#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MUTYH	4595	hgsc.bcm.edu	37	1	45797352	45797352	+	Silent	SNP	C	C	T			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr1:45797352C>T	ENST00000372098.3	-	12	1291	c.1158G>A	c.(1156-1158)ctG>ctA	p.L386L	MUTYH_ENST00000488731.2_Intron|MUTYH_ENST00000372110.3_Silent_p.L376L|MUTYH_ENST00000372100.5_Silent_p.L372L|MUTYH_ENST00000355498.2_Silent_p.L361L|MUTYH_ENST00000372115.3_Silent_p.L375L|MUTYH_ENST00000354383.6_Silent_p.L362L|MUTYH_ENST00000450313.1_Silent_p.L389L|MUTYH_ENST00000528013.2_Silent_p.L375L|MUTYH_ENST00000529984.1_Intron|MUTYH_ENST00000528332.2_Intron|MUTYH_ENST00000372104.1_Silent_p.L361L|MUTYH_ENST00000531105.1_Intron|MUTYH_ENST00000448481.1_Silent_p.L372L|MUTYH_ENST00000456914.2_Silent_p.L361L			Q9UIF7	MUTYH_HUMAN	mutY homolog	386	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depurination (GO:0045007)|DNA repair (GO:0006281)|mismatch repair (GO:0006298)	mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|hydrolase activity, acting on glycosyl bonds (GO:0016798)|metal ion binding (GO:0046872)|MutSalpha complex binding (GO:0032407)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					GCCTCTGCACCAGCAGAATTT	0.617			Mis			colorectal		Base excision repair (BER), DNA glycosylases	MUTYH-associated polyposis																												p.L389L		Atlas-SNP	.	yes	Rec		Adenomatous polyposis coli	1	1p34.3-1p32.1	4595	mutY homolog (E. coli)		E	.	MUTYH	38	.	0			c.G1167A						PASS	.						36.0	41.0	40.0					1																	45797352		2199	4299	6498	SO:0001819	synonymous_variant	4595	exon12	Familial Cancer Database	MAP, MYH-associated polyposis	CTGCACCAGCAGA	U63329	CCDS520.1, CCDS41320.1, CCDS41321.1, CCDS41322.1, CCDS72776.1, CCDS72777.1	1p34.1	2014-09-17	2013-09-12		ENSG00000132781	ENSG00000132781			7527	protein-coding gene	gene with protein product		604933	"""mutY (E. coli) homolog"", ""mutY homolog (E. coli)"""			7823963, 10684930	Standard	NM_012222		Approved	MYH	uc009vxp.3	Q9UIF7	OTTHUMG00000007682	ENST00000372098.3:c.1158G>A	chr1.hg19:g.45797352C>T		49.0	0.0	.		31.0	11.0	.	NM_001128425	D3DPZ4|Q15830|Q9UBP2|Q9UBS7|Q9UIF4|Q9UIF5|Q9UIF6	Silent	SNP	ENST00000372098.3	hg19	CCDS520.1																																																																																			.	.	.	none		0.617	MUTYH-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000020529.1	NM_012222	
SLC50A1	55974	hgsc.bcm.edu	37	1	155110120	155110120	+	Silent	SNP	T	T	C			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr1:155110120T>C	ENST00000368404.4	+	4	428	c.366T>C	c.(364-366)ccT>ccC	p.P122P	SLC50A1_ENST00000368401.5_Silent_p.P67P|SLC50A1_ENST00000368405.3_Intron|SLC50A1_ENST00000484157.1_Silent_p.P57P|SLC50A1_ENST00000303343.8_Intron	NM_018845.3	NP_061333.2	Q9BRV3	SWET1_HUMAN	solute carrier family 50 (sugar efflux transporter), member 1	122					carbohydrate transport (GO:0008643)|DNA recombination (GO:0006310)|glucoside transport (GO:0042946)|positive regulation of gene expression, epigenetic (GO:0045815)	endomembrane system (GO:0012505)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucoside transmembrane transporter activity (GO:0042947)			endometrium(1)|lung(1)|ovary(1)|skin(1)	4						TACCCAACCCTGAGGCCCGGC	0.577																																					p.P122P		Atlas-SNP	.											.	SLC50A1	16	.	0			c.T366C						PASS	.						75.0	77.0	76.0					1																	155110120		2203	4300	6503	SO:0001819	synonymous_variant	55974	exon4			CAACCCTGAGGCC	AF126023, AF126024	CCDS1093.1, CCDS44238.1, CCDS44239.1, CCDS72929.1, CCDS72930.1	1q22	2013-07-17	2013-07-17	2010-11-30	ENSG00000169241	ENSG00000169241		"""Solute carriers"""	30657	protein-coding gene	gene with protein product	"""stromal cell protein"""	613683	"""recombination activating gene 1 activating protein 1"""	RAG1AP1		21107422	Standard	NM_018845		Approved	SCP, RP11-540D14.5, slv, RZPDo834D038D, HsSWEET1, SWEET1	uc001fhj.4	Q9BRV3	OTTHUMG00000035333	ENST00000368404.4:c.366T>C	chr1.hg19:g.155110120T>C		92.0	0.0	.		44.0	24.0	.	NM_018845	Q5SR64|Q6IAK6|Q96DC5|Q9UHQ2|Q9UHQ3	Silent	SNP	ENST00000368404.4	hg19	CCDS1093.1																																																																																			.	.	.	none		0.577	SLC50A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085505.1	NM_018845	
ATP1A4	480	hgsc.bcm.edu	37	1	160146320	160146320	+	Silent	SNP	A	A	C			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr1:160146320A>C	ENST00000368081.4	+	17	2989	c.2518A>C	c.(2518-2520)Agg>Cgg	p.R840R	ATP1A4_ENST00000470705.1_5'Flank|ATP1A4_ENST00000418334.1_3'UTR	NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	840					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CATCATGAAGAGGCTTCCAAG	0.542																																					p.R840R		Atlas-SNP	.											.	ATP1A4	167	.	0			c.A2518C						PASS	.						77.0	67.0	70.0					1																	160146320		2203	4300	6503	SO:0001819	synonymous_variant	480	exon17			ATGAAGAGGCTTC	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.2518A>C	chr1.hg19:g.160146320A>C		135.0	0.0	.		75.0	27.0	.	NM_144699	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Silent	SNP	ENST00000368081.4	hg19	CCDS1197.1																																																																																			.	.	.	none		0.542	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699	
GREB1	9687	hgsc.bcm.edu	37	2	11755338	11755338	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr2:11755338G>A	ENST00000381486.2	+	20	3544	c.3244G>A	c.(3244-3246)Gct>Act	p.A1082T	GREB1_ENST00000234142.5_Missense_Mutation_p.A1082T|GREB1_ENST00000396123.1_Missense_Mutation_p.A80T	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1082						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GGAGAAGGGGGCTAGGAACGA	0.582																																					p.A1082T	Ovarian(39;850 945 2785 23371 33093)	Atlas-SNP	.											.	GREB1	308	.	0			c.G3244A						PASS	.						75.0	80.0	78.0					2																	11755338		2094	4224	6318	SO:0001583	missense	9687	exon20			AAGGGGGCTAGGA		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.3244G>A	chr2.hg19:g.11755338G>A	ENSP00000370896:p.Ala1082Thr	126.0	0.0	.		74.0	29.0	.	NM_014668	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	hg19	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	G	9.541	1.113334	0.20795	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000396123	T;T;T	0.22336	3.27;3.27;1.96	5.12	-2.51	0.06365	.	1.032170	0.07616	N	0.926316	T	0.06735	0.0172	N	0.04203	-0.255	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.37663	-0.9696	10	0.07990	T	0.79	-38.687	3.2282	0.06739	0.2075:0.3012:0.3892:0.1021	.	1082	Q4ZG55	GREB1_HUMAN	T	1082;1082;80	ENSP00000370896:A1082T;ENSP00000234142:A1082T;ENSP00000379429:A80T	ENSP00000234142:A1082T	A	+	1	0	GREB1	11672789	0.000000	0.05858	0.001000	0.08648	0.962000	0.63368	-0.227000	0.09126	-0.373000	0.07979	-0.254000	0.11334	GCT	.	.	.	none		0.582	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
NAT8	9027	hgsc.bcm.edu	37	2	73868455	73868455	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr2:73868455A>G	ENST00000272425.3	-	2	450	c.301T>C	c.(301-303)Tac>Cac	p.Y101H		NM_003960.3|NM_016347.2	NP_003951.3|NP_057431.2			N-acetyltransferase 8 (GCN5-related, putative)											breast(1)|endometrium(2)|kidney(2)|lung(2)|ovary(1)|prostate(1)	9						TCACTCAGGTAGGATTTGGTA	0.537																																					p.Y101H		Atlas-SNP	.											.	NAT8	26	.	0			c.T301C						PASS	.						126.0	119.0	122.0					2																	73868455		2203	4300	6503	SO:0001583	missense	9027	exon2			TCAGGTAGGATTT	AB013094	CCDS1926.1	2p13.2	2012-03-20	2008-09-24		ENSG00000144035	ENSG00000144035			18069	protein-coding gene	gene with protein product		606716	"""N-acetyltransferase 8"""			11397015, 9852678, 19011241	Standard	NM_003960		Approved	Hcml1, TSC501, GLA, ATase2	uc002sji.1	Q9UHE5	OTTHUMG00000129818	ENST00000272425.3:c.301T>C	chr2.hg19:g.73868455A>G	ENSP00000272425:p.Tyr101His	134.0	0.0	.		107.0	45.0	.	NM_003960		Missense_Mutation	SNP	ENST00000272425.3	hg19	CCDS1926.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.108127	0.77096	.	.	ENSG00000144035	ENST00000272425	T	0.30714	1.52	3.86	3.86	0.44501	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.57784	0.2077	M	0.86420	2.815	0.44061	D	0.996801	D	0.89917	1.0	D	0.80764	0.994	T	0.65384	-0.6181	10	0.87932	D	0	-39.9926	11.3146	0.49383	1.0:0.0:0.0:0.0	.	101	Q9UHE5	NAT8_HUMAN	H	101	ENSP00000272425:Y101H	ENSP00000272425:Y101H	Y	-	1	0	NAT8	73721963	1.000000	0.71417	0.423000	0.26634	0.335000	0.28730	5.761000	0.68801	1.715000	0.51383	0.524000	0.50904	TAC	.	.	.	none		0.537	NAT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327854.1	NM_003960	
SCTR	6344	hgsc.bcm.edu	37	2	120221714	120221714	+	Silent	SNP	G	G	A			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr2:120221714G>A	ENST00000019103.5	-	6	888	c.621C>T	c.(619-621)taC>taT	p.Y207Y		NM_002980.2	NP_002971.2	P47872	SCTR_HUMAN	secretin receptor	207					digestion (GO:0007586)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic microtubule (GO:0005881)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	secretin receptor activity (GO:0015055)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)	19					Secretin(DB00021)	GGGCATCGCAGTAGGTGACAT	0.572																																					p.Y207Y		Atlas-SNP	.											.	SCTR	45	.	0			c.C621T						PASS	.						176.0	152.0	160.0					2																	120221714		2203	4300	6503	SO:0001819	synonymous_variant	6344	exon6			ATCGCAGTAGGTG		CCDS2127.1	2q14.1	2012-08-10			ENSG00000080293	ENSG00000080293		"""GPCR / Class B : Glucagon receptors"""	10608	protein-coding gene	gene with protein product		182098				1646711	Standard	NM_002980		Approved		uc002tma.3	P47872	OTTHUMG00000131407	ENST00000019103.5:c.621C>T	chr2.hg19:g.120221714G>A		122.0	0.0	.		97.0	39.0	.	NM_002980	Q12961|Q13213|Q53T00	Silent	SNP	ENST00000019103.5	hg19	CCDS2127.1																																																																																			.	.	.	none		0.572	SCTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254198.2		
GPR155	151556	hgsc.bcm.edu	37	2	175304729	175304729	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr2:175304729C>G	ENST00000392552.2	-	15	2447	c.2209G>C	c.(2209-2211)Gaa>Caa	p.E737Q	GPR155_ENST00000459996.1_5'UTR|GPR155_ENST00000295500.4_Missense_Mutation_p.E737Q|GPR155_ENST00000392551.2_Missense_Mutation_p.E737Q	NM_001267051.1|NM_152529.6	NP_001253980.1|NP_689742.4	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155	737					cognition (GO:0050890)|intracellular signal transduction (GO:0035556)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	26						TCCCTGTTTTCTGCTGTGTCT	0.373																																					p.E737Q		Atlas-SNP	.											.	GPR155	76	.	0			c.G2209C						PASS	.						126.0	124.0	124.0					2																	175304729		2203	4300	6503	SO:0001583	missense	151556	exon16			TGTTTTCTGCTGT	AY255528	CCDS2259.1, CCDS74605.1	2q31.1	2012-04-10			ENSG00000163328	ENSG00000163328			22951	protein-coding gene	gene with protein product						12679517	Standard	NM_001033045		Approved	DEPDC3, DEP.7, FLJ31819, PGR22	uc002uiu.4	Q7Z3F1	OTTHUMG00000132336	ENST00000392552.2:c.2209G>C	chr2.hg19:g.175304729C>G	ENSP00000376335:p.Glu737Gln	81.0	0.0	.		59.0	31.0	.	NM_001033045	B2RCI2|D3DPE2|Q4G0Y6|Q53SJ3|Q53TA8|Q69YG8|Q86SP9|Q8N261|Q8N639|Q8N8K3|Q96MV6	Missense_Mutation	SNP	ENST00000392552.2	hg19	CCDS2259.1	.	.	.	.	.	.	.	.	.	.	C	10.74	1.434272	0.25813	.	.	ENSG00000163328	ENST00000392552;ENST00000510236;ENST00000392551;ENST00000295500	T;T;T	0.44083	0.93;0.93;0.93	5.59	5.59	0.84812	.	0.587930	0.19501	N	0.112740	T	0.37598	0.1009	L	0.38838	1.175	0.24898	N	0.992127	B;B	0.26258	0.145;0.003	B;B	0.27887	0.084;0.009	T	0.15752	-1.0426	10	0.18276	T	0.48	-0.5171	19.5907	0.95509	0.0:1.0:0.0:0.0	.	217;737	F5H464;Q7Z3F1	.;GP155_HUMAN	Q	737;217;737;737	ENSP00000376335:E737Q;ENSP00000376334:E737Q;ENSP00000295500:E737Q	ENSP00000295500:E737Q	E	-	1	0	GPR155	175012975	1.000000	0.71417	0.991000	0.47740	0.931000	0.56810	4.009000	0.57110	2.640000	0.89533	0.655000	0.94253	GAA	.	.	.	none		0.373	GPR155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255455.1	NM_152529	
GIGYF2	26058	hgsc.bcm.edu	37	2	233612395	233612395	+	Silent	SNP	T	T	C			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr2:233612395T>C	ENST00000409547.1	+	6	423	c.112T>C	c.(112-114)Tta>Cta	p.L38L	GIGYF2_ENST00000373563.4_Silent_p.L38L|GIGYF2_ENST00000409451.3_Silent_p.L38L|GIGYF2_ENST00000409196.3_Silent_p.L38L|GIGYF2_ENST00000409480.1_Silent_p.L38L|GIGYF2_ENST00000373566.3_Silent_p.L38L	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	38					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		GAAGTATAAATTAGCAGATTA	0.398																																					p.L38L		Atlas-SNP	.											.	GIGYF2	288	.	0			c.T112C						PASS	.						124.0	123.0	123.0					2																	233612395		2203	4300	6503	SO:0001819	synonymous_variant	26058	exon4			TATAAATTAGCAG	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.112T>C	chr2.hg19:g.233612395T>C		96.0	0.0	.		68.0	28.0	.	NM_001103146	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Silent	SNP	ENST00000409547.1	hg19	CCDS33401.1																																																																																			.	.	.	none		0.398	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146	
OR6B2	389090	hgsc.bcm.edu	37	2	240969002	240969002	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr2:240969002G>A	ENST00000402971.2	-	1	904	c.845C>T	c.(844-846)aCg>aTg	p.T282M		NM_001005853.1	NP_001005853.1	Q6IFH4	OR6B2_HUMAN	olfactory receptor, family 6, subfamily B, member 2	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(9)|prostate(1)	15		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;3.4e-29)|all cancers(36;2.08e-27)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)		AATTATTGGCGTGACAACAGT	0.468																																					p.T282M		Atlas-SNP	.											.	OR6B2	30	.	0			c.C845T						PASS	.						119.0	116.0	117.0					2																	240969002		1917	4130	6047	SO:0001583	missense	389090	exon1			ATTGGCGTGACAA		CCDS46559.1	2q37.3	2012-08-09	2004-10-07	2004-10-07	ENSG00000182083	ENSG00000182083		"""GPCR / Class A : Olfactory receptors"""	15041	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 2 pseudogene"""	OR6B2P			Standard	XM_005247004		Approved		uc010zoc.2	Q6IFH4	OTTHUMG00000152400	ENST00000402971.2:c.845C>T	chr2.hg19:g.240969002G>A	ENSP00000384563:p.Thr282Met	229.0	0.0	.		146.0	7.0	.	NM_001005853	B2RPR3|Q8NGW0	Missense_Mutation	SNP	ENST00000402971.2	hg19	CCDS46559.1	.	.	.	.	.	.	.	.	.	.	G	11.24	1.581713	0.28180	.	.	ENSG00000182083	ENST00000402971	T	0.38401	1.14	4.36	3.48	0.39840	GPCR, rhodopsin-like superfamily (1);	0.135419	0.33075	N	0.005308	T	0.54615	0.1869	M	0.88906	2.99	0.29521	N	0.8535	P	0.52577	0.954	P	0.55391	0.775	T	0.58696	-0.7591	10	0.87932	D	0	.	7.0844	0.25249	0.2031:0.0:0.7969:0.0	.	282	Q6IFH4	OR6B2_HUMAN	M	282	ENSP00000384563:T282M	ENSP00000384563:T282M	T	-	2	0	OR6B2	240617675	0.008000	0.16893	0.457000	0.27056	0.032000	0.12392	1.620000	0.36976	1.174000	0.42811	-0.194000	0.12790	ACG	.	.	.	none		0.468	OR6B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326079.1	NM_001005853	
LRPAP1	4043	hgsc.bcm.edu	37	4	3533995	3533995	+	Missense_Mutation	SNP	C	C	T	rs539416757		TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr4:3533995C>T	ENST00000500728.2	-	1	291	c.145G>A	c.(145-147)Gag>Aag	p.E49K	LRPAP1_ENST00000296325.5_5'Flank	NM_002337.3	NP_002328.1	P30533	AMRP_HUMAN	low density lipoprotein receptor-related protein associated protein 1	49					extracellular negative regulation of signal transduction (GO:1900116)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of protein binding (GO:0032091)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|protein folding (GO:0006457)|receptor-mediated endocytosis (GO:0006898)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|rough endoplasmic reticulum lumen (GO:0048237)|vesicle (GO:0031982)	asialoglycoprotein receptor activity (GO:0004873)|heparin binding (GO:0008201)|low-density lipoprotein particle receptor binding (GO:0050750)|receptor antagonist activity (GO:0048019)|unfolded protein binding (GO:0051082)|very-low-density lipoprotein particle receptor binding (GO:0070326)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.165)		TCTCCGGACTCGCGTTTCGGG	0.697													c|||	1	0.000199681	0.0	0.0014	5008	,	,		9728	0.0		0.0	False		,,,				2504	0.0				p.E49K		Atlas-SNP	.											.	LRPAP1	29	.	0			c.G145A						PASS	.						30.0	28.0	29.0					4																	3533995		2137	4234	6371	SO:0001583	missense	4043	exon1			CGGACTCGCGTTT		CCDS3371.1	4p16.3	2008-05-02	2003-03-17		ENSG00000163956	ENSG00000163956			6701	protein-coding gene	gene with protein product		104225	"""low density lipoprotein-related protein-associated protein 1 (alpha-2-macroglobulin receptor-associated protein 1)"""	A2MRAP		1712782	Standard	NM_002337		Approved	HBP44	uc003ghh.4	P30533	OTTHUMG00000090299	ENST00000500728.2:c.145G>A	chr4.hg19:g.3533995C>T	ENSP00000421922:p.Glu49Lys	158.0	0.0	.		99.0	41.0	.	NM_002337	D3DVR9|Q2M310|Q53HQ3|Q53HS6	Missense_Mutation	SNP	ENST00000500728.2	hg19	CCDS3371.1	.	.	.	.	.	.	.	.	.	.	C	11.08	1.532771	0.27387	.	.	ENSG00000163956	ENST00000500728	T	0.43688	0.94	3.59	3.59	0.41128	Alpha-2-macroglobulin receptor-associated protein, domain 1 (1);	0.744185	0.12472	N	0.465930	T	0.35480	0.0933	L	0.46741	1.465	0.27557	N	0.950308	P	0.41008	0.735	B	0.38056	0.264	T	0.16158	-1.0412	10	0.38643	T	0.18	-15.3408	10.5987	0.45354	0.0:1.0:0.0:0.0	.	49	P30533	AMRP_HUMAN	K	49	ENSP00000421922:E49K	ENSP00000421922:E49K	E	-	1	0	LRPAP1	3503793	0.445000	0.25657	0.659000	0.29680	0.054000	0.15201	0.827000	0.27421	1.823000	0.53134	0.591000	0.81541	GAG	.	.	.	none		0.697	LRPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206659.4		
LRRC66	339977	hgsc.bcm.edu	37	4	52861561	52861562	+	Missense_Mutation	DNP	CC	CC	TG			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr4:52861561_52861562CC>TG	ENST00000343457.3	-	4	1632_1633	c.1626_1627GG>CA	c.(1624-1629)gtGGcc>gtCAcc	p.A543T		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	543						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						TCTTCCTGGGCCACAGTTTCAT	0.505																																					p.A543T|p.V542V		Atlas-SNP	.											.	LRRC66	128	.	0			c.G1627A|c.G1626C						PASS	.																																			SO:0001583	missense	339977	exon4			CCTGGGCCACAGT|CTGGGCCACAGTT	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1626_1627delinsTG	chr4.hg19:g.52861561_52861562delinsTG	ENSP00000341944:p.Ala543Thr	114.0|117.0	0.0	.		77.0|76.0	24.0|23.0	.	NM_001024611		Missense_Mutation|Silent	SNP	ENST00000343457.3	hg19	CCDS43229.1																																																																																			.	.	.	none		0.505	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1	NM_001024611	
GRIA2	2891	hgsc.bcm.edu	37	4	158257702	158257702	+	Nonsense_Mutation	SNP	C	C	A			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr4:158257702C>A	ENST00000264426.9	+	11	1926	c.1647C>A	c.(1645-1647)tgC>tgA	p.C549*	GRIA2_ENST00000296526.7_Nonsense_Mutation_p.C549*|GRIA2_ENST00000393815.2_Nonsense_Mutation_p.C502*|GRIA2_ENST00000507898.1_Nonsense_Mutation_p.C502*|GRIA2_ENST00000449365.1_Nonsense_Mutation_p.C502*	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	549					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TCTGGATGTGCATTGTTTTTG	0.443																																					p.C549X		Atlas-SNP	.											.	GRIA2	358	.	0			c.C1647A						PASS	.						234.0	219.0	224.0					4																	158257702		2203	4300	6503	SO:0001587	stop_gained	2891	exon11			GATGTGCATTGTT		CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.1647C>A	chr4.hg19:g.158257702C>A	ENSP00000264426:p.Cys549*	247.0	0.0	.		128.0	39.0	.	NM_000826	A8MT92|I6L997|Q96FP6	Nonsense_Mutation	SNP	ENST00000264426.9	hg19	CCDS43274.1	.	.	.	.	.	.	.	.	.	.	C	39	7.595898	0.98381	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365	.	.	.	5.46	4.62	0.57501	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	.	14.5219	0.67856	0.0:0.9291:0.0:0.0709	.	.	.	.	X	502;502;549;549;502	.	ENSP00000264426:C549X	C	+	3	2	GRIA2	158477152	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.561000	0.45905	1.442000	0.47568	0.655000	0.94253	TGC	.	.	.	none		0.443	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2		
TENM3	55714	hgsc.bcm.edu	37	4	183696133	183696133	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr4:183696133G>A	ENST00000511685.1	+	24	5254	c.5131G>A	c.(5131-5133)Ggc>Agc	p.G1711S	RP11-18D7.2_ENST00000513255.1_RNA|TENM3_ENST00000406950.2_Missense_Mutation_p.G1711S			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1711					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CTACGCCAGTGGCCTGGACTC	0.473																																					p.G1711S		Atlas-SNP	.											.	.	.	.	0			c.G5131A						PASS	.						42.0	43.0	43.0					4																	183696133		1907	4124	6031	SO:0001583	missense	55714	exon23			GCCAGTGGCCTGG	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.5131G>A	chr4.hg19:g.183696133G>A	ENSP00000424226:p.Gly1711Ser	189.0	0.0	.		141.0	57.0	.	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	hg19	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.404306	0.83230	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.87966	-2.32;-2.32	4.77	4.77	0.60923	.	.	.	.	.	D	0.93706	0.7989	M	0.80847	2.515	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94287	0.7525	9	0.72032	D	0.01	.	18.3535	0.90348	0.0:0.0:1.0:0.0	.	1711	Q9P273	TEN3_HUMAN	S	1711	ENSP00000424226:G1711S;ENSP00000385276:G1711S	ENSP00000385276:G1711S	G	+	1	0	ODZ3	183933127	1.000000	0.71417	0.835000	0.33067	0.392000	0.30506	9.601000	0.98297	2.627000	0.88993	0.650000	0.86243	GGC	.	.	.	none		0.473	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
ICE1	23379	hgsc.bcm.edu	37	5	5465025	5465025	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr5:5465025A>T	ENST00000296564.7	+	13	5800	c.5578A>T	c.(5578-5580)Agg>Tgg	p.R1860W		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1860					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						ACCAGAAACCAGGGGAGTCAC	0.507																																					p.R1860W		Atlas-SNP	.											.	KIAA0947	301	.	0			c.A5578T						PASS	.						59.0	63.0	62.0					5																	5465025		1889	4124	6013	SO:0001583	missense	23379	exon13			GAAACCAGGGGAG																												ENST00000296564.7:c.5578A>T	chr5.hg19:g.5465025A>T	ENSP00000296564:p.Arg1860Trp	303.0	0.0	.		229.0	108.0	.	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	hg19	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	A	18.28	3.588195	0.66105	.	.	ENSG00000164151	ENST00000296564	T	0.10668	2.85	5.24	-3.67	0.04476	.	.	.	.	.	T	0.09818	0.0241	N	0.22421	0.69	0.09310	N	1	D	0.59767	0.986	P	0.55455	0.776	T	0.13522	-1.0506	9	0.66056	D	0.02	-0.8027	1.3306	0.02134	0.1867:0.3863:0.1747:0.2523	.	1860	Q9Y2F5	K0947_HUMAN	W	1860	ENSP00000296564:R1860W	ENSP00000296564:R1860W	R	+	1	2	KIAA0947	5518025	0.000000	0.05858	0.000000	0.03702	0.137000	0.21094	-0.142000	0.10311	-0.636000	0.05524	-0.644000	0.03951	AGG	.	.	.	none		0.507	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
FAM173B	134145	hgsc.bcm.edu	37	5	10227716	10227716	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr5:10227716T>C	ENST00000511437.1	-	5	551	c.539A>G	c.(538-540)gAt>gGt	p.D180G	FAM173B_ENST00000510047.1_Missense_Mutation_p.D163G|FAM173B_ENST00000510052.1_5'UTR|FAM173B_ENST00000280330.8_Missense_Mutation_p.D16G	NM_199133.3	NP_954584.2	Q6P4H8	F173B_HUMAN	family with sequence similarity 173, member B	180						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	16						AACTCGTGCATCATCCTCAAG	0.488																																					p.D180G		Atlas-SNP	.											.	FAM173B	24	.	0			c.A539G						PASS	.						117.0	111.0	112.0					5																	10227716		1974	4158	6132	SO:0001583	missense	134145	exon5			CGTGCATCATCCT		CCDS43301.1, CCDS58942.1	5p15.2	2008-08-08			ENSG00000150756	ENSG00000150756			27029	protein-coding gene	gene with protein product						12477932	Standard	NM_199133		Approved		uc003jeo.3	Q6P4H8	OTTHUMG00000161771	ENST00000511437.1:c.539A>G	chr5.hg19:g.10227716T>C	ENSP00000422338:p.Asp180Gly	82.0	0.0	.		83.0	4.0	.	NM_199133	B4DT41|B4DXK2|E9PBZ4	Missense_Mutation	SNP	ENST00000511437.1	hg19	CCDS43301.1	.	.	.	.	.	.	.	.	.	.	T	5.398	0.258646	0.10239	.	.	ENSG00000150756	ENST00000280330;ENST00000511437;ENST00000510047	T;T;T	0.16897	2.31;3.03;3.03	5.17	2.75	0.32379	.	0.481441	0.24198	N	0.040649	T	0.04907	0.0132	N	0.01809	-0.71	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.13407	0.004;0.009	T	0.40905	-0.9538	10	0.12430	T	0.62	-6.4801	4.8377	0.13473	0.0:0.1713:0.1582:0.6705	.	163;180	E9PBZ4;Q6P4H8	.;F173B_HUMAN	G	16;180;163	ENSP00000280330:D16G;ENSP00000422338:D180G;ENSP00000420876:D163G	ENSP00000280330:D16G	D	-	2	0	FAM173B	10280716	0.020000	0.18652	0.000000	0.03702	0.368000	0.29767	1.126000	0.31344	0.381000	0.24851	0.528000	0.53228	GAT	.	.	.	none		0.488	FAM173B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000366048.2	NM_199133	
ZNF622	90441	hgsc.bcm.edu	37	5	16463842	16463842	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr5:16463842T>C	ENST00000308683.2	-	2	761	c.635A>G	c.(634-636)gAt>gGt	p.D212G		NM_033414.2	NP_219482.1	Q969S3	ZN622_HUMAN	zinc finger protein 622	212	Glu-rich.				intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of kinase activity (GO:0033674)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						AGAATCAATATCTTCCCAATC	0.413																																					p.D212G		Atlas-SNP	.											ZNF622,NS,carcinoma,0,1	ZNF622	49	.	0			c.A635G						PASS	.						152.0	164.0	160.0					5																	16463842		2203	4300	6503	SO:0001583	missense	90441	exon2			TCAATATCTTCCC	AY046059	CCDS3886.1	5p15.1	2012-10-05			ENSG00000173545	ENSG00000173545			30958	protein-coding gene	gene with protein product		608694				11802789, 12645566	Standard	NM_033414		Approved	MGC2485, MGC17552, ZPR9	uc003jfq.3	Q969S3	OTTHUMG00000090567	ENST00000308683.2:c.635A>G	chr5.hg19:g.16463842T>C	ENSP00000310042:p.Asp212Gly	91.0	0.0	.		78.0	30.0	.	NM_033414		Missense_Mutation	SNP	ENST00000308683.2	hg19	CCDS3886.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.407580	0.83340	.	.	ENSG00000173545	ENST00000308683	.	.	.	5.18	5.18	0.71444	.	0.092716	0.64402	N	0.000001	T	0.61553	0.2356	M	0.78049	2.395	0.80722	D	1	P	0.48294	0.908	B	0.43754	0.43	T	0.63664	-0.6586	9	0.27082	T	0.32	-3.0532	15.3358	0.74250	0.0:0.0:0.0:1.0	.	212	Q969S3	ZN622_HUMAN	G	212	.	ENSP00000310042:D212G	D	-	2	0	ZNF622	16516842	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.193000	0.77780	2.068000	0.61886	0.459000	0.35465	GAT	.	.	.	none		0.413	ZNF622-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207105.1	NM_033414	
RXFP3	51289	hgsc.bcm.edu	37	5	33937725	33937725	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr5:33937725A>T	ENST00000330120.3	+	1	1235	c.880A>T	c.(880-882)Atc>Ttc	p.I294F		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	294					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)			endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						GGTGCGCTTCATCGCCGACCG	0.672																																					p.I294F		Atlas-SNP	.											.	RXFP3	114	.	0			c.A880T						PASS	.						33.0	25.0	28.0					5																	33937725		2190	4272	6462	SO:0001583	missense	51289	exon1			CGCTTCATCGCCG	D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.880A>T	chr5.hg19:g.33937725A>T	ENSP00000328708:p.Ile294Phe	75.0	0.0	.		53.0	31.0	.	NM_016568	Q14DA5	Missense_Mutation	SNP	ENST00000330120.3	hg19	CCDS3900.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.991457	0.74703	.	.	ENSG00000182631	ENST00000330120	T	0.41758	0.99	5.74	4.55	0.56014	GPCR, rhodopsin-like superfamily (1);	0.108059	0.64402	D	0.000008	T	0.63343	0.2503	M	0.78285	2.405	0.48632	D	0.999689	D	0.63046	0.992	D	0.68483	0.958	T	0.66352	-0.5945	10	0.62326	D	0.03	-23.9733	12.8323	0.57752	0.8636:0.1364:0.0:0.0	.	294	Q9NSD7	RL3R1_HUMAN	F	294	ENSP00000328708:I294F	ENSP00000328708:I294F	I	+	1	0	RXFP3	33973482	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.969000	0.40510	0.944000	0.37579	0.533000	0.62120	ATC	.	.	.	none		0.672	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207369.1	NM_016568	
RASA1	5921	hgsc.bcm.edu	37	5	86659213	86659213	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr5:86659213A>G	ENST00000274376.6	+	11	2066	c.1502A>G	c.(1501-1503)gAt>gGt	p.D501G	RASA1_ENST00000506290.1_Missense_Mutation_p.D335G|RASA1_ENST00000512763.1_Missense_Mutation_p.D334G|RASA1_ENST00000456692.2_Missense_Mutation_p.D324G	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	501	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		GAGGGTAGTGATGCCCAACTT	0.318																																					p.D501G		Atlas-SNP	.											.	RASA1	213	.	0			c.A1502G						PASS	.						76.0	77.0	77.0					5																	86659213		2203	4300	6503	SO:0001583	missense	5921	exon11			GTAGTGATGCCCA		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.1502A>G	chr5.hg19:g.86659213A>G	ENSP00000274376:p.Asp501Gly	102.0	0.0	.		78.0	31.0	.	NM_002890	B2R6W3|Q9UDI1	Missense_Mutation	SNP	ENST00000274376.6	hg19	CCDS34200.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.763741	0.89932	.	.	ENSG00000145715	ENST00000274376;ENST00000534133;ENST00000456692;ENST00000512763;ENST00000506290	T;T;T;T	0.12255	2.7;2.7;2.7;2.7	5.58	5.58	0.84498	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.31827	0.0809	L	0.49571	1.57	0.80722	D	1	D;D;D;D;D	0.67145	0.996;0.996;0.996;0.995;0.992	D;D;D;D;D	0.69479	0.964;0.935;0.964;0.939;0.947	T	0.01858	-1.1259	10	0.72032	D	0.01	.	15.754	0.78011	1.0:0.0:0.0:0.0	.	335;334;335;324;501	E9PGC0;B4DTL2;B4DTX4;P20936-2;P20936	.;.;.;.;RASA1_HUMAN	G	501;534;324;334;335	ENSP00000274376:D501G;ENSP00000411221:D324G;ENSP00000422008:D334G;ENSP00000420905:D335G	ENSP00000274376:D501G	D	+	2	0	RASA1	86694969	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.305000	0.96197	2.118000	0.64928	0.383000	0.25322	GAT	.	.	.	none		0.318	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
DST	667	hgsc.bcm.edu	37	6	56464935	56464935	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr6:56464935C>G	ENST00000361203.3	-	41	11000	c.10993G>C	c.(10993-10995)Ggt>Cgt	p.G3665R	DST_ENST00000421834.2_Missense_Mutation_p.G1579R|DST_ENST00000244364.6_Missense_Mutation_p.G1253R|DST_ENST00000370788.2_Missense_Mutation_p.G1579R|DST_ENST00000370769.4_Missense_Mutation_p.G3667R|DST_ENST00000446842.2_Missense_Mutation_p.G3341R|DST_ENST00000370754.5_Missense_Mutation_p.G3845R|DST_ENST00000312431.6_Missense_Mutation_p.G3665R			Q03001	DYST_HUMAN	dystonin	3665					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TCTTGGTGACCAATTAGGCGG	0.403																																					p.G1253R		Atlas-SNP	.											.	DST	1427	.	0			c.G3757C						PASS	.						168.0	156.0	160.0					6																	56464935		1847	4102	5949	SO:0001583	missense	667	exon26			GGTGACCAATTAG	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.10993G>C	chr6.hg19:g.56464935C>G	ENSP00000354508:p.Gly3665Arg	124.0	0.0	.		74.0	27.0	.	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	hg19		.	.	.	.	.	.	.	.	.	.	C	17.41	3.383400	0.61845	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73;0.73;0.73;0.73	6.05	5.17	0.71159	.	0.113109	0.39341	N	0.001390	T	0.48624	0.1510	L	0.50333	1.59	0.29604	N	0.847445	D;D;D;D;B	0.69078	0.974;0.997;0.997;0.976;0.439	P;D;D;P;B	0.71184	0.726;0.972;0.972;0.788;0.209	T	0.46871	-0.9160	9	0.21540	T	0.41	.	14.4473	0.67359	0.0:0.9289:0.0:0.0711	.	1579;3667;3845;3665;1253	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	R	1253;3845;3667;1579;3341;3665;1579;3665	ENSP00000244364:G1253R;ENSP00000359790:G3845R;ENSP00000359805:G3667R;ENSP00000400883:G1579R;ENSP00000393645:G3341R;ENSP00000307959:G3665R;ENSP00000359824:G1579R;ENSP00000354508:G3665R	ENSP00000244364:G1253R	G	-	1	0	DST	56572894	0.999000	0.42202	0.887000	0.34795	0.994000	0.84299	4.339000	0.59322	1.543000	0.49345	0.650000	0.86243	GGT	.	.	.	none		0.403	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
ZBTB24	9841	hgsc.bcm.edu	37	6	109796655	109796655	+	Missense_Mutation	SNP	T	T	G	rs548726702		TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr6:109796655T>G	ENST00000230122.3	-	5	1402	c.1235A>C	c.(1234-1236)cAt>cCt	p.H412P		NM_001164313.1|NM_014797.2	NP_001157785.1|NP_055612.2	O43167	ZBT24_HUMAN	zinc finger and BTB domain containing 24	412					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)		GAATTTGCGATGGCAGTCTTT	0.453																																					p.H412P		Atlas-SNP	.											.	ZBTB24	64	.	0			c.A1235C						PASS	.						214.0	175.0	188.0					6																	109796655		2203	4300	6503	SO:0001583	missense	9841	exon5			TTGCGATGGCAGT	AB007901	CCDS34509.1	6q21	2014-09-17	2004-04-15	2004-04-16	ENSG00000112365	ENSG00000112365		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	21143	protein-coding gene	gene with protein product	"""POZ (BTB) and AT hook containing zinc finger 2"""	614064	"""zinc finger protein 450"""	ZNF450		9455477	Standard	NM_014797		Approved	KIAA0441, BIF1, PATZ2	uc003ptl.1	O43167	OTTHUMG00000015349	ENST00000230122.3:c.1235A>C	chr6.hg19:g.109796655T>G	ENSP00000230122:p.His412Pro	115.0	0.0	.		65.0	26.0	.	NM_014797	Q17RC6|Q5TED5|Q8N455	Missense_Mutation	SNP	ENST00000230122.3	hg19	CCDS34509.1	.	.	.	.	.	.	.	.	.	.	T	18.54	3.645420	0.67358	.	.	ENSG00000112365	ENST00000230122	T	0.07327	3.2	6.17	3.82	0.43975	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.047154	0.85682	D	0.000000	T	0.01765	0.0056	N	0.03948	-0.315	0.41015	D	0.985037	B	0.31009	0.303	B	0.34038	0.174	T	0.49707	-0.8911	10	0.72032	D	0.01	-13.7104	11.4813	0.50326	0.0:0.1436:0.0:0.8564	.	412	O43167	ZBT24_HUMAN	P	412	ENSP00000230122:H412P	ENSP00000230122:H412P	H	-	2	0	ZBTB24	109903348	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	2.512000	0.45485	0.579000	0.29504	0.533000	0.62120	CAT	.	.	.	none		0.453	ZBTB24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041758.1	NM_014797	
IGF2BP3	10643	hgsc.bcm.edu	37	7	23357270	23357270	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr7:23357270C>A	ENST00000258729.3	-	12	1739	c.1383G>T	c.(1381-1383)gaG>gaT	p.E461D		NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3	461	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						TGAACTGAGCCTCTGGTGGTC	0.448																																					p.E461D		Atlas-SNP	.											.	IGF2BP3	71	.	0			c.G1383T						PASS	.						246.0	192.0	210.0					7																	23357270		2203	4300	6503	SO:0001583	missense	10643	exon12			CTGAGCCTCTGGT	AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.1383G>T	chr7.hg19:g.23357270C>A	ENSP00000258729:p.Glu461Asp	78.0	0.0	.		108.0	45.0	.	NM_006547	A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Missense_Mutation	SNP	ENST00000258729.3	hg19	CCDS5382.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.931823	0.73442	.	.	ENSG00000136231	ENST00000258729	T	0.35236	1.32	5.52	4.62	0.57501	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.33440	0.0863	L	0.37800	1.135	0.80722	D	1	B	0.32160	0.358	B	0.42625	0.393	T	0.05582	-1.0876	10	0.25751	T	0.34	-21.5421	9.7329	0.40372	0.0:0.8035:0.0:0.1965	.	461	O00425	IF2B3_HUMAN	D	461	ENSP00000258729:E461D	ENSP00000258729:E461D	E	-	3	2	IGF2BP3	23323795	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.113000	0.31184	2.767000	0.95098	0.655000	0.94253	GAG	.	.	.	none		0.448	IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250243.2	NM_006547	
AQP1	358	hgsc.bcm.edu	37	7	30963176	30963176	+	Missense_Mutation	SNP	G	G	A	rs149637560		TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr7:30963176G>A	ENST00000311813.4	+	4	797	c.742G>A	c.(742-744)Ggc>Agc	p.G248S	AQP1_ENST00000409611.1_Missense_Mutation_p.G197S|AQP1_ENST00000409899.1_Missense_Mutation_p.G133S|AQP1_ENST00000434909.2_Missense_Mutation_p.G308S|AQP1_ENST00000509504.1_Missense_Mutation_p.G425S|AQP1_ENST00000441328.2_Missense_Mutation_p.G165S|AQP1_ENST00000482461.1_3'UTR	NM_198098.2	NP_932766.1	P29972	AQP1_HUMAN	aquaporin 1 (Colton blood group)	248					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|camera-type eye morphogenesis (GO:0048593)|carbon dioxide transmembrane transport (GO:0035378)|carbon dioxide transport (GO:0015670)|cation transmembrane transport (GO:0098655)|cell volume homeostasis (GO:0006884)|cellular homeostasis (GO:0019725)|cellular hyperosmotic response (GO:0071474)|cellular response to cAMP (GO:0071320)|cellular response to copper ion (GO:0071280)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to inorganic substance (GO:0071241)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mercury ion (GO:0071288)|cellular response to nitric oxide (GO:0071732)|cellular response to retinoic acid (GO:0071300)|cellular response to salt stress (GO:0071472)|cellular response to stress (GO:0033554)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|cGMP biosynthetic process (GO:0006182)|corticotropin secretion (GO:0051458)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|glomerular filtration (GO:0003094)|glycerol transport (GO:0015793)|hyperosmotic salinity response (GO:0042538)|lateral ventricle development (GO:0021670)|lipid digestion (GO:0044241)|maintenance of symbiont-containing vacuole by host (GO:0085018)|metanephric descending thin limb development (GO:0072220)|metanephric glomerulus vasculature development (GO:0072239)|metanephric proximal convoluted tubule segment 2 development (GO:0072232)|metanephric proximal straight tubule development (GO:0072230)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|nitric oxide transport (GO:0030185)|odontogenesis (GO:0042476)|pancreatic juice secretion (GO:0030157)|positive regulation of angiogenesis (GO:0045766)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of saliva secretion (GO:0046878)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|renal water absorption (GO:0070295)|renal water transport (GO:0003097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|secretory granule organization (GO:0033363)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)|transepithelial water transport (GO:0035377)|transmembrane transport (GO:0055085)|water transport (GO:0006833)|wound healing (GO:0042060)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|axon terminus (GO:0043679)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|symbiont-containing vacuole (GO:0020003)	ammonium transmembrane transporter activity (GO:0008519)|carbon dioxide transmembrane transporter activity (GO:0035379)|glycerol transmembrane transporter activity (GO:0015168)|intracellular cGMP activated cation channel activity (GO:0005223)|nitric oxide transmembrane transporter activity (GO:0030184)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)|transmembrane transporter activity (GO:0022857)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)			kidney(1)|large_intestine(2)|lung(9)	12		Melanoma(862;0.16)			Acetazolamide(DB00819)	GTGGACCAGCGGCCAGGTGGA	0.622																																					p.G248S		Atlas-SNP	.											.	AQP1	38	.	0			c.G742A						PASS	.	G	SER/GLY,SER/GLY,SER/GLY,SER/GLY	0,4406		0,0,2203	51.0	43.0	46.0		493,589,397,742	5.1	1.0	7	dbSNP_134	46	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	AQP1	NM_001185060.1,NM_001185061.1,NM_001185062.1,NM_198098.2	56,56,56,56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,	165/187,197/219,133/155,248/270	30963176	1,13005	2203	4300	6503	SO:0001583	missense	358	exon4			ACCAGCGGCCAGG	M77829	CCDS5431.1, CCDS55096.1, CCDS55097.1, CCDS55098.1	7p14	2014-07-19	2014-01-02		ENSG00000240583	ENSG00000240583		"""Ion channels / Aquaporins"", ""Blood group antigens"""	633	protein-coding gene	gene with protein product		107776	"""Colton blood group"", ""aquaporin 1 (channel-forming integral protein, 28kDa)"", ""aquaporin 1 (channel-forming integral protein, 28kDa, CO blood group)"", ""aquaporin 1"""	CO		1722319, 3166547	Standard	NM_198098		Approved	CHIP28		P29972	OTTHUMG00000023944	ENST00000311813.4:c.742G>A	chr7.hg19:g.30963176G>A	ENSP00000311165:p.Gly248Ser	228.0	0.0	.		252.0	116.0	.	NM_198098	B5BU39|E7EM69|E9PC21|F5GY19|Q8TBI5|Q8TDC1	Missense_Mutation	SNP	ENST00000311813.4	hg19	CCDS5431.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.419918	0.83559	0.0	1.16E-4	ENSG00000240583;ENSG00000240583;ENSG00000240583;ENSG00000240583;ENSG00000240583;ENSG00000240583;ENSG00000240583;ENSG00000250424	ENST00000434909;ENST00000265298;ENST00000311813;ENST00000413400;ENST00000441328;ENST00000409899;ENST00000409611;ENST00000509504	D;D;D;D;D;D	0.93953	-2.27;-1.97;-2.93;-3.32;-2.95;-2.27	5.07	5.07	0.68467	.	0.050340	0.85682	N	0.000000	D	0.95589	0.8566	L	0.61218	1.895	0.51233	D	0.99991	P;D;D;D	0.89917	0.774;1.0;1.0;1.0	B;D;D;D	0.91635	0.099;0.999;0.998;0.999	D	0.94980	0.8125	10	0.42905	T	0.14	0.8519	13.9555	0.64144	0.0:0.0:1.0:0.0	.	308;197;133;248	B4E220;E7EM69;E9PC21;P29972	.;.;.;AQP1_HUMAN	S	308;153;248;233;165;133;197;425	ENSP00000395059:G308S;ENSP00000311165:G248S;ENSP00000405698:G165S;ENSP00000386712:G133S;ENSP00000387178:G197S;ENSP00000421315:G425S	ENSP00000265298:G153S	G	+	1	0	RP5-877J2.1;AQP1	30929701	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.861000	0.75478	2.345000	0.79718	0.549000	0.68633	GGC	.	G|1.000;A|0.000	0.000	weak		0.622	AQP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215002.3	NM_000385	
C8orf74	203076	hgsc.bcm.edu	37	8	10555296	10555296	+	Silent	SNP	G	G	A			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr8:10555296G>A	ENST00000304519.5	+	3	458	c.429G>A	c.(427-429)gaG>gaA	p.E143E	RP1L1_ENST00000329335.3_Intron	NM_001040032.1	NP_001035121	Q6P047	CH074_HUMAN	chromosome 8 open reading frame 74	143										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	13				COAD - Colon adenocarcinoma(149;0.0811)		CCCACCTGGAGGTGTGCATGC	0.627																																					p.E143E		Atlas-SNP	.											.	C8orf74	28	.	0			c.G429A						PASS	.						125.0	129.0	128.0					8																	10555296		2143	4230	6373	SO:0001819	synonymous_variant	203076	exon3			CCTGGAGGTGTGC	BC038534	CCDS47800.1	8p23.1	2012-04-17			ENSG00000171060	ENSG00000171060			32296	protein-coding gene	gene with protein product							Standard	NM_001040032		Approved		uc003wtd.1	Q6P047	OTTHUMG00000163807	ENST00000304519.5:c.429G>A	chr8.hg19:g.10555296G>A		102.0	0.0	.		69.0	25.0	.	NM_001040032	A2RUD6	Silent	SNP	ENST00000304519.5	hg19	CCDS47800.1																																																																																			.	.	.	none		0.627	C8orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375675.1	NM_001040032	
SLC7A2	6542	hgsc.bcm.edu	37	8	17409383	17409383	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr8:17409383C>T	ENST00000494857.1	+	7	1161	c.943C>T	c.(943-945)Ccg>Tcg	p.P315S	SLC7A2_ENST00000004531.10_Missense_Mutation_p.P355S|SLC7A2_ENST00000522656.1_Missense_Mutation_p.P315S|SLC7A2_ENST00000398090.3_Missense_Mutation_p.P355S|SLC7A2_ENST00000470360.1_Missense_Mutation_p.P355S	NM_001008539.3	NP_001008539.3	P52569	CTR2_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 2	315					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|macrophage activation (GO:0042116)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide production involved in inflammatory response (GO:0002537)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	basic amino acid transmembrane transporter activity (GO:0015174)|high-affinity arginine transmembrane transporter activity (GO:0005289)|L-lysine transmembrane transporter activity (GO:0015189)|L-ornithine transmembrane transporter activity (GO:0000064)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	25				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	ACTTATGATGCCGTACTACCT	0.483																																					p.P355S		Atlas-SNP	.											.	SLC7A2	157	.	0			c.C1063T						PASS	.						220.0	203.0	208.0					8																	17409383		2203	4300	6503	SO:0001583	missense	6542	exon6			ATGATGCCGTACT	D29990	CCDS6002.2, CCDS34852.1, CCDS55203.1	8p22	2013-05-22			ENSG00000003989	ENSG00000003989		"""Solute carriers"""	11060	protein-coding gene	gene with protein product		601872		ATRC2		8954799	Standard	NM_001164771		Approved	CAT-2, HCAT2	uc011kye.2	P52569	OTTHUMG00000130819	ENST00000494857.1:c.943C>T	chr8.hg19:g.17409383C>T	ENSP00000419140:p.Pro315Ser	186.0	0.0	.		120.0	50.0	.	NM_001164771	B7ZL54|O15291|O15292|Q14CQ6|Q6NSZ7|Q86TC6	Missense_Mutation	SNP	ENST00000494857.1	hg19	CCDS34852.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.660463	0.88154	.	.	ENSG00000003989	ENST00000494857;ENST00000522656;ENST00000470360;ENST00000004531;ENST00000398090	D;D;D;D;D	0.91843	-2.92;-2.92;-2.92;-2.92;-2.92	5.4	5.4	0.78164	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.96466	0.8847	M	0.82433	2.59	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.994;0.998;0.999	D	0.96575	0.9426	10	0.72032	D	0.01	.	19.5642	0.95386	0.0:1.0:0.0:0.0	.	355;355;315	P52569-3;P52569-2;P52569	.;.;CTR2_HUMAN	S	315;315;355;355;355	ENSP00000419140:P315S;ENSP00000430464:P315S;ENSP00000419873:P355S;ENSP00000004531:P355S;ENSP00000381164:P355S	ENSP00000004531:P355S	P	+	1	0	SLC7A2	17453761	1.000000	0.71417	0.999000	0.59377	0.723000	0.41478	7.818000	0.86416	2.702000	0.92279	0.655000	0.94253	CCG	.	.	.	none		0.483	SLC7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253367.3	NM_003046	
PEX2	5828	hgsc.bcm.edu	37	8	77896129	77896129	+	Nonsense_Mutation	SNP	G	G	A			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr8:77896129G>A	ENST00000419564.2	-	4	750	c.286C>T	c.(286-288)Cag>Tag	p.Q96*	PEX2_ENST00000357039.4_Nonsense_Mutation_p.Q96*|PEX2_ENST00000522527.1_Nonsense_Mutation_p.Q96*|PEX2_ENST00000520103.1_Nonsense_Mutation_p.Q96*	NM_001172087.1	NP_001165558.1	P28328	PEX2_HUMAN	peroxisomal biogenesis factor 2	96					bile acid biosynthetic process (GO:0006699)|cholesterol homeostasis (GO:0042632)|fatty acid beta-oxidation (GO:0006635)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein destabilization (GO:0031648)|protein import into peroxisome matrix (GO:0016558)|regulation of cholesterol biosynthetic process (GO:0045540)|very long-chain fatty acid metabolic process (GO:0000038)	Cdc73/Paf1 complex (GO:0016593)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	14						CTGGGTGGCTGATATCTCAGG	0.373																																					p.Q96X		Atlas-SNP	.											.	PEX2	44	.	0			c.C286T						PASS	.						48.0	47.0	47.0					8																	77896129		2203	4300	6503	SO:0001587	stop_gained	5828	exon4			GTGGCTGATATCT	M86852	CCDS6221.1	8q21.11	2010-02-09	2010-01-25	2010-01-25		ENSG00000164751		"""RING-type (C3HC4) zinc fingers"""	9717	protein-coding gene	gene with protein product	"""Zellweger syndrome"", ""peroxin 2"""	170993	"""peroxisomal membrane protein 3 (35kD, Zellweger syndrome)"", ""peroxisomal membrane protein 3, 35kDa"""	PXMP3		1546315, 8858157	Standard	NM_000318		Approved	PMP35, PAF-1, RNF72, ZWS3	uc022awf.1	P28328		ENST00000419564.2:c.286C>T	chr8.hg19:g.77896129G>A	ENSP00000400984:p.Gln96*	154.0	0.0	.		103.0	35.0	.	NM_000318	Q567S6|Q9BW41	Nonsense_Mutation	SNP	ENST00000419564.2	hg19	CCDS6221.1	.	.	.	.	.	.	.	.	.	.	G	37	6.549895	0.97654	.	.	ENSG00000164751	ENST00000357039;ENST00000419564;ENST00000520103;ENST00000522527;ENST00000518986	.	.	.	5.04	5.04	0.67666	.	0.183165	0.46442	D	0.000298	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-1.9694	13.5869	0.61937	0.0:0.0:0.8448:0.1552	.	.	.	.	X	96	.	ENSP00000349543:Q96X	Q	-	1	0	PEX2	78058684	1.000000	0.71417	0.304000	0.25085	0.816000	0.46133	3.661000	0.54503	2.625000	0.88918	0.558000	0.71614	CAG	.	.	.	none		0.373	PEX2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379122.1	NM_000318	
PHF2	5253	hgsc.bcm.edu	37	9	96435951	96435951	+	Silent	SNP	G	G	C			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr9:96435951G>C	ENST00000359246.4	+	18	2800	c.2433G>C	c.(2431-2433)ctG>ctC	p.L811L	PHF2_ENST00000375376.4_Intron	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	811					liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		ACTCCTGCCTGCAGACCACGT	0.667																																					p.L811L		Atlas-SNP	.											.	PHF2	113	.	0			c.G2433C						PASS	.						34.0	37.0	36.0					9																	96435951		2203	4300	6503	SO:0001819	synonymous_variant	5253	exon18			CTGCCTGCAGACC	AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.2433G>C	chr9.hg19:g.96435951G>C		150.0	0.0	.		116.0	47.0	.	NM_005392	Q4VXG0|Q8N3K2|Q9Y6N4	Silent	SNP	ENST00000359246.4	hg19	CCDS35069.1																																																																																			.	.	.	none		0.667	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053162.1	NM_005392	
CUBN	8029	hgsc.bcm.edu	37	10	16941122	16941122	+	Missense_Mutation	SNP	T	T	C	rs141773881		TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr10:16941122T>C	ENST00000377833.4	-	54	8536	c.8471A>G	c.(8470-8472)aAt>aGt	p.N2824S		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2824	CUB 21. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TTCGGGAAAATTCTGAGGCCA	0.428																																					p.N2824S		Atlas-SNP	.											.	CUBN	515	.	0			c.A8471G						PASS	.	T	SER/ASN	0,4406		0,0,2203	140.0	131.0	134.0		8471	1.6	0.7	10	dbSNP_134	134	1,8599	1.2+/-3.3	0,1,4299	no	missense	CUBN	NM_001081.3	46	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	possibly-damaging	2824/3624	16941122	1,13005	2203	4300	6503	SO:0001583	missense	8029	exon54			GGAAAATTCTGAG	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.8471A>G	chr10.hg19:g.16941122T>C	ENSP00000367064:p.Asn2824Ser	130.0	0.0	.		96.0	78.0	.	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	hg19	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	T	10.93	1.490599	0.26686	0.0	1.16E-4	ENSG00000107611	ENST00000377833	T	0.28666	1.6	5.63	1.6	0.23607	CUB (5);	0.653650	0.13545	N	0.379921	T	0.33789	0.0875	L	0.53729	1.69	0.80722	D	1	P	0.41366	0.747	B	0.43386	0.418	T	0.17992	-1.0351	10	0.45353	T	0.12	.	13.0134	0.58743	0.0:0.0:0.3986:0.6014	.	2824	O60494	CUBN_HUMAN	S	2824	ENSP00000367064:N2824S	ENSP00000367064:N2824S	N	-	2	0	CUBN	16981128	1.000000	0.71417	0.713000	0.30519	0.079000	0.17450	3.883000	0.56168	0.452000	0.26830	0.459000	0.35465	AAT	.	T|1.000;C|0.000	0.000	weak		0.428	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
SKIDA1	387640	hgsc.bcm.edu	37	10	21805486	21805486	+	Silent	SNP	C	C	T			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr10:21805486C>T	ENST00000449193.2	-	4	3518	c.1266G>A	c.(1264-1266)gaG>gaA	p.E422E	SKIDA1_ENST00000444772.3_Silent_p.E343E|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	341						nucleus (GO:0005634)		p.E422E(2)									cctcttcctcctcctcctcct	0.632																																					p.E422E		Atlas-SNP	.											C10orf140_ENST00000449193,rectum,carcinoma,0,4	.	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1266A						PASS	.						5.0	6.0	6.0					10																	21805486		1988	4108	6096	SO:0001819	synonymous_variant	387640	exon4			TTCCTCCTCCTCC	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1266G>A	chr10.hg19:g.21805486C>T		52.0	0.0	.		36.0	7.0	.	NM_207371	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	hg19	CCDS44363.1																																																																																			.	.	.	none		0.632	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
NLRP14	338323	hgsc.bcm.edu	37	11	7064285	7064285	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr11:7064285T>A	ENST00000299481.4	+	4	1374	c.1028T>A	c.(1027-1029)tTt>tAt	p.F343Y		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	343	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		TACCAGTTTTTTGAAGATAAG	0.418																																					p.F343Y		Atlas-SNP	.											.	NLRP14	187	.	0			c.T1028A						PASS	.						93.0	98.0	96.0					11																	7064285		2201	4296	6497	SO:0001583	missense	338323	exon4			AGTTTTTTGAAGA	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.1028T>A	chr11.hg19:g.7064285T>A	ENSP00000299481:p.Phe343Tyr	128.0	0.0	.		83.0	30.0	.	NM_176822	Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	hg19	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	T	16.50	3.140789	0.56936	.	.	ENSG00000158077	ENST00000299481	T	0.81330	-1.48	4.51	3.34	0.38264	NACHT nucleoside triphosphatase (1);	0.272209	0.26840	N	0.022228	D	0.88905	0.6564	M	0.86740	2.835	0.27111	N	0.962373	D	0.76494	0.999	D	0.69824	0.966	T	0.81604	-0.0857	10	0.62326	D	0.03	.	9.4923	0.38967	0.0:0.0:0.1784:0.8216	.	343	Q86W24	NAL14_HUMAN	Y	343	ENSP00000299481:F343Y	ENSP00000299481:F343Y	F	+	2	0	NLRP14	7020861	0.997000	0.39634	0.149000	0.22428	0.663000	0.39108	3.745000	0.55119	0.842000	0.35045	0.533000	0.62120	TTT	.	.	.	none		0.418	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822	
FAR1	84188	hgsc.bcm.edu	37	11	13729613	13729613	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr11:13729613A>C	ENST00000354817.3	+	4	676	c.532A>C	c.(532-534)Att>Ctt	p.I178L		NM_032228.5	NP_115604.1	Q8WVX9	FACR1_HUMAN	fatty acyl CoA reductase 1	178					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)|wax biosynthetic process (GO:0010025)	integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13						CAAGAAGCTGATTGATTCTTT	0.413																																					p.I178L		Atlas-SNP	.											.	FAR1	40	.	0			c.A532C						PASS	.						134.0	131.0	132.0					11																	13729613		2200	4294	6494	SO:0001583	missense	84188	exon4			AAGCTGATTGATT	AK026381	CCDS7813.1	11p15.2	2011-09-14	2008-06-06	2008-06-06	ENSG00000197601	ENSG00000197601	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	26222	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 1"""		"""male sterility domain containing 2"""	MLSTD2		15220348, 15220349, 19027726	Standard	NM_032228		Approved	FLJ22728, SDR10E1	uc001mld.3	Q8WVX9	OTTHUMG00000165743	ENST00000354817.3:c.532A>C	chr11.hg19:g.13729613A>C	ENSP00000346874:p.Ile178Leu	80.0	0.0	.		47.0	23.0	.	NM_032228	D3DQW8|Q5CZA3	Missense_Mutation	SNP	ENST00000354817.3	hg19	CCDS7813.1	.	.	.	.	.	.	.	.	.	.	A	16.79	3.219145	0.58560	.	.	ENSG00000197601	ENST00000354817;ENST00000532701;ENST00000355107	T;T	0.28895	2.03;1.59	5.83	5.83	0.93111	NAD(P)-binding domain (1);Male sterility, NAD-binding (1);	0.044587	0.85682	D	0.000000	T	0.24005	0.0581	L	0.31578	0.945	0.80722	D	1	B;B	0.12013	0.005;0.001	B;B	0.17979	0.02;0.012	T	0.07404	-1.0774	10	0.13853	T	0.58	-16.2928	15.8464	0.78895	1.0:0.0:0.0:0.0	.	178;178	E7ETC1;Q8WVX9	.;FACR1_HUMAN	L	178	ENSP00000346874:I178L;ENSP00000437111:I178L	ENSP00000346874:I178L	I	+	1	0	FAR1	13686189	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.011000	0.70760	2.216000	0.71823	0.477000	0.44152	ATT	.	.	.	none		0.413	FAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385990.2	NM_032228	
TRIM77	390231	hgsc.bcm.edu	37	11	89443479	89443479	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr11:89443479A>T	ENST00000398290.3	+	1	13	c.13A>T	c.(13-15)Atc>Ttc	p.I5F		NM_001146162.1	NP_001139634.1	I1YAP6	TRI77_HUMAN	tripartite motif containing 77	5						intracellular (GO:0005622)	zinc ion binding (GO:0008270)										GGCTTCTGCTATCACGCAGTG	0.428																																					p.I5F		Atlas-SNP	.											.	.	.	.	0			c.A13T						PASS	.						99.0	77.0	84.0					11																	89443479		692	1591	2283	SO:0001583	missense	390231	exon1			TCTGCTATCACGC		CCDS60929.1	11q14.3	2014-02-17	2013-01-14	2013-01-14	ENSG00000214414	ENSG00000214414		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	34228	protein-coding gene	gene with protein product			"""tripartite motif-containing 77"", ""tripartite motif containing 77, pseudogene"""	TRIM77P			Standard	NM_001146162		Approved		uc010rtw.2	I1YAP6	OTTHUMG00000167624	ENST00000398290.3:c.13A>T	chr11.hg19:g.89443479A>T	ENSP00000474003:p.Ile5Phe	97.0	0.0	.		61.0	21.0	.	NM_001146162		Missense_Mutation	SNP	ENST00000398290.3	hg19																																																																																				.	.	.	none		0.428	TRIM77-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146162	
TSPAN11	441631	hgsc.bcm.edu	37	12	31135568	31135568	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr12:31135568G>C	ENST00000261177.9	+	6	617	c.558G>C	c.(556-558)aaG>aaC	p.K186N	TSPAN11_ENST00000535215.1_Missense_Mutation_p.K115N|TSPAN11_ENST00000544427.1_Missense_Mutation_p.K176N|TSPAN11_ENST00000546076.1_Missense_Mutation_p.K186N	NM_001080509.2	NP_001073978.1	A1L157	TSN11_HUMAN	tetraspanin 11	186						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)	11	all_lung(12;3.11e-10)|Lung NSC(12;5.24e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					GCTGCTGCAAGACAGTGGTGG	0.647																																					p.K186N		Atlas-SNP	.											.	TSPAN11	30	.	0			c.G558C						PASS	.						19.0	21.0	20.0					12																	31135568		2198	4296	6494	SO:0001583	missense	441631	exon6			CTGCAAGACAGTG		CCDS31765.1	12p11.21	2013-02-14				ENSG00000110900		"""Tetraspanins"""	30795	protein-coding gene	gene with protein product							Standard	NM_001080509		Approved		uc001rjp.3	A1L157		ENST00000261177.9:c.558G>C	chr12.hg19:g.31135568G>C	ENSP00000261177:p.Lys186Asn	208.0	0.0	.		134.0	59.0	.	NM_001080509	A1L158|B2RUX6	Missense_Mutation	SNP	ENST00000261177.9	hg19	CCDS31765.1	.	.	.	.	.	.	.	.	.	.	G	15.37	2.814257	0.50527	.	.	ENSG00000110900	ENST00000546076;ENST00000535215;ENST00000544427;ENST00000261177	D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24	4.01	4.01	0.46588	Tetraspanin, EC2 domain (1);	0.446856	0.20497	U	0.091161	D	0.91418	0.7292	M	0.69185	2.1	0.49798	D	0.999823	D;D	0.89917	0.999;1.0	D;D	0.81914	0.986;0.995	D	0.89311	0.3633	10	0.24483	T	0.36	.	13.6064	0.62050	0.0:0.0:1.0:0.0	.	176;186	F5H0F0;A1L157	.;TSN11_HUMAN	N	186;115;176;186	ENSP00000437403:K186N;ENSP00000445503:K115N;ENSP00000439895:K176N;ENSP00000261177:K186N	ENSP00000261177:K186N	K	+	3	2	TSPAN11	31026835	1.000000	0.71417	1.000000	0.80357	0.334000	0.28698	1.524000	0.35942	1.752000	0.51891	0.313000	0.20887	AAG	.	.	.	none		0.647	TSPAN11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399888.1	XM_497334	
ZFC3H1	196441	hgsc.bcm.edu	37	12	72056805	72056805	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr12:72056805G>T	ENST00000378743.3	-	1	944	c.586C>A	c.(586-588)Cct>Act	p.P196T	ZFC3H1_ENST00000552037.1_Missense_Mutation_p.P196T|THAP2_ENST00000547843.1_5'Flank|THAP2_ENST00000308086.2_5'UTR|ZFC3H1_ENST00000549407.1_5'UTR|ZFC3H1_ENST00000548100.1_Missense_Mutation_p.P196T	NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	196					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						CTCTTCCGAGGTGGAGAGGGC	0.587																																					p.P196T		Atlas-SNP	.											.	ZFC3H1	172	.	0			c.C586A						PASS	.						136.0	151.0	147.0					12																	72056805		2010	4169	6179	SO:0001583	missense	196441	exon1			TCCGAGGTGGAGA	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.586C>A	chr12.hg19:g.72056805G>T	ENSP00000368017:p.Pro196Thr	35.0	0.0	.		32.0	13.0	.	NM_144982	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Missense_Mutation	SNP	ENST00000378743.3	hg19	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	G	12.00	1.805554	0.31961	.	.	ENSG00000133858	ENST00000378743;ENST00000548100;ENST00000552037	T	0.29142	1.58	3.73	3.73	0.42828	.	0.434461	0.21170	N	0.078982	T	0.23532	0.0569	N	0.08118	0	0.80722	D	1	B;D;P	0.54207	0.361;0.965;0.849	B;P;B	0.49708	0.141;0.62;0.227	T	0.08371	-1.0725	10	0.34782	T	0.22	.	14.9879	0.71362	0.0:0.0:1.0:0.0	.	196;196;196	G3V1X1;O60293-4;O60293	.;.;ZC3H1_HUMAN	T	196	ENSP00000368017:P196T	ENSP00000368017:P196T	P	-	1	0	ZFC3H1	70343072	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	2.062000	0.41413	2.384000	0.81235	0.650000	0.86243	CCT	.	.	.	none		0.587	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982	
VPS36	51028	hgsc.bcm.edu	37	13	52992189	52992189	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr13:52992189C>A	ENST00000378060.4	-	11	870	c.843G>T	c.(841-843)ttG>ttT	p.L281F		NM_001282168.1|NM_001282169.1|NM_016075.2	NP_001269097.1|NP_001269098.1|NP_057159.2	Q86VN1	VPS36_HUMAN	vacuolar protein sorting 36 homolog (S. cerevisiae)	281					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	17		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.14e-08)		CTGGTGAGAGCAACTAATAGG	0.363																																					p.L281F		Atlas-SNP	.											.	VPS36	38	.	0			c.G843T						PASS	.						78.0	71.0	73.0					13																	52992189		2203	4300	6503	SO:0001583	missense	51028	exon11			TGAGAGCAACTAA	AF151903	CCDS9434.1, CCDS73577.1	13q14.13	2008-02-05	2007-01-12	2005-08-02	ENSG00000136100	ENSG00000136100			20312	protein-coding gene	gene with protein product		610903	"""chromosome 13 open reading frame 9"", ""vacuolar protein sorting 36 homolog (yeast)"""	C13orf9		11278625, 15755741	Standard	NM_016075		Approved	CGI-145, Eap45	uc001vgs.3	Q86VN1	OTTHUMG00000016964	ENST00000378060.4:c.843G>T	chr13.hg19:g.52992189C>A	ENSP00000367299:p.Leu281Phe	90.0	0.0	.		55.0	12.0	.	NM_016075	A8K125|Q3ZCV7|Q5H9S1|Q5VXB6|Q9H8Z5|Q9Y3E3	Missense_Mutation	SNP	ENST00000378060.4	hg19	CCDS9434.1	.	.	.	.	.	.	.	.	.	.	.	20.4	3.978040	0.74360	.	.	ENSG00000136100	ENST00000378060	.	.	.	5.36	4.5	0.54988	.	0.000000	0.85682	D	0.000000	D	0.85102	0.5620	M	0.93594	3.435	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88191	0.2877	9	0.87932	D	0	-9.0496	12.9041	0.58141	0.0:0.9216:0.0:0.0783	.	281	Q86VN1	VPS36_HUMAN	F	281	.	ENSP00000367299:L281F	L	-	3	2	VPS36	51890190	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.228000	0.32588	2.653000	0.90120	0.561000	0.74099	TTG	.	.	.	none		0.363	VPS36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045059.3		
MYCBP2	23077	hgsc.bcm.edu	37	13	77657271	77657272	+	Missense_Mutation	DNP	TT	TT	CG			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr13:77657271_77657272TT>CG	ENST00000544440.2	-	63	10834_10835	c.10817_10818AA>CG	c.(10816-10818)gAA>gCG	p.E3606A	MYCBP2-AS1_ENST00000448470.2_RNA|MYCBP2-AS1_ENST00000450627.2_RNA|MYCBP2-AS1_ENST00000422231.2_RNA|MYCBP2-AS1_ENST00000593933.1_RNA|MYCBP2-AS2_ENST00000428716.2_RNA|MYCBP2_ENST00000407578.2_Missense_Mutation_p.E3644A|MYCBP2_ENST00000357337.6_Missense_Mutation_p.E3606A					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GATGAGCAGCTTCCCCGGCAAT	0.47																																					p.E3644E|p.E3644A		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.A10932G|c.A10931C						PASS	.																																			SO:0001583	missense	23077	exon63			AGCAGCTTCCCCG|GCAGCTTCCCCGG	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.10817_10818delinsCG	chr13.hg19:g.77657271_77657272delinsCG	ENSP00000444596:p.Glu3606Ala	102.0|99.0	0.0	.		60.0|59.0	20.0|18.0	.	NM_015057		Silent|Missense_Mutation	SNP	ENST00000544440.2	hg19																																																																																				.	.	.	none		0.470	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
KCNH5	27133	hgsc.bcm.edu	37	14	63468086	63468086	+	Silent	SNP	C	C	T	rs143574473		TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr14:63468086C>T	ENST00000322893.7	-	4	664	c.396G>A	c.(394-396)acG>acA	p.T132T	KCNH5_ENST00000420622.2_Silent_p.T132T|KCNH5_ENST00000394964.2_Silent_p.T74T|KCNH5_ENST00000394968.1_Silent_p.T74T	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	132	PAC. {ECO:0000255|PROSITE- ProRule:PRU00141}.				potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		GTTTGAACAACGTAATATCCT	0.343													C|||	1	0.000199681	0.0	0.0	5008	,	,		18984	0.0		0.0	False		,,,				2504	0.001				p.T132T		Atlas-SNP	.											.	KCNH5	320	.	0			c.G396A						PASS	.	C	,,	0,4406		0,0,2203	113.0	101.0	105.0		396,396,222	-11.3	0.1	14	dbSNP_134	105	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	KCNH5	NM_139318.3,NM_172375.1,NM_172376.1	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	132/989,132/612,74/625	63468086	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	27133	exon4			GAACAACGTAATA	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.396G>A	chr14.hg19:g.63468086C>T		130.0	0.0	.		102.0	32.0	.	NM_172375	C9JP98	Silent	SNP	ENST00000322893.7	hg19	CCDS9756.1																																																																																			.	C|1.000;T|0.000	0.000	weak		0.343	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318	
SLC28A1	9154	hgsc.bcm.edu	37	15	85488365	85488365	+	Silent	SNP	A	A	G			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr15:85488365A>G	ENST00000286749.3	+	18	1974	c.1884A>G	c.(1882-1884)ccA>ccG	p.P628P	SLC28A1_ENST00000538177.1_Silent_p.P462P|SLC28A1_ENST00000394573.1_Silent_p.P628P|SLC28A1_ENST00000537624.1_Intron|SLC28A1_ENST00000537216.1_Intron			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1	628					nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	GCGTCAATCCAGAGTTCAGCC	0.547																																					p.P628P		Atlas-SNP	.											.	SLC28A1	118	.	0			c.A1884G						PASS	.						141.0	124.0	130.0					15																	85488365		2203	4299	6502	SO:0001819	synonymous_variant	9154	exon19			CAATCCAGAGTTC	U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.1884A>G	chr15.hg19:g.85488365A>G		124.0	0.0	.		81.0	35.0	.	NM_004213	A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Silent	SNP	ENST00000286749.3	hg19	CCDS10334.1																																																																																			.	.	.	none		0.547	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308998.2		
SHMT1	6470	hgsc.bcm.edu	37	17	18232672	18232672	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr17:18232672A>G	ENST00000316694.3	-	11	1336	c.1202T>C	c.(1201-1203)cTg>cCg	p.L401P	SHMT1_ENST00000354098.3_Missense_Mutation_p.L362P|SHMT1_ENST00000539052.1_Missense_Mutation_p.L263P|SHMT1_ENST00000352886.6_Missense_Mutation_p.L321P	NM_004169.3	NP_004160.3	P34896	GLYC_HUMAN	serine hydroxymethyltransferase 1 (soluble)	401					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|folic acid metabolic process (GO:0046655)|glycine biosynthetic process from serine (GO:0019264)|L-serine catabolic process (GO:0006565)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase biosynthetic process (GO:0009113)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	amino acid binding (GO:0016597)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)	13					Glycine(DB00145)|Mimosine(DB01055)|Tetrahydrofolic acid(DB00116)	CCCCAGCCGCAGTCCACTGGG	0.498																																					p.L401P		Atlas-SNP	.											.	SHMT1	36	.	0			c.T1202C						PASS	.						41.0	43.0	42.0					17																	18232672		2203	4300	6503	SO:0001583	missense	6470	exon11			AGCCGCAGTCCAC		CCDS11196.1, CCDS11197.1, CCDS62112.1	17p11.2	2010-04-23			ENSG00000176974	ENSG00000176974	2.1.2.1		10850	protein-coding gene	gene with protein product	"""cytoplasmic serine hydroxymethyltransferase"", ""14 kDa protein"""	182144				8505317	Standard	NM_004169		Approved	CSHMT, SHMT, MGC15229, MGC24556	uc002gta.3	P34896	OTTHUMG00000059094	ENST00000316694.3:c.1202T>C	chr17.hg19:g.18232672A>G	ENSP00000318868:p.Leu401Pro	57.0	0.0	.		57.0	18.0	.	NM_004169	B4DPM9|D3DXD0|Q96HY0|Q9UMD1|Q9UMD2	Missense_Mutation	SNP	ENST00000316694.3	hg19	CCDS11196.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.193981	0.78902	.	.	ENSG00000176974	ENST00000316694;ENST00000395684;ENST00000352886;ENST00000539052;ENST00000354098	T;T;T;T	0.39592	1.07;1.07;1.07;1.07	5.52	5.52	0.82312	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.75838	0.3904	H	0.96048	3.76	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.91635	0.979;0.999	D	0.84338	0.0525	10	0.87932	D	0	-15.5184	15.9269	0.79624	1.0:0.0:0.0:0.0	.	362;401	P34896-2;P34896	.;GLYC_HUMAN	P	401;176;321;263;362	ENSP00000318868:L401P;ENSP00000345881:L321P;ENSP00000440089:L263P;ENSP00000318805:L362P	ENSP00000318868:L401P	L	-	2	0	SHMT1	18173397	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	6.913000	0.75759	2.228000	0.72767	0.533000	0.62120	CTG	.	.	.	none		0.498	SHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130831.2	NM_004169	
TBCD	6904	hgsc.bcm.edu	37	17	80714073	80714073	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr17:80714073C>A	ENST00000355528.4	+	2	347	c.217C>A	c.(217-219)Ctg>Atg	p.L73M	TBCD_ENST00000397466.2_5'UTR|TBCD_ENST00000539345.2_Missense_Mutation_p.L73M	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	73					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			GCAGCCTCATCTGTTGGACCC	0.433																																					p.L73M		Atlas-SNP	.											.	TBCD	94	.	0			c.C217A						PASS	.						96.0	91.0	92.0					17																	80714073		1904	4125	6029	SO:0001583	missense	6904	exon2			CCTCATCTGTTGG	BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.217C>A	chr17.hg19:g.80714073C>A	ENSP00000347719:p.Leu73Met	100.0	0.0	.		78.0	42.0	.	NM_005993	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	ENST00000355528.4	hg19	CCDS45818.1	.	.	.	.	.	.	.	.	.	.	C	19.26	3.793621	0.70452	.	.	ENSG00000141556	ENST00000355528;ENST00000536182	T	0.69926	-0.44	4.84	4.84	0.62591	Armadillo-type fold (1);	.	.	.	.	D	0.85835	0.5789	M	0.92507	3.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.89585	0.3823	8	.	.	.	.	16.5397	0.84382	0.0:1.0:0.0:0.0	.	73;73	Q9BTW9;Q9BTW9-4	TBCD_HUMAN;.	M	73	ENSP00000347719:L73M	.	L	+	1	2	TBCD	78307362	0.982000	0.34865	1.000000	0.80357	0.728000	0.41692	0.757000	0.26433	2.231000	0.72958	0.655000	0.94253	CTG	.	.	.	none		0.433	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439415.1	NM_005993	
DSG1	1828	hgsc.bcm.edu	37	18	28935300	28935300	+	Nonsense_Mutation	SNP	T	T	A			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr18:28935300T>A	ENST00000257192.4	+	15	3353	c.3141T>A	c.(3139-3141)taT>taA	p.Y1047*	RP11-534N16.1_ENST00000578119.1_RNA|RP11-534N16.1_ENST00000581856.1_RNA|RP11-534N16.1_ENST00000581452.1_RNA|RP11-534N16.1_ENST00000578477.1_RNA|DSG1_ENST00000462981.2_Nonsense_Mutation_p.Y406*	NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1	1047					apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)			NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			CCGTGCAATATAGCAAGTAGT	0.438																																					p.Y1047X		Atlas-SNP	.											.	DSG1	176	.	0			c.T3141A						PASS	.						50.0	47.0	48.0					18																	28935300		2203	4300	6503	SO:0001587	stop_gained	1828	exon15			GCAATATAGCAAG	X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.3141T>A	chr18.hg19:g.28935300T>A	ENSP00000257192:p.Tyr1047*	89.0	0.0	.		63.0	26.0	.	NM_001942	B7Z845	Nonsense_Mutation	SNP	ENST00000257192.4	hg19	CCDS11896.1	.	.	.	.	.	.	.	.	.	.	T	32	5.188195	0.94923	.	.	ENSG00000134760	ENST00000257192	.	.	.	6.17	-5.88	0.02290	.	0.000000	0.64402	D	0.000009	.	.	.	.	.	.	0.41102	D	0.985674	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.1241	0.97973	0.0:0.6843:0.0:0.3157	.	.	.	.	X	1047	.	ENSP00000257192:Y1047X	Y	+	3	2	DSG1	27189298	0.110000	0.22057	0.666000	0.29783	0.810000	0.45777	-1.057000	0.03486	-1.021000	0.03350	-0.242000	0.12053	TAT	.	.	.	none		0.438	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254947.1	NM_001942	
ZNF429	353088	hgsc.bcm.edu	37	19	21712584	21712584	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr19:21712584T>A	ENST00000358491.4	+	2	336	c.128T>A	c.(127-129)cTg>cAg	p.L43Q	ZNF429_ENST00000597078.1_Missense_Mutation_p.L43Q|ZNF429_ENST00000594022.1_3'UTR	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	43	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						TTGGTCTTCCTGGGTGAGAAT	0.373																																					p.L43Q		Atlas-SNP	.											.	ZNF429	338	.	0			c.T128A						PASS	.						100.0	111.0	107.0					19																	21712584		2201	4299	6500	SO:0001583	missense	353088	exon2			TCTTCCTGGGTGA	AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.128T>A	chr19.hg19:g.21712584T>A	ENSP00000351280:p.Leu43Gln	194.0	0.0	.		108.0	43.0	.	NM_001001415	A6NLV7|Q9BZE6	Missense_Mutation	SNP	ENST00000358491.4	hg19	CCDS42537.1	.	.	.	.	.	.	.	.	.	.	.	10.30	1.312394	0.23908	.	.	ENSG00000197013	ENST00000358491	T	0.02763	4.17	0.926	0.926	0.19430	Krueppel-associated box (4);	.	.	.	.	T	0.23014	0.0556	H	0.98682	4.3	0.24819	N	0.992593	D	0.89917	1.0	D	0.97110	1.0	T	0.05533	-1.0879	9	0.87932	D	0	.	6.7513	0.23489	0.0:0.0:0.0:1.0	.	43	Q86V71	ZN429_HUMAN	Q	43	ENSP00000351280:L43Q	ENSP00000351280:L43Q	L	+	2	0	ZNF429	21504424	0.948000	0.32251	0.353000	0.25747	0.357000	0.29423	2.617000	0.46385	0.263000	0.21812	0.260000	0.18958	CTG	.	.	.	none		0.373	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463981.1	NM_001001415	
SLC1A5	6510	hgsc.bcm.edu	37	19	47278876	47278876	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr19:47278876G>C	ENST00000542575.2	-	8	2145	c.1517C>G	c.(1516-1518)cCc>cGc	p.P506R	SLC1A5_ENST00000412532.2_Missense_Mutation_p.P278R|SLC1A5_ENST00000594991.1_Missense_Mutation_p.P330R|FKRP_ENST00000600646.1_Intron|SLC1A5_ENST00000434726.2_Missense_Mutation_p.P304R	NM_005628.2	NP_005619.1	Q15758	AAAT_HUMAN	solute carrier family 1 (neutral amino acid transporter), member 5	506					amino acid transport (GO:0006865)|extracellular amino acid transport (GO:0006860)|glutamine transport (GO:0006868)|ion transport (GO:0006811)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-glutamine transmembrane transporter activity (GO:0015186)|L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)|receptor activity (GO:0004872)|sodium:dicarboxylate symporter activity (GO:0017153)|virus receptor activity (GO:0001618)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(2)|stomach(1)	13		all_epithelial(76;0.00314)|Ovarian(192;0.0798)|all_neural(266;0.107)		OV - Ovarian serous cystadenocarcinoma(262;0.000338)|all cancers(93;0.000882)|Epithelial(262;0.0211)|GBM - Glioblastoma multiforme(486;0.0341)	L-Asparagine(DB00174)|L-Glutamine(DB00130)	CGGATCCAGGGGCAGCTCACT	0.592																																					p.P506R		Atlas-SNP	.											.	SLC1A5	31	.	0			c.C1517G						PASS	.						153.0	146.0	148.0					19																	47278876		2203	4300	6503	SO:0001583	missense	6510	exon8			TCCAGGGGCAGCT	U53347	CCDS12692.1, CCDS46125.1, CCDS46126.1	19q13.32	2013-07-15			ENSG00000105281	ENSG00000105281		"""Solute carriers"""	10943	protein-coding gene	gene with protein product		109190		RDRC, M7V1		8702519, 10051606	Standard	NM_005628		Approved	AAAT, ASCT2	uc002pfs.3	Q15758	OTTHUMG00000183434	ENST00000542575.2:c.1517C>G	chr19.hg19:g.47278876G>C	ENSP00000444408:p.Pro506Arg	141.0	0.0	.		98.0	48.0	.	NM_005628	A8K9H5|B4DR77|B4DWS4|B7ZB81|D0EYG6|E9PC01|O95720|Q96RL9|Q9BWQ3|Q9UNP2	Missense_Mutation	SNP	ENST00000542575.2	hg19	CCDS12692.1	.	.	.	.	.	.	.	.	.	.	-	12.62	1.992493	0.35131	.	.	ENSG00000105281	ENST00000542575;ENST00000434726;ENST00000412532;ENST00000306894	T;T;T	0.63255	0.77;-0.03;-0.02	4.88	2.72	0.32119	.	0.616112	0.14575	N	0.311214	T	0.50565	0.1623	L	0.36672	1.1	0.09310	N	1	P;P;P	0.43477	0.808;0.664;0.664	B;B;B	0.42555	0.391;0.168;0.168	T	0.28170	-1.0052	10	0.23302	T	0.38	-16.5459	9.1558	0.36992	0.0824:0.1484:0.7692:0.0	.	304;506;506	E9PC01;Q15758;Q71UA6	.;AAAT_HUMAN;.	R	506;304;278;513	ENSP00000444408:P506R;ENSP00000406532:P304R;ENSP00000397924:P278R	ENSP00000303623:P513R	P	-	2	0	SLC1A5	51970716	0.000000	0.05858	0.003000	0.11579	0.158000	0.22134	0.648000	0.24828	0.638000	0.30545	0.550000	0.68814	CCC	.	.	.	none		0.592	SLC1A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466630.1		
PIH1D1	55011	hgsc.bcm.edu	37	19	49950663	49950663	+	Silent	SNP	C	C	T			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr19:49950663C>T	ENST00000262265.5	-	6	778	c.543G>A	c.(541-543)tcG>tcA	p.S181S	PIH1D1_ENST00000596049.1_Silent_p.S181S|PIH1D1_ENST00000602226.1_5'Flank	NM_017916.2	NP_060386.1	Q9NWS0	PIHD1_HUMAN	PIH1 domain containing 1	181					box C/D snoRNP assembly (GO:0000492)|epithelial cell differentiation (GO:0030855)	pre-snoRNP complex (GO:0070761)				NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)|urinary_tract(1)	11		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00152)|GBM - Glioblastoma multiforme(486;0.0244)		GACGCTGCTCCGAGCGGATGT	0.622																																					p.S181S		Atlas-SNP	.											.	PIH1D1	23	.	0			c.G543A						PASS	.						69.0	72.0	71.0					19																	49950663		2203	4300	6503	SO:0001819	synonymous_variant	55011	exon6			CTGCTCCGAGCGG	AK000650	CCDS12765.1	19q13.33	2012-07-18	2007-01-31	2007-01-31	ENSG00000104872	ENSG00000104872			26075	protein-coding gene	gene with protein product		611480		NOP17		12477932	Standard	NM_017916		Approved	FLJ20643	uc002pns.2	Q9NWS0		ENST00000262265.5:c.543G>A	chr19.hg19:g.49950663C>T		51.0	0.0	.		29.0	9.0	.	NM_017916	B4DGN7|B4E2X7|Q9BVL0	Silent	SNP	ENST00000262265.5	hg19	CCDS12765.1																																																																																			.	.	.	none		0.622	PIH1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465389.2	NM_017916	
BMP7	655	hgsc.bcm.edu	37	20	55748287	55748287	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr20:55748287T>C	ENST00000395863.3	-	6	1620	c.1115A>G	c.(1114-1116)aAc>aGc	p.N372S	BMP7_ENST00000450594.2_Missense_Mutation_p.N372S|BMP7_ENST00000395864.3_Missense_Mutation_p.N306S|BMP7_ENST00000460817.1_5'UTR	NM_001719.2	NP_001710.1	P18075	BMP7_HUMAN	bone morphogenetic protein 7	372					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of an epithelial tube (GO:0048754)|cartilage development (GO:0051216)|cellular response to hypoxia (GO:0071456)|dendrite development (GO:0016358)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint morphogenesis (GO:0060272)|epithelial cell differentiation (GO:0030855)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|mesenchymal cell differentiation (GO:0048762)|mesenchyme development (GO:0060485)|mesoderm formation (GO:0001707)|mesonephros development (GO:0001823)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephros development (GO:0001656)|monocyte aggregation (GO:0070487)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell apoptotic process involved in nephron morphogenesis (GO:0072040)|negative regulation of mitosis (GO:0045839)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of dendrite development (GO:1900006)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of removal of superoxide radicals (GO:2000121)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|steroid hormone mediated signaling pathway (GO:0043401)|ureteric bud development (GO:0001657)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	heparin binding (GO:0008201)			endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			GTTGGTGGCGTTCATGTAGGA	0.627																																					p.N372S		Atlas-SNP	.											.	BMP7	60	.	0			c.A1115G						PASS	.						212.0	131.0	158.0					20																	55748287		2203	4300	6503	SO:0001583	missense	655	exon6			GTGGCGTTCATGT		CCDS13455.1	20q13	2014-01-30	2008-05-22		ENSG00000101144	ENSG00000101144		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1074	protein-coding gene	gene with protein product	"""osteogenic protein 1"""	112267				1427904	Standard	NM_001719		Approved	OP-1	uc010gip.1	P18075	OTTHUMG00000032812	ENST00000395863.3:c.1115A>G	chr20.hg19:g.55748287T>C	ENSP00000379204:p.Asn372Ser	74.0	0.0	.		84.0	25.0	.	NM_001719	Q9H512|Q9NTQ7	Missense_Mutation	SNP	ENST00000395863.3	hg19	CCDS13455.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.760251	0.89932	.	.	ENSG00000101144	ENST00000395863;ENST00000395864;ENST00000450594	D;D;D	0.88818	-2.43;-2.43;-2.43	4.68	4.68	0.58851	Transforming growth factor-beta, C-terminal (3);	0.082917	0.85682	D	0.000000	D	0.93989	0.8075	M	0.78344	2.41	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;P;D	0.97110	0.999;0.906;1.0	D	0.94769	0.7943	10	0.87932	D	0	.	14.4246	0.67207	0.0:0.0:0.0:1.0	.	306;372;372	B1AKZ9;P18075;B1AL00	.;BMP7_HUMAN;.	S	372;306;372	ENSP00000379204:N372S;ENSP00000379205:N306S;ENSP00000398687:N372S	ENSP00000379204:N372S	N	-	2	0	BMP7	55181694	1.000000	0.71417	0.991000	0.47740	0.978000	0.69477	7.930000	0.87610	1.878000	0.54408	0.383000	0.25322	AAC	.	.	.	none		0.627	BMP7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079831.2		
HELZ2	85441	hgsc.bcm.edu	37	20	62195231	62195231	+	Silent	SNP	G	G	A			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr20:62195231G>A	ENST00000467148.1	-	8	5013	c.4944C>T	c.(4942-4944)ggC>ggT	p.G1648G	HELZ2_ENST00000427522.2_Silent_p.G1079G	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1648					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GGGCGCAGCGGCCGAACGCCG	0.692																																					p.G1648G		Atlas-SNP	.											.	.	.	.	0			c.C4944T						PASS	.						15.0	14.0	14.0					20																	62195231		2162	4271	6433	SO:0001819	synonymous_variant	85441	exon9			GCAGCGGCCGAAC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.4944C>T	chr20.hg19:g.62195231G>A		51.0	0.0	.		56.0	16.0	.	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	ENST00000467148.1	hg19	CCDS33508.1																																																																																			.	.	.	none		0.692	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
HSPD1	3329	hgsc.bcm.edu	37	2	198362107	198362108	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr2:198362107_198362108delCT	ENST00000388968.3	-	3	450_451	c.183_184delAG	c.(181-186)acagtgfs	p.V62fs	HSPD1_ENST00000345042.2_Frame_Shift_Del_p.V62fs|HSPD1_ENST00000544407.1_Frame_Shift_Del_p.V62fs|HSPE1_ENST00000409468.1_5'Flank|HSPE1_ENST00000409729.1_5'Flank|HSPE1_ENST00000233893.5_5'Flank	NM_002156.4	NP_002147.2	P10809	CH60_HUMAN	heat shock 60kDa protein 1 (chaperonin)	62					'de novo' protein folding (GO:0006458)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|ATP catabolic process (GO:0006200)|B cell activation (GO:0042113)|B cell cytokine production (GO:0002368)|B cell proliferation (GO:0042100)|chaperone-mediated protein complex assembly (GO:0051131)|isotype switching to IgG isotypes (GO:0048291)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell mediated immune response to tumor cell (GO:0002842)|protein maturation (GO:0051604)|protein refolding (GO:0042026)|protein stabilization (GO:0050821)|response to unfolded protein (GO:0006986)|T cell activation (GO:0042110)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lipopolysaccharide receptor complex (GO:0046696)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chaperone binding (GO:0051087)|DNA replication origin binding (GO:0003688)|double-stranded RNA binding (GO:0003725)|lipopolysaccharide binding (GO:0001530)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)|unfolded protein binding (GO:0051082)			NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(7)|skin(1)	17			Epithelial(96;0.225)			TCAATAATCACTGTTCTTCCCT	0.342																																					p.62_62del		Atlas-Indel,Pindel	.											.	HSPD1	68	.	0			c.184_185del						PASS	.																																			SO:0001589	frameshift_variant	3329	exon3			.	M34664	CCDS33357.1	2q33.1	2011-09-02	2002-08-29		ENSG00000144381	ENSG00000144381		"""Heat Shock Proteins / Chaperonins"""	5261	protein-coding gene	gene with protein product		118190	"""heat shock 60kD protein 1 (chaperonin)"", ""spastic paraplegia 13 (autosomal dominant)"""	SPG13		1980192, 11898127	Standard	NM_002156		Approved	GROEL, HSP60	uc002uui.3	P10809	OTTHUMG00000154463	ENST00000388968.3:c.183_184delAG	chr2.hg19:g.198362107_198362108delCT	ENSP00000373620:p.Val62fs	271.0	0.0	0		143.0	50.0	0.34965	NM_002156	B2R5M6|B7Z712|Q38L19|Q9UCR6	Frame_Shift_Del	DEL	ENST00000388968.3	hg19	CCDS33357.1																																																																																			.	.	.	none		0.342	HSPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335324.2	NM_002156	
SLC25A13	10165	hgsc.bcm.edu	37	7	95750615	95750615	+	Frame_Shift_Del	DEL	C	C	-			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr7:95750615delC	ENST00000265631.5	-	18	2052	c.1916delG	c.(1915-1917)ggcfs	p.G639fs	SLC25A13_ENST00000416240.2_Frame_Shift_Del_p.G640fs|SLC25A13_ENST00000542654.1_Frame_Shift_Del_p.G531fs|SLC25A13_ENST00000494085.1_5'UTR			Q9UJS0	CMC2_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 13	639					aspartate transport (GO:0015810)|ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular respiration (GO:0045333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|transporter activity (GO:0005215)			breast(4)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|prostate(1)|skin(4)	42	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)	CAGTTTGTAGCCCCCAACGTG	0.448																																					p.G640fs		Atlas-Indel,Pindel	.											.	SLC25A13	131	.	0			c.1920delC						PASS	.						87.0	84.0	85.0					7																	95750615		2203	4300	6503	SO:0001589	frameshift_variant	10165	exon18			.	AF118838	CCDS5645.1, CCDS55130.1	7q21.3	2013-05-22	2012-03-29		ENSG00000004864	ENSG00000004864		"""Solute carriers"", ""EF-hand domain containing"""	10983	protein-coding gene	gene with protein product	"""mitochondrial aspartate glutamate carrier 2"""	603859	"""solute carrier family 25, member 13 (citrin)"""	CTLN2		10369257	Standard	NM_014251		Approved	CITRIN, ARALAR2	uc003uog.4	Q9UJS0	OTTHUMG00000023074	ENST00000265631.5:c.1916delG	chr7.hg19:g.95750615delC	ENSP00000265631:p.Gly639fs	174.0	0.0	0		194.0	88.0	0.453608	NM_001160210	O14566|O14575|Q546F9|Q9NZW1|Q9UNI7	Frame_Shift_Del	DEL	ENST00000265631.5	hg19	CCDS5645.1																																																																																			.	.	.	none		0.448	SLC25A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059395.2	NM_014251	
LRRC42	115353	hgsc.bcm.edu	37	1	54433526	54433526	+	Frame_Shift_Del	DEL	A	A	-			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr1:54433526delA	ENST00000371370.3	+	9	1722	c.1201delA	c.(1201-1203)acafs	p.T401fs	LRRC42_ENST00000319223.4_Frame_Shift_Del_p.T401fs	NM_001256409.1	NP_001243338.1	Q9Y546	LRC42_HUMAN	leucine rich repeat containing 42	401										breast(2)|kidney(1)|large_intestine(1)|lung(5)	9						GGAGTCAGAGACAGAACAGAA	0.423																																					p.E400fs		Atlas-INDEL	.											.	LRRC42	29	.	0			c.1200delG						PASS	.						93.0	93.0	93.0					1																	54433526		2203	4300	6503	SO:0001589	frameshift_variant	115353	exon8			.	AK075201	CCDS585.1	1p33-p32.1	2014-02-12			ENSG00000116212	ENSG00000116212			28792	protein-coding gene	gene with protein product						12477932	Standard	NM_001256409		Approved	MGC8974	uc001cwj.2	Q9Y546	OTTHUMG00000008436	ENST00000371370.3:c.1201delA	chr1.hg19:g.54433526delA	ENSP00000360421:p.Thr401fs	171.0	0.0	0		116.0	49.0	0.422414	NM_052940	D3DQ46|Q8N2Q8	Frame_Shift_Del	DEL	ENST00000371370.3	hg19	CCDS585.1																																																																																			.	.	.	none		0.423	LRRC42-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023250.1	NM_052940	
LRRC42	115353	hgsc.bcm.edu	37	1	54433526	54433527	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-UZ-A9PZ-01A-11D-A42J-10	TCGA-UZ-A9PZ-10A-01D-A42M-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d803a908-b844-4475-8169-a7139df2f89e	027f6901-bb89-4fb7-8e82-7dd1ba7fcaf3	g.chr1:54433526_54433527delAC	ENST00000371370.3	+	9	1722_1723	c.1201_1202delAC	c.(1201-1203)acafs	p.T401fs	LRRC42_ENST00000319223.4_Frame_Shift_Del_p.T401fs	NM_001256409.1	NP_001243338.1	Q9Y546	LRC42_HUMAN	leucine rich repeat containing 42	401										breast(2)|kidney(1)|large_intestine(1)|lung(5)	9						GGAGTCAGAGACAGAACAGAAT	0.421																																					p.400_401del		Pindel	.											.	LRRC42	29	.	0			c.1200_1201del						PASS	.																																			SO:0001589	frameshift_variant	115353	exon8			.	AK075201	CCDS585.1	1p33-p32.1	2014-02-12			ENSG00000116212	ENSG00000116212			28792	protein-coding gene	gene with protein product						12477932	Standard	NM_001256409		Approved	MGC8974	uc001cwj.2	Q9Y546	OTTHUMG00000008436	ENST00000371370.3:c.1201_1202delAC	chr1.hg19:g.54433526_54433527delAC	ENSP00000360421:p.Thr401fs	176.0	0.0	.		118.0	36.0	0.305	NM_052940	D3DQ46|Q8N2Q8	Frame_Shift_Del	DEL	ENST00000371370.3	hg19	CCDS585.1																																																																																			.	.	.	none		0.421	LRRC42-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023250.1	NM_052940	
