#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FAM110D	79927	hgsc.bcm.edu	37	1	26488081	26488081	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr1:26488081A>G	ENST00000374268.3	+	2	486	c.299A>G	c.(298-300)gAg>gGg	p.E100G		NM_024869.2	NP_079145.2	Q8TAY7	F110D_HUMAN	family with sequence similarity 110, member D	100																	GTGAACAAAGAGAACGCCAAG	0.697																																					p.E100G		Atlas-SNP	.											.	.	.	.	0			c.A299G						PASS	.						2.0	2.0	2.0					1																	26488081		1529	3373	4902	SO:0001583	missense	79927	exon2			ACAAAGAGAACGC		CCDS41285.1	1p36.11	2011-12-01	2011-12-01	2011-12-01	ENSG00000197245	ENSG00000197245			25860	protein-coding gene	gene with protein product			"""glycine/arginine rich protein 1"""	GRRP1		12477932	Standard	NM_024869		Approved	FLJ14050	uc001blk.3	Q8TAY7	OTTHUMG00000007537	ENST00000374268.3:c.299A>G	chr1.hg19:g.26488081A>G	ENSP00000363386:p.Glu100Gly	124.0	0.0	.		124.0	62.0	.	NM_024869	A8K3V0|Q9H7Z4	Missense_Mutation	SNP	ENST00000374268.3	hg19	CCDS41285.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.025305	0.75390	.	.	ENSG00000197245	ENST00000374268	T	0.35973	1.28	3.98	2.84	0.33178	.	0.324485	0.28815	U	0.014042	T	0.33265	0.0857	L	0.50333	1.59	0.28952	N	0.890333	P	0.47409	0.895	P	0.44518	0.452	T	0.16928	-1.0386	10	0.41790	T	0.15	.	9.1688	0.37067	0.9107:0.0:0.0893:0.0	.	100	Q8TAY7	GRPP1_HUMAN	G	100	ENSP00000363386:E100G	ENSP00000363386:E100G	E	+	2	0	GRRP1	26360668	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.970000	0.70431	0.712000	0.32039	0.352000	0.21897	GAG	.	.	.	none		0.697	FAM110D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019841.1	NM_024869	
ZC3H12A	80149	hgsc.bcm.edu	37	1	37948519	37948519	+	Silent	SNP	A	A	T			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr1:37948519A>T	ENST00000373087.6	+	6	1223	c.1107A>T	c.(1105-1107)acA>acT	p.T369T		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CTCTGCTAACAGAGAGTGAGC	0.612																																					p.T369T		Atlas-SNP	.											.	ZC3H12A	58	.	0			c.A1107T						PASS	.						23.0	25.0	25.0					1																	37948519		2203	4300	6503	SO:0001819	synonymous_variant	80149	exon6			GCTAACAGAGAGT		CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.1107A>T	chr1.hg19:g.37948519A>T		196.0	0.0	.		159.0	76.0	.	NM_025079		Silent	SNP	ENST00000373087.6	hg19	CCDS417.1																																																																																			.	.	.	none		0.612	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	NM_025079	
PRPF3	9129	hgsc.bcm.edu	37	1	150325324	150325324	+	Silent	SNP	C	C	A			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr1:150325324C>A	ENST00000324862.6	+	16	2086	c.1921C>A	c.(1921-1923)Cgg>Agg	p.R641R	PRPF3_ENST00000414970.2_Silent_p.R592R|PRPF3_ENST00000467329.1_3'UTR	NM_004698.2	NP_004689.1	O43395	PRPF3_HUMAN	pre-mRNA processing factor 3	641					mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 x U5 tri-snRNP complex (GO:0046540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		AGCCAAAGACCGGAGCTTTGG	0.368																																					p.R641R	Ovarian(168;1070 2670 5178 20729)	Atlas-SNP	.											.	PRPF3	55	.	0			c.C1921A						PASS	.						82.0	84.0	83.0					1																	150325324		2203	4300	6503	SO:0001819	synonymous_variant	9129	exon16			AAAGACCGGAGCT	AF001947	CCDS951.1	1q21.1	2013-07-16	2013-06-10		ENSG00000117360	ENSG00000117360			17348	protein-coding gene	gene with protein product		607301	"""retinitis pigmentosa 18 (autosomal dominant)"", ""PRP3 pre-mRNA processing factor 3 homolog (yeast)"", ""PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)"""	RP18			Standard	NM_004698		Approved	Prp3, hPrp3, SNRNP90	uc001eum.4	O43395	OTTHUMG00000012807	ENST00000324862.6:c.1921C>A	chr1.hg19:g.150325324C>A		460.0	1.0	.		438.0	180.0	.	NM_004698	B4DSY9|O43446|Q5VT54	Silent	SNP	ENST00000324862.6	hg19	CCDS951.1																																																																																			.	.	.	none		0.368	PRPF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035836.1	NM_004698	
MCL1	4170	hgsc.bcm.edu	37	1	150551933	150551933	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr1:150551933C>A	ENST00000369026.2	-	1	133	c.74G>T	c.(73-75)aGc>aTc	p.S25I	MCL1_ENST00000464132.1_5'Flank|MCL1_ENST00000307940.3_Missense_Mutation_p.S25I	NM_001197320.1|NM_021960.4	NP_001184249.1|NP_068779.1	Q07820	MCL1_HUMAN	myeloid cell leukemia 1	25					apoptotic mitochondrial changes (GO:0008637)|cell fate determination (GO:0001709)|cellular homeostasis (GO:0019725)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|protein transmembrane transport (GO:0071806)|regulation of response to DNA damage stimulus (GO:2001020)|response to cytokine (GO:0034097)	Bcl-2 family protein complex (GO:0097136)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	BH3 domain binding (GO:0051434)|protein channel activity (GO:0015266)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)	8	all_cancers(9;1.69e-53)|all_epithelial(9;1.95e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GGCGCCGCCGCTGCCGGCCCC	0.701																																					p.S25I		Atlas-SNP	.											.	MCL1	27	.	0			c.G74T						PASS	.						8.0	12.0	11.0					1																	150551933		1186	2513	3699	SO:0001583	missense	4170	exon1			CCGCCGCTGCCGG	BC017197	CCDS956.1, CCDS957.1, CCDS72909.1	1q21	2014-03-07	2014-03-07		ENSG00000143384	ENSG00000143384			6943	protein-coding gene	gene with protein product		159552	"""myeloid cell leukemia sequence 1 (BCL2-related)"""			7682708, 7835896	Standard	NM_021960		Approved	BCL2L3, Mcl-1	uc001euz.3	Q07820	OTTHUMG00000034867	ENST00000369026.2:c.74G>T	chr1.hg19:g.150551933C>A	ENSP00000358022:p.Ser25Ile	181.0	0.0	.		205.0	83.0	.	NM_021960	B2R6B2|D3DV03|D3DV04|Q9HD91|Q9NRQ3|Q9NRQ4|Q9UHR7|Q9UHR8|Q9UHR9|Q9UNJ1	Missense_Mutation	SNP	ENST00000369026.2	hg19	CCDS957.1	.	.	.	.	.	.	.	.	.	.	C	10.38	1.333131	0.24167	.	.	ENSG00000143384	ENST00000369026;ENST00000307940;ENST00000439749	T;T	0.27720	2.8;1.65	4.72	2.75	0.32379	.	0.757532	0.11269	N	0.581776	T	0.08313	0.0207	N	0.19112	0.55	0.24195	N	0.995532	P;B	0.36249	0.545;0.119	B;B	0.32533	0.147;0.07	T	0.16012	-1.0417	10	0.62326	D	0.03	-0.9013	11.0335	0.47787	0.0:0.6369:0.3631:0.0	.	25;25	Q07820-2;Q07820	.;MCL1_HUMAN	I	25	ENSP00000358022:S25I;ENSP00000309973:S25I	ENSP00000309973:S25I	S	-	2	0	MCL1	148818557	0.045000	0.20229	0.618000	0.29105	0.094000	0.18550	0.869000	0.27996	0.549000	0.28973	0.561000	0.74099	AGC	.	.	.	none		0.701	MCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084402.1	NM_021960	
TDRKH	11022	hgsc.bcm.edu	37	1	151748012	151748012	+	Missense_Mutation	SNP	C	C	G			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr1:151748012C>G	ENST00000368822.1	-	10	1923	c.1290G>C	c.(1288-1290)caG>caC	p.Q430H	TDRKH_ENST00000368825.3_Missense_Mutation_p.Q385H|TDRKH_ENST00000368824.3_Missense_Mutation_p.Q430H|TDRKH_ENST00000368823.1_Missense_Mutation_p.Q426H|TDRKH_ENST00000440583.2_Missense_Mutation_p.Q206H|TDRKH_ENST00000458431.2_Missense_Mutation_p.Q430H|TDRKH_ENST00000368827.6_Missense_Mutation_p.Q430H			Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing	430					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	mitochondrion (GO:0005739)|pi-body (GO:0071546)|piP-body (GO:0071547)	RNA binding (GO:0003723)			breast(5)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CCTCTTCCCACTGGTCACCTG	0.502																																					p.Q430H		Atlas-SNP	.											.	TDRKH	45	.	0			c.G1290C						PASS	.						84.0	79.0	81.0					1																	151748012		1909	4121	6030	SO:0001583	missense	11022	exon10			TTCCCACTGGTCA	AF227192	CCDS41394.1, CCDS41395.1	1q21	2013-01-23	2003-11-07		ENSG00000182134	ENSG00000182134		"""Tudor domain containing"""	11713	protein-coding gene	gene with protein product		609501	"""tudor and KH domain containing"""			10767542	Standard	NM_001083964		Approved	TDRD2	uc001eza.4	Q9Y2W6	OTTHUMG00000013062	ENST00000368822.1:c.1290G>C	chr1.hg19:g.151748012C>G	ENSP00000357812:p.Gln430His	137.0	0.0	.		120.0	59.0	.	NM_001083965	D3DV24|Q5SZR3|Q5SZR5|Q8N582|Q9NYV5	Missense_Mutation	SNP	ENST00000368822.1	hg19	CCDS41394.1	.	.	.	.	.	.	.	.	.	.	C	10.12	1.263143	0.23051	.	.	ENSG00000182134	ENST00000368827;ENST00000368825;ENST00000368824;ENST00000368823;ENST00000368822;ENST00000458431;ENST00000440583	T;T;T;T;T;T;T	0.23950	2.21;1.88;2.21;2.21;2.21;2.21;1.88	5.92	-9.61	0.00550	.	0.718421	0.14138	N	0.338922	T	0.03827	0.0108	N	0.22421	0.69	0.19775	N	0.999958	B;B;B	0.09022	0.002;0.002;0.001	B;B;B	0.06405	0.002;0.002;0.001	T	0.39941	-0.9589	10	0.17832	T	0.49	-3.0131	12.7851	0.57500	0.0:0.3884:0.0756:0.536	.	385;426;430	Q5SZR5;Q5SZR4;Q9Y2W6	.;.;TDRKH_HUMAN	H	430;385;430;426;430;430;206	ENSP00000357819:Q430H;ENSP00000357817:Q385H;ENSP00000357815:Q430H;ENSP00000357813:Q426H;ENSP00000357812:Q430H;ENSP00000395718:Q430H;ENSP00000416645:Q206H	ENSP00000357812:Q430H	Q	-	3	2	TDRKH	150014636	0.000000	0.05858	0.228000	0.23943	0.945000	0.59286	-1.669000	0.01958	-1.556000	0.01695	-1.149000	0.01842	CAG	.	.	.	none		0.502	TDRKH-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000036648.2	NM_006862	
ASTN1	460	hgsc.bcm.edu	37	1	176863825	176863825	+	Missense_Mutation	SNP	C	C	G	rs377472669		TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr1:176863825C>G	ENST00000367654.3	-	17	3048	c.2837G>C	c.(2836-2838)cGa>cCa	p.R946P	ASTN1_ENST00000361833.2_Missense_Mutation_p.R938P|ASTN1_ENST00000424564.2_Missense_Mutation_p.R938P|ASTN1_ENST00000367657.3_Missense_Mutation_p.R938P	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	946					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						CGAGGGGCATCGTCCCTTGCT	0.602																																					p.R938P		Atlas-SNP	.											.	ASTN1	314	.	0			c.G2813C						PASS	.						99.0	97.0	97.0					1																	176863825		2203	4300	6503	SO:0001583	missense	460	exon17			GGGCATCGTCCCT	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2837G>C	chr1.hg19:g.176863825C>G	ENSP00000356626:p.Arg946Pro	75.0	0.0	.		73.0	31.0	.	NM_004319	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	hg19		.	.	.	.	.	.	.	.	.	.	C	22.4	4.284468	0.80803	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.33865	1.39;1.39;1.39;1.39	5.26	5.26	0.73747	.	0.056729	0.64402	D	0.000001	T	0.45736	0.1357	L	0.39898	1.24	0.58432	D	0.999999	D;D	0.53151	0.958;0.958	P;P	0.52881	0.712;0.712	T	0.43718	-0.9374	10	0.87932	D	0	-14.8582	18.8334	0.92150	0.0:1.0:0.0:0.0	.	938;938	O14525-2;B1AJS1	.;.	P	938;938;946;938;938	ENSP00000356629:R938P;ENSP00000354536:R938P;ENSP00000356626:R946P;ENSP00000395041:R938P	ENSP00000354536:R938P	R	-	2	0	ASTN1	175130448	1.000000	0.71417	0.971000	0.41717	0.999000	0.98932	5.330000	0.65899	2.640000	0.89533	0.655000	0.94253	CGA	.	.	.	none		0.602	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
RASAL2	9462	hgsc.bcm.edu	37	1	178063695	178063695	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr1:178063695T>C	ENST00000367649.3	+	1	420	c.68T>C	c.(67-69)cTg>cCg	p.L23P	RASAL2_ENST00000448150.3_Missense_Mutation_p.L5P|RASAL2-AS1_ENST00000421505.1_lincRNA			Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	0					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						TTCCCGGCGCTGGAGTCCGAC	0.716																																					p.L23P		Atlas-SNP	.											.	RASAL2	334	.	0			c.T68C						PASS	.						17.0	16.0	16.0					1																	178063695		2197	4292	6489	SO:0001583	missense	9462	exon1			CGGCGCTGGAGTC	AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000367649.3:c.68T>C	chr1.hg19:g.178063695T>C	ENSP00000356621:p.Leu23Pro	148.0	0.0	.		124.0	58.0	.	NM_170692	F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	ENST00000367649.3	hg19	CCDS1321.2	.	.	.	.	.	.	.	.	.	.	T	21.2	4.119866	0.77323	.	.	ENSG00000075391	ENST00000448150;ENST00000367649	T;T	0.23754	1.89;2.02	4.69	3.55	0.40652	.	0.203901	0.23740	N	0.045038	T	0.16557	0.0398	N	0.08118	0	0.44515	D	0.997463	P	0.39131	0.661	P	0.45232	0.474	T	0.05037	-1.0910	10	0.87932	D	0	.	7.6777	0.28494	0.0:0.1:0.0:0.9	.	23	F8W755	.	P	5;23	ENSP00000407768:L5P;ENSP00000356621:L23P	ENSP00000356621:L23P	L	+	2	0	RASAL2	176330318	0.972000	0.33761	0.949000	0.38748	0.887000	0.51463	1.179000	0.31993	1.860000	0.53959	0.402000	0.26972	CTG	.	.	.	none		0.716	RASAL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352415.1	NM_170692	
OBSCN	84033	hgsc.bcm.edu	37	1	228528466	228528466	+	Silent	SNP	G	G	A	rs558801538		TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr1:228528466G>A	ENST00000422127.1	+	72	17618	c.17574G>A	c.(17572-17574)gcG>gcA	p.A5858A	OBSCN_ENST00000284548.11_Silent_p.A5858A|OBSCN_ENST00000570156.2_Silent_p.A6815A|OBSCN_ENST00000366709.4_Silent_p.A2977A|OBSCN_ENST00000366707.4_Silent_p.A3492A	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5858	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGAACTGCGCGCTGCTGGAGC	0.637													G|||	1	0.000199681	0.0	0.0	5008	,	,		15267	0.0		0.001	False		,,,				2504	0.0				p.A6815A		Atlas-SNP	.											.	OBSCN	2142	.	0			c.G20445A						PASS	.						18.0	22.0	21.0					1																	228528466		1999	4162	6161	SO:0001819	synonymous_variant	84033	exon83			CTGCGCGCTGCTG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.17574G>A	chr1.hg19:g.228528466G>A		225.0	1.0	.		190.0	87.0	.	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.494467	0.26774	.	.	ENSG00000154358	ENST00000441106	T	0.63096	-0.02	5.04	-7.86	0.01187	.	0.247869	0.35466	N	0.003192	T	0.40222	0.1108	.	.	.	0.53688	D	0.999977	.	.	.	.	.	.	T	0.35525	-0.9785	7	0.18276	T	0.48	.	3.5033	0.07681	0.3257:0.3274:0.2639:0.0831	.	.	.	.	T	475	ENSP00000388554:A475T	ENSP00000388554:A475T	A	+	1	0	OBSCN	226595089	0.000000	0.05858	0.146000	0.22360	0.269000	0.26545	-1.982000	0.01489	-1.315000	0.02297	-0.266000	0.10368	GCT	.	.	.	none		0.637	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
EML6	400954	hgsc.bcm.edu	37	2	55054726	55054726	+	Silent	SNP	C	C	A			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr2:55054726C>A	ENST00000356458.6	+	5	1069	c.549C>A	c.(547-549)gcC>gcA	p.A183A		NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	183						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						GTGGAAATGCCCTGACTGCAA	0.398																																					p.A183A		Atlas-SNP	.											.	EML6	85	.	0			c.C549A						PASS	.						126.0	106.0	112.0					2																	55054726		692	1591	2283	SO:0001819	synonymous_variant	400954	exon5			AAATGCCCTGACT		CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.549C>A	chr2.hg19:g.55054726C>A		76.0	0.0	.		94.0	40.0	.	NM_001039753	A8MUB5|B6ZDG7	Silent	SNP	ENST00000356458.6	hg19	CCDS46286.1																																																																																			.	.	.	none		0.398	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324997.3	XM_001725002	
ITPRIPL1	150771	hgsc.bcm.edu	37	2	96993651	96993651	+	Missense_Mutation	SNP	A	A	G	rs35855657	byFrequency	TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr2:96993651A>G	ENST00000439118.2	+	3	1533	c.1282A>G	c.(1282-1284)Agt>Ggt	p.S428G	ITPRIPL1_ENST00000536814.1_Missense_Mutation_p.S420G|ITPRIPL1_ENST00000542887.1_Missense_Mutation_p.S420G|ITPRIPL1_ENST00000361124.4_Missense_Mutation_p.S436G	NM_001008949.2	NP_001008949.1	Q6GPH6	IPIL1_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein-like 1	428			S -> C (in dbSNP:rs35855657).			integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GATCATTTTAAGTCTCCGGCA	0.557																																					p.S436G		Atlas-SNP	.											.	ITPRIPL1	58	.	0			c.A1306G						PASS	.						93.0	94.0	93.0					2																	96993651		2203	4300	6503	SO:0001583	missense	150771	exon1			ATTTTAAGTCTCC		CCDS33250.1, CCDS46360.1, CCDS54378.1	2q11.2	2011-04-28	2011-04-28	2008-08-11	ENSG00000198885	ENSG00000198885			29371	protein-coding gene	gene with protein product			"""KIAA1754-like"", ""inositol 1,4,5-triphosphate receptor interacting protein-like 1"""	KIAA1754L		12477932	Standard	NM_178495		Approved		uc010yul.2	Q6GPH6	OTTHUMG00000155230	ENST00000439118.2:c.1282A>G	chr2.hg19:g.96993651A>G	ENSP00000389308:p.Ser428Gly	91.0	0.0	.		93.0	35.0	.	NM_178495	F5H1L8|Q8NE61	Missense_Mutation	SNP	ENST00000439118.2	hg19	CCDS46360.1	.	.	.	.	.	.	.	.	.	.	A	14.17	2.456320	0.43634	.	.	ENSG00000198885	ENST00000536814;ENST00000439118;ENST00000361124;ENST00000542887	T;T;T;T	0.08458	3.09;3.09;3.09;3.09	5.5	4.29	0.51040	.	0.374013	0.22795	N	0.055547	T	0.04815	0.0130	N	0.03608	-0.345	0.29897	N	0.824686	P;P	0.43578	0.774;0.811	B;B	0.44315	0.318;0.446	T	0.08310	-1.0728	10	0.52906	T	0.07	-1.8867	8.2792	0.31889	0.7022:0.0:0.0:0.2977	.	436;428	Q6GPH6-2;Q6GPH6	.;IPIL1_HUMAN	G	420;428;436;420	ENSP00000439566:S420G;ENSP00000389308:S428G;ENSP00000355121:S436G;ENSP00000438212:S420G	ENSP00000355121:S436G	S	+	1	0	ITPRIPL1	96357378	1.000000	0.71417	0.981000	0.43875	0.824000	0.46624	4.036000	0.57304	2.308000	0.77769	0.533000	0.62120	AGT	.	A|0.643;T|0.357	.	alt		0.557	ITPRIPL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000338896.1	NM_178495	
CCNT2	905	hgsc.bcm.edu	37	2	135710229	135710229	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr2:135710229T>C	ENST00000264157.5	+	8	752	c.722T>C	c.(721-723)cTa>cCa	p.L241P	CCNT2_ENST00000537343.1_Missense_Mutation_p.L66P|CCNT2_ENST00000295238.6_Missense_Mutation_p.L241P	NM_001241.3|NM_058241.2	NP_001232.1|NP_490595.1	O60583	CCNT2_HUMAN	cyclin T2	241					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(2)|kidney(3)|large_intestine(10)|lung(6)|ovary(2)|prostate(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.107)		CATGAGTTTCTACAAATATTG	0.313																																					p.L241P		Atlas-SNP	.											.	CCNT2	98	.	0			c.T722C						PASS	.						63.0	69.0	67.0					2																	135710229		2203	4300	6503	SO:0001583	missense	905	exon8			AGTTTCTACAAAT	AF048731	CCDS2174.1, CCDS2175.1	2q21.3	2010-11-15			ENSG00000082258	ENSG00000082258			1600	protein-coding gene	gene with protein product		603862				9499409, 10465067	Standard	NM_001241		Approved		uc002tuc.2	O60583	OTTHUMG00000131712	ENST00000264157.5:c.722T>C	chr2.hg19:g.135710229T>C	ENSP00000264157:p.Leu241Pro	346.0	0.0	.		287.0	126.0	.	NM_058241	A8KA48|D3DP73|D3DP74|O60582|Q29R66|Q53SR4|Q5I1Y0	Missense_Mutation	SNP	ENST00000264157.5	hg19	CCDS2174.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.486977	0.84854	.	.	ENSG00000082258	ENST00000446247;ENST00000537343;ENST00000295238;ENST00000264157	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	5.7	5.7	0.88788	Cyclin-like (1);	0.000000	0.85682	D	0.000000	T	0.78566	0.4303	M	0.91612	3.225	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.991;0.996	D	0.83854	0.0264	10	0.87932	D	0	.	15.6442	0.77036	0.0:0.0:0.0:1.0	.	66;241;241	B4DH21;O60583;O60583-2	.;CCNT2_HUMAN;.	P	82;66;241;241	ENSP00000399497:L82P;ENSP00000439506:L66P;ENSP00000295238:L241P;ENSP00000264157:L241P	ENSP00000264157:L241P	L	+	2	0	CCNT2	135426699	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.281000	0.72632	2.167000	0.68274	0.528000	0.53228	CTA	.	.	.	none		0.313	CCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254629.1	NM_058241	
MUC13	56667	hgsc.bcm.edu	37	3	124632081	124632081	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr3:124632081C>T	ENST00000311075.3	-	8	1126	c.1088G>A	c.(1087-1089)aGt>aAt	p.S363N		NM_033049.3	NP_149038	Q9H3R2	MUC13_HUMAN	mucin 13, cell surface associated	364	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)|stomach(1)	18						ACACTTGAGACTGGAAGCTTC	0.468																																					p.S363N		Atlas-SNP	.											.	MUC13	57	.	0			c.G1088A						PASS	.						59.0	58.0	58.0					3																	124632081		2203	4300	6503	SO:0001583	missense	56667	exon8			TTGAGACTGGAAG	AF286113		3q21.2	2007-01-17	2006-03-14		ENSG00000173702	ENSG00000173702		"""Mucins"""	7511	protein-coding gene	gene with protein product		612181	"""down-regulated in colon cancer 1"", ""mucin 13, epithelial transmembrane"""	DRCC1		11278439	Standard	NM_033049		Approved		uc003ehq.2	Q9H3R2	OTTHUMG00000159484	ENST00000311075.3:c.1088G>A	chr3.hg19:g.124632081C>T	ENSP00000312235:p.Ser363Asn	84.0	0.0	.		112.0	28.0	.	NM_033049	Q6UWD9|Q9NXT5	Missense_Mutation	SNP	ENST00000311075.3	hg19		.	.	.	.	.	.	.	.	.	.	C	8.737	0.918083	0.17982	.	.	ENSG00000173702	ENST00000311075	D	0.87334	-2.24	2.5	-2.08	0.07254	.	3.688240	0.00702	N	0.000787	T	0.76948	0.4059	N	0.22421	0.69	0.09310	N	1	D	0.53885	0.963	P	0.44359	0.447	T	0.67465	-0.5664	10	0.17369	T	0.5	0.23	2.0258	0.03519	0.1747:0.2503:0.4354:0.1396	.	363	Q9H3R2	MUC13_HUMAN	N	363	ENSP00000312235:S363N	ENSP00000312235:S363N	S	-	2	0	MUC13	126114771	0.000000	0.05858	0.000000	0.03702	0.442000	0.32017	-0.169000	0.09911	-0.549000	0.06191	0.462000	0.41574	AGT	.	.	.	none		0.468	MUC13-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000355714.1	NM_033049	
ISY1	57461	hgsc.bcm.edu	37	3	128852942	128852942	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr3:128852942T>C	ENST00000393295.3	-	9	955	c.638A>G	c.(637-639)aAc>aGc	p.N213S	ISY1-RAB43_ENST00000418265.1_Missense_Mutation_p.N213S|ISY1_ENST00000273541.8_Missense_Mutation_p.N235S|ISY1_ENST00000393292.3_Silent_p.Q214Q|ISY1_ENST00000471497.1_Intron	NM_001199469.1|NM_020701.3	NP_001186398.1|NP_065752.1	Q9ULR0	ISY1_HUMAN	ISY1 splicing factor homolog (S. cerevisiae)	213					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|skin(1)	15						TGCATAGATGTTGATctcttc	0.542																																					p.N235S		Atlas-SNP	.											.	ISY1	36	.	0			c.A704G						PASS	.						117.0	122.0	120.0					3																	128852942		2055	4200	6255	SO:0001583	missense	57461	exon10			TAGATGTTGATCT		CCDS43149.1, CCDS56277.1	3q21.3	2008-11-25			ENSG00000240682	ENSG00000240682			29201	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 33"""	612764				16103217	Standard	NM_020701		Approved	KIAA1160, fSAP33		Q9ULR0	OTTHUMG00000137365	ENST00000393295.3:c.638A>G	chr3.hg19:g.128852942T>C	ENSP00000376973:p.Asn213Ser	57.0	0.0	.		92.0	54.0	.	NM_001199469	Q96IL2|Q9BT05	Missense_Mutation	SNP	ENST00000393295.3	hg19	CCDS43149.1	.	.	.	.	.	.	.	.	.	.	T	14.97	2.694987	0.48202	.	.	ENSG00000240682	ENST00000418265;ENST00000393295;ENST00000273541	T	0.30182	1.54	5.64	5.64	0.86602	.	0.211897	0.49916	D	0.000137	T	0.23054	0.0557	L	0.33485	1.01	0.80722	D	1	B;B;B	0.18610	0.016;0.02;0.029	B;B;B	0.23852	0.049;0.044;0.045	T	0.07443	-1.0772	10	0.11794	T	0.64	.	12.2414	0.54544	0.0:0.0:0.0:1.0	.	235;213;213	Q9ULR0-2;Q9ULR0;Q9ULR0-1	.;ISY1_HUMAN;.	S	213;213;235	ENSP00000273541:N235S	ENSP00000273541:N235S	N	-	2	0	ISY1	130335632	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.228000	0.58619	2.141000	0.66446	0.477000	0.44152	AAC	.	.	.	none		0.542	ISY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267856.1	NM_020701	
HTR3D	200909	hgsc.bcm.edu	37	3	183756384	183756384	+	Silent	SNP	C	C	T			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr3:183756384C>T	ENST00000382489.3	+	7	1107	c.1107C>T	c.(1105-1107)ggC>ggT	p.G369G	HTR3D_ENST00000453435.1_Silent_p.G148G|HTR3D_ENST00000334128.2_Silent_p.G194G|HTR3D_ENST00000428798.2_Silent_p.G319G	NM_001163646.1	NP_001157118.1	Q70Z44	5HT3D_HUMAN	5-hydroxytryptamine (serotonin) receptor 3D, ionotropic	369					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)	10	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Ergoloid mesylate(DB01049)	GAAATAAGGGCCCGGGTCTCA	0.657																																					p.G369G		Atlas-SNP	.											.	HTR3D	65	.	0			c.C1107T						PASS	.						27.0	32.0	30.0					3																	183756384		2202	4300	6502	SO:0001819	synonymous_variant	200909	exon7			TAAGGGCCCGGGT	AY159812	CCDS3249.1, CCDS46966.1, CCDS54685.1	3q27	2012-05-22	2012-02-03		ENSG00000186090	ENSG00000186090		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24004	protein-coding gene	gene with protein product		610122	"""5-hydroxytryptamine (serotonin) receptor 3 family member D"""			12801637	Standard	NM_001145143		Approved		uc011bqv.2	Q70Z44	OTTHUMG00000156858	ENST00000382489.3:c.1107C>T	chr3.hg19:g.183756384C>T		150.0	0.0	.		234.0	60.0	.	NM_001163646	C9J2I6|J3QT78|Q495N5|Q495N6|Q7Z6B3	Silent	SNP	ENST00000382489.3	hg19	CCDS54685.1																																																																																			.	.	.	none		0.657	HTR3D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346289.1	NM_182537	
FAM131A	131408	hgsc.bcm.edu	37	3	184062687	184062687	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr3:184062687C>A	ENST00000310585.4	+	3	2301	c.937C>A	c.(937-939)Caa>Aaa	p.Q313K	FAM131A_ENST00000453072.1_Missense_Mutation_p.Q259K|FAM131A_ENST00000340957.5_Missense_Mutation_p.Q259K|FAM131A_ENST00000450976.1_Missense_Mutation_p.Q259K|EIF2B5_ENST00000444495.1_Intron|FAM131A_ENST00000383847.2_Missense_Mutation_p.Q344K|FAM131A_ENST00000418281.1_Intron			Q6UXB0	F131A_HUMAN	family with sequence similarity 131, member A	313						extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(2)|lung(9)|skin(1)	14	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			ACGGCAGCGGCAAGCCTCTGA	0.632																																					p.Q344K		Atlas-SNP	.											.	FAM131A	37	.	0			c.C1030A						PASS	.						23.0	19.0	21.0					3																	184062687		2200	4298	6498	SO:0001583	missense	131408	exon6			CAGCGGCAAGCCT	BC026221	CCDS3262.1, CCDS3262.2, CCDS54689.1	3q27.1	2007-03-20	2007-03-20	2007-03-20	ENSG00000175182	ENSG00000175182			28308	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 40"""	C3orf40		12975309	Standard	NM_144635		Approved	MGC21688	uc003foe.3	Q6UXB0	OTTHUMG00000156206	ENST00000310585.4:c.937C>A	chr3.hg19:g.184062687C>A	ENSP00000310135:p.Gln313Lys	59.0	0.0	.		90.0	46.0	.	NM_144635	D3DNT6|G5E9B1|Q8TA84	Missense_Mutation	SNP	ENST00000310585.4	hg19		.	.	.	.	.	.	.	.	.	.	c	0.020	-1.434094	0.01108	.	.	ENSG00000175182	ENST00000450976;ENST00000340957;ENST00000383847;ENST00000453072;ENST00000310585	T;T;T;T;T	0.19394	2.15;2.15;2.15;2.15;2.15	4.63	2.58	0.30949	.	0.322570	0.28600	N	0.014777	T	0.06005	0.0156	N	0.01505	-0.83	0.31769	N	0.632341	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.26710	-1.0095	10	0.02654	T	1	-26.278	11.3787	0.49743	0.4075:0.5925:0.0:0.0	.	313;344	Q6UXB0;G5E9B1	F131A_HUMAN;.	K	259;259;344;259;313	ENSP00000388551:Q259K;ENSP00000340974:Q259K;ENSP00000373360:Q344K;ENSP00000390588:Q259K;ENSP00000310135:Q313K	ENSP00000310135:Q313K	Q	+	1	0	FAM131A	185545381	1.000000	0.71417	0.998000	0.56505	0.290000	0.27261	6.309000	0.72825	2.122000	0.65172	0.591000	0.81541	CAA	.	.	.	none		0.632	FAM131A-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000343462.1	NM_144635	
IDUA	3425	hgsc.bcm.edu	37	4	995927	995927	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr4:995927C>T	ENST00000247933.4	+	7	1038	c.950C>T	c.(949-951)aCc>aTc	p.T317I	IDUA_ENST00000453894.1_Silent_p.D303D|IDUA_ENST00000514224.1_Missense_Mutation_p.T185I	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	317					carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GCGGACGTGACCTACGCGGCC	0.726																																					p.T317I		Atlas-SNP	.											.	IDUA	33	.	0			c.C950T						PASS	.						17.0	19.0	18.0					4																	995927		2143	4218	6361	SO:0001583	missense	3425	exon7			ACGTGACCTACGC	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.950C>T	chr4.hg19:g.995927C>T	ENSP00000247933:p.Thr317Ile	107.0	0.0	.		120.0	55.0	.	NM_000203	B3KWK6	Missense_Mutation	SNP	ENST00000247933.4	hg19	CCDS3343.1	.	.	.	.	.	.	.	.	.	.	C	17.69	3.451756	0.63290	.	.	ENSG00000127415	ENST00000247933;ENST00000514224	D;D	0.95035	-3.59;-3.59	4.91	4.91	0.64330	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.96821	0.8962	M	0.79805	2.47	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.95631	0.8689	10	0.22706	T	0.39	.	15.936	0.79707	0.0:1.0:0.0:0.0	.	317	P35475	IDUA_HUMAN	I	317;185	ENSP00000247933:T317I;ENSP00000425081:T185I	ENSP00000247933:T317I	T	+	2	0	IDUA	985927	1.000000	0.71417	0.993000	0.49108	0.033000	0.12548	4.700000	0.61803	2.450000	0.82876	0.561000	0.74099	ACC	.	.	.	none		0.726	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000201812.1	NM_000203	
HTT	3064	hgsc.bcm.edu	37	4	3076668	3076668	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr4:3076668C>A	ENST00000355072.5	+	1	261	c.116C>A	c.(115-117)cCg>cAg	p.P39Q	HTT-AS_ENST00000503893.1_RNA	NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	39	Poly-Pro.				anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		cagcaacagccgccaccgccg	0.726																																					p.P39Q		Atlas-SNP	.											.	HTT	221	.	0			c.C116A						PASS	.						1.0	2.0	2.0					4																	3076668		374	1244	1618	SO:0001583	missense	3064	exon1			AACAGCCGCCACC	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.116C>A	chr4.hg19:g.3076668C>A	ENSP00000347184:p.Pro39Gln	11.0	0.0	.		16.0	4.0	.	NM_002111	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	hg19	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	C	0.023	-1.397978	0.01175	.	.	ENSG00000197386	ENST00000355072	T	0.22743	1.94	1.58	1.58	0.23477	.	.	.	.	.	T	0.12518	0.0304	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.25710	-1.0124	9	0.32370	T	0.25	.	6.4693	0.21999	0.0:1.0:0.0:0.0	.	39	P42858	HD_HUMAN	Q	39	ENSP00000347184:P39Q	ENSP00000347184:P39Q	P	+	2	0	HTT	3046466	0.949000	0.32298	0.001000	0.08648	0.004000	0.04260	0.435000	0.21510	0.829000	0.34733	0.305000	0.20034	CCG	.	.	.	none		0.726	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
SPINK5	11005	hgsc.bcm.edu	37	5	147484531	147484531	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr5:147484531G>A	ENST00000256084.7	+	16	1489	c.1447G>A	c.(1447-1449)Gca>Aca	p.A483T	SPINK5_ENST00000359874.3_Missense_Mutation_p.A483T|SPINK5_ENST00000398454.1_Missense_Mutation_p.A483T	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	483	Kazal-like 7. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAAGAAAGAGCAAGAGCAAA	0.358																																					p.A483T		Atlas-SNP	.											.	SPINK5	245	.	0			c.G1447A						PASS	.						90.0	91.0	90.0					5																	147484531		1808	4088	5896	SO:0001583	missense	11005	exon16			GAAAGAGCAAGAG	AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.1447G>A	chr5.hg19:g.147484531G>A	ENSP00000256084:p.Ala483Thr	332.0	1.0	.		323.0	146.0	.	NM_001127699	A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	ENST00000256084.7	hg19	CCDS43382.1	.	.	.	.	.	.	.	.	.	.	G	15.03	2.712874	0.48517	.	.	ENSG00000133710	ENST00000398454;ENST00000359874;ENST00000508733;ENST00000256084	T;T;T;T	0.03889	3.77;3.77;3.77;3.77	3.91	0.0124	0.14091	Proteinase inhibitor I1, Kazal (1);Protease inhibitor, Kazal-type (1);	0.480204	0.17596	N	0.168583	T	0.08492	0.0211	L	0.44542	1.39	0.23107	N	0.998281	D;P;D;D	0.76494	0.999;0.911;0.997;0.998	D;P;D;D	0.79108	0.992;0.55;0.98;0.966	T	0.30119	-0.9989	10	0.13108	T	0.6	-3.4513	3.0931	0.06301	0.3199:0.0:0.4907:0.1894	.	464;483;483;483	B4DWS3;Q9NQ38-3;Q9NQ38;Q9NQ38-2	.;.;ISK5_HUMAN;.	T	483;483;464;483	ENSP00000381472:A483T;ENSP00000352936:A483T;ENSP00000421519:A464T;ENSP00000256084:A483T	ENSP00000256084:A483T	A	+	1	0	SPINK5	147464724	1.000000	0.71417	0.925000	0.36789	0.678000	0.39670	1.527000	0.35975	-0.013000	0.14199	0.313000	0.20887	GCA	.	.	.	none		0.358	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000259215.2	NM_001127698	
SLU7	10569	hgsc.bcm.edu	37	5	159831848	159831848	+	Nonsense_Mutation	SNP	C	C	A			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr5:159831848C>A	ENST00000297151.4	-	14	1819	c.1432G>T	c.(1432-1434)Gaa>Taa	p.E478*		NM_006425.4	NP_006416.3	O95391	SLU7_HUMAN	SLU7 splicing factor homolog (S. cerevisiae)	478					alternative mRNA splicing, via spliceosome (GO:0000380)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)	pre-mRNA 3'-splice site binding (GO:0030628)|second spliceosomal transesterification activity (GO:0000386)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(4)|lung(6)|ovary(1)	20	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTCACAGATTCTTCCCCAGTT	0.378																																					p.E478X		Atlas-SNP	.											.	SLU7	35	.	0			c.G1432T						PASS	.						73.0	72.0	72.0					5																	159831848		2202	4300	6502	SO:0001587	stop_gained	10569	exon14			CAGATTCTTCCCC	AF101074	CCDS4352.1	5q33.3	2010-04-13			ENSG00000164609	ENSG00000164609			16939	protein-coding gene	gene with protein product	zinc knuckle motif containing	605974				10197984, 15728250	Standard	NM_006425		Approved	9G8	uc003lyg.3	O95391	OTTHUMG00000130324	ENST00000297151.4:c.1432G>T	chr5.hg19:g.159831848C>A	ENSP00000297151:p.Glu478*	74.0	0.0	.		94.0	36.0	.	NM_006425	D3DQK2|Q3LUJ0|Q3LUJ1|Q6RXQ5|Q96FM9	Nonsense_Mutation	SNP	ENST00000297151.4	hg19	CCDS4352.1	.	.	.	.	.	.	.	.	.	.	C	39	7.866543	0.98534	.	.	ENSG00000164609	ENST00000297151	.	.	.	5.68	4.81	0.61882	.	0.163071	0.53938	D	0.000051	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-1.6375	15.3992	0.74823	0.0:0.8614:0.1385:0.0	.	.	.	.	X	478	.	ENSP00000297151:E478X	E	-	1	0	SLU7	159764426	1.000000	0.71417	0.968000	0.41197	0.313000	0.28021	4.521000	0.60532	1.522000	0.49001	0.591000	0.81541	GAA	.	.	.	none		0.378	SLU7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252673.1	NM_006425	
F12	2161	hgsc.bcm.edu	37	5	176831333	176831333	+	Silent	SNP	C	C	T			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr5:176831333C>T	ENST00000253496.3	-	9	930	c.882G>A	c.(880-882)caG>caA	p.Q294Q	F12_ENST00000514943.1_5'Flank	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	294	Kringle. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)	p.Q294H(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	GGGTCTGGCACTGTGCCAGGT	0.692									Hereditary Angioedema		OREG0017088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q294Q		Atlas-SNP	.											F12,NS,carcinoma,0,1	F12	35	.	1	Substitution - Missense(1)	kidney(1)	c.G882A						PASS	.						17.0	21.0	20.0					5																	176831333		2200	4295	6495	SO:0001819	synonymous_variant	2161	exon9	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	CTGGCACTGTGCC	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.882G>A	chr5.hg19:g.176831333C>T		204.0	0.0	.	1934	160.0	81.0	.	NM_000505	P78339	Silent	SNP	ENST00000253496.3	hg19	CCDS34302.1																																																																																			.	.	.	none		0.692	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373217.1		
SCGN	10590	hgsc.bcm.edu	37	6	25665199	25665199	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr6:25665199A>C	ENST00000377961.2	+	4	443	c.275A>C	c.(274-276)gAa>gCa	p.E92A	SCGN_ENST00000334979.6_3'UTR	NM_006998.3	NP_008929.2	O76038	SEGN_HUMAN	secretagogin, EF-hand calcium binding protein	92	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						TCTGAGGATGAAAACTTTCTT	0.478																																					p.E92A		Atlas-SNP	.											.	SCGN	57	.	0			c.A275C						PASS	.						161.0	140.0	147.0					6																	25665199		2203	4300	6503	SO:0001583	missense	10590	exon4			AGGATGAAAACTT	BC000336	CCDS4561.1	6p22.3-p22.1	2013-01-10			ENSG00000079689	ENSG00000079689		"""EF-hand domain containing"""	16941	protein-coding gene	gene with protein product	"""calbindin-like"""	609202				10811645	Standard	NM_006998		Approved	SECRET, DJ501N12.8, SEGN, CALBL	uc003nfb.3	O76038	OTTHUMG00000014409	ENST00000377961.2:c.275A>C	chr6.hg19:g.25665199A>C	ENSP00000367197:p.Glu92Ala	33.0	0.0	.		40.0	15.0	.	NM_006998	A8K0B2|Q5VV44|Q96QV7|Q9UJF6	Missense_Mutation	SNP	ENST00000377961.2	hg19	CCDS4561.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.147340	0.77888	.	.	ENSG00000079689	ENST00000377961	D	0.88431	-2.38	5.19	5.19	0.71726	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.92977	0.7765	M	0.78344	2.41	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94009	0.7282	10	0.72032	D	0.01	.	14.0409	0.64674	1.0:0.0:0.0:0.0	.	92	O76038	SEGN_HUMAN	A	92	ENSP00000367197:E92A	ENSP00000367197:E92A	E	+	2	0	SCGN	25773178	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.810000	0.75216	1.938000	0.56188	0.528000	0.53228	GAA	.	.	.	none		0.478	SCGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040067.1		
HIST1H2AD	3013	hgsc.bcm.edu	37	6	26199103	26199103	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr6:26199103A>C	ENST00000341023.1	-	1	368	c.369T>G	c.(367-369)agT>agG	p.S123R	HIST1H3D_ENST00000356476.2_5'Flank|HIST1H3D_ENST00000377831.5_5'UTR|HIST1H2BF_ENST00000359985.1_5'Flank	NM_021065.2	NP_066409.1	P20671	H2A1D_HUMAN	histone cluster 1, H2ad	123						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6		all_hematologic(11;0.196)				CCTTGTGGTGACTCTCAGTCT	0.478																																					p.S123R		Atlas-SNP	.											.	HIST1H2AD	20	.	0			c.T369G						PASS	.						117.0	103.0	107.0					6																	26199103		2203	4300	6503	SO:0001583	missense	3013	exon1			GTGGTGACTCTCA	Z80776	CCDS4591.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196866	ENSG00000196866		"""Histones / Replication-dependent"""	4729	protein-coding gene	gene with protein product		602792	"""H2A histone family, member G"", ""histone 1, H2ad"""	H2AFG		9119399, 12408966	Standard	NM_021065		Approved	H2A/g, H2A.3	uc003ngw.4	P20671	OTTHUMG00000014437	ENST00000341023.1:c.369T>G	chr6.hg19:g.26199103A>C	ENSP00000341094:p.Ser123Arg	151.0	0.0	.		131.0	58.0	.	NM_021065	A0PK91|P57754|Q6FGY6	Missense_Mutation	SNP	ENST00000341023.1	hg19	CCDS4591.1	.	.	.	.	.	.	.	.	.	.	.	5.438	0.265913	0.10294	.	.	ENSG00000196866	ENST00000341023	T	0.40756	1.02	4.5	0.596	0.17496	Histone-fold (2);Histone H2A (1);	0.000000	0.51477	U	0.000097	T	0.08492	0.0211	N	0.10916	0.065	0.24754	N	0.992963	B	0.06786	0.001	B	0.04013	0.001	T	0.30765	-0.9967	10	0.51188	T	0.08	.	9.3362	0.38051	0.4304:0.0:0.5696:0.0	.	123	P20671	H2A1D_HUMAN	R	123	ENSP00000341094:S123R	ENSP00000341094:S123R	S	-	3	2	HIST1H2AD	26307082	0.996000	0.38824	0.997000	0.53966	0.146000	0.21551	0.211000	0.17474	-0.102000	0.12197	-0.726000	0.03593	AGT	.	.	.	none		0.478	HIST1H2AD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040100.1	NM_021065	
HSD17B8	7923	hgsc.bcm.edu	37	6	33173455	33173455	+	Silent	SNP	G	G	A			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr6:33173455G>A	ENST00000374662.3	+	5	546	c.519G>A	c.(517-519)aaG>aaA	p.K173K	RING1_ENST00000374656.4_5'Flank|HSD17B8_ENST00000469186.1_3'UTR|MIR219-1_ENST00000362166.1_RNA	NM_014234.4	NP_055049.1	Q92506	DHB8_HUMAN	hydroxysteroid (17-beta) dehydrogenase 8	173					androgen metabolic process (GO:0008209)|estrogen biosynthetic process (GO:0006703)|fatty acid biosynthetic process (GO:0006633)	mitochondrial envelope (GO:0005740)|mitochondrial matrix (GO:0005759)|plasma membrane (GO:0005886)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|estradiol 17-beta-dehydrogenase activity (GO:0004303)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(2)	9						CAGCATCCAAGGCTGGAGTGA	0.587																																					p.K173K		Atlas-SNP	.											.	HSD17B8	20	.	0			c.G519A						PASS	.						46.0	47.0	47.0					6																	33173455		1508	2707	4215	SO:0001819	synonymous_variant	7923	exon5			ATCCAAGGCTGGA	D82061	CCDS4769.1	6p21.3	2011-09-14	2002-02-19	2002-02-22	ENSG00000204228	ENSG00000204228	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	3554	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 30C, member 1"""	601417	"""FabG (beta-ketoacyl-[acyl-carrier-protein] reductase, E coli) like (E. coli)"""	FABGL		8812499, 19027726	Standard	NM_014234		Approved	HKE6, D6S2245E, RING2, KE6, H2-KE6, SDR30C1	uc003odi.2	Q92506	OTTHUMG00000031117	ENST00000374662.3:c.519G>A	chr6.hg19:g.33173455G>A		80.0	0.0	.		101.0	42.0	.	NM_014234	A6NLX7|Q5STP7|Q9UIQ1	Silent	SNP	ENST00000374662.3	hg19	CCDS4769.1																																																																																			.	.	.	none		0.587	HSD17B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076196.1	NM_014234	
SYNE1	23345	hgsc.bcm.edu	37	6	152462387	152462387	+	Silent	SNP	C	C	T			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr6:152462387C>T	ENST00000367255.5	-	139	25798	c.25197G>A	c.(25195-25197)gaG>gaA	p.E8399E	SYNE1_ENST00000356820.4_Silent_p.E2923E|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000448038.1_Silent_p.E8351E|SYNE1_ENST00000354674.4_Silent_p.E577E|SYNE1_ENST00000423061.1_Silent_p.E8351E|SYNE1_ENST00000539504.1_Silent_p.E554E|SYNE1_ENST00000341594.5_Silent_p.E8011E|SYNE1_ENST00000265368.4_Silent_p.E8399E	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8399					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CAGGAAGGCTCTCCTCTTCCT	0.478										HNSCC(10;0.0054)																											p.E8399E		Atlas-SNP	.											.	SYNE1	3227	.	0			c.G25197A						PASS	.						180.0	152.0	162.0					6																	152462387		2203	4300	6503	SO:0001819	synonymous_variant	23345	exon139			AAGGCTCTCCTCT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.25197G>A	chr6.hg19:g.152462387C>T		92.0	0.0	.		82.0	36.0	.	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	hg19	CCDS5236.2																																																																																			.	.	.	none		0.478	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SSPO	23145	hgsc.bcm.edu	37	7	149499004	149499004	+	RNA	SNP	C	C	T	rs376985175		TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr7:149499004C>T	ENST00000378016.2	+	0	7456							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CTGTGACCTGCGGCCTGACTG	0.687													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17106	0.0		0.0	False		,,,				2504	0.0				p.R2486W		Atlas-SNP	.											.	.	.	.	0			c.C7456T						PASS	.	C		1,4285		0,1,2142	26.0	28.0	27.0		7460	3.5	0.0	7		27	0,8482		0,0,4241	no	coding-notMod3	SSPO	NM_198455.2		0,1,6383	TT,TC,CC		0.0,0.0233,0.0078			149499004	1,12767	2143	4241	6384			23145	exon50			GACCTGCGGCCTG	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		chr7.hg19:g.149499004C>T		40.0	0.0	.		70.0	27.0	.	NM_198455	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	hg19																																																																																				.	.	.	weak		0.687	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
FPGS	2356	hgsc.bcm.edu	37	9	130570589	130570589	+	Splice_Site	SNP	C	C	A			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr9:130570589C>A	ENST00000373247.2	+	9	871	c.821C>A	c.(820-822)tCa>tAa	p.S274*	FPGS_ENST00000373225.3_Splice_Site_p.S224*|FPGS_ENST00000393706.2_Splice_Site_p.S248*|FPGS_ENST00000460181.1_3'UTR|FPGS_ENST00000373245.1_Splice_Site_p.S274*	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	274					brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	CAGCAGATCTCAGTAAGTCTG	0.592																																					p.S274X		Atlas-SNP	.											.	FPGS	30	.	0			c.C821A						PASS	.						84.0	76.0	79.0					9																	130570589		2203	4300	6503	SO:0001630	splice_region_variant	2356	exon9			AGATCTCAGTAAG		CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.822+1C>A	chr9.hg19:g.130570589C>A		52.0	0.0	.		48.0	18.0	.	NM_004957	B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Nonsense_Mutation	SNP	ENST00000373247.2	hg19	CCDS35148.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.709436	0.89018	.	.	ENSG00000136877	ENST00000373247;ENST00000373245;ENST00000393706;ENST00000373228;ENST00000373225;ENST00000431857	.	.	.	5.06	3.12	0.35913	.	0.769059	0.12103	N	0.499303	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-8.0083	4.8255	0.13414	0.1505:0.62:0.1462:0.0833	.	.	.	.	X	274;274;248;274;224;224	.	ENSP00000362322:S224X	S	+	2	0	FPGS	129610410	0.000000	0.05858	0.996000	0.52242	0.900000	0.52787	0.615000	0.24329	1.084000	0.41184	0.462000	0.41574	TCA	.	.	.	none		0.592	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054251.1		Nonsense_Mutation
PRKG1	5592	hgsc.bcm.edu	37	10	54053646	54053646	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr10:54053646G>T	ENST00000401604.2	+	18	2196	c.2002G>T	c.(2002-2004)Gat>Tat	p.D668Y	PRKG1_ENST00000373985.1_Missense_Mutation_p.D656Y|PRKG1_ENST00000373975.2_Missense_Mutation_p.D386Y|PRKG1-AS1_ENST00000452247.2_RNA|PRKG1_ENST00000373980.4_Missense_Mutation_p.D683Y|PRKG1-AS1_ENST00000426785.2_RNA			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	668	AGC-kinase C-terminal.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		CTCAGGATGGGATATAGACTT	0.443																																					p.D683Y		Atlas-SNP	.											.	PRKG1	167	.	0			c.G2047T						PASS	.						153.0	136.0	142.0					10																	54053646		2203	4300	6503	SO:0001583	missense	5592	exon18			GGATGGGATATAG		CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.2002G>T	chr10.hg19:g.54053646G>T	ENSP00000384200:p.Asp668Tyr	69.0	0.0	.		70.0	34.0	.	NM_006258	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Missense_Mutation	SNP	ENST00000401604.2	hg19	CCDS44399.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.976705	0.74360	.	.	ENSG00000185532	ENST00000401604;ENST00000373985;ENST00000373980;ENST00000332193;ENST00000373975	T;T;T	0.72835	-0.69;-0.68;-0.69	5.99	5.99	0.97316	AGC-kinase, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.87653	0.6231	M	0.89163	3.01	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.88702	0.3216	10	0.87932	D	0	-21.0641	20.0728	0.97731	0.0:0.0:1.0:0.0	.	386;683;668	B3KSF3;Q13976-2;Q13976	.;.;KGP1_HUMAN	Y	668;656;683;386;280	ENSP00000384200:D668Y;ENSP00000363097:D656Y;ENSP00000363092:D683Y	ENSP00000327642:D386Y	D	+	1	0	PRKG1	53723652	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.840000	0.97914	0.655000	0.94253	GAT	.	.	.	none		0.443	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
SMPD1	6609	hgsc.bcm.edu	37	11	6411941	6411941	+	Missense_Mutation	SNP	C	C	T	rs550365194|rs550067660|rs71467507|rs78250081|rs558809956|rs3838786	byFrequency	TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr11:6411941C>T	ENST00000342245.4	+	1	281	c.113C>T	c.(112-114)gCg>gTg	p.A38V	SMPD1_ENST00000527275.1_Missense_Mutation_p.A38V|SMPD1_ENST00000533196.1_3'UTR|SMPD1_ENST00000356761.2_Missense_Mutation_p.A38V|SMPD1_ENST00000299397.3_Missense_Mutation_p.A38V	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	38					cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	ctggtgctggcgctggcgctg	0.711																																					p.A38V		Atlas-SNP	.											.	SMPD1	108	.	0			c.C113T						PASS	.						11.0	14.0	13.0					11																	6411941		2185	4258	6443	SO:0001583	missense	6609	exon1			TGCTGGCGCTGGC	AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.113C>T	chr11.hg19:g.6411941C>T	ENSP00000340409:p.Ala38Val	74.0	0.0	.		102.0	11.0	.	NM_000543	A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	Missense_Mutation	SNP	ENST00000342245.4	hg19	CCDS44531.1	.	.	.	.	.	.	.	.	.	.	C	13.43	2.234305	0.39498	.	.	ENSG00000166311	ENST00000299397;ENST00000356761;ENST00000342245;ENST00000527275	T;T;T;T	0.09723	2.95;2.95;2.95;2.95	4.54	-1.08	0.09936	.	.	.	.	.	T	0.04363	0.0120	N	0.08118	0	0.09310	N	1	B;B	0.15473	0.002;0.013	B;B	0.10450	0.002;0.005	T	0.47275	-0.9130	9	0.12103	T	0.63	.	6.8659	0.24093	0.0:0.5614:0.262:0.1766	.	38;38	E9PKS3;G3XAB5	.;.	V	38	ENSP00000299397:A38V;ENSP00000349203:A38V;ENSP00000340409:A38V;ENSP00000435350:A38V	ENSP00000299397:A38V	A	+	2	0	SMPD1	6368517	0.000000	0.05858	0.130000	0.21974	0.033000	0.12548	-2.110000	0.01334	-0.479000	0.06813	-1.305000	0.01319	GCG	.	.	.	weak		0.711	SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384205.1	NM_000543	
PLEKHA7	144100	hgsc.bcm.edu	37	11	16816490	16816490	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr11:16816490A>G	ENST00000355661.3	-	18	2495	c.2485T>C	c.(2485-2487)Ttc>Ctc	p.F829L	PLEKHA7_ENST00000532079.1_Intron|PLEKHA7_ENST00000531066.1_Missense_Mutation_p.F829L|PLEKHA7_ENST00000448080.2_Missense_Mutation_p.F829L			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	829					epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						AGAATTCTGAAGTTCTCTTTA	0.483																																					p.F829L		Atlas-SNP	.											.	PLEKHA7	120	.	0			c.T2485C						PASS	.						197.0	190.0	193.0					11																	16816490		2200	4294	6494	SO:0001583	missense	144100	exon18			TTCTGAAGTTCTC	BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.2485T>C	chr11.hg19:g.16816490A>G	ENSP00000347883:p.Phe829Leu	77.0	0.0	.		94.0	42.0	.	NM_175058	B4DK33|B4DWC3|Q86VZ7	Missense_Mutation	SNP	ENST00000355661.3	hg19	CCDS31434.1	.	.	.	.	.	.	.	.	.	.	A	15.76	2.928012	0.52759	.	.	ENSG00000166689	ENST00000531066;ENST00000355661;ENST00000448080	T;T;T	0.17370	2.28;2.28;2.28	5.57	5.57	0.84162	.	0.210963	0.50627	D	0.000109	T	0.16471	0.0396	L	0.42245	1.32	0.41172	D	0.986176	B;B;B;B	0.20368	0.026;0.031;0.044;0.043	B;B;B;B	0.24541	0.036;0.05;0.024;0.054	T	0.06844	-1.0804	10	0.10636	T	0.68	-10.738	16.0108	0.80402	1.0:0.0:0.0:0.0	.	403;829;829;829	Q6IQ23-3;E9PKC0;Q6IQ23;Q6IQ23-2	.;.;PKHA7_HUMAN;.	L	829	ENSP00000435389:F829L;ENSP00000347883:F829L;ENSP00000416895:F829L	ENSP00000347883:F829L	F	-	1	0	PLEKHA7	16773066	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	8.870000	0.92336	2.242000	0.73789	0.482000	0.46254	TTC	.	.	.	none		0.483	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000387242.2	NM_175058	
ARFGAP2	84364	hgsc.bcm.edu	37	11	47198367	47198367	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr11:47198367A>G	ENST00000524782.1	-	1	266	c.38T>C	c.(37-39)cTt>cCt	p.L13P	ARFGAP2_ENST00000319543.6_5'UTR|ARFGAP2_ENST00000419701.2_5'UTR|ARFGAP2_ENST00000426335.2_Missense_Mutation_p.L13P|ARFGAP2_ENST00000395449.3_5'UTR	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2	13	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						CCTCTTAAAAAGAGTCTGGAT	0.652																																					p.L13P		Atlas-SNP	.											.	ARFGAP2	43	.	0			c.T38C						PASS	.						52.0	55.0	54.0					11																	47198367		2201	4298	6499	SO:0001583	missense	84364	exon1			TTAAAAAGAGTCT	AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773	ENST00000524782.1:c.38T>C	chr11.hg19:g.47198367A>G	ENSP00000434442:p.Leu13Pro	57.0	0.0	.		79.0	40.0	.	NM_001242832	B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	Missense_Mutation	SNP	ENST00000524782.1	hg19	CCDS7926.1	.	.	.	.	.	.	.	.	.	.	A	32	5.139315	0.94560	.	.	ENSG00000149182	ENST00000426335;ENST00000524782;ENST00000526342;ENST00000527927;ENST00000525398;ENST00000525314;ENST00000528444;ENST00000530596	T;T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86	5.54	5.54	0.83059	.	0.251453	0.32533	N	0.005971	T	0.60996	0.2312	L	0.39467	1.215	0.80722	D	1	D;D;D;P	0.76494	0.998;0.999;0.999;0.874	D;D;D;P	0.76575	0.969;0.985;0.988;0.756	T	0.64283	-0.6444	10	0.87932	D	0	-3.7774	15.6714	0.77279	1.0:0.0:0.0:0.0	.	13;13;13;13	B7Z6H9;B3KV00;G5E9L0;Q8N6H7	.;.;.;ARFG2_HUMAN	P	13	ENSP00000400226:L13P;ENSP00000434442:L13P;ENSP00000437305:L13P;ENSP00000434433:L13P;ENSP00000431939:L13P;ENSP00000434809:L13P;ENSP00000431684:L13P;ENSP00000435488:L13P	ENSP00000400226:L13P	L	-	2	0	ARFGAP2	47154943	0.987000	0.35691	0.974000	0.42286	0.983000	0.72400	6.783000	0.75078	2.107000	0.64212	0.459000	0.35465	CTT	.	.	.	none		0.652	ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391425.1	NM_032389	
BCL9L	283149	hgsc.bcm.edu	37	11	118772132	118772132	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr11:118772132T>C	ENST00000334801.3	-	6	3284	c.2320A>G	c.(2320-2322)Atg>Gtg	p.M774V	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	774	Met-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)			NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		ttgacattcatgttcatgttG	0.597																																					p.M774V		Atlas-SNP	.											.	BCL9L	254	.	0			c.A2320G						PASS	.						170.0	97.0	122.0					11																	118772132		2200	4294	6494	SO:0001583	missense	283149	exon6			CATTCATGTTCAT	AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.2320A>G	chr11.hg19:g.118772132T>C	ENSP00000335320:p.Met774Val	34.0	0.0	.		43.0	22.0	.	NM_182557	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Missense_Mutation	SNP	ENST00000334801.3	hg19	CCDS8403.1	.	.	.	.	.	.	.	.	.	.	T	12.07	1.827150	0.32329	.	.	ENSG00000186174	ENST00000334801;ENST00000526143;ENST00000525300;ENST00000392849;ENST00000431085	T	0.78364	-1.17	5.24	4.12	0.48240	.	0.000000	0.64402	D	0.000011	T	0.69967	0.3170	L	0.42245	1.32	0.41065	D	0.985405	P;B	0.36837	0.571;0.435	B;B	0.39503	0.301;0.158	T	0.68606	-0.5364	10	0.32370	T	0.25	-11.8278	10.1544	0.42814	0.0:0.0794:0.0:0.9206	.	769;774	Q86UU0-2;Q86UU0	.;BCL9L_HUMAN	V	774;737;67;774;774	ENSP00000335320:M774V	ENSP00000335320:M774V	M	-	1	0	BCL9L	118277342	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.585000	0.60977	1.974000	0.57490	0.379000	0.24179	ATG	.	.	.	none		0.597	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557	
NCAPD3	23310	hgsc.bcm.edu	37	11	134038058	134038058	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr11:134038058G>C	ENST00000534548.2	-	27	3470	c.3406C>G	c.(3406-3408)Ctg>Gtg	p.L1136V		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	1136					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CTGGCGTCCAGGTCCAGGGGT	0.493																																					p.L1136V		Atlas-SNP	.											.	NCAPD3	141	.	0			c.C3406G						PASS	.						89.0	80.0	83.0					11																	134038058		2201	4297	6498	SO:0001583	missense	23310	exon27			CGTCCAGGTCCAG	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.3406C>G	chr11.hg19:g.134038058G>C	ENSP00000433681:p.Leu1136Val	71.0	0.0	.		70.0	43.0	.	NM_015261	A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	hg19	CCDS31723.1	.	.	.	.	.	.	.	.	.	.	g	8.791	0.930650	0.18131	.	.	ENSG00000151503	ENST00000534548;ENST00000527944;ENST00000530396	T;T	0.41758	0.99;0.99	5.52	3.25	0.37280	Armadillo-type fold (1);	0.321794	0.43416	D	0.000563	T	0.18923	0.0454	N	0.03608	-0.345	0.80722	D	1	B;B	0.16802	0.012;0.019	B;B	0.21151	0.033;0.02	T	0.04029	-1.0983	10	0.30078	T	0.28	-16.907	8.1785	0.31296	0.0:0.0704:0.2849:0.6447	.	1136;196	P42695;Q96FA6	CNDD3_HUMAN;.	V	1136;41;172	ENSP00000433681:L1136V;ENSP00000435173:L172V	ENSP00000432532:L41V	L	-	1	2	NCAPD3	133543268	1.000000	0.71417	0.996000	0.52242	0.523000	0.34469	1.122000	0.31295	0.430000	0.26230	0.586000	0.80456	CTG	.	.	.	none		0.493	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	
KRT82	3888	hgsc.bcm.edu	37	12	52789833	52789833	+	Missense_Mutation	SNP	C	C	T	rs377127392		TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr12:52789833C>T	ENST00000257974.2	-	7	1329	c.1252G>A	c.(1252-1254)Gcc>Acc	p.A418T	RP3-416H24.4_ENST00000547174.1_RNA	NM_033033.3	NP_149022.3	Q9NSB4	KRT82_HUMAN	keratin 82	418	Coil 2.|Rod.					keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	29				BRCA - Breast invasive adenocarcinoma(357;0.193)		CTGTAGGTGGCGATCTCGATG	0.602																																					p.A418T		Atlas-SNP	.											.	KRT82	45	.	0			c.G1252A						PASS	.						80.0	74.0	76.0					12																	52789833		2203	4300	6503	SO:0001583	missense	3888	exon7			AGGTGGCGATCTC	Y19207	CCDS8826.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000161850		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6459	protein-coding gene	gene with protein product	"""hard keratin type II 2"""	601078	"""keratin, hair, basic, 2"""	KRTHB2		2431943, 16831889	Standard	NM_033033		Approved	Hb-2	uc001sai.1	Q9NSB4	OTTHUMG00000169636	ENST00000257974.2:c.1252G>A	chr12.hg19:g.52789833C>T	ENSP00000257974:p.Ala418Thr	91.0	0.0	.		76.0	32.0	.	NM_033033		Missense_Mutation	SNP	ENST00000257974.2	hg19	CCDS8826.1	.	.	.	.	.	.	.	.	.	.	C	35	5.503534	0.96371	.	.	ENSG00000161850	ENST00000257974	D	0.90900	-2.75	4.93	4.93	0.64822	Filament (1);Intermediate filament protein, conserved site (1);	0.000000	0.48767	D	0.000169	D	0.95255	0.8461	M	0.77616	2.38	0.51233	D	0.999916	D	0.89917	1.0	D	0.75484	0.986	D	0.95515	0.8589	10	0.66056	D	0.02	.	18.3396	0.90300	0.0:1.0:0.0:0.0	.	418	Q9NSB4	KRT82_HUMAN	T	418	ENSP00000257974:A418T	ENSP00000257974:A418T	A	-	1	0	KRT82	51076100	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.724000	0.68500	2.566000	0.86566	0.561000	0.74099	GCC	.	.	.	weak		0.602	KRT82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405189.1	NM_033033	
RDH5	5959	hgsc.bcm.edu	37	12	56115699	56115699	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr12:56115699A>C	ENST00000257895.5	+	3	689	c.537A>C	c.(535-537)aaA>aaC	p.K179N	RDH5_ENST00000548082.1_Missense_Mutation_p.K179N|RDH5_ENST00000553160.1_Intron|RP11-644F5.10_ENST00000550412.1_3'UTR|RDH5_ENST00000547072.1_Missense_Mutation_p.K82N	NM_001199771.1|NM_002905.3	NP_001186700.1|NP_002896.2	Q92781	RDH1_HUMAN	retinol dehydrogenase 5 (11-cis/9-cis)	179					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	cell body (GO:0044297)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	retinol dehydrogenase activity (GO:0004745)			breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|skin(1)	12					Vitamin A(DB00162)	GTGTCTCCAAATTTGGCCTGG	0.627																																					p.K179N		Atlas-SNP	.											.	RDH5	25	.	0			c.A537C						PASS	.						25.0	27.0	26.0					12																	56115699		2203	4300	6503	SO:0001583	missense	5959	exon3			CTCCAAATTTGGC	U89717	CCDS31829.1	12q13-q14	2013-06-03	2006-05-09			ENSG00000135437	1.1.1.105	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	9940	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 5"""	601617	"""retinol dehydrogenase 5 (11-cis and 9-cis)"""	RDH1		9115228, 8884265, 19027726	Standard	NM_002905		Approved	HSD17B9, SDR9C5	uc001shl.3	Q92781	OTTHUMG00000170126	ENST00000257895.5:c.537A>C	chr12.hg19:g.56115699A>C	ENSP00000257895:p.Lys179Asn	345.0	0.0	.		365.0	142.0	.	NM_001199771	O00179|Q8TAI2	Missense_Mutation	SNP	ENST00000257895.5	hg19	CCDS31829.1	.	.	.	.	.	.	.	.	.	.	A	14.75	2.627250	0.46944	.	.	ENSG00000135437	ENST00000547072;ENST00000257895;ENST00000548082	D;D;D	0.98958	-5.27;-5.27;-5.27	5.36	2.02	0.26589	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99339	0.9768	H	0.98466	4.24	0.51482	D	0.999926	D	0.89917	1.0	D	0.97110	1.0	D	0.98368	1.0552	10	0.87932	D	0	.	7.5049	0.27538	0.3471:0.0:0.6529:0.0	.	179	Q92781	RDH1_HUMAN	N	82;179;179	ENSP00000449927:K82N;ENSP00000257895:K179N;ENSP00000447128:K179N	ENSP00000257895:K179N	K	+	3	2	RDH5	54401966	1.000000	0.71417	1.000000	0.80357	0.057000	0.15508	1.727000	0.38095	0.738000	0.32606	-0.242000	0.12053	AAA	.	.	.	none		0.627	RDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407493.1	NM_002905	
PAN2	9924	hgsc.bcm.edu	37	12	56720417	56720417	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr12:56720417A>G	ENST00000425394.2	-	7	1622	c.1246T>C	c.(1246-1248)Tct>Cct	p.S416P	PAN2_ENST00000548043.1_Missense_Mutation_p.S416P|PAN2_ENST00000440411.3_Missense_Mutation_p.S416P|PAN2_ENST00000257931.5_Missense_Mutation_p.S416P	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	GCTGGAGCAGAGTTGGCAGCA	0.572																																					p.S416P		Atlas-SNP	.											.	PAN2	107	.	0			c.T1246C						PASS	.						42.0	37.0	39.0					12																	56720417		2203	4299	6502	SO:0001583	missense	9924	exon7			GAGCAGAGTTGGC	AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.1246T>C	chr12.hg19:g.56720417A>G	ENSP00000401721:p.Ser416Pro	131.0	0.0	.		127.0	53.0	.	NM_014871		Missense_Mutation	SNP	ENST00000425394.2	hg19	CCDS44922.1	.	.	.	.	.	.	.	.	.	.	A	14.28	2.488292	0.44249	.	.	ENSG00000135473	ENST00000425394;ENST00000440411;ENST00000257931;ENST00000548043	T;T;T;T	0.05717	3.4;3.4;3.4;3.4	5.08	3.91	0.45181	.	0.201660	0.45867	D	0.000336	T	0.05364	0.0142	N	0.17082	0.46	0.36821	D	0.886405	P;P;P	0.43885	0.82;0.727;0.733	B;B;B	0.43103	0.408;0.408;0.177	T	0.51116	-0.8746	10	0.34782	T	0.22	-11.6206	11.3926	0.49824	0.8479:0.152:0.0:0.0	.	416;416;416	Q504Q3-3;Q504Q3-2;Q504Q3	.;.;PAN2_HUMAN	P	416	ENSP00000401721:S416P;ENSP00000388231:S416P;ENSP00000257931:S416P;ENSP00000449861:S416P	ENSP00000257931:S416P	S	-	1	0	PAN2	55006684	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	2.711000	0.47177	1.033000	0.39918	0.477000	0.44152	TCT	.	.	.	none		0.572	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409024.1	NM_014871	
ATP5B	506	hgsc.bcm.edu	37	12	57033773	57033773	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr12:57033773C>A	ENST00000262030.3	-	8	1328	c.1278G>T	c.(1276-1278)aaG>aaT	p.K426N	ATP5B_ENST00000550162.1_5'UTR|ATP5B_ENST00000552919.1_Missense_Mutation_p.K415N	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	426					angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CCTGCAGGATCTTTTGCACCC	0.478																																					p.K426N		Atlas-SNP	.											.	ATP5B	48	.	0			c.G1278T						PASS	.						80.0	71.0	74.0					12																	57033773		2203	4300	6503	SO:0001583	missense	506	exon8			CAGGATCTTTTGC	M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.1278G>T	chr12.hg19:g.57033773C>A	ENSP00000262030:p.Lys426Asn	74.0	0.0	.		85.0	31.0	.	NM_001686	A8K4X0|Q14283	Missense_Mutation	SNP	ENST00000262030.3	hg19	CCDS8924.1	.	.	.	.	.	.	.	.	.	.	C	17.49	3.403225	0.62288	.	.	ENSG00000110955	ENST00000262030;ENST00000552919;ENST00000552104	T;T;T	0.76839	-1.05;-1.05;-1.05	5.77	2.93	0.34026	ATPase, F1/V1/A1 complex, alpha/beta subunit, C-terminal (2);ATPase, F1 complex beta subunit/V1 complex, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.79592	0.4472	M	0.82923	2.615	0.58432	D	0.999999	B	0.20368	0.044	B	0.29077	0.098	T	0.74393	-0.3680	10	0.72032	D	0.01	-20.7654	11.5714	0.50836	0.0:0.7302:0.0:0.2698	.	426	P06576	ATPB_HUMAN	N	426;415;129	ENSP00000262030:K426N;ENSP00000450297:K415N;ENSP00000450233:K129N	ENSP00000262030:K426N	K	-	3	2	ATP5B	55320040	0.994000	0.37717	0.999000	0.59377	0.958000	0.62258	0.429000	0.21412	0.086000	0.17137	-0.797000	0.03246	AAG	.	.	.	none		0.478	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1	NM_001686	
SCYL2	55681	hgsc.bcm.edu	37	12	100717393	100717393	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr12:100717393T>A	ENST00000360820.2	+	11	1923	c.1486T>A	c.(1486-1488)Tgt>Agt	p.C496S		NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	496					endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						TAAAAATGCTTGTCTACAAAC	0.308																																					p.C496S		Atlas-SNP	.											.	SCYL2	99	.	0			c.T1486A						PASS	.						83.0	79.0	81.0					12																	100717393		2203	4297	6500	SO:0001583	missense	55681	exon11			AATGCTTGTCTAC	AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.1486T>A	chr12.hg19:g.100717393T>A	ENSP00000354061:p.Cys496Ser	73.0	0.0	.		80.0	30.0	.	NM_017988	A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Missense_Mutation	SNP	ENST00000360820.2	hg19	CCDS9076.1	.	.	.	.	.	.	.	.	.	.	T	28.6	4.933340	0.92458	.	.	ENSG00000136021	ENST00000549687;ENST00000258506;ENST00000360820	T;T	0.32272	1.46;1.46	5.68	5.68	0.88126	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.54447	0.1859	M	0.78637	2.42	0.80722	D	1	D	0.59767	0.986	P	0.60886	0.88	T	0.58120	-0.7692	10	0.56958	D	0.05	.	16.2237	0.82280	0.0:0.0:0.0:1.0	.	496	Q6P3W7	SCYL2_HUMAN	S	496;323;496	ENSP00000448366:C496S;ENSP00000354061:C496S	ENSP00000258506:C323S	C	+	1	0	SCYL2	99241524	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.901000	0.87382	2.289000	0.77006	0.482000	0.46254	TGT	.	.	.	none		0.308	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408493.2	NM_017988	
HPD	3242	hgsc.bcm.edu	37	12	122295709	122295709	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr12:122295709A>G	ENST00000289004.4	-	3	82	c.47T>C	c.(46-48)tTc>tCc	p.F16S	HPD_ENST00000543163.1_5'UTR|RP11-7M8.2_ENST00000543848.1_RNA	NM_002150.2	NP_002141	P32754	HPPD_HUMAN	4-hydroxyphenylpyruvate dioxygenase	16					cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	4-hydroxyphenylpyruvate dioxygenase activity (GO:0003868)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|urinary_tract(1)	18	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000105)|Epithelial(86;0.000352)|BRCA - Breast invasive adenocarcinoma(302;0.225)	Nitisinone(DB00348)	GAAGTGGAGGAATCGGCCTCT	0.597																																					p.F16S		Atlas-SNP	.											.	HPD	46	.	0			c.T47C						PASS	.						61.0	55.0	57.0					12																	122295709		2203	4300	6503	SO:0001583	missense	3242	exon3			TGGAGGAATCGGC	BC014790	CCDS9224.1, CCDS53839.1	12q24.31	2013-09-19			ENSG00000158104	ENSG00000158104	1.13.11.27		5147	protein-coding gene	gene with protein product	"""glyoxalase domain containing 3"""	609695		PPD			Standard	NM_001171993		Approved	4-HPPD, 4HPPD, GLOD3	uc001ubj.3	P32754	OTTHUMG00000169081	ENST00000289004.4:c.47T>C	chr12.hg19:g.122295709A>G	ENSP00000289004:p.Phe16Ser	168.0	0.0	.		160.0	68.0	.	NM_002150	A8K461|B3KQ63|Q13234	Missense_Mutation	SNP	ENST00000289004.4	hg19	CCDS9224.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.002646	0.74932	.	.	ENSG00000158104	ENST00000289004;ENST00000545969	T	0.63417	-0.04	5.28	5.28	0.74379	.	0.200575	0.49916	D	0.000131	T	0.75583	0.3869	M	0.84082	2.675	0.80722	D	1	D	0.62365	0.991	P	0.59424	0.857	T	0.79225	-0.1891	10	0.72032	D	0.01	-30.6711	9.6882	0.40111	0.8256:0.1744:0.0:0.0	.	16	P32754	HPPD_HUMAN	S	16;13	ENSP00000289004:F16S	ENSP00000289004:F16S	F	-	2	0	HPD	120780092	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.648000	0.83479	2.107000	0.64212	0.533000	0.62120	TTC	.	.	.	none		0.597	HPD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402184.1	NM_002150	
B3GNT4	79369	hgsc.bcm.edu	37	12	122691299	122691299	+	Silent	SNP	A	A	T			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr12:122691299A>T	ENST00000324189.4	+	3	857	c.501A>T	c.(499-501)ccA>ccT	p.P167P	B3GNT4_ENST00000545141.1_Intron|B3GNT4_ENST00000546192.1_Silent_p.P142P|B3GNT4_ENST00000535274.1_Silent_p.P142P	NM_030765.2	NP_110392.1	Q9C0J1	B3GN4_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4	167					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	13	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000297)|Epithelial(86;0.000497)|BRCA - Breast invasive adenocarcinoma(302;0.222)		CCGCTCCCCCAGCCCAGCTGC	0.632																																					p.P167P		Atlas-SNP	.											.	B3GNT4	35	.	0			c.A501T						PASS	.						25.0	28.0	27.0					12																	122691299		2203	4300	6503	SO:0001819	synonymous_variant	79369	exon3			TCCCCCAGCCCAG	AB049586	CCDS9227.1	12q24	2013-02-19						"""Beta 3-glycosyltransferases"""	15683	protein-coding gene	gene with protein product		605864				11042166	Standard	NM_030765		Approved	B3GN-T4, beta3Gn-T4	uc001ubx.3	Q9C0J1		ENST00000324189.4:c.501A>T	chr12.hg19:g.122691299A>T		37.0	0.0	.		43.0	17.0	.	NM_030765	Q8N5W4|Q8N934|Q8ND21|Q8WWR5|Q8WY02|Q96QH5	Silent	SNP	ENST00000324189.4	hg19	CCDS9227.1																																																																																			.	.	.	none		0.632	B3GNT4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401595.1	NM_030765	
GOLGA3	2802	hgsc.bcm.edu	37	12	133385055	133385055	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr12:133385055C>A	ENST00000450791.2	-	4	783	c.600G>T	c.(598-600)agG>agT	p.R200S	GOLGA3_ENST00000204726.3_Missense_Mutation_p.R200S|GOLGA3_ENST00000456883.2_Missense_Mutation_p.R200S|GOLGA3_ENST00000537452.1_Missense_Mutation_p.R200S|GOLGA3_ENST00000545875.1_Missense_Mutation_p.R200S			Q08378	GOGA3_HUMAN	golgin A3	200	Golgi-targeting domain.				intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GGGTACTGGCCCTTGGTAAGT	0.512																																					p.R200S		Atlas-SNP	.											.	GOLGA3	234	.	0			c.G600T						PASS	.						205.0	228.0	220.0					12																	133385055		2203	4300	6503	SO:0001583	missense	2802	exon5			ACTGGCCCTTGGT	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.600G>T	chr12.hg19:g.133385055C>A	ENSP00000410378:p.Arg200Ser	95.0	0.0	.		110.0	54.0	.	NM_001172557	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	ENST00000450791.2	hg19	CCDS9281.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.987682	0.74589	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61	5.34	0.246	0.15516	.	0.086607	0.85682	D	0.000000	T	0.42040	0.1185	M	0.66939	2.045	0.80722	D	1	D;P;D	0.64830	0.972;0.925;0.994	P;P;P	0.60068	0.742;0.621;0.868	T	0.27606	-1.0069	10	0.87932	D	0	.	6.2402	0.20787	0.1205:0.4387:0.0:0.4408	.	200;200;200	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	S	200	ENSP00000204726:R200S;ENSP00000410378:R200S;ENSP00000409303:R200S;ENSP00000442143:R200S;ENSP00000442603:R200S	ENSP00000204726:R200S	R	-	3	2	GOLGA3	131895128	0.974000	0.33945	0.998000	0.56505	0.895000	0.52256	0.129000	0.15830	0.060000	0.16281	0.585000	0.79938	AGG	.	.	.	none		0.512	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	NM_005895	
COG3	83548	hgsc.bcm.edu	37	13	46066332	46066332	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr13:46066332G>T	ENST00000349995.5	+	11	1246	c.1134G>T	c.(1132-1134)caG>caT	p.Q378H	COG3_ENST00000465942.1_3'UTR	NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3	378					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		ATGTCTGCCAGGATGAACACC	0.373																																					p.Q378H	Ovarian(150;1048 1859 18083 21577 42700)	Atlas-SNP	.											.	COG3	52	.	0			c.G1134T						PASS	.						195.0	157.0	170.0					13																	46066332		2203	4300	6503	SO:0001583	missense	83548	exon11			CTGCCAGGATGAA	AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.1134G>T	chr13.hg19:g.46066332G>T	ENSP00000258654:p.Gln378His	107.0	0.0	.		106.0	5.0	.	NM_031431	B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Missense_Mutation	SNP	ENST00000349995.5	hg19	CCDS9398.1	.	.	.	.	.	.	.	.	.	.	g	13.99	2.401591	0.42613	.	.	ENSG00000136152	ENST00000349995	T	0.48201	0.82	5.87	1.67	0.24075	.	0.000000	0.85682	D	0.000000	T	0.57475	0.2056	M	0.63843	1.955	0.80722	D	1	B;D;P	0.71674	0.052;0.998;0.539	B;P;B	0.61940	0.035;0.896;0.188	T	0.53315	-0.8456	10	0.31617	T	0.26	-12.2902	10.952	0.47334	0.3066:0.0:0.6934:0.0	.	215;378;378	B4E2F3;Q96JB2;Q96JB2-2	.;COG3_HUMAN;.	H	378	ENSP00000258654:Q378H	ENSP00000258654:Q378H	Q	+	3	2	COG3	44964333	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.694000	0.47035	0.386000	0.24997	-0.119000	0.15052	CAG	.	.	.	none		0.373	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044777.2		
ACTR10	55860	hgsc.bcm.edu	37	14	58675768	58675768	+	Silent	SNP	A	A	G			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr14:58675768A>G	ENST00000254286.4	+	4	365	c.285A>G	c.(283-285)gtA>gtG	p.V95V		NM_018477.2	NP_060947.1	Q9NZ32	ARP10_HUMAN	actin-related protein 10 homolog (S. cerevisiae)	95					microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|dynactin complex (GO:0005869)				central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	13						TCGAATCGGTATTATGTCCTT	0.328																																					p.V95V		Atlas-SNP	.											.	ACTR10	33	.	0			c.A285G						PASS	.						122.0	123.0	122.0					14																	58675768		2203	4300	6503	SO:0001819	synonymous_variant	55860	exon4			ATCGGTATTATGT	AF220190	CCDS32090.1	14q23.1	2014-08-08			ENSG00000131966	ENSG00000131966			17372	protein-coding gene	gene with protein product						12857853	Standard	NM_018477		Approved	HARP11, ACTR11, Arp11	uc001xdf.3	Q9NZ32	OTTHUMG00000171049	ENST00000254286.4:c.285A>G	chr14.hg19:g.58675768A>G		86.0	0.0	.		62.0	21.0	.	NM_018477	Q9H9Y5|Q9NWY2	Silent	SNP	ENST00000254286.4	hg19	CCDS32090.1																																																																																			.	.	.	none		0.328	ACTR10-002	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411405.1		
SNAPC1	6617	hgsc.bcm.edu	37	14	62229244	62229244	+	Silent	SNP	C	C	T			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr14:62229244C>T	ENST00000216294.4	+	1	170	c.66C>T	c.(64-66)gaC>gaT	p.D22D	RP11-618G20.1_ENST00000555937.1_RNA	NM_003082.3	NP_003073.1	Q16533	SNPC1_HUMAN	small nuclear RNA activating complex, polypeptide 1, 43kDa	22	SNAPC3-binding.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.0639)|BRCA - Breast invasive adenocarcinoma(234;0.186)		AGGAGACGGACAGTGTACGCT	0.642																																					p.D22D	NSCLC(27;223 907 37180 39193 46568)	Atlas-SNP	.											.	SNAPC1	32	.	0			c.C66T						PASS	.						124.0	116.0	119.0					14																	62229244		2203	4300	6503	SO:0001819	synonymous_variant	6617	exon1			GACGGACAGTGTA	Z47542	CCDS9755.1	14q22	2008-08-11	2002-08-29		ENSG00000023608	ENSG00000023608			11134	protein-coding gene	gene with protein product		600591	"""small nuclear RNA activating complex, polypeptide 1, 43kD"""			9644240	Standard	NM_003082		Approved	SNAP43, PTFgamma	uc001xft.3	Q16533	OTTHUMG00000140343	ENST00000216294.4:c.66C>T	chr14.hg19:g.62229244C>T		66.0	0.0	.		61.0	20.0	.	NM_003082		Silent	SNP	ENST00000216294.4	hg19	CCDS9755.1																																																																																			.	.	.	none		0.642	SNAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276976.2	NM_003082	
SYNE2	23224	hgsc.bcm.edu	37	14	64595265	64595265	+	Silent	SNP	G	G	A			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr14:64595265G>A	ENST00000344113.4	+	74	14225	c.14013G>A	c.(14011-14013)caG>caA	p.Q4671Q	SYNE2_ENST00000555002.1_Silent_p.Q1305Q|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000357395.3_Silent_p.Q1056Q|SYNE2_ENST00000394768.2_Silent_p.Q1056Q|SYNE2_ENST00000358025.3_Silent_p.Q4671Q|SYNE2_ENST00000554584.1_Intron	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4671					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TTGCTGAACAGCTTCAGGTAA	0.368																																					p.Q4671Q		Atlas-SNP	.											.	SYNE2	577	.	0			c.G14013A						PASS	.						86.0	84.0	84.0					14																	64595265		2203	4300	6503	SO:0001819	synonymous_variant	23224	exon74			TGAACAGCTTCAG	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.14013G>A	chr14.hg19:g.64595265G>A		151.0	0.0	.		143.0	55.0	.	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	hg19	CCDS41963.1																																																																																			.	.	.	none		0.368	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
GPHN	10243	hgsc.bcm.edu	37	14	67646373	67646373	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr14:67646373C>A	ENST00000315266.5	+	21	3180	c.2059C>A	c.(2059-2061)Cct>Act	p.P687T	GPHN_ENST00000543237.1_Missense_Mutation_p.P733T|GPHN_ENST00000478722.1_Missense_Mutation_p.P720T|GPHN_ENST00000305960.9_Missense_Mutation_p.P656T|GPHN_ENST00000544752.2_3'UTR	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	687	MPT adenylyltransferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)			large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		AGAACCACTACCTTGGGCACA	0.368			T	MLL	AL																																p.P720T		Atlas-SNP	.		Dom	yes		14	14q24	10243	gephyrin (GPH)		L	.	GPHN	79	.	0			c.C2158A						PASS	.						124.0	103.0	110.0					14																	67646373		2203	4300	6503	SO:0001583	missense	10243	exon22			CCACTACCTTGGG	AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.2059C>A	chr14.hg19:g.67646373C>A	ENSP00000312771:p.Pro687Thr	96.0	0.0	.		77.0	41.0	.	NM_020806	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	ENST00000315266.5	hg19	CCDS32103.1	.	.	.	.	.	.	.	.	.	.	C	18.33	3.599845	0.66332	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000543237;ENST00000305960	.	.	.	5.79	5.79	0.91817	MoeA, C-terminal, domain IV (3);	0.000000	0.85682	D	0.000000	D	0.83885	0.5351	M	0.86028	2.79	0.80722	D	1	D;D;D;D	0.71674	0.998;0.997;0.989;0.994	D;D;D;D	0.74023	0.982;0.97;0.964;0.961	T	0.82086	-0.0631	9	0.33940	T	0.23	-6.8827	20.0417	0.97594	0.0:1.0:0.0:0.0	.	656;733;687;720	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2	.;.;GEPH_HUMAN;.	T	687;720;733;656	.	ENSP00000303019:P656T	P	+	1	0	GPHN	66716126	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.734000	0.84928	2.736000	0.93811	0.655000	0.94253	CCT	.	.	.	none		0.368	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	NM_020806	
VRTN	55237	hgsc.bcm.edu	37	14	74824607	74824607	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr14:74824607T>A	ENST00000256362.4	+	2	1362	c.1121T>A	c.(1120-1122)cTa>cAa	p.L374Q		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	374					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						ATGGAGGAGCTAGAGAAGCTG	0.637																																					p.L374Q		Atlas-SNP	.											.	VRTN	79	.	0			c.T1121A						PASS	.						41.0	40.0	41.0					14																	74824607		2203	4300	6503	SO:0001583	missense	55237	exon2			AGGAGCTAGAGAA	AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	ENST00000256362.4:c.1121T>A	chr14.hg19:g.74824607T>A	ENSP00000256362:p.Leu374Gln	61.0	0.0	.		55.0	23.0	.	NM_018228	Q9NVC7	Missense_Mutation	SNP	ENST00000256362.4	hg19	CCDS9830.1	.	.	.	.	.	.	.	.	.	.	T	11.39	1.625234	0.28889	.	.	ENSG00000133980	ENST00000256362	T	0.47177	0.85	4.53	2.07	0.26955	.	0.926239	0.09176	N	0.838183	T	0.30823	0.0777	N	0.24115	0.695	0.24060	N	0.996016	B	0.15473	0.013	B	0.08055	0.003	T	0.29458	-1.0011	10	0.72032	D	0.01	-8.4468	3.2816	0.06917	0.1707:0.2001:0.0:0.6292	.	374	Q9H8Y1	VRTN_HUMAN	Q	374	ENSP00000256362:L374Q	ENSP00000256362:L374Q	L	+	2	0	VRTN	73894360	0.947000	0.32204	0.681000	0.30009	0.154000	0.21943	0.153000	0.16323	0.238000	0.21222	0.459000	0.35465	CTA	.	.	.	none		0.637	VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412339.1	NM_018228	
PLA2G4E	123745	hgsc.bcm.edu	37	15	42298282	42298282	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr15:42298282A>G	ENST00000399518.3	-	4	917	c.431T>C	c.(430-432)gTg>gCg	p.V144A	CTD-2382E5.2_ENST00000552704.1_RNA|PLA2G4E_ENST00000413860.2_Missense_Mutation_p.V115A	NM_001206670.1	NP_001193599.1	Q3MJ16	PA24E_HUMAN	phospholipase A2, group IVE	126					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|stomach(1)	16		all_cancers(109;8.09e-13)|all_epithelial(112;2.03e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.0273)		OV - Ovarian serous cystadenocarcinoma(18;7.61e-18)|GBM - Glioblastoma multiforme(94;3.07e-06)		ATCTGGTGTCACTGTGTCTTC	0.507																																					p.V144A		Atlas-SNP	.											.	PLA2G4E	60	.	0			c.T431C						PASS	.						133.0	140.0	138.0					15																	42298282		2138	4259	6397	SO:0001583	missense	123745	exon4			GGTGTCACTGTGT		CCDS55962.1	15q15.1	2008-09-19			ENSG00000188089	ENSG00000188089	3.1.1.4		24791	protein-coding gene	gene with protein product						15866882	Standard	NM_001206670		Approved	FLJ45651	uc021sjp.1	Q3MJ16	OTTHUMG00000130371	ENST00000399518.3:c.431T>C	chr15.hg19:g.42298282A>G	ENSP00000382434:p.Val144Ala	106.0	0.0	.		101.0	52.0	.	NM_001206670	Q6ZSC0	Missense_Mutation	SNP	ENST00000399518.3	hg19	CCDS55962.1	.	.	.	.	.	.	.	.	.	.	A	15.16	2.750182	0.49257	.	.	ENSG00000188089	ENST00000399518;ENST00000413860	T;T	0.40476	1.03;2.9	5.66	5.66	0.87406	.	1.275240	0.06088	U	0.663186	T	0.48502	0.1503	M	0.67517	2.055	0.19775	N	0.999954	B	0.29232	0.238	B	0.35353	0.201	T	0.43861	-0.9365	10	0.41790	T	0.15	-0.4635	8.9392	0.35720	0.735:0.0:0.0:0.265	.	115	C9JK77	.	A	144;115	ENSP00000382434:V144A;ENSP00000413897:V115A	ENSP00000382434:V144A	V	-	2	0	PLA2G4E	40085574	0.205000	0.23458	0.884000	0.34674	0.976000	0.68499	2.142000	0.42177	2.153000	0.67306	0.460000	0.39030	GTG	.	.	.	none		0.507	PLA2G4E-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252738.2	NM_198442	
SLC24A1	9187	hgsc.bcm.edu	37	15	65943100	65943100	+	Silent	SNP	A	A	G	rs574760946		TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr15:65943100A>G	ENST00000261892.6	+	7	2900	c.2613A>G	c.(2611-2613)gaA>gaG	p.E871E	SLC24A1_ENST00000546330.1_Silent_p.E853E|SLC24A1_ENST00000449142.2_3'UTR|SLC24A1_ENST00000544319.2_Silent_p.E757E|SLC24A1_ENST00000537259.1_Silent_p.E853E|SLC24A1_ENST00000399033.4_Silent_p.E871E|SLC24A1_ENST00000339868.6_Silent_p.E853E	NM_001254740.1|NM_004727.2	NP_001241669.1|NP_004718.1	O60721	NCKX1_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 1	871	Poly-Glu.				calcium ion transport (GO:0006816)|ion transport (GO:0006811)|phototransduction, visible light (GO:0007603)|response to light intensity (GO:0009642)|rhodopsin mediated signaling pathway (GO:0016056)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						agcaggaggaagaggaggagg	0.547																																					p.E871E		Atlas-SNP	.											.	SLC24A1	58	.	0			c.A2613G						PASS	.						28.0	32.0	30.0					15																	65943100		2182	4274	6456	SO:0001819	synonymous_variant	9187	exon7			GGAGGAAGAGGAG	AF062922	CCDS45284.1, CCDS73742.1, CCDS73743.1, CCDS73744.1	15q22.31	2014-01-28			ENSG00000074621	ENSG00000074621		"""Solute carriers"""	10975	protein-coding gene	gene with protein product		603617				9856482	Standard	NM_004727		Approved	NCKX1, NCKX, RODX, KIAA0702, HsT17412, CSNB1D	uc010ujf.2	O60721	OTTHUMG00000167960	ENST00000261892.6:c.2613A>G	chr15.hg19:g.65943100A>G		84.0	0.0	.		79.0	10.0	.	NM_004727	O43485|O75184|Q17RM9	Silent	SNP	ENST00000261892.6	hg19	CCDS45284.1																																																																																			.	.	.	none		0.547	SLC24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397304.1	NM_004727	
NR2F2	7026	hgsc.bcm.edu	37	15	96875660	96875660	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr15:96875660G>T	ENST00000394166.3	+	1	1715	c.326G>T	c.(325-327)aGg>aTg	p.R109M	NR2F2_ENST00000394171.2_5'Flank|MIR1469_ENST00000410719.1_RNA|NR2F2_ENST00000453270.2_5'Flank|NR2F2_ENST00000421109.2_Intron	NM_021005.3	NP_066285.1	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2	109					anterior/posterior pattern specification (GO:0009952)|blood vessel morphogenesis (GO:0048514)|fertilization (GO:0009566)|forebrain development (GO:0030900)|intracellular receptor signaling pathway (GO:0030522)|limb development (GO:0060173)|lipid metabolic process (GO:0006629)|maternal placenta development (GO:0001893)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|radial pattern formation (GO:0009956)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(2)|lung(3)|ovary(2)|urinary_tract(1)	17	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			AGCGTGCGGAGGAACCTGAGC	0.607																																					p.R109M		Atlas-SNP	.											.	NR2F2	35	.	0			c.G326T						PASS	.						83.0	69.0	73.0					15																	96875660		2197	4298	6495	SO:0001583	missense	7026	exon1			TGCGGAGGAACCT	M64497	CCDS10375.1, CCDS45358.1, CCDS45359.1	15q26	2013-01-16			ENSG00000185551	ENSG00000185551		"""Nuclear hormone receptors"""	7976	protein-coding gene	gene with protein product		107773		ARP1, TFCOUP2		8530078, 11544252	Standard	NM_021005		Approved	COUP-TFII, COUPTFB, SVP40, NF-E3	uc010uri.2	P24468	OTTHUMG00000149848	ENST00000394166.3:c.326G>T	chr15.hg19:g.96875660G>T	ENSP00000377721:p.Arg109Met	100.0	0.0	.		86.0	32.0	.	NM_021005	B4DQJ2|B6ZGU1|Q03754|Q3KQR7	Missense_Mutation	SNP	ENST00000394166.3	hg19	CCDS10375.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.687254	0.88639	.	.	ENSG00000185551	ENST00000394166	D	0.97455	-4.39	4.61	4.61	0.57282	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (4);	0.000000	0.64402	D	0.000001	D	0.98096	0.9372	M	0.73319	2.225	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99327	1.0908	10	0.87932	D	0	.	16.0226	0.80509	0.0:0.0:1.0:0.0	.	109	P24468	COT2_HUMAN	M	109	ENSP00000377721:R109M	ENSP00000377721:R109M	R	+	2	0	NR2F2	94676664	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.728000	0.74769	2.097000	0.63578	0.462000	0.41574	AGG	.	.	.	none		0.607	NR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313534.1		
NTN3	4917	hgsc.bcm.edu	37	16	2522514	2522514	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr16:2522514A>C	ENST00000293973.1	+	1	1015	c.812A>C	c.(811-813)cAc>cCc	p.H271P	TBC1D24_ENST00000567020.1_5'Flank|TBC1D24_ENST00000293970.5_5'Flank	NM_006181.2	NP_006172.1	O00634	NET3_HUMAN	netrin 3	271	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(2)|lung(3)|prostate(1)	7						ACACAGGGCCACCTGATCTGC	0.677																																					p.H271P		Atlas-SNP	.											.	NTN3	28	.	0			c.A812C						PASS	.						33.0	32.0	32.0					16																	2522514		2195	4291	6486	SO:0001583	missense	4917	exon1			AGGGCCACCTGAT	U86759	CCDS10469.1	16p13.3	2013-03-01	2008-10-29	2008-10-29	ENSG00000162068	ENSG00000162068		"""Netrins"""	8030	protein-coding gene	gene with protein product	"""Netrin-3"""	602349	"""netrin 2 (chicken)-like"", ""netrin 2-like (chicken)"""	NTN2L		9143507, 10366627	Standard	NM_006181		Approved		uc002cqj.3	O00634	OTTHUMG00000128867	ENST00000293973.1:c.812A>C	chr16.hg19:g.2522514A>C	ENSP00000293973:p.His271Pro	41.0	0.0	.		47.0	5.0	.	NM_006181		Missense_Mutation	SNP	ENST00000293973.1	hg19	CCDS10469.1	.	.	.	.	.	.	.	.	.	.	A	9.869	1.198347	0.22037	.	.	ENSG00000162068	ENST00000293973	T	0.61158	0.13	4.09	-0.489	0.12052	EGF-like, laminin (3);	0.412612	0.24350	N	0.039292	T	0.34832	0.0911	N	0.21240	0.645	0.28172	N	0.928542	P	0.42357	0.777	B	0.35655	0.207	T	0.29150	-1.0021	10	0.44086	T	0.13	.	8.7149	0.34405	0.5211:0.0:0.4789:0.0	.	271	O00634	NET3_HUMAN	P	271	ENSP00000293973:H271P	ENSP00000293973:H271P	H	+	2	0	NTN3	2462515	0.000000	0.05858	0.988000	0.46212	0.933000	0.57130	0.208000	0.17415	-0.098000	0.12285	0.254000	0.18369	CAC	.	.	.	none		0.677	NTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250812.1	NM_006181	
TANGO6	79613	hgsc.bcm.edu	37	16	68914532	68914532	+	Splice_Site	SNP	A	A	C			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr16:68914532A>C	ENST00000261778.1	+	7	1388	c.1376A>C	c.(1375-1377)aAg>aCg	p.K459T		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	459						integral component of membrane (GO:0016021)											GATGTGTTTAAGGTTGGTAAT	0.323																																					p.K459T		Atlas-SNP	.											.	.	.	.	0			c.A1376C						PASS	.						192.0	175.0	181.0					16																	68914532		1823	4084	5907	SO:0001630	splice_region_variant	79613	exon7			TGTTTAAGGTTGG		CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.1377+1A>C	chr16.hg19:g.68914532A>C		115.0	0.0	.		163.0	41.0	.	NM_024562	Q569F9|Q9H9K1	Missense_Mutation	SNP	ENST00000261778.1	hg19	CCDS45516.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.952009	0.73787	.	.	ENSG00000103047	ENST00000261778	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	T	0.76047	0.3933	M	0.72894	2.215	0.49299	D	0.999779	D	0.89917	1.0	D	0.85130	0.997	T	0.74460	-0.3658	8	0.29301	T	0.29	-10.3412	12.9949	0.58640	1.0:0.0:0.0:0.0	.	459	Q9C0B7	TMCO7_HUMAN	T	459	.	ENSP00000261778:K459T	K	+	2	0	TMCO7	67472033	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	5.339000	0.65953	2.053000	0.61076	0.533000	0.62120	AAG	.	.	.	none		0.323	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433471.2	XM_928235.2	Missense_Mutation
BANP	54971	hgsc.bcm.edu	37	16	88039824	88039824	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr16:88039824G>A	ENST00000393207.1	+	6	805	c.584G>A	c.(583-585)aGt>aAt	p.S195N	BANP_ENST00000355163.5_Missense_Mutation_p.S170N|BANP_ENST00000538234.1_Missense_Mutation_p.S203N|BANP_ENST00000355022.4_Missense_Mutation_p.S164N|BANP_ENST00000393208.2_Missense_Mutation_p.S164N|BANP_ENST00000479780.2_Missense_Mutation_p.S164N|BANP_ENST00000286122.7_Missense_Mutation_p.S195N	NM_001173543.1	NP_001167014.1	Q8N9N5	BANP_HUMAN	BTG3 associated nuclear protein	195	Interaction with CUX1 and HDAC1. {ECO:0000250}.				cell cycle (GO:0007049)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of protein catabolic process (GO:0042177)|protein localization to nucleus (GO:0034504)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.00551)		CAGGCGGGCAGTCAGAGCATC	0.627																																					p.S203N		Atlas-SNP	.											.	BANP	67	.	0			c.G608A						PASS	.						84.0	83.0	83.0					16																	88039824		2198	4300	6498	SO:0001583	missense	54971	exon6			CGGGCAGTCAGAG	AK094158	CCDS10966.2, CCDS42215.1, CCDS54052.1, CCDS54053.1, CCDS54054.1	16q24	2012-11-22			ENSG00000172530	ENSG00000172530		"""BEN domain containing"""	13450	protein-coding gene	gene with protein product	"""BEN domain containing 1"""	611564				10940556, 10950932	Standard	NM_017869		Approved	SMARBP1, SMAR1, FLJ20538, DKFZp761H172, FLJ10177, BEND1	uc010vow.2	Q8N9N5	OTTHUMG00000137678	ENST00000393207.1:c.584G>A	chr16.hg19:g.88039824G>A	ENSP00000376902:p.Ser195Asn	49.0	0.0	.		58.0	31.0	.	NM_001173542	A8MU25|A8MX25|B2RCF7|B4DNJ9|F5GZM0|Q96GJ7|Q9NWY1	Missense_Mutation	SNP	ENST00000393207.1	hg19	CCDS54054.1	.	.	.	.	.	.	.	.	.	.	G	8.683	0.905509	0.17760	.	.	ENSG00000172530	ENST00000439677;ENST00000286122;ENST00000355163;ENST00000289484;ENST00000479780;ENST00000393208;ENST00000540932;ENST00000355022;ENST00000538234;ENST00000393207	T;T;T;T;T;T;T;T	0.25912	1.77;1.77;1.77;1.77;1.77;1.77;1.77;1.77	5.43	5.43	0.79202	.	0.141405	0.64402	D	0.000002	T	0.12050	0.0293	N	0.03608	-0.345	0.31704	N	0.64034	B;B;B;B;B;B	0.26258	0.002;0.002;0.001;0.145;0.002;0.001	B;B;B;B;B;B	0.25884	0.004;0.003;0.001;0.064;0.003;0.005	T	0.10245	-1.0638	10	0.29301	T	0.29	.	11.9944	0.53194	0.0791:0.0:0.9209:0.0	.	203;170;164;195;164;164	B4DE54;B4DNJ9;B2RCF7;Q8N9N5;Q8N9N5-2;Q8N9N5-4	.;.;.;BANP_HUMAN;.;.	N	170;195;170;160;164;164;164;164;203;195	ENSP00000411479:S170N;ENSP00000286122:S195N;ENSP00000347290:S170N;ENSP00000432508:S164N;ENSP00000376903:S164N;ENSP00000347125:S164N;ENSP00000444352:S203N;ENSP00000376902:S195N	ENSP00000286122:S195N	S	+	2	0	BANP	86597325	0.981000	0.34729	0.229000	0.23960	0.201000	0.24016	2.542000	0.45744	2.706000	0.92434	0.655000	0.94253	AGT	.	.	.	none		0.627	BANP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269166.1	NM_017869	
NTN1	9423	hgsc.bcm.edu	37	17	9066277	9066277	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr17:9066277G>T	ENST00000173229.2	+	3	1273	c.1166G>T	c.(1165-1167)cGc>cTc	p.R389L	NTN1_ENST00000546090.1_Missense_Mutation_p.R389L|NTN1_ENST00000538852.1_Missense_Mutation_p.R389L	NM_004822.2	NP_004813.2	O95631	NET1_HUMAN	netrin 1	389	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|establishment of nucleus localization (GO:0040023)|inner ear morphogenesis (GO:0042472)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of axon extension (GO:0030517)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of cell proliferation (GO:0008284)|regulation of cell migration (GO:0030334)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)			NTN1/ACLY(2)	central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(5)	13						GGCTACTACCGCGACATGGGC	0.662																																					p.R389L		Atlas-SNP	.											.	NTN1	31	.	0			c.G1166T						PASS	.						33.0	25.0	28.0					17																	9066277		2203	4300	6503	SO:0001583	missense	9423	exon3			ACTACCGCGACAT	U75586	CCDS11148.1	17p13-p12	2013-03-01			ENSG00000065320	ENSG00000065320		"""Netrins"""	8029	protein-coding gene	gene with protein product	"""Netrin-1"""	601614				9950216	Standard	NM_004822		Approved	NTN1L	uc002glw.4	O95631	OTTHUMG00000130257	ENST00000173229.2:c.1166G>T	chr17.hg19:g.9066277G>T	ENSP00000173229:p.Arg389Leu	83.0	0.0	.		139.0	87.0	.	NM_004822	E9KL51	Missense_Mutation	SNP	ENST00000173229.2	hg19	CCDS11148.1	.	.	.	.	.	.	.	.	.	.	G	34	5.334742	0.95758	.	.	ENSG00000065320	ENST00000173229;ENST00000538852;ENST00000546090;ENST00000436734	T;T;T;T	0.64438	-0.1;-0.1;-0.1;2.47	4.89	4.89	0.63831	EGF-like, laminin (4);	0.000000	0.85682	D	0.000000	D	0.84188	0.5417	M	0.92317	3.295	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.88486	0.3072	10	0.87932	D	0	.	18.4101	0.90549	0.0:0.0:1.0:0.0	.	389	O95631	NET1_HUMAN	L	389;389;389;9	ENSP00000173229:R389L;ENSP00000443259:R389L;ENSP00000441611:R389L;ENSP00000389375:R9L	ENSP00000173229:R389L	R	+	2	0	NTN1	9007002	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.365000	0.97139	2.437000	0.82529	0.650000	0.86243	CGC	.	.	.	none		0.662	NTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252583.1		
ACACA	31	hgsc.bcm.edu	37	17	35609953	35609953	+	Silent	SNP	C	C	A			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr17:35609953C>A	ENST00000394406.2	-	15	1915	c.1725G>T	c.(1723-1725)gtG>gtT	p.V575V	ACACA_ENST00000360679.3_Silent_p.V517V|ACACA_ENST00000353139.5_Silent_p.V612V|ACACA_ENST00000335166.5_Silent_p.V497V	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	575	Biotin carboxylation.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	TCAAAGCCACCACCATGTTTC	0.403																																					p.V612V	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	Atlas-SNP	.											.	ACACA	395	.	0			c.G1836T						PASS	.						103.0	101.0	102.0					17																	35609953		2203	4300	6503	SO:0001819	synonymous_variant	31	exon15			AGCCACCACCATG	U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.1725G>T	chr17.hg19:g.35609953C>A		88.0	0.0	.		93.0	59.0	.	NM_198834	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Silent	SNP	ENST00000394406.2	hg19	CCDS11317.1																																																																																			.	.	.	none		0.403	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836	
UBE2O	63893	hgsc.bcm.edu	37	17	74398143	74398143	+	Splice_Site	SNP	A	A	G			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr17:74398143A>G	ENST00000319380.7	-	5	815		c.e5+1		UBE2O_ENST00000587581.1_5'Flank	NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O						positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						GGAGCACACTACCGAGTCGCT	0.562																																					.		Atlas-SNP	.											.	UBE2O	207	.	0			c.750+2T>C						PASS	.						86.0	61.0	70.0					17																	74398143		2203	4300	6503	SO:0001630	splice_region_variant	63893	exon6			CACACTACCGAGT	AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.750+1T>C	chr17.hg19:g.74398143A>G		76.0	0.0	.		135.0	85.0	.	NM_022066	A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Splice_Site	SNP	ENST00000319380.7	hg19	CCDS32742.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.810257	0.90707	.	.	ENSG00000175931	ENST00000319380	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5935	0.68386	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	UBE2O	71909738	1.000000	0.71417	0.995000	0.50966	0.970000	0.65996	8.917000	0.92751	2.198000	0.70561	0.533000	0.62120	.	.	.	.	none		0.562	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450123.1	NM_022066	Intron
SMARCA4	6597	hgsc.bcm.edu	37	19	11138579	11138579	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr19:11138579T>G	ENST00000429416.3	+	25	3616	c.3335T>G	c.(3334-3336)aTg>aGg	p.M1112R	SMARCA4_ENST00000450717.3_Missense_Mutation_p.M1112R|SMARCA4_ENST00000344626.4_Missense_Mutation_p.M1112R|SMARCA4_ENST00000358026.2_Missense_Mutation_p.M1112R|SMARCA4_ENST00000541122.2_Missense_Mutation_p.M1112R|SMARCA4_ENST00000444061.3_Missense_Mutation_p.M1112R|SMARCA4_ENST00000589677.1_Missense_Mutation_p.M1112R|SMARCA4_ENST00000413806.3_Missense_Mutation_p.M1112R|SMARCA4_ENST00000590574.1_Missense_Mutation_p.M1112R	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1112	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(2)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				ATGACCATCATGGAAGATTAC	0.468			"""F, N, Mis"""		NSCLC																																p.M1112R		Atlas-SNP	.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4	502	.	2	Unknown(2)	lung(2)	c.T3335G						PASS	.						181.0	176.0	177.0					19																	11138579		2203	4300	6503	SO:0001583	missense	6597	exon24			CCATCATGGAAGA	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3335T>G	chr19.hg19:g.11138579T>G	ENSP00000395654:p.Met1112Arg	151.0	0.0	.		145.0	71.0	.	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	hg19	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.536828	0.85812	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	T;T;T;T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97;-0.97;-0.97;-0.97	5.04	5.04	0.67666	Helicase, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.85978	0.5823	M	0.87758	2.905	0.58432	D	0.999999	D;D;D;D;D;D;D;D	0.61080	0.989;0.989;0.989;0.988;0.981;0.969;0.989;0.989	P;P;P;P;P;P;P;P	0.61201	0.862;0.862;0.862;0.885;0.716;0.832;0.862;0.862	D	0.88680	0.3201	10	0.87932	D	0	-42.4872	13.9052	0.63831	0.0:0.0:0.0:1.0	.	1112;1112;1112;1112;1112;332;1112;1112	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	R	1112;1112;1176;1112;1112;1112;1112;1112	ENSP00000395654:M1112R;ENSP00000350720:M1112R;ENSP00000343896:M1112R;ENSP00000445036:M1112R;ENSP00000392837:M1112R;ENSP00000397783:M1112R;ENSP00000414727:M1112R	ENSP00000343896:M1112R	M	+	2	0	SMARCA4	10999579	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.575000	0.82447	2.115000	0.64714	0.533000	0.62120	ATG	.	.	.	none		0.468	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
PAK4	10298	hgsc.bcm.edu	37	19	39664225	39664225	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr19:39664225C>A	ENST00000593690.1	+	6	1100	c.673C>A	c.(673-675)Cat>Aat	p.H225N	PAK4_ENST00000321944.4_Missense_Mutation_p.H135N|PAK4_ENST00000599470.1_Missense_Mutation_p.H72N|PAK4_ENST00000358301.3_Missense_Mutation_p.H225N|PAK4_ENST00000435673.2_Missense_Mutation_p.H225N|PAK4_ENST00000599386.1_Missense_Mutation_p.H72N|PAK4_ENST00000360442.3_Missense_Mutation_p.H225N	NM_001014831.2	NP_001014831.1	O96013	PAK4_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 4	225	Linker.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	13	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			GGGGGAGCCTCATGACGTGGC	0.667																																					p.H225N		Atlas-SNP	.											.	PAK4	40	.	0			c.C673A						PASS	.						13.0	15.0	14.0					19																	39664225		2145	4193	6338	SO:0001583	missense	10298	exon4			GAGCCTCATGACG	AJ011855	CCDS12528.1, CCDS33019.1	19p11-q11	2008-06-17	2008-06-17						16059	protein-coding gene	gene with protein product		605451	"""p21(CDKN1A)-activated kinase 4"""			9822598, 10461188	Standard	NM_001014831		Approved		uc002okn.1	O96013		ENST00000593690.1:c.673C>A	chr19.hg19:g.39664225C>A	ENSP00000469413:p.His225Asn	65.0	0.0	.		66.0	22.0	.	NM_001014832	B4DGG6|Q8N4E1|Q8NCH5|Q8NDE3|Q9BU33|Q9ULS8	Missense_Mutation	SNP	ENST00000593690.1	hg19	CCDS12528.1	.	.	.	.	.	.	.	.	.	.	C	0.108	-1.142902	0.01728	.	.	ENSG00000130669	ENST00000358301;ENST00000321944;ENST00000358801;ENST00000435673;ENST00000360442	T;T;T	0.70986	-0.53;-0.53;-0.53	4.25	3.22	0.36961	.	1.326000	0.04874	N	0.446555	T	0.65249	0.2673	L	0.53249	1.67	0.30292	N	0.790288	B;B;B	0.16166	0.016;0.016;0.009	B;B;B	0.16289	0.01;0.015;0.005	T	0.51188	-0.8737	10	0.16896	T	0.51	.	7.9058	0.29761	0.0:0.887:0.0:0.113	.	135;72;225	O96013-4;O96013-3;O96013	.;.;PAK4_HUMAN	N	225;72;29;225;225	ENSP00000351049:H225N;ENSP00000392753:H225N;ENSP00000353625:H225N	ENSP00000326864:H72N	H	+	1	0	PAK4	44356065	0.020000	0.18652	0.427000	0.26684	0.020000	0.10135	0.211000	0.17474	1.008000	0.39264	0.462000	0.41574	CAT	.	.	.	none		0.667	PAK4-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463823.1		
C20orf144	128864	hgsc.bcm.edu	37	20	32251357	32251357	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr20:32251357T>C	ENST00000375222.3	+	2	208	c.146T>C	c.(145-147)cTc>cCc	p.L49P	ACTL10_ENST00000330271.4_5'Flank|NECAB3_ENST00000375238.4_Intron|NECAB3_ENST00000246190.6_Intron|NECAB3_ENST00000606525.1_5'Flank	NM_080825.3	NP_543015.1	Q9BQM9	CT144_HUMAN	chromosome 20 open reading frame 144	49										lung(1)	1						GTGCTGATTCTCCCCCTGGAC	0.721																																					p.L49P		Atlas-SNP	.											.	C20orf144	4	.	0			c.T146C						PASS	.						14.0	17.0	16.0					20																	32251357		1788	3701	5489	SO:0001583	missense	128864	exon2			TGATTCTCCCCCT	AL121906	CCDS13223.1	20q11.22	2012-07-17			ENSG00000149609	ENSG00000149609			16137	protein-coding gene	gene with protein product	"""bcl-2-like protein from testis"""					11780052	Standard	NM_080825		Approved	dJ63M2.6, bclt	uc002wzs.2	Q9BQM9	OTTHUMG00000032263	ENST00000375222.3:c.146T>C	chr20.hg19:g.32251357T>C	ENSP00000364370:p.Leu49Pro	106.0	0.0	.		141.0	7.0	.	NM_080825	Q1AHR2	Missense_Mutation	SNP	ENST00000375222.3	hg19	CCDS13223.1	.	.	.	.	.	.	.	.	.	.	T	17.28	3.349754	0.61183	.	.	ENSG00000149609	ENST00000375222	T	0.55413	0.52	4.08	4.08	0.47627	.	0.272630	0.26366	N	0.024800	T	0.51160	0.1658	N	0.24115	0.695	0.18873	N	0.999984	D	0.60160	0.987	P	0.58391	0.838	T	0.41484	-0.9506	10	0.72032	D	0.01	-9.1117	9.636	0.39809	0.0:0.0:0.0:1.0	.	49	Q9BQM9	CT144_HUMAN	P	49	ENSP00000364370:L49P	ENSP00000364370:L49P	L	+	2	0	C20orf144	31715018	0.001000	0.12720	0.013000	0.15412	0.002000	0.02628	0.816000	0.27267	1.842000	0.53543	0.379000	0.24179	CTC	.	.	.	none		0.721	C20orf144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078714.2	NM_080825	
SDF2L1	23753	hgsc.bcm.edu	37	22	21996638	21996638	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr22:21996638G>A	ENST00000248958.4	+	1	89	c.13G>A	c.(13-15)Ggc>Agc	p.G5S	KB-1440D3.14_ENST00000609038.1_lincRNA	NM_022044.2	NP_071327.2	Q9HCN8	SDF2L_HUMAN	stromal cell-derived factor 2-like 1	5						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				prostate(1)	1	Colorectal(54;0.105)					GTGGAGCGCGGGCCGCGGCGG	0.771																																					p.G5S		Atlas-SNP	.											.	SDF2L1	5	.	0			c.G13A						PASS	.						4.0	6.0	5.0					22																	21996638		1658	3214	4872	SO:0001583	missense	23753	exon1			AGCGCGGGCCGCG		CCDS13792.1	22q11.21	2008-07-01			ENSG00000128228	ENSG00000128228			10676	protein-coding gene	gene with protein product	"""dihydropyrimidinase-like 2"", ""PWP1-interacting protein 8"""	607551				10591208, 11162531	Standard	NM_022044		Approved	AP000553.C22.4, OTTHUMT00000075032	uc002zvf.3	Q9HCN8	OTTHUMG00000150820	ENST00000248958.4:c.13G>A	chr22.hg19:g.21996638G>A	ENSP00000248958:p.Gly5Ser	46.0	0.0	.		49.0	24.0	.	NM_022044	A2RUD3|Q9BRI5	Missense_Mutation	SNP	ENST00000248958.4	hg19	CCDS13792.1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.327679	0.60743	.	.	ENSG00000128228	ENST00000248958	T	0.79247	-1.25	4.86	3.84	0.44239	.	0.284658	0.24713	N	0.036213	T	0.66839	0.2830	L	0.36672	1.1	0.24093	N	0.995908	B	0.02656	0.0	B	0.10450	0.005	T	0.54840	-0.8233	10	0.30854	T	0.27	-18.1036	10.7972	0.46468	0.0977:0.0:0.9023:0.0	.	5	Q9HCN8	SDF2L_HUMAN	S	5	ENSP00000248958:G5S	ENSP00000248958:G5S	G	+	1	0	SDF2L1	20326638	0.052000	0.20516	0.997000	0.53966	0.628000	0.37860	0.117000	0.15583	1.332000	0.45431	0.655000	0.94253	GGC	.	.	.	none		0.771	SDF2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320197.1	NM_022044	
MT-CO1	4512	hgsc.bcm.edu	37	M	6481	6481	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chrM:6481T>C	ENST00000361624.2	+	1	578	c.578T>C	c.(577-579)gTc>gCc	p.V193A	MT-CO2_ENST00000361739.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	193					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						AATCACAGCAGTCCTACTTCT	0.502																																					p.V193A		Atlas-SNP	.											.	.	.	.	0			c.T578C						PASS	.																																			SO:0001583	missense	5742	exon1			CAGCAGTCCTACT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.578T>C	chrM.hg19:g.6481T>C	ENSP00000354499:p.Val193Ala	42.0	0.0	.		12.0	10.0	.	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	A|0.006;G|0.994	.	alt		0.502	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
MT-CO3	4514	hgsc.bcm.edu	37	M	9420	9420	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chrM:9420A>G	ENST00000362079.2	+	1	214	c.214A>G	c.(214-216)Aca>Gca	p.T72A	MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	72					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						AAGGCCACCACACACCACCTG	0.448																																					p.T72A		Atlas-SNP	.											.	.	.	.	0			c.A214G						PASS	.																																			SO:0001583	missense	5742	exon1			CACCACACACCAC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.214A>G	chrM.hg19:g.9420A>G	ENSP00000354982:p.Thr72Ala	46.0	0.0	.		16.0	15.0	.	ENST00000362079	Q14Y83	Missense_Mutation	SNP	ENST00000362079.2	hg19																																																																																				.	.	.	none		0.448	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
DFNA5	1687	hgsc.bcm.edu	37	7	24742409	24742409	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr7:24742409delT	ENST00000342947.3	-	9	1652	c.1227delA	c.(1225-1227)aaafs	p.K409fs	DFNA5_ENST00000545231.1_Frame_Shift_Del_p.K245fs|DFNA5_ENST00000409775.3_Frame_Shift_Del_p.K409fs|DFNA5_ENST00000419307.1_Frame_Shift_Del_p.K245fs|DFNA5_ENST00000409970.1_Frame_Shift_Del_p.K245fs	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	409					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						TGATCTGGAGTTTGCAGCAAG	0.502																																					p.L410fs	GBM(78;184 1250 20134 20900 23600)	Atlas-Indel,Pindel	.											.	DFNA5	51	.	0			c.1228delC						PASS	.						117.0	111.0	113.0					7																	24742409		2203	4300	6503	SO:0001589	frameshift_variant	1687	exon9			.	AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.1227delA	chr7.hg19:g.24742409delT	ENSP00000339587:p.Lys409fs	70.0	0.0	0		120.0	75.0	0.625	NM_001127453	A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Frame_Shift_Del	DEL	ENST00000342947.3	hg19	CCDS5389.1																																																																																			.	.	.	none		0.502	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214060.2	NM_004403	
MAGI1	9223	hgsc.bcm.edu	37	3	65342733	65342733	+	Frame_Shift_Del	DEL	G	G	-			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr3:65342733delG	ENST00000402939.2	-	23	3708	c.3709delC	c.(3709-3711)cggfs	p.R1237fs	RP11-88H12.2_ENST00000602316.1_RNA|MAGI1_ENST00000330909.8_3'UTR	NM_001033057.1	NP_001028229.1	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	1266					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		GGATGCTGCCGGCGGTCGGGC	0.622																																					p.R1237fs		Atlas-Indel,Pindel	.											.	MAGI1	481	.	0			c.3710delG						PASS	.						70.0	73.0	72.0					3																	65342733		2203	4300	6503	SO:0001589	frameshift_variant	9223	exon23			.	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000402939.2:c.3709delC	chr3.hg19:g.65342733delG	ENSP00000385450:p.Arg1237fs	93.0	0.0	0		107.0	40.0	0.373832	NM_001033057	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Frame_Shift_Del	DEL	ENST00000402939.2	hg19	CCDS33780.1																																																																																			.	.	.	none		0.622	MAGI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349126.1	NM_004742	
ZNF582	147948	hgsc.bcm.edu	37	19	56895643	56895643	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr19:56895643delT	ENST00000301310.4	-	5	1301	c.1143delA	c.(1141-1143)caafs	p.Q381fs	ZNF582_ENST00000586929.1_Frame_Shift_Del_p.Q381fs	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	381					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		GTTGCTTGAGTTGTGAGCTCA	0.428																																					p.L382fs	Ovarian(183;1887 2032 4349 30507 51343)	Atlas-Indel,Pindel	.											.	ZNF582	56	.	0			c.1144delC						PASS	.						99.0	97.0	97.0					19																	56895643		2203	4300	6503	SO:0001589	frameshift_variant	147948	exon5			.	AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.1143delA	chr19.hg19:g.56895643delT	ENSP00000301310:p.Gln381fs	125.0	0.0	0		93.0	46.0	0.494624	NM_144690	B4DQZ9|B7Z9R3|Q6PJT6	Frame_Shift_Del	DEL	ENST00000301310.4	hg19	CCDS33121.1																																																																																			.	.	.	none		0.428	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458387.2	NM_144690	
USP25	29761	hgsc.bcm.edu	37	21	17214827	17214829	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr21:17214827_17214829delGAA	ENST00000285679.6	+	18	2674_2676	c.2305_2307delGAA	c.(2305-2307)gaadel	p.E769del	USP25_ENST00000351097.5_Intron|USP25_ENST00000400183.2_In_Frame_Del_p.E769del|USP25_ENST00000285681.2_In_Frame_Del_p.E769del	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	769					cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		ACATGAGCATGAAGATAAAAGTC	0.404																																					p.768_769del		Atlas-Indel,Pindel	.											.	USP25	156	.	0			c.2304_2306del						PASS	.																																			SO:0001651	inframe_deletion	29761	exon18			.	AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.2305_2307delGAA	chr21.hg19:g.17214827_17214829delGAA	ENSP00000285679:p.Glu769del	178.0	0.0	0		217.0	125.0	0.576037	NM_013396	C0LSZ0|Q6DHZ9|Q9H9W1	In_Frame_Del	DEL	ENST00000285679.6	hg19	CCDS33515.1																																																																																			.	.	.	none		0.404	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1		
ZSWIM8	23053	hgsc.bcm.edu	37	10	75548546	75548546	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr10:75548546delT	ENST00000605216.1	+	2	544	c.327delT	c.(325-327)gctfs	p.A109fs	ZSWIM8_ENST00000603114.1_Frame_Shift_Del_p.A109fs|ZSWIM8_ENST00000604729.1_Frame_Shift_Del_p.A109fs|ZSWIM8_ENST00000398706.2_Frame_Shift_Del_p.A109fs|ZSWIM8_ENST00000604524.1_Frame_Shift_Del_p.A109fs	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	109							zinc ion binding (GO:0008270)										TCCGAATTGCTTTTTGGAGCT	0.527																																					p.A109fs		Atlas-Indel,Pindel	.											.	.	.	.	0			c.326delC						PASS	.						71.0	69.0	70.0					10																	75548546		1931	4131	6062	SO:0001589	frameshift_variant	23053	exon2			.	BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.327delT	chr10.hg19:g.75548546delT	ENSP00000474748:p.Ala109fs	56.0	0.0	0		56.0	19.0	0.339286	NM_015037	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Frame_Shift_Del	DEL	ENST00000605216.1	hg19																																																																																				.	.	.	none		0.527	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000468545.1	NM_001242487	
STXBP5L	9515	hgsc.bcm.edu	37	3	121100364	121100367	+	Frame_Shift_Del	DEL	ATGG	ATGG	-			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	ATGG	ATGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr3:121100364_121100367delATGG	ENST00000273666.6	+	23	2915_2918	c.2644_2647delATGG	c.(2644-2649)atggtafs	p.MV882fs	STXBP5L_ENST00000471454.1_Frame_Shift_Del_p.MV858fs|STXBP5L_ENST00000497029.1_Frame_Shift_Del_p.MV856fs|STXBP5L_ENST00000472879.1_Frame_Shift_Del_p.MV858fs|STXBP5L_ENST00000492541.1_Frame_Shift_Del_p.MV882fs	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	882					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		AGAGCCAGTCATGGTATTGCCAAG	0.353																																					p.881_882del		Atlas-Indel,Pindel	.											.	STXBP5L	159	.	0			c.2643_2646del						PASS	.																																			SO:0001589	frameshift_variant	9515	exon23			.	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.2644_2647delATGG	chr3.hg19:g.121100364_121100367delATGG	ENSP00000273666:p.Met882fs	75.0	0.0	0		118.0	31.0	0.262712	NM_014980	Q4G1B4|Q6PIC3	Frame_Shift_Del	DEL	ENST00000273666.6	hg19	CCDS43137.1																																																																																			.	.	.	none		0.353	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3		
ARID1A	8289	hgsc.bcm.edu	37	1	27105645	27105645	+	Frame_Shift_Del	DEL	G	G	-			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr1:27105645delG	ENST00000324856.7	+	20	5627	c.5256delG	c.(5254-5256)aagfs	p.K1752fs	ARID1A_ENST00000540690.1_Frame_Shift_Del_p.K80fs|ARID1A_ENST00000457599.2_Frame_Shift_Del_p.K1535fs|ARID1A_ENST00000374152.2_Frame_Shift_Del_p.K1369fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1752					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GGTTCAGCAAGGTGTCTAGTC	0.473			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.K1752fs		Atlas-Indel,Pindel	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	842	.	0			c.5255delA						PASS	.						84.0	88.0	87.0					1																	27105645		2203	4300	6503	SO:0001589	frameshift_variant	8289	exon20			.	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5256delG	chr1.hg19:g.27105645delG	ENSP00000320485:p.Lys1752fs	136.0	0.0	0		130.0	55.0	0.423077	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Del	DEL	ENST00000324856.7	hg19	CCDS285.1																																																																																			.	.	.	none		0.473	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
CFC1	55997	hgsc.bcm.edu	37	2	131356313	131356313	+	Frame_Shift_Del	DEL	G	G	-			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr2:131356313delG	ENST00000259216.4	-	3	411	c.149delC	c.(148-150)ccgfs	p.P50fs		NM_032545.3	NP_115934.1	P0CG37	CFC1_HUMAN	cripto, FRL-1, cryptic family 1	50					determination of left/right symmetry (GO:0007368)|gastrulation (GO:0007369)|nodal signaling pathway (GO:0038092)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nodal binding (GO:0038100)			endometrium(1)|lung(4)	5	Colorectal(110;0.1)					CCAGTTGAGCGGTGACTGTCG	0.557																																					p.P50fs		Pindel	.											.	CFC1	14	.	0			c.150delG						PASS	.						13.0	20.0	18.0					2																	131356313		2172	4248	6420	SO:0001589	frameshift_variant	55997	exon3			.	AF312769	CCDS2162.1, CCDS74573.1, CCDS74574.1	2q21.2	2014-02-04			ENSG00000136698	ENSG00000136698			18292	protein-coding gene	gene with protein product		605194	"""heterotaxy 2 (autosomal dominant)"""	HTX2		11062482, 10858660	Standard	NM_032545		Approved	CRYPTIC, HTX2	uc002tro.2	P0CG37	OTTHUMG00000131628	ENST00000259216.4:c.149delC	chr2.hg19:g.131356313delG	ENSP00000259216:p.Pro50fs	957.0	0.0	.		1015.0	120.0	0.118	NM_001270420	B2RCY0|B9EJD3|Q53T05|Q9GZR3	Frame_Shift_Del	DEL	ENST00000259216.4	hg19	CCDS2162.1																																																																																			.	.	.	none		0.557	CFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333367.1	NM_032545	
CFC1B	653275	hgsc.bcm.edu	37	2	131279604	131279604	+	Frame_Shift_Del	DEL	C	C	-			TCGA-UZ-A9Q0-01A-12D-A42J-10	TCGA-UZ-A9Q0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1ade8c1b-f1d7-49ad-a7f1-d7b91dd79670	43bffa96-ab4f-4ba3-b15b-918e180d7be6	g.chr2:131279604delC	ENST00000281882.3	+	3	436	c.148delC	c.(148-150)ccgfs	p.P50fs	AC013269.3_ENST00000450486.1_RNA	NM_001079530.1	NP_001072998.1	P0CG36	CFC1B_HUMAN	cripto, FRL-1, cryptic family 1B	50					gastrulation (GO:0007369)	extracellular region (GO:0005576)						Colorectal(110;0.1)					CCGACAGTCACCGCTCAACTG	0.547																																					p.S49fs		Pindel	.											.	.	.	.	0			c.147delA						PASS	.						5.0	1.0	5.0					2																	131279604		353	34	387	SO:0001589	frameshift_variant	653275	exon3			.		CCDS33286.1	2q21.1	2008-09-04			ENSG00000152093	ENSG00000152093			33983	protein-coding gene	gene with protein product							Standard	NM_001079530		Approved		uc002trl.2	P0CG36	OTTHUMG00000153959	ENST00000281882.3:c.148delC	chr2.hg19:g.131279604delC	ENSP00000281882:p.Pro50fs	396.0	0.0	.		381.0	39.0	0.102	NM_001079530	B2RCY0|B9EJD3|Q53T05|Q9GZR3	Frame_Shift_Del	DEL	ENST00000281882.3	hg19	CCDS33286.1																																																																																			.	.	.	none		0.547	CFC1B-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254521.1	NM_001079530	
