	C2orf71	29150385	0.006000	0.16342	0.039000	0.18376	0.862000	0.49288	-0.319000	0.08039	-0.669000	0.05289	0.459000	0.35465	TCA	.	.	.	none		0.512	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883	
PCBP1	5093	hgsc.bcm.edu	37	2	70315518	70315518	+	Nonsense_Mutation	SNP	G	G	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr2:70315518G>T	ENST00000303577.5	+	1	934	c.643G>T	c.(643-645)Gag>Tag	p.E215*	PCBP1-AS1_ENST00000411429.1_RNA|PCBP1-AS1_ENST00000415742.1_RNA|PCBP1-AS1_ENST00000457770.1_RNA|PCBP1-AS1_ENST00000439670.2_RNA|PCBP1-AS1_ENST00000415060.2_RNA|PCBP1-AS1_ENST00000601396.1_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000439892.1_RNA|PCBP1-AS1_ENST00000418308.1_RNA|AC016700.2_ENST00000455541.1_lincRNA|PCBP1-AS1_ENST00000419963.1_RNA|PCBP1-AS1_ENST00000456161.1_RNA|PCBP1-AS1_ENST00000423402.1_RNA|PCBP1-AS1_ENST00000434781.1_RNA|PCBP1-AS1_ENST00000425601.1_RNA|PCBP1-AS1_ENST00000609075.1_RNA|PCBP1-AS1_ENST00000444410.1_RNA|PCBP1-AS1_ENST00000596573.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000421843.1_RNA|PCBP1-AS1_ENST00000452431.1_RNA|PCBP1-AS1_ENST00000458698.2_RNA|PCBP1-AS1_ENST00000429599.2_RNA|PCBP1-AS1_ENST00000432604.1_RNA|PCBP1-AS1_ENST00000416395.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000413069.1_RNA|PCBP1-AS1_ENST00000596665.1_RNA|PCBP1-AS1_ENST00000610168.1_RNA|PCBP1-AS1_ENST00000420309.1_RNA|PCBP1-AS1_ENST00000413791.1_RNA|PCBP1-AS1_ENST00000599673.1_RNA|PCBP1-AS1_ENST00000437456.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000596028.1_RNA|PCBP1-AS1_ENST00000595459.1_RNA|PCBP1-AS1_ENST00000425333.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000458686.1_RNA|PCBP1-AS1_ENST00000366234.3_RNA|PCBP1-AS1_ENST00000444320.1_RNA|PCBP1-AS1_ENST00000442040.1_RNA|PCBP1-AS1_ENST00000449178.1_RNA|PCBP1-AS1_ENST00000422515.1_RNA|PCBP1-AS1_ENST00000421255.1_RNA|PCBP1-AS1_ENST00000594548.1_RNA|PCBP1-AS1_ENST00000416068.1_RNA|PCBP1-AS1_ENST00000437019.1_RNA	NM_006196.3	NP_006187.2	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	215					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.E215Q(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|skin(1)	12						CCATGACCTGGAGGGACCACC	0.612																																					p.E215X	Colon(85;1146 1307 3484 18706 25380)	Atlas-SNP	.											PCBP1,NS,carcinoma,0,1	PCBP1	28	.	1	Substitution - Missense(1)	endometrium(1)	c.G643T						PASS	.						36.0	37.0	36.0					2																	70315518		2203	4300	6503	SO:0001587	stop_gained	5093	exon1			GACCTGGAGGGAC		CCDS1898.1	2p13-p12	2013-07-16	2001-11-28		ENSG00000169564	ENSG00000169564			8647	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein E1"""	601209	"""poly(rC)-binding protein 1"""			8833161	Standard	NM_006196		Approved	HNRPE1, hnRNP-E1, HNRPX, hnRNP-X	uc002sgf.3	Q15365	OTTHUMG00000129645	ENST00000303577.5:c.643G>T	chr2.hg19:g.70315518G>T	ENSP00000305556:p.Glu215*	101.0	0.0	.		120.0	57.0	.	NM_006196	Q13157|Q14975	Nonsense_Mutation	SNP	ENST00000303577.5	hg19	CCDS1898.1	.	.	.	.	.	.	.	.	.	.	G	38	6.876858	0.97904	.	.	ENSG00000169564	ENST00000303577	.	.	.	4.82	4.82	0.62117	.	0.453218	0.16777	N	0.199971	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	13.6585	0.62352	0.0:0.0:1.0:0.0	.	.	.	.	X	215	.	ENSP00000305556:E215X	E	+	1	0	PCBP1	70169022	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.492000	0.53259	2.696000	0.92011	0.650000	0.86243	GAG	.	.	.	none		0.612	PCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251844.1	NM_006196	
SESTD1	91404	hgsc.bcm.edu	37	2	179997038	179997038	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr2:179997038T>G	ENST00000428443.3	-	10	1281	c.965A>C	c.(964-966)cAg>cCg	p.Q322P		NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	322							phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			CACACTGTGCTGGCTCTCAAT	0.478																																					p.Q322P		Atlas-SNP	.											.	SESTD1	66	.	0			c.A965C						PASS	.						276.0	296.0	289.0					2																	179997038		2203	4300	6503	SO:0001583	missense	91404	exon10			CTGTGCTGGCTCT	AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.965A>C	chr2.hg19:g.179997038T>G	ENSP00000415332:p.Gln322Pro	65.0	0.0	.		61.0	23.0	.	NM_178123	Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Missense_Mutation	SNP	ENST00000428443.3	hg19	CCDS33338.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.399544	0.83120	.	.	ENSG00000187231	ENST00000428443	T	0.35048	1.33	6.0	6.0	0.97389	.	0.000000	0.85682	D	0.000000	T	0.37128	0.0992	N	0.14661	0.345	0.80722	D	1	D	0.53885	0.963	P	0.55785	0.784	T	0.15925	-1.0420	9	.	.	.	-13.1246	16.5156	0.84299	0.0:0.0:0.0:1.0	.	322	Q86VW0	SESD1_HUMAN	P	322	ENSP00000415332:Q322P	.	Q	-	2	0	SESTD1	179705283	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.102000	0.71486	2.291000	0.77112	0.519000	0.50382	CAG	.	.	.	none		0.478	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335916.2	NM_178123	
CERKL	375298	hgsc.bcm.edu	37	2	182468798	182468798	+	Nonsense_Mutation	SNP	T	T	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr2:182468798T>A	ENST00000339098.5	-	2	246	c.247A>T	c.(247-249)Aag>Tag	p.K83*	CERKL_ENST00000410087.3_Nonsense_Mutation_p.K83*|CERKL_ENST00000374970.2_Nonsense_Mutation_p.K83*|CERKL_ENST00000374969.2_Nonsense_Mutation_p.K83*|CERKL_ENST00000479558.1_5'UTR|CERKL_ENST00000409440.3_Nonsense_Mutation_p.K83*			Q49MI3	CERKL_HUMAN	ceramide kinase-like	83					negative regulation of apoptotic process (GO:0043066)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(13)|ovary(3)|skin(3)	32			OV - Ovarian serous cystadenocarcinoma(117;0.088)			AAGTCATACTTAGAATCACCT	0.363																																					p.K83X		Atlas-SNP	.											.	CERKL	138	.	0			c.A247T						PASS	.						37.0	37.0	37.0					2																	182468798		2201	4294	6495	SO:0001587	stop_gained	375298	exon2			CATACTTAGAATC	BC020465	CCDS33340.1, CCDS33341.1, CCDS42789.1, CCDS46466.1, CCDS54425.1	2q31.3	2005-01-04			ENSG00000188452	ENSG00000188452			21699	protein-coding gene	gene with protein product			"""retinitis pigmentosa 26 (autosomal recessive)"""	RP26		14681825	Standard	NR_027689		Approved		uc002uny.3	Q49MI3	OTTHUMG00000154315	ENST00000339098.5:c.247A>T	chr2.hg19:g.182468798T>A	ENSP00000341159:p.Lys83*	81.0	0.0	.		109.0	48.0	.	NM_001160277	B2RPL2|B4DEY1|Q49MH9|Q49MI0|Q49MI1|Q49MI2|Q5DVJ2|Q5DVJ4|Q5DVJ5|Q6UZF6|Q6ZP59	Nonsense_Mutation	SNP	ENST00000339098.5	hg19	CCDS42789.1	.	.	.	.	.	.	.	.	.	.	T	15.06	2.720717	0.48728	.	.	ENSG00000188452	ENST00000410087;ENST00000409440;ENST00000374969;ENST00000339098;ENST00000374970	.	.	.	5.4	2.99	0.34606	.	0.821591	0.10973	N	0.613588	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9745	0.64262	0.0:0.0:0.236:0.764	.	.	.	.	X	83	.	ENSP00000341159:K83X	K	-	1	0	CERKL	182177043	0.982000	0.34865	0.014000	0.15608	0.524000	0.34500	1.038000	0.30254	0.033000	0.15463	-1.333000	0.01266	AAG	.	.	.	none		0.363	CERKL-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334811.1		
TRIP12	9320	hgsc.bcm.edu	37	2	230633435	230633435	+	Splice_Site	SNP	A	A	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr2:230633435A>G	ENST00000283943.5	-	40	5857	c.5679T>C	c.(5677-5679)agT>agC	p.S1893S	TRIP12_ENST00000389044.4_Splice_Site_p.S1941S|TRIP12_ENST00000389045.3_Splice_Site_p.S1623S	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1893	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TCACAGCCCGACTATAACAGA	0.348																																					p.S1893S		Atlas-SNP	.											.	TRIP12	207	.	0			c.T5679C						PASS	.						57.0	55.0	55.0					2																	230633435		2203	4300	6503	SO:0001630	splice_region_variant	9320	exon40			AGCCCGACTATAA	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.5679-1T>C	chr2.hg19:g.230633435A>G		64.0	0.0	.		84.0	35.0	.	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Silent	SNP	ENST00000283943.5	hg19	CCDS33391.1																																																																																			.	.	.	none		0.348	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	Silent
TRIP12	9320	hgsc.bcm.edu	37	2	230663701	230663701	+	Silent	SNP	T	T	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr2:230663701T>C	ENST00000283943.5	-	22	3325	c.3147A>G	c.(3145-3147)acA>acG	p.T1049T	TRIP12_ENST00000389044.4_Silent_p.T1097T|TRIP12_ENST00000389045.3_Silent_p.T779T|TRIP12_ENST00000543084.1_3'UTR	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1049					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		ACCTTCCCCATGTTTTTGGAT	0.458																																					p.T1049T		Atlas-SNP	.											.	TRIP12	207	.	0			c.A3147G						PASS	.						160.0	153.0	155.0					2																	230663701		2203	4300	6503	SO:0001819	synonymous_variant	9320	exon22			TCCCCATGTTTTT	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.3147A>G	chr2.hg19:g.230663701T>C		94.0	0.0	.		95.0	44.0	.	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Silent	SNP	ENST00000283943.5	hg19	CCDS33391.1																																																																																			.	.	.	none		0.458	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
PER2	8864	hgsc.bcm.edu	37	2	239167228	239167228	+	Missense_Mutation	SNP	C	C	G	rs202103918		TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr2:239167228C>G	ENST00000254657.3	-	15	1964	c.1685G>C	c.(1684-1686)aGc>aCc	p.S562T	AC096574.4_ENST00000456601.1_RNA|PER2_ENST00000254658.3_3'UTR	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	562	CSNK1E binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		GACCCCCAGGCTGTCCTTTTC	0.527																																					p.S562T		Atlas-SNP	.											.	PER2	85	.	0			c.G1685C						PASS	.						62.0	58.0	59.0					2																	239167228		2203	4300	6503	SO:0001583	missense	8864	exon15			CCCAGGCTGTCCT	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.1685G>C	chr2.hg19:g.239167228C>G	ENSP00000254657:p.Ser562Thr	81.0	0.0	.		84.0	39.0	.	NM_022817	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	ENST00000254657.3	hg19	CCDS2528.1	.	.	.	.	.	.	.	.	.	.	C	11.82	1.752339	0.31046	.	.	ENSG00000132326	ENST00000254657	T	0.11712	2.75	4.79	4.79	0.61399	.	.	.	.	.	T	0.27697	0.0681	L	0.58428	1.81	0.80722	D	1	P;B	0.52842	0.956;0.168	D;B	0.65010	0.931;0.018	T	0.00440	-1.1738	9	0.42905	T	0.14	-18.6957	15.7283	0.77780	0.0:1.0:0.0:0.0	.	562;562	B4DH14;O15055	.;PER2_HUMAN	T	562	ENSP00000254657:S562T	ENSP00000254657:S562T	S	-	2	0	PER2	238831967	0.009000	0.17119	0.973000	0.42090	0.026000	0.11368	1.058000	0.30504	2.391000	0.81399	0.555000	0.69702	AGC	.	C|1.000;T|0.000	.	alt		0.527	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	
THAP4	51078	hgsc.bcm.edu	37	2	242541346	242541347	+	Silent	DNP	TG	TG	GC			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T|G	T|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr2:242541346_242541347TG>GC	ENST00000407315.1	-	5	2009_2010	c.1578_1579CA>GC	c.(1576-1581)gcCAgg>gcGCgg	p.526_527AR>AR	THAP4_ENST00000402136.1_Silent_p.114_115AR>AR|THAP4_ENST00000402545.1_Silent_p.114_115AR>AR|THAP4_ENST00000497486.1_5'UTR	NM_015963.5	NP_057047.4	Q8WY91	THAP4_HUMAN	THAP domain containing 4	526							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	9		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;2.3e-33)|all cancers(36;8.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.68e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0844)		AAGGAGATCCTGGCGATGGAGT	0.639																																					p.R527R|p.A526A		Atlas-SNP	.											.	THAP4	27	.	0			c.A1579C|c.C1578G						PASS	.																																			SO:0001819	synonymous_variant	51078	exon5			AGATCCTGGCGAT|GATCCTGGCGATG	AF258556	CCDS2551.1, CCDS54440.1	2q37.3	2013-01-25			ENSG00000176946	ENSG00000176946		"""THAP (C2CH-type zinc finger) domain containing"""	23187	protein-coding gene	gene with protein product		612533				12575992, 10810093	Standard	NM_015963		Approved	CGI-36	uc002wbt.3	Q8WY91	OTTHUMG00000133410	ENST00000407315.1:c.1578_1579delinsGC	chr2.hg19:g.242541346_242541347delinsGC		50.0	0.0	.		42.0|41.0	17.0|16.0	.	NM_015963	Q53NU7|Q6GRN0|Q6IPJ3|Q9NW26|Q9Y325	Silent	SNP	ENST00000407315.1	hg19	CCDS2551.1																																																																																			.	.	.	none		0.639	THAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257267.3	NM_015963	
CNTN6	27255	hgsc.bcm.edu	37	3	1424987	1424987	+	Silent	SNP	G	G	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr3:1424987G>A	ENST00000446702.2	+	19	3039	c.2412G>A	c.(2410-2412)ctG>ctA	p.L804L	CNTN6_ENST00000539053.1_Silent_p.L732L|CNTN6_ENST00000350110.2_Silent_p.L804L			Q9UQ52	CNTN6_HUMAN	contactin 6	804					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		AACCTCAACTGGCCCCAAGGG	0.438																																					p.L804L		Atlas-SNP	.											.	CNTN6	245	.	0			c.G2412A						PASS	.						186.0	193.0	191.0					3																	1424987		2203	4300	6503	SO:0001819	synonymous_variant	27255	exon19			TCAACTGGCCCCA	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.2412G>A	chr3.hg19:g.1424987G>A		135.0	0.0	.		203.0	45.0	.	NM_014461	Q2KHM2	Silent	SNP	ENST00000446702.2	hg19	CCDS2557.1																																																																																			.	.	.	none		0.438	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	
ZNF385D	79750	hgsc.bcm.edu	37	3	21478596	21478596	+	Missense_Mutation	SNP	C	C	T	rs368223028		TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr3:21478596C>T	ENST00000281523.2	-	5	1057	c.539G>A	c.(538-540)aGc>aAc	p.S180N	ZNF385D_ENST00000494118.1_5'UTR	NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	180	Thr-rich.					nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						TGTCGTTGGGCTTTTTTCCAC	0.478																																					p.S180N		Atlas-SNP	.											.	ZNF385D	93	.	0			c.G539A						PASS	.						174.0	155.0	162.0					3																	21478596		2203	4300	6503	SO:0001583	missense	79750	exon5			GTTGGGCTTTTTT	BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.539G>A	chr3.hg19:g.21478596C>T	ENSP00000281523:p.Ser180Asn	96.0	0.0	.		136.0	35.0	.	NM_024697		Missense_Mutation	SNP	ENST00000281523.2	hg19	CCDS2636.1	.	.	.	.	.	.	.	.	.	.	C	13.12	2.143723	0.37825	.	.	ENSG00000151789	ENST00000281523	T	0.45276	0.9	6.09	4.22	0.49857	.	0.295113	0.41194	D	0.000939	T	0.22859	0.0552	L	0.27053	0.805	0.24203	N	0.995504	B	0.22276	0.067	B	0.19391	0.025	T	0.06303	-1.0834	10	0.21014	T	0.42	-5.7655	2.7247	0.05210	0.1956:0.534:0.1249:0.1455	.	180	Q9H6B1	Z385D_HUMAN	N	180	ENSP00000281523:S180N	ENSP00000281523:S180N	S	-	2	0	ZNF385D	21453600	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	2.076000	0.41548	2.891000	0.99171	0.655000	0.94253	AGC	.	.	.	alt		0.478	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252884.1	NM_024697	
AMT	275	hgsc.bcm.edu	37	3	49456530	49456530	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr3:49456530G>C	ENST00000273588.3	-	7	1053	c.751C>G	c.(751-753)Cca>Gca	p.P251A	AMT_ENST00000546031.1_Missense_Mutation_p.P154A|AMT_ENST00000395338.2_Missense_Mutation_p.P251A|AMT_ENST00000538581.1_Missense_Mutation_p.P195A|AMT_ENST00000458307.2_Missense_Mutation_p.P207A|AMT_ENST00000476226.1_5'UTR	NM_000481.3	NP_000472.2	P48728	GCST_HUMAN	aminomethyltransferase	251					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|transaminase activity (GO:0008483)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	Tetrahydrofolic acid(DB00116)	TTCACCTCTGGGTTTTTCAGA	0.572																																					p.P251A		Atlas-SNP	.											.	AMT	22	.	0			c.C751G						PASS	.						44.0	46.0	45.0					3																	49456530		2203	4300	6503	SO:0001583	missense	275	exon7			CCTCTGGGTTTTT	D13811	CCDS2797.1, CCDS54583.1, CCDS54584.1, CCDS54585.1	3p21.2-p21.1	2014-09-17	2006-05-22		ENSG00000145020	ENSG00000145020	2.1.2.10		473	protein-coding gene	gene with protein product	"""glycine cleavage system protein T"""	238310	"""aminomethyltransferase (glycine cleavage system protein T)"""			1993704, 8188235	Standard	NM_000481		Approved	GCST, NKH	uc003cww.3	P48728	OTTHUMG00000156847	ENST00000273588.3:c.751C>G	chr3.hg19:g.49456530G>C	ENSP00000273588:p.Pro251Ala	121.0	0.0	.		167.0	98.0	.	NM_001164712	A8K3I5|B4DE61|B4DJQ0|E9PBG1|Q96IG6	Missense_Mutation	SNP	ENST00000273588.3	hg19	CCDS2797.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.07|11.07	1.531135|1.531135	0.27387|0.27387	.|.	.|.	ENSG00000145020|ENSG00000145020	ENST00000395338;ENST00000458307;ENST00000273588;ENST00000538581;ENST00000546031;ENST00000430521|ENST00000427987	T;T;T;T;T;T|.	0.74315|.	-0.83;-0.83;-0.83;-0.83;-0.83;-0.83|.	5.28|5.28	1.06|1.06	0.20224|0.20224	Glycine cleavage T-protein, N-terminal (1);|.	0.317346|0.317346	0.36134|0.36134	N|N	0.002773|0.002773	T|T	0.22126|0.22126	0.0533|0.0533	N|N	0.13352|0.13352	0.335|0.335	0.32666|0.32666	N|N	0.517387|0.517387	B;B;B;B|.	0.16166|.	0.001;0.016;0.001;0.001|.	B;B;B;B|.	0.21360|.	0.003;0.034;0.003;0.003|.	T|T	0.17806|0.17806	-1.0357|-1.0357	10|6	0.24483|.	T|.	0.36|.	-15.0969|-15.0969	4.9721|4.9721	0.14121|0.14121	0.1775:0.0:0.5332:0.2893|0.1775:0.0:0.5332:0.2893	.|.	195;207;251;251|.	B4DE61;B4DJQ0;E9PBG1;P48728|.	.;.;.;GCST_HUMAN|.	A|R	251;207;251;195;154;195|248	ENSP00000378747:P251A;ENSP00000415619:P207A;ENSP00000273588:P251A;ENSP00000443200:P195A;ENSP00000440672:P154A;ENSP00000388068:P195A|.	ENSP00000273588:P251A|.	P|P	-|-	1|2	0|0	AMT|AMT	49431534|49431534	1.000000|1.000000	0.71417|0.71417	0.958000|0.958000	0.39756|0.39756	0.720000|0.720000	0.41350|0.41350	1.685000|1.685000	0.37659|0.37659	0.618000|0.618000	0.30179|0.30179	-0.136000|-0.136000	0.14681|0.14681	CCA|CCC	.	.	.	none		0.572	AMT-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346216.2	NM_000481	
GNAI2	2771	hgsc.bcm.edu	37	3	50294444	50294444	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr3:50294444C>A	ENST00000313601.6	+	7	1183	c.799C>A	c.(799-801)Ctc>Atc	p.L267I	GNAI2_ENST00000451956.1_Missense_Mutation_p.L230I|GNAI2_ENST00000536647.1_Missense_Mutation_p.L186I|GNAI2_ENST00000440628.1_Missense_Mutation_p.L215I|GNAI2_ENST00000491100.1_3'UTR|GNAI2_ENST00000422163.1_Missense_Mutation_p.L251I|GNAI2_ENST00000266027.5_Missense_Mutation_p.L251I	NM_002070.2	NP_002061.1	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2	267					activation of MAPKK activity (GO:0000186)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of synaptic transmission (GO:0050805)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|regulation of calcium ion transport (GO:0051924)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|liver(2)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		GTCCATCATCCTCTTCCTCAA	0.507											OREG0015582	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L267I		Atlas-SNP	.											.	GNAI2	42	.	0			c.C799A						PASS	.						186.0	157.0	166.0					3																	50294444		2203	4300	6503	SO:0001583	missense	2771	exon7			ATCATCCTCTTCC	X04828	CCDS2813.1, CCDS54587.1, CCDS63642.1, CCDS63644.1	3p21.31	2010-08-27			ENSG00000114353	ENSG00000114353			4385	protein-coding gene	gene with protein product	"""GTP-binding regulatory protein Gi alpha-2 chain"""	139360		GNAI2B		3100330, 1733849	Standard	NM_001166425		Approved	GIP	uc003cyq.1	P04899	OTTHUMG00000156940	ENST00000313601.6:c.799C>A	chr3.hg19:g.50294444C>A	ENSP00000312999:p.Leu267Ile	105.0	0.0	.	968	106.0	78.0	.	NM_002070	B3KTZ0|B4DYA0|B4E2X5|Q6B6N3|Q8IZ71	Missense_Mutation	SNP	ENST00000313601.6	hg19	CCDS2813.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.933965	0.92458	.	.	ENSG00000114353	ENST00000422163;ENST00000313601;ENST00000536647;ENST00000540560;ENST00000440628;ENST00000451956;ENST00000266027	D;D;D;D;D;D	0.95788	-3.81;-3.81;-3.81;-3.81;-3.81;-3.81	4.48	4.48	0.54585	.	0.000000	0.85682	D	0.000000	D	0.98235	0.9416	H	0.94964	3.605	0.80722	D	1	P;P;D;D	0.56968	0.939;0.949;0.978;0.973	D;D;D;D	0.73380	0.954;0.98;0.954;0.923	D	0.99032	1.0821	10	0.87932	D	0	.	15.0562	0.71915	0.0:1.0:0.0:0.0	.	230;267;251;251	B4DYA0;P04899;B3KTZ0;P04899-2	.;GNAI2_HUMAN;.;.	I	251;267;186;267;215;230;251	ENSP00000406871:L251I;ENSP00000312999:L267I;ENSP00000444360:L186I;ENSP00000395736:L215I;ENSP00000406369:L230I;ENSP00000266027:L251I	ENSP00000266027:L251I	L	+	1	0	GNAI2	50269448	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.604000	0.82830	2.517000	0.84864	0.650000	0.86243	CTC	.	.	.	none		0.507	GNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346688.1	NM_002070	
STAB1	23166	hgsc.bcm.edu	37	3	52551367	52551367	+	Silent	SNP	C	C	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr3:52551367C>T	ENST00000321725.6	+	43	4597	c.4521C>T	c.(4519-4521)ggC>ggT	p.G1507G		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1507	EGF-like 12. {ECO:0000255|PROSITE- ProRule:PRU00076, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		ACCACGGGGGCTGCCACATTC	0.617																																					p.G1507G		Atlas-SNP	.											.	STAB1	178	.	0			c.C4521T						PASS	.						42.0	44.0	43.0					3																	52551367		2203	4299	6502	SO:0001819	synonymous_variant	23166	exon43			CGGGGGCTGCCAC	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.4521C>T	chr3.hg19:g.52551367C>T		162.0	0.0	.		213.0	61.0	.	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Silent	SNP	ENST00000321725.6	hg19	CCDS33768.1																																																																																			.	.	.	none		0.617	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
ZBTB11	27107	hgsc.bcm.edu	37	3	101371385	101371385	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr3:101371385A>C	ENST00000312938.4	-	10	3179	c.2599T>G	c.(2599-2601)Ttc>Gtc	p.F867V		NM_014415.3	NP_055230.2	O95625	ZBT11_HUMAN	zinc finger and BTB domain containing 11	867					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						AGCTGAGTGAATTTTCTTCCA	0.373																																					p.F867V		Atlas-SNP	.											.	ZBTB11	77	.	0			c.T2599G						PASS	.						160.0	164.0	162.0					3																	101371385		2202	4300	6502	SO:0001583	missense	27107	exon10			GAGTGAATTTTCT	U69274	CCDS2943.1	3q12.3	2013-01-09			ENSG00000066422	ENSG00000066422		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16740	protein-coding gene	gene with protein product							Standard	NM_014415		Approved	ZNF-U69274, ZNF913	uc003dve.4	O95625	OTTHUMG00000159133	ENST00000312938.4:c.2599T>G	chr3.hg19:g.101371385A>C	ENSP00000326200:p.Phe867Val	107.0	0.0	.		157.0	74.0	.	NM_014415	Q2NKP9	Missense_Mutation	SNP	ENST00000312938.4	hg19	CCDS2943.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.202625	0.79127	.	.	ENSG00000066422	ENST00000312938	T	0.73469	-0.75	5.29	4.14	0.48551	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.61776	0.2374	N	0.19112	0.55	0.80722	D	1	P	0.41393	0.748	B	0.41374	0.355	T	0.65096	-0.6251	10	0.87932	D	0	-10.2042	11.1725	0.48579	0.9276:0.0:0.0724:0.0	.	867	O95625	ZBT11_HUMAN	V	867	ENSP00000326200:F867V	ENSP00000326200:F867V	F	-	1	0	ZBTB11	102854075	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	7.100000	0.76989	0.958000	0.37956	0.528000	0.53228	TTC	.	.	.	none		0.373	ZBTB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353441.2	NM_014415	
ZBTB11	27107	hgsc.bcm.edu	37	3	101371390	101371390	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr3:101371390C>T	ENST00000312938.4	-	10	3174	c.2594G>A	c.(2593-2595)aGa>aAa	p.R865K		NM_014415.3	NP_055230.2	O95625	ZBT11_HUMAN	zinc finger and BTB domain containing 11	865					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						AGTGAATTTTCTTCCACATTT	0.368																																					p.R865K		Atlas-SNP	.											.	ZBTB11	77	.	0			c.G2594A						PASS	.						159.0	163.0	161.0					3																	101371390		2202	4300	6502	SO:0001583	missense	27107	exon10			AATTTTCTTCCAC	U69274	CCDS2943.1	3q12.3	2013-01-09			ENSG00000066422	ENSG00000066422		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16740	protein-coding gene	gene with protein product							Standard	NM_014415		Approved	ZNF-U69274, ZNF913	uc003dve.4	O95625	OTTHUMG00000159133	ENST00000312938.4:c.2594G>A	chr3.hg19:g.101371390C>T	ENSP00000326200:p.Arg865Lys	106.0	0.0	.		159.0	75.0	.	NM_014415	Q2NKP9	Missense_Mutation	SNP	ENST00000312938.4	hg19	CCDS2943.1	.	.	.	.	.	.	.	.	.	.	C	10.25	1.297368	0.23650	.	.	ENSG00000066422	ENST00000312938	T	0.38722	1.12	5.29	3.5	0.40072	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.048362	0.85682	N	0.000000	T	0.18173	0.0436	N	0.08118	0	0.80722	D	1	B	0.09022	0.002	B	0.10450	0.005	T	0.13791	-1.0496	10	0.02654	T	1	-12.5319	9.1783	0.37125	0.0:0.7777:0.0:0.2223	.	865	O95625	ZBT11_HUMAN	K	865	ENSP00000326200:R865K	ENSP00000326200:R865K	R	-	2	0	ZBTB11	102854080	1.000000	0.71417	0.992000	0.48379	0.981000	0.71138	3.794000	0.55492	0.721000	0.32231	0.650000	0.86243	AGA	.	.	.	none		0.368	ZBTB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353441.2	NM_014415	
ACAP2	23527	hgsc.bcm.edu	37	3	195000100	195000100	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr3:195000100G>T	ENST00000326793.6	-	23	2524	c.2294C>A	c.(2293-2295)cCa>cAa	p.P765Q	ACAP2_ENST00000472860.1_5'UTR|ACAP2-IT1_ENST00000419899.1_RNA	NM_012287.5	NP_036419.3	Q15057	ACAP2_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 2	765					cellular response to nerve growth factor stimulus (GO:1990090)|protein localization to endosome (GO:0036010)|regulation of ARF GTPase activity (GO:0032312)	endosome membrane (GO:0010008)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	27						TAGTTTCTCTGGATTATTGGA	0.318																																					p.P765Q		Atlas-SNP	.											.	ACAP2	72	.	0			c.C2294A						PASS	.						64.0	68.0	67.0					3																	195000100		2203	4291	6494	SO:0001583	missense	23527	exon23			TTCTCTGGATTAT		CCDS33924.1	3q29	2013-01-10	2008-09-22	2008-09-22	ENSG00000114331	ENSG00000114331		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16469	protein-coding gene	gene with protein product		607766	"""centaurin, beta 2"""	CENTB2		11050434, 11062263	Standard	NM_012287		Approved	KIAA0041, CNT-B2	uc003fun.4	Q15057	OTTHUMG00000155885	ENST00000326793.6:c.2294C>A	chr3.hg19:g.195000100G>T	ENSP00000324287:p.Pro765Gln	186.0	0.0	.		284.0	79.0	.	NM_012287	A8K2V4|Q8N5Z8|Q9UQR3	Missense_Mutation	SNP	ENST00000326793.6	hg19	CCDS33924.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.871995	0.91587	.	.	ENSG00000114331	ENST00000326793	T	0.47528	0.84	6.02	6.02	0.97574	.	0.113510	0.64402	D	0.000009	T	0.74253	0.3692	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76767	-0.2838	10	0.87932	D	0	.	19.5352	0.95251	0.0:0.0:1.0:0.0	.	765	Q15057	ACAP2_HUMAN	Q	765	ENSP00000324287:P765Q	ENSP00000324287:P765Q	P	-	2	0	ACAP2	196481389	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.133000	0.94460	2.850000	0.98022	0.650000	0.86243	CCA	.	.	.	none		0.318	ACAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342126.2	NM_012287	
MUC4	4585	hgsc.bcm.edu	37	3	195512378	195512378	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr3:195512378C>A	ENST00000463781.3	-	2	6532	c.6073G>T	c.(6073-6075)Gca>Tca	p.A2025S	MUC4_ENST00000475231.1_Missense_Mutation_p.A2025S|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CCAGTGGATGCTGAGGAAAGG	0.577																																					p.A2025S		Atlas-SNP	.											.	MUC4	1505	.	0			c.G6073T						PASS	.						25.0	25.0	25.0					3																	195512378		682	1581	2263	SO:0001583	missense	4585	exon2			TGGATGCTGAGGA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6073G>T	chr3.hg19:g.195512378C>A	ENSP00000417498:p.Ala2025Ser	74.0	0.0	.		115.0	7.0	.	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	hg19	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	C	6.737	0.504849	0.12822	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33438	1.41;1.42	.	.	.	.	.	.	.	.	T	0.15782	0.0380	N	0.08118	0	0.09310	N	1	P	0.42584	0.784	B	0.42959	0.403	T	0.14144	-1.0483	6	.	.	.	.	.	.	.	.	2025	E7ESK3	.	S	2025	ENSP00000417498:A2025S;ENSP00000420243:A2025S	.	A	-	1	0	MUC4	196996773	0.000000	0.05858	0.004000	0.12327	0.008000	0.06430	-0.332000	0.07904	0.488000	0.27723	0.064000	0.15345	GCA	.	.	.	none		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
LRRC66	339977	hgsc.bcm.edu	37	4	52861134	52861134	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr4:52861134T>A	ENST00000343457.3	-	4	2060	c.2054A>T	c.(2053-2055)gAa>gTa	p.E685V		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	685						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						CTGCACTGGTTCCTTGTTAGC	0.517																																					p.E685V		Atlas-SNP	.											.	LRRC66	128	.	0			c.A2054T						PASS	.						87.0	84.0	85.0					4																	52861134		2004	4173	6177	SO:0001583	missense	339977	exon4			ACTGGTTCCTTGT	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.2054A>T	chr4.hg19:g.52861134T>A	ENSP00000341944:p.Glu685Val	38.0	0.0	.		48.0	21.0	.	NM_001024611		Missense_Mutation	SNP	ENST00000343457.3	hg19	CCDS43229.1	.	.	.	.	.	.	.	.	.	.	T	14.83	2.651422	0.47362	.	.	ENSG00000188993	ENST00000343457	T	0.36340	1.26	4.37	-0.899	0.10547	.	0.798338	0.10965	N	0.614504	T	0.23886	0.0578	L	0.36672	1.1	0.09310	N	1	P	0.50943	0.94	B	0.40982	0.345	T	0.15636	-1.0430	10	0.87932	D	0	-3.7352	4.4438	0.11588	0.0:0.2796:0.1775:0.5428	.	685	Q68CR7	LRC66_HUMAN	V	685	ENSP00000341944:E685V	ENSP00000341944:E685V	E	-	2	0	LRRC66	52555891	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.196000	0.17176	-0.214000	0.10078	-0.250000	0.11733	GAA	.	.	.	none		0.517	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1	NM_001024611	
MOB1B	92597	hgsc.bcm.edu	37	4	71844887	71844887	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr4:71844887T>C	ENST00000309395.2	+	5	653	c.452T>C	c.(451-453)aTa>aCa	p.I151T	MOB1B_ENST00000396051.2_Missense_Mutation_p.I156T|MOB1B_ENST00000511449.1_Intron	NM_001244766.1|NM_173468.3	NP_001231695.1|NP_775739.1	Q7L9L4	MOB1B_HUMAN	MOB kinase activator 1B	151					hippo signaling (GO:0035329)|positive regulation of phosphorylation (GO:0042327)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	kinase activator activity (GO:0019209)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)										GCAAAAACTATACTCAAACGC	0.398																																					p.I156T		Atlas-SNP	.											.	.	.	.	0			c.T467C						PASS	.						158.0	157.0	157.0					4																	71844887		2203	4300	6503	SO:0001583	missense	92597	exon6			AAACTATACTCAA	BC038112	CCDS34002.1, CCDS58903.1	4q13.3	2011-09-28	2011-09-28	2011-09-27	ENSG00000173542	ENSG00000173542		"""MOB kinase activators"""	29801	protein-coding gene	gene with protein product	"""Mob4A protein"""	609282	"""MOB1, Mps One Binder kinase activator-like 1A (yeast)"", ""MOB1 Mps One Binder homolog B (yeast)"""	MOBKL1A		15067004	Standard	NM_173468		Approved	MOB4A	uc003hfw.3	Q7L9L4	OTTHUMG00000160844	ENST00000309395.2:c.452T>C	chr4.hg19:g.71844887T>C	ENSP00000310189:p.Ile151Thr	83.0	0.0	.		96.0	36.0	.	NM_001244766	B2R8U6|B4DRY3|Q8IY23	Missense_Mutation	SNP	ENST00000309395.2	hg19	CCDS34002.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.520487	0.85495	.	.	ENSG00000173542	ENST00000309395;ENST00000396051	.	.	.	5.26	5.26	0.73747	.	0.044863	0.85682	D	0.000000	D	0.86952	0.6057	H	0.95745	3.715	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	D	0.90963	0.4814	9	0.87932	D	0	-46.1108	15.1665	0.72833	0.0:0.0:0.0:1.0	.	156;151	B4DRY3;Q7L9L4	.;MOB1B_HUMAN	T	151;156	.	ENSP00000310189:I151T	I	+	2	0	MOBKL1A	72063751	1.000000	0.71417	0.997000	0.53966	0.978000	0.69477	8.040000	0.89188	1.984000	0.57885	0.459000	0.35465	ATA	.	.	.	none		0.398	MOB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362634.1	NM_173468	
SHROOM3	57619	hgsc.bcm.edu	37	4	77680809	77680809	+	Silent	SNP	G	G	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr4:77680809G>T	ENST00000296043.6	+	9	6263	c.5310G>T	c.(5308-5310)gtG>gtT	p.V1770V	RP11-359D14.2_ENST00000452412.1_RNA|RP11-359D14.3_ENST00000449007.1_RNA	NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	1770	ASD2. {ECO:0000255|PROSITE- ProRule:PRU00638}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CAGCAGAAGTGAATGAGGAAG	0.448																																					p.V1770V		Atlas-SNP	.											.	SHROOM3	134	.	0			c.G5310T						PASS	.						111.0	93.0	99.0					4																	77680809		2203	4300	6503	SO:0001819	synonymous_variant	57619	exon9			AGAAGTGAATGAG	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.5310G>T	chr4.hg19:g.77680809G>T		167.0	0.0	.		171.0	82.0	.	NM_020859	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	hg19	CCDS3579.2																																																																																			.	.	.	none		0.448	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
FRAS1	80144	hgsc.bcm.edu	37	4	79188585	79188585	+	Splice_Site	SNP	G	G	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr4:79188585G>T	ENST00000325942.6	+	9	1420	c.980G>T	c.(979-981)cGg>cTg	p.R327L	FRAS1_ENST00000264895.6_Splice_Site_p.R327L|FRAS1_ENST00000264899.6_Splice_Site_p.R327L	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	327	VWFC 5. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GAGTGTGCCCGGGTAAGAAGC	0.547																																					p.R327L		Atlas-SNP	.											.	FRAS1	779	.	0			c.G980T						PASS	.						55.0	59.0	58.0					4																	79188585		2046	4189	6235	SO:0001630	splice_region_variant	80144	exon9			GTGCCCGGGTAAG	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.981+1G>T	chr4.hg19:g.79188585G>T		123.0	0.0	.		122.0	48.0	.	NM_001166133	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	hg19	CCDS54772.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	6.298|6.298	0.423096|0.423096	0.11928|0.11928	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000502446|ENST00000325942;ENST00000264895;ENST00000264899;ENST00000534913	.|T;T;T	.|0.71698	.|-0.59;-0.59;-0.59	5.19|5.19	-10.3|-10.3	0.00346|0.00346	.|von Willebrand factor, type C (4);	.|0.722452	.|0.13283	.|N	.|0.399620	T|T	0.39517|0.39517	0.1081|0.1081	N|N	0.12961|0.12961	0.28|0.28	0.22066|0.22066	N|N	0.999381|0.999381	.|B;B;B;B	.|0.09022	.|0.0;0.0;0.001;0.002	.|B;B;B;B	.|0.13407	.|0.007;0.007;0.005;0.009	T|T	0.11036|0.11036	-1.0604|-1.0604	5|10	.|0.33940	.|T	.|0.23	.|.	4.1729|4.1729	0.10337|0.10337	0.3378:0.0883:0.4013:0.1726|0.3378:0.0883:0.4013:0.1726	.|.	.|327;327;327;327	.|E9PHH6;Q86XX4;E7EWM9;A2RRR8	.|.;FRAS1_HUMAN;.;.	W|L	256|327;327;327;67	.|ENSP00000326330:R327L;ENSP00000264895:R327L;ENSP00000264899:R327L	.|ENSP00000264895:R327L	G|R	+|+	1|2	0|0	FRAS1|FRAS1	79407609|79407609	0.003000|0.003000	0.15002|0.15002	0.337000|0.337000	0.25536|0.25536	0.014000|0.014000	0.08584|0.08584	-0.399000|-0.399000	0.07250|0.07250	-2.237000|-2.237000	0.00712|0.00712	-3.042000|-3.042000	0.00070|0.00070	GGG|CGG	.	.	.	none		0.547	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		Missense_Mutation
USP53	54532	hgsc.bcm.edu	37	4	120189437	120189437	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr4:120189437G>A	ENST00000274030.6	+	14	2329	c.1150G>A	c.(1150-1152)Gta>Ata	p.V384I	USP53_ENST00000450251.1_Missense_Mutation_p.V384I	NM_019050.2	NP_061923.2			ubiquitin specific peptidase 53											breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	27						TGAAAAGCCTGTAATTCATAA	0.289																																					p.V384I		Atlas-SNP	.											.	USP53	69	.	0			c.G1150A						PASS	.						49.0	48.0	49.0					4																	120189437		1807	4076	5883	SO:0001583	missense	54532	exon13			AAGCCTGTAATTC	BC017382	CCDS43265.1	4q26	2010-05-12	2005-08-08		ENSG00000145390	ENSG00000145390		"""Ubiquitin-specific peptidases"""	29255	protein-coding gene	gene with protein product			"""ubiquitin specific protease 53"""			10718198, 14715245	Standard	NM_019050		Approved	KIAA1350	uc003ics.4	Q70EK8	OTTHUMG00000161331	ENST00000274030.6:c.1150G>A	chr4.hg19:g.120189437G>A	ENSP00000274030:p.Val384Ile	373.0	1.0	.		350.0	132.0	.	NM_019050		Missense_Mutation	SNP	ENST00000274030.6	hg19	CCDS43265.1	.	.	.	.	.	.	.	.	.	.	G	5.203	0.223010	0.09863	.	.	ENSG00000145390	ENST00000274030;ENST00000450251	T;T	0.42513	0.97;0.97	5.36	-0.763	0.11030	.	0.499782	0.19980	N	0.101785	T	0.13798	0.0334	N	0.01705	-0.755	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17592	-1.0364	10	0.34782	T	0.22	0.1555	5.6415	0.17567	0.4731:0.0:0.2531:0.2738	.	384	Q70EK8	UBP53_HUMAN	I	384	ENSP00000274030:V384I;ENSP00000409906:V384I	ENSP00000274030:V384I	V	+	1	0	USP53	120408885	0.000000	0.05858	0.020000	0.16555	0.706000	0.40770	0.322000	0.19576	-0.017000	0.14103	-0.253000	0.11424	GTA	.	.	.	none		0.289	USP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364564.2	XM_052597	
KIAA1109	84162	hgsc.bcm.edu	37	4	123159421	123159421	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr4:123159421A>T	ENST00000264501.4	+	28	4122	c.3749A>T	c.(3748-3750)aAg>aTg	p.K1250M	KIAA1109_ENST00000495260.1_3'UTR|KIAA1109_ENST00000388738.3_Missense_Mutation_p.K1250M|KIAA1109_ENST00000455637.1_Missense_Mutation_p.K1250M			Q2LD37	K1109_HUMAN	KIAA1109	1250					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						GCTGGTGAAAAGGAAAGTCCT	0.428																																					p.K1250M		Atlas-SNP	.											.	KIAA1109	424	.	0			c.A3749T						PASS	.						140.0	130.0	133.0					4																	123159421		1892	4124	6016	SO:0001583	missense	84162	exon26			GTGAAAAGGAAAG	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.3749A>T	chr4.hg19:g.123159421A>T	ENSP00000264501:p.Lys1250Met	99.0	0.0	.		115.0	48.0	.	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	hg19	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.21|16.21	3.059532|3.059532	0.55325|0.55325	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000424425	T;T;T|.	0.27557|.	2.25;2.25;1.66|.	5.68|5.68	4.49|4.49	0.54785|0.54785	.|.	0.121477|0.121477	0.31784|0.31784	U|U	0.007068|0.007068	T|T	0.29783|0.29783	0.0744|0.0744	N|N	0.19112|0.19112	0.55|0.55	0.30998|0.30998	N|N	0.720613|0.720613	P|.	0.43094|.	0.799|.	P|.	0.45946|.	0.498|.	T|T	0.28364|0.28364	-1.0046|-1.0046	10|6	0.72032|.	D|.	0.01|.	.|.	9.5739|9.5739	0.39445|0.39445	0.8588:0.0:0.1412:0.0|0.8588:0.0:0.1412:0.0	.|.	1250|.	Q2LD37|.	K1109_HUMAN|.	M|N	1250|1081	ENSP00000264501:K1250M;ENSP00000373390:K1250M;ENSP00000389925:K1250M|.	ENSP00000264501:K1250M|.	K|K	+|+	2|3	0|2	KIAA1109|KIAA1109	123378871|123378871	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.941000|0.941000	0.58515|0.58515	4.307000|4.307000	0.59123|0.59123	0.990000|0.990000	0.38787|0.38787	0.477000|0.477000	0.44152|0.44152	AAG|AAA	.	.	.	none		0.428	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
GZMK	3003	hgsc.bcm.edu	37	5	54327207	54327207	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr5:54327207A>G	ENST00000231009.2	+	4	449	c.379A>G	c.(379-381)Aaa>Gaa	p.K127E	CTD-2313F11.1_ENST00000609699.1_RNA|CTD-2313F11.1_ENST00000609792.1_RNA|CTD-2313F11.1_ENST00000595218.1_RNA|CTD-2313F11.1_ENST00000596137.1_RNA	NM_002104.2	NP_002095.1	P49863	GRAK_HUMAN	granzyme K (granzyme 3; tryptase II)	127	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)	15		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				AACAGCCGCAAAACTCAATAA	0.443																																					p.K127E		Atlas-SNP	.											.	GZMK	39	.	0			c.A379G						PASS	.						74.0	79.0	77.0					5																	54327207		2203	4300	6503	SO:0001583	missense	3003	exon4			GCCGCAAAACTCA	BC035802	CCDS3964.1	5q11.2	2008-05-15	2005-08-17		ENSG00000113088	ENSG00000113088			4711	protein-coding gene	gene with protein product		600784	"""granzyme K (serine protease, granzyme 3; tryptase II)"""			7758581	Standard	NM_002104		Approved	TRYP2, PRSS	uc003jpl.1	P49863	OTTHUMG00000097009	ENST00000231009.2:c.379A>G	chr5.hg19:g.54327207A>G	ENSP00000231009:p.Lys127Glu	160.0	0.0	.		177.0	77.0	.	NM_002104	B2R563	Missense_Mutation	SNP	ENST00000231009.2	hg19	CCDS3964.1	.	.	.	.	.	.	.	.	.	.	A	6.131	0.392489	0.11638	.	.	ENSG00000113088	ENST00000231009	D	0.88664	-2.41	4.78	0.361	0.16107	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.503112	0.19871	N	0.104186	T	0.76492	0.3995	L	0.33668	1.02	0.09310	N	0.999996	B	0.02656	0.0	B	0.08055	0.003	T	0.56649	-0.7944	10	0.08837	T	0.75	.	4.6689	0.12680	0.62:0.158:0.222:0.0	.	127	P49863	GRAK_HUMAN	E	127	ENSP00000231009:K127E	ENSP00000231009:K127E	K	+	1	0	GZMK	54362964	0.033000	0.19621	0.012000	0.15200	0.341000	0.28922	1.879000	0.39618	-0.075000	0.12798	-0.316000	0.08728	AAA	.	.	.	none		0.443	GZMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214098.1	NM_002104	
MAST4	375449	hgsc.bcm.edu	37	5	66448607	66448607	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr5:66448607T>A	ENST00000403625.2	+	25	3733	c.3438T>A	c.(3436-3438)agT>agA	p.S1146R	MAST4_ENST00000261569.7_Missense_Mutation_p.S952R|MAST4_ENST00000403666.1_Missense_Mutation_p.S957R|MAST4_ENST00000405643.1_Missense_Mutation_p.S967R|MAST4_ENST00000404260.3_Missense_Mutation_p.S1149R	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	1149	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TGATCCACAGTTCGGGGAAGA	0.532																																					p.S1146R		Atlas-SNP	.											.	MAST4	218	.	0			c.T3438A						PASS	.						89.0	90.0	90.0					5																	66448607		1970	4163	6133	SO:0001583	missense	375449	exon25			CCACAGTTCGGGG	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.3438T>A	chr5.hg19:g.66448607T>A	ENSP00000385727:p.Ser1146Arg	126.0	0.0	.		121.0	48.0	.	NM_001164664	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	hg19	CCDS54861.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.09|14.09	2.431177|2.431177	0.43122|0.43122	.|.	.|.	ENSG00000069020|ENSG00000069020	ENST00000443808|ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569;ENST00000432399	.|T;T;T;T;T	.|0.40756	.|1.02;1.02;1.02;1.02;1.02	6.17|6.17	-3.57|-3.57	0.04612|0.04612	.|PDZ/DHR/GLGF (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.28200|0.28200	0.0696|0.0696	N|N	0.02286|0.02286	-0.61|-0.61	0.33633|0.33633	D|D	0.606291|0.606291	.|D;P	.|0.71674	.|0.998;0.712	.|D;B	.|0.79108	.|0.992;0.327	T|T	0.38693|0.38693	-0.9649|-0.9649	5|10	.|0.05620	.|T	.|0.96	-18.4408|-18.4408	14.5549|14.5549	0.68094|0.68094	0.0:0.5151:0.0:0.4849|0.0:0.5151:0.0:0.4849	.|.	.|1149;957	.|O15021;O15021-3	.|MAST4_HUMAN;.	I|R	203|1149;1146;957;967;967;952;885	.|ENSP00000385048:S1149R;ENSP00000385727:S1146R;ENSP00000384313:S957R;ENSP00000384099:S967R;ENSP00000261569:S952R	.|ENSP00000261569:S952R	F|S	+|+	1|3	0|2	MAST4|MAST4	66484363|66484363	0.699000|0.699000	0.27786|0.27786	0.769000|0.769000	0.31535|0.31535	0.947000|0.947000	0.59692|0.59692	-0.116000|-0.116000	0.10724|0.10724	-0.539000|-0.539000	0.06273|0.06273	0.533000|0.533000	0.62120|0.62120	TTC|AGT	.	.	.	none		0.532	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
AGGF1	55109	hgsc.bcm.edu	37	5	76326724	76326724	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr5:76326724G>A	ENST00000312916.7	+	1	515	c.133G>A	c.(133-135)Gag>Aag	p.E45K	AGGF1_ENST00000503538.1_Intron|AGGF1_ENST00000506806.1_Missense_Mutation_p.E45K	NM_018046.4	NP_060516.2	Q8N302	AGGF1_HUMAN	angiogenic factor with G patch and FHA domains 1	45					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|RNA processing (GO:0006396)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	nucleic acid binding (GO:0003676)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	20		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;4.51e-51)|Epithelial(54;2.2e-45)|all cancers(79;6.68e-41)		GCAGGTGCGGGAGATCGAGAA	0.657																																					p.E45K		Atlas-SNP	.											.	AGGF1	71	.	0			c.G133A						PASS	.						62.0	60.0	61.0					5																	76326724		2203	4300	6503	SO:0001583	missense	55109	exon1			GTGCGGGAGATCG	AK001145	CCDS4035.1	5q13.3	2013-10-11			ENSG00000164252	ENSG00000164252		"""G patch domain containing"""	24684	protein-coding gene	gene with protein product		608464				18564129, 17103452	Standard	NM_018046		Approved	VG5Q, HSU84971, FLJ10283, GPATC7, GPATCH7	uc003ket.3	Q8N302	OTTHUMG00000102132	ENST00000312916.7:c.133G>A	chr5.hg19:g.76326724G>A	ENSP00000316109:p.Glu45Lys	979.0	1.0	.		916.0	356.0	.	NM_018046	O00581|Q53YS3|Q9BU84|Q9NW66	Missense_Mutation	SNP	ENST00000312916.7	hg19	CCDS4035.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.026317	0.75390	.	.	ENSG00000164252	ENST00000312916;ENST00000506806	T;T	0.79033	1.36;-1.23	4.04	4.04	0.47022	.	0.131176	0.51477	D	0.000092	T	0.63402	0.2508	N	0.24115	0.695	0.33944	D	0.643624	B;B	0.28998	0.048;0.23	B;B	0.28849	0.029;0.095	T	0.68685	-0.5343	10	0.26408	T	0.33	-20.5081	11.9022	0.52690	0.0:0.0:1.0:0.0	.	45;45	Q8N302;Q8N302-3	AGGF1_HUMAN;.	K	45	ENSP00000316109:E45K;ENSP00000424733:E45K	ENSP00000316109:E45K	E	+	1	0	AGGF1	76362480	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.934000	0.56553	2.258000	0.74832	0.555000	0.69702	GAG	.	.	.	none		0.657	AGGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219971.2	NM_018046	
APC	324	hgsc.bcm.edu	37	5	112177639	112177639	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr5:112177639T>G	ENST00000457016.1	+	16	6728	c.6348T>G	c.(6346-6348)caT>caG	p.H2116Q	APC_ENST00000257430.4_Missense_Mutation_p.H2116Q|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Missense_Mutation_p.H2116Q			P25054	APC_HUMAN	adenomatous polyposis coli	2116	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GTAGTTTACATCAAGCTGCTG	0.408		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.H2116Q	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	Atlas-SNP	.	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	APC	4158	.	1	Unknown(1)	skin(1)	c.T6348G						PASS	.						105.0	109.0	108.0					5																	112177639		2202	4300	6502	SO:0001583	missense	324	exon17	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	TTTACATCAAGCT	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.6348T>G	chr5.hg19:g.112177639T>G	ENSP00000413133:p.His2116Gln	84.0	0.0	.		111.0	50.0	.	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	hg19	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	T	12.77	2.038546	0.35989	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.91011	-2.77;-2.77;-2.77	5.9	1.66	0.24008	.	0.042186	0.85682	D	0.000000	D	0.89283	0.6671	L	0.39245	1.2	0.51233	D	0.999917	D;D	0.67145	0.996;0.996	P;P	0.56788	0.806;0.737	D	0.85416	0.1140	9	.	.	.	-17.2926	9.2445	0.37518	0.0:0.2467:0.0:0.7533	.	2118;2116	Q4LE70;P25054	.;APC_HUMAN	Q	2116	ENSP00000413133:H2116Q;ENSP00000257430:H2116Q;ENSP00000427089:H2116Q	.	H	+	3	2	APC	112205538	0.990000	0.36364	1.000000	0.80357	0.990000	0.78478	0.132000	0.15891	0.335000	0.23614	-0.263000	0.10527	CAT	.	.	.	none		0.408	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
FAM217A	222826	hgsc.bcm.edu	37	6	4073537	4073537	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr6:4073537G>C	ENST00000274673.3	-	6	677	c.274C>G	c.(274-276)Ctt>Gtt	p.L92V	FAM217A_ENST00000380188.2_5'UTR	NM_173563.2	NP_775834.2	Q8IXS0	F217A_HUMAN	family with sequence similarity 217, member A	92																	CCTTCATTAAGAGGACAATTC	0.284																																					p.L92V		Atlas-SNP	.											.	.	.	.	0			c.C274G						PASS	.						88.0	91.0	90.0					6																	4073537		2200	4298	6498	SO:0001583	missense	222826	exon6			CATTAAGAGGACA	BC039349	CCDS4489.1	6p25.1	2012-02-07	2012-02-07	2012-02-07	ENSG00000145975	ENSG00000145975			21362	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 146"""	C6orf146			Standard	NM_173563		Approved	MGC43581	uc003mvx.3	Q8IXS0	OTTHUMG00000014159	ENST00000274673.3:c.274C>G	chr6.hg19:g.4073537G>C	ENSP00000274673:p.Leu92Val	141.0	0.0	.		167.0	72.0	.	NM_173563	Q5JYK1	Missense_Mutation	SNP	ENST00000274673.3	hg19	CCDS4489.1	.	.	.	.	.	.	.	.	.	.	G	3.603	-0.081079	0.07141	.	.	ENSG00000145975	ENST00000274673;ENST00000470599;ENST00000498677;ENST00000492651	T	0.13657	2.57	4.94	2.43	0.29744	.	0.789154	0.10830	N	0.629459	T	0.01523	0.0049	N	0.12746	0.255	0.19300	N	0.999974	B	0.17038	0.02	B	0.15484	0.013	T	0.48658	-0.9016	10	0.08381	T	0.77	-3.6355	4.8234	0.13403	0.1733:0.1967:0.63:0.0	.	92	Q8IXS0	CF146_HUMAN	V	92;220;29;29	ENSP00000274673:L92V	ENSP00000274673:L92V	L	-	1	0	C6orf146	4018536	0.351000	0.24887	0.297000	0.24988	0.263000	0.26337	0.157000	0.16402	0.340000	0.23745	0.467000	0.42956	CTT	.	.	.	none		0.284	FAM217A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352577.2	NM_173563	
HIST1H4E	8367	hgsc.bcm.edu	37	6	26204932	26204932	+	Silent	SNP	T	T	C	rs147263244		TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr6:26204932T>C	ENST00000360441.4	+	1	75	c.60T>C	c.(58-60)cgT>cgC	p.R20R		NM_003545.3	NP_003536.1	P62805	H4_HUMAN	histone cluster 1, H4e	20					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	18		all_hematologic(11;0.196)				AGCGTCACCGTAAGGTCCTGC	0.552																																					p.R20R		Atlas-SNP	.											.	HIST1H4E	22	.	0			c.T60C						PASS	.						86.0	85.0	85.0					6																	26204932		2203	4300	6503	SO:0001819	synonymous_variant	8367	exon1			TCACCGTAAGGTC	Z80787	CCDS4593.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198518	ENSG00000276966		"""Histones / Replication-dependent"""	4790	protein-coding gene	gene with protein product		602830	"""H4 histone family, member J"", ""histone 1, H4e"""	H4FJ		9119399, 12408966	Standard	NM_003545		Approved	H4/j	uc003ngy.3	P62805	OTTHUMG00000014441	ENST00000360441.4:c.60T>C	chr6.hg19:g.26204932T>C		92.0	0.0	.		104.0	46.0	.	NM_003545	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	ENST00000360441.4	hg19	CCDS4593.1																																																																																			.	T|1.000;A|0.000	.	alt		0.552	HIST1H4E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040104.1	NM_003545	
GTF2H4	2968	hgsc.bcm.edu	37	6	30877807	30877807	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr6:30877807T>A	ENST00000259895.4	+	4	564	c.341T>A	c.(340-342)tTc>tAc	p.F114Y	GTF2H4_ENST00000539324.1_Missense_Mutation_p.F58Y|GTF2H4_ENST00000376316.2_Missense_Mutation_p.F114Y|RN7SL175P_ENST00000580375.1_RNA	NM_001517.4	NP_001508.1	Q92759	TF2H4_HUMAN	general transcription factor IIH, polypeptide 4, 52kDa	114					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)	ATP-dependent DNA helicase activity (GO:0004003)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11						AACCCCATTTTCCGCCAGAAC	0.567								Nucleotide excision repair (NER)																													p.F114Y		Atlas-SNP	.											.	GTF2H4	38	.	0			c.T341A						PASS	.						115.0	132.0	126.0					6																	30877807		1510	2708	4218	SO:0001583	missense	2968	exon4			CCATTTTCCGCCA	Y07595	CCDS34386.1	6p21.3	2012-11-05	2002-08-29		ENSG00000213780	ENSG00000213780		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4658	protein-coding gene	gene with protein product		601760	"""general transcription factor IIH, polypeptide 4 (52kD subunit)"""			9118947	Standard	NM_001517		Approved	TFB2, TFIIH, P52	uc003nsa.1	Q92759	OTTHUMG00000031043	ENST00000259895.4:c.341T>A	chr6.hg19:g.30877807T>A	ENSP00000259895:p.Phe114Tyr	75.0	0.0	.		77.0	22.0	.	NM_001517	B4DTJ5|Q76KU4	Missense_Mutation	SNP	ENST00000259895.4	hg19	CCDS34386.1	.	.	.	.	.	.	.	.	.	.	T	29.6	5.016695	0.93404	.	.	ENSG00000213780	ENST00000259895;ENST00000539324;ENST00000376316;ENST00000453897	T;T;T;T	0.60299	0.2;0.2;0.2;0.2	5.6	5.6	0.85130	.	0.000000	0.64402	U	0.000001	T	0.68641	0.3023	M	0.83012	2.62	0.80722	D	1	D;D;P;P	0.63046	0.992;0.959;0.825;0.825	P;P;P;P	0.61397	0.888;0.71;0.467;0.467	T	0.73392	-0.3997	10	0.51188	T	0.08	-11.768	13.7555	0.62935	0.0:0.0:0.0:1.0	.	120;58;114;114	B4DNU0;B4DTJ5;Q53HH3;Q92759	.;.;.;TF2H4_HUMAN	Y	114;58;114;114	ENSP00000259895:F114Y;ENSP00000442700:F58Y;ENSP00000365493:F114Y;ENSP00000410160:F114Y	ENSP00000259895:F114Y	F	+	2	0	GTF2H4	30985786	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.991000	0.76232	2.130000	0.65690	0.482000	0.46254	TTC	.	.	.	none		0.567	GTF2H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076044.3	NM_001517	
SPDEF	25803	hgsc.bcm.edu	37	6	34508841	34508841	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr6:34508841G>A	ENST00000374037.3	-	3	968	c.554C>T	c.(553-555)gCc>gTc	p.A185V	SPDEF_ENST00000544425.1_Missense_Mutation_p.A185V	NM_012391.2	NP_036523.1	O95238	SPDEF_HUMAN	SAM pointed domain containing ETS transcription factor	185	PNT. {ECO:0000255|PROSITE- ProRule:PRU00762}.				cell differentiation (GO:0030154)|intestinal epithelial cell development (GO:0060576)|lung goblet cell differentiation (GO:0060480)|multicellular organismal development (GO:0007275)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell fate commitment (GO:0010455)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)	15						CTCCGACATGGCGCACAGCTC	0.652																																					p.A185V		Atlas-SNP	.											.	SPDEF	34	.	0			c.C554T						PASS	.						33.0	32.0	32.0					6																	34508841		2202	4299	6501	SO:0001583	missense	25803	exon3			GACATGGCGCACA	AF071538	CCDS4794.1, CCDS59013.1	6p21.3	2013-08-07	2013-08-07		ENSG00000124664	ENSG00000124664			17257	protein-coding gene	gene with protein product		608144	"""SAM pointed domain containing ets transcription factor"""			10625666, 6857767	Standard	NM_012391		Approved	PDEF, bA375E1.3	uc003ojq.2	O95238	OTTHUMG00000014548	ENST00000374037.3:c.554C>T	chr6.hg19:g.34508841G>A	ENSP00000363149:p.Ala185Val	68.0	0.0	.		57.0	23.0	.	NM_001252294	B4DWH8|F5H778	Missense_Mutation	SNP	ENST00000374037.3	hg19	CCDS4794.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.319042	0.81469	.	.	ENSG00000124664	ENST00000374037;ENST00000544425	T;T	0.32023	1.47;1.47	5.65	4.77	0.60923	Sterile alpha motif/pointed domain (2);Pointed domain (3);	0.358823	0.31636	N	0.007318	T	0.26376	0.0644	M	0.73962	2.25	0.52099	D	0.999947	P;P	0.44521	0.837;0.521	B;B	0.42593	0.392;0.272	T	0.09185	-1.0686	10	0.46703	T	0.11	.	15.4502	0.75268	0.0:0.0:0.8599:0.1401	.	185;185	F5H778;O95238	.;SPDEF_HUMAN	V	185	ENSP00000363149:A185V;ENSP00000442715:A185V	ENSP00000363149:A185V	A	-	2	0	SPDEF	34616819	1.000000	0.71417	0.989000	0.46669	0.971000	0.66376	6.742000	0.74843	1.342000	0.45619	0.561000	0.74099	GCC	.	.	.	none		0.652	SPDEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040246.1	NM_012391	
GPR110	266977	hgsc.bcm.edu	37	6	46973599	46973599	+	Silent	SNP	C	C	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr6:46973599C>A	ENST00000371253.2	-	13	2762	c.2547G>T	c.(2545-2547)ctG>ctT	p.L849L	GPR110_ENST00000449332.2_5'UTR|GPR110_ENST00000283297.5_Silent_p.L652L	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	849					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						ACTTGTTGAACAGAAGTTGTC	0.373																																					p.L849L		Atlas-SNP	.											.	GPR110	102	.	0			c.G2547T						PASS	.						72.0	59.0	64.0					6																	46973599		2203	4300	6503	SO:0001819	synonymous_variant	266977	exon13			GTTGAACAGAAGT	AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.2547G>T	chr6.hg19:g.46973599C>A		69.0	0.0	.		75.0	29.0	.	NM_153840	Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Silent	SNP	ENST00000371253.2	hg19	CCDS34471.1																																																																																			.	.	.	none		0.373	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040810.2	NM_153840	
ARHGAP18	93663	hgsc.bcm.edu	37	6	129963090	129963090	+	Silent	SNP	G	G	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr6:129963090G>T	ENST00000368149.2	-	2	275	c.187C>A	c.(187-189)Cga>Aga	p.R63R		NM_033515.2	NP_277050.2			Rho GTPase activating protein 18											NS(2)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(3)	18				OV - Ovarian serous cystadenocarcinoma(136;0.0621)|GBM - Glioblastoma multiforme(226;0.0638)|all cancers(137;0.074)		GAAATTGATCGATCAAATGGA	0.388																																					p.R63R		Atlas-SNP	.											.	ARHGAP18	52	.	0			c.C187A						PASS	.						141.0	138.0	139.0					6																	129963090		2203	4300	6503	SO:0001819	synonymous_variant	93663	exon2			TTGATCGATCAAA	AB053293	CCDS34535.1	6q23.1	2011-06-29			ENSG00000146376	ENSG00000146376		"""Rho GTPase activating proteins"""	21035	protein-coding gene	gene with protein product		613351					Standard	NM_033515		Approved	MacGAP, bA307O14.2	uc003qbr.3	Q8N392	OTTHUMG00000015547	ENST00000368149.2:c.187C>A	chr6.hg19:g.129963090G>T		90.0	0.0	.		98.0	6.0	.	NM_033515		Silent	SNP	ENST00000368149.2	hg19	CCDS34535.1																																																																																			.	.	.	none		0.388	ARHGAP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042185.2	NM_033515	
UTRN	7402	hgsc.bcm.edu	37	6	144744729	144744729	+	Silent	SNP	C	C	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr6:144744729C>A	ENST00000367545.3	+	4	279	c.279C>A	c.(277-279)gtC>gtA	p.V93V		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	93	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TAAATAACGTCAACAGAGTGC	0.413																																					p.V93V		Atlas-SNP	.											.	UTRN	327	.	0			c.C279A						PASS	.						204.0	179.0	187.0					6																	144744729		2203	4300	6503	SO:0001819	synonymous_variant	7402	exon4			TAACGTCAACAGA	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.279C>A	chr6.hg19:g.144744729C>A		80.0	0.0	.		73.0	27.0	.	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Silent	SNP	ENST00000367545.3	hg19	CCDS34547.1																																																																																			.	.	.	none		0.413	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
SCAF8	22828	hgsc.bcm.edu	37	6	155153549	155153549	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr6:155153549A>G	ENST00000367178.3	+	20	3412	c.2836A>G	c.(2836-2838)Att>Gtt	p.I946V	SCAF8_ENST00000417268.1_Missense_Mutation_p.I946V|TIAM2_ENST00000461783.3_5'Flank|SCAF8_ENST00000367186.4_Missense_Mutation_p.I1012V	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	946	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						ACAGCCTGGAATTCCACCCCA	0.502																																					p.I946V		Atlas-SNP	.											.	SCAF8	122	.	0			c.A2836G						PASS	.						148.0	160.0	156.0					6																	155153549		2203	4300	6503	SO:0001583	missense	22828	exon20			CCTGGAATTCCAC	AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.2836A>G	chr6.hg19:g.155153549A>G	ENSP00000356146:p.Ile946Val	115.0	0.0	.		83.0	31.0	.	NM_014892	B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Missense_Mutation	SNP	ENST00000367178.3	hg19	CCDS5247.1	.	.	.	.	.	.	.	.	.	.	A	1.796	-0.478336	0.04414	.	.	ENSG00000213079	ENST00000367178;ENST00000417268;ENST00000367186	T;T;T	0.42513	0.99;0.99;0.97	5.58	-2.13	0.07144	.	0.310943	0.25708	U	0.028827	T	0.07098	0.0180	N	0.19112	0.55	0.21105	N	0.999786	P;P;P	0.35272	0.493;0.493;0.493	B;B;B	0.32928	0.155;0.155;0.155	T	0.40924	-0.9537	10	0.15952	T	0.53	.	6.918	0.24371	0.4362:0.4171:0.0598:0.087	.	991;1012;946	B7Z876;B7Z888;Q9UPN6	.;.;SCAF8_HUMAN	V	946;946;1012	ENSP00000356146:I946V;ENSP00000413098:I946V;ENSP00000356154:I1012V	ENSP00000356146:I946V	I	+	1	0	SCAF8	155195241	1.000000	0.71417	0.828000	0.32881	0.019000	0.09904	0.787000	0.26858	-0.163000	0.10946	-1.089000	0.02181	ATT	.	.	.	none		0.502	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042798.1	NM_014892	
MAGI2	9863	hgsc.bcm.edu	37	7	77885345	77885345	+	Silent	SNP	T	T	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr7:77885345T>A	ENST00000354212.4	-	10	2215	c.1962A>T	c.(1960-1962)gtA>gtT	p.V654V	MAGI2_ENST00000419488.1_Silent_p.V654V|MAGI2_ENST00000535697.1_Silent_p.V491V|MAGI2_ENST00000522391.1_Silent_p.V654V|MAGI2_ENST00000536571.1_Silent_p.V486V	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	654	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TCAGGTTCTGTACATTCTGCT	0.458																																					p.V654V		Atlas-SNP	.											.	MAGI2	246	.	0			c.A1962T						PASS	.						72.0	60.0	64.0					7																	77885345		2203	4300	6503	SO:0001819	synonymous_variant	9863	exon10			GTTCTGTACATTC	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.1962A>T	chr7.hg19:g.77885345T>A		73.0	0.0	.		71.0	34.0	.	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Silent	SNP	ENST00000354212.4	hg19	CCDS5594.1																																																																																			.	.	.	none		0.458	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
SEMA3E	9723	hgsc.bcm.edu	37	7	83023614	83023614	+	Splice_Site	SNP	C	C	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr7:83023614C>A	ENST00000307792.3	-	13	1966	c.1499G>T	c.(1498-1500)cGg>cTg	p.R500L	SEMA3E_ENST00000427262.1_Splice_Site_p.R440L	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	500	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				aGAACTTACCCGCTTTGAAGA	0.313																																					p.R500L		Atlas-SNP	.											.	SEMA3E	125	.	0			c.G1499T						PASS	.						46.0	46.0	46.0					7																	83023614		2203	4297	6500	SO:0001630	splice_region_variant	9723	exon13			CTTACCCGCTTTG	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.1500+1G>T	chr7.hg19:g.83023614C>A		48.0	0.0	.		74.0	25.0	.	NM_012431	B4E1P1|Q75M94|Q75M97	Missense_Mutation	SNP	ENST00000307792.3	hg19	CCDS34674.1	.	.	.	.	.	.	.	.	.	.	C	32	5.174122	0.94807	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514	T;T	0.11712	2.75;2.75	5.97	5.97	0.96955	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.35422	0.0931	M	0.72479	2.2	0.80722	D	1	D	0.69078	0.997	D	0.71656	0.974	T	0.00920	-1.1514	10	0.62326	D	0.03	.	20.4324	0.99085	0.0:1.0:0.0:0.0	.	500	O15041	SEM3E_HUMAN	L	500;440;500	ENSP00000303212:R500L;ENSP00000405052:R440L	ENSP00000303212:R500L	R	-	2	0	SEMA3E	82861550	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	5.122000	0.64697	2.833000	0.97629	0.585000	0.79938	CGG	.	.	.	none		0.313	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	Missense_Mutation
GATAD1	57798	hgsc.bcm.edu	37	7	92085728	92085728	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr7:92085728T>A	ENST00000287957.3	+	5	939	c.662T>A	c.(661-663)tTt>tAt	p.F221Y	AC007566.10_ENST00000427458.1_RNA	NM_021167.4	NP_066990.3	Q8WUU5	GATD1_HUMAN	GATA zinc finger domain containing 1	221						nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|lung(3)	6	all_cancers(62;1.63e-10)|all_epithelial(64;8.33e-10)|Breast(17;0.00311)|all_lung(186;0.0498)|Lung NSC(181;0.0676)		STAD - Stomach adenocarcinoma(171;4.51e-05)|GBM - Glioblastoma multiforme(5;8.83e-05)|all cancers(6;0.000136)|Lung(22;0.123)|Epithelial(20;0.179)|LUSC - Lung squamous cell carcinoma(200;0.225)			TACTTGGAATTTGTTTGTCAT	0.433																																					p.F221Y		Atlas-SNP	.											.	GATAD1	10	.	0			c.T662A						PASS	.						163.0	148.0	153.0					7																	92085728		2203	4300	6503	SO:0001583	missense	57798	exon5			TGGAATTTGTTTG		CCDS5625.1	7q21-q22	2014-09-17			ENSG00000157259	ENSG00000157259		"""GATA zinc finger domain containing"""	29941	protein-coding gene	gene with protein product	"""ocular development associated gene"""	614518				12062807	Standard	NM_021167		Approved	ODAG, RG083M05.2, FLJ22489	uc003ulx.2	Q8WUU5	OTTHUMG00000131201	ENST00000287957.3:c.662T>A	chr7.hg19:g.92085728T>A	ENSP00000287957:p.Phe221Tyr	73.0	0.0	.		70.0	33.0	.	NM_021167	B2RE37|D6W5Q5|Q8N5Y5|Q99995|Q9H689	Missense_Mutation	SNP	ENST00000287957.3	hg19	CCDS5625.1	.	.	.	.	.	.	.	.	.	.	T	35	5.436365	0.96168	.	.	ENSG00000157259	ENST00000287957	T	0.68624	-0.34	5.77	5.77	0.91146	.	0.046872	0.85682	D	0.000000	T	0.72598	0.3480	M	0.82193	2.58	0.80722	D	1	P	0.40250	0.709	B	0.40410	0.328	T	0.78016	-0.2369	10	0.87932	D	0	-14.2119	16.1448	0.81559	0.0:0.0:0.0:1.0	.	221	Q8WUU5	GATD1_HUMAN	Y	221	ENSP00000287957:F221Y	ENSP00000287957:F221Y	F	+	2	0	GATAD1	91923664	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.010000	0.88615	2.210000	0.71456	0.472000	0.43445	TTT	.	.	.	none		0.433	GATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253929.2	NM_021167	
CUX1	1523	hgsc.bcm.edu	37	7	101891877	101891877	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr7:101891877A>T	ENST00000292535.7	+	24	4111	c.4073A>T	c.(4072-4074)cAg>cTg	p.Q1358L	CUX1_ENST00000393824.3_Intron|CUX1_ENST00000546411.2_Missense_Mutation_p.Q1256L|CUX1_ENST00000360264.3_Missense_Mutation_p.Q1369L|CUX1_ENST00000556210.1_Missense_Mutation_p.Q1200L|CUX1_ENST00000550008.2_Missense_Mutation_p.Q1302L|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000549414.2_Missense_Mutation_p.Q1336L|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000547394.2_Intron	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	1358					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						CCCAAGTCTCAGGGAGAGGCC	0.791																																					p.Q1369L		Atlas-SNP	.											.	CUX1	253	.	0			c.A4106T						PASS	.						3.0	3.0	3.0					7																	101891877		1346	2553	3899	SO:0001583	missense	1523	exon24			AGTCTCAGGGAGA	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.4073A>T	chr7.hg19:g.101891877A>T	ENSP00000292535:p.Gln1358Leu	50.0	0.0	.		38.0	14.0	.	NM_001202543	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	hg19	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	A	13.22	2.172495	0.38315	.	.	ENSG00000257923	ENST00000360264;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T	0.61158	0.17;0.18;0.16;0.13;0.14;0.15	3.09	3.09	0.35607	.	7.025930	0.01253	U	0.008923	T	0.71048	0.3294	L	0.44542	1.39	0.80722	D	1	P;P	0.42039	0.659;0.769	P;P	0.61397	0.775;0.888	T	0.54957	-0.8215	10	0.31617	T	0.26	.	11.7319	0.51741	1.0:0.0:0.0:0.0	.	1358;1369	P39880;P39880-3	CUX1_HUMAN;.	L	1369;1358;1336;1302;1256;1200	ENSP00000353401:Q1369L;ENSP00000292535:Q1358L;ENSP00000446630:Q1336L;ENSP00000447373:Q1302L;ENSP00000450125:Q1256L;ENSP00000451558:Q1200L	ENSP00000292535:Q1358L	Q	+	2	0	CUX1	101678597	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	2.124000	0.42006	1.398000	0.46701	0.402000	0.26972	CAG	.	.	.	none		0.791	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
HIPK2	28996	hgsc.bcm.edu	37	7	139305300	139305300	+	Silent	SNP	T	T	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr7:139305300T>C	ENST00000406875.3	-	7	1723	c.1629A>G	c.(1627-1629)tcA>tcG	p.S543S	HIPK2_ENST00000342645.6_Silent_p.S543S|HIPK2_ENST00000428878.2_Silent_p.S543S	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	543	Interaction with SKI and SMAD1.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					TCTGGAAACATGATTTGACGC	0.502											OREG0018361	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S543S		Atlas-SNP	.											.	HIPK2	192	.	0			c.A1629G						PASS	.						279.0	262.0	267.0					7																	139305300		2041	4230	6271	SO:0001819	synonymous_variant	28996	exon7			GAAACATGATTTG	AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.1629A>G	chr7.hg19:g.139305300T>C		73.0	0.0	.	1647	98.0	43.0	.	NM_022740	Q75MR7|Q8WWI4|Q9H2Y1	Silent	SNP	ENST00000406875.3	hg19																																																																																				.	.	.	none		0.502	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349430.3	NM_022740	
DPP6	1804	hgsc.bcm.edu	37	7	154684050	154684050	+	Missense_Mutation	SNP	C	C	A	rs186233086		TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr7:154684050C>A	ENST00000377770.3	+	26	2599	c.2458C>A	c.(2458-2460)Ccg>Acg	p.P820T	DPP6_ENST00000404039.1_Missense_Mutation_p.P756T|DPP6_ENST00000427557.1_Missense_Mutation_p.P713T|DPP6_ENST00000332007.3_Missense_Mutation_p.P758T			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	820					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			GCAGATTTACCCGGACGAAAG	0.517																																					p.P820T	NSCLC(125;1384 1783 2490 7422 34254)	Atlas-SNP	.											.	DPP6	383	.	0			c.C2458A						PASS	.						87.0	92.0	91.0					7																	154684050		2008	4163	6171	SO:0001583	missense	1804	exon26			ATTTACCCGGACG	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.2458C>A	chr7.hg19:g.154684050C>A	ENSP00000367001:p.Pro820Thr	99.0	0.0	.		115.0	49.0	.	NM_130797		Missense_Mutation	SNP	ENST00000377770.3	hg19		.	.	.	.	.	.	.	.	.	.	C	15.88	2.962931	0.53507	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.54675	0.56;0.56;0.56;0.56	4.66	4.66	0.58398	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.66819	0.2828	L	0.53561	1.675	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.986;0.999;1.0;0.999	T	0.62077	-0.6930	10	0.18710	T	0.47	-16.57	17.5681	0.87926	0.0:1.0:0.0:0.0	.	713;758;820;756	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	T	756;820;758;713	ENSP00000385578:P756T;ENSP00000367001:P820T;ENSP00000328226:P758T;ENSP00000397303:P713T	ENSP00000328226:P758T	P	+	1	0	DPP6	154314983	1.000000	0.71417	0.984000	0.44739	0.083000	0.17756	6.962000	0.76048	2.147000	0.66899	0.655000	0.94253	CCG	.	C|1.000;T|0.000	.	alt		0.517	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797	
DLC1	10395	hgsc.bcm.edu	37	8	12957624	12957624	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr8:12957624C>G	ENST00000276297.4	-	9	2631	c.2222G>C	c.(2221-2223)aGc>aCc	p.S741T	DLC1_ENST00000358919.2_Missense_Mutation_p.S304T|DLC1_ENST00000512044.2_Missense_Mutation_p.S338T|DLC1_ENST00000520226.1_Missense_Mutation_p.S230T	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	741	Focal adhesion-targeting (FAT).|Poly-Ser.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						GCTGCTGCTGCTGGTCTGCGT	0.627																																					p.S741T		Atlas-SNP	.											DLC1,bladder,carcinoma,0,3	DLC1	411	.	0			c.G2222C						PASS	.						56.0	47.0	50.0					8																	12957624		2203	4300	6503	SO:0001583	missense	10395	exon9			CTGCTGCTGGTCT	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.2222G>C	chr8.hg19:g.12957624C>G	ENSP00000276297:p.Ser741Thr	51.0	0.0	.		63.0	6.0	.	NM_182643	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	hg19	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.320479	0.81469	.	.	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000512044;ENST00000520226	T;T;T;T	0.07688	3.42;3.19;3.19;3.17	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.31979	0.0814	M	0.80422	2.495	0.80722	D	1	D;B;D	0.65815	0.995;0.103;0.99	P;B;D	0.72982	0.795;0.132;0.979	T	0.09975	-1.0650	10	0.66056	D	0.02	.	17.9274	0.88987	0.0:1.0:0.0:0.0	.	741;338;304	Q96QB1;E9PDZ8;Q96QB1-1	RHG07_HUMAN;.;.	T	741;304;338;230	ENSP00000276297:S741T;ENSP00000351797:S304T;ENSP00000422595:S338T;ENSP00000428028:S230T	ENSP00000276297:S741T	S	-	2	0	DLC1	13001995	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.462000	0.80851	2.527000	0.85204	0.561000	0.74099	AGC	.	.	.	none		0.627	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094	
DUSP4	1846	hgsc.bcm.edu	37	8	29195962	29195962	+	Silent	SNP	G	G	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr8:29195962G>A	ENST00000240100.2	-	3	1025	c.636C>T	c.(634-636)gcC>gcT	p.A212A	DUSP4_ENST00000240101.2_Silent_p.A121A	NM_001394.6	NP_001385.1	Q13115	DUS4_HUMAN	dual specificity phosphatase 4	212	Tyrosine-protein phosphatase.				endoderm formation (GO:0001706)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein dephosphorylation (GO:0006470)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			endometrium(1)|large_intestine(1)|lung(4)	6				KIRC - Kidney renal clear cell carcinoma(542;0.094)|Kidney(114;0.113)		TGTCTCTCCGGGCAGCATGGT	0.562																																					p.A212A		Atlas-SNP	.											.	DUSP4	58	.	0			c.C636T						PASS	.						89.0	69.0	76.0					8																	29195962		2203	4300	6503	SO:0001819	synonymous_variant	1846	exon3			TCTCCGGGCAGCA	U21108	CCDS6072.1, CCDS6073.1	8p12-p11	2011-06-09			ENSG00000120875	ENSG00000120875		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3070	protein-coding gene	gene with protein product	"""VH1 homologous phosphatase 2"", ""MAP kinase phosphatase 2"""	602747				7535768, 9205128	Standard	NM_001394		Approved	HVH2, MKP-2, TYP	uc003xhm.3	Q13115	OTTHUMG00000133395	ENST00000240100.2:c.636C>T	chr8.hg19:g.29195962G>A		77.0	0.0	.		74.0	27.0	.	NM_001394	B2RBU5|D3DSU4|G5E930|Q13524	Silent	SNP	ENST00000240100.2	hg19	CCDS6072.1																																																																																			.	.	.	none		0.562	DUSP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257249.1	NM_001394	
COL14A1	7373	hgsc.bcm.edu	37	8	121170481	121170481	+	Silent	SNP	T	T	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr8:121170481T>A	ENST00000297848.3	+	3	471	c.201T>A	c.(199-201)acT>acA	p.T67T	COL14A1_ENST00000537875.1_Silent_p.T67T|COL14A1_ENST00000309791.4_Silent_p.T67T|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000247781.3_Silent_p.T67T	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TGACTCCAACTTCAGGTAAAA	0.348																																					p.T67T		Atlas-SNP	.											.	COL14A1	292	.	0			c.T201A						PASS	.						61.0	62.0	61.0					8																	121170481		2203	4299	6502	SO:0001819	synonymous_variant	7373	exon3			TCCAACTTCAGGT		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.201T>A	chr8.hg19:g.121170481T>A		109.0	0.0	.		100.0	48.0	.	NM_021110		Silent	SNP	ENST00000297848.3	hg19	CCDS34938.1																																																																																			.	.	.	none		0.348	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
TTC39B	158219	hgsc.bcm.edu	37	9	15211355	15211355	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr9:15211355T>C	ENST00000512701.2	-	5	559	c.523A>G	c.(523-525)Att>Gtt	p.I175V	TTC39B_ENST00000380850.4_Missense_Mutation_p.I175V|TTC39B_ENST00000355694.2_Missense_Mutation_p.I109V|TTC39B_ENST00000541445.1_Missense_Mutation_p.I109V|TTC39B_ENST00000582994.1_5'Flank|TTC39B_ENST00000297615.5_Missense_Mutation_p.I106V|TTC39B_ENST00000507285.1_Missense_Mutation_p.I10V|TTC39B_ENST00000507993.1_Missense_Mutation_p.I10V			Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	175										NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)	21						AACACCACAATGGTACTGTAG	0.453																																					p.I175V		Atlas-SNP	.											.	TTC39B	83	.	0			c.A523G						PASS	.						149.0	127.0	135.0					9																	15211355		2203	4300	6503	SO:0001583	missense	158219	exon5			CCACAATGGTACT	AK091187	CCDS6477.1, CCDS6477.2, CCDS55294.1, CCDS55295.1, CCDS55296.1	9p22.2	2013-01-11	2008-06-23	2008-06-23	ENSG00000155158	ENSG00000155158		"""Tetratricopeptide (TTC) repeat domain containing"""	23704	protein-coding gene	gene with protein product		613574	"""chromosome 9 open reading frame 52"""	C9orf52			Standard	NM_001168339		Approved	FLJ33868	uc003zlr.2	Q5VTQ0	OTTHUMG00000019581	ENST00000512701.2:c.523A>G	chr9.hg19:g.15211355T>C	ENSP00000422496:p.Ile175Val	129.0	0.0	.		123.0	47.0	.	NM_001168340	A5PLN1|B4DQ10|B4DQX4|B4DW93|Q8IVR7|Q8IXZ6|Q8N267	Missense_Mutation	SNP	ENST00000512701.2	hg19	CCDS6477.2	.	.	.	.	.	.	.	.	.	.	T	22.3	4.269430	0.80469	.	.	ENSG00000155158	ENST00000380850;ENST00000297615;ENST00000355694;ENST00000512701;ENST00000507285;ENST00000507993;ENST00000541445	T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0	5.79	5.79	0.91817	.	0.058027	0.64402	N	0.000002	T	0.60599	0.2281	M	0.63428	1.95	0.80722	D	1	P;P;D;P;P	0.65815	0.51;0.565;0.995;0.597;0.597	B;P;D;P;P	0.78314	0.327;0.456;0.991;0.53;0.53	T	0.55805	-0.8083	10	0.23302	T	0.38	-18.5916	15.7917	0.78369	0.0:0.0:0.0:1.0	.	106;175;175;109;109	F5H705;E9PAQ9;E9PE60;A5PLN1;Q5VTQ0	.;.;.;.;TT39B_HUMAN	V	175;106;109;175;10;10;109	ENSP00000370231:I175V;ENSP00000297615:I106V;ENSP00000347920:I109V;ENSP00000422496:I175V;ENSP00000426539:I10V;ENSP00000423392:I10V;ENSP00000442880:I109V	ENSP00000297615:I106V	I	-	1	0	TTC39B	15201355	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	7.701000	0.84566	2.218000	0.71995	0.533000	0.62120	ATT	.	.	.	none		0.453	TTC39B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051758.3	NM_152574	
FOCAD	54914	hgsc.bcm.edu	37	9	20740261	20740261	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr9:20740261T>G	ENST00000380249.1	+	7	678	c.314T>G	c.(313-315)aTt>aGt	p.I105S	FOCAD_ENST00000338382.6_Missense_Mutation_p.I105S	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	105						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											ATAAAAGCCATTATGCACTTA	0.313																																					p.I105S		Atlas-SNP	.											.	.	.	.	0			c.T314G						PASS	.						76.0	78.0	77.0					9																	20740261		2203	4297	6500	SO:0001583	missense	54914	exon7			AAGCCATTATGCA	AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.314T>G	chr9.hg19:g.20740261T>G	ENSP00000369599:p.Ile105Ser	357.0	0.0	.		449.0	185.0	.	NM_017794	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	ENST00000380249.1	hg19	CCDS34993.1	.	.	.	.	.	.	.	.	.	.	T	19.26	3.793357	0.70452	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.24538	1.85;1.85	5.54	5.54	0.83059	Domain of unknown function DUF3730 (1);	0.320980	0.32819	N	0.005603	T	0.25419	0.0618	N	0.19112	0.55	0.43191	D	0.995023	P	0.46512	0.879	P	0.48598	0.583	T	0.04017	-1.0984	10	0.87932	D	0	-3.8635	13.8993	0.63792	0.0:0.0:0.0:1.0	.	105	Q5VW36	K1797_HUMAN	S	105	ENSP00000369599:I105S;ENSP00000344307:I105S	ENSP00000344307:I105S	I	+	2	0	KIAA1797	20730261	1.000000	0.71417	0.949000	0.38748	0.844000	0.47949	3.640000	0.54350	2.103000	0.63969	0.454000	0.30748	ATT	.	.	.	none		0.313	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794	
ZFP37	7539	hgsc.bcm.edu	37	9	115805449	115805449	+	Silent	SNP	A	A	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr9:115805449A>G	ENST00000374227.3	-	4	1476	c.1449T>C	c.(1447-1449)caT>caC	p.H483H	ZFP37_ENST00000555206.1_Silent_p.H484H|ZFP37_ENST00000553380.1_Silent_p.H498H	NM_001282515.1|NM_001282518.1	NP_001269444.1|NP_001269447.1	Q9Y6Q3	ZFP37_HUMAN	ZFP37 zinc finger protein	483					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						TCTCCTTAGTATGAGTTCTTT	0.373																																					p.H483H		Atlas-SNP	.											.	ZFP37	93	.	0			c.T1449C						PASS	.						75.0	73.0	74.0					9																	115805449		2203	4300	6503	SO:0001819	synonymous_variant	7539	exon4			CTTAGTATGAGTT	AF022158	CCDS6787.1, CCDS65109.1, CCDS65110.1	9q32	2013-01-08	2012-11-27		ENSG00000136866	ENSG00000136866		"""Zinc fingers, C2H2-type"", ""-"""	12863	protein-coding gene	gene with protein product		602951	"""zinc finger protein homologous to Zfp37 in mouse"", ""zinc finger protein 37 homolog (mouse)"""				Standard	NM_001282515		Approved	ZNF906	uc004bgm.1	Q9Y6Q3	OTTHUMG00000021019	ENST00000374227.3:c.1449T>C	chr9.hg19:g.115805449A>G		60.0	0.0	.		71.0	18.0	.	NM_003408	A0AVJ9|B4DVX4|G3V3L7|Q5T7Q4	Silent	SNP	ENST00000374227.3	hg19	CCDS6787.1																																																																																			.	.	.	none		0.373	ZFP37-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055439.1	NM_003408	
PHYHD1	254295	hgsc.bcm.edu	37	9	131689459	131689459	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr9:131689459A>G	ENST00000372592.3	+	4	1109	c.176A>G	c.(175-177)gAg>gGg	p.E59G	PHYHD1_ENST00000353176.5_Missense_Mutation_p.E59G|PHYHD1_ENST00000421063.2_Missense_Mutation_p.E59G|PHYHD1_ENST00000308941.5_Missense_Mutation_p.E59G	NM_001100876.1	NP_001094346.1	Q5SRE7	PHYD1_HUMAN	phytanoyl-CoA dioxygenase domain containing 1	59							dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|skin(1)|stomach(3)	10						CAGGAAGAGGAGCAGCTTCGA	0.582											OREG0019526	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E59G		Atlas-SNP	.											.	PHYHD1	29	.	0			c.A176G						PASS	.						137.0	118.0	124.0					9																	131689459		2203	4300	6503	SO:0001583	missense	254295	exon2			AAGAGGAGCAGCT	BC051300	CCDS6914.1, CCDS43885.1, CCDS43886.1	9q34.13	2010-08-13			ENSG00000175287	ENSG00000175287			23396	protein-coding gene	gene with protein product						12477932	Standard	NM_174933		Approved	MGC16638	uc004bwp.2	Q5SRE7	OTTHUMG00000020764	ENST00000372592.3:c.176A>G	chr9.hg19:g.131689459A>G	ENSP00000361673:p.Glu59Gly	67.0	0.0	.	1589	71.0	37.0	.	NM_001100877	A6PWN9|A6PWP0|B3KT57|B4E3X8|Q5SRE9|Q5SRF0|Q7Z623|Q7Z7P9|Q96GM4	Missense_Mutation	SNP	ENST00000372592.3	hg19	CCDS43885.1	.	.	.	.	.	.	.	.	.	.	A	15.58	2.876179	0.51801	.	.	ENSG00000175287	ENST00000372592;ENST00000428610;ENST00000308941;ENST00000419552;ENST00000353176;ENST00000426694;ENST00000421063	D;D;D	0.89810	-2.54;-2.57;-2.57	5.32	5.32	0.75619	.	0.100735	0.64402	D	0.000003	D	0.90868	0.7131	M	0.73598	2.24	0.58432	D	0.999999	P;P;D	0.54397	0.734;0.605;0.966	B;B;P	0.49887	0.373;0.412;0.625	D	0.91285	0.5054	10	0.51188	T	0.08	-23.6398	14.0941	0.65008	1.0:0.0:0.0:0.0	.	59;59;59	Q5SRE7-2;Q5SRE7;Q5SRE7-3	.;PHYD1_HUMAN;.	G	59	ENSP00000361673:E59G;ENSP00000340945:E59G;ENSP00000409928:E59G	ENSP00000309515:E59G	E	+	2	0	PHYHD1	130729280	1.000000	0.71417	0.998000	0.56505	0.324000	0.28378	3.925000	0.56484	2.002000	0.58637	0.533000	0.62120	GAG	.	.	.	none		0.582	PHYHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054506.2	NM_174933	
DOLK	22845	hgsc.bcm.edu	37	9	131708203	131708203	+	Silent	SNP	G	G	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr9:131708203G>T	ENST00000372586.3	-	1	1695	c.1380C>A	c.(1378-1380)acC>acA	p.T460T	RP11-101E3.5_ENST00000482796.1_Intron|NUP188_ENST00000372577.2_5'Flank	NM_014908.3	NP_055723.1	Q9UPQ8	DOLK_HUMAN	dolichol kinase	460	CTP-binding.				cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|dolichyl monophosphate biosynthetic process (GO:0043048)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	dolichol kinase activity (GO:0004168)			breast(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	11						TCTCCCCCATGGTGCTACCGA	0.547																																					p.T460T		Atlas-SNP	.											.	DOLK	39	.	0			c.C1380A						PASS	.						85.0	86.0	86.0					9																	131708203		2203	4300	6503	SO:0001819	synonymous_variant	22845	exon1			CCCCATGGTGCTA	AB029017	CCDS6915.1	9q34.13	2014-09-17	2007-02-09	2007-02-09	ENSG00000175283	ENSG00000175283			23406	protein-coding gene	gene with protein product	"""dolichol kinase 1"""	610746	"""transmembrane protein 15"""	TMEM15		12975309, 16923818	Standard	NM_014908		Approved	KIAA1094, DK1	uc004bwr.3	Q9UPQ8	OTTHUMG00000020765	ENST00000372586.3:c.1380C>A	chr9.hg19:g.131708203G>T		115.0	0.0	.		111.0	39.0	.	NM_014908	Q5SRE6	Silent	SNP	ENST00000372586.3	hg19	CCDS6915.1																																																																																			.	.	.	none		0.547	DOLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054515.1	NM_014908	
UPF2	26019	hgsc.bcm.edu	37	10	11998440	11998440	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr10:11998440T>A	ENST00000356352.2	-	12	2926	c.2453A>T	c.(2452-2454)aAt>aTt	p.N818I	UPF2_ENST00000357604.5_Missense_Mutation_p.N818I|UPF2_ENST00000397053.2_Missense_Mutation_p.N818I			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	818	MIF4G 3.|Sufficient for interaction with EIF4A1 and EIF1.|Sufficient for interaction with UPF3A and UPF3B.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				ATATTTCACATTCCAGATGTT	0.393																																					p.N818I		Atlas-SNP	.											.	UPF2	111	.	0			c.A2453T						PASS	.						151.0	152.0	152.0					10																	11998440		2203	4300	6503	SO:0001583	missense	26019	exon13			TTCACATTCCAGA	AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.2453A>T	chr10.hg19:g.11998440T>A	ENSP00000348708:p.Asn818Ile	84.0	0.0	.		90.0	39.0	.	NM_080599	A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	ENST00000356352.2	hg19	CCDS7086.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.433991	0.83776	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000397053	T;T;T	0.20463	2.07;2.07;2.07	5.53	5.53	0.82687	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.37517	0.1006	L	0.60957	1.885	0.80722	D	1	P	0.49862	0.929	P	0.57204	0.815	T	0.03728	-1.1009	10	0.33141	T	0.24	.	15.6297	0.76893	0.0:0.0:0.0:1.0	.	818	Q9HAU5	RENT2_HUMAN	I	818	ENSP00000348708:N818I;ENSP00000350221:N818I;ENSP00000380244:N818I	ENSP00000348708:N818I	N	-	2	0	UPF2	12038446	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.482000	0.81143	2.097000	0.63578	0.397000	0.26171	AAT	.	.	.	none		0.393	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046783.1		
UPF2	26019	hgsc.bcm.edu	37	10	11998442	11998442	+	Missense_Mutation	SNP	C	C	A	rs367800253		TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr10:11998442C>A	ENST00000356352.2	-	12	2924	c.2451G>T	c.(2449-2451)tgG>tgT	p.W817C	UPF2_ENST00000357604.5_Missense_Mutation_p.W817C|UPF2_ENST00000397053.2_Missense_Mutation_p.W817C			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	817	MIF4G 3.|Sufficient for interaction with EIF4A1 and EIF1.|Sufficient for interaction with UPF3A and UPF3B.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				ATTTCACATTCCAGATGTTTA	0.398																																					p.W817C		Atlas-SNP	.											.	UPF2	111	.	0			c.G2451T						PASS	.						150.0	152.0	152.0					10																	11998442		2203	4300	6503	SO:0001583	missense	26019	exon13			CACATTCCAGATG	AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.2451G>T	chr10.hg19:g.11998442C>A	ENSP00000348708:p.Trp817Cys	84.0	0.0	.		87.0	39.0	.	NM_080599	A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	ENST00000356352.2	hg19	CCDS7086.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.224664	0.79576	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000397053	T;T;T	0.22336	1.96;1.96;1.96	5.53	5.53	0.82687	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.46756	0.1409	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.19128	-1.0315	10	0.36615	T	0.2	.	19.4313	0.94768	0.0:1.0:0.0:0.0	.	817	Q9HAU5	RENT2_HUMAN	C	817	ENSP00000348708:W817C;ENSP00000350221:W817C;ENSP00000380244:W817C	ENSP00000348708:W817C	W	-	3	0	UPF2	12038448	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.277000	0.78572	2.596000	0.87737	0.484000	0.47621	TGG	.	.	.	none		0.398	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046783.1		
MYPN	84665	hgsc.bcm.edu	37	10	69918255	69918255	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr10:69918255T>A	ENST00000358913.5	+	7	1818	c.1330T>A	c.(1330-1332)Ttg>Atg	p.L444M	RN7SKP202_ENST00000410439.1_RNA|MYPN_ENST00000373675.3_Missense_Mutation_p.L444M|MYPN_ENST00000354393.2_Missense_Mutation_p.L169M|MYPN_ENST00000540630.1_Missense_Mutation_p.L444M	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	444	Ig-like 2.|Interaction with CARP.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						GCTACAAAATTTGTCAGCTTC	0.358																																					p.L444M		Atlas-SNP	.											.	MYPN	189	.	0			c.T1330A						PASS	.						87.0	86.0	86.0					10																	69918255		2203	4300	6503	SO:0001583	missense	84665	exon7			CAAAATTTGTCAG	AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.1330T>A	chr10.hg19:g.69918255T>A	ENSP00000351790:p.Leu444Met	84.0	0.0	.		91.0	34.0	.	NM_032578	Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	ENST00000358913.5	hg19	CCDS7275.1	.	.	.	.	.	.	.	.	.	.	T	16.03	3.007533	0.54361	.	.	ENSG00000138347	ENST00000354393;ENST00000542332;ENST00000358913;ENST00000540630;ENST00000373675	T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34	5.62	2.08	0.27032	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.181068	0.36482	N	0.002568	T	0.64249	0.2581	L	0.32530	0.975	0.37395	D	0.912605	D;D;D;D	0.67145	0.989;0.996;0.973;0.991	P;D;P;P	0.65010	0.847;0.931;0.822;0.906	T	0.63269	-0.6675	9	.	.	.	.	3.9856	0.09514	0.196:0.3257:0.0:0.4783	.	444;444;169;444	F5GWA6;Q86TC9-3;Q86TC9-2;Q86TC9	.;.;.;MYPN_HUMAN	M	169;169;444;444;444	ENSP00000346369:L169M;ENSP00000351790:L444M;ENSP00000441668:L444M;ENSP00000362779:L444M	.	L	+	1	2	MYPN	69588261	0.367000	0.25023	1.000000	0.80357	0.991000	0.79684	-0.022000	0.12480	0.427000	0.26145	-0.250000	0.11733	TTG	.	.	.	none		0.358	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578	
TET1	80312	hgsc.bcm.edu	37	10	70451494	70451494	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr10:70451494T>G	ENST00000373644.4	+	12	6543	c.6334T>G	c.(6334-6336)Tta>Gta	p.L2112V		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	2112					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						AGCATTAACATTAACCCATGA	0.458																																					p.L2112V		Atlas-SNP	.											.	TET1	255	.	0			c.T6334G						PASS	.						117.0	120.0	119.0					10																	70451494		2203	4300	6503	SO:0001583	missense	80312	exon12			TTAACATTAACCC	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.6334T>G	chr10.hg19:g.70451494T>G	ENSP00000362748:p.Leu2112Val	96.0	0.0	.		92.0	36.0	.	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	hg19	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	T	14.99	2.698882	0.48307	.	.	ENSG00000138336	ENST00000373644	T	0.06218	3.33	5.59	3.33	0.38152	.	1.030220	0.07660	N	0.933448	T	0.03136	0.0092	N	0.11870	0.19	0.26401	N	0.976415	B	0.24823	0.112	B	0.24006	0.05	T	0.45789	-0.9237	10	0.07325	T	0.83	.	2.4588	0.04536	0.1167:0.0943:0.2833:0.5057	.	2112	Q8NFU7	TET1_HUMAN	V	2112	ENSP00000362748:L2112V	ENSP00000362748:L2112V	L	+	1	2	TET1	70121500	1.000000	0.71417	0.992000	0.48379	0.967000	0.64934	0.736000	0.26130	0.966000	0.38159	0.460000	0.39030	TTA	.	.	.	none		0.458	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
C10orf11	83938	hgsc.bcm.edu	37	10	77795776	77795776	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr10:77795776G>A	ENST00000372499.1	+	2	273	c.58G>A	c.(58-60)Gga>Aga	p.G20R	C10orf11_ENST00000593699.1_3'UTR	NM_032024.3	NP_114413.1	Q9H2I8	CJ011_HUMAN	chromosome 10 open reading frame 11	20					melanocyte differentiation (GO:0030318)					endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	10	Prostate(51;0.0095)|all_epithelial(25;0.0221)					GTCACTGGAAGGACTGAGCGC	0.478											OREG0020279	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G20R		Atlas-SNP	.											.	C10orf11	19	.	0			c.G58A						PASS	.						171.0	149.0	156.0					10																	77795776		2203	4300	6503	SO:0001583	missense	83938	exon2			CTGGAAGGACTGA	AF267860	CCDS7351.1	10q22.3	2013-08-22			ENSG00000148655	ENSG00000148655			23405	protein-coding gene	gene with protein product	"""oculocutaneous albinism 7, autosomal recessive"""	614537				23395477	Standard	NM_032024		Approved	CDA017, OCA7	uc001jxi.3	Q9H2I8	OTTHUMG00000018532	ENST00000372499.1:c.58G>A	chr10.hg19:g.77795776G>A	ENSP00000361577:p.Gly20Arg	83.0	0.0	.	1178	53.0	17.0	.	NM_032024	B1AVW6	Missense_Mutation	SNP	ENST00000372499.1	hg19	CCDS7351.1	.	.	.	.	.	.	.	.	.	.	G	19.57	3.852066	0.71719	.	.	ENSG00000148655	ENST00000354343;ENST00000372499	T	0.66460	-0.21	4.39	4.39	0.52855	.	0.000000	0.85682	D	0.000000	D	0.83982	0.5372	M	0.87456	2.885	0.58432	D	0.999994	D	0.71674	0.998	D	0.75484	0.986	D	0.87143	0.2204	10	0.62326	D	0.03	0.031	17.848	0.88736	0.0:0.0:1.0:0.0	.	20	Q9H2I8	CJ011_HUMAN	R	48;20	ENSP00000361577:G20R	ENSP00000346310:G48R	G	+	1	0	C10orf11	77465782	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.167000	0.94773	2.382000	0.81193	0.455000	0.32223	GGA	.	.	.	none		0.478	C10orf11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048839.1	NM_032024	
PIK3AP1	118788	hgsc.bcm.edu	37	10	98380246	98380246	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr10:98380246T>C	ENST00000339364.5	-	12	1923	c.1804A>G	c.(1804-1806)Acg>Gcg	p.T602A	PIK3AP1_ENST00000371110.2_Missense_Mutation_p.T424A|PIK3AP1_ENST00000371109.3_Missense_Mutation_p.T201A|RNA5SP324_ENST00000365177.1_RNA	NM_152309.2	NP_689522.2	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	602					negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of inflammatory response (GO:0050727)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(27)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	52		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		TGGCCTGGCGTTTTCATTCCC	0.567																																					p.T602A		Atlas-SNP	.											.	PIK3AP1	111	.	0			c.A1804G						PASS	.						83.0	76.0	79.0					10																	98380246		2203	4300	6503	SO:0001583	missense	118788	exon12			CTGGCGTTTTCAT	AK092883	CCDS31259.1	10q24.2	2008-10-23			ENSG00000155629	ENSG00000155629			30034	protein-coding gene	gene with protein product		607942				1251844, 11163197	Standard	NM_152309		Approved	BCAP, FLJ35564	uc001kmq.3	Q6ZUJ8	OTTHUMG00000018838	ENST00000339364.5:c.1804A>G	chr10.hg19:g.98380246T>C	ENSP00000339826:p.Thr602Ala	104.0	0.0	.		100.0	41.0	.	NM_152309	Q5TB56|Q5VXJ9|Q8N6J6|Q8NAC8	Missense_Mutation	SNP	ENST00000339364.5	hg19	CCDS31259.1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.806745	0.90623	.	.	ENSG00000155629	ENST00000339364;ENST00000371110;ENST00000371109	T;T;T	0.48522	0.81;0.81;0.81	5.89	5.89	0.94794	.	0.047516	0.85682	D	0.000000	T	0.58878	0.2153	L	0.52759	1.655	0.80722	D	1	P;D	0.65815	0.948;0.995	P;P	0.57371	0.562;0.819	T	0.60611	-0.7229	10	0.59425	D	0.04	-15.0229	15.4934	0.75629	0.0:0.0:0.0:1.0	.	602;201	Q6ZUJ8;Q6ZUJ8-3	BCAP_HUMAN;.	A	602;424;201	ENSP00000339826:T602A;ENSP00000360151:T424A;ENSP00000360150:T201A	ENSP00000339826:T602A	T	-	1	0	PIK3AP1	98370236	1.000000	0.71417	0.805000	0.32314	0.787000	0.44495	7.972000	0.88022	2.254000	0.74563	0.459000	0.35465	ACG	.	.	.	none		0.567	PIK3AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049619.2	NM_152309	
TDRD1	56165	hgsc.bcm.edu	37	10	115964611	115964611	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr10:115964611A>T	ENST00000369280.1	+	10	1716	c.1256A>T	c.(1255-1257)gAa>gTa	p.E419V	TDRD1_ENST00000369282.1_Missense_Mutation_p.E419V|TDRD1_ENST00000422662.1_Missense_Mutation_p.E80V|TDRD1_ENST00000251864.2_Missense_Mutation_p.E419V|TDRD1_ENST00000369281.2_Missense_Mutation_p.E419V			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	419					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		TTGGAAGAGGAAGTGGTTACC	0.398																																					p.E419V		Atlas-SNP	.											.	TDRD1	126	.	0			c.A1256T						PASS	.						143.0	124.0	130.0					10																	115964611		2203	4300	6503	SO:0001583	missense	56165	exon10			AAGAGGAAGTGGT	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.1256A>T	chr10.hg19:g.115964611A>T	ENSP00000358286:p.Glu419Val	114.0	0.0	.		139.0	53.0	.	NM_198795	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	ENST00000369280.1	hg19		.	.	.	.	.	.	.	.	.	.	A	7.940	0.742555	0.15642	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369281;ENST00000422662;ENST00000369280	T;T;T;T;T	0.20463	2.91;2.89;2.07;2.07;2.92	6.03	4.89	0.63831	.	0.870569	0.10238	N	0.698731	T	0.19366	0.0465	L	0.35854	1.095	0.34876	D	0.74407	B;B;B;B;B	0.14805	0.001;0.004;0.011;0.007;0.003	B;B;B;B;B	0.16289	0.012;0.007;0.007;0.015;0.008	T	0.09509	-1.0671	10	0.40728	T	0.16	-3.9984	10.6134	0.45436	0.8567:0.0:0.0:0.1433	.	80;419;419;419;419	Q9BXT4-4;Q9BXT4;B7WPM2;Q9BXT4-3;Q9BXT4-2	.;TDRD1_HUMAN;.;.;.	V	419;419;419;80;419	ENSP00000358288:E419V;ENSP00000251864:E419V;ENSP00000358287:E419V;ENSP00000402794:E80V;ENSP00000358286:E419V	ENSP00000251864:E419V	E	+	2	0	TDRD1	115954601	0.998000	0.40836	0.167000	0.22817	0.038000	0.13279	3.088000	0.50175	1.089000	0.41292	-0.301000	0.09380	GAA	.	.	.	none		0.398	TDRD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050457.2		
CALCA	796	hgsc.bcm.edu	37	11	14991618	14991618	+	Silent	SNP	A	A	T	rs528241428		TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr11:14991618A>T	ENST00000486207.1	-	2	98	c.90T>A	c.(88-90)tcT>tcA	p.S30S	CALCA_ENST00000359642.3_Silent_p.S30S|CALCA_ENST00000396372.2_Silent_p.S30S|CALCA_ENST00000361010.3_Silent_p.S30S|CALCB_ENST00000523376.1_Intron|CALCA_ENST00000331587.4_Silent_p.S30S			P06881	CALCA_HUMAN	calcitonin-related polypeptide alpha	30					activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|cytosolic calcium ion homeostasis (GO:0051480)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor internalization (GO:0002031)|leukocyte cell-cell adhesion (GO:0007159)|negative regulation of blood pressure (GO:0045776)|negative regulation of bone resorption (GO:0045779)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of osteoclast differentiation (GO:0045671)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of vasodilation (GO:0045909)|protein phosphorylation (GO:0006468)|receptor internalization (GO:0031623)|regulation of blood pressure (GO:0008217)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	protein complex binding (GO:0032403)|receptor binding (GO:0005102)			central_nervous_system(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	8						TCTCCAGGGCAGACCTGTGGA	0.632																																					p.S30S		Atlas-SNP	.											.	CALCA	30	.	0			c.T90A						PASS	.						34.0	34.0	34.0					11																	14991618		2200	4294	6494	SO:0001819	synonymous_variant	796	exon3			CAGGGCAGACCTG	X00356, M64486	CCDS7819.1, CCDS31432.1	11p15.2	2014-09-17	2008-02-20		ENSG00000110680	ENSG00000110680		"""Endogenous ligands"""	1437	protein-coding gene	gene with protein product	"""calcitonin"""	114130	"""calcitonin 1"""	CALC1		6546550	Standard	NM_001033953		Approved		uc001mlw.1	P01258	OTTHUMG00000159731	ENST00000486207.1:c.90T>A	chr11.hg19:g.14991618A>T		210.0	0.0	.		226.0	86.0	.	NM_001033953	Q93048|Q9UCP0	Silent	SNP	ENST00000486207.1	hg19	CCDS31432.1																																																																																			.	.	.	none		0.632	CALCA-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357068.1	NM_001741	
CPSF7	79869	hgsc.bcm.edu	37	11	61183972	61183972	+	Silent	SNP	A	A	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr11:61183972A>G	ENST00000394888.4	-	6	742	c.570T>C	c.(568-570)caT>caC	p.H190H	CPSF7_ENST00000340437.4_Silent_p.H233H|CPSF7_ENST00000439958.3_Silent_p.H181H|CPSF7_ENST00000448745.1_Silent_p.H181H	NM_001136040.2	NP_001129512.1	Q8N684	CPSF7_HUMAN	cleavage and polyadenylation specific factor 7, 59kDa	190					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|protein tetramerization (GO:0051262)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	22						AATCTCGGGAATGGGCCCGTG	0.517																																					p.H233H		Atlas-SNP	.											.	CPSF7	46	.	0			c.T699C						PASS	.						77.0	77.0	77.0					11																	61183972		2202	4299	6501	SO:0001819	synonymous_variant	79869	exon6			TCGGGAATGGGCC		CCDS8006.2, CCDS44619.1, CCDS44620.1	11q12.2	2013-06-18			ENSG00000149532	ENSG00000149532		"""RNA binding motif (RRM) containing"""	30098	protein-coding gene	gene with protein product	"""pre mRNA cleavage factor I, 59 kDa subunit"", ""cleavage factor Im complex 59 kDa subunit"""					12477932	Standard	NM_024811		Approved	FLJ12529	uc001nrp.3	Q8N684	OTTHUMG00000168198	ENST00000394888.4:c.570T>C	chr11.hg19:g.61183972A>G		94.0	0.0	.		89.0	32.0	.	NM_024811	B3KU04|C9K0Q4|Q7Z3H9|Q9H025|Q9H9V1	Silent	SNP	ENST00000394888.4	hg19	CCDS44619.1																																																																																			.	.	.	none		0.517	CPSF7-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347835.2	NM_024811	
PAAF1	80227	hgsc.bcm.edu	37	11	73602239	73602239	+	Missense_Mutation	SNP	C	C	T	rs369473709	byFrequency	TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr11:73602239C>T	ENST00000310571.3	+	4	328	c.275C>T	c.(274-276)aCa>aTa	p.T92I	PAAF1_ENST00000536003.1_Missense_Mutation_p.T75I|PAAF1_ENST00000544909.1_Missense_Mutation_p.T93I|PAAF1_ENST00000376384.5_Missense_Mutation_p.T75I|PAAF1_ENST00000543079.1_3'UTR|PAAF1_ENST00000544552.1_Missense_Mutation_p.T75I|PAAF1_ENST00000541951.1_5'UTR|PAAF1_ENST00000535604.1_5'UTR	NM_025155.2	NP_079431.1	Q9BRP4	PAAF1_HUMAN	proteasomal ATPase-associated factor 1	92					viral process (GO:0016032)	proteasome complex (GO:0000502)				breast(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(11;7.42e-05)					AGAATTCATACAAAGAGTGTA	0.269																																					p.T92I		Atlas-SNP	.											.	PAAF1	39	.	0			c.C275T						PASS	.						72.0	68.0	70.0					11																	73602239		2197	4288	6485	SO:0001583	missense	80227	exon4			TTCATACAAAGAG	BC006142	CCDS8226.1, CCDS58157.1, CCDS58158.1	11q13.4	2013-05-21	2007-08-16	2007-08-16	ENSG00000175575	ENSG00000175575		"""WD repeat domain containing"""	25687	protein-coding gene	gene with protein product			"""WD repeat domain 71"""	WDR71		15831487, 17317272, 17289585	Standard	NM_001267803		Approved	FLJ11848, Rpn14	uc001ouk.2	Q9BRP4	OTTHUMG00000168062	ENST00000310571.3:c.275C>T	chr11.hg19:g.73602239C>T	ENSP00000311665:p.Thr92Ile	55.0	0.0	.		70.0	24.0	.	NM_025155	A6NDR5|B4DPB0|B7ZAS9|Q4G165|Q53HS9|Q7Z500|Q8TBU6|Q9HAB6	Missense_Mutation	SNP	ENST00000310571.3	hg19	CCDS8226.1	.	.	.	.	.	.	.	.	.	.	C	10.38	1.333327	0.24167	.	.	ENSG00000175575	ENST00000310571;ENST00000504441;ENST00000543814;ENST00000536003;ENST00000544552;ENST00000376384;ENST00000536582;ENST00000544909	T;T;T;T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14	5.96	1.58	0.23477	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	1.146690	0.06484	N	0.733427	T	0.57989	0.2091	M	0.66939	2.045	0.09310	N	1	B;B	0.13145	0.007;0.001	B;B	0.11329	0.005;0.006	T	0.49173	-0.8967	10	0.52906	T	0.07	0.3313	4.2156	0.10533	0.2415:0.3916:0.2938:0.0731	.	75;92	Q9BRP4-2;Q9BRP4	.;PAAF1_HUMAN	I	92;75;75;75;75;75;70;93	ENSP00000311665:T92I;ENSP00000439747:T75I;ENSP00000438894:T75I;ENSP00000438124:T75I;ENSP00000441494:T75I;ENSP00000365564:T75I;ENSP00000443473:T70I;ENSP00000438071:T93I	ENSP00000311665:T92I	T	+	2	0	PAAF1	73279887	0.009000	0.17119	0.929000	0.37066	0.836000	0.47400	0.864000	0.27926	0.314000	0.23086	-0.182000	0.12963	ACA	.	.	.	none		0.269	PAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397885.1	NM_025155	
SLCO2B1	11309	hgsc.bcm.edu	37	11	74915579	74915579	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr11:74915579T>C	ENST00000289575.5	+	14	2479	c.2084T>C	c.(2083-2085)tTg>tCg	p.L695S	SLCO2B1_ENST00000525650.1_Missense_Mutation_p.L551S|SLCO2B1_ENST00000341411.4_Missense_Mutation_p.L468S|SLCO2B1_ENST00000454962.2_Missense_Mutation_p.L468S|SLCO2B1_ENST00000428359.2_Missense_Mutation_p.L673S|SLCO2B1_ENST00000532236.1_Missense_Mutation_p.L579S	NM_007256.4	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family, member 2B1	695					liver development (GO:0001889)|sodium-independent icosanoid transport (GO:0071718)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid transmembrane transporter activity (GO:0015125)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|endometrium(1)|large_intestine(7)|lung(20)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	39					Acetic acid(DB03166)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)|Ergoloid mesylate(DB01049)|Estradiol(DB00783)|Estrone(DB00655)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Glyburide(DB01016)|Ibuprofen(DB01050)|Iloprost(DB01088)|Latanoprost(DB00654)|Montelukast(DB00471)|Niacin(DB00627)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Tolbutamide(DB01124)	GAGCAGCAATTGCTAGTGTCG	0.577																																					p.L695S		Atlas-SNP	.											.	SLCO2B1	84	.	0			c.T2084C						PASS	.						84.0	74.0	78.0					11																	74915579		2200	4293	6493	SO:0001583	missense	11309	exon14			AGCAATTGCTAGT	AB026256	CCDS8235.1, CCDS44683.1, CCDS53679.1	11q13	2013-05-22	2003-11-25	2003-11-26				"""Solute carriers"""	10962	protein-coding gene	gene with protein product		604988	"""solute carrier family 21 (organic anion transporter), member 9"""	SLC21A9			Standard	NM_007256		Approved	OATP-B, OATP2B1	uc001owb.3	O94956		ENST00000289575.5:c.2084T>C	chr11.hg19:g.74915579T>C	ENSP00000289575:p.Leu695Ser	91.0	0.0	.		78.0	27.0	.	NM_007256	A8K2G9|B4DGA9|B4DTB0|E7ERN5|E9PPU8|Q9H2Z0|Q9UFU1	Missense_Mutation	SNP	ENST00000289575.5	hg19	CCDS8235.1	.	.	.	.	.	.	.	.	.	.	T	12.95	2.092879	0.36952	.	.	ENSG00000137491	ENST00000289575;ENST00000341411;ENST00000532236;ENST00000525650;ENST00000454962;ENST00000428359	T;T;T;T;T;T	0.42900	1.13;1.14;1.26;0.96;1.14;1.13	5.34	-3.38	0.04883	.	8.866070	0.00166	N	0.000000	T	0.15478	0.0373	N	0.08118	0	0.09310	N	1	P;B;B	0.34462	0.454;0.053;0.031	B;B;B	0.24974	0.057;0.022;0.004	T	0.06752	-1.0809	10	0.09084	T	0.74	.	1.9229	0.03311	0.1969:0.4011:0.1263:0.2757	.	551;468;695	E9PPU8;O94956-2;O94956	.;.;SO2B1_HUMAN	S	695;468;579;551;468;673	ENSP00000289575:L695S;ENSP00000341286:L468S;ENSP00000434112:L579S;ENSP00000436324:L551S;ENSP00000389653:L468S;ENSP00000388912:L673S	ENSP00000289575:L695S	L	+	2	0	SLCO2B1	74593227	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-0.363000	0.07593	-0.519000	0.06444	0.460000	0.39030	TTG	.	.	.	none		0.577	SLCO2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383933.1	NM_007256	
BIRC3	330	hgsc.bcm.edu	37	11	102195478	102195478	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr11:102195478G>T	ENST00000263464.3	+	2	2988	c.238G>T	c.(238-240)Gac>Tac	p.D80Y	BIRC3_ENST00000532808.1_Missense_Mutation_p.D80Y	NM_001165.4	NP_001156.1	Q13489	BIRC3_HUMAN	baculoviral IAP repeat containing 3	80					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of necroptotic process (GO:0060546)|negative regulation of phosphorylation (GO:0042326)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|protein heterooligomerization (GO:0051291)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|spermatogenesis (GO:0007283)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(7)|lung(5)|ovary(3)|skin(1)	21	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0146)		GAAAAGAGGAGACAGTCCTAC	0.428			T	MALT1	MALT																																p.D80Y		Atlas-SNP	.		Dom	yes		11	11q22-q23	330	baculoviral IAP repeat-containing 3		L	.	BIRC3	56	.	0			c.G238T						PASS	.						139.0	140.0	139.0					11																	102195478		2203	4299	6502	SO:0001583	missense	330	exon2			AGAGGAGACAGTC	L49432	CCDS8315.1	11q22	2011-01-25	2011-01-25			ENSG00000023445		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	591	protein-coding gene	gene with protein product	"""apoptosis inhibitor 2"", ""TNFR2-TRAF signaling complex protein"", ""mammalian IAP homolog C"", ""inhibitor of apoptosis protein 1"""	601721	"""baculoviral IAP repeat-containing 3"""	API2		8552191, 8548810	Standard	NM_001165		Approved	cIAP2, hiap-1, MIHC, RNF49, MALT2, c-IAP2	uc001pgx.3	Q13489		ENST00000263464.3:c.238G>T	chr11.hg19:g.102195478G>T	ENSP00000263464:p.Asp80Tyr	137.0	0.0	.		100.0	11.0	.	NM_001165	Q16628|Q9HC27|Q9UP46	Missense_Mutation	SNP	ENST00000263464.3	hg19	CCDS8315.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.040615	0.75732	.	.	ENSG00000023445	ENST00000263464;ENST00000532808	T;T	0.09723	2.95;2.95	5.93	5.93	0.95920	Baculoviral inhibition of apoptosis protein repeat (5);	0.000000	0.85682	D	0.000000	T	0.53174	0.1780	H	0.98238	4.18	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.70710	-0.4797	10	0.87932	D	0	.	20.3334	0.98727	0.0:0.0:1.0:0.0	.	80	Q13489	BIRC3_HUMAN	Y	80	ENSP00000263464:D80Y;ENSP00000432907:D80Y	ENSP00000263464:D80Y	D	+	1	0	BIRC3	101700688	1.000000	0.71417	1.000000	0.80357	0.546000	0.35178	9.869000	0.99810	2.818000	0.97014	0.591000	0.81541	GAC	.	.	.	none		0.428	BIRC3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394159.1	NM_001165	
ATM	472	hgsc.bcm.edu	37	11	108236079	108236079	+	Silent	SNP	A	A	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr11:108236079A>T	ENST00000452508.2	+	64	9204	c.9015A>T	c.(9013-9015)gtA>gtT	p.V3005V	C11orf65_ENST00000526725.1_Intron|ATM_ENST00000525178.1_3'UTR|ATM_ENST00000278616.4_Silent_p.V3005V|C11orf65_ENST00000525729.1_Intron			Q13315	ATM_HUMAN	ATM serine/threonine kinase	3005					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TCAACAAAGTAGCTGAACGTG	0.403			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.V3005V		Atlas-SNP	.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM	1657	.	0			c.A9015T						PASS	.						122.0	119.0	120.0					11																	108236079		2201	4298	6499	SO:0001819	synonymous_variant	472	exon63	Familial Cancer Database	AT, Louis-Bar syndrome	CAAAGTAGCTGAA	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.9015A>T	chr11.hg19:g.108236079A>T		113.0	0.0	.		67.0	48.0	.	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Silent	SNP	ENST00000452508.2	hg19	CCDS31669.1																																																																																			.	.	.	none		0.403	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
JAM3	83700	hgsc.bcm.edu	37	11	134014786	134014786	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr11:134014786A>C	ENST00000299106.4	+	5	668	c.509A>C	c.(508-510)cAc>cCc	p.H170P	JAM3_ENST00000524969.1_3'UTR|JAM3_ENST00000529443.2_Missense_Mutation_p.H215P|JAM3_ENST00000441717.3_Missense_Mutation_p.H119P			Q9BX67	JAM3_HUMAN	junctional adhesion molecule 3	170	Ig-like C2-type.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|establishment of cell polarity (GO:0030010)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|myelination (GO:0042552)|myeloid progenitor cell differentiation (GO:0002318)|neutrophil homeostasis (GO:0001780)|regulation of actin cytoskeleton organization by cell-cell adhesion (GO:0090138)|regulation of neutrophil chemotaxis (GO:0090022)|spermatid development (GO:0007286)|transmission of nerve impulse (GO:0019226)	cell-cell contact zone (GO:0044291)|desmosome (GO:0030057)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	integrin binding (GO:0005178)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)	10	all_hematologic(175;0.127)	all_cancers(12;1.06e-21)|all_epithelial(12;3.37e-16)|all_lung(97;7.03e-06)|Lung NSC(97;1.67e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0506)|Esophageal squamous(93;0.0566)		Epithelial(10;1.55e-09)|BRCA - Breast invasive adenocarcinoma(10;1.35e-08)|all cancers(11;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00402)|Lung(977;0.245)		CCCCGGCCTCACTACAGCTGG	0.542																																					p.H170P		Atlas-SNP	.											.	JAM3	41	.	0			c.A509C						PASS	.						123.0	105.0	111.0					11																	134014786		2201	4297	6498	SO:0001583	missense	83700	exon5			GGCCTCACTACAG	AF356518	CCDS8494.1, CCDS55799.1, CCDS8494.2	11q25	2013-01-29			ENSG00000166086	ENSG00000166086		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15532	protein-coding gene	gene with protein product		606871					Standard	NM_032801		Approved	JAM-C, JAMC	uc001qhb.3	Q9BX67	OTTHUMG00000167130	ENST00000299106.4:c.509A>C	chr11.hg19:g.134014786A>C	ENSP00000299106:p.His170Pro	154.0	0.0	.		136.0	58.0	.	NM_032801	B3KWG9|Q8WWL8|Q96FL1	Missense_Mutation	SNP	ENST00000299106.4	hg19	CCDS8494.2	.	.	.	.	.	.	.	.	.	.	A	15.40	2.822437	0.50739	.	.	ENSG00000166086	ENST00000299106;ENST00000441717;ENST00000532165	T	0.12147	2.71	5.1	2.59	0.31030	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.712485	0.14249	N	0.331596	T	0.13415	0.0325	L	0.35341	1.055	0.09310	N	0.999991	P;P	0.41524	0.753;0.753	P;P	0.48089	0.566;0.566	T	0.15178	-1.0446	10	0.30854	T	0.27	.	4.8908	0.13726	0.4689:0.2664:0.0:0.2647	.	119;170	B3KWG9;Q9BX67	.;JAM3_HUMAN	P	215;119;16	ENSP00000395742:H119P	ENSP00000299106:H215P	H	+	2	0	JAM3	133519996	0.001000	0.12720	0.703000	0.30354	0.829000	0.46940	1.746000	0.38288	0.763000	0.33175	0.533000	0.62120	CAC	.	.	.	none		0.542	JAM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393303.4	NM_032801	
CNTN1	1272	hgsc.bcm.edu	37	12	41387017	41387017	+	Missense_Mutation	SNP	C	C	G	rs377022967		TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr12:41387017C>G	ENST00000551295.2	+	17	2176	c.2059C>G	c.(2059-2061)Ctg>Gtg	p.L687V	CNTN1_ENST00000347616.1_Missense_Mutation_p.L687V|CNTN1_ENST00000348761.2_Missense_Mutation_p.L676V	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	687	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.			L -> P (in Ref. 5; AA sequence). {ECO:0000305}.	axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				AACCAATACACTGGGTAGAGG	0.398																																					p.L687V		Atlas-SNP	.											.	CNTN1	207	.	0			c.C2059G						PASS	.						86.0	87.0	87.0					12																	41387017		2203	4300	6503	SO:0001583	missense	1272	exon17			AATACACTGGGTA	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.2059C>G	chr12.hg19:g.41387017C>G	ENSP00000447006:p.Leu687Val	145.0	0.0	.		127.0	44.0	.	NM_001843	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	hg19	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.439004	0.43326	.	.	ENSG00000018236	ENST00000551295;ENST00000347616;ENST00000348761	T;T;T	0.55052	0.54;0.54;0.54	5.2	0.159	0.14968	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.41396	0.1157	N	0.03281	-0.365	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.74348	0.971;0.983	T	0.18681	-1.0329	10	0.15952	T	0.53	.	10.3176	0.43747	0.0:0.3385:0.0:0.6615	.	676;687	Q12860-2;Q12860	.;CNTN1_HUMAN	V	687;687;676	ENSP00000447006:L687V;ENSP00000325660:L687V;ENSP00000261160:L676V	ENSP00000325660:L687V	L	+	1	2	CNTN1	39673284	0.003000	0.15002	0.249000	0.24280	0.929000	0.56500	-0.024000	0.12435	0.071000	0.16664	-0.351000	0.07748	CTG	.	.	.	alt		0.398	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
KRT3	3850	hgsc.bcm.edu	37	12	53188110	53188110	+	Silent	SNP	C	C	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr12:53188110C>A	ENST00000417996.2	-	2	725	c.651G>T	c.(649-651)cgG>cgT	p.R217R	KRT3_ENST00000309505.3_Silent_p.R217R	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	217	Coil 1A.|Rod.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						GCTCCAGGAACCGCACCTGCA	0.542																																					p.R217R		Atlas-SNP	.											.	KRT3	65	.	0			c.G651T						PASS	.						90.0	99.0	96.0					12																	53188110		2199	4299	6498	SO:0001819	synonymous_variant	3850	exon2			CAGGAACCGCACC		CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.651G>T	chr12.hg19:g.53188110C>A		122.0	0.0	.		98.0	45.0	.	NM_057088	A6NIS2|Q701L8	Silent	SNP	ENST00000417996.2	hg19	CCDS44895.1																																																																																			.	.	.	none		0.542	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1	NM_057088	
ATP5G2	517	hgsc.bcm.edu	37	12	54059109	54059109	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr12:54059109A>G	ENST00000549164.1	-	5	602	c.415T>C	c.(415-417)Ttt>Ctt	p.F139L	ATP5G2_ENST00000338662.5_Missense_Mutation_p.F155L|ATP5G2_ENST00000550241.1_Intron|ATP5G2_ENST00000394349.3_Missense_Mutation_p.F196L|ATP5G2_ENST00000602871.1_Missense_Mutation_p.F139L			Q06055	AT5G2_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9)	139					ATP hydrolysis coupled proton transport (GO:0015991)|ATP synthesis coupled proton transport (GO:0015986)|response to ethanol (GO:0045471)	integral component of membrane (GO:0016021)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|lipid binding (GO:0008289)|transporter activity (GO:0005215)			kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	6						CACATGGCAAAGAGGATGAGA	0.572																																					p.F196L		Atlas-SNP	.											.	ATP5G2	16	.	0			c.T586C						PASS	.						58.0	57.0	58.0					12																	54059109		2203	4300	6503	SO:0001583	missense	517	exon5			TGGCAAAGAGGAT	X69908	CCDS8863.2, CCDS31812.1	12q13.13	2012-10-12	2010-06-11		ENSG00000135390	ENSG00000135390		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	842	protein-coding gene	gene with protein product		603193	"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 2"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C2 (subunit 9)"""			8328972	Standard	NM_005176		Approved		uc001sec.3	Q06055	OTTHUMG00000133442	ENST00000549164.1:c.415T>C	chr12.hg19:g.54059109A>G	ENSP00000447317:p.Phe139Leu	128.0	0.0	.		167.0	60.0	.	NM_005176	B3KQQ6	Missense_Mutation	SNP	ENST00000549164.1	hg19		.	.	.	.	.	.	.	.	.	.	A	35	5.594874	0.96602	.	.	ENSG00000135390	ENST00000394349;ENST00000549164;ENST00000338662	T;T;T	0.53857	0.6;0.6;0.6	5.32	5.32	0.75619	ATPase, F0/V0 complex, subunit C (3);	0.000000	0.85682	D	0.000000	T	0.68081	0.2962	M	0.85197	2.74	0.53688	D	0.999978	P;P;D	0.56968	0.891;0.945;0.978	P;P;P	0.52627	0.704;0.547;0.57	T	0.75007	-0.3469	10	0.72032	D	0.01	-18.2017	14.7093	0.69215	1.0:0.0:0.0:0.0	.	139;155;196	Q06055;Q06055-3;Q06055-2	AT5G2_HUMAN;.;.	L	196;139;155	ENSP00000377878:F196L;ENSP00000447317:F139L;ENSP00000340315:F155L	ENSP00000340315:F155L	F	-	1	0	ATP5G2	52345376	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.051000	0.93849	2.371000	0.80710	0.533000	0.62120	TTT	.	.	.	none		0.572	ATP5G2-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000407403.1	NM_005176	
TBK1	29110	hgsc.bcm.edu	37	12	64860793	64860793	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr12:64860793T>G	ENST00000331710.5	+	5	810	c.471T>G	c.(469-471)gaT>gaG	p.D157E		NM_013254.3	NP_037386.1	Q9UHD2	TBK1_HUMAN	TANK-binding kinase 1	157	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|dendritic cell proliferation (GO:0044565)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of gene expression (GO:0010629)|negative regulation of type I interferon production (GO:0032480)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to virus (GO:0009615)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon production (GO:0032606)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)	ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)	20				GBM - Glioblastoma multiforme(28;0.0386)		AACTCACAGATTTTGGTGCAG	0.378																																					p.D157E		Atlas-SNP	.											.	TBK1	149	.	0			c.T471G						PASS	.						196.0	183.0	188.0					12																	64860793		2203	4300	6503	SO:0001583	missense	29110	exon5			CACAGATTTTGGT	AF191838	CCDS8968.1	12q14.2	2006-06-10			ENSG00000183735	ENSG00000183735			11584	protein-coding gene	gene with protein product		604834				10581243, 10783893	Standard	NM_013254		Approved	NAK	uc001ssc.2	Q9UHD2	OTTHUMG00000168796	ENST00000331710.5:c.471T>G	chr12.hg19:g.64860793T>G	ENSP00000329967:p.Asp157Glu	93.0	0.0	.		94.0	31.0	.	NM_013254	A8K4S4|Q8IYV3|Q9NUJ5	Missense_Mutation	SNP	ENST00000331710.5	hg19	CCDS8968.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.937682	0.73557	.	.	ENSG00000183735	ENST00000331710	D	0.92911	-3.13	5.34	0.168	0.15012	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97353	0.9134	H	0.99090	4.425	0.50467	D	0.99987	D	0.63046	0.992	D	0.79108	0.992	D	0.96021	0.9009	9	.	.	.	-13.1372	10.9578	0.47368	0.0:0.3822:0.0:0.6178	.	157	Q9UHD2	TBK1_HUMAN	E	157	ENSP00000329967:D157E	.	D	+	3	2	TBK1	63147060	0.998000	0.40836	0.997000	0.53966	0.836000	0.47400	0.527000	0.22987	-0.117000	0.11872	-0.326000	0.08463	GAT	.	.	.	none		0.378	TBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401130.1	NM_013254	
GLTP	51228	hgsc.bcm.edu	37	12	110295370	110295370	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr12:110295370G>A	ENST00000318348.4	-	3	370	c.257C>T	c.(256-258)cCc>cTc	p.P86L	GLTP_ENST00000544393.1_Intron	NM_016433.3	NP_057517.1	Q9NZD2	GLTP_HUMAN	glycolipid transfer protein	86					glycolipid transport (GO:0046836)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)|lipid binding (GO:0008289)			endometrium(1)|kidney(1)|lung(1)|upper_aerodigestive_tract(1)	4		Lung NSC(355;2.38e-06)|Breast(359;0.00354)|Myeloproliferative disorder(1001;0.0122)		BRCA - Breast invasive adenocarcinoma(302;0.0025)		CCCTACTTTGGGCCACTCTGC	0.552																																					p.P86L		Atlas-SNP	.											.	GLTP	15	.	0			c.C257T						PASS	.						89.0	85.0	86.0					12																	110295370		2203	4300	6503	SO:0001583	missense	51228	exon3			ACTTTGGGCCACT	AF209704, AY372530	CCDS9136.1	12q24.11	2008-08-08			ENSG00000139433	ENSG00000139433			24867	protein-coding gene	gene with protein product		608949				15287756, 15901739	Standard	NM_016433		Approved		uc001tpm.3	Q9NZD2	OTTHUMG00000169278	ENST00000318348.4:c.257C>T	chr12.hg19:g.110295370G>A	ENSP00000315263:p.Pro86Leu	63.0	0.0	.		51.0	30.0	.	NM_016433	Q53Z13|Q96J68	Missense_Mutation	SNP	ENST00000318348.4	hg19	CCDS9136.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.77|16.77	3.214772|3.214772	0.58452|0.58452	.|.	.|.	ENSG00000139433|ENSG00000139433	ENST00000318348|ENST00000540772	.|.	.|.	.|.	4.65|4.65	4.65|4.65	0.58169|0.58169	Glycolipid transfer protein domain (3);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.70343|0.70343	0.3213|0.3213	L|L	0.57536|0.57536	1.79|1.79	0.80722|0.80722	D|D	1|1	B|.	0.22604|.	0.072|.	B|.	0.25405|.	0.06|.	T|T	0.69405|0.69405	-0.5154|-0.5154	9|6	0.38643|.	T|.	0.18|.	.|.	16.5324|16.5324	0.84365|0.84365	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	86|.	Q9NZD2|.	GLTP_HUMAN|.	L|S	86|70	.|.	ENSP00000315263:P86L|.	P|P	-|-	2|1	0|0	GLTP|GLTP	108779753|108779753	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	8.981000|8.981000	0.93465|0.93465	2.312000|2.312000	0.78011|0.78011	0.585000|0.585000	0.79938|0.79938	CCC|CCA	.	.	.	none		0.552	GLTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403278.2	NM_016433	
HNF1A	6927	hgsc.bcm.edu	37	12	121434509	121434509	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr12:121434509A>C	ENST00000257555.6	+	6	1499	c.1273A>C	c.(1273-1275)Acg>Ccg	p.T425P	HNF1A_ENST00000543427.1_Missense_Mutation_p.T308P|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000544413.1_Missense_Mutation_p.T425P|HNF1A_ENST00000400024.2_Missense_Mutation_p.T425P|HNF1A_ENST00000402929.1_Missense_Mutation_p.T425P|HNF1A_ENST00000541395.1_Missense_Mutation_p.T425P			P20823	HNF1A_HUMAN	HNF1 homeobox A	425					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CCTGGGTCCTACGTTCACCAA	0.637									Hepatic Adenoma, Familial Clustering of																												p.T425P		Atlas-SNP	.											.	HNF1A	302	.	0			c.A1273C						PASS	.						95.0	74.0	81.0					12																	121434509		2203	4300	6503	SO:0001583	missense	6927	exon6	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	GGTCCTACGTTCA	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.1273A>C	chr12.hg19:g.121434509A>C	ENSP00000257555:p.Thr425Pro	80.0	0.0	.		104.0	36.0	.	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	ENST00000257555.6	hg19	CCDS9209.1	.	.	.	.	.	.	.	.	.	.	A	17.32	3.360841	0.61403	.	.	ENSG00000135100	ENST00000257555;ENST00000535125;ENST00000544680;ENST00000537424;ENST00000543027;ENST00000543427;ENST00000545458;ENST00000541395;ENST00000340577;ENST00000344370;ENST00000544413	D;D;D;D	0.99893	-5.42;-7.57;-5.41;-5.42	4.81	4.81	0.61882	Hepatocyte nuclear factor 1, beta isoform, C-terminal (1);	0.100353	0.45126	D	0.000390	D	0.99390	0.9785	L	0.36672	1.1	0.30828	N	0.73707	P;P;P;D	0.55172	0.531;0.761;0.761;0.97	B;B;P;P	0.50314	0.259;0.312;0.582;0.637	D	0.99963	1.1771	10	0.33940	T	0.23	-13.874	5.8526	0.18701	0.8058:0.0:0.1942:0.0	.	425;425;425;425	F5H0K0;P20823;E7EUQ4;E7EMR0	.;HNF1A_HUMAN;.;.	P	425;317;425;425;246;308;425;425;425;425;425	ENSP00000257555:T425P;ENSP00000439721:T308P;ENSP00000443112:T425P;ENSP00000438804:T425P	ENSP00000257555:T425P	T	+	1	0	HNF1A	119918892	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	2.436000	0.44819	1.823000	0.53134	0.451000	0.29950	ACG	.	.	.	none		0.637	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
SETD1B	23067	hgsc.bcm.edu	37	12	122260973	122260973	+	Silent	SNP	G	G	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr12:122260973G>T	ENST00000604567.1	+	12	4556	c.4488G>T	c.(4486-4488)gcG>gcT	p.A1496A	SETD1B_ENST00000542440.1_Silent_p.A1453A|SETD1B_ENST00000267197.5_Silent_p.A1453A			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	1496	Pro-rich.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						aggctcgtgcgcccaccccgc	0.741																																					p.A1453A		Atlas-SNP	.											.	SETD1B	105	.	0			c.G4359T						PASS	.						2.0	3.0	3.0					12																	122260973		616	1430	2046	SO:0001819	synonymous_variant	23067	exon12			TCGTGCGCCCACC	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.4488G>T	chr12.hg19:g.122260973G>T		31.0	0.0	.		41.0	14.0	.	NM_015048	F6MFW1	Silent	SNP	ENST00000604567.1	hg19																																																																																				.	.	.	none		0.741	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000468264.1	XM_037523	
PSMD9	5715	hgsc.bcm.edu	37	12	122340948	122340948	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr12:122340948T>A	ENST00000541212.1	+	4	616	c.490T>A	c.(490-492)Tct>Act	p.S164T	PSMD9_ENST00000261817.2_Missense_Mutation_p.S164T|PSMD9_ENST00000340175.5_Missense_Mutation_p.S164T|RP11-87C12.2_ENST00000546333.1_3'UTR|PSMD9_ENST00000542602.1_Missense_Mutation_p.S59T			O00233	PSMD9_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 9	164	PDZ.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion (GO:0046676)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of insulin secretion (GO:0032024)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome regulatory particle assembly (GO:0070682)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome regulatory particle (GO:0005838)	bHLH transcription factor binding (GO:0043425)|transcription coactivator activity (GO:0003713)			endometrium(1)|large_intestine(1)|lung(1)	3	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000117)|Epithelial(86;0.000415)|BRCA - Breast invasive adenocarcinoma(302;0.231)		GGAGTTCGGCTCTGTGAACAC	0.527																																					p.S164T		Atlas-SNP	.											.	PSMD9	8	.	0			c.T490A						PASS	.						169.0	134.0	146.0					12																	122340948		2203	4300	6503	SO:0001583	missense	5715	exon4			TTCGGCTCTGTGA	AB003177	CCDS9225.1, CCDS58284.1	12q24.31-q24.32	2008-05-22			ENSG00000110801	ENSG00000110801		"""Proteasome (prosome, macropain) subunits"""	9567	protein-coding gene	gene with protein product		603146				9653651	Standard	NM_002813		Approved	p27, Rpn4	uc001ubl.4	O00233	OTTHUMG00000168945	ENST00000541212.1:c.490T>A	chr12.hg19:g.122340948T>A	ENSP00000440485:p.Ser164Thr	113.0	0.0	.		148.0	90.0	.	NM_002813	B2RD35|G3V1Q6|Q9BQ42	Missense_Mutation	SNP	ENST00000541212.1	hg19	CCDS9225.1	.	.	.	.	.	.	.	.	.	.	T	17.83	3.485602	0.63962	.	.	ENSG00000110801;ENSG00000110801;ENSG00000110801;ENSG00000110801;ENSG00000256950	ENST00000541212;ENST00000340175;ENST00000261817;ENST00000544724;ENST00000542602	T;T;T;T;T	0.30182	1.54;2.39;1.69;1.54;2.39	5.6	5.6	0.85130	PDZ/DHR/GLGF (2);	0.054713	0.85682	D	0.000000	T	0.35008	0.0917	L	0.43923	1.385	0.58432	D	0.999995	B;D	0.57899	0.313;0.981	B;P	0.53360	0.279;0.724	T	0.05599	-1.0875	10	0.20046	T	0.44	-10.8784	10.947	0.47306	0.1396:0.0:0.0:0.8604	.	164;164	F8W7V8;O00233	.;PSMD9_HUMAN	T	164;164;164;75;59	ENSP00000440485:S164T;ENSP00000340847:S164T;ENSP00000261817:S164T;ENSP00000443929:S75T;ENSP00000443772:S59T	ENSP00000261817:S164T	S	+	1	0	RP11-87C12.2;PSMD9	120825331	1.000000	0.71417	1.000000	0.80357	0.657000	0.38888	4.346000	0.59367	2.129000	0.65627	0.533000	0.62120	TCT	.	.	.	none		0.527	PSMD9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401686.1	NM_002813	
RILPL1	353116	hgsc.bcm.edu	37	12	123984011	123984011	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr12:123984011C>T	ENST00000376874.4	-	3	768	c.533G>A	c.(532-534)cGc>cAc	p.R178H	RILPL1_ENST00000340724.6_Missense_Mutation_p.R26H	NM_178314.3	NP_847884.2	Q5EBL4	RIPL1_HUMAN	Rab interacting lysosomal protein-like 1	178					epithelial cell morphogenesis (GO:0003382)|intracellular protein transport (GO:0006886)|regulation of neuron death (GO:1901214)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.00067)|all cancers(50;0.00836)|BRCA - Breast invasive adenocarcinoma(302;0.197)		GTCCTTGGCGCGGATCTCGTC	0.617																																					p.R178H		Atlas-SNP	.											.	RILPL1	23	.	0			c.G533A						PASS	.						139.0	155.0	150.0					12																	123984011		2155	4245	6400	SO:0001583	missense	353116	exon3			TTGGCGCGGATCT	AK097550	CCDS45006.1	12q24.31	2007-11-27			ENSG00000188026	ENSG00000188026			26814	protein-coding gene	gene with protein product		614092				14668488	Standard	NM_178314		Approved	FLJ39378	uc001ufe.2	Q5EBL4	OTTHUMG00000168686	ENST00000376874.4:c.533G>A	chr12.hg19:g.123984011C>T	ENSP00000366070:p.Arg178His	59.0	0.0	.		87.0	43.0	.	NM_178314	Q66K36|Q8N1M0	Missense_Mutation	SNP	ENST00000376874.4	hg19	CCDS45006.1	.	.	.	.	.	.	.	.	.	.	C	16.97	3.268272	0.59540	.	.	ENSG00000188026	ENST00000376874;ENST00000340724	T;T	0.30182	1.54;1.54	5.07	4.18	0.49190	.	0.000000	0.85682	D	0.000000	T	0.56949	0.2020	M	0.81802	2.56	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.63033	-0.6727	10	0.72032	D	0.01	-1.0E-4	13.638	0.62233	0.0:0.9246:0.0:0.0754	.	154;178;27	Q5EBL4-2;Q5EBL4;Q5EBL4-3	.;RIPL1_HUMAN;.	H	178;26	ENSP00000366070:R178H;ENSP00000345874:R26H	ENSP00000345874:R26H	R	-	2	0	RILPL1	122549964	1.000000	0.71417	0.816000	0.32577	0.005000	0.04900	7.818000	0.86416	1.125000	0.41998	-0.291000	0.09656	CGC	.	.	.	none		0.617	RILPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400595.1	NM_178314	
NCOR2	9612	hgsc.bcm.edu	37	12	124887084	124887084	+	Silent	SNP	C	C	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr12:124887084C>T	ENST00000405201.1	-	14	1506	c.1506G>A	c.(1504-1506)caG>caA	p.Q502Q	NCOR2_ENST00000356219.3_Silent_p.Q502Q|NCOR2_ENST00000397355.1_Silent_p.Q502Q|NCOR2_ENST00000404621.1_Silent_p.Q501Q|NCOR2_ENST00000429285.2_Silent_p.Q501Q|NCOR2_ENST00000404121.2_Silent_p.Q72Q			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	502	Poly-Gln.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gctgctgctgctgctgctgct	0.617																																					p.Q502Q		Atlas-SNP	.											.	NCOR2	475	.	0			c.G1506A						PASS	.						9.0	12.0	11.0					12																	124887084		2067	4185	6252	SO:0001819	synonymous_variant	9612	exon16			CTGCTGCTGCTGC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1506G>A	chr12.hg19:g.124887084C>T		29.0	0.0	.		57.0	6.0	.	NM_006312	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	hg19	CCDS41858.2																																																																																			.	.	.	none		0.617	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
RIMBP2	23504	hgsc.bcm.edu	37	12	130921476	130921476	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr12:130921476G>T	ENST00000261655.4	-	10	2129	c.1966C>A	c.(1966-1968)Ctg>Atg	p.L656M	RIMBP2_ENST00000535703.1_Missense_Mutation_p.L564M|RIMBP2_ENST00000536002.1_Missense_Mutation_p.L564M	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	656	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GGCTGTGGCAGGATGCGGCTG	0.731																																					p.L656M		Atlas-SNP	.											.	RIMBP2	220	.	0			c.C1966A						PASS	.						12.0	17.0	15.0					12																	130921476		2182	4275	6457	SO:0001583	missense	23504	exon10			GTGGCAGGATGCG	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1966C>A	chr12.hg19:g.130921476G>T	ENSP00000261655:p.Leu656Met	92.0	0.0	.		100.0	60.0	.	NM_015347	Q96ID2	Missense_Mutation	SNP	ENST00000261655.4	hg19	CCDS31925.1	.	.	.	.	.	.	.	.	.	.	G	16.87	3.240944	0.58995	.	.	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.22336	1.96;2.46;2.46	4.63	3.75	0.43078	.	0.084015	0.49305	D	0.000146	T	0.42944	0.1225	M	0.66939	2.045	0.47094	D	0.999317	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.97110	0.997;1.0;0.997	T	0.28776	-1.0033	10	0.49607	T	0.09	-23.8929	12.9334	0.58301	0.0794:0.0:0.9206:0.0	.	564;564;656	C9JWN3;O15034-2;O15034	.;.;RIMB2_HUMAN	M	656;564;564;564	ENSP00000261655:L656M;ENSP00000440347:L564M;ENSP00000439159:L564M	ENSP00000261655:L656M	L	-	1	2	RIMBP2	129487429	1.000000	0.71417	1.000000	0.80357	0.503000	0.33858	6.415000	0.73328	0.952000	0.37798	-0.224000	0.12420	CTG	.	.	.	none		0.731	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
PGAM5	192111	hgsc.bcm.edu	37	12	133291557	133291557	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr12:133291557T>A	ENST00000498926.2	+	2	363	c.305T>A	c.(304-306)cTc>cAc	p.L102H	PGAM5_ENST00000317555.2_Missense_Mutation_p.L102H|PGAM5_ENST00000454808.2_5'UTR|PXMP2_ENST00000545677.1_Silent_p.P141P|PGAM5_ENST00000543955.1_5'UTR	NM_001170543.1|NM_001170544.1	NP_001164014.1|NP_001164015.1	Q96HS1	PGAM5_HUMAN	phosphoglycerate mutase family member 5	102					dephosphorylation (GO:0016311)|necroptotic process (GO:0070266)|positive regulation of GTPase activity (GO:0043547)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein complex binding (GO:0032403)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.89e-08)|Epithelial(86;1.14e-07)|all cancers(50;3.57e-06)		CACATCTTCCTCATCAGGCAT	0.587																																					p.L102H		Atlas-SNP	.											.	PGAM5	18	.	0			c.T305A						PASS	.						138.0	92.0	108.0					12																	133291557		2202	4300	6502	SO:0001583	missense	192111	exon2			TCTTCCTCATCAG	BC008196	CCDS9280.1, CCDS53845.1	12q24.33	2011-07-28			ENSG00000247077	ENSG00000247077			28763	protein-coding gene	gene with protein product		614939				11283018	Standard	NM_001170543		Approved	MGC5352, BXLBv68	uc009zyv.3	Q96HS1	OTTHUMG00000168021	ENST00000498926.2:c.305T>A	chr12.hg19:g.133291557T>A	ENSP00000438465:p.Leu102His	105.0	0.0	.		162.0	40.0	.	NM_138575	A9LN06|C9IZY7|Q96JB0	Missense_Mutation	SNP	ENST00000498926.2	hg19	CCDS53845.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.609079	0.87258	.	.	ENSG00000247077	ENST00000317555;ENST00000498926	T;T	0.80738	0.33;-1.41	4.64	4.64	0.57946	Histidine phosphatase superfamily, clade-1 (2);	0.000000	0.85682	D	0.000000	D	0.93539	0.7938	H	0.98333	4.205	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	D	0.95728	0.8772	10	0.87932	D	0	-4.5906	14.0667	0.64834	0.0:0.0:0.0:1.0	.	102;102	Q96HS1;Q96HS1-2	PGAM5_HUMAN;.	H	102	ENSP00000321503:L102H;ENSP00000438465:L102H	ENSP00000321503:L102H	L	+	2	0	PGAM5	131801630	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.658000	0.83755	1.735000	0.51646	0.379000	0.24179	CTC	.	.	.	none		0.587	PGAM5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397562.1	NM_138575	
MDP1	145553	hgsc.bcm.edu	37	14	24683307	24683307	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr14:24683307G>C	ENST00000288087.7	-	6	565	c.454C>G	c.(454-456)Caa>Gaa	p.Q152E	CHMP4A_ENST00000609024.1_5'Flank|CHMP4A_ENST00000530996.1_5'Flank|MDP1_ENST00000396833.2_Nonsense_Mutation_p.S105*|NEDD8-MDP1_ENST00000534348.1_Missense_Mutation_p.Q169E|MDP1_ENST00000532557.1_5'UTR|AL136419.6_ENST00000565988.1_RNA|NEDD8-MDP1_ENST00000604306.1_5'Flank|CHMP4A_ENST00000347519.6_5'Flank|CHMP4A_ENST00000542700.2_5'Flank|TM9SF1_ENST00000530611.1_5'Flank|TM9SF1_ENST00000556387.1_5'Flank	NM_001199822.1|NM_138476.3	NP_001186751.1|NP_612485.2	Q86V88	MGDP1_HUMAN	magnesium-dependent phosphatase 1	152						extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|large_intestine(2)|lung(3)	7						TCTAACCCTTGACTTAGAGTT	0.433																																					p.S105X		Atlas-SNP	.											.	MDP1	13	.	0			c.C314G						PASS	.						82.0	82.0	82.0					14																	24683307		2203	4300	6503	SO:0001583	missense	145553	exon5			ACCCTTGACTTAG	BC046912	CCDS9620.1, CCDS55908.1	14q12	2009-07-09			ENSG00000213920	ENSG00000213920			28781	protein-coding gene	gene with protein product	"""fructosamine-6-phosphatase"""					10889041, 16670083	Standard	NM_138476		Approved	MGC5987, FN6Pase		Q86V88	OTTHUMG00000133477	ENST00000288087.7:c.454C>G	chr14.hg19:g.24683307G>C	ENSP00000288087:p.Gln152Glu	77.0	0.0	.		77.0	38.0	.	NM_001199821	Q86Y84|Q8NAD9	Nonsense_Mutation	SNP	ENST00000288087.7	hg19	CCDS9620.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.69|18.69	3.677241|3.677241	0.68042|0.68042	.|.	.|.	ENSG00000213920;ENSG00000255526|ENSG00000213920	ENST00000288087;ENST00000534348|ENST00000396833	D|.	0.97114|.	-4.25|.	5.25|5.25	3.22|3.22	0.36961|0.36961	HAD-like domain (1);|.	0.317545|.	0.17362|.	U|.	0.177013|.	T|.	0.27663|.	0.0680|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|.	0.13495|.	-1.0507|.	9|.	0.06365|0.02654	T|T	0.9|1	-8.3948|-8.3948	7.5144|7.5144	0.27592|0.27592	0.0:0.1719:0.6255:0.2025|0.0:0.1719:0.6255:0.2025	.|.	152|.	Q86V88|.	MGDP1_HUMAN|.	E|X	152;169|105	ENSP00000288087:Q152E|.	ENSP00000288087:Q152E|ENSP00000380045:S105X	Q|S	-|-	1|2	0|0	MDP1;NEDD8-MDP1|MDP1	23753147|23753147	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	1.295000|1.295000	0.33377|0.33377	1.398000|1.398000	0.46701|0.46701	0.655000|0.655000	0.94253|0.94253	CAA|TCA	.	.	.	none		0.433	MDP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257367.1	NM_138476	
COQ6	51004	hgsc.bcm.edu	37	14	74426189	74426189	+	Silent	SNP	T	T	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr14:74426189T>C	ENST00000334571.2	+	8	895	c.855T>C	c.(853-855)gaT>gaC	p.D285D	ENTPD5_ENST00000557325.1_3'UTR|COQ6_ENST00000554920.1_Intron|COQ6_ENST00000238709.4_Silent_p.D210D|COQ6_ENST00000394026.4_Silent_p.D260D	NM_182476.2	NP_872282.1	Q9Y2Z9	COQ6_HUMAN	coenzyme Q6 monooxygenase	285					small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(234;0.00337)		TTAGCATGGATGAGGAAAAAT	0.458																																					p.D285D		Atlas-SNP	.											.	COQ6	27	.	0			c.T855C						PASS	.						256.0	224.0	235.0					14																	74426189		2203	4300	6503	SO:0001819	synonymous_variant	51004	exon8			CATGGATGAGGAA	AF132944	CCDS9823.1, CCDS9824.1, CCDS9824.2	14q24.1	2013-05-01	2013-05-01		ENSG00000119723	ENSG00000119723			20233	protein-coding gene	gene with protein product		614647	"""coenzyme Q6 homolog (yeast)"", ""coenzyme Q6 homolog, monooxygenase (yeast)"", ""coenzyme Q6 homolog, monooxygenase (S. cerevisiae)"""			21540551	Standard	NM_182476		Approved	CGI-10	uc001xph.3	Q9Y2Z9	OTTHUMG00000171260	ENST00000334571.2:c.855T>C	chr14.hg19:g.74426189T>C		102.0	0.0	.		103.0	46.0	.	NM_182476	B7Z3K8|Q53GG6|Q86U30|Q96CA1|Q96CK2	Silent	SNP	ENST00000334571.2	hg19	CCDS9823.1																																																																																			.	.	.	none		0.458	COQ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412616.1		
PPP4R4	57718	hgsc.bcm.edu	37	14	94722854	94722854	+	Silent	SNP	T	T	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr14:94722854T>C	ENST00000304338.3	+	17	2077	c.1923T>C	c.(1921-1923)gaT>gaC	p.D641D		NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	641					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)			NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						TTCCTGCTGATAAGCATCTAC	0.343																																					p.D641D		Atlas-SNP	.											.	PPP4R4	107	.	0			c.T1923C						PASS	.						102.0	107.0	105.0					14																	94722854		2203	4300	6503	SO:0001819	synonymous_variant	57718	exon17			TGCTGATAAGCAT	AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.1923T>C	chr14.hg19:g.94722854T>C		88.0	0.0	.		81.0	35.0	.	NM_058237	Q9BUF8|Q9HCF0	Silent	SNP	ENST00000304338.3	hg19	CCDS9921.1																																																																																			.	.	.	none		0.343	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413056.1	NM_058237	
TP53BP1	7158	hgsc.bcm.edu	37	15	43714077	43714077	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr15:43714077G>C	ENST00000263801.3	-	19	4313	c.4061C>G	c.(4060-4062)tCc>tGc	p.S1354C	TP53BP1_ENST00000382044.4_Missense_Mutation_p.S1359C|TP53BP1_ENST00000450115.2_Missense_Mutation_p.S1359C|TP53BP1_ENST00000382039.3_Missense_Mutation_p.S1359C	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1354					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		GCCTCCTCGGGAGCTGGGTAA	0.562								Other conserved DNA damage response genes																													p.S1359C		Atlas-SNP	.											.	TP53BP1	157	.	0			c.C4076G						PASS	.						63.0	66.0	65.0					15																	43714077		2201	4298	6499	SO:0001583	missense	7158	exon19			CCTCGGGAGCTGG	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.4061C>G	chr15.hg19:g.43714077G>C	ENSP00000263801:p.Ser1354Cys	86.0	0.0	.		79.0	39.0	.	NM_001141980	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	ENST00000263801.3	hg19	CCDS10096.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.034770	0.54896	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115	T;T;T;T	0.04917	3.58;3.58;3.53;3.58	5.71	5.71	0.89125	.	0.308734	0.33670	N	0.004678	T	0.10337	0.0253	N	0.19112	0.55	0.33853	D	0.63282	D;D;D;D	0.76494	0.997;0.993;0.999;0.996	P;P;P;P	0.56216	0.781;0.628;0.794;0.794	T	0.05484	-1.0882	10	0.59425	D	0.04	-8.8598	14.0939	0.65008	0.0:0.2469:0.7531:0.0	.	1359;1354;1359;1359	B7Z3E7;Q12888;Q12888-2;F8VY86	.;TP53B_HUMAN;.;.	C	1354;1359;1359;1359	ENSP00000263801:S1354C;ENSP00000371475:S1359C;ENSP00000371470:S1359C;ENSP00000393497:S1359C	ENSP00000263801:S1354C	S	-	2	0	TP53BP1	41501369	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.367000	0.44213	2.860000	0.98153	0.655000	0.94253	TCC	.	.	.	none		0.562	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3		
POLG	5428	hgsc.bcm.edu	37	15	89861981	89861981	+	Splice_Site	SNP	C	C	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr15:89861981C>G	ENST00000268124.5	-	21	3607		c.e21-1		POLG_ENST00000442287.2_Splice_Site	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma						aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			TGGTCATAAACTGGGAAGGGA	0.507								DNA polymerases (catalytic subunits)																													.	Colon(73;648 1203 11348 18386 27782)	Atlas-SNP	.											.	POLG	75	.	0			c.3274-1G>C						PASS	.						71.0	68.0	69.0					15																	89861981		2200	4299	6499	SO:0001630	splice_region_variant	5428	exon22			CATAAACTGGGAA	X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.3274-1G>C	chr15.hg19:g.89861981C>G		30.0	0.0	.		44.0	13.0	.	NM_002693	Q8NFM2|Q92515	Splice_Site	SNP	ENST00000268124.5	hg19	CCDS10350.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315677	0.60524	.	.	ENSG00000140521	ENST00000268124;ENST00000442287	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.037	0.92983	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	POLG	87662985	1.000000	0.71417	0.999000	0.59377	0.663000	0.39108	7.320000	0.79064	2.738000	0.93877	0.655000	0.94253	.	.	.	.	none		0.507	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	NM_002693	Intron
RGMA	56963	hgsc.bcm.edu	37	15	93595536	93595536	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr15:93595536C>G	ENST00000329082.7	-	3	603	c.332G>C	c.(331-333)aGc>aCc	p.S111T	RGMA_ENST00000543599.1_Missense_Mutation_p.S95T|RGMA_ENST00000556087.1_Missense_Mutation_p.S95T|RGMA_ENST00000538818.1_Missense_Mutation_p.S2T|RGMA_ENST00000556658.1_Missense_Mutation_p.S2T|RGMA_ENST00000555584.1_5'UTR|RGMA_ENST00000425933.2_Missense_Mutation_p.S95T|RGMA_ENST00000557301.1_Missense_Mutation_p.S119T|RGMA_ENST00000557420.1_Intron|RGMA_ENST00000542321.2_Missense_Mutation_p.S95T	NM_020211.2	NP_064596	Q96B86	RGMA_HUMAN	repulsive guidance molecule family member a	111					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|neural tube closure (GO:0001843)|regulation of BMP signaling pathway (GO:0030510)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	9	Lung NSC(78;0.0542)|all_lung(78;0.0786)		BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)			GTTGTGCTGGCTCATGAGGTC	0.706																																					p.S119T		Atlas-SNP	.											.	RGMA	49	.	0			c.G356C						PASS	.						24.0	29.0	27.0					15																	93595536		2185	4291	6476	SO:0001583	missense	56963	exon3			TGCTGGCTCATGA	AL390083	CCDS45357.1, CCDS53973.1, CCDS53974.1	15q26.1	2013-11-06	2013-11-06			ENSG00000182175			30308	protein-coding gene	gene with protein product		607362	"""RGM domain family, member A"""			15975920	Standard	NM_020211		Approved	RGM, RGMa	uc010urc.2	Q96B86		ENST00000329082.7:c.332G>C	chr15.hg19:g.93595536C>G	ENSP00000330005:p.Ser111Thr	41.0	0.0	.		37.0	16.0	.	NM_001166283	B2RTW1|B7Z5S8|F5GXQ7|F5GZU6|G3V518|Q0JV97|Q8NC80|Q9H0E6|Q9NPM3	Missense_Mutation	SNP	ENST00000329082.7	hg19	CCDS45357.1	.	.	.	.	.	.	.	.	.	.	C	8.229	0.804169	0.16467	.	.	ENSG00000182175	ENST00000543599;ENST00000425933;ENST00000329082;ENST00000542321;ENST00000538818;ENST00000557301	D;D;D;D;D;D	0.97455	-4.39;-4.39;-4.39;-4.39;-4.39;-4.39	5.15	4.23	0.50019	Repulsive guidance molecule, N-terminal (1);	0.091755	0.85682	D	0.000000	D	0.94318	0.8174	L	0.49126	1.545	0.41814	D	0.989988	P;P	0.36438	0.498;0.553	B;B	0.40782	0.23;0.34	D	0.90471	0.4453	10	0.22109	T	0.4	-1.9022	5.7538	0.18162	0.1399:0.6452:0.1359:0.079	.	119;111	G3V518;Q96B86	.;RGMA_HUMAN	T	95;95;111;95;2;119	ENSP00000442498:S95T;ENSP00000404442:S95T;ENSP00000330005:S111T;ENSP00000440025:S95T;ENSP00000442546:S2T;ENSP00000452126:S119T	ENSP00000330005:S111T	S	-	2	0	RGMA	91396540	0.997000	0.39634	1.000000	0.80357	0.997000	0.91878	0.555000	0.23422	1.175000	0.42826	0.462000	0.41574	AGC	.	.	.	none		0.706	RGMA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000415091.1	NM_020211	
SMPD3	55512	hgsc.bcm.edu	37	16	68405641	68405641	+	Silent	SNP	T	T	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr16:68405641T>C	ENST00000219334.5	-	3	1047	c.444A>G	c.(442-444)caA>caG	p.Q148Q	SMPD3_ENST00000566009.1_5'Flank|SMPD3_ENST00000563226.1_Silent_p.Q148Q|SMPD3_ENST00000568373.1_Silent_p.Q148Q	NM_018667.3	NP_061137.1	Q9NY59	NSMA2_HUMAN	sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II)	148					cell cycle (GO:0007049)|glycosphingolipid metabolic process (GO:0006687)|hematopoietic progenitor cell differentiation (GO:0002244)|peptide hormone secretion (GO:0030072)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	Golgi cis cisterna (GO:0000137)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	TGGCCCGCGCTTGGGTGTTAA	0.607																																					p.Q148Q		Atlas-SNP	.											.	SMPD3	52	.	0			c.A444G						PASS	.						23.0	27.0	26.0					16																	68405641		2198	4300	6498	SO:0001819	synonymous_variant	55512	exon3			CCGCGCTTGGGTG	AJ250460	CCDS10867.1	16q22.1	2008-02-05			ENSG00000103056	ENSG00000103056			14240	protein-coding gene	gene with protein product		605777				10823942	Standard	NM_018667		Approved	NSMASE2	uc002ewa.3	Q9NY59	OTTHUMG00000137559	ENST00000219334.5:c.444A>G	chr16.hg19:g.68405641T>C		73.0	0.0	.		86.0	42.0	.	NM_018667	B7ZL82|Q2M1S8	Silent	SNP	ENST00000219334.5	hg19	CCDS10867.1																																																																																			.	.	.	none		0.607	SMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268895.3	NM_018667	
SMPD3	55512	hgsc.bcm.edu	37	16	68405649	68405649	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr16:68405649T>G	ENST00000219334.5	-	3	1039	c.436A>C	c.(436-438)Aac>Cac	p.N146H	SMPD3_ENST00000566009.1_5'Flank|SMPD3_ENST00000563226.1_Missense_Mutation_p.N146H|SMPD3_ENST00000568373.1_Missense_Mutation_p.N146H	NM_018667.3	NP_061137.1	Q9NY59	NSMA2_HUMAN	sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II)	146					cell cycle (GO:0007049)|glycosphingolipid metabolic process (GO:0006687)|hematopoietic progenitor cell differentiation (GO:0002244)|peptide hormone secretion (GO:0030072)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	Golgi cis cisterna (GO:0000137)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	GCTTGGGTGTTAAAAAGGTTG	0.587																																					p.N146H		Atlas-SNP	.											.	SMPD3	52	.	0			c.A436C						PASS	.						21.0	25.0	24.0					16																	68405649		2198	4300	6498	SO:0001583	missense	55512	exon3			GGGTGTTAAAAAG	AJ250460	CCDS10867.1	16q22.1	2008-02-05			ENSG00000103056	ENSG00000103056			14240	protein-coding gene	gene with protein product		605777				10823942	Standard	NM_018667		Approved	NSMASE2	uc002ewa.3	Q9NY59	OTTHUMG00000137559	ENST00000219334.5:c.436A>C	chr16.hg19:g.68405649T>G	ENSP00000219334:p.Asn146His	69.0	0.0	.		85.0	45.0	.	NM_018667	B7ZL82|Q2M1S8	Missense_Mutation	SNP	ENST00000219334.5	hg19	CCDS10867.1	.	.	.	.	.	.	.	.	.	.	T	7.498	0.651973	0.14516	.	.	ENSG00000103056	ENST00000219334	T	0.50001	0.76	5.24	4.11	0.48088	.	0.170687	0.64402	N	0.000005	T	0.31327	0.0793	N	0.20881	0.62	0.40830	D	0.983588	B;B;B	0.12630	0.006;0.006;0.006	B;B;B	0.08055	0.003;0.003;0.003	T	0.07947	-1.0746	10	0.23891	T	0.37	-22.7541	10.5661	0.45173	0.0:0.0:0.1623:0.8377	.	146;146;146	B7ZL82;B7ZL84;Q9NY59	.;.;NSMA2_HUMAN	H	146	ENSP00000219334:N146H	ENSP00000219334:N146H	N	-	1	0	SMPD3	66963150	1.000000	0.71417	0.879000	0.34478	0.943000	0.58893	1.979000	0.40608	0.898000	0.36418	0.533000	0.62120	AAC	.	.	.	none		0.587	SMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268895.3	NM_018667	
PKD1L2	114780	hgsc.bcm.edu	37	16	81219237	81219237	+	RNA	SNP	C	C	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr16:81219237C>A	ENST00000525539.1	-	0	1856				PKD1L2_ENST00000337114.4_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						CTGGAACCACCAGCTCCCTCT	0.602																																					p.L619L		Atlas-SNP	.											.	PKD1L2	361	.	0			c.G1857T						PASS	.						28.0	37.0	34.0					16																	81219237		2054	4211	6265			114780	exon11			AACCACCAGCTCC	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		chr16.hg19:g.81219237C>A		76.0	0.0	.		112.0	64.0	.	NM_001076780	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Silent	SNP	ENST00000525539.1	hg19		.	.	.	.	.	.	.	.	.	.	C	2.794	-0.250742	0.05867	.	.	ENSG00000166473	ENST00000526632	.	.	.	4.83	4.83	0.62350	.	.	.	.	.	T	0.63977	0.2557	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62817	-0.6774	4	.	.	.	-11.14	12.4984	0.55942	0.0:0.832:0.168:0.0	.	.	.	.	C	147	.	.	G	-	1	0	PKD1L2	79776738	0.992000	0.36948	0.998000	0.56505	0.243000	0.25628	1.525000	0.35953	2.241000	0.73720	0.551000	0.68910	GGT	.	.	.	none		0.602	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2		
SPNS3	201305	hgsc.bcm.edu	37	17	4343008	4343008	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr17:4343008G>C	ENST00000355530.2	+	2	535	c.255G>C	c.(253-255)ttG>ttC	p.L85F	SPNS3_ENST00000576069.1_3'UTR|SPNS3_ENST00000333476.2_Missense_Mutation_p.C4S	NM_182538.4	NP_872344.3	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3 (Drosophila)	85					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(6)|stomach(2)	28						ATGCTGGTTTGCTTCAGACTG	0.582																																					p.L85F		Atlas-SNP	.											.	SPNS3	52	.	0			c.G255C						PASS	.						58.0	49.0	52.0					17																	4343008		2203	4300	6503	SO:0001583	missense	201305	exon2			TGGTTTGCTTCAG		CCDS11045.1	17p13.2	2014-08-12			ENSG00000182557	ENSG00000182557			28433	protein-coding gene	gene with protein product		611701					Standard	NM_182538		Approved	MGC29671	uc002fxt.3	Q6ZMD2	OTTHUMG00000177737	ENST00000355530.2:c.255G>C	chr17.hg19:g.4343008G>C	ENSP00000347721:p.Leu85Phe	45.0	0.0	.		42.0	14.0	.	NM_182538	Q8IZ31	Missense_Mutation	SNP	ENST00000355530.2	hg19	CCDS11045.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.05|17.05	3.289082|3.289082	0.59976|0.59976	.|.	.|.	ENSG00000182557|ENSG00000182557	ENST00000333476|ENST00000355530	T|T	0.25579|0.61980	1.79|0.06	4.31|4.31	3.33|3.33	0.38152|0.38152	.|Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	.|0.161988	.|0.40554	.|N	.|0.001061	T|T	0.74680|0.74680	0.3748|0.3748	M|M	0.75777|0.75777	2.31|2.31	0.24745|0.24745	N|N	0.993014|0.993014	B|D	0.18013|0.67145	0.025|0.996	B|D	0.16289|0.74023	0.015|0.982	T|T	0.65010|0.65010	-0.6272|-0.6272	9|10	0.07813|0.87932	T|D	0.8|0	-8.5223|-8.5223	8.7516|8.7516	0.34620|0.34620	0.1093:0.0:0.8907:0.0|0.1093:0.0:0.8907:0.0	.|.	4|85	Q6ZMD2-2|Q6ZMD2	.|SPNS3_HUMAN	S|F	4|85	ENSP00000333207:C4S|ENSP00000347721:L85F	ENSP00000333207:C4S|ENSP00000347721:L85F	C|L	+|+	2|3	0|2	SPNS3|SPNS3	4289757|4289757	0.836000|0.836000	0.29430|0.29430	1.000000|1.000000	0.80357|0.80357	0.959000|0.959000	0.62525|0.62525	-0.176000|-0.176000	0.09811|0.09811	1.115000|1.115000	0.41800|0.41800	0.650000|0.650000	0.86243|0.86243	TGC|TTG	.	.	.	none		0.582	SPNS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438793.1	NM_182538	
MED9	55090	hgsc.bcm.edu	37	17	17380470	17380470	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr17:17380470C>T	ENST00000268711.3	+	1	171	c.115C>T	c.(115-117)Cct>Tct	p.P39S	MED9_ENST00000585041.1_3'UTR|MED9_ENST00000580462.1_Missense_Mutation_p.P39S	NM_018019.2	NP_060489.1	Q9NWA0	MED9_HUMAN	mediator complex subunit 9	39	Pro-rich.					mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			cervix(1)|endometrium(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						gccgccggtccctgcgcctca	0.672																																					p.P39S		Atlas-SNP	.											.	MED9	11	.	0			c.C115T						PASS	.						15.0	16.0	16.0					17																	17380470		2199	4293	6492	SO:0001583	missense	55090	exon1			CCGGTCCCTGCGC	BC000647	CCDS11184.1	17p11.2	2007-07-30	2007-07-30		ENSG00000141026	ENSG00000141026			25487	protein-coding gene	gene with protein product		609878	"""mediator of RNA polymerase II transcription, subunit 9 homolog (S. cerevisiae)"""			11997338	Standard	NM_018019		Approved	FLJ10193, MED25	uc002grh.1	Q9NWA0	OTTHUMG00000059293	ENST00000268711.3:c.115C>T	chr17.hg19:g.17380470C>T	ENSP00000268711:p.Pro39Ser	69.0	0.0	.		103.0	48.0	.	NM_018019		Missense_Mutation	SNP	ENST00000268711.3	hg19	CCDS11184.1	.	.	.	.	.	.	.	.	.	.	C	2.166	-0.390952	0.04932	.	.	ENSG00000141026	ENST00000268711	.	.	.	5.5	2.19	0.27852	.	0.724378	0.12016	N	0.507437	T	0.22282	0.0537	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17868	-1.0355	9	0.44086	T	0.13	-8.2254	8.2274	0.31577	0.0:0.3189:0.5081:0.1731	.	39	Q9NWA0	MED9_HUMAN	S	39	.	ENSP00000268711:P39S	P	+	1	0	MED9	17321195	0.067000	0.21026	0.021000	0.16686	0.292000	0.27327	1.046000	0.30354	0.668000	0.31126	-0.226000	0.12346	CCT	.	.	.	none		0.672	MED9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131669.2	NM_018019	
MYO18A	399687	hgsc.bcm.edu	37	17	27447772	27447772	+	Silent	SNP	C	C	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr17:27447772C>T	ENST00000527372.1	-	7	1770	c.1590G>A	c.(1588-1590)gaG>gaA	p.E530E	MYO18A_ENST00000354329.4_Silent_p.E530E|MYO18A_ENST00000531253.1_Silent_p.E530E|MYO18A_ENST00000533112.1_Silent_p.E530E	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	530	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CCTGCCACTTCTCCACTGCAG	0.572																																					p.E530E	Esophageal Squamous(182;472 2015 7001 15270 22562)	Atlas-SNP	.											.	MYO18A	217	.	0			c.G1590A						PASS	.						57.0	65.0	62.0					17																	27447772		2043	4187	6230	SO:0001819	synonymous_variant	399687	exon7			CCACTTCTCCACT	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.1590G>A	chr17.hg19:g.27447772C>T		96.0	0.0	.		102.0	27.0	.	NM_078471	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Silent	SNP	ENST00000527372.1	hg19	CCDS45642.1																																																																																			.	.	.	none		0.572	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
GPR179	440435	hgsc.bcm.edu	37	17	36482812	36482812	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr17:36482812T>A	ENST00000342292.4	-	11	6660	c.6640A>T	c.(6640-6642)Atg>Ttg	p.M2214L	GPR179_ENST00000584976.1_Intron	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	2214					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CTGCTTCCCATGCTGCCTGCT	0.567																																					p.M2214L		Atlas-SNP	.											.	GPR179	170	.	0			c.A6640T						PASS	.						96.0	95.0	95.0					17																	36482812		2057	4211	6268	SO:0001583	missense	440435	exon11			TTCCCATGCTGCC		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.6640A>T	chr17.hg19:g.36482812T>A	ENSP00000345060:p.Met2214Leu	63.0	0.0	.		83.0	48.0	.	NM_001004334		Missense_Mutation	SNP	ENST00000342292.4	hg19	CCDS42308.1	.	.	.	.	.	.	.	.	.	.	T	12.05	1.822812	0.32237	.	.	ENSG00000188888	ENST00000342292	T	0.47869	0.83	4.85	-7.67	0.01272	.	2.213480	0.02200	N	0.062151	T	0.35278	0.0926	L	0.40543	1.245	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12760	-1.0535	10	0.27082	T	0.32	2.8526	9.3478	0.38120	0.0:0.4802:0.2389:0.2809	.	2214	Q6PRD1	GP179_HUMAN	L	2214	ENSP00000345060:M2214L	ENSP00000345060:M2214L	M	-	1	0	GPR179	33736338	0.000000	0.05858	0.000000	0.03702	0.273000	0.26683	-2.919000	0.00694	-1.922000	0.01067	-0.621000	0.04028	ATG	.	.	.	none		0.567	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2		
TEX2	55852	hgsc.bcm.edu	37	17	62271048	62271048	+	Silent	SNP	G	G	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr17:62271048G>T	ENST00000583097.1	-	4	2219	c.2047C>A	c.(2047-2049)Cga>Aga	p.R683R	TEX2_ENST00000584379.1_Silent_p.R683R|TEX2_ENST00000258991.3_Silent_p.R683R			Q8IWB9	TEX2_HUMAN	testis expressed 2	683					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		ATCTGATCTCGCTGGCTAGAT	0.483																																					p.R683R		Atlas-SNP	.											.	TEX2	89	.	0			c.C2047A						PASS	.						127.0	121.0	123.0					17																	62271048		2203	4300	6503	SO:0001819	synonymous_variant	55852	exon4			GATCTCGCTGGCT	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.2047C>A	chr17.hg19:g.62271048G>T		107.0	0.0	.		180.0	116.0	.	NM_018469	Q6AHZ5|Q8N3L0|Q9C0C5	Silent	SNP	ENST00000583097.1	hg19																																																																																				.	.	.	none		0.483	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469	
ABCA8	10351	hgsc.bcm.edu	37	17	66918423	66918423	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr17:66918423T>G	ENST00000269080.2	-	11	1598	c.1461A>C	c.(1459-1461)aaA>aaC	p.K487N	ABCA8_ENST00000430352.2_Missense_Mutation_p.K487N|ABCA8_ENST00000586539.1_Missense_Mutation_p.K487N	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	487	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					CTTTATATTCTTTTGTAACAT	0.244																																					p.K487N		Atlas-SNP	.											.	ABCA8	213	.	0			c.A1461C						PASS	.						37.0	40.0	39.0					17																	66918423		2187	4289	6476	SO:0001583	missense	10351	exon11			ATATTCTTTTGTA	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.1461A>C	chr17.hg19:g.66918423T>G	ENSP00000269080:p.Lys487Asn	164.0	0.0	.		253.0	75.0	.	NM_007168	A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	ENST00000269080.2	hg19	CCDS11680.1	.	.	.	.	.	.	.	.	.	.	T	17.21	3.332251	0.60853	.	.	ENSG00000141338	ENST00000269080;ENST00000430352;ENST00000541225;ENST00000542396	T;T	0.46819	0.86;0.86	4.74	1.29	0.21616	ABC transporter-like (1);	0.000000	0.56097	D	0.000033	T	0.68705	0.3030	M	0.92219	3.285	0.51012	D	0.999901	D;D;D;D;D	0.89917	0.999;0.991;1.0;0.998;0.996	D;D;D;D;D	0.79784	0.984;0.938;0.993;0.984;0.963	T	0.67007	-0.5779	10	0.87932	D	0	.	5.0198	0.14356	0.1396:0.164:0.0:0.6964	.	426;487;487;487;487	F5H6Z4;A1L3U3;B4DJ11;C9JQE6;O94911	.;.;.;.;ABCA8_HUMAN	N	487;487;426;118	ENSP00000269080:K487N;ENSP00000402814:K487N	ENSP00000269080:K487N	K	-	3	2	ABCA8	64430018	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.679000	0.37597	0.382000	0.24878	0.477000	0.44152	AAA	.	.	.	none		0.244	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168	
SMCHD1	23347	hgsc.bcm.edu	37	18	2728547	2728547	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr18:2728547G>A	ENST00000320876.6	+	23	3204	c.2866G>A	c.(2866-2868)Gaa>Aaa	p.E956K	RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000609587.1_3'UTR|SMCHD1_ENST00000261598.8_Missense_Mutation_p.E956K	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	956					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						AGTTTTAGATGAATCAGACAA	0.363																																					p.E956K		Atlas-SNP	.											.	SMCHD1	88	.	0			c.G2866A						PASS	.						106.0	100.0	101.0					18																	2728547		1849	4098	5947	SO:0001583	missense	23347	exon23			TTAGATGAATCAG	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.2866G>A	chr18.hg19:g.2728547G>A	ENSP00000326603:p.Glu956Lys	115.0	0.0	.		103.0	47.0	.	NM_015295	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	ENST00000320876.6	hg19	CCDS45822.1	.	.	.	.	.	.	.	.	.	.	G	15.65	2.895482	0.52121	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.23754	1.89;1.89	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.21103	0.0508	L	0.39633	1.23	0.38058	D	0.935997	B	0.28512	0.214	B	0.20767	0.031	T	0.06643	-1.0815	10	0.23891	T	0.37	-26.3497	14.3232	0.66502	0.0705:0.0:0.9295:0.0	.	956	A6NHR9	SMHD1_HUMAN	K	956	ENSP00000326603:E956K;ENSP00000261598:E956K	ENSP00000261598:E956K	E	+	1	0	SMCHD1	2718547	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.430000	0.66501	2.764000	0.94973	0.650000	0.86243	GAA	.	.	.	none		0.363	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
CABLES1	91768	hgsc.bcm.edu	37	18	20815956	20815956	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr18:20815956T>C	ENST00000256925.7	+	6	1283	c.1283T>C	c.(1282-1284)cTg>cCg	p.L428P	CABLES1_ENST00000420687.2_Missense_Mutation_p.L163P|TMEM241_ENST00000450466.2_Intron|CABLES1_ENST00000400473.2_Missense_Mutation_p.L101P|CABLES1_ENST00000585061.1_Intron	NM_001100619.2	NP_001094089.1	Q8TDN4	CABL1_HUMAN	Cdk5 and Abl enzyme substrate 1	428	Interacts with CDK3. {ECO:0000250}.				blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|nervous system development (GO:0007399)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)	cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|stomach(1)	11	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TTCCGTAACCTGAGCCACCGC	0.572																																					p.L428P		Atlas-SNP	.											.	CABLES1	32	.	0			c.T1283C						PASS	.						79.0	83.0	82.0					18																	20815956		1895	4107	6002	SO:0001583	missense	91768	exon6			GTAACCTGAGCCA	BC037218	CCDS42417.1, CCDS42418.1, CCDS58615.1	18q11.2	2005-08-16				ENSG00000134508			25097	protein-coding gene	gene with protein product		609194				12477932	Standard	NM_138375		Approved	HsT2563, FLJ35924	uc002kuc.2	Q8TDN4		ENST00000256925.7:c.1283T>C	chr18.hg19:g.20815956T>C	ENSP00000256925:p.Leu428Pro	63.0	0.0	.		76.0	23.0	.	NM_001100619	B4DK60|Q8N3Y8|Q8NA22|Q9BTG1	Missense_Mutation	SNP	ENST00000256925.7	hg19	CCDS42417.1	.	.	.	.	.	.	.	.	.	.	T	15.05	2.717455	0.48622	.	.	ENSG00000134508	ENST00000400473;ENST00000256925;ENST00000420687	T;T;T	0.46063	0.93;0.88;0.89	5.47	4.34	0.51931	.	0.175925	0.48767	D	0.000177	T	0.18383	0.0441	N	0.14661	0.345	0.80722	D	1	B;P	0.46395	0.343;0.877	B;B	0.36030	0.134;0.216	T	0.02721	-1.1119	10	0.34782	T	0.22	-26.8928	3.1763	0.06570	0.0:0.357:0.0:0.643	.	163;428	Q8TDN4-2;Q8TDN4	.;CABL1_HUMAN	P	101;428;163	ENSP00000383321:L101P;ENSP00000256925:L428P;ENSP00000413851:L163P	ENSP00000256925:L428P	L	+	2	0	CABLES1	19069954	1.000000	0.71417	0.996000	0.52242	0.986000	0.74619	4.678000	0.61641	2.080000	0.62538	0.533000	0.62120	CTG	.	.	.	none		0.572	CABLES1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445198.2	NM_138375	
TTR	7276	hgsc.bcm.edu	37	18	29178600	29178600	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr18:29178600T>G	ENST00000237014.3	+	4	583	c.406T>G	c.(406-408)Tat>Gat	p.Y136D		NM_000371.3	NP_000362.1	P02766	TTHY_HUMAN	transthyretin	136	Thyroid hormone binding.		Y -> S (in AMYL-TTR; amyloid polyneuropathy). {ECO:0000269|PubMed:10627135}.|Y -> V (requires 2 nucleotide substitutions). {ECO:0000269|PubMed:3675594}.		extracellular matrix organization (GO:0030198)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	hormone binding (GO:0042562)|identical protein binding (GO:0042802)			cervix(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	13			OV - Ovarian serous cystadenocarcinoma(10;0.00523)		Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diflunisal(DB00861)|Dimethyl sulfoxide(DB01093)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CCCCTACTCCTATTCCACCAC	0.547																																					p.Y136D		Atlas-SNP	.											TTR,NS,carcinoma,0,1	TTR	21	.	0			c.T406G						PASS	.						80.0	67.0	71.0					18																	29178600		2203	4300	6503	SO:0001583	missense	7276	exon4			TACTCCTATTCCA	M10605	CCDS11899.1	18q12.1	2014-09-17	2008-07-31		ENSG00000118271	ENSG00000118271			12405	protein-coding gene	gene with protein product		176300	"""prealbumin, amyloidosis type I"", ""carpal tunnel syndrome 1"""	PALB, CTS1		8309582	Standard	NM_000371		Approved	HsT2651, CTS	uc002kwx.4	P02766	OTTHUMG00000131984	ENST00000237014.3:c.406T>G	chr18.hg19:g.29178600T>G	ENSP00000237014:p.Tyr136Asp	71.0	2.0	.		60.0	20.0	.	NM_000371	Q549C7|Q6IB96|Q9UBZ6|Q9UCM9	Missense_Mutation	SNP	ENST00000237014.3	hg19	CCDS11899.1	.	.	.	.	.	.	.	.	.	.	T	17.49	3.403205	0.62288	.	.	ENSG00000118271	ENST00000237014;ENST00000432547;ENST00000541025	D	0.98120	-4.73	6.08	6.08	0.98989	Transthyretin, conserved site (1);Transthyretin/hydroxyisourate hydrolase, superfamily (4);	0.246709	0.42294	D	0.000722	D	0.99064	0.9679	H	0.96301	3.8	0.53688	D	0.99997	D	0.89917	1.0	D	0.97110	1.0	D	0.99497	1.0952	10	0.87932	D	0	-18.6558	11.4063	0.49900	0.1349:0.0:0.0:0.8651	.	136	P02766	TTHY_HUMAN	D	136;173;128	ENSP00000237014:Y136D	ENSP00000237014:Y136D	Y	+	1	0	TTR	27432598	0.997000	0.39634	0.892000	0.35008	0.476000	0.33039	4.452000	0.60054	2.333000	0.79357	0.482000	0.46254	TAT	.	.	.	none		0.547	TTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254948.1	NM_000371	
WDR18	57418	hgsc.bcm.edu	37	19	984377	984377	+	Silent	SNP	C	C	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr19:984377C>T	ENST00000251289.5	+	1	47	c.24C>T	c.(22-24)gcC>gcT	p.A8A	WDR18_ENST00000591997.1_Intron|WDR18_ENST00000587001.2_Silent_p.A8A	NM_024100.3	NP_077005.2	Q9BV38	WDR18_HUMAN	WD repeat domain 18	8					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|lung(2)|skin(2)	7		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGAGGTGGCCGTGTGTACGG	0.716																																					p.A8A		Atlas-SNP	.											.	WDR18	20	.	0			c.C24T						PASS	.						20.0	22.0	21.0					19																	984377		2200	4296	6496	SO:0001819	synonymous_variant	57418	exon1			GGTGGCCGTGTGT		CCDS12051.1	19p13.3	2013-01-09				ENSG00000065268		"""WD repeat domain containing"""	17956	protein-coding gene	gene with protein product	"""Involved in Processing ITS2 3 homolog (S. cerevisiae)"""					22190735	Standard	NM_024100		Approved	Ipi3	uc002lqm.1	Q9BV38		ENST00000251289.5:c.24C>T	chr19.hg19:g.984377C>T		157.0	0.0	.		179.0	8.0	.	NM_024100	O60390|Q9BWR2	Silent	SNP	ENST00000251289.5	hg19	CCDS12051.1																																																																																			.	.	.	none		0.716	WDR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458225.2		
DOT1L	84444	hgsc.bcm.edu	37	19	2216297	2216297	+	Silent	SNP	A	A	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr19:2216297A>T	ENST00000398665.3	+	20	1977	c.1941A>T	c.(1939-1941)ctA>ctT	p.L647L	AC004490.1_ENST00000585593.1_RNA|DOT1L_ENST00000608122.1_3'UTR	NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	647					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTGTGGAGCTAGAGAAGAGCC	0.662																																					p.L647L		Atlas-SNP	.											.	DOT1L	205	.	0			c.A1941T						PASS	.						38.0	44.0	42.0					19																	2216297		2012	4155	6167	SO:0001819	synonymous_variant	84444	exon20			GGAGCTAGAGAAG	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.1941A>T	chr19.hg19:g.2216297A>T		60.0	0.0	.		64.0	30.0	.	NM_032482	O60379|Q96JL1	Silent	SNP	ENST00000398665.3	hg19	CCDS42460.1	.	.	.	.	.	.	.	.	.	.	A	10.49	1.364766	0.24684	.	.	ENSG00000104885	ENST00000440640	.	.	.	5.13	-2.15	0.07102	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-18.8059	1.5698	0.02612	0.2261:0.288:0.3288:0.1572	.	.	.	.	L	434	.	.	X	+	2	0	DOT1L	2167297	0.994000	0.37717	0.998000	0.56505	0.938000	0.57974	0.207000	0.17395	-0.059000	0.13154	-0.132000	0.14878	TAG	.	.	.	none		0.662	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
RANBP3	8498	hgsc.bcm.edu	37	19	5921298	5921298	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr19:5921298G>A	ENST00000340578.6	-	14	1301	c.1244C>T	c.(1243-1245)tCa>tTa	p.S415L	RANBP3_ENST00000591092.1_Missense_Mutation_p.S342L|RANBP3_ENST00000034275.8_Missense_Mutation_p.S347L|RANBP3_ENST00000439268.2_Missense_Mutation_p.S410L|RANBP3_ENST00000541471.1_Missense_Mutation_p.S287L	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	415	RanBD1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						CCAGGACTGTGAGGTCTTGTC	0.612																																					p.S415L		Atlas-SNP	.											.	RANBP3	36	.	0			c.C1244T						PASS	.						58.0	66.0	63.0					19																	5921298		2009	4184	6193	SO:0001583	missense	8498	exon14			GACTGTGAGGTCT	Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.1244C>T	chr19.hg19:g.5921298G>A	ENSP00000341483:p.Ser415Leu	92.0	0.0	.		55.0	23.0	.	NM_007322	B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Missense_Mutation	SNP	ENST00000340578.6	hg19	CCDS42478.1	.	.	.	.	.	.	.	.	.	.	G	34	5.360198	0.95877	.	.	ENSG00000031823	ENST00000340578;ENST00000439268;ENST00000034275;ENST00000324807;ENST00000541471	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.28	5.28	0.74379	Pleckstrin homology-type (1);Ran binding protein 1 (3);	0.191591	0.46442	D	0.000294	T	0.57460	0.2055	M	0.67569	2.06	0.58432	D	0.999995	P;D;D;D;D;D;D	0.59357	0.924;0.985;0.971;0.971;0.964;0.982;0.985	P;P;P;P;P;P;P	0.57548	0.505;0.823;0.714;0.714;0.591;0.729;0.823	T	0.54886	-0.8226	10	0.34782	T	0.22	-13.0523	16.4424	0.83906	0.0:0.0:1.0:0.0	.	287;410;287;342;347;410;415	F5H4C2;Q53GE1;B7Z5P4;B7Z7F3;Q9H6Z4-3;Q9H6Z4-2;Q9H6Z4	.;.;.;.;.;.;RANB3_HUMAN	L	415;410;347;346;287	ENSP00000341483:S415L;ENSP00000404837:S410L;ENSP00000034275:S347L;ENSP00000445071:S287L	ENSP00000034275:S347L	S	-	2	0	RANBP3	5872298	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	7.498000	0.81546	2.479000	0.83701	0.655000	0.94253	TCA	.	.	.	none		0.612	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452304.1	NM_007322	
MUC16	94025	hgsc.bcm.edu	37	19	9049050	9049050	+	Missense_Mutation	SNP	A	A	C	rs554642180		TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr19:9049050A>C	ENST00000397910.4	-	5	32784	c.32581T>G	c.(32581-32583)Tcc>Gcc	p.S10861A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10863	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GCTGAACTGGATTCTGCCCCA	0.483													A|||	1	0.000199681	0.0	0.0	5008	,	,		23708	0.001		0.0	False		,,,				2504	0.0				p.S10861A		Atlas-SNP	.											.	MUC16	4315	.	0			c.T32581G						PASS	.						110.0	99.0	102.0					19																	9049050		1929	4137	6066	SO:0001583	missense	94025	exon5			AACTGGATTCTGC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.32581T>G	chr19.hg19:g.9049050A>C	ENSP00000381008:p.Ser10861Ala	115.0	0.0	.		125.0	49.0	.	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	a	3.311	-0.140758	0.06669	.	.	ENSG00000181143	ENST00000397910	T	0.02395	4.31	3.2	-6.4	0.01944	.	.	.	.	.	T	0.01320	0.0043	N	0.08118	0	.	.	.	B	0.02656	0.0	B	0.04013	0.001	T	0.48055	-0.9068	8	0.87932	D	0	.	0.8056	0.01083	0.3995:0.1925:0.1073:0.3007	.	10861	B5ME49	.	A	10861	ENSP00000381008:S10861A	ENSP00000381008:S10861A	S	-	1	0	MUC16	8910050	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.603000	0.00890	-2.560000	0.00474	-2.063000	0.00397	TCC	.	.	.	none		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF490	57474	hgsc.bcm.edu	37	19	12693704	12693704	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr19:12693704C>G	ENST00000311437.6	-	4	432	c.310G>C	c.(310-312)Gat>Cat	p.D104H	CTD-2192J16.20_ENST00000593682.1_5'Flank|ZNF490_ENST00000465656.1_5'Flank	NM_020714.2	NP_065765.1	Q9ULM2	ZN490_HUMAN	zinc finger protein 490	104	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	18						TCTTCAATATCCTGGTCTTTC	0.313																																					p.D104H		Atlas-SNP	.											.	ZNF490	42	.	0			c.G310C						PASS	.						119.0	124.0	122.0					19																	12693704		2203	4299	6502	SO:0001583	missense	57474	exon4			CAATATCCTGGTC	AB033024	CCDS12272.1	19p13.2	2013-01-08			ENSG00000188033	ENSG00000188033		"""Zinc fingers, C2H2-type"", ""-"""	23705	protein-coding gene	gene with protein product							Standard	NM_020714		Approved	KIAA1198	uc002mtz.2	Q9ULM2	OTTHUMG00000156398	ENST00000311437.6:c.310G>C	chr19.hg19:g.12693704C>G	ENSP00000311521:p.Asp104His	56.0	0.0	.		90.0	10.0	.	NM_020714		Missense_Mutation	SNP	ENST00000311437.6	hg19	CCDS12272.1	.	.	.	.	.	.	.	.	.	.	C	4.469	0.086965	0.08583	.	.	ENSG00000188033	ENST00000311437;ENST00000440366	T;T	0.00949	5.51;5.51	0.93	-0.166	0.13351	Krueppel-associated box (3);	.	.	.	.	T	0.00784	0.0026	N	0.26042	0.785	0.09310	N	1	B	0.10296	0.003	B	0.01281	0.0	T	0.46748	-0.9169	9	0.40728	T	0.16	.	3.172	0.06555	0.0:0.6767:0.0:0.3233	.	104	Q9ULM2	ZN490_HUMAN	H	104;51	ENSP00000311521:D104H;ENSP00000404112:D51H	ENSP00000311521:D104H	D	-	1	0	ZNF490	12554704	0.000000	0.05858	0.001000	0.08648	0.060000	0.15804	-1.188000	0.03064	-0.024000	0.13941	0.436000	0.28706	GAT	.	.	.	none		0.313	ZNF490-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344073.1	NM_020714	
UPF1	5976	hgsc.bcm.edu	37	19	18960968	18960968	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr19:18960968G>T	ENST00000599848.1	+	4	755	c.546G>T	c.(544-546)gaG>gaT	p.E182D	UPF1_ENST00000600310.1_3'UTR|UPF1_ENST00000262803.5_Missense_Mutation_p.E182D			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	182	Sufficient for interaction with RENT2.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						CAGTCCTGGAGTGCTACAACT	0.572																																					p.E182D		Atlas-SNP	.											.	UPF1	88	.	0			c.G546T						PASS	.						106.0	100.0	102.0					19																	18960968		2203	4300	6503	SO:0001583	missense	5976	exon4			CCTGGAGTGCTAC	AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.546G>T	chr19.hg19:g.18960968G>T	ENSP00000470142:p.Glu182Asp	68.0	0.0	.		61.0	29.0	.	NM_002911	O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	ENST00000599848.1	hg19		.	.	.	.	.	.	.	.	.	.	G	21.7	4.189383	0.78789	.	.	ENSG00000005007	ENST00000262803	D	0.91843	-2.92	4.89	1.59	0.23543	RNA helicase UPF1, UPF2-interacting domain (1);	0.000000	0.85682	D	0.000000	D	0.96762	0.8943	H	0.97415	4	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.79108	0.992;0.987	D	0.95078	0.8210	10	0.87932	D	0	-47.5877	7.77	0.29001	0.4208:0.0:0.5792:0.0	.	182;182	Q92900;Q92900-2	RENT1_HUMAN;.	D	182	ENSP00000262803:E182D	ENSP00000262803:E182D	E	+	3	2	UPF1	18821968	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	2.236000	0.43052	0.472000	0.27344	0.467000	0.42956	GAG	.	.	.	none		0.572	UPF1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464684.1	NM_002911	
ZNF529	57711	hgsc.bcm.edu	37	19	37038652	37038652	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr19:37038652T>A	ENST00000591340.1	-	5	966	c.808A>T	c.(808-810)Act>Tct	p.T270S	ZNF529_ENST00000334116.7_Missense_Mutation_p.T165S	NM_020951.4	NP_066002.3	Q6P280	ZN529_HUMAN	zinc finger protein 529	270					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)	1	Esophageal squamous(110;0.198)					TGAAGTGGAGTAACTTTTCCA	0.333																																					p.T270S		Atlas-SNP	.											.	ZNF529	82	.	0			c.A808T						PASS	.						143.0	141.0	141.0					19																	37038652		1875	4122	5997	SO:0001583	missense	57711	exon6			GTGGAGTAACTTT	AK025110	CCDS54256.1	19q13.13	2014-08-22			ENSG00000186020	ENSG00000186020		"""Zinc fingers, C2H2-type"", ""-"""	29328	protein-coding gene	gene with protein product						10997877	Standard	NM_020951		Approved	KIAA1615	uc002oeh.4	Q6P280	OTTHUMG00000180714	ENST00000591340.1:c.808A>T	chr19.hg19:g.37038652T>A	ENSP00000465578:p.Thr270Ser	72.0	0.0	.		77.0	36.0	.	NM_001145649	K7EKE1|Q9H731|Q9HCF7	Missense_Mutation	SNP	ENST00000591340.1	hg19	CCDS54256.1	.	.	.	.	.	.	.	.	.	.	T	7.954	0.745517	0.15710	.	.	ENSG00000186020	ENST00000334116	.	.	.	3.68	2.66	0.31614	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.30070	0.0753	L	0.37800	1.135	0.09310	N	1	B;B	0.15719	0.014;0.008	B;B	0.15484	0.013;0.004	T	0.22034	-1.0228	8	0.42905	T	0.14	.	5.3337	0.15945	0.0:0.3507:0.0:0.6492	.	165;237	Q6P280-2;Q6P280	.;ZN529_HUMAN	S	270	.	ENSP00000334695:T270S	T	-	1	0	ZNF529	41730492	0.000000	0.05858	0.022000	0.16811	0.636000	0.38137	0.098000	0.15189	0.486000	0.27676	0.482000	0.46254	ACT	.	.	.	none		0.333	ZNF529-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452730.1	NM_020951	
ZNF585B	92285	hgsc.bcm.edu	37	19	37677880	37677880	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr19:37677880T>G	ENST00000532828.2	-	5	810	c.559A>C	c.(559-561)Aag>Cag	p.K187Q	CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000527838.1_Intron|ZNF585B_ENST00000312908.5_Intron|ZNF585B_ENST00000531805.1_Missense_Mutation_p.K132Q	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	187					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCATTGCACTTATAGGGCTTC	0.378																																					p.K187Q	Melanoma(93;882 1454 18863 28917 48427)	Atlas-SNP	.											.	ZNF585B	91	.	0			c.A559C						PASS	.						131.0	132.0	132.0					19																	37677880		2203	4300	6503	SO:0001583	missense	92285	exon5			TGCACTTATAGGG	AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.559A>C	chr19.hg19:g.37677880T>G	ENSP00000433773:p.Lys187Gln	80.0	0.0	.		91.0	39.0	.	NM_152279	Q8IZD3|Q96JW6	Missense_Mutation	SNP	ENST00000532828.2	hg19	CCDS12500.1	.	.	.	.	.	.	.	.	.	.	T	6.257	0.415489	0.11870	.	.	ENSG00000245680	ENST00000531805;ENST00000532828	T;T	0.18810	2.19;2.19	2.41	0.0526	0.14303	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.398528	0.18240	N	0.147278	T	0.08891	0.0220	N	0.17838	0.53	0.22571	N	0.998976	P	0.42620	0.785	B	0.33521	0.165	T	0.22695	-1.0209	10	0.42905	T	0.14	.	4.7311	0.12964	0.0:0.1276:0.1936:0.6789	.	187	Q52M93	Z585B_HUMAN	Q	132;187	ENSP00000436774:K132Q;ENSP00000433773:K187Q	ENSP00000436774:K132Q	K	-	1	0	ZNF585B	42369720	0.000000	0.05858	0.916000	0.36221	0.699000	0.40488	-0.527000	0.06200	0.126000	0.18424	0.374000	0.22700	AAG	.	.	.	none		0.378	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388272.2	NM_152279	
PLEKHA4	57664	hgsc.bcm.edu	37	19	49364695	49364695	+	Missense_Mutation	SNP	C	C	T	rs201822487		TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr19:49364695C>T	ENST00000263265.6	-	5	884	c.329G>A	c.(328-330)gGg>gAg	p.G110E	PLEKHA4_ENST00000355496.5_Missense_Mutation_p.G110E|PLEKHA4_ENST00000596713.1_5'Flank	NM_020904.2	NP_065955.2	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4	110	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	30		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		GGCTCCCGGCCCATCTGGTCT	0.612																																					p.G110E		Atlas-SNP	.											.	PLEKHA4	70	.	0			c.G329A						PASS	.						47.0	61.0	56.0					19																	49364695		2203	4300	6503	SO:0001583	missense	57664	exon5			CCCGGCCCATCTG	AY007233	CCDS12737.1, CCDS54291.1	19q13.33	2013-01-10	2002-01-14			ENSG00000105559		"""Pleckstrin homology (PH) domain containing"""	14339	protein-coding gene	gene with protein product		607769	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 4"""			11001876	Standard	NM_020904		Approved	PEPP1	uc002pkx.3	Q9H4M7		ENST00000263265.6:c.329G>A	chr19.hg19:g.49364695C>T	ENSP00000263265:p.Gly110Glu	56.0	0.0	.		98.0	51.0	.	NM_001161354	Q8N4M8|Q8N658	Missense_Mutation	SNP	ENST00000263265.6	hg19	CCDS12737.1	.	.	.	.	.	.	.	.	.	.	c	19.98	3.926443	0.73327	.	.	ENSG00000105559	ENST00000263265;ENST00000355496	T;T	0.74209	-0.82;-0.82	4.56	4.56	0.56223	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.424077	0.22724	N	0.056413	T	0.76849	0.4045	N	0.20357	0.565	0.31463	N	0.669357	D;P	0.89917	1.0;0.685	D;P	0.75020	0.985;0.624	T	0.78802	-0.2061	10	0.66056	D	0.02	.	15.2385	0.73450	0.0:1.0:0.0:0.0	.	110;110	Q9H4M7-2;Q9H4M7	.;PKHA4_HUMAN	E	110	ENSP00000263265:G110E;ENSP00000347683:G110E	ENSP00000263265:G110E	G	-	2	0	PLEKHA4	54056507	0.877000	0.30153	1.000000	0.80357	0.992000	0.81027	2.412000	0.44609	2.548000	0.85928	0.457000	0.33378	GGG	.	C|0.999;T|0.001	0.001	weak		0.612	PLEKHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466216.1		
AP2A1	160	hgsc.bcm.edu	37	19	50304776	50304776	+	Silent	SNP	C	C	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr19:50304776C>T	ENST00000359032.5	+	13	1683	c.1683C>T	c.(1681-1683)ggC>ggT	p.G561G	AP2A1_ENST00000354293.5_Silent_p.G561G	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	561					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CCATCCAGGGCGTCCTGCGGG	0.652																																					p.G561G		Atlas-SNP	.											.	AP2A1	108	.	0			c.C1683T						PASS	.						50.0	53.0	52.0					19																	50304776		2111	4233	6344	SO:0001819	synonymous_variant	160	exon13			CCAGGGCGTCCTG	AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.1683C>T	chr19.hg19:g.50304776C>T		138.0	0.0	.		156.0	20.0	.	NM_130787	Q96CI7|Q96PP6|Q96PP7|Q9H070	Silent	SNP	ENST00000359032.5	hg19	CCDS46148.1																																																																																			.	.	.	none		0.652	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465809.1		
ZNF749	388567	hgsc.bcm.edu	37	19	57955392	57955392	+	Silent	SNP	C	C	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr19:57955392C>T	ENST00000334181.4	+	3	1126	c.876C>T	c.(874-876)ctC>ctT	p.L292L	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	292					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		AGGAGATTCTCAGTAGACCAA	0.453																																					p.L292L		Atlas-SNP	.											.	ZNF749	75	.	0			c.C876T						PASS	.						74.0	75.0	75.0					19																	57955392		2203	4300	6503	SO:0001819	synonymous_variant	388567	exon3			GATTCTCAGTAGA	AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.876C>T	chr19.hg19:g.57955392C>T		118.0	0.0	.		123.0	49.0	.	NM_001023561		Silent	SNP	ENST00000334181.4	hg19	CCDS33132.2																																																																																			.	.	.	none		0.453	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317879.1	NM_001023561	
NINL	22981	hgsc.bcm.edu	37	20	25460838	25460838	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr20:25460838T>G	ENST00000278886.6	-	15	1949	c.1876A>C	c.(1876-1878)Aag>Cag	p.K626Q	NINL_ENST00000422516.1_Missense_Mutation_p.K626Q	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	626					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						TAATGCTCCTTTACCTGCTCC	0.542																																					p.K626Q		Atlas-SNP	.											.	NINL	148	.	0			c.A1876C						PASS	.						167.0	142.0	150.0					20																	25460838		2203	4300	6503	SO:0001583	missense	22981	exon15			GCTCCTTTACCTG		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.1876A>C	chr20.hg19:g.25460838T>G	ENSP00000278886:p.Lys626Gln	97.0	0.0	.		132.0	48.0	.	NM_025176	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	ENST00000278886.6	hg19	CCDS33452.1	.	.	.	.	.	.	.	.	.	.	T	12.63	1.994822	0.35226	.	.	ENSG00000101004	ENST00000278886;ENST00000422516	T;T	0.41758	0.99;1.04	4.83	3.7	0.42460	.	0.285870	0.26460	N	0.024250	T	0.60971	0.2310	M	0.79258	2.445	0.25995	N	0.982195	D;D	0.76494	0.999;0.997	D;D	0.69479	0.964;0.953	T	0.54596	-0.8270	10	0.48119	T	0.1	-33.9293	10.6943	0.45890	0.0:0.0:0.1609:0.8391	.	626;626	Q9Y2I6-2;Q9Y2I6	.;NINL_HUMAN	Q	626	ENSP00000278886:K626Q;ENSP00000410431:K626Q	ENSP00000278886:K626Q	K	-	1	0	NINL	25408838	1.000000	0.71417	0.918000	0.36340	0.002000	0.02628	3.465000	0.53064	0.838000	0.34948	0.460000	0.39030	AAG	.	.	.	none		0.542	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176	
EDEM2	55741	hgsc.bcm.edu	37	20	33730267	33730267	+	Silent	SNP	G	G	T	rs375028628		TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr20:33730267G>T	ENST00000374492.3	-	4	378	c.273C>A	c.(271-273)gtC>gtA	p.V91V	EDEM2_ENST00000374491.3_Silent_p.V54V|EDEM2_ENST00000540582.1_Silent_p.V50V|EDEM2_ENST00000541621.1_5'UTR|EDEM2_ENST00000542871.1_5'UTR	NM_018217.2	NP_060687.2	Q9BV94	EDEM2_HUMAN	ER degradation enhancer, mannosidase alpha-like 2	91					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	22			BRCA - Breast invasive adenocarcinoma(18;0.00936)			GGAATTCTGAGACATTCCCCA	0.453																																					p.V91V	Esophageal Squamous(51;906 1021 24535 36410 39145)	Atlas-SNP	.											.	EDEM2	46	.	0			c.C273A						PASS	.						66.0	60.0	62.0					20																	33730267		2203	4300	6503	SO:0001819	synonymous_variant	55741	exon4			TTCTGAGACATTC	AK001645	CCDS13247.1, CCDS46592.1	20q11.22	2006-03-31	2006-03-31	2006-03-31	ENSG00000088298	ENSG00000088298			15877	protein-coding gene	gene with protein product		610302	"""chromosome 20 open reading frame 31"""	C20orf49, C20orf31		15537790, 15579471	Standard	NM_018217		Approved	FLJ10783, bA4204.1	uc002xbo.2	Q9BV94	OTTHUMG00000032322	ENST00000374492.3:c.273C>A	chr20.hg19:g.33730267G>T		56.0	0.0	.		103.0	55.0	.	NM_018217	B4DTG9|Q6GU33|Q6IA89|Q6UWZ4|Q9H4U0|Q9H886|Q9NTL9|Q9NVE6	Silent	SNP	ENST00000374492.3	hg19	CCDS13247.1																																																																																			.	.	.	alt		0.453	EDEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078842.2	NM_018217	
TOMM34	10953	hgsc.bcm.edu	37	20	43580553	43580553	+	Silent	SNP	C	C	T			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr20:43580553C>T	ENST00000372813.3	-	4	623	c.471G>A	c.(469-471)agG>agA	p.R157R	PABPC1L_ENST00000372819.1_Intron|PABPC1L_ENST00000490798.1_Intron	NM_006809.4	NP_006800.2	Q15785	TOM34_HUMAN	translocase of outer mitochondrial membrane 34	157					protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	heat shock protein binding (GO:0031072)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	11		Myeloproliferative disorder(115;0.0122)				AGGAATTCCACCTCTTCTGAG	0.522																																					p.R157R		Atlas-SNP	.											.	TOMM34	16	.	0			c.G471A						PASS	.						157.0	125.0	135.0					20																	43580553		2203	4300	6503	SO:0001819	synonymous_variant	10953	exon4			ATTCCACCTCTTC	U58970	CCDS13340.1	20q12-q13.1	2013-01-10			ENSG00000025772	ENSG00000025772		"""Tetratricopeptide (TTC) repeat domain containing"""	15746	protein-coding gene	gene with protein product	"""outer mitochondrial membrane translocase (34kD)"""					9324309	Standard	NM_006809		Approved	TOM34, HTOM34P	uc002xmy.3	Q15785	OTTHUMG00000032552	ENST00000372813.3:c.471G>A	chr20.hg19:g.43580553C>T		71.0	0.0	.		73.0	29.0	.	NM_006809	Q53GH9|Q6IBN7|Q9NTZ3	Silent	SNP	ENST00000372813.3	hg19	CCDS13340.1																																																																																			.	.	.	none		0.522	TOMM34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079390.3	NM_006809	
NRIP1	8204	hgsc.bcm.edu	37	21	16337481	16337482	+	Missense_Mutation	DNP	AC	AC	TA			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr21:16337481_16337482AC>TA	ENST00000400202.1	-	3	3744_3745	c.3032_3033GT>TA	c.(3031-3033)aGT>aTA	p.S1011I	NRIP1_ENST00000400199.1_Missense_Mutation_p.S1011I|NRIP1_ENST00000318948.4_Missense_Mutation_p.S1011I|AF127577.10_ENST00000446301.1_RNA			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	1011	Interaction with ZNF366.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		GGAAAGTAGGACTCACAGGAGT	0.47																																					p.S1011R|p.S1011I		Atlas-SNP	.											.	NRIP1	103	.	0			c.T3033A|c.G3032T						PASS	.																																			SO:0001583	missense	8204	exon4			AGTAGGACTCACA|GTAGGACTCACAG	X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.3032_3033delinsTA	chr21.hg19:g.16337481_16337482delinsTA	ENSP00000383063:p.Ser1011Ile	35.0|34.0	0.0	.		53.0|52.0	26.0|25.0	.	NM_003489	Q8IWE8	Missense_Mutation	SNP	ENST00000400202.1	hg19	CCDS13568.1																																																																																			.	.	.	none		0.470	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157926.1	NM_003489	
MORC3	23515	hgsc.bcm.edu	37	21	37732306	37732306	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr21:37732306A>C	ENST00000400485.1	+	11	1338	c.1262A>C	c.(1261-1263)aAa>aCa	p.K421T	AP000692.9_ENST00000397184.2_RNA|MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	421					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						AAGTGGCGGAAATTACCTGAT	0.428																																					p.K421T		Atlas-SNP	.											.	MORC3	78	.	0			c.A1262C						PASS	.						194.0	186.0	188.0					21																	37732306		2049	4224	6273	SO:0001583	missense	23515	exon11			GGCGGAAATTACC	AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.1262A>C	chr21.hg19:g.37732306A>C	ENSP00000383333:p.Lys421Thr	171.0	0.0	.		142.0	55.0	.	NM_015358	A8KA92|Q9UEZ2	Missense_Mutation	SNP	ENST00000400485.1	hg19	CCDS42924.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.096626	0.76870	.	.	ENSG00000159256	ENST00000400485	T	0.15256	2.44	5.68	5.68	0.88126	Zinc finger, CW-type (2);	0.000000	0.85682	D	0.000000	T	0.31420	0.0796	L	0.57130	1.785	0.58432	D	0.999995	P	0.46020	0.871	P	0.52343	0.696	T	0.01093	-1.1454	10	0.45353	T	0.12	-32.2775	15.9418	0.79758	1.0:0.0:0.0:0.0	.	421	Q14149	MORC3_HUMAN	T	421	ENSP00000383333:K421T	ENSP00000383333:K421T	K	+	2	0	MORC3	36654176	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	6.056000	0.71111	2.158000	0.67659	0.455000	0.32223	AAA	.	.	.	none		0.428	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1	NM_015358	
TBC1D22A	25771	hgsc.bcm.edu	37	22	47507468	47507468	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr22:47507468G>C	ENST00000337137.4	+	12	1560	c.1394G>C	c.(1393-1395)aGg>aCg	p.R465T	TBC1D22A_ENST00000355704.3_Missense_Mutation_p.R387T|TBC1D22A_ENST00000407381.3_Missense_Mutation_p.R406T|TBC1D22A_ENST00000406733.1_Missense_Mutation_p.R418T	NM_001284304.1|NM_001284305.1|NM_014346.2	NP_001271233.1|NP_001271234.1|NP_055161.1	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	465							protein homodimerization activity (GO:0042803)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(3)|large_intestine(10)|lung(5)|ovary(2)|prostate(1)	22		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		GTGAGATGGAGGAAGGAAATA	0.348																																					p.R465T		Atlas-SNP	.											.	TBC1D22A	54	.	0			c.G1394C						PASS	.						102.0	100.0	101.0					22																	47507468		2203	4300	6503	SO:0001583	missense	25771	exon12			GATGGAGGAAGGA	AK125705	CCDS14078.1, CCDS63511.1, CCDS63512.1, CCDS74877.1	22q13	2008-01-22	2005-01-05	2005-01-05	ENSG00000054611	ENSG00000054611			1309	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 4"""	C22orf4			Standard	XM_005261496		Approved		uc003bib.3	Q8WUA7	OTTHUMG00000150332	ENST00000337137.4:c.1394G>C	chr22.hg19:g.47507468G>C	ENSP00000336724:p.Arg465Thr	107.0	0.0	.		101.0	34.0	.	NM_014346	B0QYI2|B0QYI3|B9A6M3|Q5TE47|Q6ZUH2|Q92680|Q9BVD6|Q9UGG0|Q9UGT2|Q9UGU6|Q9UH25|Q9Y4W5	Missense_Mutation	SNP	ENST00000337137.4	hg19	CCDS14078.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.775821	0.90195	.	.	ENSG00000054611	ENST00000337137;ENST00000407381;ENST00000355704;ENST00000406733	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	5.3	5.3	0.74995	Rab-GAP/TBC domain (3);	0.000000	0.85682	D	0.000000	T	0.46014	0.1371	M	0.77406	2.37	0.80722	D	1	B;D;P;B	0.57257	0.14;0.979;0.953;0.14	B;P;P;B	0.50352	0.059;0.638;0.54;0.059	T	0.42949	-0.9421	10	0.32370	T	0.25	.	16.4417	0.83903	0.0:0.0:1.0:0.0	.	465;387;406;465	B9A6M3;Q8WUA7-2;B0QYI1;Q8WUA7	.;.;.;TB22A_HUMAN	T	465;406;387;418	ENSP00000336724:R465T;ENSP00000384036:R406T;ENSP00000347932:R387T;ENSP00000385634:R418T	ENSP00000336724:R465T	R	+	2	0	TBC1D22A	45886132	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.438000	0.66550	2.462000	0.83206	0.655000	0.94253	AGG	.	.	.	none		0.348	TBC1D22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317600.3	NM_014346	
BRD1	23774	hgsc.bcm.edu	37	22	50187854	50187854	+	Missense_Mutation	SNP	G	G	C	rs369329207		TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr22:50187854G>C	ENST00000216267.8	-	6	2673	c.2187C>G	c.(2185-2187)tgC>tgG	p.C729W	BRD1_ENST00000542442.1_Missense_Mutation_p.C417W|BRD1_ENST00000404760.1_Missense_Mutation_p.C729W|BRD1_ENST00000342989.5_Missense_Mutation_p.C324W|BRD1_ENST00000404034.1_Missense_Mutation_p.C729W|BRD1_ENST00000457780.2_Missense_Mutation_p.C729W	NM_014577.1	NP_055392.1	O95696	BRD1_HUMAN	bromodomain containing 1	729					histone H3 acetylation (GO:0043966)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleus (GO:0005634)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	37		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		ACTTCATAGCGCAGGTGAGGT	0.612																																					p.C729W		Atlas-SNP	.											.	BRD1	144	.	0			c.C2187G						PASS	.						60.0	64.0	62.0					22																	50187854		2203	4300	6503	SO:0001583	missense	23774	exon6			CATAGCGCAGGTG	AF005067	CCDS14080.1	22q13.33	2008-07-01	2002-01-14		ENSG00000100425	ENSG00000100425			1102	protein-coding gene	gene with protein product	"""BR140-like"""	604589	"""bromodomain-containing 1"""			10591208, 10602503	Standard	NM_014577		Approved	BRL, BRPF2	uc003biv.3	O95696	OTTHUMG00000150288	ENST00000216267.8:c.2187C>G	chr22.hg19:g.50187854G>C	ENSP00000216267:p.Cys729Trp	69.0	0.0	.		61.0	30.0	.	NM_014577	A6ZJA4	Missense_Mutation	SNP	ENST00000216267.8	hg19	CCDS14080.1	.	.	.	.	.	.	.	.	.	.	G	11.72	1.723195	0.30503	.	.	ENSG00000100425	ENST00000216267;ENST00000404034;ENST00000404760;ENST00000457780;ENST00000542442;ENST00000342989;ENST00000419212	T;T;T;T;T;T	0.27256	2.61;2.61;2.58;2.43;1.68;2.02	5.4	-1.65	0.08291	.	0.088754	0.85682	D	0.000000	T	0.37073	0.0990	L	0.59436	1.845	0.49051	D	0.999745	D;D;D;D	0.76494	0.998;0.996;0.996;0.999	P;P;P;P	0.60415	0.752;0.817;0.752;0.874	T	0.13710	-1.0499	10	0.66056	D	0.02	.	11.3583	0.49627	0.6417:0.0:0.3583:0.0	.	729;324;729;729	Q86X06;B7Z926;O95696;O95696-2	.;.;BRD1_HUMAN;.	W	729;729;729;729;417;324;189	ENSP00000216267:C729W;ENSP00000384076:C729W;ENSP00000385858:C729W;ENSP00000410042:C729W;ENSP00000437514:C417W;ENSP00000345886:C324W	ENSP00000216267:C729W	C	-	3	2	BRD1	48573858	0.040000	0.19996	0.370000	0.25965	0.975000	0.68041	-0.140000	0.10342	-0.460000	0.07003	-1.202000	0.01658	TGC	.	.	.	alt		0.612	BRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317402.1	NM_014577	
ZRSR2	8233	hgsc.bcm.edu	37	X	15841227	15841227	+	Silent	SNP	G	G	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chrX:15841227G>C	ENST00000307771.7	+	11	1335	c.1311G>C	c.(1309-1311)cgG>cgC	p.R437R		NM_005089.3	NP_005080.1	Q15696	U2AFM_HUMAN	zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2	437	Arg/Ser-rich (RS domain).				mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	U12-type spliceosomal complex (GO:0005689)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|pre-mRNA 3'-splice site binding (GO:0030628)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(38)|kidney(1)|large_intestine(2)|ovary(2)	48	Hepatocellular(33;0.183)					GCCGGGGCCGGGGCagccgga	0.647			"""F, S, Mis"""		"""MDS, CLL"""																																p.R437R	NSCLC(197;1631 3042 5741 31152)	Atlas-SNP	.		Rec	yes		X	Xp22.1	8233	"""zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2"""		L	.	ZRSR2	78	.	0			c.G1311C						PASS	.						9.0	10.0	10.0					X																	15841227		2136	4121	6257	SO:0001819	synonymous_variant	8233	exon11			GGGCCGGGGCAGC	BC050451	CCDS14172.1	Xp22.1	2014-09-17	2006-09-26	2006-09-26	ENSG00000169249	ENSG00000169249		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	23019	protein-coding gene	gene with protein product		300028	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 2"", ""U2 small nuclear RNA auxiliary factor 1-like 2"""	U2AF1L2		8586425, 9237760, 15146077	Standard	NM_005089		Approved	U2AF1-RS2, URP	uc004cxg.4	Q15696	OTTHUMG00000021184	ENST00000307771.7:c.1311G>C	chrX.hg19:g.15841227G>C		334.0	0.0	.		338.0	14.0	.	NM_005089	Q14D69	Silent	SNP	ENST00000307771.7	hg19	CCDS14172.1																																																																																			.	.	.	none		0.647	ZRSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055889.1	NM_005089	
ZRSR2	8233	hgsc.bcm.edu	37	X	15841260	15841260	+	Silent	SNP	C	C	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chrX:15841260C>G	ENST00000307771.7	+	11	1368	c.1344C>G	c.(1342-1344)cgC>cgG	p.R448R		NM_005089.3	NP_005080.1	Q15696	U2AFM_HUMAN	zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2	448	Arg/Ser-rich (RS domain).				mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	U12-type spliceosomal complex (GO:0005689)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|pre-mRNA 3'-splice site binding (GO:0030628)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(38)|kidney(1)|large_intestine(2)|ovary(2)	48	Hepatocellular(33;0.183)					gccggagccgCAGGAGCCGCC	0.647			"""F, S, Mis"""		"""MDS, CLL"""																																p.R448R	NSCLC(197;1631 3042 5741 31152)	Atlas-SNP	.		Rec	yes		X	Xp22.1	8233	"""zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2"""		L	.	ZRSR2	78	.	0			c.C1344G						PASS	.						7.0	9.0	9.0					X																	15841260		1924	3790	5714	SO:0001819	synonymous_variant	8233	exon11			GAGCCGCAGGAGC	BC050451	CCDS14172.1	Xp22.1	2014-09-17	2006-09-26	2006-09-26	ENSG00000169249	ENSG00000169249		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	23019	protein-coding gene	gene with protein product		300028	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 2"", ""U2 small nuclear RNA auxiliary factor 1-like 2"""	U2AF1L2		8586425, 9237760, 15146077	Standard	NM_005089		Approved	U2AF1-RS2, URP	uc004cxg.4	Q15696	OTTHUMG00000021184	ENST00000307771.7:c.1344C>G	chrX.hg19:g.15841260C>G		328.0	0.0	.		336.0	18.0	.	NM_005089	Q14D69	Silent	SNP	ENST00000307771.7	hg19	CCDS14172.1																																																																																			.	.	.	none		0.647	ZRSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055889.1	NM_005089	
MAGEC3	139081	hgsc.bcm.edu	37	X	140967157	140967157	+	Missense_Mutation	SNP	A	A	G	rs200403296|rs372869684		TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chrX:140967157A>G	ENST00000298296.1	+	3	455	c.455A>G	c.(454-456)tAc>tGc	p.Y152C	MAGEC3_ENST00000443323.2_5'Flank|MAGEC3_ENST00000448920.1_5'Flank|MAGEC3_ENST00000536088.1_5'Flank	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	152										NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					GGCACAGGCTACACCCTTTCC	0.567																																					p.Y152C		Atlas-SNP	.											.	MAGEC3	228	.	0			c.A455G						PASS	.						40.0	35.0	37.0					X																	140967157		2130	4297	6427	SO:0001583	missense	139081	exon3			CAGGCTACACCCT	AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.455A>G	chrX.hg19:g.140967157A>G	ENSP00000298296:p.Tyr152Cys	261.0	0.0	.		271.0	13.0	.	NM_138702	Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	ENST00000298296.1	hg19	CCDS14676.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.107554	0.00033	.	.	ENSG00000165509	ENST00000298296	T	0.06449	3.3	0.588	-0.678	0.11353	.	.	.	.	.	T	0.02571	0.0078	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45571	-0.9252	8	0.23891	T	0.37	.	.	.	.	.	152	Q8TD91	MAGC3_HUMAN	C	152	ENSP00000298296:Y152C	ENSP00000298296:Y152C	Y	+	2	0	MAGEC3	140794823	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.178000	0.03093	-1.244000	0.02516	-1.723000	0.00705	TAC	.	.	.	weak		0.567	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	NM_138702	
AGPAT2	10555	hgsc.bcm.edu	37	9	139568332	139568332	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr9:139568332delT	ENST00000371696.2	-	6	774	c.709delA	c.(709-711)actfs	p.T237fs	AGPAT2_ENST00000538402.1_Frame_Shift_Del_p.T237fs|AGPAT2_ENST00000371694.3_Frame_Shift_Del_p.T205fs	NM_006412.3	NP_006403.2	O15120	PLCB_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 2	237					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|epidermis development (GO:0008544)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			endometrium(1)|large_intestine(1)|lung(2)|prostate(2)	6	all_cancers(76;0.0893)|all_epithelial(76;0.231)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		TCCGCCGCAGTGAGGCCGCTG	0.672																																					p.T237fs		Atlas-Indel,Pindel	.											.	AGPAT2	17	.	0			c.710delC						PASS	.						38.0	37.0	37.0					9																	139568332		2196	4296	6492	SO:0001589	frameshift_variant	10555	exon6			.	AF000237	CCDS7003.1, CCDS35181.1	9q34.3	2013-02-05	2013-02-05		ENSG00000169692	ENSG00000169692	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	325	protein-coding gene	gene with protein product	"""LPAAT-beta"", ""lysophosphatidic acid acyltransferase, beta"""	603100	"""Berardinelli-Seip congenital lipodystrophy"", ""1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)"""	BSCL		9242711, 9212163	Standard	NM_006412		Approved		uc004cii.1	O15120	OTTHUMG00000020936	ENST00000371696.2:c.709delA	chr9.hg19:g.139568332delT	ENSP00000360761:p.Thr237fs	97.0	0.0	0		96.0	34.0	0.354167	NM_006412	O00516|O15106|Q5VUD3|Q5VUD4|Q9BSV7|Q9BWR7	Frame_Shift_Del	DEL	ENST00000371696.2	hg19	CCDS7003.1																																																																																			.	.	.	none		0.672	AGPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055090.1	NM_006412	
NPM1	4869	hgsc.bcm.edu	37	5	170818328	170818329	+	Frame_Shift_Ins	INS	-	-	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr5:170818328_170818329insA	ENST00000296930.5	+	3	459_460	c.158_159insA	c.(157-162)gcaaagfs	p.AK53fs	NPM1_ENST00000351986.6_Frame_Shift_Ins_p.AK53fs|NPM1_ENST00000517671.1_Frame_Shift_Ins_p.AK53fs|NPM1_ENST00000393820.2_Frame_Shift_Ins_p.AK53fs	NM_002520.6	NP_002511.1	P06748	NPM_HUMAN	nucleophosmin (nucleolar phosphoprotein B23, numatrin)	53	Necessary for interaction with APEX1.|Required for interaction with SENP3.				cell aging (GO:0007569)|CENP-A containing nucleosome assembly (GO:0034080)|centrosome cycle (GO:0007098)|DNA repair (GO:0006281)|intracellular protein transport (GO:0006886)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of centrosome duplication (GO:0010826)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|nucleocytoplasmic transport (GO:0006913)|nucleosome assembly (GO:0006334)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of translation (GO:0045727)|protein localization (GO:0008104)|protein oligomerization (GO:0051259)|regulation of centriole replication (GO:0046599)|regulation of eIF2 alpha phosphorylation by dsRNA (GO:0060735)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of endoribonuclease activity (GO:0060699)|response to stress (GO:0006950)|ribosome assembly (GO:0042255)|signal transduction (GO:0007165)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle pole centrosome (GO:0031616)	histone binding (GO:0042393)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|unfolded protein binding (GO:0051082)		NPM1/ALK(632)	central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4261)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	4269	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GGGGCTGGTGCAAAGGATGAGT	0.411			"""T, F """	"""ALK, RARA, MLF1"""	"""NHL, APL, AML"""																																p.A53fs		Atlas-INDEL	.		Dom	yes		5	5q35	4869	"""nucleophosmin (nucleolar phosphoprotein B23, numatrin)"""		L	.	NPM1	5003	.	0			c.158_159insA						PASS	.																																			SO:0001589	frameshift_variant	4869	exon3			.	M26697	CCDS4376.1, CCDS4377.1, CCDS43399.1	5q35.1	2014-09-17			ENSG00000181163	ENSG00000181163			7910	protein-coding gene	gene with protein product	"""nucleolar phosphoprotein B23"", ""numatrin"", ""nucleophosmin/nucleoplasmin family, member 1"""	164040				8471164, 8122112	Standard	NM_002520		Approved	B23, NPM	uc003mbi.3	P06748	OTTHUMG00000130465	ENST00000296930.5:c.161dupA	chr5.hg19:g.170818331_170818331dupA	ENSP00000296930:p.Ala53fs	29.0	0.0	0		26.0	12.0	0.461538	NM_199185	A8K3N7|B5BU00|D3DQL6|P08693|Q12826|Q13440|Q13441|Q14115|Q5EU94|Q5EU95|Q5EU96|Q5EU97|Q5EU98|Q5EU99|Q6V962|Q8WTW5|Q96AT6|Q96DC4|Q96EA5|Q9BYG9|Q9UDJ7	Frame_Shift_Ins	INS	ENST00000296930.5	hg19	CCDS4376.1																																																																																			.	.	.	none		0.411	NPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252858.2	NM_002520	
CDH10	1008	hgsc.bcm.edu	37	5	24535913	24535913	+	Frame_Shift_Del	DEL	A	A	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr5:24535913delA	ENST00000264463.4	-	4	1052	c.545delT	c.(544-546)gtcfs	p.V182fs		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	182	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TGTAGCTGTGACTTGCACCAC	0.463										HNSCC(23;0.051)																											p.V182fs		Atlas-Indel,Pindel	.											.	CDH10	391	.	0			c.546delC						PASS	.						107.0	98.0	101.0					5																	24535913		2203	4300	6503	SO:0001589	frameshift_variant	1008	exon4			.	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.545delT	chr5.hg19:g.24535913delA	ENSP00000264463:p.Val182fs	67.0	0.0	0		45.0	28.0	0.622222	NM_006727	Q9ULB3	Frame_Shift_Del	DEL	ENST00000264463.4	hg19	CCDS3892.1																																																																																			.	.	.	none		0.463	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727	
ARHGEF37	389337	hgsc.bcm.edu	37	5	149006771	149006772	+	In_Frame_Ins	INS	-	-	TGGCCA			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr5:149006771_149006772insTGGCCA	ENST00000333677.6	+	11	1760_1761	c.1597_1598insTGGCCA	c.(1597-1599)gtg>gTGGCCAtg	p.533_534insAM		NM_001001669.2	NP_001001669.2	A1IGU5	ARH37_HUMAN	Rho guanine nucleotide exchange factor (GEF) 37	533	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(5)|lung(6)|ovary(1)|prostate(2)|stomach(3)	17						GGGCCAAATCGTGGCCATCCTT	0.609																																					p.V533delinsVAM		Atlas-Indel,Pindel	.											.	ARHGEF37	45	.	0			c.1597_1598insTGGCCA						PASS	.																																			SO:0001652	inframe_insertion	389337	exon11			.	BC041325	CCDS43385.1	5q33.1	2012-07-24			ENSG00000183111	ENSG00000183111		"""Rho guanine nucleotide exchange factors"""	34430	protein-coding gene	gene with protein product							Standard	XM_005268448		Approved	FLJ41603	uc003lra.1	A1IGU5	OTTHUMG00000163491	ENST00000333677.6:c.1598_1603dupTGGCCA	chr5.hg19:g.149006772_149006777dupTGGCCA	ENSP00000328083:p.Val533_Ala534insAlaMet	97.0	0.0	0		94.0	22.0	0.234043	NM_001001669	Q6ZW51	In_Frame_Ins	INS	ENST00000333677.6	hg19	CCDS43385.1																																																																																			.	.	.	none		0.609	ARHGEF37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373763.1	NM_001001669	
MED13	9969	hgsc.bcm.edu	37	17	60033103	60033103	+	Frame_Shift_Del	DEL	G	G	-	rs74792573		TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr17:60033103delG	ENST00000397786.2	-	25	5796	c.5720delC	c.(5719-5721)cctfs	p.P1907fs		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1907					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GAGAATGCTAGGGGAGTCTGC	0.418																																					p.P1907fs		Atlas-Indel,Pindel	.											.	MED13	181	.	0			c.5721delT						PASS	.						96.0	97.0	97.0					17																	60033103		1894	4134	6028	SO:0001589	frameshift_variant	9969	exon25			.	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.5720delC	chr17.hg19:g.60033103delG	ENSP00000380888:p.Pro1907fs	186.0	0.0	0		291.0	24.0	0.0824742	NM_005121	B2RU05|O60334	Frame_Shift_Del	DEL	ENST00000397786.2	hg19	CCDS42366.1																																																																																			.	.	.	none		0.418	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121	
C1orf127	148345	hgsc.bcm.edu	37	1	11008797	11008797	+	Frame_Shift_Del	DEL	A	A	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr1:11008797delA	ENST00000377008.4	-	11	1340	c.894delT	c.(892-894)cctfs	p.P300fs	C1orf127_ENST00000377004.4_Frame_Shift_Del_p.P467fs			Q8N9H9	CA127_HUMAN	chromosome 1 open reading frame 127	300	Pro-rich.									NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(5)	32	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		CCCCTGGGGGAGGCTGGGGAC	0.652																																					p.P466fs		Atlas-Indel,Pindel	.											.	C1orf127	134	.	0			c.1396delC						PASS	.						53.0	62.0	59.0					1																	11008797		2203	4300	6503	SO:0001589	frameshift_variant	148345	exon12			.	AK094437	CCDS53267.1	1p36.22	2008-02-05			ENSG00000175262	ENSG00000175262			26730	protein-coding gene	gene with protein product						14702039	Standard	NM_001170754		Approved	FLJ37118	uc010oao.2	Q8N9H9	OTTHUMG00000002032	ENST00000377008.4:c.894delT	chr1.hg19:g.11008797delA	ENSP00000366207:p.Pro300fs	69.0	0.0	0		69.0	25.0	0.362319	NM_001170754	A0AVG8|A6NKM7|Q5VXJ2	Frame_Shift_Del	DEL	ENST00000377008.4	hg19																																																																																				.	.	.	none		0.652	C1orf127-202	KNOWN	basic	protein_coding	protein_coding		NM_173507	
NDST4	64579	hgsc.bcm.edu	37	4	115749045	115749046	+	Frame_Shift_Ins	INS	-	-	G			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr4:115749045_115749046insG	ENST00000264363.2	-	14	3223_3224	c.2545_2546insC	c.(2545-2547)ctafs	p.L849fs		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	849	Heparan sulfate N-sulfotransferase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		CAGTTTGGATAGTTCCACATTA	0.431																																					p.L849fs		Atlas-Indel,Pindel	.											.	NDST4	193	.	0			c.2546_2547insC						PASS	.																																			SO:0001589	frameshift_variant	64579	exon14			.	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.2546dupC	chr4.hg19:g.115749046_115749046dupG	ENSP00000264363:p.Leu849fs	65.0	0.0	0		55.0	30.0	0.545455	NM_022569	Q2KHM8	Frame_Shift_Ins	INS	ENST00000264363.2	hg19	CCDS3706.1																																																																																			.	.	.	none		0.431	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569	
EPHA4	2043	hgsc.bcm.edu	37	2	222321422	222321422	+	Frame_Shift_Del	DEL	G	G	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr2:222321422delG	ENST00000281821.2	-	7	1555	c.1514delC	c.(1513-1515)cctfs	p.P505fs	EPHA4_ENST00000409854.1_Frame_Shift_Del_p.P505fs|EPHA4_ENST00000392071.4_Frame_Shift_Del_p.P454fs|EPHA4_ENST00000409938.1_Frame_Shift_Del_p.P505fs	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	505	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		GGAAGTGAGAGGGTTCAGGCC	0.493																																					p.P505fs		Atlas-Indel,Pindel	.											.	EPHA4	263	.	0			c.1515delT						PASS	.						151.0	132.0	139.0					2																	222321422		2203	4300	6503	SO:0001589	frameshift_variant	2043	exon7			.	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.1514delC	chr2.hg19:g.222321422delG	ENSP00000281821:p.Pro505fs	98.0	0.0	0		96.0	44.0	0.458333	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Frame_Shift_Del	DEL	ENST00000281821.2	hg19	CCDS2447.1																																																																																			.	.	.	none		0.493	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
SLC32A1	140679	hgsc.bcm.edu	37	20	37356467	37356468	+	Frame_Shift_Ins	INS	-	-	C			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr20:37356467_37356468insC	ENST00000217420.1	+	2	1026_1027	c.763_764insC	c.(763-765)gccfs	p.A255fs		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	255					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	GCTGCCTTGCGCCTTCCTTAAG	0.579																																					p.A255fs		Atlas-Indel,Pindel	.											.	SLC32A1	81	.	0			c.763_764insC						PASS	.																																			SO:0001589	frameshift_variant	140679	exon2			.	AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.765dupC	chr20.hg19:g.37356469_37356469dupC	ENSP00000217420:p.Ala255fs	84.0	0.0	0		73.0	30.0	0.410959	NM_080552	Q8N489	Frame_Shift_Ins	INS	ENST00000217420.1	hg19	CCDS13307.1																																																																																			.	.	.	none		0.579	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552	
TUBB4B	10383	hgsc.bcm.edu	37	9	140137032	140137033	+	Frame_Shift_Ins	INS	-	-	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr9:140137032_140137033insA	ENST00000340384.4	+	4	510_511	c.362_363insA	c.(361-366)agaaagfs	p.RK121fs		NM_006088.5	NP_006079.1	P68371	TBB4B_HUMAN	tubulin, beta 4B class IVb	121					'de novo' posttranslational protein folding (GO:0051084)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|natural killer cell mediated cytotoxicity (GO:0042267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|MHC class I protein binding (GO:0042288)|structural constituent of cytoskeleton (GO:0005200)|unfolded protein binding (GO:0051082)									Albendazole(DB00518)|Mebendazole(DB00643)	GATGTTGTGAGAAAGGAGGCTG	0.604																																					p.R121fs		Atlas-Indel,Pindel	.											.	.	.	.	0			c.362_363insA						PASS	.																																			SO:0001589	frameshift_variant	10383	exon4			.	BC019359	CCDS7039.1	9q34.3	2011-10-10	2011-10-10	2011-10-10	ENSG00000188229	ENSG00000188229		"""Tubulins"""	20771	protein-coding gene	gene with protein product	"""class IVb beta-tubulin"""	602660	"""tubulin, beta 2C"""	TUBB2C		3999141	Standard	NM_006088		Approved	Beta2	uc004cmh.1	P68371	OTTHUMG00000131783	ENST00000340384.4:c.365dupA	chr9.hg19:g.140137035_140137035dupA	ENSP00000341289:p.Arg121fs	78.0	0.0	0		61.0	18.0	0.295082	NM_006088	A2BFA2|P05217	Frame_Shift_Ins	INS	ENST00000340384.4	hg19	CCDS7039.1																																																																																			.	.	.	none		0.604	TUBB4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254715.1	NM_006088	
COL6A2	1292	hgsc.bcm.edu	37	21	47545869	47545879	+	Frame_Shift_Del	DEL	CTCATCAAGGA	CTCATCAAGGA	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	CTCATCAAGGA	CTCATCAAGGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr21:47545869_47545879delCTCATCAAGGA	ENST00000300527.4	+	26	2244_2254	c.2140_2150delCTCATCAAGGA	c.(2140-2151)ctcatcaaggagfs	p.LIKE714fs	COL6A2_ENST00000357838.4_Frame_Shift_Del_p.LIKE714fs|COL6A2_ENST00000397763.1_Frame_Shift_Del_p.LIKE714fs|COL6A2_ENST00000310645.5_Frame_Shift_Del_p.LIKE714fs|COL6A2_ENST00000409416.1_Frame_Shift_Del_p.LIKE714fs	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	714	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)		p.I715M(3)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CTACGACCGCCTCATCAAGGAGAGCCGGCGC	0.63																																					p.713_717del		Atlas-INDEL	.											.	COL6A2	351	.	3	Substitution - Missense(3)	lung(3)	c.2139_2149del						PASS	.																																			SO:0001589	frameshift_variant	1292	exon26			.	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2140_2150delCTCATCAAGGA	chr21.hg19:g.47545869_47545879delCTCATCAAGGA	ENSP00000300527:p.Leu714fs	190.0	0.0	0		131.0	31.0	0.236641	NM_058175	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Frame_Shift_Del	DEL	ENST00000300527.4	hg19	CCDS13728.1																																																																																			.	.	.	none		0.630	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1		
MAPRE1	22919	hgsc.bcm.edu	37	20	31413759	31413764	+	In_Frame_Del	DEL	CAGTGA	CAGTGA	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	CAGTGA	CAGTGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr20:31413759_31413764delCAGTGA	ENST00000375571.5	+	2	165_170	c.26_31delCAGTGA	c.(25-33)tcagtgacc>tcc	p.VT10del		NM_012325.2	NP_036457.1	Q15691	MARE1_HUMAN	microtubule-associated protein, RP/EB family, member 1	10					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of microtubule plus-end binding (GO:1903033)|protein localization to microtubule (GO:0035372)	cell projection membrane (GO:0031253)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule plus-end (GO:0035371)	microtubule plus-end binding (GO:0051010)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			endometrium(2)|large_intestine(1)|lung(3)|prostate(2)	8						TACTCAACGTCAGTGACCAGTGATAA	0.442																																					p.9_10del		Atlas-Indel,Pindel	.											.	MAPRE1	17	.	0			c.25_30del						PASS	.																																			SO:0001651	inframe_deletion	22919	exon2			.	U24166	CCDS13208.1	20q11.1-q11.3	2013-01-17			ENSG00000101367	ENSG00000101367			6890	protein-coding gene	gene with protein product	"""adenomatous polyposis coli-binding protein EB1"""	603108				7606712, 9724749, 11470413	Standard	NM_012325		Approved	EB1	uc002wyh.3	Q15691	OTTHUMG00000032228	ENST00000375571.5:c.26_31delCAGTGA	chr20.hg19:g.31413759_31413764delCAGTGA	ENSP00000364721:p.Val10_Thr11del	62.0	0.0	0		80.0	42.0	0.525	NM_012325	B2R6I7|E1P5M8|Q3KQS8	In_Frame_Del	DEL	ENST00000375571.5	hg19	CCDS13208.1																																																																																			.	.	.	none		0.442	MAPRE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078647.2	NM_012325	
F9	2158	hgsc.bcm.edu	37	X	138643733	138643760	+	Frame_Shift_Del	DEL	ATTCGAATTATTCCTCACCACAACTACA	ATTCGAATTATTCCTCACCACAACTACA	-	rs1801202|rs137852250|rs369841886	byFrequency	TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	ATTCGAATTATTCCTCACCACAACTACA	ATTCGAATTATTCCTCACCACAACTACA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chrX:138643733_138643760delATTCGAATTATTCCTCACCACAACTACA	ENST00000218099.2	+	8	896_923	c.889_916delATTCGAATTATTCCTCACCACAACTACA	c.(889-918)attcgaattattcctcaccacaactacaatfs	p.IRIIPHHNYN297fs	F9_ENST00000394090.2_Frame_Shift_Del_p.IRIIPHHNYN259fs	NM_000133.3	NP_000124.1	P00740	FA9_HUMAN	coagulation factor IX	297	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|skin(1)	35	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Menadione(DB00170)	GCGAAATGTGATTCGAATTATTCCTCACCACAACTACAATGCAGCTAT	0.36																																					p.296_305del		Atlas-Indel,Pindel	.											.	F9	107	.	0			c.888_915del	GRCh37	CD010615|CD920994|CD951701|CM001680|CM940594|CM940595|CM940596|CM940597|CM940598|CM960592	F9	D|M	rs137852250|rs1801202	PASS	.																																			SO:0001589	frameshift_variant	2158	exon8			.	M11309	CCDS14666.1	Xq26.3-q27.1	2014-09-17	2008-08-01		ENSG00000101981	ENSG00000101981	3.4.21.22		3551	protein-coding gene	gene with protein product	"""Factor IX"", ""plasma thromboplastic component"", ""Christmas disease"", ""hemophilia B"""	300746					Standard	NM_000133		Approved	FIX	uc004fas.1	P00740	OTTHUMG00000022536	ENST00000218099.2:c.889_916delATTCGAATTATTCCTCACCACAACTACA	chrX.hg19:g.138643733_138643760delATTCGAATTATTCCTCACCACAACTACA	ENSP00000218099:p.Ile297fs	184.0	0.0	0		190.0	44.0	0.231579	NM_000133	A8K9N4|F2RM36|Q5FBE1|Q5JYJ8	Frame_Shift_Del	DEL	ENST00000218099.2	hg19	CCDS14666.1																																																																																			.	.	.	none		0.360	F9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058557.1		
GOLGA6A	342096	hgsc.bcm.edu	37	15	74367333	74367333	+	Frame_Shift_Del	DEL	G	G	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr15:74367333delG	ENST00000290438.3	-	11	897	c.857delC	c.(856-858)ccafs	p.P286fs	RN7SL429P_ENST00000479090.2_RNA	NM_001038640.2	NP_001033729.2	Q9NYA3	GOG6A_HUMAN	golgin A6 family, member A	286						Golgi apparatus (GO:0005794)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|liver(1)|lung(6)|prostate(1)|urinary_tract(1)	16						CGCCAGGGATGGGGGCTCAGC	0.542																																					p.P286fs		Atlas-INDEL	.											.	GOLGA6A	28	.	0			c.858delA						PASS	.						7.0	10.0	9.0					15																	74367333		1445	3996	5441	SO:0001589	frameshift_variant	342096	exon11			.	AF263742	CCDS32290.1	15q24.1	2013-05-10	2010-02-12	2009-09-28	ENSG00000159289	ENSG00000159289			13567	protein-coding gene	gene with protein product		610288	"""golgi autoantigen, golgin subfamily a, member 6"", ""golgi autoantigen, golgin subfamily a, 6"", ""golgi autoantigen, golgin subfamily a, 6A"""	GOLGA6		11161787	Standard	NM_001038640		Approved	GLP	uc002axa.1	Q9NYA3	OTTHUMG00000173035	ENST00000290438.3:c.857delC	chr15.hg19:g.74367333delG	ENSP00000290438:p.Pro286fs	85.0	0.0	0		40.0	22.0	0.55	NM_001038640	A8K959|Q9NYA7	Frame_Shift_Del	DEL	ENST00000290438.3	hg19	CCDS32290.1																																																																																			.	.	.	none		0.542	GOLGA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421835.1	XM_292357	
COL6A2	1292	hgsc.bcm.edu	37	21	47545867	47545867	+	Frame_Shift_Del	DEL	G	G	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr21:47545867delG	ENST00000300527.4	+	26	2242	c.2138delG	c.(2137-2139)cgcfs	p.R713fs	COL6A2_ENST00000357838.4_Frame_Shift_Del_p.R713fs|COL6A2_ENST00000397763.1_Frame_Shift_Del_p.R713fs|COL6A2_ENST00000310645.5_Frame_Shift_Del_p.R713fs|COL6A2_ENST00000409416.1_Frame_Shift_Del_p.R713fs	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	713	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GCCTACGACCGCCTCATCAAG	0.627																																					p.R713fs		Atlas-INDEL	.											COL6A2_ENST00000357838,NS,carcinoma,0,5	COL6A2	351	.	0			c.2137delC						PASS	.						64.0	63.0	63.0					21																	47545867		2202	4300	6502	SO:0001589	frameshift_variant	1292	exon26			.	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2138delG	chr21.hg19:g.47545867delG	ENSP00000300527:p.Arg713fs	192.0	0.0	0		136.0	31.0	0.227941	NM_058175	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Frame_Shift_Del	DEL	ENST00000300527.4	hg19	CCDS13728.1																																																																																			.	.	.	none		0.627	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1		
ZSWIM2	151112	hgsc.bcm.edu	37	2	187703706	187703706	+	Frame_Shift_Del	DEL	C	C	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr2:187703706delC	ENST00000295131.2	-	4	513	c.474delG	c.(472-474)aagfs	p.K158fs		NM_182521.2	NP_872327.2	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM-type containing 2	158					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein polyubiquitination (GO:0000209)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(28)|ovary(2)|prostate(4)|skin(6)|urinary_tract(1)	52			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			TGACAGGAAGCTTTTTCTCTA	0.308																																					p.L159fs		Atlas-Indel,Pindel	.											.	ZSWIM2	119	.	0			c.475delC						PASS	.						150.0	154.0	153.0					2																	187703706		2203	4299	6502	SO:0001589	frameshift_variant	151112	exon4			.	AK128006	CCDS33348.1	2q32.2	2008-02-05			ENSG00000163012	ENSG00000163012		"""Zinc fingers, SWIM-type"", ""Zinc fingers, ZZ-type"""	30990	protein-coding gene	gene with protein product						12477932	Standard	NM_182521		Approved	MGC33890, ZZZ2	uc002upu.1	Q8NEG5	OTTHUMG00000154259	ENST00000295131.2:c.474delG	chr2.hg19:g.187703706delC	ENSP00000295131:p.Lys158fs	52.0	0.0	0		50.0	26.0	0.52	NM_182521	B3KXV6|Q53SI3|Q57ZY3	Frame_Shift_Del	DEL	ENST00000295131.2	hg19	CCDS33348.1																																																																																			.	.	.	none		0.308	ZSWIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334565.1	NM_182521	
SLC3A2	6520	hgsc.bcm.edu	37	11	62648555	62648556	+	Frame_Shift_Ins	INS	-	-	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr11:62648555_62648556insA	ENST00000377890.2	+	4	531_532	c.363_364insA	c.(364-366)aagfs	p.K122fs	SLC3A2_ENST00000535296.1_Frame_Shift_Ins_p.K91fs|SLC3A2_ENST00000377892.1_Frame_Shift_Ins_p.K153fs|SLC3A2_ENST00000536981.1_5'Flank|SLC3A2_ENST00000338663.7_Frame_Shift_Ins_p.K21fs|SLC3A2_ENST00000377889.2_Frame_Shift_Ins_p.K60fs|SLC3A2_ENST00000377891.2_Frame_Shift_Ins_p.K123fs	NM_002394.5	NP_002385.3	P08195	4F2_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 2	122					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|carbohydrate metabolic process (GO:0005975)|cell growth (GO:0016049)|ion transport (GO:0006811)|leucine import (GO:0060356)|leukocyte migration (GO:0050900)|response to exogenous dsRNA (GO:0043330)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|tryptophan transport (GO:0015827)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|double-stranded RNA binding (GO:0003725)|neutral amino acid transmembrane transporter activity (GO:0015175)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)	22						TAGAGCCCGAGAAGCAGCCGAT	0.629											OREG0021031	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E122fs		Atlas-Indel,Pindel	.											.	SLC3A2	55	.	0			c.366_367insA						PASS	.																																			SO:0001589	frameshift_variant	6520	exon4			.		CCDS8039.2, CCDS31588.1, CCDS31589.1, CCDS31590.1	11q12-q22	2013-07-19	2013-07-19		ENSG00000168003	ENSG00000168003		"""Solute carriers"""	11026	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibodies 4F2, TRA1.10, TROP4, and T43"", ""antigen defined by monoclonal antibody 4F2"", ""heavy chain"", ""4F2 heavy chain"", ""CD98 heavy chain"", ""monoclonal antibody 44D7"", ""4F2 cell-surface antigen heavy chain"", ""lymphocyte activation antigen 4F2 large subunit"""	158070	"""solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2"""	MDU1		3036867	Standard	NM_001012662		Approved	4T2HC, 4F2, NACAE, CD98, CD98HC, 4F2HC	uc001nwd.3	P08195	OTTHUMG00000074091	ENST00000377890.2:c.365dupA	chr11.hg19:g.62648557_62648557dupA	ENSP00000367122:p.Lys122fs	127.0	0.0	0	1062	129.0	49.0	0.379845	NM_001012662	Q13543	Frame_Shift_Ins	INS	ENST00000377890.2	hg19	CCDS8039.2																																																																																			.	.	.	none		0.629	SLC3A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157306.1	NM_001012661	
GOLGA6A	342096	hgsc.bcm.edu	37	15	74367328	74367328	+	Frame_Shift_Del	DEL	G	G	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr15:74367328delG	ENST00000290438.3	-	11	902	c.862delC	c.(862-864)ctgfs	p.L288fs	RN7SL429P_ENST00000479090.2_RNA	NM_001038640.2	NP_001033729.2	Q9NYA3	GOG6A_HUMAN	golgin A6 family, member A	288						Golgi apparatus (GO:0005794)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|liver(1)|lung(6)|prostate(1)|urinary_tract(1)	16						GGGGGCGCCAGGGATGGGGGC	0.547																																					p.L288fs		Atlas-INDEL	.											.	GOLGA6A	28	.	0			c.863delT						PASS	.						7.0	10.0	9.0					15																	74367328		1445	3996	5441	SO:0001589	frameshift_variant	342096	exon11			.	AF263742	CCDS32290.1	15q24.1	2013-05-10	2010-02-12	2009-09-28	ENSG00000159289	ENSG00000159289			13567	protein-coding gene	gene with protein product		610288	"""golgi autoantigen, golgin subfamily a, member 6"", ""golgi autoantigen, golgin subfamily a, 6"", ""golgi autoantigen, golgin subfamily a, 6A"""	GOLGA6		11161787	Standard	NM_001038640		Approved	GLP	uc002axa.1	Q9NYA3	OTTHUMG00000173035	ENST00000290438.3:c.862delC	chr15.hg19:g.74367328delG	ENSP00000290438:p.Leu288fs	86.0	0.0	0		45.0	23.0	0.511111	NM_001038640	A8K959|Q9NYA7	Frame_Shift_Del	DEL	ENST00000290438.3	hg19	CCDS32290.1																																																																																			.	.	.	none		0.547	GOLGA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421835.1	XM_292357	
PRKCA	5578	hgsc.bcm.edu	37	17	64728827	64728827	+	Frame_Shift_Del	DEL	G	G	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr17:64728827delG	ENST00000413366.3	+	9	966	c.940delG	c.(940-942)ggcfs	p.G314fs		NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	314					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	TGGCCCTGCTGGCAACAAAGT	0.458																																					p.A313fs		Atlas-Indel,Pindel	.											.	PRKCA	82	.	0			c.939delT						PASS	.						189.0	194.0	192.0					17																	64728827		2203	4300	6503	SO:0001589	frameshift_variant	5578	exon9			.		CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.940delG	chr17.hg19:g.64728827delG	ENSP00000408695:p.Gly314fs	145.0	0.0	0		215.0	65.0	0.302326	NM_002737	B5BU22|Q15137|Q32M72|Q96RE4	Frame_Shift_Del	DEL	ENST00000413366.3	hg19	CCDS11664.1																																																																																			.	.	.	none		0.458	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446976.1		
KMT2C	58508	hgsc.bcm.edu	37	7	151874432	151874433	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr7:151874432_151874433delTT	ENST00000262189.6	-	38	8323_8324	c.8105_8106delAA	c.(8104-8106)aaafs	p.K2702fs	KMT2C_ENST00000355193.2_Frame_Shift_Del_p.K2702fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2702	Asp-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CCTCAAGGTCTTTAACATCCAG	0.386																																					p.2702_2703del		Atlas-Indel,Pindel	.											.	MLL3	1564	.	0			c.8106_8107del						PASS	.																																			SO:0001589	frameshift_variant	58508	exon38			.	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.8105_8106delAA	chr7.hg19:g.151874432_151874433delTT	ENSP00000262189:p.Lys2702fs	86.0	0.0	0		88.0	33.0	0.375	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	ENST00000262189.6	hg19	CCDS5931.1																																																																																			.	.	.	none		0.386	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
ERCC6	2074	hgsc.bcm.edu	37	10	50679145	50679146	+	Frame_Shift_Ins	INS	-	-	A			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr10:50679145_50679146insA	ENST00000355832.5	-	17	3023_3024	c.2945_2946insT	c.(2944-2946)ttgfs	p.L982fs	ERCC6_ENST00000542458.1_Frame_Shift_Ins_p.L352fs|ERCC6_ENST00000465653.1_5'Flank|RP11-123B3.2_ENST00000423283.1_RNA	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	982	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CTCTATTTGTCAAAAACTGCTT	0.332								Direct reversal of damage;Nucleotide excision repair (NER)																													p.T982fs		Atlas-Indel,Pindel	.											.	ERCC6	162	.	0			c.2946_2947insT						PASS	.																																			SO:0001589	frameshift_variant	2074	exon17			.	L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.2946dupT	chr10.hg19:g.50679150_50679150dupA	ENSP00000348089:p.Leu982fs	72.0	0.0	0		70.0	34.0	0.485714	NM_000124	D3DX94|Q5W0L9	Frame_Shift_Ins	INS	ENST00000355832.5	hg19	CCDS7229.1																																																																																			.	.	.	none		0.332	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1	NM_000124	
A4GALT	53947	hgsc.bcm.edu	37	22	43089135	43089143	+	In_Frame_Del	DEL	CGCGGCAGG	CGCGGCAGG	-	rs577646955|rs372559008		TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	CGCGGCAGG	CGCGGCAGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr22:43089135_43089143delCGCGGCAGG	ENST00000401850.1	-	2	1304_1312	c.815_823delCCTGCCGCG	c.(814-825)gcctgccgcggc>ggc	p.ACR272del	A4GALT_ENST00000381278.3_In_Frame_Del_p.ACR272del|A4GALT_ENST00000465765.2_5'Flank|A4GALT_ENST00000249005.2_In_Frame_Del_p.ACR272del			Q9NPC4	A4GAT_HUMAN	alpha 1,4-galactosyltransferase	272					globoside biosynthetic process (GO:0001576)|glycosphingolipid biosynthetic process (GO:0006688)|plasma membrane organization (GO:0007009)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	galactosyltransferase activity (GO:0008378)|lactosylceramide 4-alpha-galactosyltransferase activity (GO:0050512)|toxic substance binding (GO:0015643)	p.R274R(1)		NS(1)|central_nervous_system(2)|large_intestine(6)|skin(1)|urinary_tract(1)	11						GTGGTGACGCCGCGGCAGGCGCGGCTCTC	0.66																																					p.272_275del		Atlas-Indel,Pindel	.											.	A4GALT	35	.	1	Substitution - coding silent(1)	large_intestine(1)	c.816_824del						PASS	.																																			SO:0001651	inframe_deletion	53947	exon3			.		CCDS14041.1	22q13.2	2014-07-18	2008-07-31		ENSG00000128274	ENSG00000128274	2.4.1.228		18149	protein-coding gene	gene with protein product	"""Gb3 synthase"", ""CD77 synthase"", ""globotriaosylceramide synthase"", ""lactosylceramide 4-alpha-galactosyltransferase"""	607922	"""alpha 1,4-galactosyltransferase (globotriaosylceramide synthase, P blood group)"""			10854428	Standard	XM_005261643		Approved	A14GALT, Gb3S, P(k)	uc003bdb.3	Q9NPC4	OTTHUMG00000150744	ENST00000401850.1:c.815_823delCCTGCCGCG	chr22.hg19:g.43089135_43089143delCGCGGCAGG	ENSP00000384794:p.Ala272_Arg274del	57.0	0.0	0		46.0	11.0	0.23913	NM_017436	B2R7C4|Q9P1X5	In_Frame_Del	DEL	ENST00000401850.1	hg19	CCDS14041.1																																																																																			.	.	.	none		0.660	A4GALT-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319917.1	NM_017436	
ANK2	287	hgsc.bcm.edu	37	4	114279656	114279656	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr4:114279656delT	ENST00000357077.4	+	38	9935	c.9882delT	c.(9880-9882)aatfs	p.N3294fs	ANK2_ENST00000264366.6_Frame_Shift_Del_p.N3261fs|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000509550.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3294					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CCATGGAGAATGTGCCTTTTA	0.453																																					p.N3294fs		Atlas-Indel,Pindel	.											.	ANK2	576	.	0			c.9881delA						PASS	.						105.0	100.0	102.0					4																	114279656		2203	4300	6503	SO:0001589	frameshift_variant	287	exon38			.	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.9882delT	chr4.hg19:g.114279656delT	ENSP00000349588:p.Asn3294fs	91.0	0.0	0		101.0	50.0	0.49505	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Frame_Shift_Del	DEL	ENST00000357077.4	hg19	CCDS3702.1																																																																																			.	.	.	none		0.453	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
FBXO38	81545	hgsc.bcm.edu	37	5	147806844	147806844	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr5:147806844delT	ENST00000340253.5	+	15	2155	c.1987delT	c.(1987-1989)tttfs	p.F663fs	CTD-2283N19.1_ENST00000520980.2_RNA|FBXO38_ENST00000296701.6_Intron|FBXO38_ENST00000394370.3_Frame_Shift_Del_p.F663fs|FBXO38_ENST00000513826.1_Intron			Q6PIJ6	FBX38_HUMAN	F-box protein 38	663					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)			ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCGAAGCAGTTTCCCCTCGA	0.478																																					p.Q662fs		Atlas-Indel,Pindel	.											.	FBXO38	115	.	0			c.1986delG						PASS	.						62.0	57.0	59.0					5																	147806844		2203	4300	6503	SO:0001589	frameshift_variant	81545	exon15			.	BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.1987delT	chr5.hg19:g.147806844delT	ENSP00000342023:p.Phe663fs	248.0	0.0	0		259.0	124.0	0.478764	NM_030793	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Frame_Shift_Del	DEL	ENST00000340253.5	hg19																																																																																				.	.	.	none		0.478	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793	
R3HDM1	23518	hgsc.bcm.edu	37	2	136396355	136396355	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr2:136396355delT	ENST00000264160.4	+	13	1358	c.988delT	c.(988-990)tttfs	p.F330fs	R3HDM1_ENST00000409606.1_Frame_Shift_Del_p.F330fs|R3HDM1_ENST00000409478.1_Frame_Shift_Del_p.F286fs|R3HDM1_ENST00000443537.2_3'UTR|R3HDM1_ENST00000329971.3_Frame_Shift_Del_p.F286fs|R3HDM1_ENST00000410054.1_Frame_Shift_Del_p.F274fs	NM_001282798.1|NM_015361.2	NP_001269727.1|NP_056176.2	Q15032	R3HD1_HUMAN	R3H domain containing 1	330							poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(6)|kidney(5)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	38				BRCA - Breast invasive adenocarcinoma(221;0.127)		GCGCCAGATATTTAGGTATTG	0.343																																					p.I329fs		Atlas-Indel,Pindel	.											.	R3HDM1	84	.	0			c.987delA						PASS	.						72.0	77.0	76.0					2																	136396355		2203	4299	6502	SO:0001589	frameshift_variant	23518	exon13			.	D21852	CCDS2177.1, CCDS63024.1, CCDS63025.1, CCDS63026.1	2q21.3	2012-09-20	2005-09-02	2005-09-02	ENSG00000048991	ENSG00000048991			9757	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing"""	R3HDM		7584026	Standard	NM_001282798		Approved	KIAA0029	uc002tuo.3	Q15032	OTTHUMG00000131740	ENST00000264160.4:c.988delT	chr2.hg19:g.136396355delT	ENSP00000264160:p.Phe330fs	89.0	0.0	0		133.0	52.0	0.390977	NM_015361	A8K1V0|B3KXQ9|E9PBB4|E9PG42|G5E9G8|Q8IW32	Frame_Shift_Del	DEL	ENST00000264160.4	hg19	CCDS2177.1																																																																																			.	.	.	none		0.343	R3HDM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254659.1	NM_015361	
IMMP1L	196294	hgsc.bcm.edu	37	11	31454087	31454087	+	Frame_Shift_Del	DEL	A	A	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr11:31454087delA	ENST00000278200.1	-	7	656	c.461delT	c.(460-462)ttafs	p.L154fs	IMMP1L_ENST00000534812.1_Frame_Shift_Del_p.L45fs|IMMP1L_ENST00000533642.1_Frame_Shift_Del_p.L45fs|AC108456.1_ENST00000408411.1_RNA|IMMP1L_ENST00000532287.1_Frame_Shift_Del_p.L154fs|IMMP1L_ENST00000526776.1_Frame_Shift_Del_p.L82fs	NM_144981.1	NP_659418.1	Q96LU5	IMP1L_HUMAN	IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)	154					protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	serine-type peptidase activity (GO:0008236)			breast(1)|cervix(1)|large_intestine(1)|lung(4)	7	Lung SC(675;0.225)					GCTGGCACGTAAAAATCCAAA	0.338																																					p.L154fs		Atlas-Indel,Pindel	.											.	IMMP1L	16	.	0			c.462delA						PASS	.						71.0	67.0	69.0					11																	31454087		2202	4298	6500	SO:0001589	frameshift_variant	196294	exon7			.		CCDS7874.1	11p13	2014-07-30			ENSG00000148950	ENSG00000148950			26317	protein-coding gene	gene with protein product		612323					Standard	NM_144981		Approved	FLJ25059	uc001msy.1	Q96LU5	OTTHUMG00000166226	ENST00000278200.1:c.461delT	chr11.hg19:g.31454087delA	ENSP00000278200:p.Leu154fs	374.0	0.0	0		400.0	141.0	0.3525	NM_144981	D3DQZ7|Q96SH9	Frame_Shift_Del	DEL	ENST00000278200.1	hg19	CCDS7874.1																																																																																			.	.	.	none		0.338	IMMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388496.1	NM_144981	
TM9SF2	9375	hgsc.bcm.edu	37	13	100172311	100172311	+	Frame_Shift_Del	DEL	A	A	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr13:100172311delA	ENST00000376387.4	+	3	451	c.261delA	c.(259-261)tcafs	p.S87fs	TM9SF2_ENST00000463709.1_3'UTR	NM_004800.1	NP_004791.1	Q99805	TM9S2_HUMAN	transmembrane 9 superfamily member 2	87					transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)	17	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)					GCCAAGCATCAGAAGGAAAGC	0.353																																					p.S87X		Pindel	.											.	TM9SF2	52	.	0			c.260delC						PASS	.						75.0	75.0	75.0					13																	100172311		2203	4300	6503	SO:0001589	frameshift_variant	9375	exon3			.	U81006	CCDS9493.1	13q32.2	2011-03-28			ENSG00000125304	ENSG00000125304			11865	protein-coding gene	gene with protein product		604678				9729438	Standard	NM_004800		Approved	P76	uc001voj.2	Q99805	OTTHUMG00000017272	ENST00000376387.4:c.261delA	chr13.hg19:g.100172311delA	ENSP00000365567:p.Ser87fs	108.0	0.0	.		119.0	10.0	0.084	NM_004800	A8K399|Q2TAY5	Frame_Shift_Del	DEL	ENST00000376387.4	hg19	CCDS9493.1																																																																																			.	.	.	none		0.353	TM9SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045602.3		
COL6A2	1292	hgsc.bcm.edu	37	21	47545867	47545879	+	Frame_Shift_Del	DEL	GCCTCATCAAGGA	GCCTCATCAAGGA	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	GCCTCATCAAGGA	GCCTCATCAAGGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr21:47545867_47545879delGCCTCATCAAGGA	ENST00000300527.4	+	26	2242_2254	c.2138_2150delGCCTCATCAAGGA	c.(2137-2151)cgcctcatcaaggagfs	p.RLIKE713fs	COL6A2_ENST00000357838.4_Frame_Shift_Del_p.RLIKE713fs|COL6A2_ENST00000397763.1_Frame_Shift_Del_p.RLIKE713fs|COL6A2_ENST00000310645.5_Frame_Shift_Del_p.RLIKE713fs|COL6A2_ENST00000409416.1_Frame_Shift_Del_p.RLIKE713fs	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	713	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)		p.I715M(3)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GCCTACGACCGCCTCATCAAGGAGAGCCGGCGC	0.634																																					p.713_717del		Pindel	.											COL6A2_ENST00000357838,NS,carcinoma,0,5	COL6A2	351	.	3	Substitution - Missense(3)	lung(3)	c.2137_2149del						PASS	.																																			SO:0001589	frameshift_variant	1292	exon26			.	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2138_2150delGCCTCATCAAGGA	chr21.hg19:g.47545867_47545879delGCCTCATCAAGGA	ENSP00000300527:p.Arg713fs	184.0	0.0	.		145.0	33.0	0.228	NM_058175	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Frame_Shift_Del	DEL	ENST00000300527.4	hg19	CCDS13728.1																																																																																			.	.	.	none		0.634	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1		
USP4	7375	hgsc.bcm.edu	37	3	49315762	49315762	+	Frame_Shift_Del	DEL	A	A	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr3:49315762delA	ENST00000265560.4	-	22	2902	c.2856delT	c.(2854-2856)tttfs	p.F952fs	USP4_ENST00000351842.4_Frame_Shift_Del_p.F905fs|C3orf62_ENST00000343010.3_5'Flank	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	952					negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		CATCATCCCCAAAGCCCTGCT	0.507																																					p.G953fs		Pindel	.											.	USP4	72	.	0			c.2857delG						PASS	.						120.0	118.0	119.0					3																	49315762		2203	4300	6503	SO:0001589	frameshift_variant	7375	exon22			.	U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.2856delT	chr3.hg19:g.49315762delA	ENSP00000265560:p.Phe952fs	68.0	0.0	.		112.0	43.0	0.384	NM_003363	A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Frame_Shift_Del	DEL	ENST00000265560.4	hg19	CCDS2793.1																																																																																			.	.	.	none		0.507	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346069.1	NM_199443	
TENM2	57451	hgsc.bcm.edu	37	5	167622284	167622285	+	Frame_Shift_Ins	INS	-	-	CCCGCCAGGATGGCACGTGAGT			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr5:167622284_167622285insCCCGCCAGGATGGCACGTGAGT	ENST00000518659.1	+	15	2923_2924	c.2884_2885insCCCGCCAGGATGGCACGTGAGT	c.(2884-2886)accfs	p.-962fs	TENM2_ENST00000545108.1_Frame_Shift_Ins_p.-962fs|TENM2_ENST00000519204.1_Frame_Shift_Ins_p.-841fs|TENM2_ENST00000403607.2_Frame_Shift_Ins_p.-786fs|TENM2_ENST00000520394.1_Frame_Shift_Ins_p.-730fs	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2						axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										CTACACCATCACCCGCCAGGAT	0.545																																					p.T953_R954delinsTRQDGTX		Pindel	.											.	.	.	.	0			c.2857_2858insCCCGCCAGGATGGCACGTGAGT						PASS	.																																			SO:0001589	frameshift_variant	57451	exon15			.	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	Exception_encountered	chr5.hg19:g.167622284_167622285insCCCGCCAGGATGGCACGTGAGT	ENSP00000429430:p.Thr962fs	84.0	0.0	.		88.0	21.0	0.239	NM_001122679	Q9ULU2	Frame_Shift_Ins	INS	ENST00000518659.1	hg19																																																																																				.	.	.	none		0.545	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
OR2T2	401992	hgsc.bcm.edu	37	1	248616710	248616734	+	Frame_Shift_Del	DEL	CGTGCTGATGCTGCTTATCCCTCTA	CGTGCTGATGCTGCTTATCCCTCTA	-	rs199823862|rs201716034|rs376194718		TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	CGTGCTGATGCTGCTTATCCCTCTA	CGTGCTGATGCTGCTTATCCCTCTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr1:248616710_248616734delCGTGCTGATGCTGCTTATCCCTCTA	ENST00000342927.3	+	1	634_658	c.612_636delCGTGCTGATGCTGCTTATCCCTCTA	c.(610-636)tgcgtgctgatgctgcttatccctctafs	p.CVLMLLIPL204fs		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	204						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATGCCTGCTGCGTGCTGATGCTGCTTATCCCTCTATCTGTCATCT	0.529																																					p.204_212del		Pindel	.											.	OR2T2	73	.	0			c.611_635del						PASS	.																																			SO:0001589	frameshift_variant	401992	exon1			.	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.612_636delCGTGCTGATGCTGCTTATCCCTCTA	chr1.hg19:g.248616710_248616734delCGTGCTGATGCTGCTTATCCCTCTA	ENSP00000343062:p.Cys204fs	261.0	0.0	.		218.0	21.0	0.096	NM_001004136	B2RNM1|B9EH01	Frame_Shift_Del	DEL	ENST00000342927.3	hg19	CCDS31116.1																																																																																			.	.	.	alt		0.529	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136	
GOLGA6A	342096	hgsc.bcm.edu	37	15	74367333	74367334	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr15:74367333_74367334delGG	ENST00000290438.3	-	11	896_897	c.856_857delCC	c.(856-858)ccafs	p.P286fs	RN7SL429P_ENST00000479090.2_RNA	NM_001038640.2	NP_001033729.2	Q9NYA3	GOG6A_HUMAN	golgin A6 family, member A	286						Golgi apparatus (GO:0005794)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|liver(1)|lung(6)|prostate(1)|urinary_tract(1)	16						CGCCAGGGATGGGGGCTCAGCT	0.54																																					p.286_286del		Pindel	.											.	GOLGA6A	28	.	0			c.857_858del						PASS	.																																			SO:0001589	frameshift_variant	342096	exon11			.	AF263742	CCDS32290.1	15q24.1	2013-05-10	2010-02-12	2009-09-28	ENSG00000159289	ENSG00000159289			13567	protein-coding gene	gene with protein product		610288	"""golgi autoantigen, golgin subfamily a, member 6"", ""golgi autoantigen, golgin subfamily a, 6"", ""golgi autoantigen, golgin subfamily a, 6A"""	GOLGA6		11161787	Standard	NM_001038640		Approved	GLP	uc002axa.1	Q9NYA3	OTTHUMG00000173035	ENST00000290438.3:c.856_857delCC	chr15.hg19:g.74367335_74367336delGG	ENSP00000290438:p.Pro286fs	84.0	0.0	.		40.0	11.0	0.275	NM_001038640	A8K959|Q9NYA7	Frame_Shift_Del	DEL	ENST00000290438.3	hg19	CCDS32290.1																																																																																			.	.	.	none		0.540	GOLGA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421835.1	XM_292357	
KRT86	3892	hgsc.bcm.edu	37	12	52702335	52702335	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UZ-A9PS-01A-11D-A42J-10	TCGA-UZ-A9PS-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	acba931b-e52d-4487-b13a-7d8c91981263	57691588-0681-41ba-b333-4d612c7f0542	g.chr12:52702335delT	ENST00000423955.2	+	11	1605	c.1427delT	c.(1426-1428)gttfs	p.V476fs	RP11-845M18.6_ENST00000552441.1_RNA|KRT86_ENST00000293525.5_Frame_Shift_Del_p.V476fs|KRT86_ENST00000544024.1_Frame_Shift_Del_p.V476fs			O43790	KRT86_HUMAN	keratin 86	476	Tail.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		TCCGCCCGGGTTGGCGTCTGC	0.672																																					p.V476fs		Pindel	.											.	KRT86	33	.	0			c.1426delG						PASS	.						21.0	27.0	25.0					12																	52702335		2075	4201	6276	SO:0001589	frameshift_variant	3892	exon9			.	X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000423955.2:c.1427delT	chr12.hg19:g.52702335delT	ENSP00000444533:p.Val476fs	9.0	0.0	.		21.0	12.0	0.571	NM_002284	P78387	Frame_Shift_Del	DEL	ENST00000423955.2	hg19	CCDS41785.1																																																																																			.	.	.	none		0.672	KRT86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404911.1	NM_002284	
