#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
GMEB1	10691	hgsc.bcm.edu	37	1	29037152	29037152	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr1:29037152C>A	ENST00000294409.2	+	9	1109	c.1019C>A	c.(1018-1020)aCa>aAa	p.T340K	GMEB1_ENST00000480454.1_3'UTR|GMEB1_ENST00000373816.1_Missense_Mutation_p.T330K|GMEB1_ENST00000361872.4_Missense_Mutation_p.T330K	NM_006582.3	NP_006573.2	Q9Y692	GMEB1_HUMAN	glucocorticoid modulatory element binding protein 1	340					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)	11		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Breast(348;0.00502)|Renal(390;0.00555)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		TATACTCTGACAGGTATGTAT	0.378																																					p.T340K		Atlas-SNP	.											.	GMEB1	28	.	0			c.C1019A						PASS	.						162.0	144.0	150.0					1																	29037152		2203	4300	6503	SO:0001583	missense	10691	exon9			CTCTGACAGGTAT	AF099013	CCDS327.1, CCDS328.1	1p35	2008-02-05			ENSG00000162419	ENSG00000162419			4370	protein-coding gene	gene with protein product		604409				10386584, 10523663	Standard	NM_006582		Approved	P96PIF, PIF96	uc001bra.3	Q9Y692	OTTHUMG00000003647	ENST00000294409.2:c.1019C>A	chr1.hg19:g.29037152C>A	ENSP00000294409:p.Thr340Lys	201.0	0.0	.		85.0	32.0	.	NM_006582	B1AT48|Q9NWH1|Q9UKD0	Missense_Mutation	SNP	ENST00000294409.2	hg19	CCDS327.1	.	.	.	.	.	.	.	.	.	.	C	17.10	3.303791	0.60305	.	.	ENSG00000162419	ENST00000373816;ENST00000456852;ENST00000361872;ENST00000294409	T;T;T	0.54279	0.58;0.58;0.58	5.52	5.52	0.82312	.	0.273025	0.41500	D	0.000870	T	0.48995	0.1531	L	0.50333	1.59	0.29901	N	0.824419	B;B	0.27498	0.023;0.18	B;B	0.19946	0.015;0.027	T	0.48864	-0.8997	10	0.36615	T	0.2	-8.9719	18.278	0.90089	0.0:1.0:0.0:0.0	.	340;330	Q9Y692;B1AT47	GMEB1_HUMAN;.	K	330;306;330;340	ENSP00000362922:T330K;ENSP00000355186:T330K;ENSP00000294409:T340K	ENSP00000294409:T340K	T	+	2	0	GMEB1	28909739	1.000000	0.71417	1.000000	0.80357	0.764000	0.43329	4.712000	0.61888	2.609000	0.88269	0.650000	0.86243	ACA	.	.	.	none		0.378	GMEB1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000010333.1	NM_006582	
ZMYM6	9204	hgsc.bcm.edu	37	1	35457924	35457924	+	Nonsense_Mutation	SNP	A	A	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr1:35457924A>C	ENST00000357182.4	-	15	2284	c.2057T>G	c.(2056-2058)tTa>tGa	p.L686*	ZMYM6_ENST00000487874.1_Nonsense_Mutation_p.L686*|ZMYM6_ENST00000373340.2_Nonsense_Mutation_p.L686*|ZMYM6_ENST00000493328.1_5'UTR	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	686					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				TTTGTTCTTTAAAAGCCTGGA	0.408																																					p.L686X		Atlas-SNP	.											.	ZMYM6	110	.	0			c.T2057G						PASS	.						209.0	193.0	198.0					1																	35457924		2203	4300	6503	SO:0001587	stop_gained	9204	exon15			TTCTTTAAAAGCC	AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.2057T>G	chr1.hg19:g.35457924A>C	ENSP00000349708:p.Leu686*	188.0	0.0	.		95.0	46.0	.	NM_007167	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Nonsense_Mutation	SNP	ENST00000357182.4	hg19	CCDS387.2	.	.	.	.	.	.	.	.	.	.	A	39	7.609622	0.98387	.	.	ENSG00000163867	ENST00000373340;ENST00000357182	.	.	.	4.47	4.47	0.54385	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.6736	13.8694	0.63610	1.0:0.0:0.0:0.0	.	.	.	.	X	686	.	ENSP00000349708:L686X	L	-	2	0	ZMYM6	35230511	1.000000	0.71417	0.941000	0.38009	0.897000	0.52465	3.726000	0.54977	2.009000	0.58944	0.477000	0.44152	TTA	.	.	.	none		0.408	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011999.1	NM_007167	
NFYC	4802	hgsc.bcm.edu	37	1	41228712	41228712	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr1:41228712G>C	ENST00000308733.5	+	6	720	c.714G>C	c.(712-714)caG>caC	p.Q238H	NFYC_ENST00000447388.3_Missense_Mutation_p.Q238H|NFYC_ENST00000372651.1_Missense_Mutation_p.Q238H|NFYC_ENST00000427410.2_Missense_Mutation_p.Q200H|NFYC_ENST00000456393.2_Missense_Mutation_p.Q238H|NFYC_ENST00000425457.2_Missense_Mutation_p.Q238H|NFYC_ENST00000440226.3_Missense_Mutation_p.Q238H|NFYC_ENST00000372652.1_Missense_Mutation_p.Q238H|NFYC_ENST00000372654.1_Missense_Mutation_p.Q238H|NFYC_ENST00000372653.1_Missense_Mutation_p.Q204H			Q13952	NFYC_HUMAN	nuclear transcription factor Y, gamma	238					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription, DNA-templated (GO:0045893)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(3)|lung(1)|prostate(1)|skin(2)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.72e-17)			AGATCCAGCAGATCCCGGTGA	0.448																																					p.Q238H		Atlas-SNP	.											.	NFYC	39	.	0			c.G714C						PASS	.						58.0	54.0	56.0					1																	41228712		2203	4300	6503	SO:0001583	missense	4802	exon7			CCAGCAGATCCCG	U78774	CCDS455.1, CCDS44120.1, CCDS44121.1, CCDS44122.1, CCDS44123.1	1p32	2008-11-11			ENSG00000066136	ENSG00000066136			7806	protein-coding gene	gene with protein product		605344				8921405, 9249075	Standard	NM_014223		Approved	CBF-C, NF-YC	uc009vwd.3	Q13952	OTTHUMG00000007729	ENST00000308733.5:c.714G>C	chr1.hg19:g.41228712G>C	ENSP00000312617:p.Gln238His	189.0	0.0	.		109.0	41.0	.	NM_001142587	B4DUS6|B4DW63|D3DPV9|F8VWM3|Q59GY4|Q5T6K8|Q5T6K9|Q5T6L1|Q5TZR6|Q92869|Q9HBX1|Q9NXB5|Q9UM67|Q9UML0|Q9UMT7	Missense_Mutation	SNP	ENST00000308733.5	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.22|16.22	3.060411|3.060411	0.55432|0.55432	.|.	.|.	ENSG00000066136|ENSG00000066136	ENST00000414185|ENST00000427410;ENST00000447388;ENST00000425457;ENST00000456393;ENST00000372658;ENST00000372655;ENST00000372654;ENST00000372653;ENST00000372669;ENST00000372652;ENST00000372651;ENST00000440226;ENST00000308733	.|T;T;T;T;T;T;T;T;T;T;T	.|0.48201	.|0.82;0.82;0.82;0.82;0.82;1.32;0.82;0.82;0.82;0.82;0.82	5.69|5.69	4.59|4.59	0.56863|0.56863	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.57814|0.57814	0.2079|0.2079	L|L	0.41236|0.41236	1.265|1.265	0.52501|0.52501	D|D	0.99995|0.99995	.|D;D;B;B;B;D;D;D	.|0.71674	.|0.994;0.996;0.053;0.006;0.089;0.998;0.998;0.997	.|P;D;B;B;B;D;D;D	.|0.79108	.|0.808;0.992;0.028;0.007;0.035;0.933;0.933;0.989	T|T	0.56541|0.56541	-0.7962|-0.7962	5|10	.|0.51188	.|T	.|0.08	.|.	12.8221|12.8221	0.57698|0.57698	0.0927:0.0:0.9073:0.0|0.0927:0.0:0.9073:0.0	.|.	.|200;144;238;204;238;238;238;238	.|B4DW63;B4DVS8;Q13952;Q5T6K9;Q13952-3;F8VWM3;Q13952-2;B4DUS6	.|.;.;NFYC_HUMAN;.;.;.;.;.	H|H	121|200;238;238;238;136;136;238;204;238;238;238;238;238	.|ENSP00000408315:Q200H;ENSP00000404427:Q238H;ENSP00000396620:Q238H;ENSP00000408867:Q238H;ENSP00000361738:Q238H;ENSP00000361737:Q204H;ENSP00000361754:Q238H;ENSP00000361736:Q238H;ENSP00000361734:Q238H;ENSP00000414299:Q238H;ENSP00000312617:Q238H	.|ENSP00000312617:Q238H	D|Q	+|+	1|3	0|2	NFYC|NFYC	41001299|41001299	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	1.519000|1.519000	0.35888|0.35888	2.686000|2.686000	0.91538|0.91538	0.603000|0.603000	0.83216|0.83216	GAT|CAG	.	.	.	none		0.448	NFYC-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000020802.1	NM_014223	
LRIG2	9860	hgsc.bcm.edu	37	1	113642882	113642882	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr1:113642882G>T	ENST00000361127.5	+	10	1420	c.1222G>T	c.(1222-1224)Ggt>Tgt	p.G408C		NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	408					innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		AGCATTCATTGGTCTTGAATC	0.308																																					p.G408C		Atlas-SNP	.											.	LRIG2	67	.	0			c.G1222T						PASS	.						84.0	89.0	87.0					1																	113642882		2203	4293	6496	SO:0001583	missense	9860	exon10			TTCATTGGTCTTG	AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.1222G>T	chr1.hg19:g.113642882G>T	ENSP00000355396:p.Gly408Cys	506.0	0.0	.		325.0	145.0	.	NM_014813	Q9NSN2	Missense_Mutation	SNP	ENST00000361127.5	hg19	CCDS30808.1	.	.	.	.	.	.	.	.	.	.	g	20.3	3.966927	0.74131	.	.	ENSG00000198799	ENST00000361127	T	0.25912	1.77	5.81	4.9	0.64082	.	0.049680	0.85682	D	0.000000	T	0.49098	0.1537	M	0.88979	2.995	0.58432	D	0.99999	D	0.89917	1.0	D	0.87578	0.998	T	0.62258	-0.6892	10	0.87932	D	0	.	14.7602	0.69600	0.0694:0.0:0.9306:0.0	.	408	O94898	LRIG2_HUMAN	C	408	ENSP00000355396:G408C	ENSP00000355396:G408C	G	+	1	0	LRIG2	113444405	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.124000	0.71620	1.457000	0.47850	0.655000	0.94253	GGT	.	.	.	none		0.308	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033549.2	NM_014813	
DCLRE1B	64858	hgsc.bcm.edu	37	1	114454066	114454066	+	Silent	SNP	C	C	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr1:114454066C>T	ENST00000369563.3	+	4	1298	c.852C>T	c.(850-852)gcC>gcT	p.A284A	DCLRE1B_ENST00000466480.1_3'UTR	NM_022836.3	NP_073747.1	Q9H816	DCR1B_HUMAN	DNA cross-link repair 1B	284					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|protection from non-homologous end joining at telomere (GO:0031848)|telomere maintenance (GO:0000723)|telomeric 3' overhang formation (GO:0031860)|telomeric loop formation (GO:0031627)	centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)			breast(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(6)|stomach(1)	18	Lung SC(450;0.184)	all_cancers(81;1.46e-05)|all_epithelial(167;2.42e-05)|all_lung(203;0.000353)|Lung NSC(69;0.000518)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGCTTCGTGCCTTTGTCGCAG	0.572								Other identified genes with known or suspected DNA repair function																													p.A284A		Atlas-SNP	.											.	DCLRE1B	36	.	0			c.C852T						PASS	.						123.0	105.0	111.0					1																	114454066		2203	4300	6503	SO:0001819	synonymous_variant	64858	exon4			TCGTGCCTTTGTC	BC029687	CCDS866.1	1p11.1	2010-06-24	2010-06-24		ENSG00000118655	ENSG00000118655			17641	protein-coding gene	gene with protein product	"""APOLLO"", ""PSO2 homolog (S. cerevisiae)"""	609683	"""DNA cross-link repair 1B (PSO2 homolog, S. cerevisiae)"""				Standard	NM_022836		Approved	SNM1B, FLJ12810, FLJ13998	uc001eeg.3	Q9H816	OTTHUMG00000011937	ENST00000369563.3:c.852C>T	chr1.hg19:g.114454066C>T		75.0	0.0	.		52.0	22.0	.	NM_022836	Q9H9E5	Silent	SNP	ENST00000369563.3	hg19	CCDS866.1																																																																																			.	.	.	none		0.572	DCLRE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033020.2	NM_022836	
UBAP2L	9898	hgsc.bcm.edu	37	1	154221875	154221875	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr1:154221875T>C	ENST00000361546.2	+	11	1217	c.1175T>C	c.(1174-1176)aTg>aCg	p.M392T	UBAP2L_ENST00000343815.6_Missense_Mutation_p.M392T|UBAP2L_ENST00000271877.7_Missense_Mutation_p.M403T|UBAP2L_ENST00000428931.1_Missense_Mutation_p.M392T			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	392					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TCTTGGGACATGGGCTCGACG	0.517																																					p.M392T		Atlas-SNP	.											.	UBAP2L	197	.	0			c.T1175C						PASS	.						133.0	121.0	125.0					1																	154221875		2203	4300	6503	SO:0001583	missense	9898	exon12			GGGACATGGGCTC	BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.1175T>C	chr1.hg19:g.154221875T>C	ENSP00000355343:p.Met392Thr	163.0	0.0	.		93.0	40.0	.	NM_001127320	B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	ENST00000361546.2	hg19	CCDS1063.1	.	.	.	.	.	.	.	.	.	.	T	14.70	2.614833	0.46631	.	.	ENSG00000143569	ENST00000343815;ENST00000428931;ENST00000271877;ENST00000361546	T;T;T;T	0.10860	2.83;2.84;2.83;2.84	5.1	5.1	0.69264	.	0.045985	0.85682	D	0.000000	T	0.02083	0.0065	N	0.02011	-0.69	0.32303	N	0.564825	B;B;B;B;B	0.17465	0.0;0.022;0.0;0.0;0.0	B;B;B;B;B	0.24541	0.0;0.054;0.001;0.001;0.0	T	0.36720	-0.9736	10	0.72032	D	0.01	-3.987	14.5124	0.67797	0.0:0.0:0.0:1.0	.	306;403;385;392;392	B4DZJ6;F8W726;Q14157-4;Q14157-1;Q14157	.;.;.;.;UBP2L_HUMAN	T	392;392;403;392	ENSP00000345308:M392T;ENSP00000389445:M392T;ENSP00000271877:M403T;ENSP00000355343:M392T	ENSP00000271877:M403T	M	+	2	0	UBAP2L	152488499	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.269000	0.65542	2.263000	0.75096	0.533000	0.62120	ATG	.	.	.	none		0.517	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087673.1	NM_014847	
TTC24	164118	hgsc.bcm.edu	37	1	156551345	156551345	+	Silent	SNP	C	C	T	rs12729118		TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr1:156551345C>T	ENST00000368237.3	+	1	189	c.189C>T	c.(187-189)ttC>ttT	p.F63F	TTC24_ENST00000368236.3_Silent_p.F63F			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	63										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGAGGGCCTTCCTTCTGGCCT	0.632																																					p.F63F		Atlas-SNP	.											.	TTC24	46	.	0			c.C189T						PASS	.						34.0	36.0	35.0					1																	156551345		692	1591	2283	SO:0001819	synonymous_variant	164118	exon2			GGCCTTCCTTCTG		CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.189C>T	chr1.hg19:g.156551345C>T		186.0	0.0	.		97.0	40.0	.	NM_001105669	Q5T3H7	Silent	SNP	ENST00000368237.3	hg19	CCDS53379.1																																																																																			.	.	.	weak		0.632	TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158547.1	XM_089384	
MYOC	4653	hgsc.bcm.edu	37	1	171621388	171621388	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr1:171621388C>G	ENST00000037502.6	-	1	435	c.364G>C	c.(364-366)Ggc>Cgc	p.G122R		NM_000261.1	NP_000252.1	Q99972	MYOC_HUMAN	myocilin, trabecular meshwork inducible glucocorticoid response	122					bone development (GO:0060348)|clustering of voltage-gated sodium channels (GO:0045162)|ERBB2-ERBB3 signaling pathway (GO:0038133)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neuron projection development (GO:0031175)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|osteoblast differentiation (GO:0001649)|positive regulation of cell migration (GO:0030335)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of MAPK cascade (GO:0043408)|skeletal muscle hypertrophy (GO:0014734)	cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|node of Ranvier (GO:0033268)|proteinaceous extracellular matrix (GO:0005578)	fibronectin binding (GO:0001968)|frizzled binding (GO:0005109)|myosin light chain binding (GO:0032027)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(1)|urinary_tract(2)	28	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					CTCAGGGTGCCCAGCTCCCTC	0.622																																					p.G122R		Atlas-SNP	.											.	MYOC	69	.	0			c.G364C						PASS	.						53.0	59.0	57.0					1																	171621388		2203	4300	6503	SO:0001583	missense	4653	exon1			GGGTGCCCAGCTC	BC029261	CCDS1297.1	1q23-q24	2008-02-05			ENSG00000034971	ENSG00000034971			7610	protein-coding gene	gene with protein product		601652		GLC1A		9169133, 9005853	Standard	NM_000261		Approved	TIGR, JOAG1	uc001ghu.3	Q99972	OTTHUMG00000034789	ENST00000037502.6:c.364G>C	chr1.hg19:g.171621388C>G	ENSP00000037502:p.Gly122Arg	98.0	0.0	.		57.0	20.0	.	NM_000261	B2RD84|O00620|Q7Z6Q9	Missense_Mutation	SNP	ENST00000037502.6	hg19	CCDS1297.1	.	.	.	.	.	.	.	.	.	.	C	0.034	-1.318487	0.01320	.	.	ENSG00000034971	ENST00000037502;ENST00000536591;ENST00000537133	T	0.57273	0.41	5.25	2.99	0.34606	.	0.913959	0.09386	N	0.809260	T	0.22166	0.0534	L	0.57536	1.79	0.33371	D	0.573529	B	0.34015	0.435	B	0.28305	0.088	T	0.10064	-1.0646	10	0.14252	T	0.57	.	6.6244	0.22820	0.0:0.7184:0.0:0.2816	.	122	Q99972	MYOC_HUMAN	R	122;55;122	ENSP00000037502:G122R	ENSP00000037502:G122R	G	-	1	0	MYOC	169888011	0.075000	0.21258	0.056000	0.19401	0.003000	0.03518	0.213000	0.17521	0.446000	0.26666	-0.345000	0.07892	GGC	.	.	.	none		0.622	MYOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084178.2	NM_000261	
KLHL20	27252	hgsc.bcm.edu	37	1	173703270	173703270	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr1:173703270C>A	ENST00000209884.4	+	3	578	c.442C>A	c.(442-444)Ctc>Atc	p.L148I	KLHL20_ENST00000493170.1_3'UTR|KLHL20_ENST00000546011.1_Intron	NM_014458.3	NP_055273.2	Q9Y2M5	KLH20_HUMAN	kelch-like family member 20	148					cytoskeleton organization (GO:0007010)|Golgi to endosome transport (GO:0006895)|negative regulation of apoptotic process (GO:0043066)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K33-linked ubiquitination (GO:1990390)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|response to interferon-alpha (GO:0035455)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|PML body (GO:0016605)|trans-Golgi network (GO:0005802)	interferon-gamma binding (GO:0019964)|ubiquitin-protein transferase activity (GO:0004842)			breast(3)|endometrium(6)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|upper_aerodigestive_tract(1)	34						TGCTTGCCTCCTCCAGCTGGC	0.473																																					p.L148I	GBM(159;862 2695 6559 23041)	Atlas-SNP	.											.	KLHL20	54	.	0			c.C442A						PASS	.						68.0	66.0	66.0					1																	173703270		2203	4300	6503	SO:0001583	missense	27252	exon3			TGCCTCCTCCAGC	AB026190	CCDS1310.1	1q25.1	2013-01-30	2013-01-30		ENSG00000076321	ENSG00000076321		"""Kelch-like"", ""BTB/POZ domain containing"""	25056	protein-coding gene	gene with protein product			"""kelch-like 20 (Drosophila)"""			14668487, 20389280	Standard	NM_014458		Approved	KLEIP, KHLHX	uc001gjc.3	Q9Y2M5	OTTHUMG00000040548	ENST00000209884.4:c.442C>A	chr1.hg19:g.173703270C>A	ENSP00000209884:p.Leu148Ile	108.0	0.0	.		72.0	28.0	.	NM_014458	B3KMA0|B4DUR0|Q5TZF2|Q5ZF45|Q9H457	Missense_Mutation	SNP	ENST00000209884.4	hg19	CCDS1310.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.307687	0.81247	.	.	ENSG00000076321	ENST00000209884	T	0.74421	-0.84	5.63	4.72	0.59763	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.86385	0.5920	M	0.93106	3.38	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.989	D	0.89802	0.3976	9	.	.	.	.	13.2837	0.60230	0.0:0.9226:0.0:0.0774	.	148;148	Q9BS75;Q9Y2M5	.;KLH20_HUMAN	I	148	ENSP00000209884:L148I	.	L	+	1	0	KLHL20	171969893	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.951000	0.70273	1.382000	0.46385	0.644000	0.83932	CTC	.	.	.	none		0.473	KLHL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097582.1	NM_014458	
RYR2	6262	hgsc.bcm.edu	37	1	237550598	237550598	+	Silent	SNP	C	C	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr1:237550598C>T	ENST00000366574.2	+	9	911	c.594C>T	c.(592-594)aaC>aaT	p.N198N	RYR2_ENST00000360064.6_Silent_p.N196N|RYR2_ENST00000542537.1_Silent_p.N182N	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	198	MIR 2. {ECO:0000255|PROSITE- ProRule:PRU00131}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTTATGGCAACGGCAGCTTAC	0.498																																					p.N198N		Atlas-SNP	.											RYR2,colon,carcinoma,0,1	RYR2	1273	.	0			c.C594T						PASS	.						113.0	114.0	114.0					1																	237550598		2003	4178	6181	SO:0001819	synonymous_variant	6262	exon9			TGGCAACGGCAGC	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.594C>T	chr1.hg19:g.237550598C>T		120.0	0.0	.		72.0	6.0	.	NM_001035	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	hg19	CCDS55691.1																																																																																			.	.	.	none		0.498	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
APOB	338	hgsc.bcm.edu	37	2	21238299	21238299	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr2:21238299C>T	ENST00000233242.1	-	22	3578	c.3451G>A	c.(3451-3453)Gac>Aac	p.D1151N		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1151					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCAGATGAGTCCATTTGGAGA	0.488																																					p.D1151N		Atlas-SNP	.											.	APOB	761	.	0			c.G3451A						PASS	.						147.0	128.0	134.0					2																	21238299		2203	4300	6503	SO:0001583	missense	338	exon22			ATGAGTCCATTTG	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3451G>A	chr2.hg19:g.21238299C>T	ENSP00000233242:p.Asp1151Asn	156.0	0.0	.		77.0	29.0	.	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	hg19	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.225393	0.79576	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00816	5.66	5.49	4.6	0.57074	.	0.185608	0.38272	N	0.001754	T	0.03434	0.0099	M	0.67953	2.075	0.80722	D	1	D	0.69078	0.997	D	0.64042	0.921	T	0.43163	-0.9408	10	0.72032	D	0.01	.	8.2055	0.31452	0.1578:0.7577:0.0:0.0845	.	1151	P04114	APOB_HUMAN	N	1151	ENSP00000233242:D1151N	ENSP00000233242:D1151N	D	-	1	0	APOB	21091804	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.251000	0.43187	1.441000	0.47550	0.655000	0.94253	GAC	.	.	.	none		0.488	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
ITSN2	50618	hgsc.bcm.edu	37	2	24524074	24524074	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr2:24524074G>C	ENST00000355123.4	-	11	1473	c.1030C>G	c.(1030-1032)Ctg>Gtg	p.L344V	ITSN2_ENST00000361999.3_Missense_Mutation_p.L344V|ITSN2_ENST00000406921.3_Missense_Mutation_p.L344V	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	344					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TATGAAGGCAGAGTTCCATTA	0.338																																					p.L344V		Atlas-SNP	.											.	ITSN2	224	.	0			c.C1030G						PASS	.						94.0	93.0	93.0					2																	24524074		2203	4299	6502	SO:0001583	missense	50618	exon11			AAGGCAGAGTTCC	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.1030C>G	chr2.hg19:g.24524074G>C	ENSP00000347244:p.Leu344Val	342.0	1.0	.		203.0	77.0	.	NM_147152	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	ENST00000355123.4	hg19	CCDS1710.2	.	.	.	.	.	.	.	.	.	.	G	11.47	1.649174	0.29336	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868;ENST00000445614;ENST00000406921;ENST00000412011	T;T;T;T;T	0.60424	0.2;0.19;0.2;0.69;1.02	5.36	4.48	0.54585	.	0.000000	0.27927	U	0.017293	T	0.46678	0.1405	L	0.38838	1.175	0.32270	N	0.568969	B;B;B;B	0.29805	0.147;0.147;0.257;0.107	B;B;B;B	0.34093	0.141;0.13;0.175;0.159	T	0.54330	-0.8310	10	0.25106	T	0.35	.	10.1709	0.42908	0.1543:0.0:0.8457:0.0	.	344;344;344;344	Q9NZM3-4;Q9NZM3-3;Q9NZM3-2;Q9NZM3	.;.;.;ITSN2_HUMAN	V	344;344;344;368;344;369	ENSP00000354561:L344V;ENSP00000347244:L344V;ENSP00000370250:L344V;ENSP00000384499:L344V;ENSP00000391224:L369V	ENSP00000347244:L344V	L	-	1	2	ITSN2	24377578	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.457000	0.45005	1.413000	0.46997	0.491000	0.48974	CTG	.	.	.	none		0.338	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	NM_006277	
MTIF2	4528	hgsc.bcm.edu	37	2	55473542	55473542	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr2:55473542T>G	ENST00000263629.4	-	10	1352	c.1037A>C	c.(1036-1038)gAa>gCa	p.E346A	MTIF2_ENST00000394600.3_Missense_Mutation_p.E346A|MTIF2_ENST00000403721.1_Missense_Mutation_p.E346A	NM_002453.2	NP_002444.2	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	346	tr-type G.				formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	24						TGCTTTCAATTCTAACATTTC	0.363																																					p.E346A		Atlas-SNP	.											.	MTIF2	64	.	0			c.A1037C						PASS	.						167.0	153.0	158.0					2																	55473542		2203	4300	6503	SO:0001583	missense	4528	exon10			TTCAATTCTAACA	L34600	CCDS1853.1	2p16.1	2008-02-05			ENSG00000085760	ENSG00000085760			7441	protein-coding gene	gene with protein product		603766				9925935, 7829522	Standard	XM_005264335		Approved	IF-2mt	uc002ryo.3	P46199	OTTHUMG00000129338	ENST00000263629.4:c.1037A>C	chr2.hg19:g.55473542T>G	ENSP00000263629:p.Glu346Ala	133.0	0.0	.		90.0	41.0	.	NM_002453	D6W5D0	Missense_Mutation	SNP	ENST00000263629.4	hg19	CCDS1853.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.368297	0.82463	.	.	ENSG00000085760	ENST00000403721;ENST00000263629;ENST00000394600;ENST00000418823;ENST00000535023	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.75997	0.3926	H	0.97315	3.98	0.80722	D	1	P	0.39094	0.659	P	0.51701	0.677	D	0.83541	0.0096	10	0.87932	D	0	-25.932	15.3048	0.73985	0.0:0.0:0.0:1.0	.	346	P46199	IF2M_HUMAN	A	346;346;346;66;346	ENSP00000384481:E346A;ENSP00000263629:E346A;ENSP00000378099:E346A;ENSP00000403492:E66A	ENSP00000263629:E346A	E	-	2	0	MTIF2	55327046	1.000000	0.71417	0.999000	0.59377	0.758000	0.43043	7.472000	0.80996	2.027000	0.59764	0.533000	0.62120	GAA	.	.	.	none		0.363	MTIF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251486.4	NM_002453	
NFU1	27247	hgsc.bcm.edu	37	2	69650823	69650823	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr2:69650823C>T	ENST00000410022.2	-	3	398	c.193G>A	c.(193-195)Gat>Aat	p.D65N	NFU1_ENST00000394305.1_Intron|NFU1_ENST00000303698.3_Missense_Mutation_p.D41N|NFU1_ENST00000471185.1_Intron	NM_001002755.2	NP_001002755.1	Q9UMS0	NFU1_HUMAN	NFU1 iron-sulfur cluster scaffold	65					iron-sulfur cluster assembly (GO:0016226)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron ion binding (GO:0005506)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	7						TTTGGGGTATCTTGTGTTTGA	0.368																																					p.D65N		Atlas-SNP	.											.	NFU1	19	.	0			c.G193A						PASS	.						74.0	72.0	73.0					2																	69650823		2203	4300	6503	SO:0001583	missense	27247	exon3			GGGTATCTTGTGT	AJ132584	CCDS33217.1, CCDS42694.1, CCDS46315.1	2p15-p13	2014-07-03	2014-07-03	2006-10-24	ENSG00000169599	ENSG00000169599			16287	protein-coding gene	gene with protein product		608100	"""HIRA interacting protein 5"", ""NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)"""	HIRIP5		11342215, 12886008	Standard	NR_045631		Approved	CGI-33, NifU, NIFUC	uc002sfk.3	Q9UMS0	OTTHUMG00000152668	ENST00000410022.2:c.193G>A	chr2.hg19:g.69650823C>T	ENSP00000387219:p.Asp65Asn	128.0	0.0	.		61.0	21.0	.	NM_001002755	B4DUL9|Q53QE5|Q6VNZ8|Q7Z5B1|Q7Z5B2|Q9Y322	Missense_Mutation	SNP	ENST00000410022.2	hg19	CCDS33217.1	.	.	.	.	.	.	.	.	.	.	C	18.66	3.671512	0.67814	.	.	ENSG00000169599	ENST00000410022;ENST00000303698	T;T	0.63417	-0.04;-0.02	5.18	5.18	0.71444	NIF system FeS cluster assembly, NifU-like scaffold, N-terminal (4);	0.091423	0.64402	D	0.000001	T	0.76335	0.3973	M	0.75884	2.315	0.80722	D	1	D;P	0.65815	0.995;0.571	P;B	0.61800	0.894;0.378	T	0.74450	-0.3661	10	0.29301	T	0.29	3.0E-4	17.7387	0.88402	0.0:1.0:0.0:0.0	.	41;65	Q9UMS0-3;Q9UMS0	.;NFU1_HUMAN	N	65;41	ENSP00000387219:D65N;ENSP00000306965:D41N	ENSP00000306965:D41N	D	-	1	0	NFU1	69504327	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.121000	0.77160	2.421000	0.82119	0.591000	0.81541	GAT	.	.	.	none		0.368	NFU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327279.3	NM_015700	
TTC21B	79809	hgsc.bcm.edu	37	2	166737187	166737187	+	Splice_Site	SNP	A	A	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr2:166737187A>T	ENST00000243344.7	-	27	3943		c.e27+1		TTC21B_ENST00000536175.1_Splice_Site	NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B						forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)				breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						TGCCAAACTCACCTACTGCCG	0.313																																					.		Atlas-SNP	.											.	TTC21B	130	.	0			c.3805+2T>A						PASS	.						107.0	99.0	102.0					2																	166737187		2203	4300	6503	SO:0001630	splice_region_variant	79809	exon28			AAACTCACCTACT	AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.3805+1T>A	chr2.hg19:g.166737187A>T		55.0	0.0	.		24.0	11.0	.	NM_024753	A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Splice_Site	SNP	ENST00000243344.7	hg19	CCDS33315.1	.	.	.	.	.	.	.	.	.	.	A	11.57	1.677877	0.29783	.	.	ENSG00000123607	ENST00000536175;ENST00000243344	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9431	0.47285	0.9214:0.0:0.0786:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TTC21B	166445433	1.000000	0.71417	1.000000	0.80357	0.048000	0.14542	6.088000	0.71371	2.311000	0.77944	0.533000	0.62120	.	.	.	.	none		0.313	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333770.1	NM_024753	Intron
CAB39	51719	hgsc.bcm.edu	37	2	231663533	231663533	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr2:231663533C>T	ENST00000258418.5	+	5	917	c.488C>T	c.(487-489)tCg>tTg	p.S163L	CAB39_ENST00000409788.3_Missense_Mutation_p.S163L|CAB39_ENST00000410084.3_Missense_Mutation_p.S163L	NM_016289.3	NP_057373.1	Q9Y376	CAB39_HUMAN	calcium binding protein 39	163					activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|cellular hypotonic response (GO:0071476)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of rubidium ion transmembrane transporter activity (GO:2000687)|negative regulation of rubidium ion transport (GO:2000681)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein heterooligomerization (GO:0051291)|signal transduction by phosphorylation (GO:0023014)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activator activity (GO:0043539)			central_nervous_system(1)|large_intestine(1)|skin(1)	3		all_lung(227;4.63e-07)|all_hematologic(139;1.83e-06)|Lung NSC(271;2.11e-05)|Acute lymphoblastic leukemia(138;5.51e-05)|Hepatocellular(293;0.0207)|Lung SC(224;0.187)		all cancers(144;1.64e-12)|Epithelial(121;5.29e-11)|LUSC - Lung squamous cell carcinoma(224;0.0154)|Lung(119;0.0177)|COAD - Colon adenocarcinoma(134;0.226)		ATTTTGTGGTCGGAACAGTTT	0.343																																					p.S163L		Atlas-SNP	.											CAB39_ENST00000258418,NS,carcinoma,0,1	CAB39	30	.	0			c.C488T						PASS	.						88.0	86.0	87.0					2																	231663533		2203	4300	6503	SO:0001583	missense	51719	exon5			TGTGGTCGGAACA	AF113536	CCDS2478.1	2q37.1	2008-02-05			ENSG00000135932	ENSG00000135932			20292	protein-coding gene	gene with protein product		612174					Standard	NM_016289		Approved	CGI-66, MO25	uc002vqx.3	Q9Y376	OTTHUMG00000133220	ENST00000258418.5:c.488C>T	chr2.hg19:g.231663533C>T	ENSP00000258418:p.Ser163Leu	319.0	1.0	.		164.0	66.0	.	NM_001130849	A8K8L7	Missense_Mutation	SNP	ENST00000258418.5	hg19	CCDS2478.1	.	.	.	.	.	.	.	.	.	.	C	32	5.161225	0.94727	.	.	ENSG00000135932	ENST00000258418;ENST00000409788;ENST00000410084	T;T;T	0.35236	1.32;1.32;1.32	5.58	5.58	0.84498	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67078	0.2855	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	T	0.72478	-0.4281	10	0.52906	T	0.07	.	17.0555	0.86532	0.0:1.0:0.0:0.0	.	163	Q9Y376	CAB39_HUMAN	L	163	ENSP00000258418:S163L;ENSP00000386238:S163L;ENSP00000386642:S163L	ENSP00000258418:S163L	S	+	2	0	CAB39	231371777	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	7.818000	0.86416	2.616000	0.88540	0.467000	0.42956	TCG	.	.	.	none		0.343	CAB39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256955.2	NM_016289	
CTNNB1	1499	hgsc.bcm.edu	37	3	41267192	41267192	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr3:41267192T>A	ENST00000349496.5	+	6	1056	c.776T>A	c.(775-777)cTc>cAc	p.L259H	CTNNB1_ENST00000396183.3_Missense_Mutation_p.L259H|CTNNB1_ENST00000405570.1_Missense_Mutation_p.L259H|CTNNB1_ENST00000396185.3_Missense_Mutation_p.L259H|CTNNB1_ENST00000453024.1_Missense_Mutation_p.L252H	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	259					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ATTACAACTCTCCACAACCTT	0.383		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.L259H	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1	4904	.	0			c.T776A						PASS	.						93.0	99.0	97.0					3																	41267192		2203	4300	6503	SO:0001583	missense	1499	exon6	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CAACTCTCCACAA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.776T>A	chr3.hg19:g.41267192T>A	ENSP00000344456:p.Leu259His	237.0	0.0	.		115.0	49.0	.	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.007483	0.75046	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	D;D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05;-2.05	5.51	5.51	0.81932	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.92941	0.7754	M	0.84511	2.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.94038	0.7307	10	0.87932	D	0	-18.0393	15.6183	0.76784	0.0:0.0:0.0:1.0	.	187;259	B4DSW9;P35222	.;CTNB1_HUMAN	H	259;259;259;252;259	ENSP00000385604:L259H;ENSP00000379486:L259H;ENSP00000344456:L259H;ENSP00000411226:L252H;ENSP00000379488:L259H	ENSP00000344456:L259H	L	+	2	0	CTNNB1	41242196	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.092000	0.63282	0.482000	0.46254	CTC	.	.	.	none		0.383	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
RBM15B	29890	hgsc.bcm.edu	37	3	51429622	51429622	+	Silent	SNP	C	C	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr3:51429622C>A	ENST00000323686.4	+	1	892	c.792C>A	c.(790-792)cgC>cgA	p.R264R		NM_013286.4	NP_037418.3	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	264					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|large_intestine(5)|lung(3)	12				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		ACAAGCAGCGCTCGCTGTccc	0.781																																					p.R264R		Atlas-SNP	.											.	RBM15B	47	.	0			c.C792A						PASS	.						3.0	3.0	3.0					3																	51429622		1417	2994	4411	SO:0001819	synonymous_variant	29890	exon1			GCAGCGCTCGCTG	AL831838	CCDS33764.1	3p21.1	2013-02-12			ENSG00000179837	ENSG00000259956		"""RNA binding motif (RRM) containing"""	24303	protein-coding gene	gene with protein product		612602				16129689	Standard	NM_013286		Approved	HUMAGCGB, OTT3	uc003dbd.3	Q8NDT2	OTTHUMG00000156896	ENST00000323686.4:c.792C>A	chr3.hg19:g.51429622C>A		60.0	0.0	.		28.0	10.0	.	NM_013286	A4QPG7|Q6QE19|Q9BV96	Silent	SNP	ENST00000323686.4	hg19	CCDS33764.1																																																																																			.	.	.	none		0.781	RBM15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346489.1	NM_013286	
TMF1	7110	hgsc.bcm.edu	37	3	69096518	69096518	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr3:69096518A>C	ENST00000398559.2	-	2	1554	c.1338T>G	c.(1336-1338)gaT>gaG	p.D446E	MIR3136_ENST00000583498.1_RNA|CTD-2013N24.2_ENST00000596732.1_RNA|CTD-2013N24.2_ENST00000596274.1_RNA|CTD-2013N24.2_ENST00000598783.1_RNA|CTD-2013N24.2_ENST00000595925.1_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|CTD-2013N24.2_ENST00000596523.1_RNA|CTD-2013N24.2_ENST00000482368.2_RNA|CTD-2013N24.2_ENST00000597950.1_RNA|TMF1_ENST00000543976.1_Missense_Mutation_p.D446E			P82094	TMF1_HUMAN	TATA element modulatory factor 1	446					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		CCTTGCAAACATCTTCCTTCT	0.373																																					p.D446E		Atlas-SNP	.											.	TMF1	77	.	0			c.T1338G						PASS	.						117.0	113.0	114.0					3																	69096518		1877	4104	5981	SO:0001583	missense	7110	exon2			GCAAACATCTTCC		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.1338T>G	chr3.hg19:g.69096518A>C	ENSP00000381567:p.Asp446Glu	83.0	0.0	.		48.0	20.0	.	NM_007114	B7ZLJ2|Q17R87|Q59GK0	Missense_Mutation	SNP	ENST00000398559.2	hg19	CCDS43105.1	.	.	.	.	.	.	.	.	.	.	A	8.573	0.880464	0.17467	.	.	ENSG00000144747	ENST00000398559;ENST00000543976;ENST00000356248;ENST00000438636	T;T	0.81247	-1.47;-1.31	5.86	-2.1	0.07210	.	0.177079	0.64402	D	0.000012	T	0.63367	0.2505	L	0.41824	1.3	0.23210	N	0.998115	B;B	0.15141	0.012;0.007	B;B	0.11329	0.006;0.003	T	0.51387	-0.8712	10	0.02654	T	1	-12.2902	9.5763	0.39459	0.3454:0.155:0.4996:0.0	.	446;446	P82094-2;P82094	.;TMF1_HUMAN	E	446;446;359;446	ENSP00000381567:D446E;ENSP00000438706:D446E	ENSP00000348582:D359E	D	-	3	2	TMF1	69179208	0.978000	0.34361	0.568000	0.28447	0.499000	0.33736	0.418000	0.21230	-0.266000	0.09339	-0.297000	0.09499	GAT	.	.	.	none		0.373	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	NM_007114	
LETM1	3954	hgsc.bcm.edu	37	4	1836665	1836665	+	Silent	SNP	G	G	T	rs145939138		TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr4:1836665G>T	ENST00000302787.2	-	5	1079	c.783C>A	c.(781-783)gcC>gcA	p.A261A		NM_012318.2	NP_036450.1	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane protein 1	261	LETM1.				cristae formation (GO:0042407)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(2)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	13			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			GGAGGAACTTGGCCAGCTCCA	0.567																																					p.A261A		Atlas-SNP	.											.	LETM1	48	.	0			c.C783A						PASS	.						102.0	82.0	89.0					4																	1836665		2203	4300	6503	SO:0001819	synonymous_variant	3954	exon5			GAACTTGGCCAGC	AF061025	CCDS3355.1	4p16.3	2013-01-10			ENSG00000168924	ENSG00000168924		"""EF-hand domain containing"""	6556	protein-coding gene	gene with protein product	"""Mdm38 homolog (yeast)"""	604407				10486213	Standard	NM_012318		Approved		uc003gdv.3	O95202	OTTHUMG00000121149	ENST00000302787.2:c.783C>A	chr4.hg19:g.1836665G>T		52.0	0.0	.		35.0	21.0	.	NM_012318	B4DED2|Q9UF65	Silent	SNP	ENST00000302787.2	hg19	CCDS3355.1																																																																																			.	G|1.000;A|0.000	.	alt		0.567	LETM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241634.1		
PPARGC1A	10891	hgsc.bcm.edu	37	4	23833339	23833339	+	Silent	SNP	T	T	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr4:23833339T>A	ENST00000264867.2	-	3	389	c.270A>T	c.(268-270)gcA>gcT	p.A90A	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	90					androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				CTGTGAGGACTGCTAGCAAGT	0.473																																					p.A90A	Esophageal Squamous(29;694 744 13796 34866 44181)	Atlas-SNP	.											.	PPARGC1A	129	.	0			c.A270T						PASS	.						335.0	275.0	295.0					4																	23833339		2203	4300	6503	SO:0001819	synonymous_variant	10891	exon3			GAGGACTGCTAGC	AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.270A>T	chr4.hg19:g.23833339T>A		112.0	0.0	.		52.0	21.0	.	NM_013261	B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Silent	SNP	ENST00000264867.2	hg19	CCDS3429.1																																																																																			.	.	.	none		0.473	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214976.1	NM_013261	
KLB	152831	hgsc.bcm.edu	37	4	39409127	39409127	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr4:39409127C>A	ENST00000257408.4	+	1	655	c.558C>A	c.(556-558)aaC>aaA	p.N186K		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	186	Glycosyl hydrolase-1 1.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						TGCTTAGAAACATTGAACCTA	0.413																																					p.N186K		Atlas-SNP	.											.	KLB	95	.	0			c.C558A						PASS	.						77.0	80.0	79.0					4																	39409127		2203	4299	6502	SO:0001583	missense	152831	exon1			TAGAAACATTGAA	AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.558C>A	chr4.hg19:g.39409127C>A	ENSP00000257408:p.Asn186Lys	175.0	0.0	.		71.0	35.0	.	NM_175737	Q2M3K8	Missense_Mutation	SNP	ENST00000257408.4	hg19	CCDS3451.1	.	.	.	.	.	.	.	.	.	.	C	3.801	-0.041733	0.07452	.	.	ENSG00000134962	ENST00000257408	T	0.32272	1.46	5.33	3.58	0.41010	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.257041	0.43416	D	0.000578	T	0.29256	0.0728	L	0.55103	1.725	0.18873	N	0.999985	B;B	0.26483	0.15;0.15	B;B	0.32624	0.149;0.149	T	0.21793	-1.0235	10	0.41790	T	0.15	-11.7505	7.8899	0.29672	0.0:0.6521:0.0:0.3479	.	186;186	B7ZL50;Q86Z14	.;KLOTB_HUMAN	K	186	ENSP00000257408:N186K	ENSP00000257408:N186K	N	+	3	2	KLB	39085522	0.996000	0.38824	0.004000	0.12327	0.405000	0.30901	0.343000	0.19944	0.607000	0.29982	-0.373000	0.07131	AAC	.	.	.	none		0.413	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250429.1	NM_175737	
PRKG2	5593	hgsc.bcm.edu	37	4	82126083	82126083	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr4:82126083T>G	ENST00000395578.1	-	2	235	c.119A>C	c.(118-120)aAg>aCg	p.K40T	PRKG2_ENST00000264399.1_Missense_Mutation_p.K40T|PRKG2_ENST00000418486.2_Missense_Mutation_p.K40T			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	40					blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						CTCAGCATCCTTCCTCCTCAA	0.542																																					p.K40T		Atlas-SNP	.											.	PRKG2	195	.	0			c.A119C						PASS	.						114.0	108.0	110.0					4																	82126083		2203	4300	6503	SO:0001583	missense	5593	exon1			GCATCCTTCCTCC	X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.119A>C	chr4.hg19:g.82126083T>G	ENSP00000378945:p.Lys40Thr	106.0	0.0	.		66.0	28.0	.	NM_006259	B4DMX3|E7EPE6|O00125|O60916	Missense_Mutation	SNP	ENST00000395578.1	hg19	CCDS3589.1	.	.	.	.	.	.	.	.	.	.	T	14.64	2.594584	0.46214	.	.	ENSG00000138669	ENST00000395578;ENST00000264399;ENST00000418486	D;D;D	0.82433	-1.61;-1.61;-1.61	5.1	3.88	0.44766	.	0.098784	0.64402	D	0.000002	T	0.68677	0.3027	N	0.24115	0.695	0.80722	D	1	B;P	0.36465	0.411;0.554	B;B	0.33196	0.111;0.159	T	0.63001	-0.6734	10	0.20519	T	0.43	-22.8646	10.7529	0.46219	0.0:0.076:0.0:0.924	.	40;40	E7EPE6;Q13237	.;KGP2_HUMAN	T	40	ENSP00000378945:K40T;ENSP00000264399:K40T;ENSP00000389038:K40T	ENSP00000264399:K40T	K	-	2	0	PRKG2	82345107	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.387000	0.44389	0.940000	0.37473	0.477000	0.44152	AAG	.	.	.	none		0.542	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252639.1	NM_006259	
SEC31A	22872	hgsc.bcm.edu	37	4	83765635	83765635	+	Missense_Mutation	SNP	T	T	C	rs375945567		TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr4:83765635T>C	ENST00000395310.2	-	21	2712	c.2530A>G	c.(2530-2532)Ata>Gta	p.I844V	SEC31A_ENST00000348405.4_Missense_Mutation_p.I805V|SEC31A_ENST00000508502.1_Missense_Mutation_p.I844V|SEC31A_ENST00000500777.2_Missense_Mutation_p.I805V|SEC31A_ENST00000509142.1_Missense_Mutation_p.I844V|SEC31A_ENST00000355196.2_Missense_Mutation_p.I844V|SEC31A_ENST00000505984.1_Missense_Mutation_p.I805V|SEC31A_ENST00000505472.1_Missense_Mutation_p.I875V|SEC31A_ENST00000311785.7_Missense_Mutation_p.I844V|SEC31A_ENST00000448323.1_Missense_Mutation_p.I844V|SEC31A_ENST00000513858.1_Missense_Mutation_p.I805V|SEC31A_ENST00000432794.1_Missense_Mutation_p.I844V|SEC31A_ENST00000264405.5_Missense_Mutation_p.I608V|SEC31A_ENST00000508479.1_Missense_Mutation_p.I844V|SEC31A_ENST00000326950.5_Missense_Mutation_p.I805V|SEC31A_ENST00000443462.2_Missense_Mutation_p.I839V	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	844	Interaction with PDCD6.|Pro-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)		SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				CCATGCATTATGAAACCCGGA	0.458																																					p.I844V		Atlas-SNP	.											.	SEC31A	227	.	0			c.A2530G						PASS	.	T	VAL/ILE,VAL/ILE,VAL/ILE,VAL/ILE,VAL/ILE,VAL/ILE	1,4405	2.1+/-5.4	0,1,2202	125.0	120.0	122.0		2530,2530,2530,2515,2530,2413	-1.9	1.0	4		122	0,8600		0,0,4300	no	missense,missense,missense,missense,missense,missense	SEC31A	NM_001077206.2,NM_001077207.2,NM_001077208.2,NM_001191049.1,NM_014933.3,NM_016211.3	29,29,29,29,29,29	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	benign,benign,benign,benign,benign,benign	844/1107,844/1221,844/1206,839/1201,844/1221,805/1182	83765635	1,13005	2203	4300	6503	SO:0001583	missense	22872	exon21			GCATTATGAAACC	AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.2530A>G	chr4.hg19:g.83765635T>C	ENSP00000378721:p.Ile844Val	190.0	0.0	.		85.0	32.0	.	NM_001077206	B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Missense_Mutation	SNP	ENST00000395310.2	hg19	CCDS3596.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.116|9.116	1.007818|1.007818	0.19199|0.19199	2.27E-4|2.27E-4	0.0|0.0	ENSG00000138674|ENSG00000138674	ENST00000511338|ENST00000348405;ENST00000513858;ENST00000395310;ENST00000443462;ENST00000509142;ENST00000432794;ENST00000448323;ENST00000326950;ENST00000311785;ENST00000505472;ENST00000500777;ENST00000508502;ENST00000355196;ENST00000264405;ENST00000505984;ENST00000508479	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.35789	.|1.48;1.32;2.52;2.52;1.38;2.41;2.52;1.48;1.38;1.29;1.32;2.52;2.52;3.35;2.47;2.4	5.52|5.52	-1.9|-1.9	0.07665|0.07665	.|.	.|0.490823	.|0.23787	.|N	.|0.044567	T|T	0.16214|0.16214	0.0390|0.0390	L|L	0.29908|0.29908	0.895|0.895	0.29715|0.29715	N|N	0.839122|0.839122	.|B;B;B;B;B;B;B;B;B	.|0.12013	.|0.001;0.0;0.0;0.005;0.0;0.003;0.0;0.0;0.002	.|B;B;B;B;B;B;B;B;B	.|0.16289	.|0.001;0.0;0.001;0.015;0.0;0.009;0.001;0.001;0.002	T|T	0.15321|0.15321	-1.0441|-1.0441	5|10	.|0.13853	.|T	.|0.58	-1.5149|-1.5149	0.9936|0.9936	0.01462|0.01462	0.1356:0.2089:0.246:0.4096|0.1356:0.2089:0.246:0.4096	.|.	.|839;805;844;805;805;844;844;844;608	.|B4DIW6;B7ZL00;D6RHZ5;O94979-6;O94979-4;O94979-3;O94979-2;O94979;O94979-7	.|.;.;.;.;.;.;.;SC31A_HUMAN;.	R|V	54|805;805;844;839;844;844;844;805;844;875;805;844;844;608;805;844	.|ENSP00000337602:I805V;ENSP00000426886:I805V;ENSP00000378721:I844V;ENSP00000408027:I839V;ENSP00000426569:I844V;ENSP00000407944:I844V;ENSP00000400926:I844V;ENSP00000325087:I805V;ENSP00000309070:I844V;ENSP00000421633:I875V;ENSP00000421464:I805V;ENSP00000424635:I844V;ENSP00000347329:I844V;ENSP00000264405:I608V;ENSP00000424451:I805V;ENSP00000425999:I844V	.|ENSP00000264405:I608V	H|I	-|-	2|1	0|0	SEC31A|SEC31A	83984659|83984659	0.978000|0.978000	0.34361|0.34361	0.958000|0.958000	0.39756|0.39756	0.867000|0.867000	0.49689|0.49689	-0.068000|-0.068000	0.11561|0.11561	-0.543000|-0.543000	0.06240|0.06240	-0.707000|-0.707000	0.03653|0.03653	CAT|ATA	.	.	.	weak		0.458	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252640.1	NM_016211	
KIAA1109	84162	hgsc.bcm.edu	37	4	123150305	123150305	+	Silent	SNP	T	T	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr4:123150305T>A	ENST00000264501.4	+	25	3325	c.2952T>A	c.(2950-2952)acT>acA	p.T984T	KIAA1109_ENST00000455637.1_Silent_p.T984T|KIAA1109_ENST00000388738.3_Silent_p.T984T|KIAA1109_ENST00000495260.1_3'UTR			Q2LD37	K1109_HUMAN	KIAA1109	984					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.T984T(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CTTGTCCAACTTCAGATGATT	0.323																																					p.T984T		Atlas-SNP	.											KIAA1109,NS,carcinoma,0,1	KIAA1109	424	.	1	Substitution - coding silent(1)	kidney(1)	c.T2952A						PASS	.						207.0	193.0	198.0					4																	123150305		1864	4109	5973	SO:0001819	synonymous_variant	84162	exon23			TCCAACTTCAGAT	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.2952T>A	chr4.hg19:g.123150305T>A		120.0	0.0	.		60.0	25.0	.	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Silent	SNP	ENST00000264501.4	hg19	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	T	9.845	1.191962	0.21954	.	.	ENSG00000138688	ENST00000424425	.	.	.	5.33	-0.0113	0.13993	.	.	.	.	.	T	0.39989	0.1099	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22521	-1.0214	4	.	.	.	.	0.9972	0.01470	0.4442:0.207:0.1147:0.2341	.	.	.	.	I	816	.	.	F	+	1	0	KIAA1109	123369755	0.878000	0.30173	1.000000	0.80357	0.992000	0.81027	-0.019000	0.12546	0.060000	0.16281	-0.496000	0.04628	TTC	.	.	.	none		0.323	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
SAP30	8819	hgsc.bcm.edu	37	4	174294597	174294597	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr4:174294597C>G	ENST00000296504.3	+	2	612	c.372C>G	c.(370-372)aaC>aaG	p.N124K	RP11-798M19.6_ENST00000609153.1_RNA	NM_003864.3	NP_003855.1			Sin3A-associated protein, 30kDa											large_intestine(1)|lung(2)|ovary(1)	4		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.15e-17)|Epithelial(43;4.33e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.62e-09)|STAD - Stomach adenocarcinoma(60;0.00278)|GBM - Glioblastoma multiforme(59;0.00659)|LUSC - Lung squamous cell carcinoma(193;0.0919)		GTGTTCGAAACAGAAGAAAGA	0.338																																					p.N124K		Atlas-SNP	.											.	SAP30	9	.	0			c.C372G						PASS	.						143.0	139.0	141.0					4																	174294597		2203	4300	6503	SO:0001583	missense	8819	exon2			TCGAAACAGAAGA	AF055993	CCDS3817.1	4q34.1	2008-02-05	2006-02-02		ENSG00000164105	ENSG00000164105			10532	protein-coding gene	gene with protein product		603378	"""sin3A-associated protein, 30kDa"""			9651585	Standard	NM_003864		Approved		uc003itd.3	O75446	OTTHUMG00000160798	ENST00000296504.3:c.372C>G	chr4.hg19:g.174294597C>G	ENSP00000296504:p.Asn124Lys	247.0	1.0	.		105.0	47.0	.	NM_003864		Missense_Mutation	SNP	ENST00000296504.3	hg19	CCDS3817.1	.	.	.	.	.	.	.	.	.	.	C	14.96	2.692434	0.48202	.	.	ENSG00000164105	ENST00000296504	.	.	.	5.62	4.78	0.61160	.	0.301984	0.31415	N	0.007686	T	0.67730	0.2924	L	0.50333	1.59	0.52501	D	0.999957	D	0.76494	0.999	D	0.87578	0.998	T	0.69075	-0.5241	9	0.66056	D	0.02	-17.9972	8.8041	0.34927	0.0:0.7598:0.0:0.2402	.	124	O75446	SAP30_HUMAN	K	124	.	ENSP00000296504:N124K	N	+	3	2	SAP30	174531172	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.014000	0.57145	1.353000	0.45828	0.655000	0.94253	AAC	.	.	.	none		0.338	SAP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362360.1	NM_003864	
TRIO	7204	hgsc.bcm.edu	37	5	14401112	14401112	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr5:14401112C>A	ENST00000344204.4	+	31	4679	c.4655C>A	c.(4654-4656)cCt>cAt	p.P1552H	TRIO_ENST00000537187.1_Missense_Mutation_p.P1552H	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1552	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GAAGGAGACCCTTGCAAATTT	0.393																																					p.P1552H		Atlas-SNP	.											.	TRIO	305	.	0			c.C4655A						PASS	.						90.0	87.0	88.0					5																	14401112		2203	4300	6503	SO:0001583	missense	7204	exon31			GAGACCCTTGCAA	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.4655C>A	chr5.hg19:g.14401112C>A	ENSP00000339299:p.Pro1552His	127.0	0.0	.		72.0	32.0	.	NM_007118	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	hg19	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	C	18.24	3.579193	0.65878	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000513206	T;T	0.31769	1.48;1.48	5.8	5.8	0.92144	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.053023	0.85682	D	0.000000	T	0.40815	0.1132	M	0.69823	2.125	0.58432	D	0.999999	B;B	0.25809	0.135;0.005	B;B	0.30029	0.11;0.006	T	0.18840	-1.0324	10	0.42905	T	0.14	.	20.063	0.97692	0.0:1.0:0.0:0.0	.	1552;1552	O75962-5;O75962	.;TRIO_HUMAN	H	1552;1552;1239	ENSP00000339299:P1552H;ENSP00000446348:P1552H	ENSP00000339299:P1552H	P	+	2	0	TRIO	14454112	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.986000	0.70563	2.735000	0.93741	0.655000	0.94253	CCT	.	.	.	none		0.393	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
MAP3K1	4214	hgsc.bcm.edu	37	5	56178645	56178645	+	Silent	SNP	T	T	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr5:56178645T>C	ENST00000399503.3	+	14	3618	c.3618T>C	c.(3616-3618)ccT>ccC	p.P1206P		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1206					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		CCATAGTTCCTCAGCTGCAGG	0.423																																					p.P1206P		Atlas-SNP	.											.	MAP3K1	355	.	0			c.T3618C						PASS	.						77.0	78.0	78.0					5																	56178645		2084	4234	6318	SO:0001819	synonymous_variant	4214	exon14			AGTTCCTCAGCTG	U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.3618T>C	chr5.hg19:g.56178645T>C		61.0	0.0	.		34.0	12.0	.	NM_005921		Silent	SNP	ENST00000399503.3	hg19	CCDS43318.1																																																																																			.	.	.	none		0.423	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132309.2	XM_042066	
DEPDC1B	55789	hgsc.bcm.edu	37	5	59901536	59901536	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr5:59901536C>T	ENST00000265036.5	-	8	1113	c.1046G>A	c.(1045-1047)gGc>gAc	p.G349D	DEPDC1B_ENST00000509006.1_5'UTR|DEPDC1B_ENST00000545085.1_Missense_Mutation_p.G322D|DEPDC1B_ENST00000453022.2_Missense_Mutation_p.G349D	NM_018369.2	NP_060839.2	Q8WUY9	DEP1B_HUMAN	DEP domain containing 1B	349	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(2)|skin(2)	17		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)				GGTACCAAAGCCATCACACAG	0.423																																					p.G349D		Atlas-SNP	.											.	DEPDC1B	56	.	0			c.G1046A						PASS	.						178.0	157.0	164.0					5																	59901536		2203	4300	6503	SO:0001583	missense	55789	exon8			CCAAAGCCATCAC	AF303178	CCDS3977.1, CCDS47214.1	5q12	2008-02-05			ENSG00000035499	ENSG00000035499			24902	protein-coding gene	gene with protein product	"""breast cancer cell 3"""					12477932	Standard	NM_001145208		Approved	XTP1, BRCC3	uc003jsh.3	Q8WUY9	OTTHUMG00000097083	ENST00000265036.5:c.1046G>A	chr5.hg19:g.59901536C>T	ENSP00000265036:p.Gly349Asp	125.0	0.0	.		53.0	22.0	.	NM_001145208	A8K3R9|B4DUT4|Q86WJ3|Q8IZY6|Q9NUN3|Q9NW57	Missense_Mutation	SNP	ENST00000265036.5	hg19	CCDS3977.1	.	.	.	.	.	.	.	.	.	.	C	13.16	2.155593	0.38021	.	.	ENSG00000035499	ENST00000265036;ENST00000453022;ENST00000545085	T;T;T	0.41400	1.0;1.0;1.0	4.18	4.18	0.49190	Rho GTPase-activating protein domain (2);Rho GTPase activation protein (1);	0.363482	0.31167	N	0.008126	T	0.21103	0.0508	N	0.08118	0	0.33818	D	0.628647	B;B	0.24823	0.112;0.088	B;B	0.20184	0.028;0.028	T	0.25047	-1.0143	9	.	.	.	-7.9597	11.4426	0.50105	0.0:0.6472:0.3528:0.0	.	349;349	B4DUT4;Q8WUY9	.;DEP1B_HUMAN	D	349;349;322	ENSP00000265036:G349D;ENSP00000389101:G349D;ENSP00000438320:G322D	.	G	-	2	0	DEPDC1B	59937293	0.062000	0.20869	0.939000	0.37840	0.962000	0.63368	2.567000	0.45956	2.166000	0.68216	0.655000	0.94253	GGC	.	.	.	none		0.423	DEPDC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214207.1	NM_018369	
THBS4	7060	hgsc.bcm.edu	37	5	79375049	79375049	+	Nonsense_Mutation	SNP	C	C	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr5:79375049C>T	ENST00000350881.2	+	19	2669	c.2479C>T	c.(2479-2481)Cga>Tga	p.R827*	CTD-2201I18.1_ENST00000514042.1_RNA|CTD-2201I18.1_ENST00000503007.1_RNA|THBS4_ENST00000511733.1_Nonsense_Mutation_p.R736*|THBS4_ENST00000504720.1_3'UTR	NM_003248.4	NP_003239.2	P35443	TSP4_HUMAN	thrombospondin 4	827	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				behavioral response to pain (GO:0048266)|endothelial cell-cell adhesion (GO:0071603)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of tissue remodeling (GO:0034103)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|tissue remodeling (GO:0048771)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)|integrin binding (GO:0005178)			breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|stomach(3)	34		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		CACCCCATTCCGAGCAGTTGC	0.468																																					p.R827X		Atlas-SNP	.											.	THBS4	82	.	0			c.C2479T						PASS	.						88.0	77.0	81.0					5																	79375049		2203	4300	6503	SO:0001587	stop_gained	7060	exon19			CCATTCCGAGCAG		CCDS4049.1	5q13	2008-05-15			ENSG00000113296	ENSG00000113296			11788	protein-coding gene	gene with protein product		600715				7852353	Standard	NM_003248		Approved		uc021yaw.1	P35443	OTTHUMG00000108173	ENST00000350881.2:c.2479C>T	chr5.hg19:g.79375049C>T	ENSP00000339730:p.Arg827*	83.0	0.0	.		47.0	23.0	.	NM_003248	B2R909|Q86TG2	Nonsense_Mutation	SNP	ENST00000350881.2	hg19	CCDS4049.1	.	.	.	.	.	.	.	.	.	.	C	40	8.514351	0.98843	.	.	ENSG00000113296	ENST00000350881;ENST00000511733	.	.	.	5.08	3.24	0.37175	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.6578	14.4118	0.67119	0.5359:0.4641:0.0:0.0	.	.	.	.	X	827;736	.	ENSP00000339730:R827X	R	+	1	2	THBS4	79410805	1.000000	0.71417	0.998000	0.56505	0.669000	0.39330	1.437000	0.34991	0.789000	0.33779	0.650000	0.86243	CGA	.	.	.	none		0.468	THBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226977.1		
ST8SIA4	7903	hgsc.bcm.edu	37	5	100231400	100231400	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr5:100231400A>G	ENST00000231461.5	-	2	513	c.203T>C	c.(202-204)gTa>gCa	p.V68A	ST8SIA4_ENST00000451528.2_Missense_Mutation_p.V68A	NM_005668.4	NP_005659.1	Q92187	SIA8D_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4	68					axon guidance (GO:0007411)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	25		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)		COAD - Colon adenocarcinoma(37;0.00402)		CCAACCTTCTACATTGTGCTG	0.378																																					p.V68A		Atlas-SNP	.											.	ST8SIA4	77	.	0			c.T203C						PASS	.						121.0	116.0	117.0					5																	100231400		2203	4299	6502	SO:0001583	missense	7903	exon2			CCTTCTACATTGT	L41680	CCDS4091.1, CCDS47252.1	5q21	2013-03-01	2003-01-14	2005-02-07	ENSG00000113532	ENSG00000113532		"""Sialyltransferases"""	10871	protein-coding gene	gene with protein product	"""ST8Sia IV"""	602547	"""sialyltransferase 8 (alpha-2, 8-polysialytransferase) D"""	SIAT8D		7624364	Standard	NM_005668		Approved	PST, PST1	uc003knk.3	Q92187	OTTHUMG00000128727	ENST00000231461.5:c.203T>C	chr5.hg19:g.100231400A>G	ENSP00000231461:p.Val68Ala	135.0	0.0	.		82.0	33.0	.	NM_175052	A8KA07|G3V104|Q8N1F4|Q92693	Missense_Mutation	SNP	ENST00000231461.5	hg19	CCDS4091.1	.	.	.	.	.	.	.	.	.	.	A	13.16	2.154860	0.38021	.	.	ENSG00000113532	ENST00000231461;ENST00000451528	T;T	0.30448	2.29;1.53	6.07	4.92	0.64577	.	0.093065	0.46758	D	0.000265	T	0.16171	0.0389	N	0.24115	0.695	0.29429	N	0.859974	B	0.02656	0.0	B	0.01281	0.0	T	0.26292	-1.0107	10	0.08837	T	0.75	.	6.0554	0.19809	0.7189:0.1383:0.1427:0.0	.	68	Q92187	SIA8D_HUMAN	A	68	ENSP00000231461:V68A;ENSP00000428914:V68A	ENSP00000231461:V68A	V	-	2	0	ST8SIA4	100259299	1.000000	0.71417	0.997000	0.53966	0.966000	0.64601	2.363000	0.44178	1.122000	0.41944	0.533000	0.62120	GTA	.	.	.	none		0.378	ST8SIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250632.3	NM_005668	
ATXN1	6310	hgsc.bcm.edu	37	6	16327864	16327864	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr6:16327864G>C	ENST00000244769.4	-	8	1614	c.678C>G	c.(676-678)caC>caG	p.H226Q	ATXN1_ENST00000436367.1_Missense_Mutation_p.H226Q	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	226					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				CCCTGCTGAGGtgctgctgct	0.652																																					p.H226Q		Atlas-SNP	.											.,1	ATXN1	117	.	0			c.C678G						PASS	.						11.0	15.0	13.0					6																	16327864		2150	4194	6344	SO:0001583	missense	6310	exon7			GCTGAGGTGCTGC	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.678C>G	chr6.hg19:g.16327864G>C	ENSP00000244769:p.His226Gln	80.0	1.0	.		29.0	5.0	.	NM_001128164	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	hg19	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	G	1.926	-0.447046	0.04572	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.27256	1.68;1.68	4.74	0.503	0.16940	.	0.308295	0.34291	N	0.004091	T	0.05686	0.0149	L	0.39397	1.21	0.09310	N	0.999995	B	0.32245	0.361	B	0.28638	0.092	T	0.23976	-1.0173	10	0.48119	T	0.1	-16.8942	3.2876	0.06937	0.3032:0.0:0.385:0.3119	.	226	P54253	ATX1_HUMAN	Q	226	ENSP00000244769:H226Q;ENSP00000416360:H226Q	ENSP00000244769:H226Q	H	-	3	2	ATXN1	16435843	0.437000	0.25593	0.006000	0.13384	0.009000	0.06853	0.925000	0.28791	0.191000	0.20236	0.563000	0.77884	CAC	.	.	.	none		0.652	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
GRM4	2914	hgsc.bcm.edu	37	6	34004335	34004335	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr6:34004335A>C	ENST00000538487.2	-	9	1995	c.1552T>G	c.(1552-1554)Tcc>Gcc	p.S518A	GRM4_ENST00000374181.4_Missense_Mutation_p.S518A|GRM4_ENST00000455714.2_Missense_Mutation_p.S378A|GRM4_ENST00000609222.1_Missense_Mutation_p.S385A|GRM4_ENST00000374177.3_Missense_Mutation_p.S402A|GRM4_ENST00000545715.1_5'UTR|GRM4_ENST00000535756.1_Missense_Mutation_p.S385A|GRM4_ENST00000544773.2_Missense_Mutation_p.S349A	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	518					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CTGCAGATGGAGCGGGGCAGC	0.647																																					p.S518A		Atlas-SNP	.											.	GRM4	317	.	0			c.T1552G						PASS	.						35.0	32.0	33.0					6																	34004335		2201	4299	6500	SO:0001583	missense	2914	exon9			AGATGGAGCGGGG	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.1552T>G	chr6.hg19:g.34004335A>C	ENSP00000440556:p.Ser518Ala	63.0	0.0	.		23.0	14.0	.	NM_000841	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	ENST00000538487.2	hg19	CCDS4787.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.236349	0.79800	.	.	ENSG00000124493	ENST00000374181;ENST00000374177;ENST00000545715;ENST00000535756;ENST00000544773;ENST00000538487;ENST00000455714	D;D;D;D;D;D;D	0.97089	-4.24;-4.24;-4.24;-4.24;-4.24;-4.24;-4.24	4.79	4.79	0.61399	GPCR, family 3, nine cysteines domain (1);	0.000000	0.85682	D	0.000000	D	0.98172	0.9396	M	0.85542	2.76	0.58432	D	0.999997	D;D;D;D;D	0.89917	1.0;1.0;0.99;0.997;1.0	D;D;D;D;D	0.91635	0.999;0.997;0.979;0.992;0.997	D	0.98468	1.0599	10	0.49607	T	0.09	.	14.1617	0.65450	1.0:0.0:0.0:0.0	.	471;349;378;518;385	B7ZLU9;B7Z1T9;F5GXM5;Q14833;B3KVL9	.;.;.;GRM4_HUMAN;.	A	518;402;210;385;349;518;378	ENSP00000363296:S518A;ENSP00000363292:S402A;ENSP00000445533:S210A;ENSP00000437925:S385A;ENSP00000437730:S349A;ENSP00000440556:S518A;ENSP00000398456:S378A	ENSP00000363292:S402A	S	-	1	0	GRM4	34112313	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.130000	0.94437	2.008000	0.58898	0.450000	0.29827	TCC	.	.	.	none		0.647	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2		
SPDEF	25803	hgsc.bcm.edu	37	6	34508954	34508954	+	Silent	SNP	G	G	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr6:34508954G>T	ENST00000374037.3	-	3	855	c.441C>A	c.(439-441)ccC>ccA	p.P147P	SPDEF_ENST00000544425.1_Silent_p.P147P	NM_012391.2	NP_036523.1	O95238	SPDEF_HUMAN	SAM pointed domain containing ETS transcription factor	147	PNT. {ECO:0000255|PROSITE- ProRule:PRU00762}.				cell differentiation (GO:0030154)|intestinal epithelial cell development (GO:0060576)|lung goblet cell differentiation (GO:0060480)|multicellular organismal development (GO:0007275)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell fate commitment (GO:0010455)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)	15						TCCAGTCCATGGGATCTGGGC	0.642																																					p.P147P		Atlas-SNP	.											.	SPDEF	34	.	0			c.C441A						PASS	.						34.0	33.0	33.0					6																	34508954		2203	4299	6502	SO:0001819	synonymous_variant	25803	exon3			GTCCATGGGATCT	AF071538	CCDS4794.1, CCDS59013.1	6p21.3	2013-08-07	2013-08-07		ENSG00000124664	ENSG00000124664			17257	protein-coding gene	gene with protein product		608144	"""SAM pointed domain containing ets transcription factor"""			10625666, 6857767	Standard	NM_012391		Approved	PDEF, bA375E1.3	uc003ojq.2	O95238	OTTHUMG00000014548	ENST00000374037.3:c.441C>A	chr6.hg19:g.34508954G>T		59.0	0.0	.		27.0	12.0	.	NM_001252294	B4DWH8|F5H778	Silent	SNP	ENST00000374037.3	hg19	CCDS4794.1																																																																																			.	.	.	none		0.642	SPDEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040246.1	NM_012391	
C6orf223	221416	hgsc.bcm.edu	37	6	43969793	43969793	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr6:43969793T>C	ENST00000336600.5	+	3	232	c.212T>C	c.(211-213)cTg>cCg	p.L71P	RP5-1120P11.1_ENST00000607590.1_RNA|C6orf223_ENST00000442114.2_Missense_Mutation_p.L51P|C6orf223_ENST00000448947.2_3'UTR|C6orf223_ENST00000439969.2_Silent_p.S85S|RP5-1120P11.1_ENST00000422059.1_RNA	NM_001171992.1|NM_153246.4	NP_001165463.1|NP_694978.2	Q8N319	CF223_HUMAN	chromosome 6 open reading frame 223	71										central_nervous_system(1)|lung(2)|pancreas(1)|prostate(1)|urinary_tract(1)	6	all_cancers(18;2.28e-07)|all_epithelial(2;1.62e-08)|Lung NSC(15;0.000172)|all_lung(25;0.000533)|Hepatocellular(11;0.00309)|Ovarian(13;0.0437)		all cancers(41;0.00141)|Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.217)			ttgccagatctggtaacccta	0.463																																					p.L71P		Atlas-SNP	.											.	C6orf223	14	.	0			c.T212C						PASS	.						88.0	87.0	87.0					6																	43969793		2156	4227	6383	SO:0001583	missense	221416	exon3			CAGATCTGGTAAC	BC032706	CCDS34459.1, CCDS55016.1	6p21.1	2012-09-05			ENSG00000181577	ENSG00000181577			28692	protein-coding gene	gene with protein product						12477932	Standard	NM_153246		Approved	MGC45491	uc003own.3	Q8N319	OTTHUMG00000014753	ENST00000336600.5:c.212T>C	chr6.hg19:g.43969793T>C	ENSP00000426159:p.Leu71Pro	98.0	0.0	.		58.0	22.0	.	NM_153246	E9PB59|Q8N575	Missense_Mutation	SNP	ENST00000336600.5	hg19	CCDS34459.1	.	.	.	.	.	.	.	.	.	.	T	4.326	0.059826	0.08339	.	.	ENSG00000181577	ENST00000336600	T	0.44482	0.92	3.87	-0.527	0.11909	.	1.108720	0.07254	N	0.866419	T	0.38268	0.1034	.	.	.	0.22127	N	0.999349	D	0.71674	0.998	D	0.66351	0.943	T	0.14868	-1.0457	9	0.87932	D	0	.	4.1088	0.10049	0.4521:0.0:0.1694:0.3784	.	71	Q8N319	CF223_HUMAN	P	71	ENSP00000426159:L71P	ENSP00000426159:L71P	L	+	2	0	C6orf223	44077771	0.330000	0.24705	0.001000	0.08648	0.005000	0.04900	0.534000	0.23098	-0.065000	0.13021	0.459000	0.35465	CTG	.	.	.	none		0.463	C6orf223-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040702.3	NM_153246	
LTV1	84946	hgsc.bcm.edu	37	6	144179108	144179108	+	Silent	SNP	T	T	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr6:144179108T>C	ENST00000367576.5	+	6	893	c.759T>C	c.(757-759)aaT>aaC	p.N253N		NM_032860.3	NP_116249.2	Q96GA3	LTV1_HUMAN	LTV1 ribosome biogenesis factor	253						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(155;2.72e-06)|GBM - Glioblastoma multiforme(68;0.0372)		TGAGGAGAAATGAACAGCTGA	0.398																																					p.N253N		Atlas-SNP	.											.	LTV1	48	.	0			c.T759C						PASS	.						73.0	73.0	73.0					6																	144179108		2203	4300	6503	SO:0001819	synonymous_variant	84946	exon6			GAGAAATGAACAG	BC009855	CCDS5201.1	6q24.2	2014-02-03	2014-02-03	2006-02-06	ENSG00000135521	ENSG00000135521			21173	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 93"", ""LTV1 homolog (S. cerevisiae)"""	C6orf93			Standard	NM_032860		Approved	FLJ14909, dJ468K18.4	uc003qjs.3	Q96GA3	OTTHUMG00000015733	ENST00000367576.5:c.759T>C	chr6.hg19:g.144179108T>C		110.0	0.0	.		47.0	20.0	.	NM_032860	Q96JX8	Silent	SNP	ENST00000367576.5	hg19	CCDS5201.1																																																																																			.	.	.	none		0.398	LTV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042532.1	NM_032860	
ZNF3	7551	hgsc.bcm.edu	37	7	99669236	99669236	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr7:99669236T>C	ENST00000424697.1	-	6	1177	c.871A>G	c.(871-873)Aag>Gag	p.K291E	ZNF3_ENST00000303915.6_Missense_Mutation_p.K291E|ZNF3_ENST00000299667.4_Missense_Mutation_p.K291E|ZNF3_ENST00000413658.2_Intron	NM_001278284.1|NM_001278287.1|NM_001278290.1|NM_001278291.1|NM_001278292.1|NM_032924.3	NP_001265213.1|NP_001265216.1|NP_001265219.1|NP_001265220.1|NP_001265221.1|NP_116313.3	P17036	ZNF3_HUMAN	zinc finger protein 3	291					cell differentiation (GO:0030154)|leukocyte activation (GO:0045321)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	25	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)	Ovarian(593;2.06e-05)|Myeloproliferative disorder(862;0.0122)|Breast(660;0.029)	STAD - Stomach adenocarcinoma(171;0.129)			CTGAAGGTCTTCCCACACTCA	0.527																																					p.K291E		Atlas-SNP	.											.	ZNF3	54	.	0			c.A871G						PASS	.						57.0	64.0	62.0					7																	99669236		2202	4300	6502	SO:0001583	missense	7551	exon6			AGGTCTTCCCACA	AF027136	CCDS43618.1, CCDS43619.1	7q22.1	2013-01-08	2006-05-05					"""Zinc fingers, C2H2-type"", ""-"""	13089	protein-coding gene	gene with protein product		194510	"""zinc finger protein 3 (A8-51)"""				Standard	NM_032924		Approved	A8-51, KOX25, PP838, FLJ20216, HF.12, Zfp113	uc003usr.4	P17036		ENST00000424697.1:c.871A>G	chr7.hg19:g.99669236T>C	ENSP00000415358:p.Lys291Glu	99.0	0.0	.		100.0	49.0	.	NM_032924	D6W5U0|P13683|Q9HBR4|Q9NNX8|Q9NXJ1|Q9UC15|Q9UC16	Missense_Mutation	SNP	ENST00000424697.1	hg19	CCDS43619.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.498565	0.85069	.	.	ENSG00000166526	ENST00000424697;ENST00000303915;ENST00000299667	T;T;T	0.35973	1.28;1.28;1.28	4.6	4.6	0.57074	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.56097	D	0.000028	T	0.60547	0.2277	M	0.80028	2.48	0.53005	D	0.99996	D;D	0.89917	0.998;1.0	D;D	0.91635	0.991;0.999	T	0.66172	-0.5990	10	0.87932	D	0	-36.512	12.2643	0.54668	0.0:0.0:0.0:1.0	.	274;291	B3KRP4;P17036	.;ZNF3_HUMAN	E	291	ENSP00000415358:K291E;ENSP00000306372:K291E;ENSP00000299667:K291E	ENSP00000299667:K291E	K	-	1	0	ZNF3	99507172	0.994000	0.37717	1.000000	0.80357	0.995000	0.86356	2.522000	0.45572	2.075000	0.62263	0.533000	0.62120	AAG	.	.	.	none		0.527	ZNF3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336247.3	NM_017715	
HIPK2	28996	hgsc.bcm.edu	37	7	139311504	139311504	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr7:139311504T>C	ENST00000406875.3	-	6	1556	c.1462A>G	c.(1462-1464)Agc>Ggc	p.S488G	HIPK2_ENST00000342645.6_Missense_Mutation_p.S488G|HIPK2_ENST00000428878.2_Missense_Mutation_p.S488G	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	488	Interaction with DAXX.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					AACATGTCGCTCCCTTCCAAA	0.507																																					p.S488G		Atlas-SNP	.											.	HIPK2	192	.	0			c.A1462G						PASS	.						174.0	175.0	175.0					7																	139311504		2001	4177	6178	SO:0001583	missense	28996	exon6			TGTCGCTCCCTTC	AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.1462A>G	chr7.hg19:g.139311504T>C	ENSP00000385571:p.Ser488Gly	98.0	0.0	.		106.0	46.0	.	NM_022740	Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	ENST00000406875.3	hg19		.	.	.	.	.	.	.	.	.	.	T	15.60	2.880967	0.51801	.	.	ENSG00000064393	ENST00000406875;ENST00000428878;ENST00000342645	T;T;T	0.20598	2.06;2.06;2.06	5.67	5.67	0.87782	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.41442	0.1159	.	.	.	0.52501	D	0.999952	D;P	0.63046	0.992;0.525	D;B	0.76071	0.987;0.158	T	0.11084	-1.0602	8	0.19590	T	0.45	.	15.9026	0.79392	0.0:0.0:0.0:1.0	.	488;488	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	G	488	ENSP00000385571:S488G;ENSP00000413724:S488G;ENSP00000343108:S488G	ENSP00000343108:S488G	S	-	1	0	HIPK2	138962044	1.000000	0.71417	0.844000	0.33320	0.847000	0.48162	7.986000	0.88173	2.163000	0.67991	0.368000	0.22195	AGC	.	.	.	none		0.507	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349430.3	NM_022740	
OR2F1	26211	hgsc.bcm.edu	37	7	143657752	143657752	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr7:143657752C>G	ENST00000392899.1	+	1	726	c.689C>G	c.(688-690)tCc>tGc	p.S230C	RP4-669B10.3_ENST00000466281.1_lincRNA	NM_012369.2	NP_036501.2	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F, member 1 (gene/pseudogene)	230					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|skin(4)	34	Melanoma(164;0.0903)					AAGATCCAGTCCAGAGAAGGA	0.493																																					p.S230C		Atlas-SNP	.											.	OR2F1	71	.	0			c.C689G						PASS	.						183.0	161.0	168.0					7																	143657752		2203	4300	6503	SO:0001583	missense	26211	exon1			TCCAGTCCAGAGA	U56421	CCDS5887.1	7q35	2013-06-03	2013-06-03		ENSG00000213215	ENSG00000213215		"""GPCR / Class A : Olfactory receptors"""	8246	protein-coding gene	gene with protein product		608497	"""olfactory receptor, family 2, subfamily F, member 1"""	OR2F4, OR2F5, OR2F3, OR2F3P		9500546	Standard	NM_012369		Approved	OLF3, OR7-140, OR7-139, OR14-60	uc003wds.1	Q13607	OTTHUMG00000157771	ENST00000392899.1:c.689C>G	chr7.hg19:g.143657752C>G	ENSP00000376633:p.Ser230Cys	150.0	0.0	.		156.0	68.0	.	NM_012369	A4D2G1|Q6IFP7|Q96R49|Q9UDX1	Missense_Mutation	SNP	ENST00000392899.1	hg19	CCDS5887.1	.	.	.	.	.	.	.	.	.	.	C	15.75	2.925090	0.52759	.	.	ENSG00000213215	ENST00000392899	T	0.00575	6.46	5.53	5.53	0.82687	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000064	T	0.04407	0.0121	M	0.91354	3.2	0.43913	D	0.996555	D	0.89917	1.0	D	0.91635	0.999	T	0.01608	-1.1313	10	0.87932	D	0	-33.0786	17.0114	0.86407	0.0:1.0:0.0:0.0	.	230	Q13607	OR2F1_HUMAN	C	230	ENSP00000376633:S230C	ENSP00000376633:S230C	S	+	2	0	OR2F1	143288685	0.411000	0.25384	0.245000	0.24217	0.417000	0.31264	2.968000	0.49224	2.871000	0.98454	0.655000	0.94253	TCC	.	.	.	none		0.493	OR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349581.1		
ATP6V1B2	526	hgsc.bcm.edu	37	8	20077779	20077779	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr8:20077779T>C	ENST00000276390.2	+	14	1442	c.1402T>C	c.(1402-1404)Tac>Cac	p.Y468H		NM_001693.3	NP_001684.2	P21281	VATB2_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2	468					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|ruffle (GO:0001726)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			endometrium(1)|kidney(2)|lung(5)|prostate(1)	9				Colorectal(74;0.0535)|COAD - Colon adenocarcinoma(73;0.211)	Gallium nitrate(DB05260)	TTAAGGTCCTTACGAAAATCG	0.388																																					p.Y468H	Pancreas(119;1230 1726 3901 4036 31644)	Atlas-SNP	.											.	ATP6V1B2	34	.	0			c.T1402C						PASS	.						102.0	99.0	100.0					8																	20077779		2203	4300	6503	SO:0001583	missense	526	exon14			GGTCCTTACGAAA	L35249	CCDS6014.1	8p21.3	2010-04-21	2006-01-13	2002-05-10	ENSG00000147416	ENSG00000147416	3.6.3.14	"""ATPases / V-type"""	854	protein-coding gene	gene with protein product		606939	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), beta polypeptide, 56/58kD, isoform 2"", ""ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2"""	VPP3, ATP6B2		2145275, 14580332	Standard	NM_001693		Approved	VATB, Vma2, HO57	uc003wzp.3	P21281	OTTHUMG00000131073	ENST00000276390.2:c.1402T>C	chr8.hg19:g.20077779T>C	ENSP00000276390:p.Tyr468His	140.0	0.0	.		81.0	36.0	.	NM_001693	B2R5Z3|D3DSQ5|Q14544|Q15859|Q96IR0	Missense_Mutation	SNP	ENST00000276390.2	hg19	CCDS6014.1	.	.	.	.	.	.	.	.	.	.	T	16.87	3.242329	0.58995	.	.	ENSG00000147416	ENST00000276390;ENST00000542368	T	0.79554	-1.28	5.32	5.32	0.75619	ATPase, F1/V1/A1 complex, alpha/beta subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.83220	0.5207	M	0.70108	2.13	0.80722	D	1	B	0.32507	0.373	B	0.41202	0.35	D	0.84288	0.0498	10	0.66056	D	0.02	-15.2107	14.392	0.66986	0.0:0.0:0.0:1.0	.	468	P21281	VATB2_HUMAN	H	468;342	ENSP00000276390:Y468H	ENSP00000276390:Y468H	Y	+	1	0	ATP6V1B2	20122059	1.000000	0.71417	0.990000	0.47175	0.969000	0.65631	8.040000	0.89188	2.134000	0.65973	0.460000	0.39030	TAC	.	.	.	none		0.388	ATP6V1B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253732.1	NM_001693	
PLEC	5339	hgsc.bcm.edu	37	8	144995292	144995292	+	Silent	SNP	G	G	T	rs200383203	byFrequency	TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr8:144995292G>T	ENST00000322810.4	-	32	9277	c.9108C>A	c.(9106-9108)tcC>tcA	p.S3036S	PLEC_ENST00000356346.3_Silent_p.S2885S|PLEC_ENST00000398774.2_Silent_p.S2867S|PLEC_ENST00000354958.2_Silent_p.S2877S|PLEC_ENST00000436759.2_Silent_p.S2926S|PLEC_ENST00000345136.3_Silent_p.S2899S|PLEC_ENST00000527096.1_Silent_p.S2922S|PLEC_ENST00000354589.3_Silent_p.S2899S|PLEC_ENST00000357649.2_Silent_p.S2903S	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3036	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CCCGGGCCTCGGAGTCAGTGT	0.617																																					p.S3036S		Atlas-SNP	.											PLEC_ENST00000436759,NS,carcinoma,0,4	PLEC	1144	.	0			c.C9108A						PASS	.						58.0	66.0	63.0					8																	144995292		2203	4300	6503	SO:0001819	synonymous_variant	5339	exon32			GGCCTCGGAGTCA	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.9108C>A	chr8.hg19:g.144995292G>T		64.0	0.0	.		28.0	14.0	.	NM_201380	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	hg19	CCDS43772.1																																																																																			.	G|1.000;A|0.000	.	alt		0.617	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
CCDC171	203238	hgsc.bcm.edu	37	9	15724954	15724954	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr9:15724954G>C	ENST00000380701.3	+	14	2000	c.1672G>C	c.(1672-1674)Gct>Cct	p.A558P	CCDC171_ENST00000297641.3_Missense_Mutation_p.A558P	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	558																	GCTTTCCCAGGCTTTCCATAA	0.428																																					p.A558P		Atlas-SNP	.											.	.	.	.	0			c.G1672C						PASS	.						76.0	78.0	78.0					9																	15724954		2203	4300	6503	SO:0001583	missense	203238	exon14			TCCCAGGCTTTCC	AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.1672G>C	chr9.hg19:g.15724954G>C	ENSP00000370077:p.Ala558Pro	247.0	0.0	.		126.0	59.0	.	NM_173550	B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Missense_Mutation	SNP	ENST00000380701.3	hg19	CCDS6481.1	.	.	.	.	.	.	.	.	.	.	G	18.24	3.580851	0.65992	.	.	ENSG00000164989	ENST00000297641;ENST00000380701	T;T	0.56103	0.48;0.48	5.63	3.81	0.43845	.	0.436641	0.26773	N	0.022576	T	0.52789	0.1756	L	0.27053	0.805	0.80722	D	1	P;P;P	0.48589	0.912;0.912;0.912	P;P;P	0.54759	0.76;0.696;0.76	T	0.47812	-0.9088	10	0.31617	T	0.26	-0.6344	15.1024	0.72292	0.0788:0.0:0.9212:0.0	.	566;558;558	B7ZM22;Q6TFL3-3;Q6TFL3	.;.;CI093_HUMAN	P	558	ENSP00000297641:A558P;ENSP00000370077:A558P	ENSP00000297641:A558P	A	+	1	0	C9orf93	15714954	1.000000	0.71417	0.997000	0.53966	0.951000	0.60555	3.772000	0.55325	0.872000	0.35775	0.655000	0.94253	GCT	.	.	.	none		0.428	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051768.4	NM_173550	
PRUNE2	158471	hgsc.bcm.edu	37	9	79322239	79322239	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr9:79322239T>C	ENST00000376718.3	-	8	5074	c.4951A>G	c.(4951-4953)Aca>Gca	p.T1651A	PRUNE2_ENST00000428286.1_Missense_Mutation_p.T1292A	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1651					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						TCCTGATGTGTCCCTGAATGT	0.413																																					p.T1651A		Atlas-SNP	.											.	PRUNE2	331	.	0			c.A4951G						PASS	.						60.0	51.0	53.0					9																	79322239		1568	3582	5150	SO:0001583	missense	158471	exon8			GATGTGTCCCTGA	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.4951A>G	chr9.hg19:g.79322239T>C	ENSP00000365908:p.Thr1651Ala	139.0	0.0	.		75.0	24.0	.	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	hg19	CCDS47982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.001|0.001	-2.928036|-2.928036	0.00054|0.00054	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000426088|ENST00000376718;ENST00000428286;ENST00000422033	.|T;T	.|0.36520	.|1.27;1.25	4.88|4.88	0.901|0.901	0.19284|0.19284	.|.	.|0.433490	.|0.19678	.|N	.|0.108589	T|T	0.09158|0.09158	0.0226|0.0226	N|N	0.01109|0.01109	-1.01|-1.01	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.38090|0.38090	-0.9677|-0.9677	5|10	.|0.02654	.|T	.|1	-0.1643|-0.1643	7.7278|7.7278	0.28769|0.28769	0.0:0.6452:0.0:0.3548|0.0:0.6452:0.0:0.3548	.|.	.|1651	.|Q8WUY3	.|PRUN2_HUMAN	G|A	972|1651;1292;1650	.|ENSP00000365908:T1651A;ENSP00000397425:T1292A	.|ENSP00000365908:T1651A	D|T	-|-	2|1	0|0	PRUNE2|PRUNE2	78512059|78512059	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.026000|0.026000	0.11368|0.11368	-0.115000|-0.115000	0.10741|0.10741	0.049000|0.049000	0.15920|0.15920	-0.242000|-0.242000	0.12053|0.12053	GAC|ACA	.	.	.	none		0.413	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
RNF20	56254	hgsc.bcm.edu	37	9	104309714	104309714	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr9:104309714A>G	ENST00000389120.3	+	9	1096	c.1006A>G	c.(1006-1008)Aaa>Gaa	p.K336E	AL591377.1_ENST00000584534.1_RNA	NM_019592.5	NP_062538.5	Q5VTR2	BRE1A_HUMAN	ring finger protein 20, E3 ubiquitin protein ligase	336					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|negative regulation of cell migration (GO:0030336)|positive regulation of histone methylation (GO:0031062)|positive regulation of transcription, DNA-templated (GO:0045893)|protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(6)|large_intestine(7)|lung(23)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		TGAGGAGAACAAAGAGTTGGC	0.408																																					p.K336E		Atlas-SNP	.											.	RNF20	110	.	0			c.A1006G						PASS	.						73.0	74.0	74.0					9																	104309714		2203	4300	6503	SO:0001583	missense	56254	exon9			GAGAACAAAGAGT	AF265230	CCDS35084.1	9q22	2012-02-23	2012-02-23	2008-12-12	ENSG00000155827	ENSG00000155827		"""RING-type (C3HC4) zinc fingers"""	10062	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog (S. cerevisiae)"""	607699	"""ring finger protein 20"""			16337599, 12876294, 18832071, 19037095	Standard	NM_019592		Approved	FLJ20382, FLJ11189, KAIA2779, BRE1A, hBRE1, BRE1	uc004bbn.3	Q5VTR2	OTTHUMG00000020385	ENST00000389120.3:c.1006A>G	chr9.hg19:g.104309714A>G	ENSP00000373772:p.Lys336Glu	236.0	0.0	.		151.0	57.0	.	NM_019592	A7MCT5|Q2TB34|Q69YL5|Q6P527|Q8N3J4|Q96JD3|Q9H9Y7|Q9HA51|Q9NUR4|Q9NWQ3|Q9NX83	Missense_Mutation	SNP	ENST00000389120.3	hg19	CCDS35084.1	.	.	.	.	.	.	.	.	.	.	A	16.80	3.222742	0.58668	.	.	ENSG00000155827	ENST00000389120	T	0.39592	1.07	5.41	5.41	0.78517	.	0.130255	0.64402	D	0.000001	T	0.33000	0.0848	L	0.46157	1.445	0.46416	D	0.999031	B	0.16603	0.018	B	0.11329	0.006	T	0.12243	-1.0555	10	0.08381	T	0.77	-24.3341	12.0138	0.53303	0.8558:0.1442:0.0:0.0	.	336	Q5VTR2	BRE1A_HUMAN	E	336	ENSP00000373772:K336E	ENSP00000373772:K336E	K	+	1	0	RNF20	103349535	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.562000	0.60816	2.174000	0.68829	0.460000	0.39030	AAA	.	.	.	none		0.408	RNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356402.1	NM_019592	
SVEP1	79987	hgsc.bcm.edu	37	9	113241924	113241924	+	Silent	SNP	C	C	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr9:113241924C>T	ENST00000401783.2	-	13	2814	c.2478G>A	c.(2476-2478)ctG>ctA	p.L826L	SVEP1_ENST00000374469.1_Silent_p.L803L|SVEP1_ENST00000374461.1_Silent_p.L803L|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000302728.8_Silent_p.L826L	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	826					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CCATTTTTCCCAGGGTCGTCT	0.388																																					p.L826L		Atlas-SNP	.											.	SVEP1	326	.	0			c.G2478A						PASS	.						242.0	234.0	236.0					9																	113241924		1844	4091	5935	SO:0001819	synonymous_variant	79987	exon13			TTTTCCCAGGGTC	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.2478G>A	chr9.hg19:g.113241924C>T		130.0	0.0	.		56.0	27.0	.	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Silent	SNP	ENST00000401783.2	hg19	CCDS48004.1																																																																																			.	.	.	none		0.388	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
C9orf84	158401	hgsc.bcm.edu	37	9	114484785	114484785	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr9:114484785G>C	ENST00000318737.4	-	13	1971	c.1843C>G	c.(1843-1845)Cct>Gct	p.P615A	C9orf84_ENST00000394779.3_Missense_Mutation_p.P576A|C9orf84_ENST00000394777.4_Missense_Mutation_p.P576A|C9orf84_ENST00000374287.3_Missense_Mutation_p.P615A	NM_173521.3	NP_775792.3	Q5VXU9	CI084_HUMAN	chromosome 9 open reading frame 84	615										breast(1)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(10)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TTAGCAGTAGGGAGGGTACAC	0.398																																					p.P615A		Atlas-SNP	.											.	C9orf84	207	.	0			c.C1843G						PASS	.						110.0	108.0	108.0					9																	114484785		2203	4300	6503	SO:0001583	missense	158401	exon13			CAGTAGGGAGGGT	AL833535	CCDS6781.3, CCDS43863.1	9q32	2012-03-16			ENSG00000165181	ENSG00000165181			26535	protein-coding gene	gene with protein product							Standard	XM_005251738		Approved	FLJ32779	uc004bfr.3	Q5VXU9	OTTHUMG00000020495	ENST00000318737.4:c.1843C>G	chr9.hg19:g.114484785G>C	ENSP00000322108:p.Pro615Ala	141.0	0.0	.		71.0	27.0	.	NM_173521	A2A2V3|Q2M1H8|Q96M73	Missense_Mutation	SNP	ENST00000318737.4	hg19	CCDS6781.3	.	.	.	.	.	.	.	.	.	.	G	11.93	1.785821	0.31593	.	.	ENSG00000165181	ENST00000394779;ENST00000394777;ENST00000394778;ENST00000374287;ENST00000318737	T;T;T;T	0.05382	3.58;3.45;3.58;3.58	5.8	4.91	0.64330	.	0.253301	0.28630	N	0.014667	T	0.06690	0.0171	L	0.32530	0.975	0.09310	N	1	P;P;P	0.40970	0.734;0.734;0.734	B;B;B	0.43478	0.421;0.421;0.421	T	0.33137	-0.9880	10	0.22706	T	0.39	-8.4088	9.0522	0.36383	0.079:0.2432:0.6777:0.0	.	576;615;576	A6PVK7;Q5VXU9;A2A2V3	.;CI084_HUMAN;.	A	576;576;229;615;615	ENSP00000378259:P576A;ENSP00000378257:P576A;ENSP00000363405:P615A;ENSP00000322108:P615A	ENSP00000322108:P615A	P	-	1	0	C9orf84	113524606	0.993000	0.37304	0.590000	0.28732	0.735000	0.41995	2.883000	0.48554	1.478000	0.48253	0.561000	0.74099	CCT	.	.	.	none		0.398	C9orf84-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053656.2	NM_173521	
CFAP70	118491	hgsc.bcm.edu	37	10	75051507	75051507	+	Silent	SNP	C	C	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr10:75051507C>T	ENST00000310715.3	-	19	2241	c.2121G>A	c.(2119-2121)ttG>ttA	p.L707L	TTC18_ENST00000340329.3_Intron|TTC18_ENST00000493787.1_5'UTR|TTC18_ENST00000401621.2_Silent_p.L707L|TTC18_ENST00000394865.1_Silent_p.L707L|TTC18_ENST00000355577.3_Silent_p.L176L	NM_145170.3	NP_660153.3	Q5T0N1	TTC18_HUMAN		707						extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	Prostate(51;0.0119)					CACCACACAGCAACAAGCTGA	0.428																																					p.L707L		Atlas-SNP	.											.	TTC18	106	.	0			c.G2121A						PASS	.						111.0	88.0	96.0					10																	75051507		2203	4300	6503	SO:0001819	synonymous_variant	118491	exon19			ACACAGCAACAAG																												ENST00000310715.3:c.2121G>A	chr10.hg19:g.75051507C>T		166.0	0.0	.		96.0	35.0	.	NM_145170	C9JIZ9|Q5T0M4|Q5T0M9|Q5T0N0|Q69YH9|Q8IYZ8|Q8N7D5|Q8NI30|Q8NI31	Silent	SNP	ENST00000310715.3	hg19	CCDS7324.3																																																																																			.	.	.	none		0.428	TTC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
ZDHHC16	84287	hgsc.bcm.edu	37	10	99213338	99213339	+	Missense_Mutation	DNP	TC	TC	CT			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr10:99213338_99213339TC>CT	ENST00000370854.3	+	6	797_798	c.608_609TC>CT	c.(607-609)tTC>tCT	p.F203S	ZDHHC16_ENST00000352634.4_Missense_Mutation_p.F203S|ZDHHC16_ENST00000370842.2_Missense_Mutation_p.F203S|ZDHHC16_ENST00000370846.4_Intron|ZDHHC16_ENST00000495735.1_3'UTR|ZDHHC16_ENST00000353979.3_Intron|ZDHHC16_ENST00000393760.1_Missense_Mutation_p.F203S|ZDHHC16_ENST00000345745.5_Missense_Mutation_p.F138S	NM_032327.2	NP_115703.2	Q969W1	ZDH16_HUMAN	zinc finger, DHHC-type containing 16	203					apoptotic process (GO:0006915)|protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			kidney(4)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	14		Colorectal(252;0.0846)		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)		TTCTTCTCTTTCTGCTTTTTCA	0.47																																					p.F203S|p.F203F		Atlas-SNP	.											.	ZDHHC16	25	.	0			c.T608C|c.C609T						PASS	.																																			SO:0001583	missense	84287	exon7			TCTCTTTCTGCTT|CTCTTTCTGCTTT	AF258563	CCDS7460.1, CCDS7461.1, CCDS7462.1, CCDS7463.1, CCDS73176.1	10q24.1	2008-05-02			ENSG00000171307	ENSG00000171307		"""Zinc fingers, DHHC-type"""	20714	protein-coding gene	gene with protein product						12021275	Standard	NM_198043		Approved	APH2	uc001knk.3	Q969W1	OTTHUMG00000018847	Exception_encountered	chr10.hg19:g.99213338_99213339delinsCT	ENSP00000359891:p.Phe203Ser	121.0	0.0	.		58.0	23.0	.	NM_198046	D3DR52|D3DR53|D3DR54|Q5JTG7|Q5JTH0|Q8N4Z6|Q8WY84|Q9BSV3	Missense_Mutation|Silent	SNP	ENST00000370854.3	hg19	CCDS7460.1																																																																																			.	.	.	none		0.470	ZDHHC16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049658.2	NM_032327	
FAM160B1	57700	hgsc.bcm.edu	37	10	116606357	116606357	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr10:116606357C>A	ENST00000369248.4	+	11	1773	c.1438C>A	c.(1438-1440)Caa>Aaa	p.Q480K	FAM160B1_ENST00000369250.3_Missense_Mutation_p.Q480K	NM_020940.3	NP_065991.3	Q5W0V3	F16B1_HUMAN	family with sequence similarity 160, member B1	480										NS(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)	25						ACATCTTTTACAAAAACCCAA	0.299																																					p.Q480K		Atlas-SNP	.											.	FAM160B1	107	.	0			c.C1438A						PASS	.						70.0	69.0	69.0					10																	116606357		2203	4300	6503	SO:0001583	missense	57700	exon11			CTTTTACAAAAAC	AB046820	CCDS31290.1, CCDS44480.1	10q26.11	2008-06-05	2008-06-05	2008-06-05	ENSG00000151553	ENSG00000151553			29320	protein-coding gene	gene with protein product			"""KIAA1600"""	KIAA1600		10997877	Standard	NM_020940		Approved	bA106M7.3	uc001lcb.3	Q5W0V3	OTTHUMG00000019092	ENST00000369248.4:c.1438C>A	chr10.hg19:g.116606357C>A	ENSP00000358251:p.Gln480Lys	120.0	0.0	.		104.0	44.0	.	NM_020940	Q5H9P7|Q5W0V2|Q8IY76|Q9HCH2	Missense_Mutation	SNP	ENST00000369248.4	hg19	CCDS31290.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.722985	0.89298	.	.	ENSG00000151553	ENST00000369248;ENST00000369250	T;T	0.30448	1.53;1.53	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.49201	0.1543	M	0.76574	2.34	0.80722	D	1	P;P	0.48911	0.917;0.734	P;B	0.55508	0.777;0.325	T	0.38564	-0.9655	10	0.07990	T	0.79	-24.5865	20.1338	0.98010	0.0:1.0:0.0:0.0	.	480;480	Q5W0V3-2;Q5W0V3	.;F16B1_HUMAN	K	480	ENSP00000358251:Q480K;ENSP00000358253:Q480K	ENSP00000358251:Q480K	Q	+	1	0	FAM160B1	116596347	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.500000	0.81588	2.770000	0.95276	0.655000	0.94253	CAA	.	.	.	none		0.299	FAM160B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050499.1	XM_049351	
OR52B6	340980	hgsc.bcm.edu	37	11	5602863	5602863	+	Missense_Mutation	SNP	C	C	T	rs375173605		TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr11:5602863C>T	ENST00000345043.2	+	1	757	c.757C>T	c.(757-759)Cgc>Tgc	p.R253C	HBG2_ENST00000380259.2_Intron|AC015691.13_ENST00000394793.2_RNA	NM_001005162.2	NP_001005162.2	Q8NGF0	O52B6_HUMAN	olfactory receptor, family 52, subfamily B, member 6	253						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|lung(7)|ovary(1)|prostate(1)	12		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;3.56e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCAAGATGCCCGCTCCAAGGC	0.512																																					p.R253C		Atlas-SNP	.											.	OR52B6	37	.	0			c.C757T						PASS	.	C	CYS/ARG	1,4041		0,1,2020	217.0	232.0	227.0		757	3.0	0.5	11		227	0,8354		0,0,4177	no	missense	OR52B6	NM_001005162.2	180	0,1,6197	TT,TC,CC		0.0,0.0247,0.0081	benign	253/336	5602863	1,12395	2021	4177	6198	SO:0001583	missense	340980	exon1			GATGCCCGCTCCA	AB065858	CCDS41611.1	11p15.4	2012-08-09			ENSG00000187747	ENSG00000187747		"""GPCR / Class A : Olfactory receptors"""	15211	protein-coding gene	gene with protein product							Standard	NM_001005162		Approved		uc010qzi.2	Q8NGF0	OTTHUMG00000066906	ENST00000345043.2:c.757C>T	chr11.hg19:g.5602863C>T	ENSP00000341581:p.Arg253Cys	143.0	0.0	.		89.0	42.0	.	NM_001005162	Q6IFI7	Missense_Mutation	SNP	ENST00000345043.2	hg19	CCDS41611.1	.	.	.	.	.	.	.	.	.	.	C	8.515	0.867481	0.17250	2.47E-4	0.0	ENSG00000187747	ENST00000345043	T	0.00337	8.05	4.99	3.05	0.35203	GPCR, rhodopsin-like superfamily (1);	0.218860	0.22458	U	0.059787	T	0.00328	0.0010	M	0.78637	2.42	0.21220	N	0.999759	P	0.35011	0.48	B	0.34346	0.18	T	0.36016	-0.9765	10	0.72032	D	0.01	.	7.8717	0.29569	0.325:0.5173:0.1577:0.0	.	253	Q8NGF0	O52B6_HUMAN	C	253	ENSP00000341581:R253C	ENSP00000341581:R253C	R	+	1	0	OR52B6	5559439	0.000000	0.05858	0.478000	0.27316	0.464000	0.32679	-1.090000	0.03372	0.638000	0.30545	0.650000	0.86243	CGC	.	.	.	weak		0.512	OR52B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143397.1	NM_001005162	
F2	2147	hgsc.bcm.edu	37	11	46747489	46747489	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr11:46747489G>C	ENST00000311907.5	+	7	696	c.640G>C	c.(640-642)Gtc>Ctc	p.V214L	F2_ENST00000530231.1_Missense_Mutation_p.V214L	NM_000506.3	NP_000497.1	P00734	THRB_HUMAN	coagulation factor II (thrombin)	214	Kringle 2. {ECO:0000255|PROSITE- ProRule:PRU00121}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell surface receptor signaling pathway (GO:0007166)|cellular protein metabolic process (GO:0044267)|cytosolic calcium ion homeostasis (GO:0051480)|fibrinolysis (GO:0042730)|leukocyte migration (GO:0050900)|multicellular organismal development (GO:0007275)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|negative regulation of proteolysis (GO:0045861)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900738)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of blood coagulation (GO:0030193)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|thrombospondin receptor activity (GO:0070053)			endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	27		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|ART-123(DB05777)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Dabigatran etexilate(DB06695)|Drotrecogin alfa(DB00055)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Suramin(DB04786)|Ximelagatran(DB04898)	GGAGCAGTGTGTCCCTGATCG	0.647																																					p.V214L	Esophageal Squamous(147;1147 1808 2148 38609 51144)	Atlas-SNP	.											.	F2	75	.	0			c.G640C						PASS	.						67.0	61.0	63.0					11																	46747489		2201	4299	6500	SO:0001583	missense	2147	exon7			CAGTGTGTCCCTG	M33031	CCDS31476.1	11p11.2	2013-02-28			ENSG00000180210	ENSG00000180210	3.4.21.5	"""Endogenous ligands"""	3535	protein-coding gene	gene with protein product	"""prepro-coagulation factor II"""	176930					Standard	NM_000506		Approved		uc001ndf.4	P00734	OTTHUMG00000150344	ENST00000311907.5:c.640G>C	chr11.hg19:g.46747489G>C	ENSP00000308541:p.Val214Leu	181.0	0.0	.		79.0	35.0	.	NM_000506	B2R7F7|B4E1A7|Q4QZ40|Q53H04|Q53H06|Q69EZ7|Q7Z7P3|Q9UCA1	Missense_Mutation	SNP	ENST00000311907.5	hg19	CCDS31476.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.143|2.143	-0.396352|-0.396352	0.04899|0.04899	.|.	.|.	ENSG00000180210|ENSG00000180210	ENST00000446804|ENST00000311907;ENST00000530231;ENST00000442468	.|T;T;T	.|0.65549	.|-0.16;-0.16;-0.16	5.2|5.2	-3.55|-3.55	0.04639|0.04639	.|Kringle (4);Kringle-like fold (1);	.|0.978143	.|0.08402	.|N	.|0.951286	T|T	0.43919|0.43919	0.1269|0.1269	N|N	0.26042|0.26042	0.785|0.785	0.09310|0.09310	N|N	1|1	.|B	.|0.06786	.|0.001	.|B	.|0.12156	.|0.007	T|T	0.38714|0.38714	-0.9648|-0.9648	6|10	0.87932|0.87932	D|D	0|0	.|.	5.8666|5.8666	0.18779|0.18779	0.3517:0.2302:0.4182:0.0|0.3517:0.2302:0.4182:0.0	.|.	.|214	.|P00734	.|THRB_HUMAN	S|L	63|214;214;204	.|ENSP00000308541:V214L;ENSP00000433907:V214L;ENSP00000387413:V204L	ENSP00000406403:C63S|ENSP00000308541:V214L	C|V	+|+	2|1	0|0	F2|F2	46704065|46704065	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.045000|0.045000	0.14185|0.14185	-0.127000|-0.127000	0.10547|0.10547	-0.660000|-0.660000	0.05352|0.05352	-0.218000|-0.218000	0.12543|0.12543	TGT|GTC	.	.	.	none		0.647	F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317706.1		
CARNS1	57571	hgsc.bcm.edu	37	11	67191541	67191541	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr11:67191541G>T	ENST00000307823.3	+	9	2405	c.1953G>T	c.(1951-1953)gaG>gaT	p.E651D	CARNS1_ENST00000531040.1_Missense_Mutation_p.E748D|CARNS1_ENST00000445895.2_Missense_Mutation_p.E774D|CARNS1_ENST00000423745.2_Missense_Mutation_p.E651D	NM_020811.1	NP_065862.1	A5YM72	CRNS1_HUMAN	carnosine synthase 1	651	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				ATP catabolic process (GO:0006200)|carnosine biosynthetic process (GO:0035499)		ATP binding (GO:0005524)|ATPase activity (GO:0016887)|carnosine synthase activity (GO:0047730)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)	11						TGGCACCAGAGCAGGAGGCAC	0.657																																					p.E774D		Atlas-SNP	.											.	CARNS1	60	.	0			c.G2322T						PASS	.						50.0	55.0	53.0					11																	67191541		2090	4206	6296	SO:0001583	missense	57571	exon10			ACCAGAGCAGGAG		CCDS44658.1, CCDS53667.1	11q13.1	2010-03-25	2010-03-25	2010-03-25	ENSG00000172508	ENSG00000172508			29268	protein-coding gene	gene with protein product		613368	"""ATP-grasp domain containing 1"""	ATPGD1		20097752	Standard	NM_020811		Approved	KIAA1394	uc010rpr.2	A5YM72		ENST00000307823.3:c.1953G>T	chr11.hg19:g.67191541G>T	ENSP00000308268:p.Glu651Asp	51.0	0.0	.		24.0	9.0	.	NM_001166222	A8K1M3|B4DFC6|E9PK38|F5H427|Q8N467|Q9P2F3	Missense_Mutation	SNP	ENST00000307823.3	hg19	CCDS44658.1	.	.	.	.	.	.	.	.	.	.	G	7.607	0.674003	0.14841	.	.	ENSG00000172508	ENST00000531040;ENST00000307823;ENST00000542831;ENST00000423745;ENST00000445895	D;D;D;D	0.97831	-4.56;-4.56;-4.56;-4.56	5.07	5.07	0.68467	ATP-grasp fold (1);ATP-grasp fold, DUF201-type (1);ATP-grasp fold, subdomain 2 (1);	0.000000	0.64402	D	0.000017	D	0.91175	0.7220	N	0.11255	0.115	0.37414	D	0.913347	B;B	0.20988	0.015;0.05	B;B	0.17722	0.013;0.019	D	0.87313	0.2313	10	0.10902	T	0.67	-26.1766	7.3509	0.26691	0.0902:0.1717:0.7382:0.0	.	651;790	A5YM72;A5YM72-3	CRNS1_HUMAN;.	D	748;651;748;651;774	ENSP00000431670:E748D;ENSP00000308268:E651D;ENSP00000401519:E651D;ENSP00000389009:E774D	ENSP00000308268:E651D	E	+	3	2	CARNS1	66948117	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	1.888000	0.39708	2.364000	0.80123	0.549000	0.68633	GAG	.	.	.	none		0.657	CARNS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395501.1	NM_020811	
CWF19L2	143884	hgsc.bcm.edu	37	11	107326471	107326471	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr11:107326471C>G	ENST00000282251.5	-	2	164	c.137G>C	c.(136-138)cGt>cCt	p.R46P	CWF19L2_ENST00000433523.1_Missense_Mutation_p.R46P	NM_152434.2	NP_689647.2	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control (S. pombe)	46							catalytic activity (GO:0003824)			endometrium(4)|kidney(2)|large_intestine(13)|lung(21)	40		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		AAGTTCTTTACGCCTTTCTTC	0.388																																					p.R46P		Atlas-SNP	.											.	CWF19L2	135	.	0			c.G137C						PASS	.						266.0	214.0	230.0					11																	107326471		692	1591	2283	SO:0001583	missense	143884	exon2			TCTTTACGCCTTT	AK056905	CCDS8336.2	11q23.1	2005-09-22			ENSG00000152404	ENSG00000152404			26508	protein-coding gene	gene with protein product						14702039	Standard	NM_152434		Approved	FLJ32343	uc010rvp.2	Q2TBE0	OTTHUMG00000152975	ENST00000282251.5:c.137G>C	chr11.hg19:g.107326471C>G	ENSP00000282251:p.Arg46Pro	101.0	0.0	.		42.0	16.0	.	NM_152434	A4FU66|A4FU67|A4FU68|Q6PHW1|Q96MI1	Missense_Mutation	SNP	ENST00000282251.5	hg19	CCDS8336.2	.	.	.	.	.	.	.	.	.	.	C	16.65	3.180931	0.57800	.	.	ENSG00000152404	ENST00000282251;ENST00000433523	T;T	0.25085	1.82;1.82	5.4	1.37	0.22104	.	.	.	.	.	T	0.29817	0.0745	M	0.77103	2.36	0.19945	N	0.999941	P	0.48503	0.911	B	0.43301	0.415	T	0.18335	-1.0340	9	0.72032	D	0.01	.	5.946	0.19219	0.1335:0.6434:0.0:0.2231	.	46	Q2TBE0	C19L2_HUMAN	P	46	ENSP00000282251:R46P;ENSP00000387533:R46P	ENSP00000282251:R46P	R	-	2	0	CWF19L2	106831681	0.116000	0.22171	0.120000	0.21714	0.983000	0.72400	1.251000	0.32862	0.007000	0.14760	-0.237000	0.12165	CGT	.	.	.	none		0.388	CWF19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328825.2	NM_152434	
TMPRSS13	84000	hgsc.bcm.edu	37	11	117789342	117789342	+	Missense_Mutation	SNP	T	T	C	rs75037497		TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr11:117789342T>C	ENST00000430170.2	-	2	320	c.233A>G	c.(232-234)cAg>cGg	p.Q78R	TMPRSS13_ENST00000524993.1_Missense_Mutation_p.Q78R|TMPRSS13_ENST00000445164.2_Missense_Mutation_p.Q78R|TMPRSS13_ENST00000528626.1_Missense_Mutation_p.Q78R|TMPRSS13_ENST00000526090.1_Missense_Mutation_p.Q78R	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	78	13 X 5 AA repeats of A-S-P-A-[GLQR].|Ala-rich.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		TGGAGATGCCTGGGCTGGAGA	0.672																																					p.Q78R		Atlas-SNP	.											.,4	TMPRSS13	75	.	0			c.A233G						PASS	.						40.0	48.0	46.0					11																	117789342		1932	4119	6051	SO:0001583	missense	84000	exon2			GATGCCTGGGCTG	AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.233A>G	chr11.hg19:g.117789342T>C	ENSP00000387702:p.Gln78Arg	94.0	0.0	.		62.0	13.0	.	NM_001206790	B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Missense_Mutation	SNP	ENST00000430170.2	hg19	CCDS58185.1	.	.	.	.	.	.	.	.	.	.	t	0.008	-1.884785	0.00532	.	.	ENSG00000137747	ENST00000528626;ENST00000524993;ENST00000430170;ENST00000445164;ENST00000526090	D;D;D;D;D	0.87966	-2.32;-2.25;-2.25;-2.25;-2.14	3.14	-4.2	0.03823	.	0.847229	0.09877	N	0.744233	T	0.60090	0.2242	N	0.01048	-1.04	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.55780	-0.8087	9	0.11182	T	0.66	.	9.3313	0.38023	0.0:0.381:0.0:0.619	.	78	E9PRA0	.	R	78	ENSP00000435813:Q78R;ENSP00000434279:Q78R;ENSP00000387702:Q78R;ENSP00000394114:Q78R;ENSP00000436502:Q78R	ENSP00000387702:Q78R	Q	-	2	0	TMPRSS13	117294552	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.313000	0.08103	-0.789000	0.04498	-1.186000	0.01703	CAG	.	T|0.500;C|0.500	0.500	weak		0.672	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1	NM_032046	
OR8D2	283160	hgsc.bcm.edu	37	11	124190009	124190009	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr11:124190009G>A	ENST00000357438.2	-	1	175	c.85C>T	c.(85-87)Ctc>Ttc	p.L29F		NM_001002918.1	NP_001002918.1	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D, member 2	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)		AGGAACAGGAGGAAGAGTGGC	0.448																																					p.L29F		Atlas-SNP	.											.	OR8D2	65	.	0			c.C85T						PASS	.						86.0	84.0	84.0					11																	124190009		2201	4299	6500	SO:0001583	missense	283160	exon1			ACAGGAGGAAGAG	AF162668	CCDS31707.1	11q24.1	2012-08-09			ENSG00000197263	ENSG00000197263		"""GPCR / Class A : Olfactory receptors"""	8482	protein-coding gene	gene with protein product							Standard	NM_001002918		Approved		uc010sah.2	Q9GZM6	OTTHUMG00000165978	ENST00000357438.2:c.85C>T	chr11.hg19:g.124190009G>A	ENSP00000350022:p.Leu29Phe	117.0	0.0	.		50.0	19.0	.	NM_001002918	B9EH49|Q6IFR0	Missense_Mutation	SNP	ENST00000357438.2	hg19	CCDS31707.1	.	.	.	.	.	.	.	.	.	.	g	0.212	-1.036091	0.02029	.	.	ENSG00000197263	ENST00000357438	T	0.00455	7.31	3.42	-2.06	0.07298	.	0.369536	0.19376	N	0.115781	T	0.00178	0.0005	L	0.37466	1.105	0.09310	N	1	B	0.13145	0.007	B	0.10450	0.005	T	0.49835	-0.8897	10	0.05436	T	0.98	.	0.4285	0.00467	0.3664:0.1321:0.2334:0.2681	.	29	Q9GZM6	OR8D2_HUMAN	F	29	ENSP00000350022:L29F	ENSP00000350022:L29F	L	-	1	0	OR8D2	123695219	0.000000	0.05858	0.011000	0.14972	0.500000	0.33767	-3.943000	0.00329	-0.405000	0.07599	0.395000	0.25975	CTC	.	.	.	none		0.448	OR8D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387286.1	NM_001002918	
ERC1	23085	hgsc.bcm.edu	37	12	1137356	1137356	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr12:1137356G>A	ENST00000397203.2	+	2	693	c.287G>A	c.(286-288)gGa>gAa	p.G96E	ERC1_ENST00000543086.3_Missense_Mutation_p.G96E|ERC1_ENST00000546231.2_Missense_Mutation_p.G96E|ERC1_ENST00000355446.5_Missense_Mutation_p.G96E|ERC1_ENST00000360905.4_Missense_Mutation_p.G96E|ERC1_ENST00000589028.1_Missense_Mutation_p.G96E			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	96					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)			NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			CGTTCTGGGGGACGTCTGCCT	0.502																																					p.G96E		Atlas-SNP	.											.	ERC1	95	.	0			c.G287A						PASS	.						130.0	123.0	125.0					12																	1137356		2203	4300	6503	SO:0001583	missense	23085	exon2			CTGGGGGACGTCT	AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.287G>A	chr12.hg19:g.1137356G>A	ENSP00000380386:p.Gly96Glu	103.0	0.0	.		68.0	39.0	.	NM_178039	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Missense_Mutation	SNP	ENST00000397203.2	hg19	CCDS8508.1	.	.	.	.	.	.	.	.	.	.	G	17.94	3.510591	0.64522	.	.	ENSG00000082805	ENST00000347735;ENST00000397203;ENST00000454194;ENST00000537890;ENST00000299183;ENST00000543086;ENST00000542302;ENST00000545948;ENST00000546231;ENST00000355446;ENST00000360905;ENST00000440394	D;D;D;D;D;D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.82637	0.5080	N	0.24115	0.695	0.47778	D	0.999516	P;P;B	0.39424	0.617;0.673;0.399	B;B;B	0.39738	0.308;0.307;0.206	T	0.82575	-0.0389	10	0.45353	T	0.12	-21.4162	20.0621	0.97678	0.0:0.0:1.0:0.0	.	96;96;96	Q8IUD2-2;Q8IUD2-3;Q8IUD2	.;.;RB6I2_HUMAN	E	96	ENSP00000340054:G96E;ENSP00000380386:G96E;ENSP00000438546:G96E;ENSP00000445336:G96E;ENSP00000442976:G96E;ENSP00000442739:G96E;ENSP00000347621:G96E;ENSP00000354158:G96E;ENSP00000410064:G96E	ENSP00000299183:G96E	G	+	2	0	ERC1	1007617	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.334000	0.72944	2.750000	0.94351	0.655000	0.94253	GGA	.	.	.	none		0.502	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398380.2	NM_015064	
DCP1B	196513	hgsc.bcm.edu	37	12	2061663	2061663	+	Silent	SNP	A	A	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr12:2061663A>T	ENST00000280665.6	-	7	1522	c.1443T>A	c.(1441-1443)gcT>gcA	p.A481A	DCP1B_ENST00000540622.1_Silent_p.A355A|DCP1B_ENST00000541700.1_5'Flank|DCP1B_ENST00000397173.4_Silent_p.A379A	NM_152640.3	NP_689853.3	Q8IZD4	DCP1B_HUMAN	decapping mRNA 1B	481					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(10)|skin(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00193)			CAGAGCTCTGAGCGAGCACAG	0.527																																					p.A481A		Atlas-SNP	.											.	DCP1B	63	.	0			c.T1443A						PASS	.						81.0	83.0	82.0					12																	2061663		2203	4300	6503	SO:0001819	synonymous_variant	196513	exon7			GCTCTGAGCGAGC	AY146652	CCDS31727.1	12p13.33	2013-05-02	2013-05-02		ENSG00000151065	ENSG00000151065			24451	protein-coding gene	gene with protein product		609843	"""DCP1 decapping enzyme homolog B (S. cerevisiae)"""			12417715, 15067023	Standard	NM_152640		Approved	FLJ31638	uc001qjx.1	Q8IZD4	OTTHUMG00000168113	ENST00000280665.6:c.1443T>A	chr12.hg19:g.2061663A>T		105.0	0.0	.		88.0	52.0	.	NM_152640	B4DRD1|Q86XH9|Q96BP8|Q96MZ8	Silent	SNP	ENST00000280665.6	hg19	CCDS31727.1																																																																																			.	.	.	none		0.527	DCP1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398244.1	NM_152640	
ACVR1B	91	hgsc.bcm.edu	37	12	52379093	52379093	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr12:52379093C>T	ENST00000257963.4	+	6	1174	c.1097C>T	c.(1096-1098)aCc>aTc	p.T366I	ACVR1B_ENST00000415850.2_Missense_Mutation_p.T366I|ACVR1B_ENST00000542485.1_Missense_Mutation_p.T314I|RNU6-574P_ENST00000384265.1_RNA|ACVR1B_ENST00000563121.1_3'UTR|ACVR1B_ENST00000426655.2_Missense_Mutation_p.T366I|ACVR1B_ENST00000541224.1_Missense_Mutation_p.T407I	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	366	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	GTCACTGACACCATTGACATT	0.527																																					p.T407I		Atlas-SNP	.											.	ACVR1B	167	.	0			c.C1220T						PASS	.						146.0	132.0	137.0					12																	52379093		2203	4300	6503	SO:0001583	missense	91	exon7			CTGACACCATTGA		CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.1097C>T	chr12.hg19:g.52379093C>T	ENSP00000257963:p.Thr366Ile	173.0	0.0	.		112.0	72.0	.	NM_020328	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Missense_Mutation	SNP	ENST00000257963.4	hg19	CCDS8816.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315896	0.60524	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000415850;ENST00000542485	T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19	4.76	3.83	0.44106	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.051038	0.85682	D	0.000000	T	0.70684	0.3252	L	0.48260	1.515	0.80722	D	1	P;D;B;B	0.58268	0.919;0.982;0.372;0.344	P;D;B;B	0.64237	0.706;0.923;0.181;0.203	T	0.72418	-0.4300	10	0.51188	T	0.08	.	14.3487	0.66685	0.1493:0.8507:0.0:0.0	.	407;366;366;366	P36896-4;P36896;P36896-2;P36896-3	.;ACV1B_HUMAN;.;.	I	366;407;366;366;314	ENSP00000257963:T366I;ENSP00000442656:T407I;ENSP00000390477:T366I;ENSP00000397550:T366I;ENSP00000442885:T314I	ENSP00000257963:T366I	T	+	2	0	ACVR1B	50665360	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.651000	0.83577	1.302000	0.44855	0.563000	0.77884	ACC	.	.	.	none		0.527	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397000.1	NM_020328	
SLC25A3	5250	hgsc.bcm.edu	37	12	98993879	98993879	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr12:98993879T>C	ENST00000228318.3	+	6	911	c.791T>C	c.(790-792)gTt>gCt	p.V264A	SLC25A3_ENST00000552981.1_Missense_Mutation_p.V263A|SLC25A3_ENST00000401722.3_Missense_Mutation_p.V263A|SNORA53_ENST00000391141.1_RNA|SLC25A3_ENST00000188376.5_Missense_Mutation_p.V263A|SLC25A3_ENST00000548847.1_Missense_Mutation_p.V263A|SLC25A3_ENST00000549338.1_Missense_Mutation_p.V263A|SLC25A3_ENST00000551917.1_Missense_Mutation_p.V264A	NM_005888.3	NP_005879.1	Q00325	MPCP_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3	264					generation of precursor metabolites and energy (GO:0006091)|phosphate ion transmembrane transport (GO:0035435)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	phosphate ion carrier activity (GO:0015320)|protein complex binding (GO:0032403)|symporter activity (GO:0015293)			breast(1)|endometrium(2)|large_intestine(4)|lung(8)|prostate(1)	16		Lung NSC(355;4.08e-05)|Breast(359;0.00191)|Colorectal(145;0.00205)|Myeloproliferative disorder(1001;0.0255)		GBM - Glioblastoma multiforme(134;1.36e-23)|BRCA - Breast invasive adenocarcinoma(302;0.000115)		GAGCAGCTGGTTGTAACATTT	0.398																																					p.V264A		Atlas-SNP	.											.	SLC25A3	95	.	0			c.T791C						PASS	.						117.0	99.0	105.0					12																	98993879		2203	4300	6503	SO:0001583	missense	5250	exon6			AGCTGGTTGTAAC		CCDS9065.1, CCDS9066.1	12q23.1	2013-05-22			ENSG00000075415	ENSG00000075415		"""Solute carriers"""	10989	protein-coding gene	gene with protein product		600370		PHC		8168843	Standard	NM_213611		Approved		uc001tfo.3	Q00325	OTTHUMG00000170212	ENST00000228318.3:c.791T>C	chr12.hg19:g.98993879T>C	ENSP00000228318:p.Val264Ala	80.0	0.0	.		89.0	52.0	.	NM_005888	B3KS34|Q7Z7N7|Q96A03	Missense_Mutation	SNP	ENST00000228318.3	hg19	CCDS9066.1	.	.	.	.	.	.	.	.	.	.	T	9.522	1.108656	0.20714	.	.	ENSG00000075415	ENST00000401722;ENST00000188376;ENST00000228318;ENST00000551917;ENST00000552981;ENST00000549338;ENST00000548847	T;T;T;T;T;T;T	0.79749	-1.3;-1.3;-1.3;-1.3;-1.3;-1.3;-1.17	5.34	4.2	0.49525	Mitochondrial carrier domain (2);	0.219986	0.46758	N	0.000266	T	0.67363	0.2885	N	0.25647	0.755	0.58432	D	0.999999	B;B;B;B	0.09022	0.002;0.0;0.001;0.001	B;B;B;B	0.17979	0.012;0.006;0.02;0.005	T	0.58267	-0.7666	10	0.21014	T	0.42	-9.264	9.8807	0.41231	0.0:0.0779:0.0:0.9221	.	263;263;264;263	F8VVM2;B2RE88;Q00325;Q00325-2	.;.;MPCP_HUMAN;.	A	263;263;264;264;263;263;263	ENSP00000383898:V263A;ENSP00000188376:V263A;ENSP00000228318:V264A;ENSP00000447310:V264A;ENSP00000448708:V263A;ENSP00000447740:V263A;ENSP00000449166:V263A	ENSP00000188376:V263A	V	+	2	0	SLC25A3	97518010	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.469000	0.80959	0.986000	0.38683	0.533000	0.62120	GTT	.	.	.	none		0.398	SLC25A3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407989.1	NM_005888	
HSPB8	26353	hgsc.bcm.edu	37	12	119617127	119617127	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr12:119617127G>A	ENST00000281938.2	+	1	681	c.10G>A	c.(10-12)Ggt>Agt	p.G4S	RP11-64B16.3_ENST00000538405.1_RNA|RP11-64B16.4_ENST00000535921.1_RNA	NM_014365.2	NP_055180.1	Q9UJY1	HSPB8_HUMAN	heat shock 22kDa protein 8	4					cell death (GO:0008219)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	14	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CATGGCTGACGGTCAGATGCC	0.612																																					p.G4S		Atlas-SNP	.											.	HSPB8	45	.	0			c.G10A						PASS	.						50.0	61.0	57.0					12																	119617127		2203	4300	6503	SO:0001583	missense	26353	exon1			GCTGACGGTCAGA	AF191017	CCDS9189.1	12q24.23	2014-09-17	2004-04-23					"""Heat shock proteins / HSPB"""	30171	protein-coding gene	gene with protein product		608014	"""heat shock 27kDa protein 8"""			10833516, 11085516	Standard	NM_014365		Approved	H11, E2IG1, HSP22, HspB8	uc001txb.3	Q9UJY1		ENST00000281938.2:c.10G>A	chr12.hg19:g.119617127G>A	ENSP00000281938:p.Gly4Ser	41.0	0.0	.		20.0	7.0	.	NM_014365	B2R6A6|Q6FIH3|Q9UKS3	Missense_Mutation	SNP	ENST00000281938.2	hg19	CCDS9189.1	.	.	.	.	.	.	.	.	.	.	G	9.471	1.095576	0.20471	.	.	ENSG00000152137	ENST00000281938	D	0.85556	-2.0	4.42	4.42	0.53409	.	0.256618	0.33631	N	0.004719	T	0.71187	0.3310	L	0.31664	0.95	0.42229	D	0.991888	B	0.27264	0.173	B	0.13407	0.009	T	0.65697	-0.6105	9	.	.	.	.	5.2215	0.15371	0.2542:0.0:0.7458:0.0	.	4	Q9UJY1	HSPB8_HUMAN	S	4	ENSP00000281938:G4S	.	G	+	1	0	HSPB8	118101510	0.981000	0.34729	0.940000	0.37924	0.516000	0.34256	2.064000	0.41432	2.294000	0.77228	0.563000	0.77884	GGT	.	.	.	none		0.612	HSPB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401647.1	NM_014365	
DZIP1	22873	hgsc.bcm.edu	37	13	96293651	96293651	+	Silent	SNP	C	C	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr13:96293651C>T	ENST00000376829.2	-	5	1346	c.495G>A	c.(493-495)aaG>aaA	p.K165K	DZIP1_ENST00000466027.1_5'UTR|DZIP1_ENST00000347108.3_Silent_p.K165K|DZIP1_ENST00000361156.3_Silent_p.K165K|DZIP1_ENST00000361396.2_Silent_p.K165K	NM_198968.3	NP_945319.1	Q86YF9	DZIP1_HUMAN	DAZ interacting zinc finger protein 1	165					cilium assembly (GO:0042384)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(20)|lung(11)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	38	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			CCCCCGCCTGCTTGGTGAGCA	0.592																																					p.K165K		Atlas-SNP	.											.	DZIP1	195	.	0			c.G495A						PASS	.						83.0	54.0	64.0					13																	96293651		2203	4300	6503	SO:0001819	synonymous_variant	22873	exon5			CGCCTGCTTGGTG	AB023213	CCDS9477.1, CCDS9478.1	13q32.1	2013-05-22	2013-05-22		ENSG00000134874	ENSG00000134874		"""Zinc fingers, C2H2-type"""	20908	protein-coding gene	gene with protein product		608671	"""DAZ interacting protein 1"""				Standard	NM_014934		Approved	KIAA0996, DZIP	uc001vmk.4	Q86YF9	OTTHUMG00000017224	ENST00000376829.2:c.495G>A	chr13.hg19:g.96293651C>T		82.0	0.0	.		53.0	35.0	.	NM_014934	Q5W078|Q5W079|Q8WY45|Q8WY46|Q9UGA5|Q9Y2K0	Silent	SNP	ENST00000376829.2	hg19	CCDS9478.1																																																																																			.	.	.	none		0.592	DZIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045496.3	NM_014934	
AP5M1	55745	hgsc.bcm.edu	37	14	57747111	57747111	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr14:57747111T>A	ENST00000261558.3	+	3	1325	c.919T>A	c.(919-921)Tca>Aca	p.S307T	AP5M1_ENST00000431972.2_Missense_Mutation_p.S321T|AP5M1_ENST00000556723.1_3'UTR	NM_018229.3	NP_060699.3	Q9H0R1	AP5M1_HUMAN	adaptor-related protein complex 5, mu 1 subunit	307	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytosol (GO:0005829)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)											ACCTTTAGAGTCATTCAACTT	0.353																																					p.S307T		Atlas-SNP	.											.	.	.	.	0			c.T919A						PASS	.						141.0	125.0	130.0					14																	57747111		2203	4300	6503	SO:0001583	missense	55745	exon3			TTAGAGTCATTCA	AF094583	CCDS9729.1	14q22.2	2012-03-20	2012-03-20	2012-03-20	ENSG00000053770	ENSG00000053770			20192	protein-coding gene	gene with protein product	"""Mu-2 related death-inducing gene"""	614368	"""chromosome 14 open reading frame 108"", ""MU-2/AP1M2 domain containing, death-inducing"""	C14orf108, MUDENG		18395520	Standard	NM_018229		Approved	FLJ10813, MuD, mu5	uc001xcv.3	Q9H0R1	OTTHUMG00000140318	ENST00000261558.3:c.919T>A	chr14.hg19:g.57747111T>A	ENSP00000261558:p.Ser307Thr	178.0	0.0	.		86.0	35.0	.	NM_018229	O95354|Q6ZMD7|Q96DX3|Q9NVC5	Missense_Mutation	SNP	ENST00000261558.3	hg19	CCDS9729.1	.	.	.	.	.	.	.	.	.	.	T	7.432	0.638915	0.14386	.	.	ENSG00000053770	ENST00000261558;ENST00000431972	T;T	0.20200	2.09;2.09	5.96	3.58	0.41010	Clathrin adaptor, mu subunit, C-terminal (3);	0.377447	0.30901	N	0.008651	T	0.09992	0.0245	N	0.20685	0.6	0.40343	D	0.979055	B	0.02656	0.0	B	0.10450	0.005	T	0.19128	-1.0315	10	0.19147	T	0.46	.	2.013	0.03492	0.1366:0.1307:0.1425:0.5903	.	307	Q9H0R1	MUDEN_HUMAN	T	307;321	ENSP00000261558:S307T;ENSP00000390531:S321T	ENSP00000261558:S307T	S	+	1	0	MUDENG	56816864	0.995000	0.38212	0.999000	0.59377	0.983000	0.72400	1.162000	0.31786	1.044000	0.40200	0.496000	0.49642	TCA	.	.	.	none		0.353	AP5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276922.1	NM_018229	
ADSSL1	122622	hgsc.bcm.edu	37	14	105208271	105208271	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr14:105208271G>A	ENST00000330877.2	+	9	965	c.880G>A	c.(880-882)Gtg>Atg	p.V294M	ADSSL1_ENST00000332972.5_Missense_Mutation_p.V337M	NM_152328.3	NP_689541.1			adenylosuccinate synthase like 1											central_nervous_system(1)|cervix(1)|kidney(1)|lung(5)|ovary(2)|prostate(1)	11		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.18)		CATAGGTGACGTGTATGGCGT	0.632																																					p.V337M		Atlas-SNP	.											.	ADSSL1	37	.	0			c.G1009A						PASS	.						164.0	143.0	150.0					14																	105208271		2203	4300	6503	SO:0001583	missense	122622	exon9			GGTGACGTGTATG	AK095921	CCDS9990.1, CCDS9991.1	14q32.33	2010-08-05			ENSG00000185100	ENSG00000185100			20093	protein-coding gene	gene with protein product		612498					Standard	NM_199165		Approved	FLJ38602	uc001ype.3	Q8N142		ENST00000330877.2:c.880G>A	chr14.hg19:g.105208271G>A	ENSP00000331260:p.Val294Met	128.0	0.0	.		76.0	28.0	.	NM_199165		Missense_Mutation	SNP	ENST00000330877.2	hg19	CCDS9990.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.377953	0.82682	.	.	ENSG00000185100	ENST00000330877;ENST00000332972	T;T	0.55052	0.54;0.54	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.80649	0.4663	M	0.93678	3.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.85997	0.1492	10	0.87932	D	0	-2.253	18.9013	0.92443	0.0:0.0:1.0:0.0	.	337;294	Q8N142-2;Q8N142	.;PURA1_HUMAN	M	294;337	ENSP00000331260:V294M;ENSP00000333019:V337M	ENSP00000331260:V294M	V	+	1	0	ADSSL1	104279316	1.000000	0.71417	0.417000	0.26559	0.561000	0.35649	9.655000	0.98512	2.534000	0.85438	0.655000	0.94253	GTG	.	.	.	none		0.632	ADSSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410529.1		
SNURF	8926	hgsc.bcm.edu	37	15	25207312	25207312	+	Silent	SNP	A	A	G			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr15:25207312A>G	ENST00000577949.1	+	2	129	c.66A>G	c.(64-66)gaA>gaG	p.E22E	SNRPN_ENST00000577565.1_5'UTR|SNRPN_ENST00000400098.1_5'UTR|SNRPN_ENST00000553597.1_3'UTR|SNRPN_ENST00000400097.1_5'UTR|SNURF_ENST00000338094.6_Silent_p.E22E|SNURF_ENST00000338327.4_Silent_p.E22E|SNURF_ENST00000551312.2_Silent_p.E22E|SNRPN_ENST00000346403.6_5'UTR|SNRPN_ENST00000390687.4_5'UTR|SNRPN_ENST00000554227.2_5'UTR|SNRPN_ENST00000400100.1_5'UTR			Q9Y675	SNURF_HUMAN	SNRPN upstream reading frame	22						nucleus (GO:0005634)				breast(2)|large_intestine(2)|lung(1)	5		all_cancers(20;1.4e-21)|Breast(32;0.000625)		all cancers(64;3.48e-07)|Epithelial(43;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0142)		CAGAGGTGGAAGTCCAAGTCA	0.458																																					p.E22E		Atlas-SNP	.											.	SNURF	17	.	0			c.A66G						PASS	.						154.0	121.0	132.0					15																	25207312		2203	4300	6503	SO:0001819	synonymous_variant	8926	exon2			GGTGGAAGTCCAA		CCDS10016.1	15q11.2	2013-08-27			ENSG00000214265	ENSG00000214265			11171	protein-coding gene	gene with protein product						10318933	Standard	NM_022804		Approved		uc001ywu.3	Q9Y675	OTTHUMG00000129181	ENST00000577949.1:c.66A>G	chr15.hg19:g.25207312A>G		152.0	0.0	.		75.0	30.0	.	NM_005678	A6NCW2	Silent	SNP	ENST00000577949.1	hg19	CCDS10016.1																																																																																			.	.	.	none		0.458	SNURF-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446300.1	NM_005678	
HERC2	8924	hgsc.bcm.edu	37	15	28369256	28369256	+	Missense_Mutation	SNP	G	G	A	rs371676185		TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr15:28369256G>A	ENST00000261609.7	-	85	13223	c.13115C>T	c.(13114-13116)tCg>tTg	p.S4372L		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TTCGTCGAGCGAGCCTTCCAG	0.562																																					p.S4372L		Atlas-SNP	.											.	HERC2	501	.	0			c.C13115T						PASS	.	G	LEU/SER	0,4406		0,0,2203	105.0	95.0	98.0		13115	2.5	0.6	15		98	1,8599	1.2+/-3.3	0,1,4299	no	missense	HERC2	NM_004667.4	145	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	4372/4835	28369256	1,13005	2203	4300	6503	SO:0001583	missense	8924	exon85			TCGAGCGAGCCTT	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.13115C>T	chr15.hg19:g.28369256G>A	ENSP00000261609:p.Ser4372Leu	123.0	0.0	.		73.0	31.0	.	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	hg19	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	G	9.737	1.163853	0.21538	0.0	1.16E-4	ENSG00000128731	ENST00000261609	T	0.38401	1.14	5.55	2.51	0.30379	.	0.314292	0.32687	N	0.005768	T	0.25531	0.0621	L	0.38175	1.15	0.28428	N	0.917401	B	0.25105	0.118	B	0.14578	0.011	T	0.11916	-1.0568	10	0.27785	T	0.31	.	11.1638	0.48531	0.0:0.637:0.2573:0.1058	.	4372	O95714	HERC2_HUMAN	L	4372	ENSP00000261609:S4372L	ENSP00000261609:S4372L	S	-	2	0	HERC2	26042851	1.000000	0.71417	0.580000	0.28601	0.161000	0.22273	3.800000	0.55537	0.253000	0.21552	-0.150000	0.13652	TCG	.	.	.	weak		0.562	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
RYR3	6263	hgsc.bcm.edu	37	15	34127190	34127190	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr15:34127190C>A	ENST00000389232.4	+	87	11555	c.11485C>A	c.(11485-11487)Cag>Aag	p.Q3829K	RYR3_ENST00000415757.3_Missense_Mutation_p.Q3824K	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3829					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGGTAATCAACAGAGCCTGGC	0.488																																					p.Q3829K		Atlas-SNP	.											.	RYR3	760	.	0			c.C11485A						PASS	.						101.0	98.0	99.0					15																	34127190		1992	4183	6175	SO:0001583	missense	6263	exon87			AATCAACAGAGCC		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.11485C>A	chr15.hg19:g.34127190C>A	ENSP00000373884:p.Gln3829Lys	68.0	0.0	.		29.0	10.0	.	NM_001036	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	hg19	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.485309	0.84854	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D	0.94931	-3.56	4.66	4.66	0.58398	RyR/IP3R Homology associated domain (1);	0.000000	0.85682	D	0.000000	D	0.95931	0.8675	L	0.58969	1.84	0.58432	D	0.999998	P;D	0.55172	0.955;0.97	P;P	0.60068	0.725;0.868	D	0.95788	0.8822	10	0.49607	T	0.09	.	17.7356	0.88391	0.0:1.0:0.0:0.0	.	3824;3829	Q15413-2;Q15413	.;RYR3_HUMAN	K	3829;3828;3825	ENSP00000373884:Q3829K	ENSP00000354735:Q3825K	Q	+	1	0	RYR3	31914482	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	7.470000	0.80973	2.423000	0.82170	0.650000	0.86243	CAG	.	.	.	none		0.488	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
GNB5	10681	hgsc.bcm.edu	37	15	52425644	52425644	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr15:52425644A>G	ENST00000261837.7	-	9	859	c.794T>C	c.(793-795)gTg>gCg	p.V265A	GNB5_ENST00000396335.4_Missense_Mutation_p.V153A|CTD-2184D3.7_ENST00000557898.1_RNA|GNB5_ENST00000358784.7_Missense_Mutation_p.V223A|GNB5_ENST00000559348.1_5'UTR	NM_016194.3	NP_057278.2	O14775	GBB5_HUMAN	guanine nucleotide binding protein (G protein), beta 5	265					GTP catabolic process (GO:0006184)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|G-protein gamma-subunit binding (GO:0031682)|GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			large_intestine(1)|lung(1)	2				all cancers(107;0.0163)		CATGTCCCACACCATGGCTTT	0.473																																					p.V265A		Atlas-SNP	.											.	GNB5	28	.	0			c.T794C						PASS	.						151.0	122.0	132.0					15																	52425644		2195	4293	6488	SO:0001583	missense	10681	exon9			TCCCACACCATGG	AF017656	CCDS10149.1, CCDS45261.1	15q21.1	2013-01-10			ENSG00000069966	ENSG00000069966		"""WD repeat domain containing"""	4401	protein-coding gene	gene with protein product		604447				9606987	Standard	NM_016194		Approved	GB5	uc031qrz.1	O14775	OTTHUMG00000131892	ENST00000261837.7:c.794T>C	chr15.hg19:g.52425644A>G	ENSP00000261837:p.Val265Ala	95.0	0.0	.		55.0	21.0	.	NM_016194	B2RBR5|Q9HAU9|Q9UFT3	Missense_Mutation	SNP	ENST00000261837.7	hg19	CCDS10149.1	.	.	.	.	.	.	.	.	.	.	A	28.8	4.952064	0.92660	.	.	ENSG00000069966	ENST00000261837;ENST00000396335;ENST00000544480;ENST00000358784	T	0.66280	-0.2	5.78	5.78	0.91487	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.80444	0.4624	M	0.79693	2.465	0.80722	D	1	D;D	0.62365	0.991;0.986	D;P	0.80764	0.994;0.839	T	0.83227	-0.0065	10	0.87932	D	0	-28.0646	16.1146	0.81295	1.0:0.0:0.0:0.0	.	265;153	O14775;O14775-3	GBB5_HUMAN;.	A	265;223;63;153	ENSP00000261837:V265A	ENSP00000261837:V265A	V	-	2	0	GNB5	50212936	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.720000	0.91442	2.200000	0.70718	0.460000	0.39030	GTG	.	.	.	none		0.473	GNB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254842.1		
RASGRF1	5923	hgsc.bcm.edu	37	15	79294058	79294058	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr15:79294058A>G	ENST00000419573.3	-	17	2843	c.2569T>C	c.(2569-2571)Tca>Cca	p.S857P	RASGRF1_ENST00000394745.3_Missense_Mutation_p.S73P|RASGRF1_ENST00000558480.2_Missense_Mutation_p.S841P|RASGRF1_ENST00000560334.1_5'UTR	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	857					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TTAGTTGGTGATGTTTCAGTA	0.363																																					p.S857P		Atlas-SNP	.											.	RASGRF1	168	.	0			c.T2569C						PASS	.						237.0	215.0	222.0					15																	79294058		2196	4293	6489	SO:0001583	missense	5923	exon17			TTGGTGATGTTTC	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.2569T>C	chr15.hg19:g.79294058A>G	ENSP00000405963:p.Ser857Pro	161.0	0.0	.		79.0	4.0	.	NM_002891	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	hg19	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	A	19.13	3.767238	0.69878	.	.	ENSG00000058335	ENST00000419573;ENST00000394741;ENST00000394745	T;T	0.67698	-0.28;-0.28	4.97	4.97	0.65823	Ras guanine nucleotide exchange factor, domain (1);	0.227415	0.38272	N	0.001742	T	0.80025	0.4548	M	0.77820	2.39	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;0.967;0.973;0.987;0.987	D;D;P;P;P	0.74348	0.983;0.91;0.694;0.83;0.833	T	0.82112	-0.0618	10	0.66056	D	0.02	.	11.0365	0.47804	1.0:0.0:0.0:0.0	.	253;857;841;859;841	B7Z6Z6;A8K270;Q8IUU5;Q13972;F8VPA5	.;.;.;RGRF1_HUMAN;.	P	857;841;73	ENSP00000405963:S857P;ENSP00000378228:S73P	ENSP00000378224:S841P	S	-	1	0	RASGRF1	77081113	1.000000	0.71417	0.036000	0.18154	0.910000	0.53928	6.239000	0.72356	1.871000	0.54225	0.402000	0.26972	TCA	.	.	.	none		0.363	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
WDR93	56964	hgsc.bcm.edu	37	15	90260171	90260171	+	Silent	SNP	T	T	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr15:90260171T>C	ENST00000268130.7	+	7	887	c.786T>C	c.(784-786)ccT>ccC	p.P262P	RNU6-132P_ENST00000383863.1_RNA|WDR93_ENST00000560294.1_Silent_p.P262P	NM_020212.1	NP_064597.1	Q6P2C0	WDR93_HUMAN	WD repeat domain 93	262					electron transport chain (GO:0022900)		oxidoreductase activity, acting on NAD(P)H (GO:0016651)			NS(1)|breast(3)|endometrium(2)|kidney(4)|large_intestine(5)|liver(2)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	33	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			CTGCAGATCCTTTAGAAATGG	0.294																																					p.P262P		Atlas-SNP	.											.	WDR93	63	.	0			c.T786C						PASS	.						81.0	86.0	84.0					15																	90260171		2200	4299	6499	SO:0001819	synonymous_variant	56964	exon7			AGATCCTTTAGAA		CCDS32326.1, CCDS66862.1, CCDS73779.1	15q26.1	2012-11-02						"""WD repeat domain containing"""	26924	protein-coding gene	gene with protein product							Standard	NM_020212		Approved		uc002boj.3	Q6P2C0		ENST00000268130.7:c.786T>C	chr15.hg19:g.90260171T>C		151.0	0.0	.		104.0	46.0	.	NM_020212	Q8N7Y8|Q9NP89	Silent	SNP	ENST00000268130.7	hg19	CCDS32326.1																																																																																			.	.	.	none		0.294	WDR93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416369.1	NM_020212	
CLN3	1201	hgsc.bcm.edu	37	16	28497728	28497728	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr16:28497728C>A	ENST00000569430.1	-	10	1436	c.617G>T	c.(616-618)gGc>gTc	p.G206V	CLN3_ENST00000535392.1_Missense_Mutation_p.G128V|CLN3_ENST00000568224.1_Missense_Mutation_p.G128V|CLN3_ENST00000359984.7_Missense_Mutation_p.G206V|CLN3_ENST00000357076.5_Intron|CLN3_ENST00000360019.2_Missense_Mutation_p.G206V|CLN3_ENST00000355477.5_Intron|CLN3_ENST00000395653.4_Missense_Mutation_p.G106V|CLN3_ENST00000357806.7_Intron|CLN3_ENST00000565316.1_Missense_Mutation_p.G206V|CLN3_ENST00000357857.9_Missense_Mutation_p.G152V|CLN3_ENST00000354630.5_Missense_Mutation_p.G206V|CLN3_ENST00000333496.9_Missense_Mutation_p.G182V|CLN3_ENST00000567963.1_Missense_Mutation_p.G206V			Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3	206					action potential (GO:0001508)|amyloid precursor protein catabolic process (GO:0042987)|arginine transport (GO:0015809)|associative learning (GO:0008306)|autophagic vacuole fusion (GO:0000046)|cell death (GO:0008219)|cellular amino acid metabolic process (GO:0006520)|ceramide metabolic process (GO:0006672)|cytosolic calcium ion homeostasis (GO:0051480)|galactosylceramide metabolic process (GO:0006681)|globoside metabolic process (GO:0001575)|glucosylceramide metabolic process (GO:0006678)|ionotropic glutamate receptor signaling pathway (GO:0035235)|lysosomal lumen acidification (GO:0007042)|lysosomal lumen pH elevation (GO:0035752)|lysosome organization (GO:0007040)|macroautophagy (GO:0016236)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of macroautophagy (GO:0016242)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteolysis (GO:0045861)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter metabolic process (GO:0042133)|protein catabolic process (GO:0030163)|protein processing (GO:0016485)|receptor-mediated endocytosis (GO:0006898)|sphingomyelin metabolic process (GO:0006684)|vacuolar transport (GO:0007034)|vesicle transport along microtubule (GO:0047496)	autophagic vacuole (GO:0005776)|caveola (GO:0005901)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(11)|upper_aerodigestive_tract(1)	15						AGGGGAGAGGCCGGCCTGGGT	0.687																																					p.G206V		Atlas-SNP	.											.	CLN3	33	.	0			c.G617T						PASS	.						25.0	28.0	27.0					16																	28497728		2195	4300	6495	SO:0001583	missense	1201	exon9			GAGAGGCCGGCCT	U32680	CCDS10632.1, CCDS73852.1, CCDS73853.1, CCDS73854.1, CCDS73855.1	16p12	2014-09-17	2008-07-29		ENSG00000188603	ENSG00000188603			2074	protein-coding gene	gene with protein product	"""juvenile neuronal ceroid lipofuscinosis"""	607042	"""Batten, Spielmeyer-Vogt disease"""	BTS		18317235	Standard	NM_001042432		Approved	JNCL	uc002dpp.3	Q13286	OTTHUMG00000097024	ENST00000569430.1:c.617G>T	chr16.hg19:g.28497728C>A	ENSP00000454229:p.Gly206Val	180.0	0.0	.		144.0	46.0	.	NM_001042432	B2R7J1|O00668|O95089|Q549S9|Q9UP09|Q9UP11|Q9UP12|Q9UP13|Q9UP14	Missense_Mutation	SNP	ENST00000569430.1	hg19	CCDS10632.1	.	.	.	.	.	.	.	.	.	.	C	18.75	3.691246	0.68271	.	.	ENSG00000188603	ENST00000535392;ENST00000359984;ENST00000360019;ENST00000354630;ENST00000357857;ENST00000395653	T;T;T;T;T;T	0.61158	0.13;0.13;0.13;0.13;0.13;0.13	5.6	5.6	0.85130	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.81922	0.4925	M	0.92169	3.28	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;0.992	D	0.85590	0.1245	10	0.62326	D	0.03	-20.6091	17.1168	0.86691	0.0:1.0:0.0:0.0	.	106;182;206;206;257;106;206	B4DFT5;B4DXL3;Q13286-3;Q13286-4;B4DIA8;B4DMY6;Q13286	.;.;.;.;.;.;CLN3_HUMAN	V	128;206;206;206;152;106	ENSP00000443221:G128V;ENSP00000353073:G206V;ENSP00000353116:G206V;ENSP00000346650:G206V;ENSP00000350523:G152V;ENSP00000379014:G106V	ENSP00000346650:G206V	G	-	2	0	CLN3	28405229	1.000000	0.71417	1.000000	0.80357	0.240000	0.25518	6.412000	0.73303	2.654000	0.90174	0.651000	0.88453	GGC	.	.	.	none		0.687	CLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214115.2		
TERF2IP	54386	hgsc.bcm.edu	37	16	75690303	75690303	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr16:75690303G>A	ENST00000300086.4	+	3	1091	c.994G>A	c.(994-996)Gtt>Att	p.V332I		NM_018975.3	NP_061848.2	Q9NYB0	TE2IP_HUMAN	telomeric repeat binding factor 2, interacting protein	332					negative regulation of DNA recombination at telomere (GO:0048239)|negative regulation of telomere maintenance (GO:0032205)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protection from non-homologous end joining at telomere (GO:0031848)|protein localization to chromosome, telomeric region (GO:0070198)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of transcription, DNA-templated (GO:0006355)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere lengthening (GO:0010833)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear chromosome (GO:0000228)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)	5						TCTATCAACAGTTACACAGGC	0.453																																					p.V332I		Atlas-SNP	.											.	TERF2IP	17	.	0			c.G994A						PASS	.						159.0	161.0	160.0					16																	75690303		2198	4300	6498	SO:0001583	missense	54386	exon3			TCAACAGTTACAC	AK000669	CCDS32491.1	16q23.1	2012-10-03			ENSG00000166848	ENSG00000166848			19246	protein-coding gene	gene with protein product		605061				10850490	Standard	NM_018975		Approved	RAP1	uc002fet.2	Q9NYB0	OTTHUMG00000177136	ENST00000300086.4:c.994G>A	chr16.hg19:g.75690303G>A	ENSP00000300086:p.Val332Ile	214.0	0.0	.		181.0	45.0	.	NM_018975	B4DQN4|Q4W4Y2|Q8WYZ3|Q9NWR2	Missense_Mutation	SNP	ENST00000300086.4	hg19	CCDS32491.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.392384	0.83011	.	.	ENSG00000166848	ENST00000300086	T	0.45276	0.9	5.75	4.79	0.61399	.	0.055638	0.64402	N	0.000001	T	0.34454	0.0898	L	0.34521	1.04	0.44890	D	0.997905	B	0.21225	0.053	B	0.19666	0.026	T	0.16778	-1.0391	10	0.87932	D	0	-10.2609	13.2667	0.60137	0.0769:0.0:0.9231:0.0	.	332	Q9NYB0	TE2IP_HUMAN	I	332	ENSP00000300086:V332I	ENSP00000300086:V332I	V	+	1	0	TERF2IP	74247804	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.919000	0.56439	1.426000	0.47256	0.591000	0.81541	GTT	.	.	.	none		0.453	TERF2IP-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000435519.1	NM_018975	
ARHGAP23	57636	hgsc.bcm.edu	37	17	36638765	36638765	+	Splice_Site	SNP	G	G	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr17:36638765G>A	ENST00000431231.2	+	16	2821	c.2753G>A	c.(2752-2754)cGc>cAc	p.R918H	ARHGAP23_ENST00000443378.1_Splice_Site_p.R824H|ARHGAP23_ENST00000437668.3_Splice_Site_p.R918H	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	918	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						TGTCCCCAGCGCGTCCCCTTA	0.632																																					p.R918H		Atlas-SNP	.											ARHGAP23,colon,carcinoma,0,1	ARHGAP23	48	.	0			c.G2753A						PASS	.						15.0	13.0	14.0					17																	36638765		692	1590	2282	SO:0001630	splice_region_variant	57636	exon16			CCCAGCGCGTCCC	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.2752-1G>A	chr17.hg19:g.36638765G>A		132.0	0.0	.		78.0	46.0	.	NM_001199417		Missense_Mutation	SNP	ENST00000431231.2	hg19	CCDS56027.1	.	.	.	.	.	.	.	.	.	.	g	7.910	0.736222	0.15574	.	.	ENSG00000225485	ENST00000437668;ENST00000431231;ENST00000443378	T;T;T	0.11712	2.75;2.75;2.75	4.85	0.646	0.17789	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);	0.260679	0.38058	N	0.001826	T	0.06325	0.0163	L	0.39326	1.205	0.21020	N	0.999807	B;B	0.29188	0.085;0.236	B;B	0.19148	0.006;0.024	T	0.36866	-0.9730	10	0.21014	T	0.42	.	4.7256	0.12939	0.3183:0.0:0.5389:0.1428	.	918;918	Q9P227;Q9P227-2	RHG23_HUMAN;.	H	918;918;824	ENSP00000394153:R918H;ENSP00000393539:R918H;ENSP00000407333:R824H	ENSP00000393539:R918H	R	+	2	0	ARHGAP23	33892291	0.911000	0.30947	0.195000	0.23364	0.397000	0.30659	1.523000	0.35932	0.013000	0.14918	-0.127000	0.14921	CGC	.	.	.	none		0.632	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441789.1	XM_290799	Missense_Mutation
UTP18	51096	hgsc.bcm.edu	37	17	49357809	49357809	+	Silent	SNP	T	T	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr17:49357809T>C	ENST00000225298.7	+	9	1230	c.1173T>C	c.(1171-1173)tcT>tcC	p.S391S		NM_016001.2	NP_057085.2	Q9Y5J1	UTP18_HUMAN	UTP18 small subunit (SSU) processome component homolog (yeast)	391					rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(3)|kidney(2)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16			BRCA - Breast invasive adenocarcinoma(22;2.09e-07)			CCACATTCTCTTCAGATAGTA	0.353																																					p.S391S		Atlas-SNP	.											.	UTP18	28	.	0			c.T1173C						PASS	.						72.0	66.0	68.0					17																	49357809		1846	4094	5940	SO:0001819	synonymous_variant	51096	exon9			ATTCTCTTCAGAT	AF151806	CCDS42362.1	17q21.33	2013-05-21	2011-12-09	2006-05-16	ENSG00000011260	ENSG00000011260		"""WD repeat domain containing"""	24274	protein-coding gene	gene with protein product		612816	"""WD repeat domain 50"""	WDR50		10810093, 8619474, 15590835	Standard	NM_016001		Approved	CGI-48	uc002its.3	Q9Y5J1	OTTHUMG00000162370	ENST00000225298.7:c.1173T>C	chr17.hg19:g.49357809T>C		403.0	0.0	.		356.0	87.0	.	NM_016001	Q9H4N6	Silent	SNP	ENST00000225298.7	hg19	CCDS42362.1																																																																																			.	.	.	none		0.353	UTP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368654.1	NM_016001	
DDX5	1655	hgsc.bcm.edu	37	17	62496750	62496750	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr17:62496750A>T	ENST00000225792.5	-	12	1759	c.1358T>A	c.(1357-1359)gTg>gAg	p.V453E	DDX5_ENST00000580026.1_5'UTR|DDX5_ENST00000578804.1_Missense_Mutation_p.V453E|DDX5_ENST00000450599.2_Missense_Mutation_p.V374E|MIR5047_ENST00000579212.1_RNA|MIR3064_ENST00000581130.1_RNA	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	453	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)	p.V453A(2)		breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			AAGGTCGCTCACTTGCTTTAT	0.418			T	ETV4	prostate																																p.V453E	NSCLC(22;406 813 4871 19580 40307)	Atlas-SNP	.		Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	DDX5_ENST00000540698,colon,carcinoma,0,2	DDX5	101	.	2	Substitution - Missense(2)	large_intestine(2)	c.T1358A						PASS	.						159.0	141.0	147.0					17																	62496750		2203	4300	6503	SO:0001583	missense	1655	exon12			TCGCTCACTTGCT	AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.1358T>A	chr17.hg19:g.62496750A>T	ENSP00000225792:p.Val453Glu	176.0	0.0	.		126.0	68.0	.	NM_004396	B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Missense_Mutation	SNP	ENST00000225792.5	hg19	CCDS11659.1	.	.	.	.	.	.	.	.	.	.	A	8.939	0.965316	0.18583	.	.	ENSG00000108654	ENST00000540698;ENST00000450599;ENST00000225792	.	.	.	5.73	5.73	0.89815	Helicase, C-terminal (1);	0.103387	0.64402	D	0.000003	T	0.53384	0.1793	L	0.51914	1.62	0.80722	D	1	P;P;P	0.39576	0.471;0.679;0.679	B;B;B	0.35859	0.191;0.212;0.212	T	0.60229	-0.7304	9	0.87932	D	0	-5.3751	16.3123	0.82883	1.0:0.0:0.0:0.0	.	374;453;453	B4DLW8;B5BUE6;P17844	.;.;DDX5_HUMAN	E	453;383;442	.	ENSP00000225792:V442E	V	-	2	0	DDX5	59927212	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.406000	0.73276	2.308000	0.77769	0.533000	0.62120	GTG	.	.	.	none		0.418	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444030.1	NM_004396	
SLC25A19	60386	hgsc.bcm.edu	37	17	73273495	73273495	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr17:73273495T>G	ENST00000402418.3	-	5	1622	c.713A>C	c.(712-714)gAc>gCc	p.D238A	SLC25A19_ENST00000442286.2_Missense_Mutation_p.D238A|SLC25A19_ENST00000580994.1_Missense_Mutation_p.D238A|SLC25A19_ENST00000375261.4_Missense_Mutation_p.D181A|SLC25A19_ENST00000416858.2_Missense_Mutation_p.D238A|SLC25A19_ENST00000320362.3_Missense_Mutation_p.D238A			Q9HC21	TPC_HUMAN	solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19	238					deoxynucleotide transport (GO:0030302)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	deoxynucleotide transmembrane transporter activity (GO:0030233)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_cancers(13;5.98e-08)|all_epithelial(9;1.16e-08)|Breast(9;3.1e-08)		all cancers(21;6.82e-07)|Epithelial(20;6.86e-06)			CTTGAAGAGGTCCAGCGGATA	0.557																																					p.D238A		Atlas-SNP	.											.	SLC25A19	25	.	0			c.A713C						PASS	.						101.0	85.0	90.0					17																	73273495		2203	4300	6503	SO:0001583	missense	60386	exon6			AAGAGGTCCAGCG		CCDS11720.1	17q25.1	2013-05-22	2007-03-08		ENSG00000125454	ENSG00000125454		"""Solute carriers"""	14409	protein-coding gene	gene with protein product		606521	"""solute carrier family 25 (mitochondrial deoxynucleotide carrier), member 19"", ""microcephaly, Amish"""	MCPHA		11474176, 11226231, 19798730	Standard	NM_021734		Approved	DNC, MUP1, TPC	uc002jnw.4	Q9HC21		ENST00000402418.3:c.713A>C	chr17.hg19:g.73273495T>G	ENSP00000385312:p.Asp238Ala	103.0	0.0	.		56.0	13.0	.	NM_001126122	E9PF74|Q6V9R7	Missense_Mutation	SNP	ENST00000402418.3	hg19	CCDS11720.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.511535	0.85389	.	.	ENSG00000125454	ENST00000416858;ENST00000442286;ENST00000320362;ENST00000402418;ENST00000375261	D;D;D;D;D	0.84370	-1.84;-1.84;-1.84;-1.84;-1.84	5.35	5.35	0.76521	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.94486	0.8225	H	0.95884	3.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94730	0.7909	10	0.31617	T	0.26	-39.7112	15.0367	0.71754	0.0:0.0:0.0:1.0	.	181;238	E9PF74;Q9HC21	.;TPC_HUMAN	A	238;238;238;238;181	ENSP00000397818:D238A;ENSP00000402202:D238A;ENSP00000319574:D238A;ENSP00000385312:D238A;ENSP00000364410:D181A	ENSP00000319574:D238A	D	-	2	0	SLC25A19	70785090	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	7.698000	0.84413	2.033000	0.60031	0.528000	0.53228	GAC	.	.	.	none		0.557	SLC25A19-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447282.1	NM_021734	
CD7	924	hgsc.bcm.edu	37	17	80274183	80274183	+	Missense_Mutation	SNP	G	G	C	rs199986856		TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr17:80274183G>C	ENST00000312648.3	-	3	606	c.500C>G	c.(499-501)gCc>gGc	p.A167G	CD7_ENST00000583376.1_Missense_Mutation_p.A67G|CD7_ENST00000584284.1_Missense_Mutation_p.A167G|CD7_ENST00000578509.1_Missense_Mutation_p.A67G	NM_006137.6	NP_006128.1	P09564	CD7_HUMAN	CD7 molecule	167	4 X 9 AA tandem repeats, potential spacer function.				homeostasis of number of cells within a tissue (GO:0048873)|immune response (GO:0006955)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			GAGGGCAGAGGCTGTCTGCGG	0.711																																					p.A167G	Pancreas(45;804 1068 19702 28207 28798)	Atlas-SNP	.											CD7,rectum,carcinoma,0,2	CD7	25	.	0			c.C500G						PASS	.																																			SO:0001583	missense	924	exon3			GCAGAGGCTGTCT	X06180	CCDS11807.1	17q25.2-q25.3	2013-01-11	2006-03-28			ENSG00000173762		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1695	protein-coding gene	gene with protein product	"""p41 protein"", ""T-cell antigen CD7"", ""T-cell leukemia antigen"""	186820	"""CD7 antigen (p41)"""			1695199, 3501369	Standard	NM_006137		Approved	GP40, LEU-9, TP41, Tp40	uc002kel.1	P09564		ENST00000312648.3:c.500C>G	chr17.hg19:g.80274183G>C	ENSP00000312027:p.Ala167Gly	117.0	1.0	.		63.0	9.0	.	NM_006137		Missense_Mutation	SNP	ENST00000312648.3	hg19	CCDS11807.1	.	.	.	.	.	.	.	.	.	.	G	1.766	-0.485462	0.04352	.	.	ENSG00000173762	ENST00000312648	T	0.25912	1.77	0.122	-0.245	0.13027	.	.	.	.	.	T	0.08537	0.0212	N	0.08118	0	0.20926	N	0.999825	P;P	0.38110	0.618;0.618	B;B	0.28638	0.092;0.092	T	0.27088	-1.0084	9	0.21540	T	0.41	.	4.5003	0.11860	0.3195:0.0:0.6805:0.0	.	167;167	Q29VG3;P09564	.;CD7_HUMAN	G	167	ENSP00000312027:A167G	ENSP00000312027:A167G	A	-	2	0	CD7	77867472	0.013000	0.17824	0.007000	0.13788	0.007000	0.05969	0.000000	0.12993	-1.039000	0.03275	-1.031000	0.02408	GCC	.	G|0.999;A|0.001	.	alt		0.711	CD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442826.1	NM_006137	
ALPK2	115701	hgsc.bcm.edu	37	18	56202906	56202906	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr18:56202906G>C	ENST00000361673.3	-	5	4726	c.4513C>G	c.(4513-4515)Cca>Gca	p.P1505A	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1505						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						CATCCACTTGGAATTCTTTCA	0.483																																					p.P1505A		Atlas-SNP	.											.	ALPK2	487	.	0			c.C4513G						PASS	.						86.0	88.0	88.0					18																	56202906		2203	4300	6503	SO:0001583	missense	115701	exon5			CACTTGGAATTCT	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.4513C>G	chr18.hg19:g.56202906G>C	ENSP00000354991:p.Pro1505Ala	172.0	0.0	.		90.0	31.0	.	NM_052947	Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	hg19	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199585	0.58126	.	.	ENSG00000198796	ENST00000361673	T	0.68624	-0.34	5.68	3.88	0.44766	.	10.063900	0.00166	N	0.000004	T	0.68495	0.3007	L	0.43152	1.355	0.23468	N	0.997617	D;P	0.54047	0.964;0.952	P;B	0.48873	0.593;0.335	T	0.54153	-0.8336	10	0.72032	D	0.01	-9.3927	7.1825	0.25780	0.0892:0.1733:0.7374:0.0	.	1500;1505	Q86TB3-2;Q86TB3	.;ALPK2_HUMAN	A	1505	ENSP00000354991:P1505A	ENSP00000354991:P1505A	P	-	1	0	ALPK2	54353886	0.353000	0.24904	0.156000	0.22583	0.066000	0.16364	1.417000	0.34770	1.385000	0.46445	0.563000	0.77884	CCA	.	.	.	none		0.483	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947	
ADAMTS10	81794	hgsc.bcm.edu	37	19	8661948	8661948	+	Silent	SNP	G	G	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr19:8661948G>A	ENST00000597188.1	-	8	1233	c.963C>T	c.(961-963)atC>atT	p.I321I	ADAMTS10_ENST00000596709.1_5'Flank|ADAMTS10_ENST00000270328.4_Silent_p.I321I	NM_030957.2	NP_112219.3	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 10	321	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					extracellular matrix (GO:0031012)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(16)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(3)|skin(10)|urinary_tract(1)	53						TGTGGTTCACGATGGATTTCT	0.572																																					p.I321I		Atlas-SNP	.											.	ADAMTS10	132	.	0			c.C963T						PASS	.						102.0	89.0	94.0					19																	8661948		2203	4300	6503	SO:0001819	synonymous_variant	81794	exon8			GTTCACGATGGAT	AF163762	CCDS12206.1, CCDS62529.1	19p13.2	2014-08-12	2005-08-19		ENSG00000142303	ENSG00000142303		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13201	protein-coding gene	gene with protein product		608990	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10"""				Standard	XM_005272499		Approved	ADAM-TS10	uc002mkj.1	Q9H324	OTTHUMG00000182216	ENST00000597188.1:c.963C>T	chr19.hg19:g.8661948G>A		79.0	0.0	.		63.0	28.0	.	NM_030957	M0QZE4	Silent	SNP	ENST00000597188.1	hg19	CCDS12206.1																																																																																			.	.	.	none		0.572	ADAMTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460085.3	NM_030957	
KLF1	10661	hgsc.bcm.edu	37	19	12996546	12996546	+	Silent	SNP	C	C	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr19:12996546C>A	ENST00000264834.4	-	2	538	c.498G>T	c.(496-498)ctG>ctT	p.L166L	CTD-2265O21.7_ENST00000592400.1_RNA	NM_006563.3	NP_006554.1	Q13351	KLF1_HUMAN	Kruppel-like factor 1 (erythroid)	166	Pro-rich.				cellular response to peptide (GO:1901653)|chromatin remodeling (GO:0006338)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(3)|large_intestine(1)|skin(1)	5		Hepatocellular(1079;0.137)		GBM - Glioblastoma multiforme(1328;0.00016)|Lung(535;0.171)|STAD - Stomach adenocarcinoma(1328;0.18)		ACACCGGTTGCAGCGCCAGCG	0.781																																					p.L166L		Atlas-SNP	.											.	KLF1	15	.	0			c.G498T						PASS	.						1.0	1.0	1.0					19																	12996546		684	1693	2377	SO:0001819	synonymous_variant	10661	exon2			CGGTTGCAGCGCC	U37106	CCDS12285.1	19p13.2	2014-07-18			ENSG00000105610	ENSG00000105610		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6345	protein-coding gene	gene with protein product	"""erythroid Kruppel-like factor"""	600599				8924208, 9119377	Standard	NM_006563		Approved	EKLF	uc002mvo.3	Q13351	OTTHUMG00000180536	ENST00000264834.4:c.498G>T	chr19.hg19:g.12996546C>A		61.0	0.0	.		37.0	18.0	.	NM_006563	Q6PIJ5|Q92899	Silent	SNP	ENST00000264834.4	hg19	CCDS12285.1																																																																																			.	.	.	none		0.781	KLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451794.1	NM_006563	
CYP4F2	8529	hgsc.bcm.edu	37	19	16006325	16006325	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr19:16006325T>A	ENST00000221700.6	-	3	429	c.334A>T	c.(334-336)Aac>Tac	p.N112Y	CYP4F2_ENST00000011989.7_Intron	NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2											NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CCTGAGGCGTTGATGACAGAC	0.607																																					p.N112Y		Atlas-SNP	.											.	CYP4F2	97	.	0			c.A334T						PASS	.						124.0	134.0	131.0					19																	16006325		2203	4300	6503	SO:0001583	missense	8529	exon3			AGGCGTTGATGAC	U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.334A>T	chr19.hg19:g.16006325T>A	ENSP00000221700:p.Asn112Tyr	69.0	0.0	.		34.0	15.0	.	NM_001082		Missense_Mutation	SNP	ENST00000221700.6	hg19	CCDS12336.1	.	.	.	.	.	.	.	.	.	.	t	10.88	1.475353	0.26511	.	.	ENSG00000186115	ENST00000221700	D	0.95171	-3.63	3.13	2.1	0.27182	.	0.598081	0.13811	U	0.361135	D	0.90642	0.7065	M	0.62209	1.925	0.09310	N	1	B	0.02656	0.0	B	0.12837	0.008	T	0.80211	-0.1476	10	0.32370	T	0.25	.	3.9592	0.09403	0.0:0.2815:0.0:0.7185	.	112	P78329	CP4F2_HUMAN	Y	112	ENSP00000221700:N112Y	ENSP00000221700:N112Y	N	-	1	0	CYP4F2	15867325	0.008000	0.16893	0.003000	0.11579	0.625000	0.37756	1.889000	0.39718	1.414000	0.47017	0.254000	0.18369	AAC	.	.	.	none		0.607	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460372.3	NM_001082	
UNC13A	23025	hgsc.bcm.edu	37	19	17722656	17722656	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr19:17722656C>T	ENST00000519716.2	-	42	4566	c.4567G>A	c.(4567-4569)Gta>Ata	p.V1523I	UNC13A_ENST00000252773.7_Missense_Mutation_p.V1523I|UNC13A_ENST00000552293.1_Missense_Mutation_p.V1517I|UNC13A_ENST00000428389.2_Missense_Mutation_p.V1611I|UNC13A_ENST00000551649.1_Missense_Mutation_p.V1542I|UNC13A_ENST00000550896.1_Missense_Mutation_p.V1496I|CTD-3149D2.3_ENST00000600512.1_RNA	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	1523					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						GGGTCTTCTACACCCAAGCCT	0.587																																					p.V1523I		Atlas-SNP	.											.	UNC13A	299	.	0			c.G4567A						PASS	.						102.0	101.0	102.0					19																	17722656		2111	4245	6356	SO:0001583	missense	23025	exon40			CTTCTACACCCAA	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.4567G>A	chr19.hg19:g.17722656C>T	ENSP00000429562:p.Val1523Ile	119.0	0.0	.		59.0	22.0	.	NM_001080421	E5RHY9	Missense_Mutation	SNP	ENST00000519716.2	hg19	CCDS46013.2	.	.	.	.	.	.	.	.	.	.	C	17.36	3.371221	0.61624	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.80824	-1.41;-1.42;-1.41;-1.29;-1.27;-1.38	4.75	4.75	0.60458	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	U	0.000002	T	0.72614	0.3482	L	0.32530	0.975	0.43761	D	0.996277	B	0.15719	0.014	B	0.20384	0.029	T	0.67952	-0.5537	10	0.32370	T	0.25	-16.2067	15.3216	0.74126	0.0:1.0:0.0:0.0	.	1523	Q9UPW8	UN13A_HUMAN	I	1523;1611;1523;1542;1517;1496	ENSP00000429562:V1523I;ENSP00000400409:V1611I;ENSP00000252773:V1523I;ENSP00000447236:V1542I;ENSP00000447572:V1517I;ENSP00000446831:V1496I	ENSP00000252773:V1523I	V	-	1	0	UNC13A	17583656	0.982000	0.34865	0.962000	0.40283	0.916000	0.54674	3.975000	0.56859	2.209000	0.71365	0.549000	0.68633	GTA	.	.	.	none		0.587	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604	
SLC25A42	284439	hgsc.bcm.edu	37	19	19217183	19217183	+	Silent	SNP	C	C	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr19:19217183C>A	ENST00000318596.7	+	6	637	c.486C>A	c.(484-486)acC>acA	p.T162T	SLC25A42_ENST00000600275.1_3'UTR	NM_178526.4	NP_848621.2	Q86VD7	S2542_HUMAN	solute carrier family 25, member 42	162					ADP transport (GO:0015866)|AMP transport (GO:0080121)|ATP transport (GO:0015867)|coenzyme A transmembrane transport (GO:0035349)|metabolic process (GO:0008152)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenosine-diphosphatase activity (GO:0043262)|ADP transmembrane transporter activity (GO:0015217)|AMP transmembrane transporter activity (GO:0080122)|ATP transmembrane transporter activity (GO:0005347)|coenzyme A transmembrane transporter activity (GO:0015228)			cervix(1)|large_intestine(2)|lung(3)	6			OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)			TGGCCGTAACCCCGAAGGAAA	0.657																																					p.T162T		Atlas-SNP	.											.	SLC25A42	18	.	0			c.C486A						PASS	.						67.0	64.0	65.0					19																	19217183		2203	4300	6503	SO:0001819	synonymous_variant	284439	exon6			CGTAACCCCGAAG		CCDS32966.1	19p13.11	2013-05-22			ENSG00000181035	ENSG00000181035		"""Solute carriers"""	28380	protein-coding gene	gene with protein product		610823				16949250, 19429682	Standard	NM_178526		Approved	MGC26694	uc002nlf.3	Q86VD7		ENST00000318596.7:c.486C>A	chr19.hg19:g.19217183C>A		55.0	0.0	.		24.0	10.0	.	NM_178526	D2T2J5|O14553|O43378	Silent	SNP	ENST00000318596.7	hg19	CCDS32966.1																																																																																			.	.	.	none		0.657	SLC25A42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465931.1	NM_178526	
MAG	4099	hgsc.bcm.edu	37	19	35800864	35800864	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr19:35800864C>T	ENST00000392213.3	+	8	1478	c.1319C>T	c.(1318-1320)cCg>cTg	p.P440L	MAG_ENST00000361922.4_Missense_Mutation_p.P440L|MAG_ENST00000593348.1_3'UTR|MAG_ENST00000537831.2_Missense_Mutation_p.P415L	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	440	Ig-like C2-type 4.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			AACCCGGAGCCGTCCGTGGCC	0.662																																					p.P440L		Atlas-SNP	.											.	MAG	172	.	0			c.C1319T						PASS	.						78.0	73.0	75.0					19																	35800864		2203	4300	6503	SO:0001583	missense	4099	exon8			CGGAGCCGTCCGT	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.1319C>T	chr19.hg19:g.35800864C>T	ENSP00000376048:p.Pro440Leu	121.0	0.0	.		77.0	32.0	.	NM_080600	B7Z2E5|F5GYC0|Q567S4	Missense_Mutation	SNP	ENST00000392213.3	hg19	CCDS12455.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.342867	0.61073	.	.	ENSG00000105695	ENST00000262624;ENST00000361922;ENST00000392213;ENST00000537831	T;T;T	0.18338	2.22;2.22;2.22	4.8	3.74	0.42951	.	0.056265	0.64402	D	0.000001	T	0.24122	0.0584	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	0.981;1.0;0.999	B;P;P	0.61132	0.373;0.884;0.78	T	0.02345	-1.1173	10	0.87932	D	0	.	12.0011	0.53230	0.1744:0.8256:0.0:0.0	.	477;440;440	Q59GD9;P20916;Q567S4	.;MAG_HUMAN;.	L	477;440;440;415	ENSP00000355234:P440L;ENSP00000376048:P440L;ENSP00000440695:P415L	ENSP00000262624:P477L	P	+	2	0	MAG	40492704	0.999000	0.42202	0.772000	0.31596	0.697000	0.40408	5.287000	0.65645	1.212000	0.43366	0.462000	0.41574	CCG	.	.	.	none		0.662	MAG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000466071.1	NM_080600	
LTBP4	8425	hgsc.bcm.edu	37	19	41117892	41117892	+	Splice_Site	SNP	T	T	A	rs1131621		TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr19:41117892T>A	ENST00000602240.1	+	17	2269		c.e17+2		LTBP4_ENST00000545697.1_Splice_Site|LTBP4_ENST00000204005.9_Splice_Site|LTBP4_ENST00000396819.3_Splice_Site|LTBP4_ENST00000243562.9_5'Flank|LTBP4_ENST00000308370.7_Splice_Site			Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4						extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGTGCGAGGGTGAGGCCGGGG	0.637																																					.		Atlas-SNP	.											.	LTBP4	101	.	0			c.2269+2T>A						PASS	.						30.0	35.0	33.0					19																	41117892		2099	4214	6313	SO:0001630	splice_region_variant	8425	exon17			CGAGGGTGAGGCC	Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000602240.1:c.2269+2T>A	chr19.hg19:g.41117892T>A		79.0	0.0	.		67.0	33.0	.	NM_003573	O00508|O75412|O75413	Splice_Site	SNP	ENST00000602240.1	hg19		.	.	.	.	.	.	.	.	.	.	T	16.01	3.000075	0.54147	.	.	ENSG00000090006	ENST00000204005;ENST00000545697;ENST00000308370;ENST00000396819	.	.	.	4.5	4.5	0.54988	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0527	0.58964	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	LTBP4	45809732	1.000000	0.71417	1.000000	0.80357	0.626000	0.37791	4.489000	0.60309	1.800000	0.52685	0.459000	0.35465	.	.	.	.	none		0.637	LTBP4-002	KNOWN	sequence_error|basic	processed_transcript	protein_coding	OTTHUMT00000462815.2	NM_003573	Intron
LSM14B	149986	hgsc.bcm.edu	37	20	60705652	60705652	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr20:60705652T>C	ENST00000279068.6	+	6	900	c.740T>C	c.(739-741)aTc>aCc	p.I247T	LSM14B_ENST00000253001.4_Missense_Mutation_p.I247T	NM_144703.2	NP_653304.2	Q9BX40	LS14B_HUMAN	LSM14B, SCD6 homolog B (S. cerevisiae)	247	DFDF. {ECO:0000255|PROSITE- ProRule:PRU00845}.				multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)	ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|lung(4)	8	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			GAAAACACAATCAAATTTGAG	0.438																																					p.I247T		Atlas-SNP	.											.	LSM14B	62	.	0			c.T740C						PASS	.						93.0	89.0	90.0					20																	60705652		1896	4113	6009	SO:0001583	missense	149986	exon6			ACACAATCAAATT	AF172328	CCDS46626.1	20q13.33	2010-01-27	2006-12-21	2006-01-24	ENSG00000149657	ENSG00000149657			15887	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 40"", ""family with sequence similarity 61, member B"", ""LSM14 homolog B (SCD6, S. cerevisiae)"""	C20orf40, FAM61B			Standard	NM_144703		Approved	FT005, bA11M20.3, FLJ25473, LSM13, RAP55B	uc010gjy.1	Q9BX40	OTTHUMG00000032901	ENST00000279068.6:c.740T>C	chr20.hg19:g.60705652T>C	ENSP00000279068:p.Ile247Thr	220.0	0.0	.		110.0	44.0	.	NM_144703	Q6PFW8|Q96LH8	Missense_Mutation	SNP	ENST00000279068.6	hg19	CCDS46626.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.657274	0.88154	.	.	ENSG00000149657	ENST00000279068;ENST00000253001;ENST00000444156;ENST00000400318;ENST00000279069;ENST00000370906;ENST00000361670	T;T;T;T	0.44881	0.98;0.93;0.96;0.91	5.59	5.59	0.84812	.	0.055865	0.64402	D	0.000001	T	0.55705	0.1937	L	0.36672	1.1	0.51233	D	0.999912	D;D;D;D;D	0.69078	0.997;0.997;0.997;0.997;0.974	D;D;D;D;P	0.83275	0.994;0.994;0.994;0.996;0.647	T	0.58719	-0.7587	10	0.72032	D	0.01	.	15.4482	0.75248	0.0:0.0:0.0:1.0	.	167;203;247;273;247	E9PG81;C9J454;Q9BX40;Q5TBQ0;Q9BX40-2	.;.;LS14B_HUMAN;.;.	T	247;247;203;273;221;203;167	ENSP00000279068:I247T;ENSP00000253001:I247T;ENSP00000383172:I273T;ENSP00000355209:I167T	ENSP00000253001:I247T	I	+	2	0	LSM14B	60139047	1.000000	0.71417	0.999000	0.59377	0.910000	0.53928	7.768000	0.85345	2.125000	0.65367	0.454000	0.30748	ATC	.	.	.	none		0.438	LSM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079996.4	NM_144703	
BCL2L13	23786	hgsc.bcm.edu	37	22	18185096	18185096	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr22:18185096G>A	ENST00000317582.5	+	6	891	c.544G>A	c.(544-546)Ggc>Agc	p.G182S	BCL2L13_ENST00000355028.3_Intron|BCL2L13_ENST00000543133.1_Missense_Mutation_p.G20S|BCL2L13_ENST00000399782.1_Missense_Mutation_p.G182S|BCL2L13_ENST00000337612.5_Missense_Mutation_p.G20S|BCL2L13_ENST00000538149.1_Missense_Mutation_p.G58S|BCL2L13_ENST00000493680.1_Missense_Mutation_p.G182S|BCL2L13_ENST00000418951.2_Intron	NM_015367.3	NP_056182.2	Q9BXK5	B2L13_HUMAN	BCL2-like 13 (apoptosis facilitator)	182					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			breast(2)|central_nervous_system(1)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|skin(3)|urinary_tract(2)	15		all_epithelial(15;0.123)		Lung(27;0.199)		GCTGCAGTTTGGCGTGACATA	0.408																																					p.W106X		Atlas-SNP	.											.	BCL2L13	27	.	0			c.G317A						PASS	.						115.0	108.0	110.0					22																	18185096		2203	4300	6503	SO:0001583	missense	23786	exon4			CAGTTTGGCGTGA	AF146568	CCDS13746.1, CCDS59447.1, CCDS59448.1, CCDS74810.1, CCDS74811.1, CCDS74812.1, CCDS74813.1, CCDS74814.1	22q11	2014-03-07			ENSG00000099968	ENSG00000099968			17164	protein-coding gene	gene with protein product						11262395, 11381032	Standard	NM_015367		Approved	MIL1, BCL-RAMBO	uc002zmw.4	Q9BXK5	OTTHUMG00000150088	ENST00000317582.5:c.544G>A	chr22.hg19:g.18185096G>A	ENSP00000318883:p.Gly182Ser	173.0	0.0	.		88.0	35.0	.	NM_001270732	B3KPE7|Q96B37|Q96IB7|Q9BY01|Q9HC05|Q9UFE0|Q9UKN3	Nonsense_Mutation	SNP	ENST00000317582.5	hg19	CCDS13746.1	.	.	.	.	.	.	.	.	.	.	G	34	5.326602	0.95708	.	.	ENSG00000099968	ENST00000399782;ENST00000317582;ENST00000543133;ENST00000538149;ENST00000337612;ENST00000493680	T;T;T;T;T;T	0.04551	3.6;3.6;3.6;3.6;3.6;3.6	5.95	5.95	0.96441	Apoptosis regulator, Bcl2-like (1);Apoptosis regulator, Bcl-2, BH (2);	0.000000	0.85682	D	0.000000	T	0.22282	0.0537	M	0.69823	2.125	0.58432	D	0.999991	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.00008	-1.2486	10	0.54805	T	0.06	-13.5484	18.1662	0.89727	0.0:0.0:1.0:0.0	.	58;182;182	B7Z238;Q9BXK5;Q9BXK5-2	.;B2L13_HUMAN;.	S	182;182;20;58;20;182	ENSP00000382682:G182S;ENSP00000318883:G182S;ENSP00000437667:G20S;ENSP00000441344:G58S;ENSP00000338932:G20S;ENSP00000434764:G182S	ENSP00000318883:G182S	G	+	1	0	BCL2L13	16565096	1.000000	0.71417	0.994000	0.49952	0.868000	0.49771	5.477000	0.66799	2.824000	0.97209	0.655000	0.94253	GGC	.	.	.	none		0.408	BCL2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316184.1	NM_015367	
TCN2	6948	hgsc.bcm.edu	37	22	31011613	31011613	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr22:31011613G>A	ENST00000215838.3	+	6	1273	c.779G>A	c.(778-780)gGg>gAg	p.G260E	TCN2_ENST00000405742.3_Missense_Mutation_p.G256E|TCN2_ENST00000407817.3_Missense_Mutation_p.G233E			P20062	TCO2_HUMAN	transcobalamin II	260					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|prostate(2)|urinary_tract(1)	22					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CCCATGCGTGGGGCAGAACTG	0.572																																					p.G260E		Atlas-SNP	.											.	TCN2	44	.	0			c.G779A						PASS	.						71.0	63.0	66.0					22																	31011613		2203	4300	6503	SO:0001583	missense	6948	exon6			TGCGTGGGGCAGA		CCDS13881.1, CCDS54519.1	22q12.2	2014-09-17	2010-05-11		ENSG00000185339	ENSG00000185339			11653	protein-coding gene	gene with protein product	"""macrocytic anemia"""	613441	"""transcobalamin II; macrocytic anemia"""			1708393, 7742531	Standard	NM_000355		Approved	D22S676, D22S750, TC2	uc003aip.2	P20062	OTTHUMG00000151095	ENST00000215838.3:c.779G>A	chr22.hg19:g.31011613G>A	ENSP00000215838:p.Gly260Glu	102.0	0.0	.		46.0	15.0	.	NM_000355	Q96FD4|Q9BVI8|Q9UCI5|Q9UCI6|Q9UDM0	Missense_Mutation	SNP	ENST00000215838.3	hg19	CCDS13881.1	.	.	.	.	.	.	.	.	.	.	G	0.301	-0.974151	0.02215	.	.	ENSG00000185339	ENST00000215838;ENST00000405742;ENST00000407817	T;T;T	0.24908	1.83;1.83;1.83	5.33	-0.87	0.10646	.	0.953276	0.08911	N	0.875895	T	0.17365	0.0417	L	0.46157	1.445	0.09310	N	1	B;B;B	0.17465	0.022;0.017;0.017	B;B;B	0.17433	0.018;0.007;0.007	T	0.39961	-0.9588	10	0.02654	T	1	-0.0037	7.6817	0.28518	0.1555:0.4063:0.4382:0.0	.	233;256;260	Q96FD4;B5MBX2;P20062	.;.;TCO2_HUMAN	E	260;256;233	ENSP00000215838:G260E;ENSP00000385914:G256E;ENSP00000384914:G233E	ENSP00000215838:G260E	G	+	2	0	TCN2	29341613	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.178000	0.16820	0.147000	0.19030	-0.150000	0.13652	GGG	.	.	.	none		0.572	TCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321282.2	NM_000355	
RNF185	91445	hgsc.bcm.edu	37	22	31600511	31600511	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr22:31600511T>A	ENST00000326132.6	+	7	677	c.518T>A	c.(517-519)tTc>tAc	p.F173Y	RNF185-AS1_ENST00000526089.1_RNA|RNF185_ENST00000266252.7_Missense_Mutation_p.F117Y|RNF185_ENST00000426256.2_Missense_Mutation_p.F111Y	NM_152267.3	NP_689480.2	Q96GF1	RN185_HUMAN	ring finger protein 185	173					autophagy (GO:0006914)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(3)|skin(1)	6						GACGAGCAGTTCCTGTCACGC	0.552																																					p.F173Y		Atlas-SNP	.											.	RNF185	14	.	0			c.T518A						PASS	.						139.0	119.0	125.0					22																	31600511		2203	4298	6501	SO:0001583	missense	91445	exon7			AGCAGTTCCTGTC		CCDS13890.1, CCDS46689.1	22q12.2	2013-01-09			ENSG00000138942	ENSG00000138942		"""RING-type (C3HC4) zinc fingers"""	26783	protein-coding gene	gene with protein product	"""hypothetical protein FLJ38628"""					12477932	Standard	NM_152267		Approved	FLJ38628	uc003akb.3	Q96GF1	OTTHUMG00000151253	ENST00000326132.6:c.518T>A	chr22.hg19:g.31600511T>A	ENSP00000320508:p.Phe173Tyr	71.0	0.0	.		42.0	21.0	.	NM_152267	A8K5C1|A9X3T8|Q8N900	Missense_Mutation	SNP	ENST00000326132.6	hg19	CCDS13890.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.241643	0.79912	.	.	ENSG00000138942	ENST00000426256;ENST00000326132;ENST00000266252	D	0.95554	-3.74	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.95733	0.8612	L	0.37561	1.115	0.54753	D	0.999989	P;D;P	0.61080	0.877;0.989;0.805	D;D;P	0.67725	0.916;0.953;0.827	D	0.94992	0.8135	10	0.33940	T	0.23	.	14.9068	0.70727	0.0:0.0:0.0:1.0	.	117;111;173	Q96GF1-2;B4DMD6;Q96GF1	.;.;RN185_HUMAN	Y	111;173;117	ENSP00000320508:F173Y	ENSP00000266252:F117Y	F	+	2	0	RNF185	29930511	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.454000	0.80714	2.169000	0.68431	0.528000	0.53228	TTC	.	.	.	none		0.552	RNF185-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321927.2	NM_152267	
RIBC2	26150	hgsc.bcm.edu	37	22	45809422	45809422	+	5'Flank	SNP	C	C	G			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr22:45809422C>G	ENST00000342894.3	+	0	0				SMC1B_ENST00000404354.3_Silent_p.V9V|SMC1B_ENST00000357450.4_Silent_p.V9V|RIBC2_ENST00000538017.1_5'Flank			Q9H4K1	RIBC2_HUMAN	RIB43A domain with coiled-coils 2							nucleus (GO:0005634)				NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|skin(2)|urinary_tract(1)	10		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		TGAAATTTTCCACAAGCAGCA	0.637																																					p.V9V		Atlas-SNP	.											.	SMC1B	215	.	0			c.G27C						PASS	.						21.0	27.0	25.0					22																	45809422		1935	4141	6076	SO:0001631	upstream_gene_variant	27127	exon1			ATTTTCCACAAGC	AK098586		22q13.3	2004-08-18	2004-08-18	2004-08-18	ENSG00000128408	ENSG00000128408			13241	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 11"""	C22orf11		12477932	Standard	NM_015653		Approved	DKFZp566F0546, FLJ25720	uc011aqs.3	Q9H4K1	OTTHUMG00000151332		chr22.hg19:g.45809422C>G	Exception_encountered	169.0	0.0	.		104.0	50.0	.	NM_148674	Q6ICD0|Q9Y413	Silent	SNP	ENST00000342894.3	hg19																																																																																				.	.	.	none		0.637	RIBC2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000322250.1	NM_015653	
PTCHD1	139411	hgsc.bcm.edu	37	X	23353163	23353163	+	Silent	SNP	G	G	A			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chrX:23353163G>A	ENST00000379361.4	+	1	1031	c.171G>A	c.(169-171)gcG>gcA	p.A57A		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	57					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						ACCTGCTGGCGCCCCAGCACA	0.657																																					p.A57A		Atlas-SNP	.											.	PTCHD1	213	.	0			c.G171A						PASS	.						48.0	52.0	50.0					X																	23353163		2202	4298	6500	SO:0001819	synonymous_variant	139411	exon1			GCTGGCGCCCCAG	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.171G>A	chrX.hg19:g.23353163G>A		78.0	0.0	.		47.0	41.0	.	NM_173495	B4DQH0|Q0IJ60|Q6P6B8	Silent	SNP	ENST00000379361.4	hg19	CCDS35215.2																																																																																			.	.	.	none		0.657	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	NM_173495	
ELK1	2002	hgsc.bcm.edu	37	X	47497265	47497265	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chrX:47497265C>T	ENST00000247161.3	-	4	1070	c.971G>A	c.(970-972)aGc>aAc	p.S324N	ELK1_ENST00000376983.3_Missense_Mutation_p.S324N|ELK1_ENST00000592066.1_Missense_Mutation_p.S270N|ELK1_ENST00000343894.4_Intron	NM_005229.4	NP_005220.2	P19419	ELK1_HUMAN	ELK1, member of ETS oncogene family	324					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|skin(2)	10						CAGGCTCGGGCTGAGTGGAAG	0.716																																					p.S324N		Atlas-SNP	.											.	ELK1	54	.	0			c.G971A						PASS	.						6.0	7.0	7.0					X																	47497265		2104	4101	6205	SO:0001583	missense	2002	exon5			CTCGGGCTGAGTG	M25269	CCDS14283.1, CCDS59165.1	Xp11.23	2010-07-20			ENSG00000126767	ENSG00000126767			3321	protein-coding gene	gene with protein product		311040				2539641	Standard	NM_001114123		Approved		uc010nhv.4	P19419	OTTHUMG00000021452	ENST00000247161.3:c.971G>A	chrX.hg19:g.47497265C>T	ENSP00000247161:p.Ser324Asn	60.0	0.0	.		29.0	26.0	.	NM_001114123	B2R7H4|O75606|O95058|Q969X8|Q9UJM4	Missense_Mutation	SNP	ENST00000247161.3	hg19	CCDS14283.1	.	.	.	.	.	.	.	.	.	.	c	23.9	4.467119	0.84533	.	.	ENSG00000126767	ENST00000247161;ENST00000542746;ENST00000376983	T;T	0.26223	1.75;1.75	5.09	4.15	0.48705	.	0.240251	0.45361	D	0.000377	T	0.27629	0.0679	L	0.48642	1.525	0.80722	D	1	P	0.51791	0.948	P	0.48738	0.588	T	0.00842	-1.1544	10	0.37606	T	0.19	.	9.4929	0.38971	0.0:0.7904:0.2096:0.0	.	324	P19419	ELK1_HUMAN	N	324;34;324	ENSP00000247161:S324N;ENSP00000366182:S324N	ENSP00000247161:S324N	S	-	2	0	ELK1	47382209	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	2.433000	0.44793	2.447000	0.82792	0.597000	0.82753	AGC	.	.	.	none		0.716	ELK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056436.1	NM_005229	
CLCN5	1184	hgsc.bcm.edu	37	X	49846494	49846494	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chrX:49846494A>G	ENST00000307367.2	+	6	1004	c.713A>G	c.(712-714)aAg>aGg	p.K238R	CLCN5_ENST00000376088.3_Missense_Mutation_p.K308R|CLCN5_ENST00000376091.3_Missense_Mutation_p.K308R|CLCN5_ENST00000376108.3_Missense_Mutation_p.K238R			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5	238					chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					AATGAAGCCAAGCGCAGAGAG	0.468																																					p.K308R		Atlas-SNP	.											.	CLCN5	137	.	0			c.A923G						PASS	.						98.0	77.0	84.0					X																	49846494		2203	4300	6503	SO:0001583	missense	1184	exon9			AAGCCAAGCGCAG	X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.713A>G	chrX.hg19:g.49846494A>G	ENSP00000304257:p.Lys238Arg	65.0	0.0	.		28.0	21.0	.	NM_001127898	A1L475|B3KPN6|Q5JQD5|Q7RTN8	Missense_Mutation	SNP	ENST00000307367.2	hg19	CCDS14328.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.684586	0.88639	.	.	ENSG00000171365	ENST00000376088;ENST00000450422;ENST00000376091;ENST00000376108;ENST00000307367	D;D;D;D	0.93763	-3.28;-3.28;-3.28;-3.28	6.08	6.08	0.98989	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.94823	0.8328	L	0.43757	1.38	0.80722	D	1	P;D	0.67145	0.932;0.996	P;D	0.76071	0.718;0.987	D	0.94286	0.7524	10	0.39692	T	0.17	-2.9127	14.3879	0.66958	1.0:0.0:0.0:0.0	.	238;308	P51795;P51795-2	CLCN5_HUMAN;.	R	308;140;308;238;238	ENSP00000365256:K308R;ENSP00000365259:K308R;ENSP00000365276:K238R;ENSP00000304257:K238R	ENSP00000304257:K238R	K	+	2	0	CLCN5	49733234	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.185000	0.94900	2.044000	0.60594	0.486000	0.48141	AAG	.	.	.	none		0.468	CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056544.1		
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24382400	24382401	+	IGR	INS	-	-	TAT			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chrX:24382400_24382401insTAT								AC004552.1 (15377 upstream) : PDK3 (100936 downstream)																							gctgctgctgctgctgctgctg	0.599																																					p.A508delinsAI		Atlas-INDEL	.											.	.	.	.	0			c.1523_1524insTAT						PASS	.																																			SO:0001628	intergenic_variant	100130302	exon1			.																													chrX.hg19:g.24382400_24382401insTAT		90.0	0.0	0		56.0	24.0	0.428571	NM_001136234		In_Frame_Ins	INS		hg19																																																																																				.	.	.	none	0	0.599								
NAA10	8260	hgsc.bcm.edu	37	X	153199832	153199832	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chrX:153199832G>T	ENST00000464845.1	-	2	436	c.118C>A	c.(118-120)Cag>Aag	p.Q40K	NAA10_ENST00000370009.1_Missense_Mutation_p.Q40K|NAA10_ENST00000370015.4_Missense_Mutation_p.Q40K|NAA10_ENST00000393712.3_Missense_Mutation_p.Q40K|NAA10_ENST00000393710.3_5'UTR	NM_001256120.1|NM_003491.3	NP_001243049.1|NP_003482.1	P41227	NAA10_HUMAN	N(alpha)-acetyltransferase 10, NatA catalytic subunit	40	Interaction with NAA15.|N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				DNA packaging (GO:0006323)|internal protein amino acid acetylation (GO:0006475)|N-terminal protein amino acid acetylation (GO:0006474)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleolus (GO:0005730)|nucleus (GO:0005634)	N-acetyltransferase activity (GO:0008080)|peptide alpha-N-acetyltransferase activity (GO:0004596)			breast(1)|endometrium(3)|kidney(1)|lung(3)|ovary(1)|prostate(1)	10						CTGCCCACCTGGGGCCAGGAA	0.562																																					p.Q40K	Ovarian(94;1099 1433 38814 45882 51063)	Atlas-SNP	.											.	NAA10	18	.	0			c.C118A						PASS	.						66.0	51.0	56.0					X																	153199832		2200	4299	6499	SO:0001583	missense	8260	exon2			CCACCTGGGGCCA	BC000308	CCDS14737.1, CCDS59179.1	Xq28	2010-05-07	2010-01-14	2010-01-14	ENSG00000102030	ENSG00000102030	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	18704	protein-coding gene	gene with protein product		300013	"""ARD1 homolog, N-acetyltransferase (S. cerevisiae)"", ""ARD1 homolog A, N-acetyltransferase (S. cerevisiae)"""	ARD1, ARD1A		7981673, 19660095	Standard	NM_003491		Approved	DXS707, TE2	uc004fjm.2	P41227	OTTHUMG00000024225	ENST00000464845.1:c.118C>A	chrX.hg19:g.153199832G>T	ENSP00000417763:p.Gln40Lys	73.0	0.0	.		41.0	36.0	.	NM_001256119	A6NM98	Missense_Mutation	SNP	ENST00000464845.1	hg19	CCDS14737.1	.	.	.	.	.	.	.	.	.	.	G	34	5.294637	0.95546	.	.	ENSG00000102030	ENST00000464845;ENST00000370015;ENST00000393712;ENST00000370009;ENST00000545734;ENST00000370011;ENST00000432089	T;T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4;1.4	4.66	4.66	0.58398	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.065490	0.64402	D	0.000006	T	0.47948	0.1473	M	0.77712	2.385	0.80722	D	1	B;B;P	0.42375	0.417;0.227;0.778	B;P;P	0.44732	0.356;0.459;0.459	T	0.57866	-0.7737	10	0.87932	D	0	-14.9532	15.5532	0.76170	0.0:0.0:1.0:0.0	.	40;40;40	B7Z9N2;A6NM98;P41227	.;.;NAA10_HUMAN	K	40	ENSP00000417763:Q40K;ENSP00000359032:Q40K;ENSP00000377315:Q40K;ENSP00000359026:Q40K;ENSP00000359028:Q40K;ENSP00000413668:Q40K	ENSP00000359026:Q40K	Q	-	1	0	NAA10	152853026	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.859000	0.92264	1.911000	0.55334	0.529000	0.55759	CAG	.	.	.	none		0.562	NAA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061108.2	NM_003491	
CRYBG3	131544	hgsc.bcm.edu	37	3	97596113	97596114	+	Frame_Shift_Ins	INS	-	-	T			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr3:97596113_97596114insT	ENST00000182096.4	+	1	295_296	c.231_232insT	c.(232-234)tttfs	p.F78fs		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2026							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						AGTCTGTCTTGTTTCATGATAC	0.421																																					p.L2025fs		Atlas-Indel,Pindel	.											.	CRYBG3	86	.	0			c.6075_6076insT						PASS	.																																			SO:0001589	frameshift_variant	131544	exon4			.			3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.234dupT	chr3.hg19:g.97596116_97596116dupT	ENSP00000182096:p.Phe78fs	215.0	0.0	0		141.0	54.0	0.382979	NM_153605	B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Frame_Shift_Ins	INS	ENST00000182096.4	hg19																																																																																				.	.	.	none		0.421	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353751.1	NM_153605	
ESF1	51575	hgsc.bcm.edu	37	20	13756539	13756540	+	Frame_Shift_Ins	INS	-	-	T	rs138569918	byFrequency	TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr20:13756539_13756540insT	ENST00000202816.1	-	3	1121_1122	c.1014_1015insA	c.(1012-1017)aaagatfs	p.D339fs		NM_001276380.1|NM_016649.3	NP_001263309.1|NP_057733.2	Q9H501	ESF1_HUMAN	ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)	339					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|skin(1)|stomach(1)	31						CGAGGAGCATCTTTATCTAATT	0.361																																					p.D339fs		Atlas-Indel,Pindel	.											.	ESF1	77	.	0			c.1015_1016insA						PASS	.																																			SO:0001589	frameshift_variant	51575	exon3			.		CCDS13117.1	20p12.1	2007-02-12	2006-11-13	2006-11-13	ENSG00000089048	ENSG00000089048			15898	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 6"""	C20orf6			Standard	NM_016649		Approved	bA526K24.1	uc002wok.2	Q9H501	OTTHUMG00000031906	ENST00000202816.1:c.1015dupA	chr20.hg19:g.13756542_13756542dupT	ENSP00000202816:p.Asp339fs	134.0	0.0	0		76.0	28.0	0.368421	NM_016649	Q86X92|Q9H9Q5|Q9HA35|Q9NX93|Q9P1S6	Frame_Shift_Ins	INS	ENST00000202816.1	hg19	CCDS13117.1																																																																																			.	.	.	none		0.361	ESF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078049.1	NM_016649	
TTLL13P	440307	hgsc.bcm.edu	37	15	90796537	90796540	+	Frame_Shift_Del	DEL	ACTC	ACTC	-			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	ACTC	ACTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr15:90796537_90796540delACTC	ENST00000561573.1	+	4	619_622	c.355_358delACTC	c.(355-360)actctgfs	p.TL119fs	TTLL13_ENST00000438251.1_Frame_Shift_Del_p.TL119fs|TTLL13_ENST00000339615.5_Frame_Shift_Del_p.TL119fs																							TGAAGAGTGGACTCTGTACTGGAC	0.583																																					p.118_119del		Atlas-Indel,Pindel	.											.	TTLL13	44	.	0			c.354_357del						PASS	.																																			SO:0001589	frameshift_variant	440307	exon4			.																												ENST00000561573.1:c.355_358delACTC	chr15.hg19:g.90796537_90796540delACTC	ENSP00000456615:p.Thr119fs	129.0	0.0	0		87.0	25.0	0.287356	NM_001029964		Frame_Shift_Del	DEL	ENST00000561573.1	hg19																																																																																				.	.	.	none		0.583	RP11-697E2.6-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding	OTTHUMT00000435855.1		
ARHGAP22	58504	hgsc.bcm.edu	37	10	49659125	49659127	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr10:49659125_49659127delGAA	ENST00000249601.4	-	9	1341_1343	c.1045_1047delTTC	c.(1045-1047)ttcdel	p.F349del	ARHGAP22_ENST00000374170.1_In_Frame_Del_p.F190del|ARHGAP22_ENST00000417912.2_In_Frame_Del_p.F365del|ARHGAP22_ENST00000477708.2_In_Frame_Del_p.F182del|ARHGAP22_ENST00000435790.2_In_Frame_Del_p.F355del|ARHGAP22_ENST00000374172.1_In_Frame_Del_p.F240del|ARHGAP22_ENST00000417247.2_In_Frame_Del_p.F259del	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	349	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CCGGTGCCGTGAAGAGCTGGCTG	0.685																																					p.365_366del		Atlas-Indel,Pindel	.											.	ARHGAP22	94	.	0			c.1094_1096del						PASS	.																																			SO:0001651	inframe_deletion	58504	exon9			.	AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.1045_1047delTTC	chr10.hg19:g.49659125_49659127delGAA	ENSP00000249601:p.Phe349del	197.0	0.0	0		94.0	34.0	0.361702	NM_001256024	A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	In_Frame_Del	DEL	ENST00000249601.4	hg19	CCDS7227.1																																																																																			.	.	.	none		0.685	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358767.1	NM_021226	
GOLGA4	2803	hgsc.bcm.edu	37	3	37369055	37369056	+	Frame_Shift_Ins	INS	-	-	AAAT			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr3:37369055_37369056insAAAT	ENST00000361924.2	+	14	6052_6053	c.5678_5679insAAAT	c.(5677-5682)agaaatfs	p.-1895fs	GOLGA4_ENST00000356847.4_Frame_Shift_Ins_p.-1917fs|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4						Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						ATGGATGGAAGAAATAAACCCA	0.371																																					p.R1915fs		Atlas-Indel,Pindel	.											.	GOLGA4	173	.	0			c.5744_5745insAAAT						PASS	.																																			SO:0001589	frameshift_variant	2803	exon15			.	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.5679_5682dupAAAT	chr3.hg19:g.37369056_37369059dupAAAT	ENSP00000354486:p.Lys1895fs	401.0	0.0	0		217.0	88.0	0.40553	NM_001172713	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Frame_Shift_Ins	INS	ENST00000361924.2	hg19	CCDS2666.1																																																																																			.	.	.	none		0.371	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	
TNRC18	84629	hgsc.bcm.edu	37	7	5354660	5354669	+	Frame_Shift_Del	DEL	TGGCTCCTGG	TGGCTCCTGG	-	rs10250456		TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	TGGCTCCTGG	TGGCTCCTGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr7:5354660_5354669delTGGCTCCTGG	ENST00000430969.1	-	26	7321_7330	c.6973_6982delCCAGGAGCCA	c.(6973-6984)ccaggagccaagfs	p.PGAK2325fs	TNRC18_ENST00000399537.4_Frame_Shift_Del_p.PGAK2325fs	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2325							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CCACGGGCCTTGGCTCCTGGCTCCTCCGAC	0.69																																					p.2325_2328del		Atlas-Indel,Pindel	.											.	TNRC18	311	.	0			c.6974_6983del						PASS	.																																			SO:0001589	frameshift_variant	84629	exon26			.	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.6973_6982delCCAGGAGCCA	chr7.hg19:g.5354660_5354669delTGGCTCCTGG	ENSP00000395538:p.Pro2325fs	144.0	0.0	0		123.0	42.0	0.341463	NM_001080495	A8MX41|Q96JH1|Q96K91	Frame_Shift_Del	DEL	ENST00000430969.1	hg19	CCDS47534.1																																																																																			.	.	.	none		0.690	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
CD7	924	hgsc.bcm.edu	37	17	80274159	80274160	+	Frame_Shift_Ins	INS	-	-	T	rs569923406|rs200504177	byFrequency	TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr17:80274159_80274160insT	ENST00000312648.3	-	3	629_630	c.523_524insA	c.(523-525)gcafs	p.A175fs	CD7_ENST00000583376.1_Frame_Shift_Ins_p.A75fs|CD7_ENST00000584284.1_Frame_Shift_Ins_p.A175fs|CD7_ENST00000578509.1_Frame_Shift_Ins_p.A75fs	NM_006137.6	NP_006128.1	P09564	CD7_HUMAN	CD7 molecule	175	4 X 9 AA tandem repeats, potential spacer function.				homeostasis of number of cells within a tissue (GO:0048873)|immune response (GO:0006955)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			GGCAGAGGCTGCTGGCGGGTCA	0.718													?|-|T|unsure	60	0.0119808	0.0008	0.0274	5008	,	,		11744	0.001		0.0338	False		,,,				2504	0.0051				p.A175fs	Pancreas(45;804 1068 19702 28207 28798)	Atlas-INDEL	.											.,1	CD7	25	.	0			c.524_525insA						PASS	.																																			SO:0001589	frameshift_variant	924	exon3			.	X06180	CCDS11807.1	17q25.2-q25.3	2013-01-11	2006-03-28			ENSG00000173762		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1695	protein-coding gene	gene with protein product	"""p41 protein"", ""T-cell antigen CD7"", ""T-cell leukemia antigen"""	186820	"""CD7 antigen (p41)"""			1695199, 3501369	Standard	NM_006137		Approved	GP40, LEU-9, TP41, Tp40	uc002kel.1	P09564		ENST00000312648.3:c.523_524insA	chr17.hg19:g.80274159_80274160insT	ENSP00000312027:p.Ala175fs	97.0	0.0	0		62.0	15.0	0.241935	NM_006137		Frame_Shift_Ins	INS	ENST00000312648.3	hg19	CCDS11807.1																																																																																			.	.	.	none		0.718	CD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442826.1	NM_006137	
MKI67	4288	hgsc.bcm.edu	37	10	129904535	129904535	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr10:129904535delT	ENST00000368654.3	-	13	5944	c.5569delA	c.(5569-5571)atafs	p.I1857fs	MKI67_ENST00000368653.3_Frame_Shift_Del_p.I1497fs	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1857	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TTGCAGAGTATTTTTTTGGTA	0.483																																					p.I1857fs		Atlas-Indel,Pindel	.											.	MKI67	363	.	0			c.5570delT						PASS	.						237.0	241.0	240.0					10																	129904535		2203	4300	6503	SO:0001589	frameshift_variant	4288	exon13			.	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.5569delA	chr10.hg19:g.129904535delT	ENSP00000357643:p.Ile1857fs	168.0	0.0	0		107.0	43.0	0.401869	NM_002417	Q5VWH2	Frame_Shift_Del	DEL	ENST00000368654.3	hg19	CCDS7659.1																																																																																			.	.	.	none		0.483	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
ACSS2	55902	hgsc.bcm.edu	37	20	33470621	33470621	+	Frame_Shift_Del	DEL	A	A	-			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr20:33470621delA	ENST00000360596.2	+	2	414	c.203delA	c.(202-204)gaafs	p.E68fs	ACSS2_ENST00000476922.1_3'UTR|ACSS2_ENST00000336325.4_Frame_Shift_Del_p.E18fs|ACSS2_ENST00000253382.5_Frame_Shift_Del_p.E68fs	NM_018677.3	NP_061147.1	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2	68					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|lipid biosynthetic process (GO:0008610)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(9)	21					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	ATTGCCAAGGAATTTTACTGG	0.428																																					p.E68fs		Atlas-Indel,Pindel	.											.	ACSS2	75	.	0			c.202delG						PASS	.						105.0	100.0	102.0					20																	33470621		2203	4300	6503	SO:0001589	frameshift_variant	55902	exon2			.	AF263614	CCDS13243.1, CCDS42868.1, CCDS42868.2	20q11.22	2012-07-13	2005-09-08	2005-09-08	ENSG00000131069	ENSG00000131069	6.2.1.1	"""Acyl-CoA synthetase family"""	15814	protein-coding gene	gene with protein product		605832	"""acetyl-Coenzyme A synthetase 2 (ADP forming)"""	ACAS2		10843999	Standard	NM_018677		Approved	ACS, ACSA, AceCS, dJ1161H23.1	uc010gey.2	Q9NR19	OTTHUMG00000032317	ENST00000360596.2:c.203delA	chr20.hg19:g.33470621delA	ENSP00000353804:p.Glu68fs	171.0	0.0	0		90.0	33.0	0.366667	NM_001076552	A6NE90|Q5QPH2|Q5QPH3|Q8N238|Q96EL0|Q9NQP7|Q9UJ15	Frame_Shift_Del	DEL	ENST00000360596.2	hg19	CCDS13243.1																																																																																			.	.	.	none		0.428	ACSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078823.3	NM_018677	
DYNC1I2	1781	hgsc.bcm.edu	37	2	172582207	172582208	+	Frame_Shift_Ins	INS	-	-	GA			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr2:172582207_172582208insGA	ENST00000397119.3	+	8	758_759	c.591_592insGA	c.(592-594)gaafs	p.E198fs	DYNC1I2_ENST00000409197.1_Frame_Shift_Ins_p.E172fs|DYNC1I2_ENST00000409453.1_Frame_Shift_Ins_p.E198fs|DYNC1I2_ENST00000263811.4_Frame_Shift_Ins_p.E192fs|DYNC1I2_ENST00000508530.1_Frame_Shift_Ins_p.E172fs|DYNC1I2_ENST00000534253.2_Frame_Shift_Ins_p.E198fs|DYNC1I2_ENST00000340296.4_Frame_Shift_Ins_p.E172fs|DYNC1I2_ENST00000409773.1_Frame_Shift_Ins_p.E198fs|DYNC1I2_ENST00000409317.1_Frame_Shift_Ins_p.E192fs|DYNC1I2_ENST00000358002.6_Frame_Shift_Ins_p.E190fs|DYNC1I2_ENST00000410079.3_Frame_Shift_Ins_p.E190fs	NM_001378.1	NP_001369.1	Q13409	DC1I2_HUMAN	dynein, cytoplasmic 1, intermediate chain 2	198					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|microtubule (GO:0005874)|vesicle (GO:0031982)	microtubule motor activity (GO:0003777)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.198)			AGAAAGATGAGGAAAATGATAG	0.282																																					p.E197fs		Atlas-Indel,Pindel	.											.	DYNC1I2	43	.	0			c.591_592insGA						PASS	.																																			SO:0001589	frameshift_variant	1781	exon8			.	AK055491	CCDS46450.1, CCDS63054.1, CCDS63056.1, CCDS63057.1	2q31.1	2013-01-10	2005-11-24	2005-11-24	ENSG00000077380	ENSG00000077380		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2964	protein-coding gene	gene with protein product		603331	"""dynein, cytoplasmic, intermediate polypeptide 2"""	DNCI2		10049579, 16260502	Standard	NM_001378		Approved		uc002uha.2	Q13409	OTTHUMG00000154061	ENST00000397119.3:c.592_593dupGA	chr2.hg19:g.172582208_172582209dupGA	ENSP00000380308:p.Glu198fs	260.0	0.0	0		147.0	60.0	0.408163	NM_001378	B7ZA04|D3DPD4|D3DPD5|D3DPD6|Q32LY9|Q53S84|Q5BJF8|Q7Z4X1|Q96NG7|Q96S87|Q9BXZ5|Q9NT58	Frame_Shift_Ins	INS	ENST00000397119.3	hg19	CCDS46450.1																																																																																			.	.	.	none		0.282	DYNC1I2-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333683.2	NM_001378	
WDFY3	23001	hgsc.bcm.edu	37	4	85729530	85729531	+	Frame_Shift_Ins	INS	-	-	AG			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr4:85729530_85729531insAG	ENST00000295888.4	-	15	2792_2793	c.2385_2386insCT	c.(2383-2388)tcttctfs	p.S796fs	WDFY3-AS1_ENST00000510449.1_RNA|WDFY3_ENST00000322366.6_Frame_Shift_Ins_p.S796fs	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	796					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GAGGGGAGAGAAGACTCACTTG	0.46																																					p.S796fs		Atlas-Indel,Pindel	.											.	WDFY3	314	.	0			c.2386_2387insCT						PASS	.																																			SO:0001589	frameshift_variant	23001	exon15			.	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.2384_2385dupCT	chr4.hg19:g.85729531_85729532dupAG	ENSP00000295888:p.Ser796fs	349.0	0.0	0		204.0	84.0	0.411765	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Frame_Shift_Ins	INS	ENST00000295888.4	hg19	CCDS3609.1																																																																																			.	.	.	none		0.460	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
ABCC4	10257	hgsc.bcm.edu	37	13	95859038	95859041	+	Intron	DEL	GAAA	GAAA	-			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	GAAA	GAAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr13:95859038_95859041delGAAA	ENST00000376887.4	-	8	1026				ABCC4_ENST00000431522.1_Intron|ABCC4_ENST00000538287.1_Intron|ABCC4_ENST00000536256.1_Intron|ABCC4_ENST00000412704.1_Intron	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4						blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	TCTCCTTCCTGAAAGAGAGTACAG	0.426																																					.		Atlas-Indel,Pindel	.											.	ABCC4	248	.	0			.						PASS	.																																			SO:0001627	intron_variant	10257	.			.	U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.912-3TTTC>-	chr13.hg19:g.95859038_95859041delGAAA		103.0	0.0	0		73.0	22.0	0.30137	.	A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Splice_Site	DEL	ENST00000376887.4	hg19	CCDS9474.1																																																																																			.	.	.	none		0.426	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045478.2	NM_005845	
KL	9365	hgsc.bcm.edu	37	13	33628024	33628024	+	Frame_Shift_Del	DEL	A	A	-			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr13:33628024delA	ENST00000380099.3	+	2	948	c.940delA	c.(940-942)aaafs	p.K314fs	KL_ENST00000487852.1_3'UTR|KL_ENST00000426690.2_Frame_Shift_Del_p.K7fs	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	314	Glycosyl hydrolase-1 1.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)			breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		CCACAGCATCAAAGAATGTCA	0.448																																					p.I313fs		Atlas-Indel,Pindel	.											.	KL	106	.	0			c.939delC						PASS	.						167.0	159.0	162.0					13																	33628024		2203	4300	6503	SO:0001589	frameshift_variant	9365	exon2			.	AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.940delA	chr13.hg19:g.33628024delA	ENSP00000369442:p.Lys314fs	185.0	0.0	0		150.0	60.0	0.4	NM_004795	Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Frame_Shift_Del	DEL	ENST00000380099.3	hg19	CCDS9347.1																																																																																			.	.	.	none		0.448	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045987.1		
ZDHHC16	84287	hgsc.bcm.edu	37	10	99213325	99213327	+	In_Frame_Del	DEL	TAC	TAC	-			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	TAC	TAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr10:99213325_99213327delTAC	ENST00000370854.3	+	6	784_786	c.595_597delTAC	c.(595-597)tacdel	p.Y199del	ZDHHC16_ENST00000352634.4_In_Frame_Del_p.Y199del|ZDHHC16_ENST00000370842.2_In_Frame_Del_p.Y199del|ZDHHC16_ENST00000370846.4_Intron|ZDHHC16_ENST00000495735.1_3'UTR|ZDHHC16_ENST00000353979.3_Intron|ZDHHC16_ENST00000393760.1_In_Frame_Del_p.Y199del|ZDHHC16_ENST00000345745.5_In_Frame_Del_p.Y134del	NM_032327.2	NP_115703.2	Q969W1	ZDH16_HUMAN	zinc finger, DHHC-type containing 16	199					apoptotic process (GO:0006915)|protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			kidney(4)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	14		Colorectal(252;0.0846)		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)		TAACCATCGGTACTTCTTCTCTT	0.488																																					p.198_199del		Atlas-Indel,Pindel	.											.	ZDHHC16	25	.	0			c.594_596del						PASS	.																																			SO:0001651	inframe_deletion	84287	exon6			.	AF258563	CCDS7460.1, CCDS7461.1, CCDS7462.1, CCDS7463.1, CCDS73176.1	10q24.1	2008-05-02			ENSG00000171307	ENSG00000171307		"""Zinc fingers, DHHC-type"""	20714	protein-coding gene	gene with protein product						12021275	Standard	NM_198043		Approved	APH2	uc001knk.3	Q969W1	OTTHUMG00000018847	ENST00000370854.3:c.595_597delTAC	chr10.hg19:g.99213325_99213327delTAC	ENSP00000359891:p.Tyr199del	109.0	0.0	0		55.0	22.0	0.4	NM_032327	D3DR52|D3DR53|D3DR54|Q5JTG7|Q5JTH0|Q8N4Z6|Q8WY84|Q9BSV3	In_Frame_Del	DEL	ENST00000370854.3	hg19	CCDS7460.1																																																																																			.	.	.	none		0.488	ZDHHC16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049658.2	NM_032327	
CD7	924	hgsc.bcm.edu	37	17	80274162	80274162	+	Frame_Shift_Del	DEL	G	G	-	rs201027731|rs555569626	byFrequency	TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr17:80274162delG	ENST00000312648.3	-	3	627	c.521delC	c.(520-522)ccafs	p.P174fs	CD7_ENST00000583376.1_Frame_Shift_Del_p.P74fs|CD7_ENST00000584284.1_Frame_Shift_Del_p.P174fs|CD7_ENST00000578509.1_Frame_Shift_Del_p.P74fs	NM_006137.6	NP_006128.1	P09564	CD7_HUMAN	CD7 molecule	174	4 X 9 AA tandem repeats, potential spacer function.				homeostasis of number of cells within a tissue (GO:0048873)|immune response (GO:0006955)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			AGAGGCTGCTGGCGGGTCAGG	0.716													?|GG|G|unsure	60	0.0119808	0.0008	0.0274	5008	,	,		11833	0.001		0.0338	False		,,,				2504	0.0051				p.P174fs	Pancreas(45;804 1068 19702 28207 28798)	Atlas-INDEL	.											.	CD7	25	.	0			c.522delA						PASS	.						11.0	14.0	13.0					17																	80274162		2162	4241	6403	SO:0001589	frameshift_variant	924	exon3			.	X06180	CCDS11807.1	17q25.2-q25.3	2013-01-11	2006-03-28			ENSG00000173762		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1695	protein-coding gene	gene with protein product	"""p41 protein"", ""T-cell antigen CD7"", ""T-cell leukemia antigen"""	186820	"""CD7 antigen (p41)"""			1695199, 3501369	Standard	NM_006137		Approved	GP40, LEU-9, TP41, Tp40	uc002kel.1	P09564		ENST00000312648.3:c.521delC	chr17.hg19:g.80274162delG	ENSP00000312027:p.Pro174fs	92.0	0.0	0		58.0	15.0	0.258621	NM_006137		Frame_Shift_Del	DEL	ENST00000312648.3	hg19	CCDS11807.1																																																																																			.	.	.	none		0.716	CD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442826.1	NM_006137	
TSHR	7253	hgsc.bcm.edu	37	14	81610606	81610606	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr14:81610606delT	ENST00000541158.2	+	11	2526	c.2204delT	c.(2203-2205)atgfs	p.M735fs	TSHR_ENST00000298171.2_Frame_Shift_Del_p.M735fs|RP11-114N19.3_ENST00000557775.1_RNA			P16473	TSHR_HUMAN	thyroid stimulating hormone receptor	735					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult locomotory behavior (GO:0008344)|B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of locomotion (GO:0040012)|thyroid-stimulating hormone signaling pathway (GO:0038194)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	thyroid-stimulating hormone receptor activity (GO:0004996)			breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(2)|stomach(1)|thyroid(291)|upper_aerodigestive_tract(1)	337				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	CTCCACAACATGGAAGATGTC	0.463			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism																														p.M735fs		Pindel	.	yes	Dom	yes		14	14q31	7253	thyroid stimulating hormone receptor	yes	E	.	TSHR	462	.	0			c.2203delA						PASS	.						116.0	107.0	110.0					14																	81610606		2203	4300	6503	SO:0001589	frameshift_variant	7253	exon10			.	AY429111	CCDS9872.1, CCDS32131.1, CCDS55935.1	14q24-q31	2014-09-17			ENSG00000165409	ENSG00000165409		"""GPCR / Class A : Gonadotropin and TSH receptors"""	12373	protein-coding gene	gene with protein product		603372				2558651, 2610690	Standard	NM_001018036		Approved	LGR3	uc001xvd.1	P16473		ENST00000541158.2:c.2204delT	chr14.hg19:g.81610606delT	ENSP00000441235:p.Met735fs	193.0	0.0	.		113.0	31.0	0.274	NM_000369	A0PJU7|F5GYU5|G3V2A9|Q16503|Q8TB90|Q96GT6|Q9P1V4|Q9ULA3|Q9UPH3	Frame_Shift_Del	DEL	ENST00000541158.2	hg19	CCDS9872.1																																																																																			.	.	.	none		0.463	TSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413364.1	NM_000369	
STAT5A	6776	hgsc.bcm.edu	37	17	40461463	40461482	+	Frame_Shift_Del	DEL	CTGTGTGCCCCCAGGCTCCC	CTGTGTGCCCCCAGGCTCCC	-	rs552732197		TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	CTGTGTGCCCCCAGGCTCCC	CTGTGTGCCCCCAGGCTCCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr17:40461463_40461482delCTGTGTGCCCCCAGGCTCCC	ENST00000345506.4	+	19	2825_2844	c.2183_2202delCTGTGTGCCCCCAGGCTCCC	c.(2182-2202)gctgtgtgcccccaggctcccfs	p.AVCPQAP728fs	STAT5A_ENST00000588868.1_Frame_Shift_Del_p.AVCPQAP697fs|STAT5A_ENST00000546010.2_Frame_Shift_Del_p.AVCPQAP698fs|STAT5A_ENST00000587646.1_Frame_Shift_Del_p.AVCPQAP216fs|STAT5A_ENST00000590949.1_Frame_Shift_Del_p.AVCPQAP728fs|STAT5A_ENST00000452307.2_Frame_Shift_Del_p.AVCPQAP725fs	NM_003152.3	NP_003143.2	P42229	STA5A_HUMAN	signal transducer and activator of transcription 5A	728					2-oxoglutarate metabolic process (GO:0006103)|allantoin metabolic process (GO:0000255)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|luteinization (GO:0001553)|mammary gland epithelium development (GO:0061180)|natural killer cell differentiation (GO:0001779)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of mast cell apoptotic process (GO:0033026)|oxaloacetate metabolic process (GO:0006107)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mast cell differentiation (GO:0060376)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin signaling pathway (GO:0038161)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription, DNA-templated (GO:0006351)|valine metabolic process (GO:0006573)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	calcium ion binding (GO:0005509)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		CCCTCCCCAGCTGTGTGCCCCCAGGCTCCCTATAACATGT	0.618																																					p.728_734del		Pindel	.											.	STAT5A	49	.	0			c.2182_2201del						PASS	.																																			SO:0001589	frameshift_variant	6776	exon19			.	U43185	CCDS11424.1, CCDS74066.1, CCDS74067.1	17q11.2	2013-02-14			ENSG00000126561	ENSG00000126561		"""SH2 domain containing"""	11366	protein-coding gene	gene with protein product		601511		STAT5		7719937, 8631883	Standard	NM_003152		Approved	MGF	uc002hzj.2	P42229	OTTHUMG00000150725	ENST00000345506.4:c.2183_2202delCTGTGTGCCCCCAGGCTCCC	chr17.hg19:g.40461463_40461482delCTGTGTGCCCCCAGGCTCCC	ENSP00000341208:p.Ala728fs	181.0	0.0	.		112.0	10.0	0.089	NM_003152	Q1KLZ6	Frame_Shift_Del	DEL	ENST00000345506.4	hg19	CCDS11424.1																																																																																			.	.	.	none		0.618	STAT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319804.1	NM_003152	
MYOF	26509	hgsc.bcm.edu	37	10	95076511	95076511	+	Frame_Shift_Del	DEL	C	C	-			TCGA-UZ-A9PX-01A-11D-A42J-10	TCGA-UZ-A9PX-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b648818d-4e4e-47da-a20b-366ef8d54eaf	bd3cecf6-5961-4472-b1dc-a7d96c6da4a1	g.chr10:95076511delC	ENST00000359263.4	-	50	5657	c.5658delG	c.(5656-5658)cagfs	p.Q1886fs	MYOF_ENST00000371501.4_Frame_Shift_Del_p.Q1886fs|MYOF_ENST00000371502.4_Frame_Shift_Del_p.Q1876fs|MYOF_ENST00000358334.5_Frame_Shift_Del_p.Q1873fs	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	1886					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TGTCCCATATCTGAATGATCA	0.398																																					p.I1887fs		Pindel	.											.	MYOF	177	.	0			c.5659delA						PASS	.						141.0	130.0	134.0					10																	95076511		1854	4095	5949	SO:0001589	frameshift_variant	26509	exon50			.	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.5658delG	chr10.hg19:g.95076511delC	ENSP00000352208:p.Gln1886fs	190.0	0.0	.		90.0	28.0	0.311	NM_013451	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Frame_Shift_Del	DEL	ENST00000359263.4	hg19	CCDS41551.1																																																																																			.	.	.	none		0.398	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451	
