#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MRPL37	51253	hgsc.bcm.edu	37	1	54671037	54671037	+	Silent	SNP	G	G	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr1:54671037G>A	ENST00000360840.5	+	3	677	c.600G>A	c.(598-600)agG>agA	p.R200R	MRPL37_ENST00000336230.6_Intron|MRPL37_ENST00000487096.1_3'UTR|MRPL37_ENST00000605337.1_Silent_p.R200R	NM_016491.3	NP_057575.2	Q9BZE1	RM37_HUMAN	mitochondrial ribosomal protein L37	200					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(4)|skin(2)	19						CTCTGGCCAGGAGGATCTGTG	0.458																																					p.R200R		Atlas-SNP	.											.	MRPL37	36	.	0			c.G600A						PASS	.						153.0	140.0	144.0					1																	54671037		2203	4300	6503	SO:0001819	synonymous_variant	51253	exon3			GGCCAGGAGGATC	AB051344	CCDS589.1	1p32.1	2012-09-13			ENSG00000116221	ENSG00000116221		"""Mitochondrial ribosomal proteins / large subunits"""	14034	protein-coding gene	gene with protein product		611843				10600119	Standard	NM_016491		Approved	RPML2, MRP-L2	uc001cxa.4	Q9BZE1	OTTHUMG00000008118	ENST00000360840.5:c.600G>A	chr1.hg19:g.54671037G>A		180.0	0.0	.		82.0	40.0	.	NM_016491	Q96Q67|Q9BWR1|Q9P0P3	Silent	SNP	ENST00000360840.5	hg19	CCDS589.1																																																																																			.	.	.	none		0.458	MRPL37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022224.1	NM_016491	
ABCA4	24	hgsc.bcm.edu	37	1	94522185	94522185	+	Missense_Mutation	SNP	C	C	T	rs368457541		TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr1:94522185C>T	ENST00000370225.3	-	15	2440	c.2354G>A	c.(2353-2355)cGc>cAc	p.R785H	ABCA4_ENST00000535735.1_Intron	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	785					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		AGCGGTCATGCGGTCCTGCCA	0.597													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20408	0.0		0.0	False		,,,				2504	0.0				p.R785H		Atlas-SNP	.											ABCA4,colon,carcinoma,0,1	ABCA4	275	.	0			c.G2354A						PASS	.	C	HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	67.0	56.0	60.0		2354	2.3	0.5	1		60	0,8600		0,0,4300	no	missense	ABCA4	NM_000350.2	29	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	785/2274	94522185	2,13004	2203	4300	6503	SO:0001583	missense	24	exon15			GTCATGCGGTCCT	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.2354G>A	chr1.hg19:g.94522185C>T	ENSP00000359245:p.Arg785His	171.0	0.0	.		97.0	55.0	.	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	hg19	CCDS747.1	.	.	.	.	.	.	.	.	.	.	C	7.992	0.753505	0.15778	4.54E-4	0.0	ENSG00000198691	ENST00000370225	T	0.74632	-0.86	5.36	2.35	0.29111	.	0.172435	0.52532	D	0.000069	T	0.53302	0.1788	M	0.67397	2.05	0.80722	D	1	B	0.11235	0.004	B	0.18561	0.022	T	0.49214	-0.8963	10	0.28530	T	0.3	.	9.4895	0.38951	0.0:0.7563:0.0:0.2437	.	785	P78363	ABCA4_HUMAN	H	785	ENSP00000359245:R785H	ENSP00000359245:R785H	R	-	2	0	ABCA4	94294773	0.028000	0.19301	0.521000	0.27850	0.176000	0.22953	0.407000	0.21049	0.301000	0.22738	-0.258000	0.10820	CGC	.	.	.	none		0.597	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
DPH5	51611	hgsc.bcm.edu	37	1	101456156	101456156	+	Silent	SNP	T	T	C			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr1:101456156T>C	ENST00000370109.3	-	8	778	c.666A>G	c.(664-666)ttA>ttG	p.L222L	DPH5_ENST00000488176.1_Silent_p.L222L|DPH5_ENST00000370105.3_5'UTR|DPH5_ENST00000342173.7_Silent_p.L221L|AC093157.1_ENST00000593496.1_Silent_p.A50A|DPH5_ENST00000427040.2_5'UTR	NM_001077394.1|NM_001077395.1|NM_015958.2	NP_001070862.1|NP_001070863.1|NP_057042.2	Q9H2P9	DPH5_HUMAN	diphthamide biosynthesis 5	222					peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)		diphthine synthase activity (GO:0004164)			endometrium(2)|large_intestine(1)|lung(4)	7		all_epithelial(167;3.1e-06)|all_lung(203;0.000414)|Lung NSC(277;0.000946)		Epithelial(280;0.0385)|all cancers(265;0.043)|COAD - Colon adenocarcinoma(174;0.151)|Colorectal(144;0.173)|Lung(183;0.198)		CAACCCTGGCTAAGCCAACAC	0.433																																					p.L222L		Atlas-SNP	.											.	DPH5	14	.	0			c.A666G						PASS	.						82.0	80.0	81.0					1																	101456156		1943	4135	6078	SO:0001819	synonymous_variant	51611	exon8			CCTGGCTAAGCCA	AF132964	CCDS41358.1, CCDS41359.1	1p21.2	2013-05-02	2013-05-02		ENSG00000117543	ENSG00000117543			24270	protein-coding gene	gene with protein product		611075	"""DPH5 homolog (S. cerevisiae)"""			15485916, 23486472	Standard	NM_015958		Approved	CGI-30	uc001dtt.2	Q9H2P9	OTTHUMG00000010829	ENST00000370109.3:c.666A>G	chr1.hg19:g.101456156T>C		103.0	0.0	.		86.0	39.0	.	NM_015958	A8JZY6|D3DT62|Q9P017|Q9P0I4|Q9Y319	Silent	SNP	ENST00000370109.3	hg19	CCDS41358.1																																																																																			.	.	.	none		0.433	DPH5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000029881.1	NM_015958	
ALX3	257	hgsc.bcm.edu	37	1	110603552	110603552	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr1:110603552C>A	ENST00000369792.4	-	4	922	c.835G>T	c.(835-837)Ggg>Tgg	p.G279W	RP4-773N10.4_ENST00000596959.1_RNA|RP4-773N10.4_ENST00000554749.1_RNA	NM_006492.2	NP_006483.2	O95076	ALX3_HUMAN	ALX homeobox 3	279					embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal system morphogenesis (GO:0048704)|pattern specification process (GO:0007389)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6		all_cancers(81;2.35e-05)|all_epithelial(167;7.69e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.015)|all cancers(265;0.0706)|Epithelial(280;0.0758)|Colorectal(144;0.113)|LUSC - Lung squamous cell carcinoma(189;0.135)		GCCACACTCCCATGGGGGTGG	0.652																																					p.G279W		Atlas-SNP	.											.	ALX3	16	.	0			c.G835T						PASS	.						15.0	19.0	18.0					1																	110603552		2200	4297	6497	SO:0001583	missense	257	exon4			CACTCCCATGGGG	AF008203	CCDS819.1	1p13.3	2014-02-04	2008-11-04		ENSG00000156150	ENSG00000156150		"""Homeoboxes / PRD class"""	449	protein-coding gene	gene with protein product		606014	"""aristaless-like homeobox 3"", ""frontonasal dysplasia"""	FND		15226305, 11807986, 19409524	Standard	NM_006492		Approved		uc001dzb.3	O95076	OTTHUMG00000011650	ENST00000369792.4:c.835G>T	chr1.hg19:g.110603552C>A	ENSP00000358807:p.Gly279Trp	195.0	0.0	.		146.0	68.0	.	NM_006492	O95075|Q5T8M4	Missense_Mutation	SNP	ENST00000369792.4	hg19	CCDS819.1	.	.	.	.	.	.	.	.	.	.	C	11.93	1.784499	0.31593	.	.	ENSG00000156150	ENST00000369792	D	0.92752	-3.1	5.51	3.3	0.37823	.	0.149286	0.43747	D	0.000537	D	0.91872	0.7427	M	0.71581	2.175	0.43199	D	0.995046	D	0.69078	0.997	P	0.61328	0.887	D	0.91501	0.5219	10	0.59425	D	0.04	.	6.8466	0.23992	0.0:0.666:0.0:0.334	.	279	O95076	ALX3_HUMAN	W	279	ENSP00000358807:G279W	ENSP00000358807:G279W	G	-	1	0	ALX3	110405075	0.482000	0.25948	0.212000	0.23672	0.147000	0.21601	0.852000	0.27764	1.340000	0.45581	0.655000	0.94253	GGG	.	.	.	none		0.652	ALX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032232.2	NM_006492	
RAB29	8934	hgsc.bcm.edu	37	1	205739969	205739969	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr1:205739969G>T	ENST00000367139.3	-	5	695	c.392C>A	c.(391-393)cCt>cAt	p.P131H	RAB7L1_ENST00000468887.1_5'UTR|RAB7L1_ENST00000437324.2_Missense_Mutation_p.P59H|RAB7L1_ENST00000414729.1_Missense_Mutation_p.P131H|RAB7L1_ENST00000446390.2_Missense_Mutation_p.P107H|RAB7L1_ENST00000235932.4_Missense_Mutation_p.P131H	NM_003929.2	NP_003920.1	O14966	RAB7L_HUMAN		131					cell differentiation (GO:0030154)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|positive regulation of intracellular protein transport (GO:0090316)|protein transport (GO:0015031)|retrograde transport, plasma membrane to Golgi (GO:0035526)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vacuole (GO:0005773)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(1)	10	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			CACTGCCCAAGGGGACAGATC	0.403																																					p.P131H	Pancreas(25;658 872 27763 34889 38531)	Atlas-SNP	.											.	RAB7L1	19	.	0			c.C392A						PASS	.						84.0	76.0	79.0					1																	205739969		2203	4300	6503	SO:0001583	missense	8934	exon5			GCCCAAGGGGACA																												ENST00000367139.3:c.392C>A	chr1.hg19:g.205739969G>T	ENSP00000356107:p.Pro131His	77.0	0.0	.		57.0	4.0	.	NM_001135662	B4E1K3|C9JE77	Missense_Mutation	SNP	ENST00000367139.3	hg19	CCDS1459.1	.	.	.	.	.	.	.	.	.	.	G	15.80	2.940484	0.52972	.	.	ENSG00000117280	ENST00000367139;ENST00000235932;ENST00000437324;ENST00000446390;ENST00000414729	T;T;T;T;T	0.79653	-1.29;-1.29;-0.42;-1.29;-1.29	5.27	5.27	0.74061	Small GTP-binding protein domain (1);	0.121659	0.56097	D	0.000026	T	0.69602	0.3129	N	0.04820	-0.15	0.39116	D	0.96156	B;B	0.29378	0.243;0.24	B;B	0.36464	0.092;0.225	T	0.73908	-0.3834	10	0.87932	D	0	-7.8433	17.0021	0.86384	0.0:0.0:1.0:0.0	.	107;131	B4E1K3;O14966	.;RAB7L_HUMAN	H	131;131;59;107;131	ENSP00000356107:P131H;ENSP00000235932:P131H;ENSP00000416613:P59H;ENSP00000389899:P107H;ENSP00000402910:P131H	ENSP00000235932:P131H	P	-	2	0	RAB7L1	204006592	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.213000	0.65230	2.619000	0.88677	0.561000	0.74099	CCT	.	.	.	none		0.403	RAB7L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087732.1		
OR2T33	391195	hgsc.bcm.edu	37	1	248436732	248436732	+	Nonsense_Mutation	SNP	G	G	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr1:248436732G>A	ENST00000318021.2	-	1	406	c.385C>T	c.(385-387)Cga>Tga	p.R129*		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	129						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GTGGGATATCGGAGTGGGTGG	0.592																																					p.R129X		Atlas-SNP	.											.	OR2T33	133	.	0			c.C385T						PASS	.						60.0	61.0	60.0					1																	248436732		2197	4289	6486	SO:0001587	stop_gained	391195	exon1			GATATCGGAGTGG		CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.385C>T	chr1.hg19:g.248436732G>A	ENSP00000324687:p.Arg129*	654.0	0.0	.		472.0	28.0	.	NM_001004695	B2RNN0	Nonsense_Mutation	SNP	ENST00000318021.2	hg19	CCDS31109.1	.	.	.	.	.	.	.	.	.	.	-	9.949	1.219752	0.22373	.	.	ENSG00000177212	ENST00000318021	.	.	.	2.7	0.405	0.16361	.	0.000000	0.30126	U	0.010346	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.3142	0.43727	0.0:0.0:0.6163:0.3837	.	.	.	.	X	129	.	ENSP00000324687:R129X	R	-	1	2	OR2T33	246503355	0.005000	0.15991	0.021000	0.16686	0.001000	0.01503	0.673000	0.25203	-0.062000	0.13088	-0.599000	0.04106	CGA	.	.	.	none		0.592	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097354.1	NM_001004695	
SCN9A	6335	hgsc.bcm.edu	37	2	167055908	167055908	+	Silent	SNP	G	G	T			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr2:167055908G>T	ENST00000409435.1	-	26	5240	c.5241C>A	c.(5239-5241)tcC>tcA	p.S1747S	SCN9A_ENST00000375387.4_Silent_p.S1748S|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000409672.1_Silent_p.S1736S|SCN9A_ENST00000303354.6_Silent_p.S1748S			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1747					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CAACCAGGAAGGATATGATGA	0.398																																					p.S1736S		Atlas-SNP	.											SCN9A,NS,carcinoma,0,1	SCN9A	296	.	0			c.C5208A						PASS	.						187.0	198.0	194.0					2																	167055908		2203	4300	6503	SO:0001819	synonymous_variant	6335	exon27			CAGGAAGGATATG	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.5241C>A	chr2.hg19:g.167055908G>T		131.0	0.0	.		107.0	48.0	.	NM_002977	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Silent	SNP	ENST00000409435.1	hg19	CCDS46441.1																																																																																			.	.	.	none		0.398	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
VILL	50853	hgsc.bcm.edu	37	3	38043001	38043001	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr3:38043001C>G	ENST00000283713.6	+	12	1503	c.1237C>G	c.(1237-1239)Cag>Gag	p.Q413E	VILL_ENST00000465644.1_Missense_Mutation_p.Q131E|VILL_ENST00000383759.2_Missense_Mutation_p.Q413E			O15195	VILL_HUMAN	villin-like	413					actin filament capping (GO:0051693)|cytoskeleton organization (GO:0007010)	actin cytoskeleton (GO:0015629)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|urinary_tract(2)	28				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		GCGTCATGGACAGCTGTGTGC	0.587																																					p.Q413E		Atlas-SNP	.											.	VILL	61	.	0			c.C1237G						PASS	.						116.0	101.0	106.0					3																	38043001		2203	4300	6503	SO:0001583	missense	50853	exon11			CATGGACAGCTGT		CCDS2670.2	3p21	2004-07-28			ENSG00000136059	ENSG00000136059			30906	protein-coding gene	gene with protein product						9179494	Standard	XM_005265191		Approved		uc003chl.3	O15195	OTTHUMG00000130814	ENST00000283713.6:c.1237C>G	chr3.hg19:g.38043001C>G	ENSP00000283713:p.Gln413Glu	65.0	0.0	.		76.0	31.0	.	NM_015873	A8MZP1|Q9BT80|Q9BWH7	Missense_Mutation	SNP	ENST00000283713.6	hg19	CCDS2670.2	.	.	.	.	.	.	.	.	.	.	C	11.51	1.660433	0.29515	.	.	ENSG00000136059	ENST00000283713;ENST00000383759;ENST00000356246;ENST00000465644	T;T;T	0.55234	0.53;0.53;0.53	4.04	3.16	0.36331	Gelsolin domain (1);	0.108661	0.64402	D	0.000004	T	0.61961	0.2389	M	0.75150	2.29	0.37472	D	0.915635	P;P	0.41569	0.712;0.755	B;P	0.51945	0.373;0.685	T	0.64330	-0.6433	10	0.30078	T	0.28	-6.8034	10.8824	0.46946	0.0:0.9052:0.0:0.0948	.	399;413	O15195-2;O15195	.;VILL_HUMAN	E	413;413;399;131	ENSP00000283713:Q413E;ENSP00000373266:Q413E;ENSP00000422096:Q131E	ENSP00000283713:Q413E	Q	+	1	0	VILL	38018005	0.801000	0.28930	0.007000	0.13788	0.022000	0.10575	1.593000	0.36686	1.054000	0.40438	0.455000	0.32223	CAG	.	.	.	none		0.587	VILL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253360.3	NM_015873	
ASTE1	28990	hgsc.bcm.edu	37	3	130743519	130743519	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr3:130743519T>A	ENST00000264992.3	-	3	1073	c.632A>T	c.(631-633)aAt>aTt	p.N211I	NEK11_ENST00000356918.4_5'Flank|ASTE1_ENST00000514044.1_Missense_Mutation_p.N211I|NEK11_ENST00000510769.1_5'Flank|NEK11_ENST00000412440.2_5'Flank|NEK11_ENST00000429253.2_5'Flank|NEK11_ENST00000510688.1_5'Flank|NEK11_ENST00000511262.1_5'Flank|NEK11_ENST00000383366.4_5'Flank	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	211					DNA repair (GO:0006281)		nuclease activity (GO:0004518)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						TAGAGCTTTATTCATATTGCT	0.408																																					p.N211I		Atlas-SNP	.											.	ASTE1	67	.	0			c.A632T						PASS	.						105.0	99.0	101.0					3																	130743519		2203	4300	6503	SO:0001583	missense	28990	exon3			GCTTTATTCATAT	AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.632A>T	chr3.hg19:g.130743519T>A	ENSP00000264992:p.Asn211Ile	83.0	0.0	.		100.0	44.0	.	NM_014065	B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Missense_Mutation	SNP	ENST00000264992.3	hg19	CCDS3068.1	.	.	.	.	.	.	.	.	.	.	T	18.11	3.551442	0.65311	.	.	ENSG00000034533	ENST00000514044;ENST00000264992;ENST00000446270	.	.	.	5.54	4.38	0.52667	.	0.081556	0.85682	D	0.000000	T	0.71728	0.3374	M	0.71581	2.175	0.41819	D	0.990011	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.73040	-0.4108	9	0.66056	D	0.02	-14.7581	9.4519	0.38731	0.0:0.1477:0.0:0.8523	.	211;211	D6RG30;Q2TB18	.;ASTE1_HUMAN	I	211	.	ENSP00000264992:N211I	N	-	2	0	ASTE1	132226209	0.937000	0.31787	0.570000	0.28473	0.980000	0.70556	1.749000	0.38319	0.933000	0.37291	0.459000	0.35465	AAT	.	.	.	none		0.408	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356659.1	NM_014065	
WWTR1	25937	hgsc.bcm.edu	37	3	149243902	149243902	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr3:149243902G>A	ENST00000465804.1	-	7	1172	c.916C>T	c.(916-918)Cat>Tat	p.H306Y	RNU6-1098P_ENST00000516772.1_RNA|WWTR1_ENST00000467467.1_Missense_Mutation_p.H306Y|WWTR1_ENST00000360632.3_Missense_Mutation_p.H306Y	NM_001168278.1	NP_001161750.1	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1	306					cilium morphogenesis (GO:0060271)|gene expression (GO:0010467)|glomerulus development (GO:0032835)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast differentiation (GO:0001649)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of SMAD protein import into nucleus (GO:0060390)|regulation of transcription, DNA-templated (GO:0006355)|stem cell division (GO:0017145)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(5)|cervix(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	23			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			TCCCTCGAATGATATGGCCCT	0.458			T	CAMTA1	epitheliod hemangioendothelioma																																p.H306Y		Atlas-SNP	.		Dom	yes		3	3q23-q24	607392	WW domain containing transcription regulator 1		M	WWTR1,NS,carcinoma,0,1	WWTR1	42	.	0			c.C916T						PASS	.						102.0	92.0	95.0					3																	149243902		2203	4300	6503	SO:0001583	missense	25937	exon7			TCGAATGATATGG	AK022036	CCDS3144.1	3q23-q24	2004-12-03			ENSG00000018408	ENSG00000018408			24042	protein-coding gene	gene with protein product		607392				11118213, 15096513	Standard	NM_015472		Approved	TAZ, DKFZp586I1419	uc021xfm.1	Q9GZV5	OTTHUMG00000159614	ENST00000465804.1:c.916C>T	chr3.hg19:g.149243902G>A	ENSP00000419465:p.His306Tyr	88.0	0.0	.		68.0	20.0	.	NM_001168278	D3DNH7|Q8N3P2|Q9Y3W6	Missense_Mutation	SNP	ENST00000465804.1	hg19	CCDS3144.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.649621	0.87958	.	.	ENSG00000018408	ENST00000465804;ENST00000360632;ENST00000467467;ENST00000472417	D;D;D	0.82619	-1.63;-1.63;-1.63	5.71	5.71	0.89125	.	0.103999	0.64402	D	0.000004	D	0.85665	0.5749	M	0.81497	2.545	0.80722	D	1	P	0.46621	0.881	B	0.41332	0.354	D	0.88133	0.2839	10	0.87932	D	0	-29.8014	19.846	0.96707	0.0:0.0:1.0:0.0	.	306	Q9GZV5	WWTR1_HUMAN	Y	306;306;306;164	ENSP00000419465:H306Y;ENSP00000353847:H306Y;ENSP00000419234:H306Y	ENSP00000353847:H306Y	H	-	1	0	WWTR1	150726592	1.000000	0.71417	0.615000	0.29064	0.887000	0.51463	9.467000	0.97671	2.683000	0.91414	0.563000	0.77884	CAT	.	.	.	none		0.458	WWTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356498.1	NM_015472	
MRFAP1	93621	hgsc.bcm.edu	37	4	6642705	6642705	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr4:6642705T>C	ENST00000320912.4	+	2	769	c.116T>C	c.(115-117)aTc>aCc	p.I39T	MRFAP1_ENST00000382581.4_Missense_Mutation_p.I39T|MRFAP1_ENST00000507420.1_Missense_Mutation_p.I39T	NM_001272053.1	NP_001258982.1			Morf4 family associated protein 1											lung(1)	1						CGCGAGGACATCGCGTCGCTG	0.617																																					p.I39T		Atlas-SNP	.											.	MRFAP1	10	.	0			c.T116C						PASS	.						76.0	75.0	75.0					4																	6642705		2203	4300	6503	SO:0001583	missense	93621	exon2			AGGACATCGCGTC	AF116272	CCDS3389.1	4p16.1	2011-01-27	2011-01-27		ENSG00000179010	ENSG00000179010			24549	protein-coding gene	gene with protein product						15367658	Standard	NM_033296		Approved	PAM14, PGR1	uc003gjh.2	Q9Y605	OTTHUMG00000125504	ENST00000320912.4:c.116T>C	chr4.hg19:g.6642705T>C	ENSP00000318352:p.Ile39Thr	144.0	0.0	.		109.0	40.0	.	NM_001272053		Missense_Mutation	SNP	ENST00000320912.4	hg19	CCDS3389.1	.	.	.	.	.	.	.	.	.	.	T	19.09	3.759842	0.69763	.	.	ENSG00000179010	ENST00000320912;ENST00000507420;ENST00000382581	.	.	.	3.35	3.35	0.38373	.	0.000000	0.33040	N	0.005353	T	0.28366	0.0701	N	0.24115	0.695	0.23010	N	0.998433	B	0.30889	0.299	B	0.33121	0.158	T	0.26018	-1.0115	9	0.72032	D	0.01	-23.1149	8.4138	0.32659	0.0:0.0:0.0:1.0	.	39	Q9Y605	MOFA1_HUMAN	T	39	.	ENSP00000318352:I39T	I	+	2	0	MRFAP1	6693606	1.000000	0.71417	0.533000	0.28001	0.966000	0.64601	1.122000	0.31295	1.771000	0.52183	0.459000	0.35465	ATC	.	.	.	none		0.617	MRFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246831.1	NM_033296	
SLC4A4	8671	hgsc.bcm.edu	37	4	72215763	72215763	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr4:72215763A>T	ENST00000264485.5	+	5	641	c.524A>T	c.(523-525)gAg>gTg	p.E175V	SLC4A4_ENST00000514331.1_3'UTR|SLC4A4_ENST00000340595.3_Missense_Mutation_p.E131V|SLC4A4_ENST00000425175.1_Missense_Mutation_p.E175V|SLC4A4_ENST00000512686.1_Missense_Mutation_p.E131V|SLC4A4_ENST00000351898.6_Missense_Mutation_p.E175V	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	175					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	CTTGATCGGGAGGCTTCTTCT	0.463																																					p.E175V		Atlas-SNP	.											.	SLC4A4	269	.	0			c.A524T						PASS	.						180.0	166.0	171.0					4																	72215763		2203	4300	6503	SO:0001583	missense	8671	exon5			ATCGGGAGGCTTC	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.524A>T	chr4.hg19:g.72215763A>T	ENSP00000264485:p.Glu175Val	69.0	0.0	.		37.0	21.0	.	NM_001098484	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Missense_Mutation	SNP	ENST00000264485.5	hg19	CCDS43236.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.716296	0.89205	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000351898;ENST00000512686;ENST00000340595	T;T;T;T;T	0.81078	-1.45;-1.45;-1.45;-1.45;-1.45	5.64	5.64	0.86602	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.000000	0.85682	D	0.000000	D	0.90024	0.6885	M	0.85710	2.77	0.80722	D	1	P;D;D;D;P;D	0.65815	0.956;0.995;0.974;0.995;0.956;0.979	P;D;P;D;P;P	0.66847	0.864;0.923;0.848;0.947;0.864;0.901	D	0.90840	0.4723	10	0.51188	T	0.08	.	15.8582	0.79000	1.0:0.0:0.0:0.0	.	175;175;131;131;155;175	A5JJ20;Q9Y6R1-4;Q9Y6R1-2;Q9Y6R1-3;Q9Y6R3;Q9Y6R1	.;.;.;.;.;S4A4_HUMAN	V	175;175;175;131;131	ENSP00000264485:E175V;ENSP00000393557:E175V;ENSP00000307349:E175V;ENSP00000422400:E131V;ENSP00000344272:E131V	ENSP00000264485:E175V	E	+	2	0	SLC4A4	72434627	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.307000	0.96226	2.136000	0.66102	0.455000	0.32223	GAG	.	.	.	none		0.463	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
AGPAT9	84803	hgsc.bcm.edu	37	4	84516012	84516012	+	Silent	SNP	T	T	C			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr4:84516012T>C	ENST00000395226.2	+	8	971	c.753T>C	c.(751-753)caT>caC	p.H251H	AGPAT9_ENST00000264409.4_Silent_p.H251H	NM_001256421.1	NP_001243350.1	Q53EU6	GPAT3_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 9	251					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|regulation of TOR signaling (GO:0032006)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(3)	13		Hepatocellular(203;0.114)				GCCAGGTTCATGGCGGCTTGA	0.413																																					p.H251H		Atlas-SNP	.											.	AGPAT9	41	.	0			c.T753C						PASS	.						162.0	165.0	164.0					4																	84516012		2203	4300	6503	SO:0001819	synonymous_variant	84803	exon8			GGTTCATGGCGGC	AK055749	CCDS3606.1	4q21.23	2014-02-13	2008-01-29		ENSG00000138678	ENSG00000138678	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	28157	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, theta"""	610958	"""1-acylglycerol-3-phosphate O-acyltransferase 9 (lysophosphatidic acid acyltransferase, theta)"""			12975309	Standard	NM_001256421		Approved	MGC11324, LPAAT-theta, MAG1, HMFN0839	uc003how.4	Q53EU6	OTTHUMG00000130431	ENST00000395226.2:c.753T>C	chr4.hg19:g.84516012T>C		80.0	0.0	.		58.0	24.0	.	NM_001256421	Q68CJ4|Q6GPI6|Q96NA3	Silent	SNP	ENST00000395226.2	hg19	CCDS3606.1																																																																																			.	.	.	none		0.413	AGPAT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252821.3	NM_032717	
HERC6	55008	hgsc.bcm.edu	37	4	89300229	89300229	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr4:89300229G>C	ENST00000264346.7	+	1	215	c.156G>C	c.(154-156)agG>agC	p.R52S	HERC6_ENST00000380265.5_Missense_Mutation_p.R52S|HERC6_ENST00000273960.3_Missense_Mutation_p.R52S	NM_017912.3	NP_060382.3	Q8IVU3	HERC6_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 6	52					hematopoietic progenitor cell differentiation (GO:0002244)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		ACAACAGCAGGGGTCAGCTGG	0.736																																					p.R52S		Atlas-SNP	.											.	HERC6	104	.	0			c.G156C						PASS	.						3.0	4.0	4.0					4																	89300229		1741	3855	5596	SO:0001583	missense	55008	exon1			CAGCAGGGGTCAG	AF336798	CCDS47098.1, CCDS54777.1	4q22	2012-02-23	2012-02-23		ENSG00000138642	ENSG00000138642			26072	protein-coding gene	gene with protein product		609249	"""hect domain and RLD 6"""				Standard	NM_001165136		Approved	FLJ20637	uc011cdi.2	Q8IVU3	OTTHUMG00000160983	ENST00000264346.7:c.156G>C	chr4.hg19:g.89300229G>C	ENSP00000264346:p.Arg52Ser	69.0	0.0	.		51.0	28.0	.	NM_017912	B4DIY5|Q5GC90|Q5GRH3|Q5HYM6|Q5JPB6|Q6PIF4|Q8NAN3|Q9NWS4	Missense_Mutation	SNP	ENST00000264346.7	hg19	CCDS47098.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.76|11.76	1.733451|1.733451	0.30684|0.30684	.|.	.|.	ENSG00000138642|ENSG00000138642	ENST00000502870|ENST00000380265;ENST00000438983;ENST00000511939;ENST00000273960;ENST00000264346	.|D;D;D	.|0.84873	.|-1.91;-1.91;-1.91	3.8|3.8	-4.99|-4.99	0.03010|0.03010	.|Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	.|1.958200	.|0.02877	.|N	.|0.132381	T|T	0.77054|0.77054	0.4074|0.4074	L|L	0.35723|0.35723	1.085|1.085	0.09310|0.09310	N|N	0.999999|0.999999	.|P;P	.|0.38677	.|0.589;0.642	.|B;B	.|0.34991	.|0.122;0.193	T|T	0.65417|0.65417	-0.6173|-0.6173	5|10	.|0.22109	.|T	.|0.4	.|.	13.0811|13.0811	0.59114|0.59114	0.0:0.5968:0.2814:0.1218|0.0:0.5968:0.2814:0.1218	.|.	.|52;52	.|Q8IVU3-2;Q8IVU3	.|.;HERC6_HUMAN	A|S	5|52	.|ENSP00000369617:R52S;ENSP00000273960:R52S;ENSP00000264346:R52S	.|ENSP00000264346:R52S	G|R	+|+	2|3	0|2	HERC6|HERC6	89519253|89519253	0.000000|0.000000	0.05858|0.05858	0.030000|0.030000	0.17652|0.17652	0.130000|0.130000	0.20726|0.20726	-2.403000|-2.403000	0.01046|0.01046	-0.894000|-0.894000	0.03925|0.03925	0.313000|0.313000	0.20887|0.20887	GGG|AGG	.	.	.	none		0.736	HERC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363259.2		
CLCN3	1182	hgsc.bcm.edu	37	4	170610219	170610219	+	Silent	SNP	T	T	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr4:170610219T>A	ENST00000513761.1	+	5	1003	c.444T>A	c.(442-444)atT>atA	p.I148I	CLCN3_ENST00000504131.2_Silent_p.I131I|CLCN3_ENST00000347613.4_Silent_p.I148I|CLCN3_ENST00000360642.3_Silent_p.I148I	NM_001829.3	NP_001820.2	P51790	CLCN3_HUMAN	chloride channel, voltage-sensitive 3	148					chloride transmembrane transport (GO:1902476)|endosomal lumen acidification (GO:0048388)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|voltage-gated chloride channel activity (GO:0005247)			breast(5)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	29		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		TAATAGACATTGCTGCCGATT	0.418																																					p.I148I		Atlas-SNP	.											.	CLCN3	85	.	0			c.T444A						PASS	.						155.0	152.0	153.0					4																	170610219		2203	4300	6503	SO:0001819	synonymous_variant	1182	exon5			AGACATTGCTGCC	X78520	CCDS34100.1, CCDS34101.1, CCDS58932.1, CCDS75208.1	4q	2012-09-26	2012-02-23		ENSG00000109572	ENSG00000109572		"""Ion channels / Chloride channels : Voltage-sensitive"""	2021	protein-coding gene	gene with protein product		600580	"""chloride channel 3"""				Standard	NM_001243374		Approved	CLC3, ClC-3	uc003ish.3	P51790	OTTHUMG00000160973	ENST00000513761.1:c.444T>A	chr4.hg19:g.170610219T>A		89.0	0.0	.		66.0	33.0	.	NM_001243372	B7Z932|B9EGJ9|D3DP34|E9PB97|O14918|Q86Z21	Silent	SNP	ENST00000513761.1	hg19	CCDS34101.1																																																																																			.	.	.	none		0.418	CLCN3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363210.2		
MED10	84246	hgsc.bcm.edu	37	5	6372638	6372638	+	Missense_Mutation	SNP	C	C	A	rs145638352		TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr5:6372638C>A	ENST00000255764.3	-	4	496	c.386G>T	c.(385-387)gGg>gTg	p.G129V		NM_032286.2	NP_115662.2	Q9BTT4	MED10_HUMAN	mediator complex subunit 10	129					gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	RNA polymerase II transcription cofactor activity (GO:0001104)			kidney(1)|large_intestine(1)|ovary(1)|prostate(1)|urinary_tract(1)	5						GTGATCCTCCCCCCGGATGCT	0.493																																					p.G129V		Atlas-SNP	.											.	MED10	7	.	0			c.G386T						PASS	.	C	VAL/GLY	2,4404	4.2+/-10.8	0,2,2201	114.0	114.0	114.0		386	6.0	1.0	5	dbSNP_134	114	0,8600		0,0,4300	no	missense	MED10	NM_032286.2	109	0,2,6501	AA,AC,CC		0.0,0.0454,0.0154	probably-damaging	129/136	6372638	2,13004	2203	4300	6503	SO:0001583	missense	84246	exon4			TCCTCCCCCCGGA		CCDS34134.1	5p15.31	2008-02-05	2007-07-30		ENSG00000133398	ENSG00000133398			28760	protein-coding gene	gene with protein product	"""NUT2 homolog (S. cerevisiae)"""	612382	"""mediator of RNA polymerase II transcription, subunit 10 homolog (NUT2, S. cerevisiae)"""			15657623, 15175163	Standard	NM_032286		Approved	TRG20, L6, MGC5309, NUT2	uc003jdo.3	Q9BTT4	OTTHUMG00000161682	ENST00000255764.3:c.386G>T	chr5.hg19:g.6372638C>A	ENSP00000255764:p.Gly129Val	115.0	0.0	.		99.0	48.0	.	NM_032286	C6G491	Missense_Mutation	SNP	ENST00000255764.3	hg19	CCDS34134.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.560514	0.86335	4.54E-4	0.0	ENSG00000133398	ENST00000255764	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.76786	0.4036	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.74797	-0.3543	9	0.49607	T	0.09	-30.6001	19.4269	0.94746	0.0:1.0:0.0:0.0	.	129	Q9BTT4	MED10_HUMAN	V	129	.	ENSP00000255764:G129V	G	-	2	0	MED10	6425638	1.000000	0.71417	0.996000	0.52242	0.655000	0.38815	4.489000	0.60309	2.836000	0.97738	0.655000	0.94253	GGG	.	C|1.000;A|0.000	0.000	weak		0.493	MED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365714.1	NM_032286	
FAM105A	54491	hgsc.bcm.edu	37	5	14608915	14608915	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr5:14608915T>C	ENST00000274217.3	+	7	806	c.686T>C	c.(685-687)cTt>cCt	p.L229P		NM_019018.2	NP_061891.1	Q9NUU6	F105A_HUMAN	family with sequence similarity 105, member A	229	OTU.							p.S231fs*13(1)		large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Lung NSC(4;0.00592)					TGCAACACCCTTTTTTCAGAT	0.328																																					p.L229P		Atlas-SNP	.											.,1	FAM105A	32	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.T686C						PASS	.						77.0	77.0	77.0					5																	14608915		2203	4300	6503	SO:0001583	missense	54491	exon7			ACACCCTTTTTTC		CCDS3884.1	5p15.2	2014-02-24			ENSG00000145569	ENSG00000145569		"""OTU domain containing"""	25629	protein-coding gene	gene with protein product						12477932	Standard	NM_019018		Approved	FLJ11127, NET20	uc003jfj.3	Q9NUU6	OTTHUMG00000131056	ENST00000274217.3:c.686T>C	chr5.hg19:g.14608915T>C	ENSP00000274217:p.Leu229Pro	86.0	0.0	.		59.0	3.0	.	NM_019018	Q53H50|Q9H037	Missense_Mutation	SNP	ENST00000274217.3	hg19	CCDS3884.1	.	.	.	.	.	.	.	.	.	.	T	16.58	3.162069	0.57368	.	.	ENSG00000145569	ENST00000274217	T	0.16597	2.33	4.89	4.89	0.63831	.	0.109676	0.40064	N	0.001185	T	0.41213	0.1149	M	0.72894	2.215	0.58432	D	0.999999	D	0.89917	1.0	D	0.76575	0.988	T	0.37454	-0.9705	10	0.87932	D	0	-8.3487	14.4858	0.67616	0.0:0.0:0.0:1.0	.	229	Q9NUU6	F105A_HUMAN	P	229	ENSP00000274217:L229P	ENSP00000274217:L229P	L	+	2	0	FAM105A	14661915	0.991000	0.36638	0.996000	0.52242	0.879000	0.50718	4.189000	0.58358	1.819000	0.53055	0.477000	0.44152	CTT	.	.	.	none		0.328	FAM105A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253710.1	NM_019018	
LVRN	206338	hgsc.bcm.edu	37	5	115351418	115351418	+	Silent	SNP	C	C	G	rs143698388		TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr5:115351418C>G	ENST00000357872.4	+	18	2836	c.2712C>G	c.(2710-2712)gtC>gtG	p.V904V	AQPEP_ENST00000515454.1_3'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		904						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V904V(1)									GCCGGTATGTCGCAAAAGACT	0.413																																					p.V904V		Atlas-SNP	.											FLJ90650,colon,carcinoma,0,1	.	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2712G						PASS	.						78.0	76.0	77.0					5																	115351418		2202	4300	6502	SO:0001819	synonymous_variant	0	exon18			GTATGTCGCAAAA																												ENST00000357872.4:c.2712C>G	chr5.hg19:g.115351418C>G		147.0	0.0	.		122.0	67.0	.	NM_173800	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Silent	SNP	ENST00000357872.4	hg19	CCDS4124.1																																																																																			.	C|1.000;T|0.000	.	alt		0.413	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		
MARCH3	115123	hgsc.bcm.edu	37	5	126253785	126253785	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr5:126253785C>G	ENST00000308660.5	-	2	593	c.79G>C	c.(79-81)Gtg>Ctg	p.V27L	MARCH3_ENST00000502289.1_5'UTR|MARCH3_ENST00000515241.1_Missense_Mutation_p.V27L	NM_178450.3	NP_848545.1	Q86UD3	MARH3_HUMAN	membrane-associated ring finger (C3HC4) 3, E3 ubiquitin protein ligase	27					endocytosis (GO:0006897)|protein ubiquitination (GO:0016567)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.074)|OV - Ovarian serous cystadenocarcinoma(64;0.0793)		CAATCCTCCACCGTCTTCACC	0.572																																					p.V27L		Atlas-SNP	.											.	MARCH3	14	.	0			c.G79C						PASS	.						65.0	59.0	61.0					5																	126253785		2203	4300	6503	SO:0001583	missense	115123	exon2			CCTCCACCGTCTT	AF055007	CCDS4141.1	5q23.2	2013-01-09	2012-02-23		ENSG00000173926	ENSG00000173926		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	28728	protein-coding gene	gene with protein product		613333	"""membrane-associated ring finger (C3HC4) 3"""			14722266, 8619474	Standard	NM_178450		Approved	MGC48332, MARCH-III, RNF173	uc003kuf.4	Q86UD3	OTTHUMG00000128968	ENST00000308660.5:c.79G>C	chr5.hg19:g.126253785C>G	ENSP00000309141:p.Val27Leu	118.0	0.0	.		101.0	42.0	.	NM_178450	A8K264|B9EJE7	Missense_Mutation	SNP	ENST00000308660.5	hg19	CCDS4141.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.166917	0.57476	.	.	ENSG00000173926	ENST00000308660;ENST00000515241	T;T	0.24908	2.14;1.83	4.58	4.58	0.56647	.	0.206119	0.32769	N	0.005671	T	0.18923	0.0454	N	0.25485	0.75	0.48040	D	0.999578	B;B	0.16802	0.019;0.003	B;B	0.15052	0.012;0.006	T	0.03296	-1.1051	10	0.25751	T	0.34	-10.0037	15.0423	0.71799	0.0:0.8565:0.1435:0.0	.	27;27	B9EJE7;Q86UD3	.;MARH3_HUMAN	L	27	ENSP00000309141:V27L;ENSP00000421979:V27L	ENSP00000309141:V27L	V	-	1	0	MARCH3	126281684	1.000000	0.71417	0.980000	0.43619	0.988000	0.76386	5.656000	0.67988	2.833000	0.97629	0.650000	0.86243	GTG	.	.	.	none		0.572	MARCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250955.2	NM_178450	
GRXCR2	643226	hgsc.bcm.edu	37	5	145246288	145246288	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr5:145246288G>T	ENST00000377976.1	-	2	339	c.340C>A	c.(340-342)Cta>Ata	p.L114I		NM_001080516.1	NP_001073985.1	A6NFK2	GRCR2_HUMAN	glutaredoxin, cysteine rich 2	114						cell projection (GO:0042995)				breast(1)|endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(2)	7						ATAATAGGTAGGGGCTAGAGA	0.408																																					p.L114I		Atlas-SNP	.											.	GRXCR2	32	.	0			c.C340A						PASS	.						55.0	58.0	57.0					5																	145246288		2203	4300	6503	SO:0001583	missense	643226	exon2			TAGGTAGGGGCTA		CCDS34263.1	5q32	2014-03-14			ENSG00000204928	ENSG00000204928			33862	protein-coding gene	gene with protein product		615762				24619944	Standard	NM_001080516		Approved	DFNB101	uc003lns.1	A6NFK2	OTTHUMG00000163417	ENST00000377976.1:c.340C>A	chr5.hg19:g.145246288G>T	ENSP00000367214:p.Leu114Ile	74.0	0.0	.		39.0	17.0	.	NM_001080516		Missense_Mutation	SNP	ENST00000377976.1	hg19	CCDS34263.1	.	.	.	.	.	.	.	.	.	.	G	14.25	2.478994	0.44044	.	.	ENSG00000204928	ENST00000377976	T	0.22539	1.95	5.43	4.51	0.55191	.	0.330758	0.33772	N	0.004562	T	0.10594	0.0259	N	0.08118	0	0.22435	N	0.999101	B	0.22909	0.077	B	0.23018	0.043	T	0.12708	-1.0537	10	0.62326	D	0.03	-0.8771	7.9992	0.30286	0.0913:0.1642:0.7445:0.0	.	114	A6NFK2	GRCR2_HUMAN	I	114	ENSP00000367214:L114I	ENSP00000367214:L114I	L	-	1	2	GRXCR2	145226481	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	2.602000	0.46257	2.540000	0.85666	0.462000	0.41574	CTA	.	.	.	none		0.408	GRXCR2-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373289.2		
HMGXB3	22993	hgsc.bcm.edu	37	5	149386162	149386162	+	Silent	SNP	G	G	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr5:149386162G>A	ENST00000502717.1	+	3	728	c.264G>A	c.(262-264)agG>agA	p.R88R	HMGXB3_ENST00000503427.1_Silent_p.R88R	NM_014983.2	NP_055798	Q12766	HMGX3_HUMAN	HMG box domain containing 3	334	Arg-rich.				phosphorylation (GO:0016310)	nucleus (GO:0005634)	DNA binding (GO:0003677)|kinase activity (GO:0016301)			central_nervous_system(1)|endometrium(3)|kidney(3)|skin(2)	9						TGGCCGAGAGGAGTTACTACT	0.458																																					p.R88R		Atlas-SNP	.											.	HMGXB3	31	.	0			c.G264A						PASS	.						97.0	97.0	97.0					5																	149386162		692	1591	2283	SO:0001819	synonymous_variant	22993	exon3			CGAGAGGAGTTAC	D83778	CCDS54935.1	5q33.1	2011-07-01		2009-01-05	ENSG00000113716	ENSG00000113716		"""High mobility group / Non-canonical"""	28982	protein-coding gene	gene with protein product				HMGX3		8724849	Standard	NM_014983		Approved	SMF, KIAA0194	uc003lrk.4	Q12766	OTTHUMG00000163493	ENST00000502717.1:c.264G>A	chr5.hg19:g.149386162G>A		95.0	0.0	.		60.0	31.0	.	NM_014983	G5E9Y4|Q86UG3|Q9UMF4	Silent	SNP	ENST00000502717.1	hg19	CCDS54935.1																																																																																			.	.	.	none		0.458	HMGXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373771.1	XM_001717202	
CDHR2	54825	hgsc.bcm.edu	37	5	176008530	176008530	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr5:176008530G>A	ENST00000510636.1	+	17	2279	c.2005G>A	c.(2005-2007)Gac>Aac	p.D669N	CDHR2_ENST00000261944.5_Missense_Mutation_p.D669N|CDHR2_ENST00000506348.1_Missense_Mutation_p.D669N	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	669	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						GCTTGTGTCTGACTGCGGCGA	0.642																																					p.D669N		Atlas-SNP	.											.	CDHR2	152	.	0			c.G2005A						PASS	.						51.0	53.0	52.0					5																	176008530		2203	4300	6503	SO:0001583	missense	54825	exon17			GTGTCTGACTGCG	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.2005G>A	chr5.hg19:g.176008530G>A	ENSP00000424565:p.Asp669Asn	51.0	0.0	.		40.0	20.0	.	NM_017675	A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	hg19	CCDS34297.1	.	.	.	.	.	.	.	.	.	.	G	19.61	3.860050	0.71834	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.65364	-0.15;-0.15;-0.15	5.47	5.47	0.80525	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.85128	0.5626	M	0.93763	3.455	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88812	0.3292	9	0.87932	D	0	-43.5559	18.9133	0.92494	0.0:0.0:1.0:0.0	.	669	Q9BYE9	CDHR2_HUMAN	N	669	ENSP00000424565:D669N;ENSP00000261944:D669N;ENSP00000421078:D669N	ENSP00000261944:D669N	D	+	1	0	CDHR2	175941136	1.000000	0.71417	0.114000	0.21550	0.152000	0.21847	8.137000	0.89612	2.575000	0.86900	0.549000	0.68633	GAC	.	.	.	none		0.642	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675	
AGPAT1	10554	hgsc.bcm.edu	37	6	32139113	32139113	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr6:32139113G>T	ENST00000395499.1	-	2	740	c.161C>A	c.(160-162)cCt>cAt	p.P54H	AGPAT1_ENST00000395496.1_Missense_Mutation_p.P54H|AGPAT1_ENST00000336984.6_Missense_Mutation_p.P54H|AGPAT1_ENST00000490711.1_5'UTR|AGPAT1_ENST00000395497.1_Missense_Mutation_p.P54H|AGPAT1_ENST00000375107.3_Missense_Mutation_p.P54H|AGPAT1_ENST00000412465.2_De_novo_Start_InFrame|AGPAT1_ENST00000375104.2_Missense_Mutation_p.P54H|PPT2-EGFL8_ENST00000422437.1_3'UTR			Q99943	PLCA_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 1	54					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			central_nervous_system(1)|large_intestine(3)|lung(6)|ovary(2)	12						GGCACACACAGGGATGGCGAG	0.562																																					p.P54H		Atlas-SNP	.											.	AGPAT1	22	.	0			c.C161A						PASS	.						171.0	143.0	153.0					6																	32139113		1511	2708	4219	SO:0001583	missense	10554	exon2			CACACAGGGATGG	U56417	CCDS4744.1	6p21.3	2013-02-05	2013-02-05		ENSG00000204310	ENSG00000204310	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	324	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, alpha"""	603099	"""1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)"""			9461603, 9291118	Standard	NM_032741		Approved	LPAAT-alpha	uc003oae.3	Q99943	OTTHUMG00000031210	ENST00000395499.1:c.161C>A	chr6.hg19:g.32139113G>T	ENSP00000378877:p.Pro54His	139.0	0.0	.		93.0	42.0	.	NM_006411	A2BFI5|Q5BL03	Missense_Mutation	SNP	ENST00000395499.1	hg19	CCDS4744.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.425097	0.83667	.	.	ENSG00000204310	ENST00000395496;ENST00000375107;ENST00000395499;ENST00000375104;ENST00000395497;ENST00000336984	T;T;T;T;T;T	0.70869	-0.52;-0.52;-0.52;-0.52;-0.52;-0.52	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.75428	0.3848	L	0.53249	1.67	0.80722	D	1	D	0.76494	0.999	D	0.64144	0.922	T	0.78542	-0.2164	10	0.72032	D	0.01	-8.6989	16.0303	0.80572	0.0:0.0:1.0:0.0	.	54	Q99943	PLCA_HUMAN	H	54	ENSP00000378874:P54H;ENSP00000364248:P54H;ENSP00000378877:P54H;ENSP00000364245:P54H;ENSP00000378875:P54H;ENSP00000337463:P54H	ENSP00000337463:P54H	P	-	2	0	AGPAT1	32247091	0.990000	0.36364	1.000000	0.80357	0.982000	0.71751	1.946000	0.40283	2.392000	0.81423	0.561000	0.74099	CCT	.	.	.	none		0.562	AGPAT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268941.1	NM_006411	
OOEP	441161	hgsc.bcm.edu	37	6	74078985	74078985	+	Missense_Mutation	SNP	C	C	A	rs199988719		TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr6:74078985C>A	ENST00000370359.5	-	2	313	c.314G>T	c.(313-315)cGg>cTg	p.R105L	OOEP_ENST00000370363.1_Missense_Mutation_p.R50L|OOEP-AS1_ENST00000445350.2_RNA	NM_001080507.2	NP_001073976.1	A6NGQ2	OOEP_HUMAN	oocyte expressed protein	105	KH; atypical.				cellular protein complex assembly (GO:0043623)|embryo implantation (GO:0007566)|embryonic pattern specification (GO:0009880)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|protein phosphorylation (GO:0006468)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|protein complex (GO:0043234)	RNA binding (GO:0003723)			large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	8						GCTCTTCACCCGATTCTGTAC	0.567																																					p.R105L		Atlas-SNP	.											.	OOEP	18	.	0			c.G314T						PASS	.						62.0	61.0	61.0					6																	74078985		1987	4163	6150	SO:0001583	missense	441161	exon2			TTCACCCGATTCT	BC024931	CCDS47451.1	6q13	2012-02-22	2012-02-22	2007-11-13	ENSG00000203907	ENSG00000203907			21382	protein-coding gene	gene with protein product	"""KH homology domain containing 2"""	611689	"""chromosome 6 open reading frame 156"", ""oocyte expressed protein homolog (dog)"""	C6orf156		17913455	Standard	NM_001080507		Approved	Em:AC019205.2, KHDC2	uc003pgu.4	A6NGQ2	OTTHUMG00000150057	ENST00000370359.5:c.314G>T	chr6.hg19:g.74078985C>A	ENSP00000359384:p.Arg105Leu	178.0	0.0	.		124.0	52.0	.	NM_001080507	A6NIN5|A9UIB7	Missense_Mutation	SNP	ENST00000370359.5	hg19	CCDS47451.1	.	.	.	.	.	.	.	.	.	.	C	13.79	2.343145	0.41498	.	.	ENSG00000203907	ENST00000370363;ENST00000370359;ENST00000441145	T;T;T	0.13089	2.62;2.62;2.62	3.93	-2.22	0.06952	.	0.730725	0.11792	N	0.529109	T	0.04861	0.0131	M	0.65498	2.005	0.09310	N	1	P;P	0.47841	0.901;0.872	B;B	0.40782	0.303;0.34	T	0.17930	-1.0353	10	0.54805	T	0.06	-15.2063	4.2812	0.10833	0.1618:0.3562:0.0:0.4819	.	50;105	F2Z364;A6NGQ2	.;OOEP_HUMAN	L	50;105;50	ENSP00000359388:R50L;ENSP00000359384:R105L;ENSP00000397430:R50L	ENSP00000359384:R105L	R	-	2	0	OOEP	74135706	0.152000	0.22762	0.000000	0.03702	0.118000	0.20060	0.038000	0.13862	-0.521000	0.06426	-0.150000	0.13652	CGG	.	.	.	alt		0.567	OOEP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108414.2	NM_001080507	
ROS1	6098	hgsc.bcm.edu	37	6	117686779	117686779	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr6:117686779C>G	ENST00000368508.3	-	19	3136	c.2938G>C	c.(2938-2940)Gtt>Ctt	p.V980L	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Missense_Mutation_p.V975L	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	980	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CTGTAGAAAACTACACCCCAG	0.418			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																p.V980L		Atlas-SNP	.		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	ROS1	728	.	0			c.G2938C						PASS	.						78.0	69.0	72.0					6																	117686779		2203	4300	6503	SO:0001583	missense	6098	exon19			AGAAAACTACACC	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.2938G>C	chr6.hg19:g.117686779C>G	ENSP00000357494:p.Val980Leu	275.0	0.0	.		213.0	101.0	.	NM_002944	Q15368|Q5TDB5	Missense_Mutation	SNP	ENST00000368508.3	hg19	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	C	12.74	2.029959	0.35797	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	T;T	0.51817	0.69;0.69	4.98	1.7	0.24286	.	0.512100	0.17556	N	0.169963	T	0.15176	0.0366	N	0.24115	0.695	0.35341	D	0.786462	B	0.21452	0.056	B	0.18871	0.023	T	0.03545	-1.1026	10	0.72032	D	0.01	.	7.7926	0.29129	0.0:0.4713:0.0:0.5287	.	980	P08922	ROS1_HUMAN	L	980;975	ENSP00000357494:V980L;ENSP00000357493:V975L	ENSP00000357493:V975L	V	-	1	0	ROS1	117793472	0.745000	0.28261	0.167000	0.22817	0.993000	0.82548	1.022000	0.30052	0.123000	0.18342	0.650000	0.86243	GTT	.	.	.	none		0.418	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
MCM9	254394	hgsc.bcm.edu	37	6	119149243	119149243	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr6:119149243A>G	ENST00000316316.6	-	10	1865	c.1579T>C	c.(1579-1581)Tat>Cat	p.Y527H	MCM9_ENST00000505485.1_5'UTR	NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	527					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		AGGCAGAAATAGGTTTTCATC	0.468																																					p.Y527H		Atlas-SNP	.											.	MCM9	73	.	0			c.T1579C						PASS	.																																			SO:0001583	missense	254394	exon9			AGAAATAGGTTTT	BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.1579T>C	chr6.hg19:g.119149243A>G	ENSP00000314505:p.Tyr527His	131.0	0.0	.		86.0	4.0	.	NM_017696	B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Missense_Mutation	SNP	ENST00000316316.6	hg19	CCDS56447.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.670419	0.88348	.	.	ENSG00000111877	ENST00000316316;ENST00000243218	T	0.16897	2.31	5.62	5.62	0.85841	.	907.434000	0.01513	U	0.018019	T	0.55641	0.1933	H	0.96691	3.865	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.49428	-0.8941	10	0.87932	D	0	.	15.8247	0.78690	1.0:0.0:0.0:0.0	.	527	Q9NXL9	MCM9_HUMAN	H	527;146	ENSP00000314505:Y527H	ENSP00000243218:Y146H	Y	-	1	0	MCM9	119255935	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.962000	0.93254	2.151000	0.67156	0.482000	0.46254	TAT	.	.	.	none		0.468	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042005.4	NM_153255	
TXLNB	167838	hgsc.bcm.edu	37	6	139563669	139563669	+	Silent	SNP	G	G	T	rs202149819	byFrequency	TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr6:139563669G>T	ENST00000358430.3	-	10	2281	c.2049C>A	c.(2047-2049)gtC>gtA	p.V683V	RP1-225E12.3_ENST00000585874.1_RNA	NM_153235.3	NP_694967.3	Q8N3L3	TXLNB_HUMAN	taxilin beta	683						cytoplasm (GO:0005737)				breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		AGGCTTAGTCGACGCCTTCCA	0.582																																					p.V683V		Atlas-SNP	.											.	TXLNB	96	.	0			c.C2049A						PASS	.						39.0	45.0	43.0					6																	139563669		2202	4300	6502	SO:0001819	synonymous_variant	167838	exon10			TTAGTCGACGCCT		CCDS34545.1	6q23.3	2008-02-05	2005-07-29	2005-07-29	ENSG00000164440	ENSG00000164440			21617	protein-coding gene	gene with protein product		611438	"""chromosome 6 open reading frame 198"""	C6orf198		15184072	Standard	NM_153235		Approved	DKFZp451A175, MDP77, dJ522B19.2	uc021zfy.1	Q8N3L3	OTTHUMG00000015688	ENST00000358430.3:c.2049C>A	chr6.hg19:g.139563669G>T		126.0	0.0	.		83.0	32.0	.	NM_153235	Q5VTF3|Q76L25|Q86T52|Q8N3S2	Silent	SNP	ENST00000358430.3	hg19	CCDS34545.1																																																																																			.	G|0.999;A|0.001	.	alt		0.582	TXLNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042458.1	NM_153235	
HECW1	23072	hgsc.bcm.edu	37	7	43485157	43485157	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr7:43485157A>G	ENST00000395891.2	+	11	2991	c.2386A>G	c.(2386-2388)Aat>Gat	p.N796D	HECW1_ENST00000453890.1_Missense_Mutation_p.N796D	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	796					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						AGGTCCAAGCAATCGGAGAGA	0.587																																					p.N796D		Atlas-SNP	.											.	HECW1	540	.	0			c.A2386G						PASS	.						8.0	9.0	9.0					7																	43485157		1779	3853	5632	SO:0001583	missense	23072	exon11			CCAAGCAATCGGA	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.2386A>G	chr7.hg19:g.43485157A>G	ENSP00000379228:p.Asn796Asp	233.0	0.0	.		232.0	133.0	.	NM_015052	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	hg19	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	A	0.231	-1.021230	0.02061	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.30981	1.51;1.51	5.33	-4.08	0.03963	.	1.229190	0.05172	N	0.499662	T	0.19087	0.0458	N	0.19112	0.55	0.19300	N	0.999974	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.30475	-0.9977	10	0.17832	T	0.49	.	12.2128	0.54389	0.3522:0.5858:0.062:0.0	.	796;796	B4DH42;Q76N89	.;HECW1_HUMAN	D	796	ENSP00000379228:N796D;ENSP00000407774:N796D	ENSP00000265522:N796D	N	+	1	0	HECW1	43451682	0.001000	0.12720	0.000000	0.03702	0.195000	0.23768	-0.115000	0.10741	-1.064000	0.03172	-1.243000	0.01532	AAT	.	.	.	none		0.587	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
LRRC17	10234	hgsc.bcm.edu	37	7	102584947	102584947	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr7:102584947G>A	ENST00000339431.4	+	4	1514	c.1219G>A	c.(1219-1221)Gca>Aca	p.A407T	FBXL13_ENST00000393772.2_Intron|LRRC17_ENST00000485478.1_3'UTR|FBXL13_ENST00000379308.3_Intron|LRRC17_ENST00000249377.4_3'UTR|FBXL13_ENST00000436908.1_Intron|FBXL13_ENST00000379306.3_Intron|FBXL13_ENST00000379305.3_Intron|FBXL13_ENST00000313221.4_Intron|FBXL13_ENST00000455112.2_Intron|FBXL13_ENST00000456695.1_Intron	NM_001031692.2	NP_001026862.1	Q8N6Y2	LRC17_HUMAN	leucine rich repeat containing 17	407					bone marrow development (GO:0048539)|negative regulation of osteoclast differentiation (GO:0045671)|ossification (GO:0001503)	extracellular space (GO:0005615)				NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	17						CAAGTTACCAGCATATCCTGA	0.378																																					p.A407T		Atlas-SNP	.											.	LRRC17	45	.	0			c.G1219A						PASS	.						88.0	84.0	85.0					7																	102584947		2203	4300	6503	SO:0001583	missense	10234	exon4			TTACCAGCATATC	U32907	CCDS5727.1, CCDS34721.1	7q22.1	2009-05-26			ENSG00000128606	ENSG00000128606			16895	protein-coding gene	gene with protein product						8982252, 19336404	Standard	NM_005824		Approved	P37NB, H_RG318M05.3	uc003vau.3	Q8N6Y2	OTTHUMG00000157210	ENST00000339431.4:c.1219G>A	chr7.hg19:g.102584947G>A	ENSP00000344242:p.Ala407Thr	141.0	0.0	.		118.0	5.0	.	NM_001031692	Q13288|Q6UWA7|Q75MG5	Missense_Mutation	SNP	ENST00000339431.4	hg19	CCDS34721.1	.	.	.	.	.	.	.	.	.	.	G	11.22	1.574748	0.28092	.	.	ENSG00000128606	ENST00000339431	T	0.57752	0.38	5.79	1.59	0.23543	.	0.701797	0.12953	N	0.425685	T	0.36936	0.0985	L	0.44542	1.39	0.09310	N	0.999995	B	0.02656	0.0	B	0.04013	0.001	T	0.23332	-1.0191	10	0.14656	T	0.56	-5.854	4.826	0.13416	0.3778:0.0:0.449:0.1732	.	407	Q8N6Y2	LRC17_HUMAN	T	407	ENSP00000344242:A407T	ENSP00000344242:A407T	A	+	1	0	LRRC17	102372183	0.002000	0.14202	0.715000	0.30552	0.984000	0.73092	0.041000	0.13927	0.380000	0.24823	0.655000	0.94253	GCA	.	.	.	none		0.378	LRRC17-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347930.1	NM_005824	
WASL	8976	hgsc.bcm.edu	37	7	123329152	123329152	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr7:123329152A>G	ENST00000223023.4	-	10	1732	c.1400T>C	c.(1399-1401)aTt>aCt	p.I467T		NM_003941.2	NP_003932.3	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome-like	467					actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cellular protein complex localization (GO:0034629)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane budding (GO:0006900)|mitotic nuclear division (GO:0007067)|nitric oxide metabolic process (GO:0046209)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of filopodium assembly (GO:0051491)|protein complex assembly (GO:0006461)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|response to bacterium (GO:0009617)|small molecule metabolic process (GO:0044281)|spindle localization (GO:0051653)|transcription, DNA-templated (GO:0006351)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	small GTPase regulator activity (GO:0005083)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGCACCCACAATTCCTGAAGT	0.448																																					p.I467T		Atlas-SNP	.											.	WASL	70	.	0			c.T1400C						PASS	.						178.0	183.0	182.0					7																	123329152		2203	4300	6503	SO:0001583	missense	8976	exon10			CCCACAATTCCTG	D88460	CCDS34743.1	7q31.3	2008-02-01			ENSG00000106299	ENSG00000106299			12735	protein-coding gene	gene with protein product		605056				9422512, 9322739	Standard	NM_003941		Approved	N-WASP, NWASP	uc003vkz.3	O00401	OTTHUMG00000157346	ENST00000223023.4:c.1400T>C	chr7.hg19:g.123329152A>G	ENSP00000223023:p.Ile467Thr	81.0	0.0	.		68.0	26.0	.	NM_003941	A1JUI9|Q7Z746	Missense_Mutation	SNP	ENST00000223023.4	hg19	CCDS34743.1	.	.	.	.	.	.	.	.	.	.	A	17.89	3.499369	0.64298	.	.	ENSG00000106299	ENST00000223023	D	0.95949	-3.86	5.29	5.29	0.74685	Wiscott-Aldrich syndrome, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93549	0.7941	L	0.47016	1.485	0.80722	D	1	P	0.41748	0.761	B	0.40982	0.345	D	0.94194	0.7444	10	0.87932	D	0	-15.0061	15.2082	0.73195	1.0:0.0:0.0:0.0	.	467	O00401	WASL_HUMAN	T	467	ENSP00000223023:I467T	ENSP00000223023:I467T	I	-	2	0	WASL	123116388	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.310000	0.96267	1.983000	0.57843	0.477000	0.44152	ATT	.	.	.	none		0.448	WASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348522.1	NM_003941	
SLC13A4	26266	hgsc.bcm.edu	37	7	135412241	135412241	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr7:135412241C>A	ENST00000354042.4	-	1	693	c.4G>T	c.(4-6)Ggc>Tgc	p.G2C	FAM180A_ENST00000435869.1_5'Flank	NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	2					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						TGCAGCAGGCCCATCGCGCCT	0.652																																					p.G2C		Atlas-SNP	.											.	SLC13A4	56	.	0			c.G4T						PASS	.						28.0	26.0	27.0					7																	135412241		1839	3433	5272	SO:0001583	missense	26266	exon1			GCAGGCCCATCGC	AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.4G>T	chr7.hg19:g.135412241C>A	ENSP00000297282:p.Gly2Cys	139.0	0.0	.		152.0	54.0	.	NM_012450	A4D1Q4|Q8N631	Missense_Mutation	SNP	ENST00000354042.4	hg19	CCDS5840.1	.	.	.	.	.	.	.	.	.	.	C	13.88	2.369767	0.42003	.	.	ENSG00000164707	ENST00000354042	T	0.69435	-0.4	5.67	5.67	0.87782	.	0.175722	0.48767	D	0.000168	T	0.64983	0.2648	L	0.38175	1.15	0.37736	D	0.925466	P	0.49635	0.926	P	0.46718	0.525	T	0.70757	-0.4785	10	0.56958	D	0.05	.	17.2665	0.87088	0.0:1.0:0.0:0.0	.	2	Q9UKG4	S13A4_HUMAN	C	2	ENSP00000297282:G2C	ENSP00000297282:G2C	G	-	1	0	SLC13A4	135062781	1.000000	0.71417	0.999000	0.59377	0.231000	0.25187	4.087000	0.57671	2.679000	0.91253	0.655000	0.94253	GGC	.	.	.	none		0.652	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340558.1	NM_012450	
KCNU1	157855	hgsc.bcm.edu	37	8	36788664	36788664	+	Splice_Site	SNP	G	G	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr8:36788664G>A	ENST00000399881.3	+	25	2968		c.e25+1			NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1						multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		AGACGTTAATGTGAGTCTACT	0.448																																					.		Atlas-SNP	.											.	KCNU1	359	.	0			c.2931+1G>A						PASS	.						116.0	110.0	112.0					8																	36788664		1873	4109	5982	SO:0001630	splice_region_variant	157855	exon25			GTTAATGTGAGTC	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.2931+1G>A	chr8.hg19:g.36788664G>A		100.0	0.0	.		60.0	25.0	.	NM_001031836		Splice_Site	SNP	ENST00000399881.3	hg19	CCDS55220.1	.	.	.	.	.	.	.	.	.	.	G	8.145	0.786059	0.16189	.	.	ENSG00000215262	ENST00000399881	.	.	.	5.41	4.54	0.55810	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1602	0.48512	0.0858:0.0:0.9142:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KCNU1	36907822	1.000000	0.71417	0.921000	0.36526	0.007000	0.05969	4.717000	0.61923	1.287000	0.44583	-0.142000	0.14014	.	.	.	.	none		0.448	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836	Intron
FER1L6	654463	hgsc.bcm.edu	37	8	125061887	125061887	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr8:125061887G>A	ENST00000522917.1	+	22	2970	c.2764G>A	c.(2764-2766)Gtt>Att	p.V922I	FER1L6-AS2_ENST00000601180.1_RNA|FER1L6_ENST00000399018.1_Missense_Mutation_p.V922I|FER1L6-AS2_ENST00000520031.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	922						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GGCTGCTCCTGTTGTGAAGCT	0.468																																					p.V922I		Atlas-SNP	.											.	FER1L6	268	.	0			c.G2764A						PASS	.						65.0	73.0	70.0					8																	125061887		1949	4156	6105	SO:0001583	missense	654463	exon22			GCTCCTGTTGTGA	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.2764G>A	chr8.hg19:g.125061887G>A	ENSP00000428280:p.Val922Ile	103.0	0.0	.		64.0	32.0	.	NM_001039112		Missense_Mutation	SNP	ENST00000522917.1	hg19	CCDS43767.1	.	.	.	.	.	.	.	.	.	.	G	6.965	0.547952	0.13312	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	T;T	0.67171	-0.25;-0.25	5.91	4.12	0.48240	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.431030	0.22316	U	0.061665	T	0.55481	0.1923	L	0.47716	1.5	0.44162	D	0.996969	B	0.13145	0.007	B	0.17433	0.018	T	0.44817	-0.9303	10	0.19590	T	0.45	.	8.7432	0.34569	0.2874:0.0:0.7126:0.0	.	922	Q2WGJ9	FR1L6_HUMAN	I	922	ENSP00000428280:V922I;ENSP00000381982:V922I	ENSP00000381982:V922I	V	+	1	0	FER1L6	125131068	0.005000	0.15991	0.750000	0.31169	0.248000	0.25809	1.150000	0.31639	0.835000	0.34877	-0.150000	0.13652	GTT	.	.	.	none		0.468	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
RASEF	158158	hgsc.bcm.edu	37	9	85630731	85630731	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr9:85630731T>C	ENST00000376447.3	-	4	1014	c.754A>G	c.(754-756)Aag>Gag	p.K252E		NM_152573.2	NP_689786.2	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	252					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(4)|liver(1)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						TTTCTTAGCTTTTTAATGGTC	0.423																																					p.K252E		Atlas-SNP	.											.	RASEF	69	.	0			c.A754G						PASS	.						298.0	275.0	283.0					9																	85630731		2203	4300	6503	SO:0001583	missense	158158	exon4			TTAGCTTTTTAAT	AK056176	CCDS6662.1	9q21.33	2014-05-09	2004-06-11	2004-06-16	ENSG00000165105	ENSG00000165105		"""EF-hand domain containing"", ""RAB, member RAS oncogene"""	26464	protein-coding gene	gene with protein product		611344	"""RAB45, member RAS oncogene family"""	RAB45		17448446	Standard	NM_152573		Approved	FLJ31614	uc004amo.2	Q8IZ41	OTTHUMG00000020100	ENST00000376447.3:c.754A>G	chr9.hg19:g.85630731T>C	ENSP00000365630:p.Lys252Glu	56.0	0.0	.		45.0	22.0	.	NM_152573	A6NC29|Q96N04	Missense_Mutation	SNP	ENST00000376447.3	hg19	CCDS6662.1	.	.	.	.	.	.	.	.	.	.	T	16.30	3.085637	0.55861	.	.	ENSG00000165105	ENST00000376447	T	0.68479	-0.33	6.16	6.16	0.99307	.	0.144833	0.64402	N	0.000007	T	0.63129	0.2485	L	0.59436	1.845	0.80722	D	1	P	0.44429	0.835	B	0.35813	0.211	T	0.69621	-0.5096	10	0.87932	D	0	.	16.8061	0.85666	0.0:0.0:0.0:1.0	.	252	Q8IZ41	RASEF_HUMAN	E	252	ENSP00000365630:K252E	ENSP00000365630:K252E	K	-	1	0	RASEF	84820551	1.000000	0.71417	1.000000	0.80357	0.421000	0.31385	6.427000	0.73378	2.367000	0.80283	0.528000	0.53228	AAG	.	.	.	none		0.423	RASEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052825.1	NM_152573	
IMMP1L	196294	hgsc.bcm.edu	37	11	31451825	31451825	+	IGR	SNP	C	C	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr11:31451825C>A	ENST00000278200.1	-	0	795				DNAJC24_ENST00000465995.1_Missense_Mutation_p.H109Q	NM_144981.1	NP_659418.1	Q96LU5	IMP1L_HUMAN	IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)						protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	serine-type peptidase activity (GO:0008236)			breast(1)|cervix(1)|large_intestine(1)|lung(4)	7	Lung SC(675;0.225)					CAGGTGATCACTCTTTTTATC	0.353																																					p.H109Q		Atlas-SNP	.											.	DNAJC24	23	.	0			c.C327A						PASS	.						155.0	145.0	148.0					11																	31451825		1835	4085	5920	SO:0001628	intergenic_variant	120526	exon5			TGATCACTCTTTT		CCDS7874.1	11p13	2014-07-30			ENSG00000148950	ENSG00000148950			26317	protein-coding gene	gene with protein product		612323					Standard	NM_144981		Approved	FLJ25059	uc001msy.1	Q96LU5	OTTHUMG00000166226		chr11.hg19:g.31451825C>A		50.0	0.0	.		48.0	24.0	.	NM_181706	D3DQZ7|Q96SH9	Missense_Mutation	SNP	ENST00000278200.1	hg19	CCDS7874.1	.	.	.	.	.	.	.	.	.	.	C	1.616	-0.522774	0.04141	.	.	ENSG00000170946	ENST00000465995	T	0.28069	1.63	5.12	-10.2	0.00374	Zinc finger, DPH-type (2);	1.167550	0.05911	N	0.631602	T	0.06508	0.0167	N	0.01624	-0.795	0.09310	N	0.999996	B	0.06786	0.001	B	0.04013	0.001	T	0.17077	-1.0381	10	0.12766	T	0.61	.	0.9969	0.01469	0.1957:0.1745:0.2441:0.3857	.	108	Q6P3W2	DJC24_HUMAN	Q	109	ENSP00000417548:H109Q	ENSP00000417548:H109Q	H	+	3	2	DNAJC24	31408401	0.000000	0.05858	0.130000	0.21974	0.410000	0.31052	-1.536000	0.02208	-2.076000	0.00875	-0.259000	0.10710	CAC	.	.	.	none		0.353	IMMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388496.1	NM_144981	
CEP57	9702	hgsc.bcm.edu	37	11	95564230	95564230	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr11:95564230A>G	ENST00000325542.5	+	11	1551	c.1313A>G	c.(1312-1314)aAa>aGa	p.K438R	CEP57_ENST00000325486.5_Missense_Mutation_p.K412R|CEP57_ENST00000541150.1_Missense_Mutation_p.K429R|CEP57_ENST00000537677.1_Missense_Mutation_p.K411R	NM_001243776.1|NM_014679.4	NP_001230705.1|NP_055494.2	Q86XR8	CEP57_HUMAN	centrosomal protein 57kDa	438	Mediates interaction with microtubules. {ECO:0000250}.				fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|protein homooligomerization (GO:0051260)|protein import into nucleus, translocation (GO:0000060)|spermatid development (GO:0007286)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	fibroblast growth factor binding (GO:0017134)|protein homodimerization activity (GO:0042803)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	13		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AAGGAATTAAAAGCTACCAAA	0.363									Mosaic Variegated Aneuploidy Syndrome																												p.K438R		Atlas-SNP	.											.	CEP57	40	.	0			c.A1313G						PASS	.						57.0	58.0	58.0					11																	95564230		2201	4298	6499	SO:0001583	missense	9702	exon11	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	AATTAAAAGCTAC	D42054	CCDS8304.1, CCDS58166.1, CCDS58167.1	11q21	2014-09-17			ENSG00000166037	ENSG00000166037			30794	protein-coding gene	gene with protein product		607951				7788527	Standard	NM_014679		Approved	Translokin, TSP57, KIAA0092	uc001pfp.2	Q86XR8	OTTHUMG00000167740	ENST00000325542.5:c.1313A>G	chr11.hg19:g.95564230A>G	ENSP00000317902:p.Lys438Arg	279.0	0.0	.		212.0	104.0	.	NM_014679	A0PJH1|A8K5D0|B4DDP5|F5H5F7|Q14704|Q5JB46|Q8IXP0|Q9BVF9	Missense_Mutation	SNP	ENST00000325542.5	hg19	CCDS8304.1	.	.	.	.	.	.	.	.	.	.	A	7.425	0.637565	0.14386	.	.	ENSG00000166037	ENST00000537677;ENST00000325542;ENST00000325486;ENST00000541150	T;T;T;T	0.31510	1.49;1.49;1.5;1.49	5.89	-1.61	0.08399	.	0.694506	0.13726	N	0.367032	T	0.16896	0.0406	N	0.12746	0.255	0.09310	N	1	B;B;B	0.12013	0.005;0.0;0.003	B;B;B	0.11329	0.006;0.001;0.004	T	0.26360	-1.0105	10	0.87932	D	0	2.5484	11.7546	0.51868	0.8287:0.0:0.1713:0.0	.	429;412;438	F5H5F7;Q86XR8-2;Q86XR8	.;.;CEP57_HUMAN	R	411;438;412;429	ENSP00000441392:K411R;ENSP00000317902:K438R;ENSP00000317487:K412R;ENSP00000443436:K429R	ENSP00000317487:K412R	K	+	2	0	CEP57	95203878	0.971000	0.33674	0.007000	0.13788	0.813000	0.45954	1.442000	0.35046	-0.125000	0.11703	0.455000	0.32223	AAA	.	.	.	none		0.363	CEP57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395983.1	NM_014679	
DYNC2H1	79659	hgsc.bcm.edu	37	11	103126956	103126956	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr11:103126956T>A	ENST00000375735.2	+	68	10592	c.10448T>A	c.(10447-10449)aTt>aAt	p.I3483N	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.I3490N|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3483					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AAACTCCAAATTTCCCTTGAT	0.299																																					p.I3490N		Atlas-SNP	.											.	DYNC2H1	246	.	0			c.T10469A						PASS	.						42.0	41.0	41.0					11																	103126956		1802	4066	5868	SO:0001583	missense	79659	exon69			TCCAAATTTCCCT	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.10448T>A	chr11.hg19:g.103126956T>A	ENSP00000364887:p.Ile3483Asn	128.0	0.0	.		97.0	50.0	.	NM_001080463	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	hg19	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	T	8.238	0.806220	0.16467	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.48201	0.82;0.82	5.32	2.77	0.32553	.	0.485095	0.23779	N	0.044650	T	0.41743	0.1172	L	0.57536	1.79	0.30134	N	0.804506	B;B	0.10296	0.0;0.003	B;B	0.13407	0.002;0.009	T	0.39078	-0.9631	10	0.18710	T	0.47	.	12.8549	0.57880	0.0:0.0:0.3632:0.6368	.	3483;3490	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	N	3483;3490	ENSP00000364887:I3483N;ENSP00000381167:I3490N	ENSP00000364887:I3483N	I	+	2	0	DYNC2H1	102632166	1.000000	0.71417	0.987000	0.45799	0.945000	0.59286	1.972000	0.40540	0.934000	0.37316	0.454000	0.30748	ATT	.	.	.	none		0.299	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
EXPH5	23086	hgsc.bcm.edu	37	11	108384989	108384989	+	Nonsense_Mutation	SNP	A	A	T			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr11:108384989A>T	ENST00000265843.4	-	6	1355	c.1245T>A	c.(1243-1245)taT>taA	p.Y415*	EXPH5_ENST00000525344.1_Nonsense_Mutation_p.Y408*|EXPH5_ENST00000524840.1_5'UTR|EXPH5_ENST00000428840.1_Nonsense_Mutation_p.Y339*|EXPH5_ENST00000443411.1_Nonsense_Mutation_p.Y227*	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	415					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		GGTACGATTCATATCTCTTAT	0.448																																					p.Y415X		Atlas-SNP	.											.	EXPH5	193	.	0			c.T1245A						PASS	.						148.0	155.0	152.0					11																	108384989		2201	4298	6499	SO:0001587	stop_gained	23086	exon6			CGATTCATATCTC		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.1245T>A	chr11.hg19:g.108384989A>T	ENSP00000265843:p.Tyr415*	126.0	0.0	.		78.0	40.0	.	NM_015065	Q2KHM1|Q9Y4D6	Nonsense_Mutation	SNP	ENST00000265843.4	hg19	CCDS8341.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.134773	0.77662	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000439956;ENST00000526312;ENST00000533052	.	.	.	5.66	3.36	0.38483	.	0.383998	0.22411	N	0.060404	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.4969	6.9989	0.24799	0.6913:0.0:0.3087:0.0	.	.	.	.	X	415;339;227;408;259;339;227	.	ENSP00000265843:Y415X	Y	-	3	2	EXPH5	107890199	0.149000	0.22717	0.645000	0.29479	0.110000	0.19582	0.320000	0.19540	0.439000	0.26476	-0.415000	0.06103	TAT	.	.	.	none		0.448	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065	
TULP3	7289	hgsc.bcm.edu	37	12	3000145	3000145	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr12:3000145G>A	ENST00000448120.2	+	1	83	c.32G>A	c.(31-33)aGc>aAc	p.S11N	TULP3_ENST00000397132.2_Missense_Mutation_p.S11N	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3	11					anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)			endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			CTCAGTCCCAGCGGCGACAGG	0.706																																					p.S11N		Atlas-SNP	.											.	TULP3	45	.	0			c.G32A						PASS	.						22.0	24.0	23.0					12																	3000145		2194	4298	6492	SO:0001583	missense	7289	exon1			GTCCCAGCGGCGA	AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.32G>A	chr12.hg19:g.3000145G>A	ENSP00000410051:p.Ser11Asn	85.0	0.0	.		79.0	43.0	.	NM_003324	B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Missense_Mutation	SNP	ENST00000448120.2	hg19	CCDS8519.1	.	.	.	.	.	.	.	.	.	.	G	12.04	1.817250	0.32145	.	.	ENSG00000078246	ENST00000228245;ENST00000448120;ENST00000397132	D;D	0.92495	-3.0;-3.05	4.31	2.45	0.29901	.	2.190990	0.01553	N	0.019778	D	0.87970	0.6312	L	0.38175	1.15	0.80722	D	1	B;B	0.27732	0.118;0.187	B;B	0.24155	0.017;0.051	T	0.71629	-0.4535	10	0.31617	T	0.26	-25.0169	7.0328	0.24977	0.2121:0.0:0.7879:0.0	.	11;11	O75386;F8WBZ9	TULP3_HUMAN;.	N	11	ENSP00000410051:S11N;ENSP00000380321:S11N	ENSP00000228245:S11N	S	+	2	0	TULP3	2870406	0.904000	0.30761	0.543000	0.28128	0.230000	0.25150	1.285000	0.33261	0.547000	0.28938	0.561000	0.74099	AGC	.	.	.	none		0.706	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398468.1	NM_003324	
DENND5B	160518	hgsc.bcm.edu	37	12	31632918	31632918	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr12:31632918A>G	ENST00000389082.5	-	3	773	c.509T>C	c.(508-510)cTt>cCt	p.L170P	DENND5B_ENST00000354285.4_Missense_Mutation_p.L192P|DENND5B_ENST00000536562.1_Missense_Mutation_p.L205P|DENND5B_ENST00000545147.1_Intron|DENND5B_ENST00000306833.6_Missense_Mutation_p.L205P	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	170					positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						GAGTTTCAAAAGGGAAGTTGT	0.433																																					p.L170P		Atlas-SNP	.											.	DENND5B	114	.	0			c.T509C						PASS	.						158.0	149.0	152.0					12																	31632918		1970	4164	6134	SO:0001583	missense	160518	exon3			TTCAAAAGGGAAG	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.509T>C	chr12.hg19:g.31632918A>G	ENSP00000373734:p.Leu170Pro	104.0	0.0	.		100.0	4.0	.	NM_144973	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Missense_Mutation	SNP	ENST00000389082.5	hg19	CCDS44857.1	.	.	.	.	.	.	.	.	.	.	A	9.787	1.176857	0.21704	.	.	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562;ENST00000354285;ENST00000546299	T;T;T;T;T	0.08807	3.57;3.67;3.67;3.05;3.07	4.65	3.49	0.39957	.	0.357740	0.26582	N	0.023567	T	0.09862	0.0242	L	0.44542	1.39	0.80722	D	1	B;B;B;B;B	0.27192	0.171;0.066;0.171;0.107;0.171	B;B;B;B;B	0.34991	0.193;0.048;0.059;0.065;0.137	T	0.15350	-1.0440	10	0.30078	T	0.28	-26.6622	11.5172	0.50529	0.8497:0.1502:0.0:0.0	.	205;92;192;170;205	Q6ZUT9-2;Q6ZUT9-3;Q6ZUT9-4;Q6ZUT9;G3V1S3	.;.;.;DEN5B_HUMAN;.	P	170;205;205;192;122	ENSP00000373734:L170P;ENSP00000306482:L205P;ENSP00000444889:L205P;ENSP00000346238:L192P;ENSP00000442938:L122P	ENSP00000306482:L205P	L	-	2	0	DENND5B	31524185	1.000000	0.71417	0.730000	0.30809	0.950000	0.60333	6.419000	0.73345	0.795000	0.33922	0.533000	0.62120	CTT	.	.	.	none		0.433	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973	
PTPRB	5787	hgsc.bcm.edu	37	12	71016227	71016227	+	Silent	SNP	A	A	G			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr12:71016227A>G	ENST00000550358.1	-	3	676	c.651T>C	c.(649-651)atT>atC	p.I217I	PTPRB_ENST00000551525.1_Silent_p.I216I|PTPRB_ENST00000334414.6_Silent_p.I217I|PTPRB_ENST00000538174.2_5'UTR			P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	0	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			ATGTGTCTGTAATTCCAGTCA	0.493																																					p.I217I		Atlas-SNP	.											.	PTPRB	676	.	0			c.T651C						PASS	.						164.0	177.0	172.0					12																	71016227		2050	4203	6253	SO:0001819	synonymous_variant	5787	exon3			GTCTGTAATTCCA	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000550358.1:c.651T>C	chr12.hg19:g.71016227A>G		74.0	0.0	.		60.0	27.0	.	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Silent	SNP	ENST00000550358.1	hg19																																																																																				.	.	.	none		0.493	PTPRB-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404436.1		
LHX5	64211	hgsc.bcm.edu	37	12	113909298	113909298	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr12:113909298C>T	ENST00000261731.3	-	1	579	c.6G>A	c.(4-6)atG>atA	p.M2I	LHX5_ENST00000557836.1_5'UTR|RP11-82C23.2_ENST00000551357.2_RNA	NM_022363.2	NP_071758.1	Q9H2C1	LHX5_HUMAN	LIM homeobox 5	2					cell proliferation in forebrain (GO:0021846)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|forebrain neuron differentiation (GO:0021879)|hippocampus development (GO:0021766)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	10						CGCAGTGCACCATCATAGCCC	0.697																																					p.M2I		Atlas-SNP	.											.	LHX5	39	.	0			c.G6A						PASS	.						22.0	19.0	20.0					12																	113909298		2201	4297	6498	SO:0001583	missense	64211	exon1			GTGCACCATCATA	AF291181	CCDS9171.1	12q24.13	2014-01-15			ENSG00000089116	ENSG00000089116		"""Homeoboxes / LIM class"""	14216	protein-coding gene	gene with protein product		605992					Standard	NM_022363		Approved		uc001tvj.1	Q9H2C1	OTTHUMG00000169552	ENST00000261731.3:c.6G>A	chr12.hg19:g.113909298C>T	ENSP00000261731:p.Met2Ile	76.0	0.0	.		79.0	41.0	.	NM_022363	Q32MA4	Missense_Mutation	SNP	ENST00000261731.3	hg19	CCDS9171.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.207726	0.79240	.	.	ENSG00000089116	ENST00000261731	D	0.90676	-2.71	4.04	4.04	0.47022	.	0.000000	0.64402	D	0.000012	D	0.83635	0.5297	L	0.33339	1.005	0.80722	D	1	P	0.41929	0.765	B	0.34180	0.177	T	0.83273	-0.0042	10	0.25106	T	0.35	.	16.3982	0.83630	0.0:1.0:0.0:0.0	.	2	Q9H2C1	LHX5_HUMAN	I	2	ENSP00000261731:M2I	ENSP00000261731:M2I	M	-	3	0	LHX5	112393681	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	4.722000	0.61958	2.084000	0.62774	0.491000	0.48974	ATG	.	.	.	none		0.697	LHX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404788.3	NM_022363	
WDR25	79446	hgsc.bcm.edu	37	14	100847806	100847806	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr14:100847806G>T	ENST00000335290.6	+	2	771	c.545G>T	c.(544-546)aGa>aTa	p.R182I	WDR25_ENST00000402312.3_Missense_Mutation_p.R182I|WDR25_ENST00000542471.2_5'Flank|WDR25_ENST00000554998.1_Missense_Mutation_p.R182I|WDR25_ENST00000554175.1_Missense_Mutation_p.R182I	NM_024515.4	NP_078791.3	Q64LD2	WDR25_HUMAN	WD repeat domain 25	182										central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|skin(1)	20		Melanoma(154;0.212)				AGAAGACTAAGACAGCGGCAG	0.552																																					p.R182I		Atlas-SNP	.											.	WDR25	37	.	0			c.G545T						PASS	.						81.0	90.0	87.0					14																	100847806		2203	4300	6503	SO:0001583	missense	79446	exon2			GACTAAGACAGCG	BC007953	CCDS32157.1	14q32.32	2013-01-09				ENSG00000176473		"""WD repeat domain containing"""	21064	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 67"""	C14orf67		15587985	Standard	NM_001161476		Approved	MGC4645	uc001yhn.3	Q64LD2		ENST00000335290.6:c.545G>T	chr14.hg19:g.100847806G>T	ENSP00000334148:p.Arg182Ile	63.0	0.0	.		33.0	20.0	.	NM_001161476	A8K7E5|Q6NVV6|Q86TQ4|Q9BTK5	Missense_Mutation	SNP	ENST00000335290.6	hg19	CCDS32157.1	.	.	.	.	.	.	.	.	.	.	G	19.98	3.926450	0.73327	.	.	ENSG00000176473	ENST00000554998;ENST00000402312;ENST00000335290;ENST00000554175	T;T;T;T	0.67523	-0.27;-0.27;-0.27;1.59	5.75	5.75	0.90469	.	0.000000	0.56097	D	0.000030	T	0.80352	0.4607	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.81221	-0.1031	10	0.72032	D	0.01	-27.8569	16.8544	0.86002	0.0:0.0:1.0:0.0	.	182	Q64LD2	WDR25_HUMAN	I	182	ENSP00000450661:R182I;ENSP00000385540:R182I;ENSP00000334148:R182I;ENSP00000450727:R182I	ENSP00000334148:R182I	R	+	2	0	WDR25	99917559	0.490000	0.26012	0.008000	0.14137	0.041000	0.13682	5.365000	0.66116	2.711000	0.92665	0.655000	0.94253	AGA	.	.	.	none		0.552	WDR25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414312.1	NM_024515	
DYNC1H1	1778	hgsc.bcm.edu	37	14	102452422	102452422	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr14:102452422C>G	ENST00000360184.4	+	8	2024	c.1860C>G	c.(1858-1860)caC>caG	p.H620Q		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	620	Interaction with DYNC1I2. {ECO:0000250}.|Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						AGTCTCTTCACGACAAGTTCA	0.517																																					p.H620Q		Atlas-SNP	.											.	DYNC1H1	395	.	0			c.C1860G						PASS	.						68.0	57.0	61.0					14																	102452422		2203	4300	6503	SO:0001583	missense	1778	exon8			TCTTCACGACAAG	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.1860C>G	chr14.hg19:g.102452422C>G	ENSP00000348965:p.His620Gln	78.0	0.0	.		80.0	34.0	.	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	hg19	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	C	12.10	1.836491	0.32421	.	.	ENSG00000197102	ENST00000360184	T	0.52754	0.65	5.85	-4.23	0.03789	Dynein heavy chain, domain-1 (1);	0.000000	0.85682	D	0.000000	T	0.41328	0.1154	L	0.38953	1.18	0.58432	D	0.999998	P	0.47604	0.898	P	0.49528	0.614	T	0.39057	-0.9632	10	0.29301	T	0.29	.	15.3766	0.74610	0.0:0.2162:0.0:0.7838	.	620	Q14204	DYHC1_HUMAN	Q	620	ENSP00000348965:H620Q	ENSP00000348965:H620Q	H	+	3	2	DYNC1H1	101522175	0.035000	0.19736	0.804000	0.32291	0.988000	0.76386	-0.917000	0.04025	-0.650000	0.05423	0.655000	0.94253	CAC	.	.	.	none		0.517	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
LOXL1	4016	hgsc.bcm.edu	37	15	74241804	74241804	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr15:74241804A>C	ENST00000261921.7	+	6	1933	c.1607A>C	c.(1606-1608)cAc>cCc	p.H536P	LOXL1_ENST00000567675.1_3'UTR	NM_005576.2	NP_005567.2	Q08397	LOXL1_HUMAN	lysyl oxidase-like 1	536	Lysyl-oxidase like.				extracellular matrix organization (GO:0030198)|oxidation-reduction process (GO:0055114)|protein deamination (GO:0018277)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor (GO:0016641)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10						CCTCAGGTGCACGTGAACCCA	0.498																																					p.H536P		Atlas-SNP	.											.	LOXL1	25	.	0			c.A1607C						PASS	.						187.0	180.0	182.0					15																	74241804		2198	4297	6495	SO:0001583	missense	4016	exon6			AGGTGCACGTGAA	L21186	CCDS10253.1	15q24-q25	2008-07-18			ENSG00000129038	ENSG00000129038			6665	protein-coding gene	gene with protein product		153456				7689553	Standard	NM_005576		Approved	LOXL, LOL	uc002awc.1	Q08397	OTTHUMG00000137595	ENST00000261921.7:c.1607A>C	chr15.hg19:g.74241804A>C	ENSP00000261921:p.His536Pro	94.0	0.0	.		70.0	34.0	.	NM_005576	Q6NUL3|Q96BW7	Missense_Mutation	SNP	ENST00000261921.7	hg19	CCDS10253.1	.	.	.	.	.	.	.	.	.	.	A	11.75	1.732848	0.30684	.	.	ENSG00000129038	ENST00000261921;ENST00000395162	T	0.30182	1.54	5.02	5.02	0.67125	.	0.361157	0.29002	N	0.013455	T	0.18425	0.0442	N	0.14661	0.345	0.31393	N	0.677542	P	0.42584	0.784	B	0.39562	0.303	T	0.12656	-1.0539	10	0.59425	D	0.04	.	9.0722	0.36500	0.8362:0.0:0.0:0.1638	.	536	Q08397	LOXL1_HUMAN	P	536;398	ENSP00000261921:H536P	ENSP00000261921:H536P	H	+	2	0	LOXL1	72028857	0.545000	0.26449	1.000000	0.80357	0.590000	0.36582	3.250000	0.51445	1.880000	0.54463	0.460000	0.39030	CAC	.	.	.	none		0.498	LOXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268995.2	NM_005576	
NUDT21	11051	hgsc.bcm.edu	37	16	56473585	56473585	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr16:56473585T>A	ENST00000300291.5	-	4	627	c.455A>T	c.(454-456)aAt>aTt	p.N152I		NM_007006.2	NP_008937.1	O43809	CPSF5_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 21	152	Necessary for interactions with PAPOLA and PABPN1.|Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein tetramerization (GO:0051262)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	AU-rich element binding (GO:0017091)|histone deacetylase binding (GO:0042826)|hydrolase activity (GO:0016787)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)	7						AGGTTCAAAATTTGGTCTCCA	0.403																																					p.N152I		Atlas-SNP	.											.	NUDT21	12	.	0			c.A455T						PASS	.						185.0	189.0	187.0					16																	56473585		2198	4300	6498	SO:0001583	missense	11051	exon4			TCAAAATTTGGTC	AJ001810	CCDS10760.1	16q12.2	2013-06-18	2005-07-11	2005-07-11	ENSG00000167005	ENSG00000167005		"""Nudix motif containing"""	13870	protein-coding gene	gene with protein product	"""cleavage factor Im complex 25 kDa subunit"""	604978	"""cleavage and polyadenylation specific factor 5, 25 kDa"", ""cleavage and polyadenylation specific factor 5, 25 kD subunit"""	CPSF5		9659921	Standard	NM_007006		Approved	CFIM25	uc002eja.3	O43809	OTTHUMG00000133240	ENST00000300291.5:c.455A>T	chr16.hg19:g.56473585T>A	ENSP00000300291:p.Asn152Ile	119.0	0.0	.		163.0	85.0	.	NM_007006	Q6IB85|Q6NE84	Missense_Mutation	SNP	ENST00000300291.5	hg19	CCDS10760.1	.	.	.	.	.	.	.	.	.	.	T	29.9	5.044654	0.93685	.	.	ENSG00000167005	ENST00000300291	.	.	.	5.78	5.78	0.91487	NUDIX hydrolase domain (1);	0.040554	0.85682	D	0.000000	D	0.85669	0.5750	M	0.92219	3.285	0.80722	D	1	D	0.71674	0.998	D	0.71870	0.975	D	0.89235	0.3580	9	0.87932	D	0	.	16.1205	0.81351	0.0:0.0:0.0:1.0	.	152	O43809	CPSF5_HUMAN	I	152	.	ENSP00000300291:N152I	N	-	2	0	NUDT21	55031086	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.027000	0.88791	2.205000	0.71048	0.533000	0.62120	AAT	.	.	.	none		0.403	NUDT21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256980.3	NM_007006	
FOXL1	2300	hgsc.bcm.edu	37	16	86612503	86612503	+	Silent	SNP	C	C	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr16:86612503C>A	ENST00000320241.3	+	1	389	c.174C>A	c.(172-174)atC>atA	p.I58I		NM_005250.2	NP_005241.1	Q12952	FOXL1_HUMAN	forkhead box L1	58					heart development (GO:0007507)|multicellular organismal development (GO:0007275)|organ morphogenesis (GO:0009887)|Peyer's patch morphogenesis (GO:0061146)|proteoglycan biosynthetic process (GO:0030166)|regulation of Wnt signaling pathway (GO:0030111)|transcription, DNA-templated (GO:0006351)|visceral mesoderm-endoderm interaction involved in midgut development (GO:0007495)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(2)|prostate(3)|skin(1)|urinary_tract(1)	15						TCGCGCTCATCGCCATGGCGA	0.677																																					p.I58I	NSCLC(163;308 2020 10889 11476 18208)	Atlas-SNP	.											.	FOXL1	39	.	0			c.C174A						PASS	.						60.0	61.0	61.0					16																	86612503		2198	4300	6498	SO:0001819	synonymous_variant	2300	exon1			GCTCATCGCCATG	AF315075	CCDS10959.1	16q24	2014-07-15			ENSG00000176678	ENSG00000176678		"""Forkhead boxes"""	3817	protein-coding gene	gene with protein product		603252		FKHL11		7957066	Standard	NM_005250		Approved	FREAC7, FKH6	uc002fjr.3	Q12952	OTTHUMG00000137653	ENST00000320241.3:c.174C>A	chr16.hg19:g.86612503C>A		150.0	0.0	.		189.0	80.0	.	NM_005250	Q17RR1|Q9H242	Silent	SNP	ENST00000320241.3	hg19	CCDS10959.1																																																																																			.	.	.	none		0.677	FOXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269105.2	NM_005250	
SMG6	23293	hgsc.bcm.edu	37	17	2185973	2185973	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr17:2185973C>T	ENST00000263073.6	-	8	2679	c.2629G>A	c.(2629-2631)Gag>Aag	p.E877K	SMG6_ENST00000544865.1_Missense_Mutation_p.E846K	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	877					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						AGCCCATTCTCTTGCTCAGAA	0.542																																					p.E877K	Melanoma(59;28 1088 11621 25887 46638 50814)	Atlas-SNP	.											.	SMG6	97	.	0			c.G2629A						PASS	.						159.0	144.0	149.0					17																	2185973		2203	4300	6503	SO:0001583	missense	23293	exon8			CATTCTCTTGCTC	AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.2629G>A	chr17.hg19:g.2185973C>T	ENSP00000263073:p.Glu877Lys	84.0	0.0	.		99.0	27.0	.	NM_017575	B7Z874|O94837|Q86VH6|Q9UF60	Missense_Mutation	SNP	ENST00000263073.6	hg19	CCDS11016.1	.	.	.	.	.	.	.	.	.	.	C	14.29	2.490176	0.44249	.	.	ENSG00000070366	ENST00000263073;ENST00000544865	T;T	0.27256	1.68;1.68	5.55	5.55	0.83447	.	0.062061	0.64402	D	0.000004	T	0.22475	0.0542	L	0.38175	1.15	0.37547	D	0.918554	P	0.38677	0.642	B	0.37508	0.252	T	0.07849	-1.0751	10	0.36615	T	0.2	-12.2888	14.4148	0.67142	0.1475:0.8525:0.0:0.0	.	877	Q86US8	EST1A_HUMAN	K	877;846	ENSP00000263073:E877K;ENSP00000443920:E846K	ENSP00000263073:E877K	E	-	1	0	SMG6	2132723	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.269000	0.65542	2.615000	0.88500	0.555000	0.69702	GAG	.	.	.	none		0.542	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437826.3		
OR1A1	8383	hgsc.bcm.edu	37	17	3119607	3119607	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr17:3119607G>T	ENST00000304094.1	+	1	693	c.693G>T	c.(691-693)aaG>aaT	p.K231N		NM_014565.2	NP_055380.2	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A, member 1	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	23						CTTCCACCAAGGGCGTGCTCA	0.488																																					p.K231N		Atlas-SNP	.											.	OR1A1	54	.	0			c.G693T						PASS	.						217.0	191.0	199.0					17																	3119607		2203	4300	6503	SO:0001583	missense	8383	exon1			CACCAAGGGCGTG	AF087918	CCDS11022.1	17p13.3	2012-08-09			ENSG00000172146	ENSG00000172146		"""GPCR / Class A : Olfactory receptors"""	8179	protein-coding gene	gene with protein product						10673334	Standard	NM_014565		Approved	OR17-7	uc010vrc.2	Q9P1Q5	OTTHUMG00000090637	ENST00000304094.1:c.693G>T	chr17.hg19:g.3119607G>T	ENSP00000305207:p.Lys231Asn	91.0	0.0	.		94.0	68.0	.	NM_014565	A5D914|Q6IFM1|Q6NTA9|Q96R87	Missense_Mutation	SNP	ENST00000304094.1	hg19	CCDS11022.1	.	.	.	.	.	.	.	.	.	.	G	11.62	1.693103	0.30052	.	.	ENSG00000172146	ENST00000304094	T	0.00145	8.67	4.96	-0.611	0.11601	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000052	T	0.00271	0.0008	M	0.65320	2	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.51276	-0.8726	10	0.46703	T	0.11	.	4.3539	0.11169	0.3002:0.0:0.4654:0.2344	.	231	Q9P1Q5	OR1A1_HUMAN	N	231	ENSP00000305207:K231N	ENSP00000305207:K231N	K	+	3	2	OR1A1	3066357	0.998000	0.40836	0.960000	0.40013	0.312000	0.27988	0.687000	0.25407	0.303000	0.22785	0.436000	0.28706	AAG	.	.	.	none		0.488	OR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207292.1	NM_014565	
ACACA	31	hgsc.bcm.edu	37	17	35549238	35549238	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr17:35549238C>A	ENST00000394406.2	-	37	4288	c.4098G>T	c.(4096-4098)gaG>gaT	p.E1366D	ACACA_ENST00000335166.5_Missense_Mutation_p.E1288D|ACACA_ENST00000353139.5_Missense_Mutation_p.E1403D|ACACA_ENST00000360679.3_Missense_Mutation_p.E1308D	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1366					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	AGATACGATCCTCCTCAAACT	0.403																																					p.E1403D	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	Atlas-SNP	.											.	ACACA	395	.	0			c.G4209T						PASS	.						48.0	44.0	46.0					17																	35549238		2203	4300	6503	SO:0001583	missense	31	exon37			ACGATCCTCCTCA	U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.4098G>T	chr17.hg19:g.35549238C>A	ENSP00000377928:p.Glu1366Asp	56.0	0.0	.		72.0	25.0	.	NM_198834	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	ENST00000394406.2	hg19	CCDS11317.1	.	.	.	.	.	.	.	.	.	.	C	18.68	3.676844	0.67928	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166;ENST00000427330	D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7	5.68	-0.978	0.10279	Acetyl-CoA carboxylase, central domain (1);	0.048932	0.85682	D	0.000000	D	0.90851	0.7126	M	0.91872	3.25	0.80722	D	1	D;D;D;D	0.89917	0.999;0.99;1.0;0.999	D;D;D;D	0.79784	0.98;0.911;0.993;0.982	D	0.90220	0.4271	10	0.87932	D	0	-18.278	10.9907	0.47547	0.0:0.4713:0.0:0.5287	.	114;1403;1366;1308	F8W6G0;Q13085-4;Q13085;Q13085-2	.;.;ACACA_HUMAN;.	D	1403;1308;1366;1390;1288;114	ENSP00000344789:E1403D;ENSP00000353898:E1308D;ENSP00000377928:E1366D;ENSP00000335323:E1288D	ENSP00000335323:E1288D	E	-	3	2	ACACA	32623351	0.976000	0.34144	1.000000	0.80357	0.992000	0.81027	0.180000	0.16860	-0.026000	0.13895	-0.355000	0.07637	GAG	.	.	.	none		0.403	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836	
CACNA1A	773	hgsc.bcm.edu	37	19	13409851	13409851	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr19:13409851C>G	ENST00000360228.5	-	19	2595	c.2596G>C	c.(2596-2598)Gat>Cat	p.D866H	CACNA1A_ENST00000573710.2_Missense_Mutation_p.D867H	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	867					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CGGGCCCGATCGTGGTAGCGG	0.741																																					p.D867H		Atlas-SNP	.											.	CACNA1A	715	.	0			c.G2599C						PASS	.						10.0	13.0	12.0					19																	13409851		1849	4035	5884	SO:0001583	missense	773	exon19			CCCGATCGTGGTA	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.2596G>C	chr19.hg19:g.13409851C>G	ENSP00000353362:p.Asp866His	518.0	0.0	.		297.0	139.0	.	NM_001127221	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	hg19	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	C	5.552	0.286812	0.10513	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.95724	-3.79	3.09	2.04	0.26737	.	3.396480	0.00857	N	0.001886	D	0.95043	0.8395	N	0.14661	0.345	0.21105	N	0.999782	P;P;D	0.76494	0.929;0.946;0.999	B;P;D	0.69654	0.414;0.667;0.965	D	0.87123	0.2192	10	0.46703	T	0.11	.	8.9031	0.35507	0.0:0.8807:0.0:0.1193	.	867;870;866	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	H	866;870;867;867	ENSP00000353362:D866H	ENSP00000317661:D867H	D	-	1	0	CACNA1A	13270851	0.893000	0.30496	0.385000	0.26158	0.002000	0.02628	1.730000	0.38125	0.296000	0.22592	-0.481000	0.04817	GAT	.	.	.	none		0.741	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
ZNF99	7652	hgsc.bcm.edu	37	19	22941279	22941279	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr19:22941279C>G	ENST00000596209.1	-	4	1522	c.1432G>C	c.(1432-1434)Gag>Cag	p.E478Q	ZNF99_ENST00000397104.3_Missense_Mutation_p.E387Q	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	478					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E387Q(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TAGGGTTTCTCTCCAGTATGA	0.353																																					p.E478Q		Atlas-SNP	.											ZNF99,NS,carcinoma,0,1	ZNF99	273	.	1	Substitution - Missense(1)	prostate(1)	c.G1432C						PASS	.																																			SO:0001583	missense	7652	exon4			GTTTCTCTCCAGT	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1432G>C	chr19.hg19:g.22941279C>G	ENSP00000472969:p.Glu478Gln	57.0	0.0	.		29.0	3.0	.	NM_001080409	M0R335	Missense_Mutation	SNP	ENST00000596209.1	hg19	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	N	15.37	2.812264	0.50527	.	.	ENSG00000213973	ENST00000397104	T	0.25912	1.77	1.28	1.28	0.21552	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38188	0.1031	L	0.55834	1.745	0.37534	D	0.918031	D	0.65815	0.995	P	0.61328	0.887	T	0.41980	-0.9478	9	0.72032	D	0.01	.	9.4929	0.38971	0.0:1.0:0.0:0.0	.	387	A8MXY4	ZNF99_HUMAN	Q	387	ENSP00000380293:E387Q	ENSP00000380293:E387Q	E	-	1	0	ZNF99	22733119	0.013000	0.17824	0.386000	0.26170	0.619000	0.37552	0.270000	0.18607	0.675000	0.31264	0.395000	0.25975	GAG	.	.	.	none		0.353	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
FBL	2091	hgsc.bcm.edu	37	19	40328472	40328472	+	Silent	SNP	G	G	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr19:40328472G>A	ENST00000221801.3	-	6	674	c.561C>T	c.(559-561)gtC>gtT	p.V187V	FBL_ENST00000593503.1_5'UTR	NM_001436.3	NP_001427.2	P22087	FBRL_HUMAN	fibrillarin	187					histone glutamine methylation (GO:1990258)|osteoblast differentiation (GO:0001649)|rRNA processing (GO:0006364)|snoRNA metabolic process (GO:0016074)|tRNA processing (GO:0008033)	box C/D snoRNP complex (GO:0031428)|Cajal body (GO:0015030)|extracellular vesicular exosome (GO:0070062)|granular component (GO:0001652)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone-glutamine methyltransferase activity (GO:1990259)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)	9	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)	Renal(1328;0.000518)|Hepatocellular(1079;0.0893)	Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)	GBM - Glioblastoma multiforme(1328;0.000826)|STAD - Stomach adenocarcinoma(1328;0.138)		CGACTGCATAGACTAGACCAT	0.458																																					p.V187V		Atlas-SNP	.											.	FBL	37	.	0			c.C561T						PASS	.						92.0	74.0	80.0					19																	40328472		2203	4300	6503	SO:0001819	synonymous_variant	2091	exon6			TGCATAGACTAGA	AC005393	CCDS12545.1	19q13.1	2010-02-17			ENSG00000105202	ENSG00000105202			3599	protein-coding gene	gene with protein product		134795				1846968, 2026646	Standard	NM_001436		Approved	RNU3IP1, FLRN, FIB	uc002omn.3	P22087		ENST00000221801.3:c.561C>T	chr19.hg19:g.40328472G>A		114.0	0.0	.		90.0	41.0	.	NM_001436	B5BUE8|O75259|Q6IAT5|Q9UPI6	Silent	SNP	ENST00000221801.3	hg19	CCDS12545.1																																																																																			.	.	.	none		0.458	FBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462509.4	NM_001436	
CNOT3	4849	hgsc.bcm.edu	37	19	54647753	54647753	+	Silent	SNP	G	G	C			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr19:54647753G>C	ENST00000406403.1	+	5	1873	c.270G>C	c.(268-270)cgG>cgC	p.R90R	CNOT3_ENST00000221232.5_Silent_p.R90R|CNOT3_ENST00000358389.3_5'UTR			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	90					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					AAATGGAACGGTTCAAAGTTG	0.557																																					p.R90R		Atlas-SNP	.											.	CNOT3	133	.	0			c.G270C						PASS	.						84.0	85.0	85.0					19																	54647753		2203	4300	6503	SO:0001819	synonymous_variant	4849	exon6			GGAACGGTTCAAA	AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.270G>C	chr19.hg19:g.54647753G>C		169.0	0.0	.		125.0	56.0	.	NM_014516	Q9NZN7|Q9UF76	Silent	SNP	ENST00000406403.1	hg19	CCDS12880.1	.	.	.	.	.	.	.	.	.	.	G	8.775	0.926919	0.18056	.	.	ENSG00000088038	ENST00000440571	.	.	.	5.28	3.09	0.35607	.	.	.	.	.	T	0.59797	0.2220	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57376	-0.7822	4	.	.	.	-32.5338	10.2659	0.43455	0.0767:0.0:0.7851:0.1382	.	.	.	.	A	11	.	.	G	+	2	0	CNOT3	59339565	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.712000	0.25779	1.349000	0.45751	-0.182000	0.12963	GGT	.	.	.	none		0.557	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142130.3	NM_014516	
ZNF335	63925	hgsc.bcm.edu	37	20	44581108	44581108	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr20:44581108C>A	ENST00000322927.2	-	20	2967	c.2867G>T	c.(2866-2868)gGt>gTt	p.G956V	ZNF335_ENST00000426788.1_Missense_Mutation_p.G801V	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	956					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				CCATTTGGCACCAGAGGCCAG	0.627																																					p.G956V		Atlas-SNP	.											.	ZNF335	115	.	0			c.G2867T						PASS	.						50.0	55.0	53.0					20																	44581108		2203	4300	6503	SO:0001583	missense	63925	exon20			TTGGCACCAGAGG	AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.2867G>T	chr20.hg19:g.44581108C>A	ENSP00000325326:p.Gly956Val	86.0	0.0	.		84.0	57.0	.	NM_022095	B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	ENST00000322927.2	hg19	CCDS13389.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.145579	0.57044	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	T;T	0.09255	3.14;3.0	4.7	3.74	0.42951	.	0.181866	0.38663	N	0.001613	T	0.18800	0.0451	N	0.24115	0.695	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.01988	-1.1234	10	0.52906	T	0.07	-8.9973	12.4133	0.55480	0.0:0.831:0.169:0.0	.	801;956	Q9H4Z2-2;Q9H4Z2	.;ZN335_HUMAN	V	956;733;801	ENSP00000325326:G956V;ENSP00000397098:G801V	ENSP00000243961:G733V	G	-	2	0	ZNF335	44014515	0.009000	0.17119	0.998000	0.56505	0.975000	0.68041	1.170000	0.31883	1.164000	0.42652	0.561000	0.74099	GGT	.	.	.	none		0.627	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
ITSN1	6453	hgsc.bcm.edu	37	21	35208937	35208937	+	Splice_Site	SNP	G	G	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr21:35208937G>A	ENST00000381318.3	+	29	3949		c.e29+1		AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000381285.4_Splice_Site|ITSN1_ENST00000399326.3_Splice_Site|ITSN1_ENST00000399352.1_Splice_Site|ITSN1_ENST00000399353.1_Splice_Site|ITSN1_ENST00000399349.1_Splice_Site|ITSN1_ENST00000399367.3_Splice_Site|ITSN1_ENST00000437442.2_Splice_Site|ITSN1_ENST00000379960.5_Splice_Site|ITSN1_ENST00000381291.4_Splice_Site|ITSN1_ENST00000399355.2_Splice_Site	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)						apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						AGCCAGCAATGTAAGTGCCCT	0.507																																					.		Atlas-SNP	.											.	ITSN1	166	.	0			c.3661+1G>A						PASS	.						90.0	81.0	84.0					21																	35208937		2203	4300	6503	SO:0001630	splice_region_variant	6453	exon29			AGCAATGTAAGTG	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.3661+1G>A	chr21.hg19:g.35208937G>A		201.0	0.0	.		144.0	55.0	.	NM_003024	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Splice_Site	SNP	ENST00000381318.3	hg19	CCDS33545.1	.	.	.	.	.	.	.	.	.	.	G	17.71	3.456766	0.63401	.	.	ENSG00000205726	ENST00000381318;ENST00000381285;ENST00000381288;ENST00000399367;ENST00000437442	.	.	.	4.51	4.51	0.55191	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2445	0.87023	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ITSN1	34130807	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.278000	0.95766	2.059000	0.61396	0.637000	0.83480	.	.	.	.	none		0.507	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024	Intron
CCT8L2	150160	hgsc.bcm.edu	37	22	17073027	17073027	+	Silent	SNP	C	C	T			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr22:17073027C>T	ENST00000359963.3	-	1	673	c.414G>A	c.(412-414)acG>acA	p.T138T		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	138					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CTGCAGTGGCCGTGGCGTAGG	0.637																																					p.T138T		Atlas-SNP	.											CCT8L2,NS,adenocarcinoma,0,2	CCT8L2	150	.	0			c.G414A						PASS	.						46.0	43.0	44.0					22																	17073027		2203	4300	6503	SO:0001819	synonymous_variant	150160	exon1			AGTGGCCGTGGCG	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.414G>A	chr22.hg19:g.17073027C>T		86.0	1.0	.		58.0	5.0	.	NM_014406	A4QPH3|Q9UJS3	Silent	SNP	ENST00000359963.3	hg19	CCDS13738.1																																																																																			.	.	.	none		0.637	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1		
FOXO4	4303	hgsc.bcm.edu	37	X	70316598	70316598	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chrX:70316598C>A	ENST00000374259.3	+	1	552	c.220C>A	c.(220-222)Cca>Aca	p.P74T	FOXO4_ENST00000341558.3_Intron|FOXO4_ENST00000466874.1_Intron	NM_001170931.1|NM_005938.3	NP_001164402.1|NP_005929.2	P98177	FOXO4_HUMAN	forkhead box O4	74				P -> S (in Ref. 2; CAA63819). {ECO:0000305}.	cell cycle arrest (GO:0007050)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mitotic G2 DNA damage checkpoint (GO:0007095)|muscle organ development (GO:0007517)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of smooth muscle cell differentiation (GO:0051151)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)	18	Renal(35;0.156)					CTCTCGGCTCCCAGAGCCGGC	0.677																																					p.P74T		Atlas-SNP	.											.	FOXO4	60	.	0			c.C220A						PASS	.						9.0	10.0	10.0					X																	70316598		1789	4009	5798	SO:0001583	missense	4303	exon1			CGGCTCCCAGAGC		CCDS43969.1, CCDS55440.1	Xq13.1	2008-02-05	2007-05-02	2007-05-02	ENSG00000184481	ENSG00000184481		"""Forkhead boxes"""	7139	protein-coding gene	gene with protein product		300033	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 7"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7"""	MLLT7		7529552	Standard	NM_005938		Approved	AFX1	uc004dys.2	P98177	OTTHUMG00000021789	ENST00000374259.3:c.220C>A	chrX.hg19:g.70316598C>A	ENSP00000363377:p.Pro74Thr	183.0	0.0	.		117.0	114.0	.	NM_005938	B7WPJ7|O43821|Q13720|Q3KPF1|Q8TDK9	Missense_Mutation	SNP	ENST00000374259.3	hg19	CCDS43969.1	.	.	.	.	.	.	.	.	.	.	C	6.735	0.504472	0.12822	.	.	ENSG00000184481	ENST00000374259	D	0.94862	-3.54	4.83	4.83	0.62350	.	0.677789	0.13613	N	0.374986	D	0.90469	0.7015	L	0.43152	1.355	0.80722	D	1	P;P	0.39809	0.689;0.509	B;B	0.34590	0.186;0.04	D	0.87734	0.2581	10	0.15499	T	0.54	-3.4079	14.6543	0.68823	0.0:1.0:0.0:0.0	.	74;74	B4DTB6;P98177	.;FOXO4_HUMAN	T	74	ENSP00000363377:P74T	ENSP00000363377:P74T	P	+	1	0	FOXO4	70233323	0.976000	0.34144	1.000000	0.80357	0.137000	0.21094	2.530000	0.45641	2.130000	0.65690	0.594000	0.82650	CCA	.	.	.	none		0.677	FOXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057115.1	NM_005938	
MT-CO1	4512	hgsc.bcm.edu	37	M	6982	6982	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chrM:6982A>G	ENST00000361624.2	+	1	1079	c.1079A>G	c.(1078-1080)aAc>aGc	p.N360S	MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-CO2_ENST00000361739.1_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	360					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TGTATTAGCAAACTCATCACT	0.453																																					p.N360S		Atlas-SNP	.											.	.	.	.	0			c.A1079G						PASS	.																																			SO:0001583	missense	5742	exon1			TAGCAAACTCATC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1079A>G	chrM.hg19:g.6982A>G	ENSP00000354499:p.Asn360Ser	21.0	0.0	.		6.0	6.0	.	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.	.	none		0.453	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
MT-ND4	4538	hgsc.bcm.edu	37	M	11109	11109	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chrM:11109T>C	ENST00000361381.2	+	1	350	c.350T>C	c.(349-351)aTa>aCa	p.I117T	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	117					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						AGAACTAATCATATTTTATAT	0.423																																					p.M117T		Atlas-SNP	.											.	.	.	.	0			c.T350C						PASS	.																																			SO:0001583	missense	0	exon1			TAATCATATTTTA			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.350T>C	chrM.hg19:g.11109T>C	ENSP00000354961:p.Ile117Thr	26.0	0.0	.		7.0	5.0	.	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	hg19																																																																																				.	.	.	none		0.423	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
VWF	7450	hgsc.bcm.edu	37	12	6061618	6061618	+	Frame_Shift_Del	DEL	A	A	-			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr12:6061618delA	ENST00000261405.5	-	49	8308	c.8054delT	c.(8053-8055)ttcfs	p.F2685fs		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2685					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CTTCTCCCAGAAGTACTCTCC	0.502																																					p.F2685fs		Atlas-Indel,Pindel	.											.	VWF	338	.	0			c.8055delC						PASS	.						148.0	126.0	134.0					12																	6061618		2203	4300	6503	SO:0001589	frameshift_variant	7450	exon49			.		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.8054delT	chr12.hg19:g.6061618delA	ENSP00000261405:p.Phe2685fs	115.0	0.0	0		77.0	32.0	0.415584	NM_000552	Q8TCE8|Q99806	Frame_Shift_Del	DEL	ENST00000261405.5	hg19	CCDS8539.1																																																																																			.	.	.	none		0.502	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
C11orf24	53838	hgsc.bcm.edu	37	11	68031211	68031211	+	Frame_Shift_Del	DEL	A	A	-			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr11:68031211delA	ENST00000304271.6	-	3	427	c.25delT	c.(25-27)tggfs	p.W9fs	C11orf24_ENST00000530166.1_Intron|C11orf24_ENST00000533310.1_Frame_Shift_Del_p.W9fs	NM_022338.3	NP_071733.1	Q96F05	CK024_HUMAN	chromosome 11 open reading frame 24	9						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)	13						GAGAAAATCCAAATGAGCACA	0.572																																					p.W9X	NSCLC(21;855 905 4198 36694)	Atlas-Indel,Pindel	.											C11orf24,NS,carcinoma,0,1	C11orf24	35	.	0			c.26delG						PASS	.						67.0	61.0	63.0					11																	68031211		2200	4294	6494	SO:0001589	frameshift_variant	53838	exon3			.	AF264781	CCDS8180.1, CCDS73338.1	11q13.2	2014-01-08			ENSG00000171067	ENSG00000171067			1174	protein-coding gene	gene with protein product		610880				11401438, 24312644	Standard	NM_022338		Approved	DM4E3	uc001onr.4	Q96F05	OTTHUMG00000167478	ENST00000304271.6:c.25delT	chr11.hg19:g.68031211delA	ENSP00000307264:p.Trp9fs	55.0	0.0	0		46.0	21.0	0.456522	NM_022338	Q9H2K4	Frame_Shift_Del	DEL	ENST00000304271.6	hg19	CCDS8180.1																																																																																			.	.	.	none		0.572	C11orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394750.1	NM_022338	
LGR4	55366	hgsc.bcm.edu	37	11	27413998	27413999	+	Frame_Shift_Ins	INS	-	-	T			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr11:27413998_27413999insT	ENST00000379214.4	-	3	767_768	c.324_325insA	c.(322-327)aaagttfs	p.V109fs	LGR4_ENST00000389858.4_Frame_Shift_Ins_p.V85fs|LGR4_ENST00000480977.2_Intron	NM_018490.2	NP_060960.2	Q9BXB1	LGR4_HUMAN	leucine-rich repeat containing G protein-coupled receptor 4	109					bone mineralization (GO:0030282)|bone remodeling (GO:0046849)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cell differentiation involved in metanephros development (GO:0072202)|epithelial cell proliferation (GO:0050673)|innate immune response (GO:0045087)|male genitalia development (GO:0030539)|metanephric glomerulus development (GO:0072224)|metanephric nephron tubule morphogenesis (GO:0072282)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(10)|ovary(1)	32						ACTTACAGAACTTTGAGTTCTT	0.376																																					p.V109fs		Atlas-Indel,Pindel	.											.	LGR4	87	.	0			c.325_326insA						PASS	.																																			SO:0001589	frameshift_variant	55366	exon3			.	AF257182	CCDS31449.1	11p14-p13	2012-08-21	2011-01-25	2004-11-12	ENSG00000205213	ENSG00000205213		"""GPCR / Class A : Orphans"""	13299	protein-coding gene	gene with protein product		606666	"""G protein-coupled receptor 48"", ""leucine-rich repeat-containing G protein-coupled receptor 4"""	GPR48		10894923	Standard	NM_018490		Approved		uc001mrj.4	Q9BXB1	OTTHUMG00000133508	ENST00000379214.4:c.325dupA	chr11.hg19:g.27414001_27414001dupT	ENSP00000368516:p.Val109fs	255.0	0.0	0		188.0	91.0	0.484043	NM_018490	A6NCH3|G5E9B3|Q8N537|Q9NYD1	Frame_Shift_Ins	INS	ENST00000379214.4	hg19	CCDS31449.1																																																																																			.	.	.	none		0.376	LGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257467.1	NM_018490	
KCNN1	3780	hgsc.bcm.edu	37	19	18096236	18096240	+	Frame_Shift_Del	DEL	GGTGT	GGTGT	-			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	GGTGT	GGTGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr19:18096236_18096240delGGTGT	ENST00000222249.9	+	6	1352_1356	c.1033_1037delGGTGT	c.(1033-1038)ggtgtgfs	p.GV345fs		NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	345					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	CTGCGGGAAGGGTGTGTGCCTGCTC	0.6																																					p.344_346del		Atlas-Indel,Pindel	.											.	KCNN1	74	.	0			c.1032_1036del						PASS	.																																			SO:0001589	frameshift_variant	3780	exon6			.	U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.1033_1037delGGTGT	chr19.hg19:g.18096236_18096240delGGTGT	ENSP00000476519:p.Gly345fs	67.0	0.0	0		34.0	15.0	0.441176	NM_002248	Q5KR10|Q6DJU4	Frame_Shift_Del	DEL	ENST00000222249.9	hg19																																																																																				.	.	.	none		0.600	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471896.2	NM_002248	
ZNF792	126375	hgsc.bcm.edu	37	19	35450319	35450319	+	Frame_Shift_Del	DEL	A	A	-			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr19:35450319delA	ENST00000404801.1	-	4	826	c.440delT	c.(439-441)ttgfs	p.L147fs	ZNF792_ENST00000605484.1_Frame_Shift_Del_p.L80fs	NM_175872.4	NP_787068.3	Q3KQV3	ZN792_HUMAN	zinc finger protein 792	147					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)	12	all_lung(56;4.18e-08)|Lung NSC(56;6.62e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			GTGTTCAGCCAAATGCAAAAT	0.522																																					p.L147fs	GBM(1;7 183 21053 22581 22847)	Atlas-Indel,Pindel	.											.	ZNF792	46	.	0			c.441delG						PASS	.						196.0	188.0	191.0					19																	35450319		2203	4300	6503	SO:0001589	frameshift_variant	126375	exon4			.	AK095770	CCDS12440.2	19q13.11	2013-01-08			ENSG00000180884	ENSG00000180884		"""Zinc fingers, C2H2-type"", ""-"""	24751	protein-coding gene	gene with protein product						8889548	Standard	NM_175872		Approved	FLJ38451	uc002nxh.1	Q3KQV3	OTTHUMG00000150339	ENST00000404801.1:c.440delT	chr19.hg19:g.35450319delA	ENSP00000385099:p.Leu147fs	138.0	0.0	0		88.0	45.0	0.511364	NM_175872	B4E333|Q495L1|Q495L3|Q8N932	Frame_Shift_Del	DEL	ENST00000404801.1	hg19	CCDS12440.2																																																																																			.	.	.	none		0.522	ZNF792-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317673.1	NM_175872	
AGAP4	119016	hgsc.bcm.edu	37	10	51363332	51363333	+	Intron	INS	-	-	A			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr10:51363332_51363333insA	ENST00000602930.1	-	1	468				RP11-592B15.3_ENST00000432221.2_RNA	NM_001276343.1	NP_001263272.1	Q5SRD3	AGAP8_HUMAN							regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|lung(2)|ovary(2)	6						ACAACTTGCACAGTCTTCCCCA	0.47																																					p.C247fs		Atlas-INDEL	.											.	PARG	46	.	0			c.740_741insT						PASS	.																																			SO:0001627	intron_variant	8505	exon3			.																												ENST00000602930.1:c.81+7520->T	chr10.hg19:g.51363333_51363333dupA		328.0	0.0	0		189.0	29.0	0.153439	NM_003631		Frame_Shift_Ins	INS	ENST00000602930.1	hg19																																																																																				.	.	.	none		0.470	AGAP8-006	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000467541.1		
BPTF	2186	hgsc.bcm.edu	37	17	65919081	65919082	+	Frame_Shift_Ins	INS	-	-	G			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr17:65919081_65919082insG	ENST00000321892.4	+	16	6122_6123	c.6061_6062insG	c.(6061-6063)tggfs	p.W2021fs	BPTF_ENST00000424123.3_Frame_Shift_Ins_p.W1882fs|BPTF_ENST00000306378.6_Frame_Shift_Ins_p.W1895fs|BPTF_ENST00000335221.5_Frame_Shift_Ins_p.W2021fs			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2021					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			ACTGGAATTGTGGGAGATCAGG	0.411																																					p.W2021fs		Atlas-Indel,Pindel	.											.	BPTF	415	.	0			c.6061_6062insG						PASS	.																																			SO:0001589	frameshift_variant	2186	exon16			.	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.6064dupG	chr17.hg19:g.65919084_65919084dupG	ENSP00000315454:p.Trp2021fs	130.0	0.0	0		114.0	72.0	0.631579	NM_004459	Q6NX67|Q7Z7D6|Q9UIG2	Frame_Shift_Ins	INS	ENST00000321892.4	hg19																																																																																				.	.	.	none		0.411	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
ZPLD1	131368	hgsc.bcm.edu	37	3	102187928	102187929	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr3:102187928_102187929delGC	ENST00000491959.1	+	15	1764_1765	c.882_883delGC	c.(880-885)ttgcacfs	p.H295fs	ZPLD1_ENST00000306176.1_Frame_Shift_Del_p.H311fs|ZPLD1_ENST00000466937.1_Frame_Shift_Del_p.H295fs			Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	295	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(18)|ovary(2)|skin(3)	35						CTGTCTTCTTGCACTGCGTTAC	0.45																																					p.310_310del		Atlas-Indel,Pindel	.											.	ZPLD1	82	.	0			c.929_930del						PASS	.																																			SO:0001589	frameshift_variant	131368	exon8			.	AY090780	CCDS2947.1	3q12.3	2009-03-25			ENSG00000170044	ENSG00000170044			27022	protein-coding gene	gene with protein product		615915				18632209	Standard	NM_175056		Approved		uc003dvt.1	Q8TCW7	OTTHUMG00000159229	ENST00000491959.1:c.882_883delGC	chr3.hg19:g.102187928_102187929delGC	ENSP00000420265:p.His295fs	74.0	0.0	0		71.0	44.0	0.619718	NM_175056	Q49AS1|Q8WU36	Frame_Shift_Del	DEL	ENST00000491959.1	hg19																																																																																				.	.	.	none		0.450	ZPLD1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353984.1	NM_175056	
CAMKK1	84254	hgsc.bcm.edu	37	17	3786457	3786457	+	Frame_Shift_Del	DEL	G	G	-			TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr17:3786457delG	ENST00000348335.2	-	6	675	c.527delC	c.(526-528)ccgfs	p.P176fs	CAMKK1_ENST00000158166.5_Frame_Shift_Del_p.P176fs|CAMKK1_ENST00000381771.2_Frame_Shift_Del_p.P176fs|CAMKK1_ENST00000381769.2_Frame_Shift_Del_p.P203fs	NM_032294.2	NP_115670.1	Q8N5S9	KKCC1_HUMAN	calcium/calmodulin-dependent protein kinase kinase 1, alpha	176	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|RP domain.				synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	11				LUAD - Lung adenocarcinoma(2;2.11e-05)|Lung(3;0.0176)		GGACCCTCTCGGGGGAGGGCG	0.627																																					p.P176fs		Atlas-Indel,Pindel	.											.	CAMKK1	70	.	0			c.528delG						PASS	.						60.0	59.0	59.0					17																	3786457		2203	4300	6503	SO:0001589	frameshift_variant	84254	exon6			.	AL136576	CCDS11038.1, CCDS11039.1	17p13.3	2004-02-18			ENSG00000004660	ENSG00000004660			1469	protein-coding gene	gene with protein product		611411				11230166	Standard	NM_172207		Approved	DKFZp761M0423, CAMKKA, MGC34095	uc002fwt.3	Q8N5S9	OTTHUMG00000090725	ENST00000348335.2:c.527delC	chr17.hg19:g.3786457delG	ENSP00000323118:p.Pro176fs	30.0	0.0	0		29.0	21.0	0.724138	NM_172207	Q9BQH3	Frame_Shift_Del	DEL	ENST00000348335.2	hg19	CCDS11038.1																																																																																			.	.	.	none		0.627	CAMKK1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207456.1	NM_032294, NM_172206, NM_172207	
ZNF639	51193	hgsc.bcm.edu	37	3	179051889	179051926	+	Frame_Shift_Del	DEL	TGGTTTTCGGAGTAGACTTCACACAAATGTTAACAGGC	TGGTTTTCGGAGTAGACTTCACACAAATGTTAACAGGC	-	rs61741048	byFrequency	TCGA-UZ-A9PV-01A-11D-A42J-10	TCGA-UZ-A9PV-10A-01D-A42M-10	TGGTTTTCGGAGTAGACTTCACACAAATGTTAACAGGC	TGGTTTTCGGAGTAGACTTCACACAAATGTTAACAGGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b0d2ed48-20a7-461b-a05b-356f5c192282	4c8c47c9-9ba8-4f00-a029-5d6e48a25489	g.chr3:179051889_179051926delTGGTTTTCGGAGTAGACTTCACACAAATGTTAACAGGC	ENST00000326361.3	+	7	1582_1619	c.1137_1174delTGGTTTTCGGAGTAGACTTCACACAAATGTTAACAGGC	c.(1135-1176)tgtggttttcggagtagacttcacacaaatgttaacaggcatfs	p.CGFRSRLHTNVNRH379fs	ZNF639_ENST00000484866.1_Frame_Shift_Del_p.CGFRSRLHTNVNRH379fs|ZNF639_ENST00000496856.1_Frame_Shift_Del_p.CGFRSRLHTNVNRH379fs	NM_016331.1	NP_057415.1	Q9UID6	ZN639_HUMAN	zinc finger protein 639	379	Interaction with CTNNA2.				negative regulation by host of viral transcription (GO:0043922)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|transcription, DNA-templated (GO:0006351)|viral entry into host cell (GO:0046718)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein self-association (GO:0043621)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(10)|urinary_tract(1)	16	all_cancers(143;7.9e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			GTCAAGTATGTGGTTTTCGGAGTAGACTTCACACAAATGTTAACAGGCATGTTGCTAT	0.332																																					p.379_391del		Pindel	.											.	ZNF639	45	.	0			c.1136_1173del						PASS	.																																			SO:0001589	frameshift_variant	51193	exon7			.	BC020500	CCDS3227.1	3q27.1	2010-03-26			ENSG00000121864	ENSG00000121864		"""Zinc fingers, C2H2-type"""	30950	protein-coding gene	gene with protein product	"""zinc finger amplified in esophageal squamous cell carcinomas 1"""					14522885	Standard	NM_016331		Approved	ANC-2H01, ZASC1	uc003fjr.1	Q9UID6	OTTHUMG00000157439	ENST00000326361.3:c.1137_1174delTGGTTTTCGGAGTAGACTTCACACAAATGTTAACAGGC	chr3.hg19:g.179051889_179051926delTGGTTTTCGGAGTAGACTTCACACAAATGTTAACAGGC	ENSP00000325634:p.Cys379fs	170.0	0.0	.		160.0	18.0	0.112	NM_016331	A9X3Z9|D3DNR3	Frame_Shift_Del	DEL	ENST00000326361.3	hg19	CCDS3227.1																																																																																			.	.	.	none		0.332	ZNF639-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348855.1	NM_016331	
