#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PLEKHG5	57449	hgsc.bcm.edu	37	1	6556604	6556604	+	Silent	SNP	C	C	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr1:6556604C>T	ENST00000400915.3	-	2	96	c.30G>A	c.(28-30)aaG>aaA	p.K10K	PLEKHG5_ENST00000537245.1_Silent_p.K33K|PLEKHG5_ENST00000377740.3_Silent_p.K31K|PLEKHG5_ENST00000377732.1_5'UTR|PLEKHG5_ENST00000377748.1_Silent_p.K31K|PLEKHG5_ENST00000377737.2_5'UTR|PLEKHG5_ENST00000544978.1_5'UTR	NM_001042663.1	NP_001036128.1	O94827	PKHG5_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 5	10					apoptotic signaling pathway (GO:0097190)|endothelial cell chemotaxis (GO:0035767)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		AGCGCAGTCCCTTCTTTTCAG	0.711																																					p.K33K		Atlas-SNP	.											.	PLEKHG5	66	.	0			c.G99A						PASS	.						36.0	40.0	39.0					1																	6556604		1918	4113	6031	SO:0001819	synonymous_variant	57449	exon2			CAGTCCCTTCTTT	AK024676	CCDS79.1, CCDS41240.1, CCDS41241.1, CCDS57967.1, CCDS57968.1, CCDS57969.1	1p36.31	2014-09-17		2005-08-09	ENSG00000171680	ENSG00000171680		"""Pleckstrin homology (PH) domain containing"""	29105	protein-coding gene	gene with protein product	"""synectin-binding guanine exchange factor"""	611101				17564964	Standard	NM_001042663		Approved	KIAA0720, Syx, GEF720, Tech	uc010nzr.1	O94827	OTTHUMG00000000905	ENST00000400915.3:c.30G>A	chr1.hg19:g.6556604C>T		174.0	0.0	.		214.0	82.0	.	NM_001265592	B3KU07|B7Z2M3|B7Z5X2|F5GZ21|F5H1I0|Q5SY17|Q5T8W5|Q5T8W9|Q6ZNM0|Q7Z436|Q86YD8|Q96BS1	Silent	SNP	ENST00000400915.3	hg19	CCDS41241.1																																																																																			.	.	.	none		0.711	PLEKHG5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000002631.1	NM_020631	
KAZN	23254	hgsc.bcm.edu	37	1	15438985	15438985	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr1:15438985C>T	ENST00000376030.2	+	14	2405	c.2111C>T	c.(2110-2112)aCg>aTg	p.T704M		NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein	704					keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						TCCAGCGTCACGCGGGCAGGA	0.602																																					p.T704M		Atlas-SNP	.											.	KAZN	57	.	0			c.C2111T						PASS	.						35.0	34.0	34.0					1																	15438985		2203	4298	6501	SO:0001583	missense	23254	exon14			GCGTCACGCGGGC	AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.2111C>T	chr1.hg19:g.15438985C>T	ENSP00000365198:p.Thr704Met	284.0	0.0	.		349.0	137.0	.	NM_201628	B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	Missense_Mutation	SNP	ENST00000376030.2	hg19	CCDS152.2	.	.	.	.	.	.	.	.	.	.	C	15.00	2.704557	0.48412	.	.	ENSG00000189337	ENST00000376030	T	0.18174	2.23	5.52	5.52	0.82312	.	0.568180	0.15933	N	0.237585	T	0.16171	0.0389	N	0.19112	0.55	0.80722	D	1	D	0.65815	0.995	P	0.46339	0.513	T	0.02294	-1.1181	10	0.46703	T	0.11	-15.1435	14.97	0.71226	0.0:1.0:0.0:0.0	.	704	Q674X7	KAZRN_HUMAN	M	704	ENSP00000365198:T704M	ENSP00000365198:T704M	T	+	2	0	KAZN	15311572	0.897000	0.30589	0.951000	0.38953	0.622000	0.37654	3.734000	0.55037	2.591000	0.87537	0.650000	0.86243	ACG	.	.	.	none		0.602	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005690.2	NM_001017999	
XPR1	9213	hgsc.bcm.edu	37	1	180843044	180843044	+	Missense_Mutation	SNP	A	A	C			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr1:180843044A>C	ENST00000367590.4	+	13	1972	c.1774A>C	c.(1774-1776)Att>Ctt	p.I592L	XPR1_ENST00000367589.3_Missense_Mutation_p.I527L	NM_004736.3	NP_004727.2	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor 1	592	EXS. {ECO:0000255|PROSITE- ProRule:PRU00712}.				G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			breast(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	35						TGGGGACATCATTGCTACTGT	0.393																																					p.I592L		Atlas-SNP	.											.	XPR1	76	.	0			c.A1774C						PASS	.						128.0	111.0	116.0					1																	180843044		2203	4300	6503	SO:0001583	missense	9213	exon13			GACATCATTGCTA	AF099082	CCDS1340.1, CCDS44284.1	1q25.1	2013-07-18	2010-04-23		ENSG00000143324	ENSG00000143324			12827	protein-coding gene	gene with protein product		605237	"""xenotropic and polytropic retrovirus receptor"""			9990033	Standard	NM_004736		Approved	SYG1, X3	uc001goi.3	Q9UBH6	OTTHUMG00000035116	ENST00000367590.4:c.1774A>C	chr1.hg19:g.180843044A>C	ENSP00000356562:p.Ile592Leu	74.0	0.0	.		72.0	32.0	.	NM_004736	O95719|Q7L8K9|Q8IW20|Q9NT19|Q9UFB9	Missense_Mutation	SNP	ENST00000367590.4	hg19	CCDS1340.1	.	.	.	.	.	.	.	.	.	.	A	10.13	1.266946	0.23136	.	.	ENSG00000143324	ENST00000367590;ENST00000367589	T;T	0.39787	1.06;1.06	5.43	4.31	0.51392	EXS, C-terminal (2);	0.170586	0.51477	D	0.000092	T	0.19604	0.0471	N	0.04636	-0.2	0.27836	N	0.941287	B;B	0.11235	0.001;0.004	B;B	0.11329	0.003;0.006	T	0.17319	-1.0373	10	0.14656	T	0.56	-10.892	10.5361	0.45004	0.9236:0.0:0.0764:0.0	.	527;592	Q9UBH6-2;Q9UBH6	.;XPR1_HUMAN	L	592;527	ENSP00000356562:I592L;ENSP00000356561:I527L	ENSP00000356561:I527L	I	+	1	0	XPR1	179109667	1.000000	0.71417	1.000000	0.80357	0.680000	0.39746	1.548000	0.36201	0.925000	0.37094	0.528000	0.53228	ATT	.	.	.	none		0.393	XPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084996.2	NM_004736	
SYT2	127833	hgsc.bcm.edu	37	1	202572220	202572220	+	Silent	SNP	C	C	G			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr1:202572220C>G	ENST00000367267.1	-	4	564	c.372G>C	c.(370-372)ctG>ctC	p.L124L	SYT2_ENST00000367268.4_Silent_p.L124L|RP11-569A11.1_ENST00000428573.1_RNA	NM_001136504.1	NP_001129976.1	Q8N9I0	SYT2_HUMAN	synaptotagmin II	124					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	29			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	CCCCCTCAGTCAGGCCTGTCT	0.547																																					p.L124L		Atlas-SNP	.											.	SYT2	51	.	0			c.G372C						PASS	.						128.0	111.0	117.0					1																	202572220		2203	4300	6503	SO:0001819	synonymous_variant	127833	exon4			CTCAGTCAGGCCT	AK090672	CCDS1427.1	1q32.1	2013-01-21			ENSG00000143858	ENSG00000143858		"""Synaptotagmins"""	11510	protein-coding gene	gene with protein product		600104				7749232	Standard	NM_177402		Approved		uc010pqb.2	Q8N9I0	OTTHUMG00000041388	ENST00000367267.1:c.372G>C	chr1.hg19:g.202572220C>G		68.0	0.0	.		100.0	41.0	.	NM_177402	Q496K5|Q8NBE5	Silent	SNP	ENST00000367267.1	hg19	CCDS1427.1																																																																																			.	.	.	none		0.547	SYT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099157.1	NM_177402	
ADAM17	6868	hgsc.bcm.edu	37	2	9666345	9666345	+	Silent	SNP	A	A	G			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr2:9666345A>G	ENST00000310823.3	-	6	830	c.648T>C	c.(646-648)gcT>gcC	p.A216A	ADAM17_ENST00000497134.1_Silent_p.A216A	NM_003183.4	NP_003174.3	P78536	ADA17_HUMAN	ADAM metallopeptidase domain 17	216					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell motility (GO:0048870)|collagen catabolic process (GO:0030574)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|germinal center formation (GO:0002467)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil mediated immunity (GO:0002446)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of chemokine production (GO:0032722)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|proteolysis (GO:0006508)|regulation of mast cell apoptotic process (GO:0033025)|response to drug (GO:0042493)|response to high density lipoprotein particle (GO:0055099)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|wound healing, spreading of epidermal cells (GO:0035313)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|interleukin-6 receptor binding (GO:0005138)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|Notch binding (GO:0005112)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)			breast(1)|cervix(4)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	28	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		GATCTGGGTCAGCTCTTCTTT	0.368																																					p.A216A		Atlas-SNP	.											.	ADAM17	61	.	0			c.T648C						PASS	.						173.0	153.0	160.0					2																	9666345		2203	4300	6503	SO:0001819	synonymous_variant	6868	exon6			TGGGTCAGCTCTT	U69611	CCDS1665.1	2p25	2010-08-05	2008-07-31		ENSG00000151694	ENSG00000151694		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	195	protein-coding gene	gene with protein product		603639	"""tumor necrosis factor, alpha, converting enzyme"""	TACE		9034190, 9574564	Standard	NM_003183		Approved	cSVP, CD156B	uc002qzu.3	P78536	OTTHUMG00000090425	ENST00000310823.3:c.648T>C	chr2.hg19:g.9666345A>G		54.0	0.0	.		77.0	21.0	.	NM_003183	O60226	Silent	SNP	ENST00000310823.3	hg19	CCDS1665.1																																																																																			.	.	.	none		0.368	ADAM17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206857.1		
ARID5A	10865	hgsc.bcm.edu	37	2	97217448	97217448	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr2:97217448C>A	ENST00000357485.3	+	7	1261	c.1183C>A	c.(1183-1185)Cgc>Agc	p.R395S	ARID5A_ENST00000454558.2_Missense_Mutation_p.R327S	NM_212481.1	NP_997646.1	Q03989	ARI5A_HUMAN	AT rich interactive domain 5A (MRF1-like)	395					chondrocyte differentiation (GO:0002062)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|skin(1)|urinary_tract(2)	14						AGACGCTAACCGCCCTTCTGC	0.597																																					p.R395S		Atlas-SNP	.											.	ARID5A	31	.	0			c.C1183A						PASS	.						37.0	33.0	35.0					2																	97217448		2203	4299	6502	SO:0001583	missense	10865	exon7			GCTAACCGCCCTT	M62324	CCDS33251.1	2p11.1	2013-02-07			ENSG00000196843	ENSG00000196843		"""-"""	17361	protein-coding gene	gene with protein product	"""modulator recognition factor 1"""	611583				8649988	Standard	NM_212481		Approved	MRF-1, RP11-363D14	uc002swe.3	Q03989	OTTHUMG00000155229	ENST00000357485.3:c.1183C>A	chr2.hg19:g.97217448C>A	ENSP00000350078:p.Arg395Ser	153.0	0.0	.		159.0	64.0	.	NM_212481	Q6NX37	Missense_Mutation	SNP	ENST00000357485.3	hg19	CCDS33251.1	.	.	.	.	.	.	.	.	.	.	C	14.75	2.628516	0.46944	.	.	ENSG00000196843	ENST00000357485;ENST00000359765;ENST00000454558	T	0.66638	-0.22	5.22	5.22	0.72569	.	0.267002	0.27193	N	0.020484	T	0.63954	0.2555	L	0.57536	1.79	0.30657	N	0.754762	P;B;B	0.44090	0.826;0.36;0.135	B;B;B	0.43155	0.41;0.04;0.081	T	0.64101	-0.6486	10	0.17369	T	0.5	-20.5478	14.6192	0.68572	0.0:1.0:0.0:0.0	.	395;327;395	A6NM59;C9J1Q0;Q03989	.;.;ARI5A_HUMAN	S	395;395;327	ENSP00000350078:R395S	ENSP00000350078:R395S	R	+	1	0	ARID5A	96581175	0.057000	0.20700	0.976000	0.42696	0.578000	0.36192	3.330000	0.52068	2.588000	0.87417	0.655000	0.94253	CGC	.	.	.	none		0.597	ARID5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338888.2	NM_212481	
BOLL	66037	hgsc.bcm.edu	37	2	198643755	198643755	+	Silent	SNP	C	C	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr2:198643755C>T	ENST00000392296.4	-	3	474	c.165G>A	c.(163-165)caG>caA	p.Q55Q	BOLL_ENST00000433157.1_Silent_p.Q55Q|BOLL_ENST00000321801.7_Silent_p.Q67Q|BOLL_ENST00000430004.1_Silent_p.Q55Q|BOLL_ENST00000282278.8_5'UTR	NM_033030.5	NP_149019.1	Q8N9W6	BOLL_HUMAN	boule-like RNA-binding protein	55	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|positive regulation of translational initiation (GO:0045948)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|translation activator activity (GO:0008494)			central_nervous_system(1)|endometrium(2)|lung(6)|ovary(3)|prostate(1)	13						CAGACCCATACTGGGAAAAAA	0.308																																					p.Q67Q		Atlas-SNP	.											.	BOLL	67	.	0			c.G201A						PASS	.						90.0	91.0	91.0					2																	198643755		2202	4299	6501	SO:0001819	synonymous_variant	66037	exon3			CCCATACTGGGAA		CCDS2324.1, CCDS2325.1, CCDS63081.1	2q33	2013-10-17	2013-10-17		ENSG00000152430	ENSG00000152430		"""RNA binding motif (RRM) containing"""	14273	protein-coding gene	gene with protein product		606165	"""bol (Drosophila boule homolog)-like"", ""bol, boule-like (Drosophila)"""			11390979, 16001084	Standard	NM_197970		Approved	BOULE	uc002uut.2	Q8N9W6	OTTHUMG00000132747	ENST00000392296.4:c.165G>A	chr2.hg19:g.198643755C>T		73.0	0.0	.		79.0	32.0	.	NM_197970	B4DZA4|Q0JW32|Q53T62|Q969U3	Silent	SNP	ENST00000392296.4	hg19	CCDS2325.1																																																																																			.	.	.	none		0.308	BOLL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256107.3	NM_033030	
CCR9	10803	hgsc.bcm.edu	37	3	45942933	45942933	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr3:45942933A>T	ENST00000357632.2	+	3	833	c.653A>T	c.(652-654)aAg>aTg	p.K218M	CCR9_ENST00000355983.2_Missense_Mutation_p.K206M|CCR9_ENST00000422395.1_3'UTR|LZTFL1_ENST00000536047.1_Intron|Y_RNA_ENST00000364765.1_RNA|CCR9_ENST00000395963.2_Missense_Mutation_p.K206M|LZTFL1_ENST00000539217.1_Intron	NM_001256369.1|NM_031200.2	NP_001243298.1|NP_112477.1	P51686	CCR9_HUMAN	chemokine (C-C motif) receptor 9	218					cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(4)|large_intestine(8)|lung(2)|ovary(2)|prostate(2)|skin(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.00118)|KIRC - Kidney renal clear cell carcinoma(197;0.0182)|Kidney(197;0.0214)		TTGACCCTGAAGGTCATTCTG	0.478																																					p.K218M		Atlas-SNP	.											.	CCR9	45	.	0			c.A653T						PASS	.						190.0	169.0	176.0					3																	45942933		2203	4300	6503	SO:0001583	missense	10803	exon3			CCCTGAAGGTCAT	AJ132337	CCDS2732.1, CCDS2733.1	3p21.31	2012-09-20			ENSG00000173585	ENSG00000173585		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1610	protein-coding gene	gene with protein product		604738		GPR28		10229797	Standard	NM_006641		Approved	GPR-9-6, CDw199	uc003coz.2	P51686	OTTHUMG00000133450	ENST00000357632.2:c.653A>T	chr3.hg19:g.45942933A>T	ENSP00000350256:p.Lys218Met	86.0	0.0	.		124.0	51.0	.	NM_031200	Q4VBM3|Q549E0|Q9UQQ6	Missense_Mutation	SNP	ENST00000357632.2	hg19	CCDS2732.1	.	.	.	.	.	.	.	.	.	.	A	19.70	3.876744	0.72180	.	.	ENSG00000173585	ENST00000357632;ENST00000395963;ENST00000355983	T;T;T	0.72051	-0.62;-0.62;-0.62	4.96	3.82	0.43975	GPCR, rhodopsin-like superfamily (1);	8.991370	0.00357	N	0.000032	T	0.72495	0.3467	N	0.12853	0.265	0.46609	D	0.999123	P	0.49961	0.93	P	0.62014	0.897	T	0.64478	-0.6398	10	0.41790	T	0.15	.	10.0158	0.42014	0.9208:0.0:0.0792:0.0	.	218	P51686	CCR9_HUMAN	M	218;206;206	ENSP00000350256:K218M;ENSP00000379292:K206M;ENSP00000348260:K206M	ENSP00000348260:K206M	K	+	2	0	CCR9	45917937	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.324000	0.72896	1.858000	0.53909	0.460000	0.39030	AAG	.	.	.	none		0.478	CCR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257323.2		
CEP135	9662	hgsc.bcm.edu	37	4	56818348	56818348	+	Nonsense_Mutation	SNP	C	C	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr4:56818348C>T	ENST00000257287.4	+	2	176	c.52C>T	c.(52-54)Cag>Tag	p.Q18*	CEP135_ENST00000422247.2_Nonsense_Mutation_p.Q18*	NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	18					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					AAGGCTGGATCAGCTGGGATA	0.363																																					p.Q18X		Atlas-SNP	.											.	CEP135	115	.	0			c.C52T						PASS	.						62.0	66.0	64.0					4																	56818348		2203	4300	6503	SO:0001587	stop_gained	9662	exon2			CTGGATCAGCTGG	AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.52C>T	chr4.hg19:g.56818348C>T	ENSP00000257287:p.Gln18*	413.0	0.0	.		463.0	172.0	.	NM_025009	B2RMY0|O75130|Q58F25|Q9H8H7	Nonsense_Mutation	SNP	ENST00000257287.4	hg19	CCDS33986.1	.	.	.	.	.	.	.	.	.	.	C	36	5.700451	0.96802	.	.	ENSG00000174799	ENST00000422247;ENST00000257287	.	.	.	5.88	5.03	0.67393	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	16.9683	0.86293	0.0:0.8722:0.1278:0.0	.	.	.	.	X	18	.	ENSP00000257287:Q18X	Q	+	1	0	CEP135	56513105	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.794000	0.85869	1.471000	0.48121	0.655000	0.94253	CAG	.	.	.	none		0.363	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	NM_025009	
RPS3A	6189	hgsc.bcm.edu	37	4	152021725	152021725	+	Silent	SNP	A	A	C			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr4:152021725A>C	ENST00000274065.4	+	2	231	c.151A>C	c.(151-153)Agg>Cgg	p.R51R	SNORD73_ENST00000364394.1_RNA|RPS3A_ENST00000506126.1_Silent_p.R14R|RPS3A_ENST00000509736.1_Intron|RPS3A_ENST00000514682.1_Silent_p.R14R|RPS3A_ENST00000512690.1_Silent_p.R51R|RPS3A_ENST00000322686.6_Silent_p.R38R	NM_001006.4	NP_000997.1			ribosomal protein S3A											endometrium(1)|lung(1)|ovary(1)|pancreas(1)	4	all_hematologic(180;0.093)					GCTCGTCACCAGGACCCAAGG	0.398																																					p.R51R		Atlas-SNP	.											.	RPS3A	11	.	0			c.A151C						PASS	.						72.0	78.0	76.0					4																	152021725		2203	4300	6503	SO:0001819	synonymous_variant	6189	exon2			GTCACCAGGACCC	X87373	CCDS3775.1	4q31.2-q31.3	2011-04-05			ENSG00000145425	ENSG00000145425		"""S ribosomal proteins"""	10421	protein-coding gene	gene with protein product		180478		MFTL		8647443, 1398113	Standard	NM_001006		Approved	S3A	uc003ilz.4	P61247	OTTHUMG00000161445	ENST00000274065.4:c.151A>C	chr4.hg19:g.152021725A>C		45.0	0.0	.		72.0	33.0	.	NM_001006		Silent	SNP	ENST00000274065.4	hg19	CCDS3775.1																																																																																			.	.	.	none		0.398	RPS3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364957.1		
RXFP1	59350	hgsc.bcm.edu	37	4	159573058	159573058	+	Missense_Mutation	SNP	G	G	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr4:159573058G>T	ENST00000307765.5	+	18	2376	c.2125G>T	c.(2125-2127)Ggt>Tgt	p.G709C	RXFP1_ENST00000470033.1_Missense_Mutation_p.G676C|RXFP1_ENST00000448688.2_Missense_Mutation_p.G604C|RXFP1_ENST00000460056.2_Missense_Mutation_p.G628C|RXFP1_ENST00000343542.5_Missense_Mutation_p.G661C	NM_001253727.1|NM_001253728.1|NM_001253730.1|NM_001253732.1|NM_001253733.1|NM_021634.3	NP_001240656.1|NP_001240657.1|NP_001240659.1|NP_001240661.1|NP_001240662.1|NP_067647.2	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	709					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|lung connective tissue development (GO:0060427)|nipple morphogenesis (GO:0060658)|parturition (GO:0007567)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)	p.G709C(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|liver(2)|lung(22)|prostate(1)|skin(10)	49	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		GGACAGCAAAGGTCAGAAAAC	0.418																																					p.G736C		Atlas-SNP	.											RXFP1,NS,carcinoma,0,1	RXFP1	98	.	1	Substitution - Missense(1)	lung(1)	c.G2206T						PASS	.						121.0	113.0	115.0					4																	159573058		1903	4111	6014	SO:0001583	missense	59350	exon18			AGCAAAGGTCAGA	AF190500	CCDS43276.1, CCDS58929.1, CCDS58930.1, CCDS75204.1, CCDS75205.1, CCDS75206.1	4q31.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000171509	ENSG00000171509		"""GPCR / Class A : Relaxin family peptide receptors"""	19718	protein-coding gene	gene with protein product		606654	"""leucine-rich repeat-containing G protein-coupled receptor 7"""	LGR7		15956688, 16507880	Standard	NM_021634		Approved	RXFPR1	uc003ipz.3	Q9HBX9	OTTHUMG00000149973	ENST00000307765.5:c.2125G>T	chr4.hg19:g.159573058G>T	ENSP00000303248:p.Gly709Cys	97.0	0.0	.		82.0	30.0	.	NM_001253727	B4DHD1|B4DTV2|Q2M215|Q3KU24|Q3KU25|Q3KU26	Missense_Mutation	SNP	ENST00000307765.5	hg19	CCDS43276.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.232792	0.39498	.	.	ENSG00000171509	ENST00000460056;ENST00000307765;ENST00000448688;ENST00000343542;ENST00000470033;ENST00000440678	T;T;T;T;T	0.70869	-0.37;-0.47;-0.33;-0.52;-0.47	5.75	3.11	0.35812	.	0.407867	0.26279	N	0.025297	T	0.65770	0.2723	L	0.51422	1.61	0.24866	N	0.992319	P;P;P;P;P;P;P;P	0.50617	0.896;0.883;0.896;0.616;0.937;0.88;0.896;0.482	B;B;B;B;P;B;B;B	0.45913	0.302;0.417;0.395;0.393;0.497;0.376;0.321;0.28	T	0.60005	-0.7347	10	0.66056	D	0.02	.	8.488	0.33082	0.2892:0.0:0.7108:0.0	.	720;736;604;661;676;628;579;709	B3KV27;B4DGP2;B4DHD1;Q9HBX9-4;Q9HBX9-2;E9PCA3;Q59H16;Q9HBX9	.;.;.;.;.;.;.;RXFP1_HUMAN	C	628;709;604;661;676;579	ENSP00000423306:G628C;ENSP00000303248:G709C;ENSP00000414885:G604C;ENSP00000345889:G661C;ENSP00000420712:G676C	ENSP00000303248:G709C	G	+	1	0	RXFP1	159792508	0.580000	0.26733	0.981000	0.43875	0.525000	0.34531	0.400000	0.20932	0.779000	0.33543	0.655000	0.94253	GGT	.	.	.	none		0.418	RXFP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314865.1	NM_021634	
SGTB	54557	hgsc.bcm.edu	37	5	65016544	65016544	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr5:65016544T>C	ENST00000381007.4	-	2	326	c.91A>G	c.(91-93)Agt>Ggt	p.S31G	NLN_ENST00000502464.1_5'Flank|NLN_ENST00000380985.5_5'Flank	NM_019072.2	NP_061945.1	Q96EQ0	SGTB_HUMAN	small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta	31										large_intestine(3)|lung(3)|skin(3)	9		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Ovarian(174;0.0545)|Breast(144;0.174)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0657)|Lung(70;0.00487)		CCTTCCAAACTTTCTTGTTCA	0.353																																					p.S31G		Atlas-SNP	.											.	SGTB	22	.	0			c.A91G						PASS	.						105.0	106.0	105.0					5																	65016544		2203	4300	6503	SO:0001583	missense	54557	exon2			CCAAACTTTCTTG	AK096321	CCDS3988.1	5q12.3	2013-01-10			ENSG00000197860	ENSG00000197860		"""Tetratricopeptide (TTC) repeat domain containing"""	23567	protein-coding gene	gene with protein product						12477932	Standard	XM_005248548		Approved	Sgt2, FLJ39002	uc003jud.3	Q96EQ0	OTTHUMG00000097801	ENST00000381007.4:c.91A>G	chr5.hg19:g.65016544T>C	ENSP00000370395:p.Ser31Gly	73.0	0.0	.		103.0	49.0	.	NM_019072		Missense_Mutation	SNP	ENST00000381007.4	hg19	CCDS3988.1	.	.	.	.	.	.	.	.	.	.	T	13.30	2.197350	0.38806	.	.	ENSG00000197860	ENST00000381007;ENST00000506816	T;T	0.68181	-0.31;-0.23	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.66713	0.2817	M	0.62723	1.935	0.80722	D	1	B	0.27679	0.185	B	0.32342	0.144	T	0.67393	-0.5682	10	0.56958	D	0.05	-12.5719	14.3443	0.66649	0.0:0.0:0.0:1.0	.	31	Q96EQ0	SGTB_HUMAN	G	31	ENSP00000370395:S31G;ENSP00000421447:S31G	ENSP00000370395:S31G	S	-	1	0	SGTB	65052300	1.000000	0.71417	1.000000	0.80357	0.490000	0.33462	6.128000	0.71650	2.020000	0.59435	0.455000	0.32223	AGT	.	.	.	none		0.353	SGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215057.2	NM_019072	
OTP	23440	hgsc.bcm.edu	37	5	76926470	76926470	+	Silent	SNP	C	C	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr5:76926470C>T	ENST00000306422.3	-	3	1735	c.597G>A	c.(595-597)ctG>ctA	p.L199L		NM_032109.2	NP_115485.1	Q5XKR4	OTP_HUMAN	orthopedia homeobox	199					forebrain neuron differentiation (GO:0021879)|hypothalamus cell differentiation (GO:0021979)|neurohypophysis development (GO:0021985)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)	13		all_lung(232;0.00051)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;9.04e-51)|Epithelial(54;1.62e-45)|all cancers(79;4.4e-41)		GGAAAGAGCACAGGCTGTCGC	0.741																																					p.L199L		Atlas-SNP	.											.	OTP	29	.	0			c.G597A						PASS	.						4.0	5.0	5.0					5																	76926470		1672	3596	5268	SO:0001819	synonymous_variant	23440	exon3			AGAGCACAGGCTG		CCDS4039.1	5q14.1	2011-06-20	2007-02-15		ENSG00000171540	ENSG00000171540		"""Homeoboxes / PRD class"""	8518	protein-coding gene	gene with protein product		604529	"""orthopedia homolog (Drosophila)"""			10458915	Standard	NM_032109		Approved		uc003kfg.3	Q5XKR4	OTTHUMG00000102171	ENST00000306422.3:c.597G>A	chr5.hg19:g.76926470C>T		46.0	0.0	.		61.0	23.0	.	NM_032109		Silent	SNP	ENST00000306422.3	hg19	CCDS4039.1																																																																																			.	.	.	none		0.741	OTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220016.2		
ZFYVE16	9765	hgsc.bcm.edu	37	5	79743873	79743873	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr5:79743873C>T	ENST00000338008.5	+	7	2933	c.2753C>T	c.(2752-2754)tCt>tTt	p.S918F	ZFYVE16_ENST00000505560.1_Missense_Mutation_p.S918F|ZFYVE16_ENST00000510158.1_Missense_Mutation_p.S918F	NM_001284236.1|NM_014733.3	NP_001271165.1|NP_055548	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	918					BMP signaling pathway (GO:0030509)|endosomal transport (GO:0016197)|protein targeting to lysosome (GO:0006622)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|intracellular membrane-bounded organelle (GO:0043231)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein transporter activity (GO:0008565)			breast(4)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|liver(1)|lung(6)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		CATTCCCATTCTACTACAGTG	0.323																																					p.S918F	Melanoma(150;1452 1854 16018 17851 37292)	Atlas-SNP	.											.	ZFYVE16	100	.	0			c.C2753T						PASS	.						71.0	70.0	70.0					5																	79743873		2203	4300	6503	SO:0001583	missense	9765	exon8			CCCATTCTACTAC	AB002303	CCDS4050.1	5q14.1	2012-09-20			ENSG00000039319	ENSG00000039319		"""Zinc fingers, FYVE domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20756	protein-coding gene	gene with protein product	"""endofin"", ""protein phosphatase 1, regulatory subunit 69"""	608880				11546807	Standard	NM_014733		Approved	KIAA0305, PPP1R69	uc003kgq.4	Q7Z3T8	OTTHUMG00000108178	ENST00000338008.5:c.2753C>T	chr5.hg19:g.79743873C>T	ENSP00000337159:p.Ser918Phe	117.0	0.0	.		116.0	43.0	.	NM_001105251	O15023|Q5H9U2|Q7LAU7|Q86T69|Q8N5L3|Q8NEK3	Missense_Mutation	SNP	ENST00000338008.5	hg19	CCDS4050.1	.	.	.	.	.	.	.	.	.	.	C	12.75	2.031051	0.35797	.	.	ENSG00000039319	ENST00000338008;ENST00000510158;ENST00000505560	T;T;T	0.40476	1.03;1.03;1.03	5.43	4.56	0.56223	.	0.218052	0.32901	N	0.005502	T	0.38746	0.1052	M	0.62723	1.935	0.24063	N	0.996004	B	0.15473	0.013	B	0.10450	0.005	T	0.39881	-0.9592	10	0.66056	D	0.02	-5.2169	7.9596	0.30064	0.0:0.7529:0.161:0.0861	.	918	Q7Z3T8	ZFY16_HUMAN	F	918	ENSP00000337159:S918F;ENSP00000423663:S918F;ENSP00000426848:S918F	ENSP00000337159:S918F	S	+	2	0	ZFYVE16	79779629	0.001000	0.12720	0.770000	0.31555	0.998000	0.95712	0.510000	0.22723	1.440000	0.47531	0.650000	0.86243	TCT	.	.	.	none		0.323	ZFYVE16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226982.2	NM_014733	
MRS2	57380	hgsc.bcm.edu	37	6	24423170	24423170	+	Silent	SNP	T	T	C			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr6:24423170T>C	ENST00000378386.3	+	10	1206	c.1113T>C	c.(1111-1113)caT>caC	p.H371H	MRS2_ENST00000378353.1_Silent_p.H371H|MRS2_ENST00000274747.7_3'UTR|MRS2_ENST00000543597.1_Silent_p.H80H|MRS2_ENST00000443868.2_Silent_p.H374H|MRS2_ENST00000535061.1_Silent_p.H321H	NM_020662.2	NP_065713.1	Q9HD23	MRS2_HUMAN	MRS2 magnesium transporter	371						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	12						TTTAGGACCATAGAATTTTTT	0.443																																					p.H371H		Atlas-SNP	.											.	MRS2	31	.	0			c.T1113C						PASS	.						146.0	136.0	139.0					6																	24423170		2203	4300	6503	SO:0001819	synonymous_variant	57380	exon10			GGACCATAGAATT	AF288288	CCDS4552.1, CCDS69055.1, CCDS69056.1, CCDS75408.1	6p22.3-p22.1	2013-05-03	2013-05-03	2008-01-18	ENSG00000124532	ENSG00000124532			13785	protein-coding gene	gene with protein product			"""MRS2-like, magnesium homeostasis factor (S. cerevisiae)"", ""MRS2 magnesium homeostasis factor homolog (S. cerevisiae)"""	MRS2L			Standard	XM_005249242		Approved		uc003neb.3	Q9HD23	OTTHUMG00000014355	ENST00000378386.3:c.1113T>C	chr6.hg19:g.24423170T>C		54.0	0.0	.		47.0	16.0	.	NM_020662	A8K4U3|B3KNN2|B4DQL2|Q5T3Y1|Q6NTG4|Q96KF8|Q9BVP1	Silent	SNP	ENST00000378386.3	hg19	CCDS4552.1																																																																																			.	.	.	none		0.443	MRS2-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040002.1		
OPRM1	4988	hgsc.bcm.edu	37	6	154360579	154360579	+	De_novo_Start_OutOfFrame	SNP	T	T	A			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr6:154360579T>A	ENST00000330432.7	+	0	137				OPRM1_ENST00000452687.2_5'Flank|OPRM1_ENST00000360422.4_De_novo_Start_OutOfFrame|OPRM1_ENST00000414028.2_5'Flank|OPRM1_ENST00000435918.2_5'Flank|OPRM1_ENST00000428397.2_De_novo_Start_OutOfFrame|OPRM1_ENST00000434900.2_Missense_Mutation_p.L60Q|OPRM1_ENST00000520708.1_Intron|OPRM1_ENST00000337049.4_5'Flank|OPRM1_ENST00000523520.1_3'UTR|OPRM1_ENST00000518759.1_Intron|OPRM1_ENST00000229768.5_5'Flank|OPRM1_ENST00000524163.1_5'Flank|OPRM1_ENST00000419506.2_5'Flank	NM_000914.3	NP_000905.3	P35372	OPRM_HUMAN	opioid receptor, mu 1						adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CAGCAGGAGCTGTGGCAGCGG	0.617																																					p.L60Q		Atlas-SNP	.											.	OPRM1	241	.	0			c.T179A						PASS	.						27.0	40.0	36.0					6																	154360579		692	1591	2283			4988	exon3			AGGAGCTGTGGCA	L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870	ENST00000330432.7:c.-101T>A	chr6.hg19:g.154360579T>A		68.0	0.0	.		86.0	33.0	.	NM_001145279	B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Missense_Mutation	SNP	ENST00000330432.7	hg19	CCDS55070.1	.	.	.	.	.	.	.	.	.	.	T	13.40	2.225525	0.39300	.	.	ENSG00000112038	ENST00000520282;ENST00000434900	T;T	0.74632	3.71;-0.86	5.53	-5.34	0.02705	.	6.095000	0.00166	N	0.000003	T	0.28067	0.0692	N	0.08118	0	0.21020	N	0.999808	B	0.06786	0.001	B	0.08055	0.003	T	0.28650	-1.0037	10	0.72032	D	0.01	.	2.5601	0.04770	0.2319:0.4117:0.1184:0.2379	.	60	P35372-10	.	Q	15;60	ENSP00000430247:L15Q;ENSP00000394624:L60Q	ENSP00000394624:L60Q	L	+	2	0	OPRM1	154402272	0.000000	0.05858	0.005000	0.12908	0.091000	0.18340	-1.532000	0.02217	-0.475000	0.06852	0.528000	0.53228	CTG	.	.	.	none		0.617	OPRM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042786.2	NM_000914	
CNKSR3	154043	hgsc.bcm.edu	37	6	154732219	154732219	+	Silent	SNP	A	A	C			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr6:154732219A>C	ENST00000607772.1	-	11	1672	c.1128T>G	c.(1126-1128)ccT>ccG	p.P376P	CNKSR3_ENST00000479339.1_Silent_p.P296P|CNKSR3_ENST00000433165.2_Silent_p.P201P	NM_173515.2	NP_775786.2	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3	376	DUF1170.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)	cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	15		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		CCTTAGGACCAGGCAATGGTT	0.463																																					p.P376P		Atlas-SNP	.											.	CNKSR3	56	.	0			c.T1128G						PASS	.						95.0	95.0	95.0					6																	154732219		2203	4300	6503	SO:0001819	synonymous_variant	154043	exon11			AGGACCAGGCAAT	AK055911	CCDS5246.1	6q25.2	2013-01-10	2005-04-11	2005-04-11	ENSG00000153721	ENSG00000153721		"""Sterile alpha motif (SAM) domain containing"""	23034	protein-coding gene	gene with protein product			"""membrane associated guanylate kinase interacting protein-like 1"""	MAGI1			Standard	NM_173515		Approved	FLJ31349		Q6P9H4	OTTHUMG00000015873	ENST00000607772.1:c.1128T>G	chr6.hg19:g.154732219A>C		78.0	0.0	.		119.0	48.0	.	NM_173515	Q5SGD5|Q96N65	Silent	SNP	ENST00000607772.1	hg19	CCDS5246.1																																																																																			.	.	.	none		0.463	CNKSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042792.2	NM_173515	
FGFR1OP	11116	hgsc.bcm.edu	37	6	167438317	167438317	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr6:167438317A>G	ENST00000366847.4	+	9	1085	c.854A>G	c.(853-855)gAt>gGt	p.D285G	FGFR1OP_ENST00000349556.4_Missense_Mutation_p.D265G|RP11-517H2.6_ENST00000609590.1_RNA	NM_007045.2	NP_008976.1	O95684	FR1OP_HUMAN	FGFR1 oncogene partner	285					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein tyrosine kinase activity (GO:0061099)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|protein tyrosine kinase inhibitor activity (GO:0030292)			large_intestine(2)|ovary(1)|stomach(1)	4		Breast(66;1.48e-05)|Ovarian(120;0.0607)		OV - Ovarian serous cystadenocarcinoma(33;1.73e-19)|BRCA - Breast invasive adenocarcinoma(81;5.1e-06)|GBM - Glioblastoma multiforme(31;0.00231)		TCGCTCTCGGATGCACCCCCC	0.502			T	FGFR1	"""MPD, NHL"""																																p.D285G		Atlas-SNP	.		Dom	yes		6	6q27	11116	FGFR1 oncogene partner (FOP)		L	.	FGFR1OP	24	.	0			c.A854G						PASS	.						132.0	146.0	141.0					6																	167438317		2203	4300	6503	SO:0001583	missense	11116	exon9			TCTCGGATGCACC	Y18046	CCDS5296.1, CCDS5297.1, CCDS75550.1	6q27	2008-02-05			ENSG00000213066	ENSG00000213066			17012	protein-coding gene	gene with protein product		605392				9949182, 10373756	Standard	NM_007045		Approved	FOP	uc003qvj.3	O95684	OTTHUMG00000016011	ENST00000366847.4:c.854A>G	chr6.hg19:g.167438317A>G	ENSP00000355812:p.Asp285Gly	243.0	1.0	.		285.0	119.0	.	NM_007045	A8K1D1|B2R705|Q49AI0|Q5R3F6|Q96EW1	Missense_Mutation	SNP	ENST00000366847.4	hg19	CCDS5296.1	.	.	.	.	.	.	.	.	.	.	A	13.53	2.266096	0.40095	.	.	ENSG00000213066	ENST00000366847;ENST00000420493;ENST00000349556	T;T	0.31247	1.5;1.5	5.3	4.11	0.48088	.	0.629098	0.17100	N	0.187033	T	0.32823	0.0842	M	0.65975	2.015	0.09310	N	1	D;D;D	0.67145	0.996;0.984;0.973	P;P;P	0.62649	0.905;0.857;0.767	T	0.13899	-1.0492	10	0.41790	T	0.15	-15.1292	10.3254	0.43790	0.6821:0.3179:0.0:0.0	.	238;265;285	E7ET71;O95684-2;O95684	.;.;FR1OP_HUMAN	G	285;238;265	ENSP00000355812:D285G;ENSP00000230248:D265G	ENSP00000230248:D265G	D	+	2	0	FGFR1OP	167358307	0.945000	0.32115	0.000000	0.03702	0.262000	0.26303	3.526000	0.53509	0.813000	0.34350	0.443000	0.29094	GAT	.	.	.	none		0.502	FGFR1OP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043099.2	NM_007045	
AEBP1	165	hgsc.bcm.edu	37	7	44150559	44150559	+	Silent	SNP	C	C	A			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr7:44150559C>A	ENST00000223357.3	+	13	1838	c.1533C>A	c.(1531-1533)ctC>ctA	p.L511L	MIR4649_ENST00000582839.1_RNA|AEBP1_ENST00000450684.2_Silent_p.L54L	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	511	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.|Interaction with MAPK1 and MAPK3. {ECO:0000250}.|Required for DNA-binding and interaction with NFKBIA. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						TGAGTGAGCTCCCAGAGCCGG	0.637																																					p.L511L		Atlas-SNP	.											.	AEBP1	102	.	0			c.C1533A						PASS	.						93.0	85.0	87.0					7																	44150559		2203	4300	6503	SO:0001819	synonymous_variant	165	exon13			TGAGCTCCCAGAG	D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.1533C>A	chr7.hg19:g.44150559C>A		88.0	0.0	.		134.0	80.0	.	NM_001129	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Silent	SNP	ENST00000223357.3	hg19	CCDS5476.1																																																																																			.	.	.	none		0.637	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2	NM_001129	
PTPN12	5782	hgsc.bcm.edu	37	7	77256523	77256523	+	Silent	SNP	T	T	A			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr7:77256523T>A	ENST00000248594.6	+	13	1799	c.1527T>A	c.(1525-1527)acT>acA	p.T509T	PTPN12_ENST00000415482.2_Silent_p.T390T|PTPN12_ENST00000435495.2_Silent_p.T379T	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	509					protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)			breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						TTTCAGTTACTCCACCAGAAG	0.438																																					p.T509T		Atlas-SNP	.											.	PTPN12	83	.	0			c.T1527A						PASS	.						71.0	67.0	68.0					7																	77256523		2203	4300	6503	SO:0001819	synonymous_variant	5782	exon13			AGTTACTCCACCA		CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.1527T>A	chr7.hg19:g.77256523T>A		103.0	0.0	.		217.0	124.0	.	NM_002835	A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Silent	SNP	ENST00000248594.6	hg19	CCDS5592.1																																																																																			.	.	.	none		0.438	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253183.3		
CCDC132	55610	hgsc.bcm.edu	37	7	92885845	92885845	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr7:92885845A>G	ENST00000305866.5	+	5	450	c.322A>G	c.(322-324)Atc>Gtc	p.I108V	CCDC132_ENST00000251739.5_Missense_Mutation_p.I108V|CCDC132_ENST00000541136.1_5'UTR|CCDC132_ENST00000317751.6_5'UTR|CCDC132_ENST00000535481.1_Intron|CCDC132_ENST00000544910.1_Missense_Mutation_p.I78V	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	108						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			GGCAGATTTAATCCTTGAAAA	0.254																																					p.I108V		Atlas-SNP	.											.	CCDC132	136	.	0			c.A322G						PASS	.						52.0	58.0	56.0					7																	92885845		2199	4281	6480	SO:0001583	missense	55610	exon5			GATTTAATCCTTG	AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.322A>G	chr7.hg19:g.92885845A>G	ENSP00000307666:p.Ile108Val	58.0	0.0	.		93.0	20.0	.	NM_024553	B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	ENST00000305866.5	hg19	CCDS43617.1	.	.	.	.	.	.	.	.	.	.	A	15.49	2.847997	0.51164	.	.	ENSG00000004766	ENST00000251739;ENST00000305866;ENST00000544910;ENST00000458530	.	.	.	5.52	5.52	0.82312	Vacuolar protein sorting-associated protein 54 (1);	0.000000	0.85682	D	0.000000	T	0.56848	0.2013	N	0.25426	0.745	0.80722	D	1	P;P;P	0.48407	0.65;0.699;0.91	P;P;B	0.58130	0.743;0.833;0.377	T	0.50617	-0.8807	9	0.06365	T	0.9	-9.0769	15.9527	0.79855	1.0:0.0:0.0:0.0	.	78;108;108	F5H5U7;Q96JG6;Q96JG6-2	.;CC132_HUMAN;.	V	108;108;78;107	.	ENSP00000251739:I108V	I	+	1	0	CCDC132	92723781	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.183000	0.89700	2.234000	0.73211	0.460000	0.39030	ATC	.	.	.	none		0.254	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667	
TMUB1	83590	hgsc.bcm.edu	37	7	150779559	150779559	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr7:150779559G>C	ENST00000392818.3	-	2	449	c.92C>G	c.(91-93)aCg>aGg	p.T31R	FASTK_ENST00000540185.1_5'Flank|FASTK_ENST00000482571.1_5'Flank|FASTK_ENST00000353841.2_5'Flank|FASTK_ENST00000297532.6_5'Flank|FASTK_ENST00000489884.1_5'Flank|TMUB1_ENST00000476627.1_Missense_Mutation_p.T31R|TMUB1_ENST00000462940.1_Missense_Mutation_p.T31R|TMUB1_ENST00000482202.1_Missense_Mutation_p.T31R|TMUB1_ENST00000297533.4_Missense_Mutation_p.T31R	NM_031434.3	NP_113622.1	Q9BVT8	TMUB1_HUMAN	transmembrane and ubiquitin-like domain containing 1	31						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGCGGTGTGCGTTGAGACCCA	0.662																																					p.T31R		Atlas-SNP	.											.	TMUB1	7	.	0			c.C92G						PASS	.						62.0	64.0	63.0					7																	150779559		2203	4300	6503	SO:0001583	missense	83590	exon2			GTGTGCGTTGAGA	BC000936	CCDS5920.1	7q36.1	2006-06-27	2006-06-27	2006-06-27	ENSG00000164897	ENSG00000164897			21709	protein-coding gene	gene with protein product		614792	"""chromosome 7 open reading frame 21"""	C7orf21			Standard	NM_001136044		Approved	SB144	uc003wjd.3	Q9BVT8	OTTHUMG00000158621	ENST00000392818.3:c.92C>G	chr7.hg19:g.150779559G>C	ENSP00000376565:p.Thr31Arg	131.0	0.0	.		201.0	118.0	.	NM_031434	D3DX06|Q53AQ2	Missense_Mutation	SNP	ENST00000392818.3	hg19	CCDS5920.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.129878	0.77549	.	.	ENSG00000164897	ENST00000297533;ENST00000392818;ENST00000462940;ENST00000482202;ENST00000476627;ENST00000488752;ENST00000492838	T;T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91;0.91	4.83	3.95	0.45737	.	0.067439	0.64402	D	0.000018	T	0.58235	0.2108	M	0.74467	2.265	0.51767	D	0.999931	D	0.63880	0.993	P	0.60236	0.871	T	0.62215	-0.6901	10	0.87932	D	0	.	10.8464	0.46744	0.0934:0.0:0.9066:0.0	.	31	Q9BVT8	TMUB1_HUMAN	R	31	ENSP00000297533:T31R;ENSP00000376565:T31R;ENSP00000417519:T31R;ENSP00000418709:T31R;ENSP00000419214:T31R;ENSP00000420692:T31R;ENSP00000420516:T31R	ENSP00000297533:T31R	T	-	2	0	TMUB1	150410492	1.000000	0.71417	0.983000	0.44433	0.969000	0.65631	6.693000	0.74582	1.035000	0.39972	0.305000	0.20034	ACG	.	.	.	none		0.662	TMUB1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351485.1	NM_031434	
KMT2C	58508	hgsc.bcm.edu	37	7	151853289	151853289	+	Splice_Site	SNP	C	C	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr7:151853289C>T	ENST00000262189.6	-	45	12031		c.e45+1		KMT2C_ENST00000485241.1_5'Flank|KMT2C_ENST00000355193.2_Splice_Site	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C						histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TATAATCATACCTTCATGGCT	0.438																																					.		Atlas-SNP	.											.	MLL3	1564	.	0			c.11812+1G>A						PASS	.						137.0	139.0	138.0					7																	151853289		2203	4300	6503	SO:0001630	splice_region_variant	58508	exon46			ATCATACCTTCAT	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.11812+1G>A	chr7.hg19:g.151853289C>T		68.0	0.0	.		81.0	52.0	.	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Splice_Site	SNP	ENST00000262189.6	hg19	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	19.17	3.775125	0.70107	.	.	ENSG00000055609	ENST00000360104;ENST00000262189;ENST00000355193;ENST00000424877;ENST00000418061	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.077	0.89430	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MLL3	151484222	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	4.000000	0.57039	2.717000	0.92951	0.655000	0.94253	.	.	.	.	none		0.438	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		Intron
SORBS3	10174	hgsc.bcm.edu	37	8	22432205	22432205	+	Silent	SNP	C	C	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr8:22432205C>T	ENST00000240123.7	+	21	2363	c.1980C>T	c.(1978-1980)ttC>ttT	p.F660F	SORBS3_ENST00000428103.1_Silent_p.F318F	NM_005775.4	NP_005766.3	O60504	VINEX_HUMAN	sorbin and SH3 domain containing 3	660	Binds to SOS.|SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|muscle contraction (GO:0006936)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cytoskeleton organization (GO:0051495)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of stress fiber assembly (GO:0051496)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)	18		Prostate(55;0.0421)|Breast(100;0.102)		BRCA - Breast invasive adenocarcinoma(99;0.00566)|Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		CCCAGAAATTCGGAACGTTCC	0.607											OREG0018613	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F660F		Atlas-SNP	.											.	SORBS3	45	.	0			c.C1980T						PASS	.						141.0	137.0	138.0					8																	22432205		2203	4300	6503	SO:0001819	synonymous_variant	10174	exon21			GAAATTCGGAACG		CCDS6031.1	8p21.3	2008-02-05			ENSG00000120896	ENSG00000120896			30907	protein-coding gene	gene with protein product		610795				9885244, 12510380	Standard	NM_001018003		Approved	SCAM-1, SH3D4, vinexin	uc003xbv.3	O60504	OTTHUMG00000131728	ENST00000240123.7:c.1980C>T	chr8.hg19:g.22432205C>T		83.0	0.0	.	756	115.0	47.0	.	NM_005775	Q5BJE4|Q6NX54|Q96FY4|Q9UQE4	Silent	SNP	ENST00000240123.7	hg19	CCDS6031.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.883|9.883	1.202193|1.202193	0.22121|0.22121	.|.	.|.	ENSG00000120896|ENSG00000120896	ENST00000519127|ENST00000517962;ENST00000520207	.|.	.|.	.|.	5.4|5.4	-0.357|-0.357	0.12579|0.12579	.|.	.|.	.|.	.|.	.|.	T|T	0.55970|0.55970	0.1954|0.1954	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.50955|0.50955	-0.8766|-0.8766	5|4	0.87932|.	D|.	0|.	-9.7988|-9.7988	9.8167|9.8167	0.40858|0.40858	0.0:0.3502:0.0:0.6498|0.0:0.3502:0.0:0.6498	.|.	.|.	.|.	.|.	W|L	38|172;88	.|.	ENSP00000428930:R38W|.	R|S	+|+	1|2	2|0	SORBS3|SORBS3	22488150|22488150	0.993000|0.993000	0.37304|0.37304	1.000000|1.000000	0.80357|0.80357	0.439000|0.439000	0.31926|0.31926	0.168000|0.168000	0.16622|0.16622	0.093000|0.093000	0.17368|0.17368	-0.982000|-0.982000	0.02568|0.02568	CGG|TCG	.	.	.	none		0.607	SORBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254647.3	NM_005775	
GSR	2936	hgsc.bcm.edu	37	8	30537066	30537066	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr8:30537066A>G	ENST00000221130.5	-	13	1630	c.1540T>C	c.(1540-1542)Tct>Cct	p.S514P	GSR_ENST00000414019.1_Missense_Mutation_p.S471P|GSR_ENST00000541648.1_Missense_Mutation_p.S461P|GSR_ENST00000537535.1_Missense_Mutation_p.S432P|GSR_ENST00000546342.1_Missense_Mutation_p.S485P	NM_000637.3|NM_001195102.1|NM_001195103.1	NP_000628.2|NP_001182031.1|NP_001182032.1	P00390	GSHR_HUMAN	glutathione reductase	514					cell redox homeostasis (GO:0045454)|glutathione metabolic process (GO:0006749)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|glutathione-disulfide reductase activity (GO:0004362)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	23				KIRC - Kidney renal clear cell carcinoma(542;0.105)|Kidney(114;0.125)	Carmustine(DB00262)|Flavin adenine dinucleotide(DB03147)|Glutathione(DB00143)	TCTTCTGAAGAGGTAGGGTGA	0.493																																					p.S514P		Atlas-SNP	.											.	GSR	53	.	0			c.T1540C						PASS	.						170.0	132.0	145.0					8																	30537066		2203	4300	6503	SO:0001583	missense	2936	exon13			CTGAAGAGGTAGG		CCDS34877.1, CCDS56530.1, CCDS56531.1, CCDS56532.1	8p21.1	2012-10-02			ENSG00000104687	ENSG00000104687	1.8.1.7		4623	protein-coding gene	gene with protein product		138300					Standard	NM_000637		Approved		uc003xih.2	P00390	OTTHUMG00000163946	ENST00000221130.5:c.1540T>C	chr8.hg19:g.30537066A>G	ENSP00000221130:p.Ser514Pro	104.0	0.0	.		120.0	46.0	.	NM_000637	C8KIL8|C8KIL9|C8KIM0|D3DSV3|Q7Z5C9|Q9NP63	Missense_Mutation	SNP	ENST00000221130.5	hg19	CCDS34877.1	.	.	.	.	.	.	.	.	.	.	A	29.1	4.976636	0.92982	.	.	ENSG00000104687	ENST00000221130;ENST00000414019;ENST00000546342;ENST00000541648;ENST00000537535	D;D;D;D;D	0.92752	-3.1;-3.1;-3.1;-3.1;-3.1	5.34	5.34	0.76211	FAD/NAD-linked reductase, dimerisation (1);Pyridine nucleotide-disulphide oxidoreductase, dimerisation (2);	0.000000	0.85682	D	0.000000	D	0.97117	0.9058	H	0.95470	3.675	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97953	1.0333	10	0.66056	D	0.02	-17.0472	13.5686	0.61832	1.0:0.0:0.0:0.0	.	514	P00390	GSHR_HUMAN	P	514;471;485;461;432	ENSP00000221130:S514P;ENSP00000390065:S471P;ENSP00000445516:S485P;ENSP00000444559:S461P;ENSP00000438845:S432P	ENSP00000221130:S514P	S	-	1	0	GSR	30656608	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.577000	0.90773	2.160000	0.67779	0.454000	0.30748	TCT	.	.	.	none		0.493	GSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376519.1		
RORB	6096	hgsc.bcm.edu	37	9	77300383	77300383	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr9:77300383T>A	ENST00000396204.2	+	10	1262	c.1262T>A	c.(1261-1263)aTa>aAa	p.I421K	RORB_ENST00000376896.3_Missense_Mutation_p.I410K			Q92753	RORB_HUMAN	RAR-related orphan receptor B	421	Ligand-binding. {ECO:0000255}.				amacrine cell differentiation (GO:0035881)|cellular response to retinoic acid (GO:0071300)|eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(2)|large_intestine(4)|lung(1)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	12					Melatonin(DB01065)	CTGCAGTTAATAGCCAAGATA	0.478																																					p.I410K		Atlas-SNP	.											.	RORB	89	.	0			c.T1229A						PASS	.						158.0	148.0	151.0					9																	77300383		2203	4300	6503	SO:0001583	missense	6096	exon10			AGTTAATAGCCAA	Y08639	CCDS6646.1	9q22	2013-01-16			ENSG00000198963	ENSG00000198963		"""Nuclear hormone receptors"""	10259	protein-coding gene	gene with protein product		601972				7926749	Standard	NM_006914		Approved	RZRB, NR1F2, ROR-BETA	uc004ajh.3	Q92753	OTTHUMG00000020026	ENST00000396204.2:c.1262T>A	chr9.hg19:g.77300383T>A	ENSP00000379507:p.Ile421Lys	64.0	0.0	.		86.0	37.0	.	NM_006914	Q8WX73	Missense_Mutation	SNP	ENST00000396204.2	hg19		.	.	.	.	.	.	.	.	.	.	T	17.09	3.301008	0.60195	.	.	ENSG00000198963	ENST00000376896;ENST00000396204	D;D	0.96913	-4.17;-4.17	5.45	5.45	0.79879	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.083997	0.85682	D	0.000000	D	0.97210	0.9088	M	0.70275	2.135	0.80722	D	1	B;B	0.33748	0.423;0.353	P;P	0.48795	0.486;0.59	D	0.97590	1.0116	10	0.72032	D	0.01	.	16.226	0.82293	0.0:0.0:0.0:1.0	.	421;410	Q92753;Q58EY0	RORB_HUMAN;.	K	410;421	ENSP00000366093:I410K;ENSP00000379507:I421K	ENSP00000366093:I410K	I	+	2	0	RORB	76490203	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.564000	0.82326	2.371000	0.80710	0.533000	0.62120	ATA	.	.	.	none		0.478	RORB-201	KNOWN	basic	protein_coding	protein_coding			
SPATA31D1	389763	hgsc.bcm.edu	37	9	84609332	84609332	+	Missense_Mutation	SNP	G	G	A			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr9:84609332G>A	ENST00000344803.2	+	4	3994	c.3947G>A	c.(3946-3948)cGc>cAc	p.R1316H		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1316					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											ACATCCCAACGCAGGAGAAAG	0.522																																					p.R1316H		Atlas-SNP	.											FAM75D4,NS,carcinoma,0,2	.	.	.	0			c.G3947A						PASS	.						27.0	27.0	27.0					9																	84609332		1915	4114	6029	SO:0001583	missense	389763	exon4			CCCAACGCAGGAG		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3947G>A	chr9.hg19:g.84609332G>A	ENSP00000341988:p.Arg1316His	129.0	1.0	.		123.0	50.0	.	NM_001001670		Missense_Mutation	SNP	ENST00000344803.2	hg19	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.100997	0.00360	.	.	ENSG00000214929	ENST00000344803	T	0.04917	3.53	3.17	-6.34	0.01982	.	.	.	.	.	T	0.02119	0.0066	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.35450	-0.9788	9	0.39692	T	0.17	3.2905	2.1019	0.03682	0.3168:0.1206:0.0935:0.4691	.	1316	Q6ZQQ2	F75D1_HUMAN	H	1316	ENSP00000341988:R1316H	ENSP00000341988:R1316H	R	+	2	0	FAM75D1	83799152	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.252000	0.00074	-4.681000	0.00036	-4.324000	0.00007	CGC	.	.	.	none		0.522	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670	
IARS	3376	hgsc.bcm.edu	37	9	95027351	95027351	+	Silent	SNP	G	G	A			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr9:95027351G>A	ENST00000375643.3	-	16	1826	c.1560C>T	c.(1558-1560)atC>atT	p.I520I	IARS_ENST00000375629.3_5'UTR|IARS_ENST00000443024.2_Silent_p.I520I|IARS_ENST00000447699.2_Silent_p.I410I	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	520					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	ACACTTCAGAGATGCGGTGCA	0.448																																					p.I520I		Atlas-SNP	.											.	IARS	74	.	0			c.C1560T						PASS	.						83.0	69.0	74.0					9																	95027351		2203	4300	6503	SO:0001819	synonymous_variant	3376	exon16			TTCAGAGATGCGG	AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.1560C>T	chr9.hg19:g.95027351G>A		140.0	0.0	.		157.0	62.0	.	NM_013417	A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	Silent	SNP	ENST00000375643.3	hg19	CCDS6694.1																																																																																			.	.	.	none		0.448	IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053059.2	NM_002161	
FAM73B	84895	hgsc.bcm.edu	37	9	131832215	131832215	+	Nonsense_Mutation	SNP	C	C	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr9:131832215C>T	ENST00000358369.4	+	15	1772	c.1546C>T	c.(1546-1548)Cag>Tag	p.Q516*	FAM73B_ENST00000277475.5_3'UTR|FAM73B_ENST00000406926.2_3'UTR	NM_032809.2	NP_116198.2	Q7L4E1	FA73B_HUMAN	family with sequence similarity 73, member B	516					bone development (GO:0060348)	integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)	13						ACCCAAGCCTCAGCTTGCTGA	0.572																																					p.Q516X		Atlas-SNP	.											.	FAM73B	37	.	0			c.C1546T						PASS	.						214.0	204.0	208.0					9																	131832215		2203	4300	6503	SO:0001587	stop_gained	84895	exon15			AAGCCTCAGCTTG	AK074127	CCDS6917.1	9q34.13	2008-02-05	2005-08-11	2005-08-11	ENSG00000148343	ENSG00000148343			23621	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 54"""	C9orf54			Standard	NM_032809		Approved	FLJ14596, FLJ00199	uc004bxa.3	Q7L4E1	OTTHUMG00000020770	ENST00000358369.4:c.1546C>T	chr9.hg19:g.131832215C>T	ENSP00000351138:p.Gln516*	60.0	0.0	.		60.0	16.0	.	NM_032809	Q8NBM3|Q8TEJ6|Q969E6	Nonsense_Mutation	SNP	ENST00000358369.4	hg19	CCDS6917.1	.	.	.	.	.	.	.	.	.	.	C	38	7.196286	0.98129	.	.	ENSG00000148343	ENST00000358369	.	.	.	5.74	5.74	0.90152	.	0.050861	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	.	18.9022	0.92448	0.0:1.0:0.0:0.0	.	.	.	.	X	516	.	ENSP00000351138:Q516X	Q	+	1	0	FAM73B	130872036	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.736000	0.68597	2.700000	0.92200	0.655000	0.94253	CAG	.	.	.	none		0.572	FAM73B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054542.7	NM_032809	
RAPGEF1	2889	hgsc.bcm.edu	37	9	134464315	134464315	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr9:134464315C>T	ENST00000372189.3	-	17	2491	c.2368G>A	c.(2368-2370)Gtg>Atg	p.V790M	RAPGEF1_ENST00000372190.3_Missense_Mutation_p.V808M|RAPGEF1_ENST00000372195.1_Missense_Mutation_p.V807M	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	790	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		CCATTGCACACCAGGCGGAAG	0.577																																					p.V808M		Atlas-SNP	.											.	RAPGEF1	126	.	0			c.G2422A						PASS	.						75.0	81.0	79.0					9																	134464315		2106	4237	6343	SO:0001583	missense	2889	exon17			TGCACACCAGGCG	BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.2368G>A	chr9.hg19:g.134464315C>T	ENSP00000361263:p.Val790Met	41.0	0.0	.		74.0	35.0	.	NM_198679	Q5JUE4|Q8IV73	Missense_Mutation	SNP	ENST00000372189.3	hg19	CCDS48047.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.9|23.9	4.472039|4.472039	0.84533|0.84533	.|.	.|.	ENSG00000107263|ENSG00000107263	ENST00000414781|ENST00000266110;ENST00000372195;ENST00000429421;ENST00000372189;ENST00000372190;ENST00000411834;ENST00000337036;ENST00000398415;ENST00000357686	.|T;T;T	.|0.30981	.|1.51;1.51;1.51	5.45|5.45	5.45|5.45	0.79879|0.79879	.|Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.51346|0.51346	0.1669|0.1669	L|L	0.49126|0.49126	1.545|1.545	0.53005|0.53005	D|D	0.999961|0.999961	.|D;D	.|0.76494	.|0.995;0.999	.|P;D	.|0.71414	.|0.901;0.973	T|T	0.51426|0.51426	-0.8707|-0.8707	5|10	.|0.87932	.|D	.|0	.|.	18.2518|18.2518	0.90006|0.90006	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|790;808	.|Q13905;Q13905-3	.|RPGF1_HUMAN;.	D|M	217|790;807;736;790;808;770;768;235;807	.|ENSP00000361269:V807M;ENSP00000361263:V790M;ENSP00000361264:V808M	.|ENSP00000266110:V790M	G|V	-|-	2|1	0|0	RAPGEF1|RAPGEF1	133454136|133454136	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	4.538000|4.538000	0.60650|0.60650	2.546000|2.546000	0.85860|0.85860	0.462000|0.462000	0.41574|0.41574	GGT|GTG	.	.	.	none		0.577	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054759.2	NM_005312	
PTEN	5728	hgsc.bcm.edu	37	10	89653783	89653783	+	Splice_Site	SNP	T	T	A			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr10:89653783T>A	ENST00000371953.3	+	2	1438	c.81T>A	c.(79-81)taT>taA	p.Y27*		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	27	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.		Y -> S (loss of phosphatase activity towards Ins(1,3,4,5)P4).		activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(8)|p.Y27fs*1(3)|p.Y27fs*16(1)|p.Y27*(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGTACTCAGATATTTATCCAA	0.294		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.Y27X		Atlas-SNP	.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	PTEN,colon,carcinoma,+1,2	PTEN	3652	.	50	Whole gene deletion(37)|Unknown(8)|Deletion - Frameshift(4)|Substitution - Nonsense(1)	prostate(14)|central_nervous_system(9)|skin(8)|haematopoietic_and_lymphoid_tissue(4)|lung(4)|ovary(3)|endometrium(2)|breast(2)|soft_tissue(1)|urinary_tract(1)|NS(1)|kidney(1)	c.T81A						PASS	.						98.0	98.0	98.0					10																	89653783		2203	4292	6495	SO:0001630	splice_region_variant	5728	exon2	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	CTCAGATATTTAT	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.80-1T>A	chr10.hg19:g.89653783T>A		52.0	0.0	.		69.0	55.0	.	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Nonsense_Mutation	SNP	ENST00000371953.3	hg19	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	T	47	13.707906	0.99758	.	.	ENSG00000171862	ENST00000371953	.	.	.	5.19	5.19	0.71726	.	0.071107	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0135	0.64511	0.0:0.0:0.0:1.0	.	.	.	.	X	27	.	.	Y	+	3	2	PTEN	89643763	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.599000	0.67592	1.959000	0.56917	0.533000	0.62120	TAT	.	.	.	none		0.294	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	Nonsense_Mutation
EEF1G	1937	hgsc.bcm.edu	37	11	62327757	62327757	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr11:62327757T>A	ENST00000329251.4	-	8	1157	c.1027A>T	c.(1027-1029)Act>Tct	p.T343S	EEF1G_ENST00000378019.3_Missense_Mutation_p.T393S|MIR3654_ENST00000496634.2_3'UTR	NM_001404.4	NP_001395.1	P26641	EF1G_HUMAN	eukaryotic translation elongation factor 1 gamma	343	EF-1-gamma C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00519}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to virus (GO:0009615)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	translation elongation factor activity (GO:0003746)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CTCTTACCAGTGATGAGATTG	0.498																																					p.T343S		Atlas-SNP	.											.	EEF1G	33	.	0			c.A1027T						PASS	.						34.0	31.0	32.0					11																	62327757		1982	4164	6146	SO:0001583	missense	1937	exon8			TACCAGTGATGAG	X63526	CCDS44626.1	11q12.3	2008-02-05			ENSG00000254772	ENSG00000254772			3213	protein-coding gene	gene with protein product		130593				1598220, 1461723	Standard	NM_001404		Approved	EF1G	uc001ntm.1	P26641	OTTHUMG00000167567	ENST00000329251.4:c.1027A>T	chr11.hg19:g.62327757T>A	ENSP00000331901:p.Thr343Ser	108.0	0.0	.		107.0	39.0	.	NM_001404	B4DTG2|Q6PJ62|Q6PK31|Q96CU2|Q9P196	Missense_Mutation	SNP	ENST00000329251.4	hg19	CCDS44626.1	.	.	.	.	.	.	.	.	.	.	T	8.114	0.779396	0.16120	.	.	ENSG00000254772	ENST00000329251;ENST00000378019;ENST00000424909	T;T	0.21932	2.01;1.98	4.7	4.7	0.59300	Translation elongation factor EF1B, gamma chain, conserved (4);	0.158521	0.53938	D	0.000048	T	0.14098	0.0341	N	0.19112	0.55	0.46542	D	0.999093	B;B;B	0.12013	0.005;0.0;0.0	B;B;B	0.22753	0.041;0.005;0.002	T	0.09684	-1.0663	10	0.22706	T	0.39	.	12.1911	0.54273	0.0:0.0:0.0:1.0	.	393;112;343	B4DTG2;B4DUP0;P26641	.;.;EF1G_HUMAN	S	343;393;112	ENSP00000331901:T343S;ENSP00000367258:T393S	ENSP00000331901:T343S	T	-	1	0	EEF1G	62084333	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	2.991000	0.49409	1.995000	0.58328	0.449000	0.29647	ACT	.	.	.	none		0.498	EEF1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395047.1	NM_001404	
GPR152	390212	hgsc.bcm.edu	37	11	67219103	67219103	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr11:67219103G>C	ENST00000312457.2	-	1	1097	c.1093C>G	c.(1093-1095)Cag>Gag	p.Q365E	CABP4_ENST00000438189.2_5'Flank	NM_206997.1	NP_996880.1	Q8TDT2	GP152_HUMAN	G protein-coupled receptor 152	365						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			GATCGTGGCTGGAGTGTGGGG	0.632																																					p.Q365E	Pancreas(102;800 1581 2723 7382 33622)	Atlas-SNP	.											.	GPR152	41	.	0			c.C1093G						PASS	.						46.0	44.0	45.0					11																	67219103		2200	4295	6495	SO:0001583	missense	390212	exon1			GTGGCTGGAGTGT	AY255600	CCDS8165.1	11q13.2	2013-09-20			ENSG00000175514	ENSG00000175514		"""GPCR / Class A : Orphans"""	23622	protein-coding gene	gene with protein product						12679517	Standard	NM_206997		Approved	PGR5	uc001olm.3	Q8TDT2	OTTHUMG00000168032	ENST00000312457.2:c.1093C>G	chr11.hg19:g.67219103G>C	ENSP00000310255:p.Gln365Glu	49.0	0.0	.		55.0	23.0	.	NM_206997	Q0VD88|Q86SM0	Missense_Mutation	SNP	ENST00000312457.2	hg19	CCDS8165.1	.	.	.	.	.	.	.	.	.	.	G	15.14	2.744684	0.49151	.	.	ENSG00000175514	ENST00000312457	T	0.07021	3.23	4.43	1.43	0.22495	.	0.186743	0.26133	N	0.026147	T	0.09423	0.0232	M	0.68952	2.095	0.22305	N	0.99922	P	0.34662	0.462	B	0.33960	0.173	T	0.16660	-1.0395	10	0.72032	D	0.01	.	6.2505	0.20843	0.0912:0.0:0.5823:0.3265	.	365	Q8TDT2	GP152_HUMAN	E	365	ENSP00000310255:Q365E	ENSP00000310255:Q365E	Q	-	1	0	GPR152	66975679	0.005000	0.15991	0.003000	0.11579	0.008000	0.06430	0.904000	0.28491	0.114000	0.18032	0.491000	0.48974	CAG	.	.	.	none		0.632	GPR152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397623.1		
KRTAP5-8	57830	hgsc.bcm.edu	37	11	71249532	71249532	+	Missense_Mutation	SNP	C	C	G	rs532438179|rs11234084|rs369043826	byFrequency	TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr11:71249532C>G	ENST00000398534.3	+	1	462	c.431C>G	c.(430-432)tCc>tGc	p.S144C		NM_021046.2	NP_066384.2	O75690	KRA58_HUMAN	keratin associated protein 5-8	144	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|lung(2)|skin(1)|stomach(1)	6						CCCTGCTGTTCCCAGTCCAGC	0.612																																					p.S144C		Atlas-SNP	.											.	KRTAP5-8	28	.	0			c.C431G						PASS	.						148.0	160.0	156.0					11																	71249532		2200	4294	6494	SO:0001583	missense	57830	exon1			GCTGTTCCCAGTC	AB126077	CCDS41683.1	11q13.4	2008-02-05			ENSG00000241233	ENSG00000241233		"""Keratin associated proteins"""	23603	protein-coding gene	gene with protein product						15144888	Standard	NM_021046		Approved	KRTAP5.8, UHSKerB, KRTAP5-2	uc001oqr.1	O75690	OTTHUMG00000057571	ENST00000398534.3:c.431C>G	chr11.hg19:g.71249532C>G	ENSP00000420723:p.Ser144Cys	66.0	0.0	.		99.0	6.0	.	NM_021046	Q6L8G7|Q6UTX6	Missense_Mutation	SNP	ENST00000398534.3	hg19	CCDS41683.1	.	.	.	.	.	.	.	.	.	.	-	3.125	-0.179750	0.06380	.	.	ENSG00000241233	ENST00000398534	T	0.01197	5.19	1.57	-2.99	0.05497	.	.	.	.	.	T	0.00552	0.0018	N	0.02213	-0.635	0.21861	N	0.999505	B	0.02656	0.0	B	0.01281	0.0	T	0.44314	-0.9336	9	0.02654	T	1	.	12.0511	0.53507	0.0:0.7645:0.2355:0.0	rs11234084	144	O75690	KRA58_HUMAN	C	144	ENSP00000420723:S144C	ENSP00000420723:S144C	S	+	2	0	KRTAP5-8	70927180	0.000000	0.05858	0.375000	0.26029	0.014000	0.08584	-0.627000	0.05521	-0.723000	0.04915	-0.951000	0.02657	TCC	.	.	.	weak		0.612	KRTAP5-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127954.1	NM_021046	
HSPA8	3312	hgsc.bcm.edu	37	11	122930962	122930962	+	Silent	SNP	A	A	G			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr11:122930962A>G	ENST00000532636.1	-	4	545	c.426T>C	c.(424-426)gcT>gcC	p.A142A	HSPA8_ENST00000227378.3_Silent_p.A142A|SNORD14E_ENST00000364009.1_RNA|HSPA8_ENST00000533540.1_Intron|HSPA8_ENST00000534624.1_Silent_p.A142A|SNORD14C_ENST00000365382.1_RNA|HSPA8_ENST00000453788.2_Silent_p.A142A|HSPA8_ENST00000526110.1_Intron|HSPA8_ENST00000534319.1_5'UTR|SNORD14D_ENST00000384390.1_RNA|HSPA8_ENST00000526862.1_5'Flank			P11142	HSP7C_HUMAN	heat shock 70kDa protein 8	142					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone mediated protein folding requiring cofactor (GO:0051085)|clathrin coat disassembly (GO:0072318)|gene expression (GO:0010467)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|negative regulation of fibril organization (GO:1902904)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein refolding (GO:0042026)|regulation of cell cycle (GO:0051726)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	blood microparticle (GO:0072562)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Prp19 complex (GO:0000974)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|central_nervous_system(7)|endometrium(1)|kidney(9)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	36		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		CTGTGACCACAGCATTGGTAA	0.393																																					p.A142A	Colon(21;486 594 5900 6733 14272)	Atlas-SNP	.											.	HSPA8	168	.	0			c.T426C						PASS	.						64.0	62.0	62.0					11																	122930962		2202	4299	6501	SO:0001819	synonymous_variant	3312	exon4			GACCACAGCATTG	Y00371	CCDS8440.1, CCDS44754.1	11q24.1	2011-09-02	2002-08-29		ENSG00000109971	ENSG00000109971		"""Heat shock proteins / HSP70"""	5241	protein-coding gene	gene with protein product		600816	"""heat shock 70kD protein 8"""	HSPA10		8530083, 3037489	Standard	NM_006597		Approved	HSC71, HSC70, HSP73	uc001pyo.3	P11142	OTTHUMG00000166030	ENST00000532636.1:c.426T>C	chr11.hg19:g.122930962A>G		28.0	0.0	.		35.0	19.0	.	NM_006597	Q9H3R6	Silent	SNP	ENST00000532636.1	hg19	CCDS8440.1																																																																																			.	.	.	none		0.393	HSPA8-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387515.1		
EPS8	2059	hgsc.bcm.edu	37	12	15776128	15776128	+	Silent	SNP	G	G	C			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr12:15776128G>C	ENST00000281172.5	-	20	2755	c.2319C>G	c.(2317-2319)gtC>gtG	p.V773V	EPS8_ENST00000542903.1_Silent_p.V513V|EPS8_ENST00000543612.1_Silent_p.V773V|EPS8_ENST00000540613.1_Silent_p.V513V|EPS8_ENST00000543523.1_Silent_p.V773V	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	773	Effector region. {ECO:0000250}.|Helix bundle 4. {ECO:0000250}.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		TTTGGCTATAGACTCTCGCCC	0.403																																					p.V773V		Atlas-SNP	.											.	EPS8	70	.	0			c.C2319G						PASS	.						130.0	133.0	132.0					12																	15776128		2203	4300	6503	SO:0001819	synonymous_variant	2059	exon20			GCTATAGACTCTC	U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.2319C>G	chr12.hg19:g.15776128G>C		60.0	0.0	.		149.0	81.0	.	NM_004447	A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Silent	SNP	ENST00000281172.5	hg19	CCDS31753.1																																																																																			.	.	.	none		0.403	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401093.1		
PDZRN4	29951	hgsc.bcm.edu	37	12	41966314	41966314	+	Missense_Mutation	SNP	A	A	T	rs370916106		TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr12:41966314A>T	ENST00000402685.2	+	10	1741	c.1733A>T	c.(1732-1734)aAt>aTt	p.N578I	PDZRN4_ENST00000539469.2_Missense_Mutation_p.N320I|PDZRN4_ENST00000298919.7_Missense_Mutation_p.N318I	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	578							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				GAGGACCCCAATAGCACATCT	0.493																																					p.N578I		Atlas-SNP	.											.	PDZRN4	346	.	0			c.A1733T						PASS	.						93.0	84.0	87.0					12																	41966314		2203	4300	6503	SO:0001583	missense	29951	exon10			ACCCCAATAGCAC	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.1733A>T	chr12.hg19:g.41966314A>T	ENSP00000384197:p.Asn578Ile	187.0	0.0	.		291.0	82.0	.	NM_001164595	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	ENST00000402685.2	hg19	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	A	4.527	0.097859	0.08681	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.73363	-0.74;3.76;3.76	4.2	1.65	0.23941	.	2.717730	0.00792	N	0.001341	T	0.64811	0.2632	L	0.40543	1.245	0.25084	N	0.990904	P;B;B	0.34462	0.454;0.037;0.01	B;B;B	0.26202	0.067;0.062;0.038	T	0.52675	-0.8544	10	0.51188	T	0.08	-1.7376	5.993	0.19478	0.7343:0.1583:0.1074:0.0	.	578;318;320	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	I	578;320;318	ENSP00000384197:N578I;ENSP00000439990:N320I;ENSP00000298919:N318I	ENSP00000298919:N318I	N	+	2	0	PDZRN4	40252581	0.596000	0.26866	0.155000	0.22561	0.696000	0.40369	1.314000	0.33597	0.195000	0.20347	0.528000	0.53228	AAT	.	.	.	alt		0.493	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
NPFF	8620	hgsc.bcm.edu	37	12	53899550	53899550	+	IGR	SNP	C	C	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr12:53899550C>T	ENST00000267017.3	-	0	592				TARBP2_ENST00000266987.2_Silent_p.L287L|TARBP2_ENST00000456234.2_Silent_p.L266L|TARBP2_ENST00000552857.1_Missense_Mutation_p.P153L|TARBP2_ENST00000394357.2_Silent_p.L266L	NM_003717.2	NP_003708.1	O15130	NPFF_HUMAN	neuropeptide FF-amide peptide precursor						acute inflammatory response to antigenic stimulus (GO:0002438)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of appetite (GO:0032099)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion (GO:0046676)|neuropeptide signaling pathway (GO:0007218)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane depolarization (GO:0003254)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|response to morphine (GO:0043278)|somatostatin secretion (GO:0070253)|spinal cord development (GO:0021510)|synaptic transmission (GO:0007268)|vasopressin secretion (GO:0030103)	axon terminus (GO:0043679)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|vesicle (GO:0031982)	receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(1)|prostate(1)|urinary_tract(1)	3						CCTGGGCTCCCTGGGTGCCCT	0.602																																					p.L287L		Atlas-SNP	.											.	TARBP2	35	.	0			c.C859T						PASS	.						77.0	79.0	78.0					12																	53899550		2203	4300	6503	SO:0001628	intergenic_variant	6895	exon8			GGCTCCCTGGGTG	AF005271	CCDS8862.1	12q13.13	2013-02-26			ENSG00000139574	ENSG00000139574		"""Endogenous ligands"""	7901	protein-coding gene	gene with protein product		604643				9224703	Standard	NM_003717		Approved	FMRFAL	uc001sdw.1	O15130	OTTHUMG00000169856		chr12.hg19:g.53899550C>T		57.0	0.0	.		77.0	17.0	.	NM_134323	Q3SXL4	Silent	SNP	ENST00000267017.3	hg19	CCDS8862.1	.	.	.	.	.	.	.	.	.	.	C	9.318	1.057290	0.19907	.	.	ENSG00000139546	ENST00000552857;ENST00000550407	.	.	.	4.45	-0.875	0.10628	.	.	.	.	.	T	0.34279	0.0892	.	.	.	0.23533	N	0.997471	.	.	.	.	.	.	T	0.34030	-0.9845	4	.	.	.	-15.6952	9.7019	0.40192	0.0:0.6534:0.0:0.3466	.	.	.	.	L	153;145	.	.	P	+	2	0	TARBP2	52185817	0.000000	0.05858	0.105000	0.21289	0.991000	0.79684	0.070000	0.14573	-0.157000	0.11059	0.561000	0.74099	CCT	.	.	.	none		0.602	NPFF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406301.1	NM_003717	
NAV3	89795	hgsc.bcm.edu	37	12	78516178	78516178	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr12:78516178C>T	ENST00000397909.2	+	16	4381	c.4208C>T	c.(4207-4209)aCg>aTg	p.T1403M	NAV3_ENST00000536525.2_Missense_Mutation_p.T1403M|NAV3_ENST00000228327.6_Missense_Mutation_p.T1403M|NAV3_ENST00000266692.7_Intron			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1403	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.T1403M(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CTCATGAGAACGGGTAGTGTG	0.552										HNSCC(70;0.22)																											p.T1403M		Atlas-SNP	.											NAV3,NS,carcinoma,0,2	NAV3	506	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4208T						PASS	.						104.0	96.0	99.0					12																	78516178		2021	4186	6207	SO:0001583	missense	89795	exon16			TGAGAACGGGTAG	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.4208C>T	chr12.hg19:g.78516178C>T	ENSP00000381007:p.Thr1403Met	36.0	0.0	.		60.0	5.0	.	NM_014903	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	hg19		.	.	.	.	.	.	.	.	.	.	C	22.2	4.260794	0.80246	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000378640;ENST00000550788	T;T;T;T	0.30981	1.53;1.54;1.51;2.25	5.97	5.97	0.96955	.	0.000000	0.41294	U	0.000916	T	0.57961	0.2089	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.99;0.998;0.999	T	0.56860	-0.7909	10	0.87932	D	0	-13.975	20.4239	0.99064	0.0:1.0:0.0:0.0	.	1403;1403;1403	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	M	1403;1403;1403;38;46	ENSP00000446132:T1403M;ENSP00000381007:T1403M;ENSP00000228327:T1403M;ENSP00000448303:T46M	ENSP00000228327:T1403M	T	+	2	0	NAV3	77040309	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.594000	0.82698	2.828000	0.97474	0.655000	0.94253	ACG	.	.	.	none		0.552	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
NUPL1	9818	hgsc.bcm.edu	37	13	25895072	25895072	+	Missense_Mutation	SNP	G	G	C			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr13:25895072G>C	ENST00000381736.3	+	9	1042	c.792G>C	c.(790-792)gaG>gaC	p.E264D	NUPL1_ENST00000381718.3_Missense_Mutation_p.E252D|NUPL1_ENST00000466694.1_3'UTR|NUPL1_ENST00000463407.1_Missense_Mutation_p.E264D	NM_001008564.1|NM_014089.3	NP_001008564.1|NP_054808.1	Q9BVL2	NUPL1_HUMAN	nucleoporin like 1	264	14 X 2 AA repeats of F-G.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	nucleocytoplasmic transporter activity (GO:0005487)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|stomach(1)|urinary_tract(1)	16		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.0092)|Epithelial(112;0.0477)|OV - Ovarian serous cystadenocarcinoma(117;0.165)|GBM - Glioblastoma multiforme(144;0.244)		TTGTGAAGGAGCAGAAACAAG	0.308																																					p.E264D	Pancreas(166;1040 2004 4560 4728 37041)|GBM(109;1045 1520 7614 9308 19618)	Atlas-SNP	.											.	NUPL1	37	.	0			c.G792C						PASS	.						35.0	39.0	37.0					13																	25895072		2197	4296	6493	SO:0001583	missense	9818	exon9			GAAGGAGCAGAAA	AB007870	CCDS9314.1, CCDS31949.1	13q12.12	2011-04-12			ENSG00000139496	ENSG00000139496			20261	protein-coding gene	gene with protein product		607615				9455477	Standard	NM_014089		Approved	KIAA0410	uc001uqi.3	Q9BVL2	OTTHUMG00000016608	ENST00000381736.3:c.792G>C	chr13.hg19:g.25895072G>C	ENSP00000371155:p.Glu264Asp	88.0	0.0	.		87.0	32.0	.	NM_014089	A6NI12|B4DZJ1|O43160|Q5JRG2|Q5JRG5	Missense_Mutation	SNP	ENST00000381736.3	hg19	CCDS9314.1	.	.	.	.	.	.	.	.	.	.	G	11.68	1.710839	0.30322	.	.	ENSG00000139496	ENST00000381736;ENST00000381745;ENST00000313619;ENST00000463407;ENST00000381718;ENST00000381747;ENST00000394327	T;T;T;T;T	0.49720	1.38;1.35;1.37;1.32;0.77	6.14	0.847	0.18961	.	0.180956	0.64402	D	0.000016	T	0.33000	0.0848	N	0.21448	0.665	0.44432	D	0.997351	B;B;P	0.46859	0.236;0.41;0.885	B;B;P	0.44946	0.07;0.07;0.465	T	0.03043	-1.1079	10	0.28530	T	0.3	-14.1628	9.5224	0.39143	0.6241:0.0:0.3759:0.0	.	252;264;264	A6NI12;Q9BVL2;Q9BVL2-2	.;NUPL1_HUMAN;.	D	264;252;241;264;252;264;211	ENSP00000371155:E264D;ENSP00000418555:E264D;ENSP00000371137:E252D;ENSP00000371166:E264D;ENSP00000408147:E211D	ENSP00000318459:E241D	E	+	3	2	NUPL1	24793072	0.990000	0.36364	0.997000	0.53966	0.927000	0.56198	0.394000	0.20834	-0.057000	0.13199	-0.355000	0.07637	GAG	.	.	.	none		0.308	NUPL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044228.2		
MYO16	23026	hgsc.bcm.edu	37	13	109379841	109379841	+	Silent	SNP	C	C	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr13:109379841C>T	ENST00000357550.2	+	3	392	c.351C>T	c.(349-351)gtC>gtT	p.V117V	MYO16_ENST00000251041.5_Silent_p.V117V|MYO16_ENST00000356711.2_Silent_p.V117V	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			ACAGAGGAGTCAACGTCAACC	0.403																																					p.V139V		Atlas-SNP	.											.	MYO16	285	.	0			c.C417T						PASS	.						206.0	184.0	191.0					13																	109379841		2203	4300	6503	SO:0001819	synonymous_variant	23026	exon4			AGGAGTCAACGTC		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.351C>T	chr13.hg19:g.109379841C>T		81.0	0.0	.		116.0	50.0	.	NM_001198950		Silent	SNP	ENST00000357550.2	hg19	CCDS32008.1																																																																																			.	.	.	none		0.403	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
SLC7A7	9056	hgsc.bcm.edu	37	14	23242825	23242825	+	Silent	SNP	A	A	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr14:23242825A>T	ENST00000397532.3	-	10	2055	c.1530T>A	c.(1528-1530)tcT>tcA	p.S510S	SLC7A7_ENST00000554061.1_5'UTR|SLC7A7_ENST00000397529.2_Silent_p.S510S|SLC7A7_ENST00000397528.4_Silent_p.S510S|SLC7A7_ENST00000555702.1_Silent_p.S510S|SLC7A7_ENST00000285850.7_Silent_p.S510S|SLC7A7_ENST00000554517.1_Silent_p.S244S			Q9UM01	YLAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, y+L system), member 7	510					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		GTGTTTAGTTAGATTTGGGAT	0.488																																					p.S510S		Atlas-SNP	.											.	SLC7A7	36	.	0			c.T1530A						PASS	.						141.0	117.0	125.0					14																	23242825		2203	4300	6503	SO:0001819	synonymous_variant	9056	exon11			TTAGTTAGATTTG	AF092032	CCDS9574.1	14q11.2	2014-09-17	2011-07-12		ENSG00000155465	ENSG00000155465		"""Solute carriers"""	11065	protein-coding gene	gene with protein product		603593		LPI		9829974	Standard	NM_001126106		Approved	y+LAT-1	uc001wgs.4	Q9UM01	OTTHUMG00000028692	ENST00000397532.3:c.1530T>A	chr14.hg19:g.23242825A>T		89.0	0.0	.		88.0	41.0	.	NM_001126105	B2RAU0|D3DS26|O95984|Q53XC1|Q86U07|Q9P2V5	Silent	SNP	ENST00000397532.3	hg19	CCDS9574.1																																																																																			.	.	.	none		0.488	SLC7A7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071636.3		
HECTD1	25831	hgsc.bcm.edu	37	14	31604218	31604218	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr14:31604218T>C	ENST00000399332.1	-	22	3926	c.3438A>G	c.(3436-3438)atA>atG	p.I1146M	HECTD1_ENST00000553700.1_Missense_Mutation_p.I1146M	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	1146					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		ATGCTGATGGTATCACCCAGA	0.418																																					p.I1146M		Atlas-SNP	.											.	HECTD1	159	.	0			c.A3438G						PASS	.						189.0	167.0	174.0					14																	31604218		1952	4139	6091	SO:0001583	missense	25831	exon22			TGATGGTATCACC	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.3438A>G	chr14.hg19:g.31604218T>C	ENSP00000382269:p.Ile1146Met	123.0	0.0	.		117.0	44.0	.	NM_015382	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	hg19	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	T	16.23	3.064792	0.55432	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000553957	T;T;T	0.29917	1.55;1.55;1.55	5.91	3.45	0.39498	Galactose-binding domain-like (1);Sad1/UNC-like, C-terminal (1);	0.151756	0.43260	U	0.000599	T	0.20577	0.0495	L	0.43923	1.385	0.48571	D	0.999676	P;B	0.39022	0.655;0.225	B;B	0.34536	0.185;0.121	T	0.06075	-1.0847	10	0.87932	D	0	-6.2714	4.6526	0.12603	0.1194:0.0674:0.1242:0.689	.	1146;1146	D3DS86;Q9ULT8	.;HECD1_HUMAN	M	1146;1148;1146;620	ENSP00000450697:I1146M;ENSP00000382269:I1146M;ENSP00000451860:I620M	ENSP00000261312:I1148M	I	-	3	3	HECTD1	30673969	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.886000	0.28241	2.261000	0.74972	0.533000	0.62120	ATA	.	.	.	none		0.418	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
DMXL2	23312	hgsc.bcm.edu	37	15	51783940	51783940	+	Silent	SNP	G	G	A			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr15:51783940G>A	ENST00000251076.5	-	20	5075	c.4788C>T	c.(4786-4788)gtC>gtT	p.V1596V	DMXL2_ENST00000449909.3_Silent_p.V960V|RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000543779.2_Silent_p.V1596V	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1596						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		GGCATGTAGAGACACCTAAAT	0.368																																					p.V1596V		Atlas-SNP	.											.	DMXL2	262	.	0			c.C4788T						PASS	.						68.0	74.0	72.0					15																	51783940		2195	4293	6488	SO:0001819	synonymous_variant	23312	exon20			TGTAGAGACACCT	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.4788C>T	chr15.hg19:g.51783940G>A		65.0	0.0	.		63.0	29.0	.	NM_001174116	B2RTR3|B7ZMH3|F5GWF1|O94938	Silent	SNP	ENST00000251076.5	hg19	CCDS10141.1																																																																																			.	.	.	none		0.368	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
ALPK3	57538	hgsc.bcm.edu	37	15	85360356	85360356	+	Silent	SNP	C	C	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr15:85360356C>T	ENST00000258888.5	+	1	446	c.279C>T	c.(277-279)tgC>tgT	p.C93C		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	93					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			ACACCCGCTGCGCCTTCCTCC	0.731																																					p.C93C		Atlas-SNP	.											.	ALPK3	289	.	0			c.C279T						PASS	.						5.0	6.0	5.0					15																	85360356		2058	4100	6158	SO:0001819	synonymous_variant	57538	exon1			CCGCTGCGCCTTC	AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.279C>T	chr15.hg19:g.85360356C>T		75.0	0.0	.		74.0	24.0	.	NM_020778	Q9P2L6	Silent	SNP	ENST00000258888.5	hg19	CCDS10333.1																																																																																			.	.	.	none		0.731	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778	
ANPEP	290	hgsc.bcm.edu	37	15	90340878	90340878	+	Missense_Mutation	SNP	C	C	A			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr15:90340878C>A	ENST00000300060.6	-	15	2398	c.2085G>T	c.(2083-2085)tgG>tgT	p.W695C	ANPEP_ENST00000558177.1_5'UTR	NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	695	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	GGGCGGCCTCCCAGGGCATGT	0.562																																					p.W695C	NSCLC(30;827 977 2459 19669 26125)	Atlas-SNP	.											.	ANPEP	124	.	0			c.G2085T						PASS	.						135.0	127.0	130.0					15																	90340878		2200	4299	6499	SO:0001583	missense	290	exon15			GGCCTCCCAGGGC	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.2085G>T	chr15.hg19:g.90340878C>A	ENSP00000300060:p.Trp695Cys	96.0	0.0	.		145.0	70.0	.	NM_001150	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	ENST00000300060.6	hg19	CCDS10356.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.725444	0.89298	.	.	ENSG00000166825	ENST00000300060	T	0.07908	3.15	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.47525	0.1450	H	0.97806	4.08	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.67341	-0.5695	10	0.87932	D	0	.	18.2369	0.89952	0.0:1.0:0.0:0.0	.	695	P15144	AMPN_HUMAN	C	695	ENSP00000300060:W695C	ENSP00000300060:W695C	W	-	3	0	ANPEP	88141882	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.659000	0.83766	2.728000	0.93425	0.655000	0.94253	TGG	.	.	.	none		0.562	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1		
ANPEP	290	hgsc.bcm.edu	37	15	90349261	90349261	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr15:90349261T>C	ENST00000300060.6	-	2	867	c.554A>G	c.(553-555)gAg>gGg	p.E185G		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	185	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	ATCTGCCAACTCCCCCTCGAA	0.617																																					p.E185G	NSCLC(30;827 977 2459 19669 26125)	Atlas-SNP	.											.	ANPEP	124	.	0			c.A554G						PASS	.						91.0	85.0	87.0					15																	90349261		2200	4299	6499	SO:0001583	missense	290	exon2			GCCAACTCCCCCT	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.554A>G	chr15.hg19:g.90349261T>C	ENSP00000300060:p.Glu185Gly	33.0	0.0	.		42.0	20.0	.	NM_001150	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	ENST00000300060.6	hg19	CCDS10356.1	.	.	.	.	.	.	.	.	.	.	T	17.47	3.397231	0.62177	.	.	ENSG00000166825	ENST00000300060	T	0.02974	4.09	4.8	4.8	0.61643	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.19446	0.0467	M	0.93854	3.465	0.52099	D	0.999947	D	0.89917	1.0	D	0.91635	0.999	T	0.08806	-1.0704	10	0.29301	T	0.29	.	12.3003	0.54870	0.0:0.0:0.0:1.0	.	185	P15144	AMPN_HUMAN	G	185	ENSP00000300060:E185G	ENSP00000300060:E185G	E	-	2	0	ANPEP	88150265	1.000000	0.71417	1.000000	0.80357	0.161000	0.22273	6.099000	0.71466	1.794000	0.52575	0.460000	0.39030	GAG	.	.	.	none		0.617	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1		
NUDT16L1	84309	hgsc.bcm.edu	37	16	4745104	4745104	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr16:4745104A>G	ENST00000304301.6	+	3	593	c.560A>G	c.(559-561)aAg>aGg	p.K187R	NUDT16L1_ENST00000405142.1_3'UTR|NUDT16L1_ENST00000586252.1_Missense_Mutation_p.K147R|NUDT16L1_ENST00000586536.1_3'UTR	NM_032349.3	NP_115725.1	Q9BRJ7	SDOS_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1	187	Interaction with PXN. {ECO:0000250}.					cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			endometrium(1)|large_intestine(1)|lung(1)|skin(1)	4						CCCGAGGAGAAGCTGGTTGAG	0.622																																					p.K187R		Atlas-SNP	.											.	NUDT16L1	13	.	0			c.A560G						PASS	.						82.0	78.0	80.0					16																	4745104		2197	4300	6497	SO:0001583	missense	84309	exon3			AGGAGAAGCTGGT	BC006223	CCDS10519.1, CCDS59257.1	16p13.3	2008-02-05			ENSG00000168101	ENSG00000168101		"""Nudix motif containing"""	28154	protein-coding gene	gene with protein product						11805099	Standard	NM_032349		Approved	SDOS	uc002cxe.3	Q9BRJ7	OTTHUMG00000129471	ENST00000304301.6:c.560A>G	chr16.hg19:g.4745104A>G	ENSP00000306670:p.Lys187Arg	59.0	0.0	.		129.0	32.0	.	NM_032349	Q8NAI2	Missense_Mutation	SNP	ENST00000304301.6	hg19	CCDS10519.1	.	.	.	.	.	.	.	.	.	.	A	15.37	2.813806	0.50527	.	.	ENSG00000168101	ENST00000304301	T	0.50001	0.76	4.38	4.38	0.52667	NUDIX hydrolase domain-like (1);	4.226410	0.00639	N	0.000518	T	0.40979	0.1139	N	0.22421	0.69	0.80722	D	1	P	0.47484	0.896	B	0.41466	0.358	T	0.28964	-1.0027	10	0.23891	T	0.37	.	12.4484	0.55664	1.0:0.0:0.0:0.0	.	187	Q9BRJ7	SDOS_HUMAN	R	187	ENSP00000306670:K187R	ENSP00000306670:K187R	K	+	2	0	NUDT16L1	4685105	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.660000	0.61511	1.605000	0.50152	0.533000	0.62120	AAG	.	.	.	none		0.622	NUDT16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251634.1	NM_032349	
GFOD2	81577	hgsc.bcm.edu	37	16	67719468	67719468	+	Missense_Mutation	SNP	C	C	T	rs145155253		TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr16:67719468C>T	ENST00000268797.7	-	2	496	c.151G>A	c.(151-153)Gcc>Acc	p.A51T	GFOD2_ENST00000602377.1_5'UTR	NM_030819.3	NP_110446.3	Q3B7J2	GFOD2_HUMAN	glucose-fructose oxidoreductase domain containing 2	51					extracellular matrix organization (GO:0030198)	proteinaceous extracellular matrix (GO:0005578)	oxidoreductase activity (GO:0016491)			breast(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	19		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0151)|Epithelial(162;0.0505)|all cancers(182;0.242)		GTGTAGAAGGCGATGTTCATC	0.567																																					p.A51T		Atlas-SNP	.											.	GFOD2	36	.	0			c.G151A						PASS	.	C	THR/ALA	0,4396		0,0,2198	102.0	78.0	86.0		151	0.6	1.0	16	dbSNP_134	86	2,8598	2.2+/-6.3	0,2,4298	no	missense	GFOD2	NM_030819.3	58	0,2,6496	TT,TC,CC		0.0233,0.0,0.0154	benign	51/386	67719468	2,12994	2198	4300	6498	SO:0001583	missense	81577	exon2			AGAAGGCGATGTT	AK074382	CCDS10845.1, CCDS59268.1	16q22.1	2008-02-05			ENSG00000141098	ENSG00000141098			28159	protein-coding gene	gene with protein product						12975309	Standard	NM_030819		Approved	FLJ23802, MGC11335	uc002eub.3	Q3B7J2	OTTHUMG00000137537	ENST00000268797.7:c.151G>A	chr16.hg19:g.67719468C>T	ENSP00000268797:p.Ala51Thr	58.0	0.0	.		96.0	28.0	.	NM_001243650	Q69YL9|Q6UXX6|Q7L648|Q8TE86|Q9BQ07|R4GNG5	Missense_Mutation	SNP	ENST00000268797.7	hg19	CCDS10845.1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.513067	0.44660	0.0	2.33E-4	ENSG00000141098	ENST00000268797	T	0.22743	1.94	5.58	0.555	0.17247	Oxidoreductase, N-terminal (1);NAD(P)-binding domain (1);	0.438834	0.26349	N	0.024890	T	0.13628	0.0330	L	0.48642	1.525	0.23293	N	0.997962	B	0.21452	0.056	B	0.17098	0.017	T	0.16928	-1.0386	10	0.41790	T	0.15	-9.6132	1.6318	0.02734	0.2087:0.3687:0.1169:0.3057	.	51	Q3B7J2	GFOD2_HUMAN	T	51	ENSP00000268797:A51T	ENSP00000268797:A51T	A	-	1	0	GFOD2	66276969	0.995000	0.38212	0.997000	0.53966	0.894000	0.52154	0.540000	0.23191	0.101000	0.17610	-0.367000	0.07326	GCC	.	C|1.000;T|0.000	0.000	weak		0.567	GFOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268868.2	NM_030819	
SMG6	23293	hgsc.bcm.edu	37	17	1989066	1989066	+	Missense_Mutation	SNP	T	T	C	rs369806279		TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr17:1989066T>C	ENST00000263073.6	-	14	3537	c.3487A>G	c.(3487-3489)Atg>Gtg	p.M1163V	SMG6_ENST00000354901.4_Missense_Mutation_p.M255V|SMG6_ENST00000573166.1_5'UTR|SMG6_ENST00000536871.2_Missense_Mutation_p.M255V|SMG6_ENST00000544865.1_Missense_Mutation_p.M1132V	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	1163					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TCCTTTCCCATGGTGTCTGGG	0.547																																					p.M1163V	Melanoma(59;28 1088 11621 25887 46638 50814)	Atlas-SNP	.											.	SMG6	97	.	0			c.A3487G						PASS	.	T	VAL/MET,VAL/MET	0,4406		0,0,2203	278.0	263.0	268.0		3394,3487	5.9	1.0	17		268	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SMG6	NM_001170957.1,NM_017575.4	21,21	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign,benign	1132/1389,1163/1420	1989066	1,13005	2203	4300	6503	SO:0001583	missense	23293	exon14			TTCCCATGGTGTC	AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.3487A>G	chr17.hg19:g.1989066T>C	ENSP00000263073:p.Met1163Val	95.0	0.0	.		123.0	11.0	.	NM_017575	B7Z874|O94837|Q86VH6|Q9UF60	Missense_Mutation	SNP	ENST00000263073.6	hg19	CCDS11016.1	.	.	.	.	.	.	.	.	.	.	T	10.57	1.388136	0.25118	0.0	1.16E-4	ENSG00000070366	ENST00000263073;ENST00000544865;ENST00000354901;ENST00000536871	T;T;T	0.16324	3.17;3.17;2.35	5.93	5.93	0.95920	.	0.243961	0.43260	D	0.000590	T	0.09905	0.0243	N	0.12182	0.205	0.44816	D	0.997822	B	0.27351	0.176	B	0.14023	0.01	T	0.24297	-1.0164	10	0.12430	T	0.62	-8.9459	16.3798	0.83452	0.0:0.0:0.0:1.0	.	1163	Q86US8	EST1A_HUMAN	V	1163;1132;74;255	ENSP00000263073:M1163V;ENSP00000443920:M1132V;ENSP00000440283:M255V	ENSP00000263073:M1163V	M	-	1	0	SMG6	1935816	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.867000	0.63013	2.271000	0.75665	0.533000	0.62120	ATG	.	.	.	weak		0.547	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437826.3		
RAI1	10743	hgsc.bcm.edu	37	17	17699195	17699195	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr17:17699195A>T	ENST00000353383.1	+	3	3402	c.2933A>T	c.(2932-2934)aAg>aTg	p.K978M	RAI1_ENST00000261641.6_Missense_Mutation_p.K978M	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	978					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		AAGCCCAACAAGCCTGCTGTG	0.657																																					p.K978M		Atlas-SNP	.											.	RAI1	121	.	0			c.A2933T						PASS	.						29.0	30.0	30.0					17																	17699195		2203	4299	6502	SO:0001583	missense	10743	exon3			CCAACAAGCCTGC	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.2933A>T	chr17.hg19:g.17699195A>T	ENSP00000323074:p.Lys978Met	27.0	0.0	.		59.0	25.0	.	NM_030665	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Missense_Mutation	SNP	ENST00000353383.1	hg19	CCDS11188.1	.	.	.	.	.	.	.	.	.	.	A	14.60	2.582930	0.46006	.	.	ENSG00000108557	ENST00000353383;ENST00000395776;ENST00000261641;ENST00000315321	T;T	0.72282	-0.64;-0.04	4.59	3.49	0.39957	.	0.277855	0.30519	N	0.009444	T	0.70937	0.3281	L	0.57536	1.79	0.35405	D	0.791949	P	0.46395	0.877	P	0.47470	0.548	T	0.77789	-0.2456	10	0.62326	D	0.03	.	11.3935	0.49827	0.8486:0.1514:0.0:0.0	.	978	Q7Z5J4	RAI1_HUMAN	M	978;978;978;930	ENSP00000323074:K978M;ENSP00000261641:K978M	ENSP00000261641:K978M	K	+	2	0	RAI1	17639920	1.000000	0.71417	0.975000	0.42487	0.557000	0.35523	2.673000	0.46858	0.593000	0.29745	0.402000	0.26972	AAG	.	.	.	none		0.657	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665	
FAM83G	644815	hgsc.bcm.edu	37	17	18882130	18882130	+	Silent	SNP	A	A	G			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr17:18882130A>G	ENST00000388995.6	-	5	1072	c.849T>C	c.(847-849)aaT>aaC	p.N283N	SLC5A10_ENST00000395647.2_Intron|SLC5A10_ENST00000417251.2_Intron|SLC5A10_ENST00000395643.2_Intron|FAM83G_ENST00000345041.4_Silent_p.N283N|FAM83G_ENST00000585154.2_Silent_p.N283N|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000317977.6_Intron|SLC5A10_ENST00000395645.3_Intron			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	283					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						CAGAGATCACATTCCGGTCCG	0.632																																					p.N283N		Atlas-SNP	.											.	FAM83G	51	.	0			c.T849C						PASS	.						52.0	58.0	56.0					17																	18882130		2168	4253	6421	SO:0001819	synonymous_variant	644815	exon5			GATCACATTCCGG	AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.849T>C	chr17.hg19:g.18882130A>G		165.0	0.0	.		158.0	73.0	.	NM_001039999	Q3KQZ4|Q6ZW60	Silent	SNP	ENST00000388995.6	hg19	CCDS42276.1																																																																																			.	.	.	none		0.632	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253108.4		
KIAA0100	9703	hgsc.bcm.edu	37	17	26961608	26961608	+	Silent	SNP	A	A	G			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr17:26961608A>G	ENST00000528896.2	-	16	3071	c.2997T>C	c.(2995-2997)ccT>ccC	p.P999P	KIAA0100_ENST00000544884.1_Silent_p.P856P|RP11-192H23.7_ENST00000583787.1_RNA|KIAA0100_ENST00000389003.3_Silent_p.P856P|RP11-192H23.7_ENST00000577814.1_RNA	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	999						extracellular region (GO:0005576)		p.P999P(1)		breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					CAGGGGGAAAAGGGCTGCCTG	0.493																																					p.P999P		Atlas-SNP	.											KIAA0100,NS,carcinoma,0,1	KIAA0100	175	.	1	Substitution - coding silent(1)	prostate(1)	c.T2997C						PASS	.						110.0	106.0	107.0					17																	26961608		2203	4300	6503	SO:0001819	synonymous_variant	9703	exon16			GGGAAAAGGGCTG	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.2997T>C	chr17.hg19:g.26961608A>G		79.0	0.0	.		97.0	4.0	.	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Silent	SNP	ENST00000528896.2	hg19	CCDS32595.1																																																																																			.	.	.	none		0.493	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
KRTAP4-7	100132476	hgsc.bcm.edu	37	17	39240791	39240791	+	Silent	SNP	C	C	G	rs553572799	byFrequency	TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr17:39240791C>G	ENST00000391417.4	+	1	333	c.333C>G	c.(331-333)cgC>cgG	p.R111R		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	136	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].		Missing. {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.R111_C115delRPSCC(1)|p.?(1)		NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						cctgctgccgccccagctgct	0.662																																					p.R111R		Atlas-SNP	.											KRTAP4-9_ENST00000377734,NS,carcinoma,0,2	KRTAP4-7	49	.	2	Unknown(1)|Deletion - In frame(1)	NS(2)	c.C333G						PASS	.																																			SO:0001819	synonymous_variant	100132476	exon1			CTGCCGCCCCAGC	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.333C>G	chr17.hg19:g.39240791C>G		19.0	0.0	.		42.0	6.0	.	NM_033061	A0AVM6|A8MQ08|A8MTL4	Silent	SNP	ENST00000391417.4	hg19	CCDS45673.1																																																																																			.	.	.	none		0.662	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
KRT34	3885	hgsc.bcm.edu	37	17	39538610	39538610	+	Silent	SNP	C	C	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr17:39538610C>T	ENST00000394001.1	-	1	45	c.15G>A	c.(13-15)aaG>aaA	p.K5K		NM_021013.3	NP_066293.2	O76011	KRT34_HUMAN	keratin 34	5	Head.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Breast(137;0.000496)				TGGGTGGGGGCTTGGCATACA	0.443																																					p.K5K		Atlas-SNP	.											.	KRT34	71	.	0			c.G15A						PASS	.						70.0	70.0	70.0					17																	39538610		2203	4300	6503	SO:0001819	synonymous_variant	3885	exon1			TGGGGGCTTGGCA	Y16790	CCDS11390.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131737	ENSG00000131737		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6452	protein-coding gene	gene with protein product	"""hard keratin type I 4"""	602763	"""keratin, hair, acidic, 4"""	KRTHA4		2431943, 9756910, 16831889	Standard	NM_021013		Approved	Ha-4	uc002hwm.3	O76011	OTTHUMG00000133436	ENST00000394001.1:c.15G>A	chr17.hg19:g.39538610C>T		89.0	0.0	.		152.0	58.0	.	NM_021013	Q8IUT8|Q8N4W2	Silent	SNP	ENST00000394001.1	hg19	CCDS11390.1																																																																																			.	.	.	none		0.443	KRT34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257304.3	NM_021013	
ATCAY	85300	hgsc.bcm.edu	37	19	3907799	3907799	+	Silent	SNP	G	G	C	rs373080859	byFrequency	TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr19:3907799G>C	ENST00000450849.2	+	5	893	c.426G>C	c.(424-426)acG>acC	p.T142T	ATCAY_ENST00000600960.1_Silent_p.T142T|ATCAY_ENST00000398448.3_Silent_p.T148T|ATCAY_ENST00000301260.6_Silent_p.T142T	NM_033064.4	NP_149053.1	Q86WG3	ATCAY_HUMAN	ataxia, cerebellar, Cayman type	142					apoptotic process (GO:0006915)|mitochondrion distribution (GO:0048311)|negative regulation of glutamate metabolic process (GO:2000212)|neuron projection development (GO:0031175)|regulation of protein localization (GO:0032880)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|synapse (GO:0045202)	kinesin binding (GO:0019894)			breast(1)|endometrium(2)|kidney(2)|lung(2)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		GGGACGGCACGACGGAGGACG	0.647																																					p.T142T		Atlas-SNP	.											.	ATCAY	84	.	0			c.G426C						PASS	.						48.0	58.0	55.0					19																	3907799		2075	4210	6285	SO:0001819	synonymous_variant	85300	exon5			CGGCACGACGGAG		CCDS45923.1	19p13.3	2014-06-24	2008-07-18		ENSG00000167654	ENSG00000167654			779	protein-coding gene	gene with protein product	"""Cayman ataxia"", ""caytaxin"""	608179				8845847, 14556008	Standard	NM_033064		Approved		uc002lyy.4	Q86WG3	OTTHUMG00000181836	ENST00000450849.2:c.426G>C	chr19.hg19:g.3907799G>C		208.0	0.0	.		257.0	114.0	.	NM_033064	Q8NAQ2|Q8TAQ3|Q96HC6|Q96JF5	Silent	SNP	ENST00000450849.2	hg19	CCDS45923.1																																																																																			.	.	.	alt		0.647	ATCAY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457872.2		
BRD4	23476	hgsc.bcm.edu	37	19	15354087	15354087	+	Silent	SNP	G	G	A			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr19:15354087G>A	ENST00000263377.2	-	14	3014	c.2793C>T	c.(2791-2793)taC>taT	p.Y931Y		NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	931					cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			GCTGCTGCAGGTACAGCTGCA	0.692			T	C15orf55	lethal midline carcinoma of young people																																p.Y931Y		Atlas-SNP	.		Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	.	BRD4	172	.	0			c.C2793T						PASS	.						9.0	9.0	9.0					19																	15354087		2151	4234	6385	SO:0001819	synonymous_variant	23476	exon14			CTGCAGGTACAGC	Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.2793C>T	chr19.hg19:g.15354087G>A		44.0	0.0	.		32.0	18.0	.	NM_058243	O60433|Q4G0X8|Q86YS8|Q96PD3	Silent	SNP	ENST00000263377.2	hg19	CCDS12328.1																																																																																			.	.	.	none		0.692	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465800.3	NM_058243	
GYS1	2997	hgsc.bcm.edu	37	19	49489290	49489290	+	Silent	SNP	G	G	A			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr19:49489290G>A	ENST00000323798.3	-	4	691	c.495C>T	c.(493-495)ttC>ttT	p.F165F	GYS1_ENST00000540532.1_Silent_p.F85F|GYS1_ENST00000541188.1_Silent_p.F85F|GYS1_ENST00000263276.6_Silent_p.F101F|GYS1_ENST00000457974.1_5'Flank|GYS1_ENST00000544287.1_Intron	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	165					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		TCTGTGCCAGGAACTGTGGGC	0.582																																					p.F165F		Atlas-SNP	.											.	GYS1	59	.	0			c.C495T						PASS	.						52.0	43.0	46.0					19																	49489290		2203	4300	6503	SO:0001819	synonymous_variant	2997	exon4			TGCCAGGAACTGT		CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.495C>T	chr19.hg19:g.49489290G>A		46.0	0.0	.		43.0	14.0	.	NM_002103	Q9BTT9	Silent	SNP	ENST00000323798.3	hg19	CCDS12747.1																																																																																			.	.	.	none		0.582	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319791.1	NM_002103	
PPFIA3	8541	hgsc.bcm.edu	37	19	49652538	49652538	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr19:49652538T>G	ENST00000334186.4	+	27	3659	c.3310T>G	c.(3310-3312)Ttc>Gtc	p.F1104V	PPFIA3_ENST00000602351.1_Missense_Mutation_p.F1095V	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	1104	SAM 3. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		GGAGAAGGAATTCAGCAACCT	0.657																																					p.F1104V		Atlas-SNP	.											.	PPFIA3	71	.	0			c.T3310G						PASS	.						38.0	43.0	41.0					19																	49652538		2203	4300	6503	SO:0001583	missense	8541	exon27			AAGGAATTCAGCA	AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.3310T>G	chr19.hg19:g.49652538T>G	ENSP00000335614:p.Phe1104Val	168.0	0.0	.		167.0	68.0	.	NM_003660	A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Missense_Mutation	SNP	ENST00000334186.4	hg19	CCDS12758.1	.	.	.	.	.	.	.	.	.	.	T	26.6	4.749161	0.89753	.	.	ENSG00000177380	ENST00000334186	D	0.83914	-1.78	4.29	4.29	0.51040	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (1);Sterile alpha motif, type 2 (1);	0.000000	0.50627	D	0.000111	D	0.88100	0.6346	M	0.78285	2.405	0.80722	D	1	P;D	0.53462	0.934;0.96	P;P	0.55615	0.78;0.699	D	0.89774	0.3956	10	0.87932	D	0	-18.5267	12.8314	0.57748	0.0:0.0:0.0:1.0	.	1095;1104	O75145-2;O75145	.;LIPA3_HUMAN	V	1104	ENSP00000335614:F1104V	ENSP00000335614:F1104V	F	+	1	0	PPFIA3	54344350	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.014000	0.70784	1.935000	0.56089	0.459000	0.35465	TTC	.	.	.	none		0.657	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465688.1	NM_003660	
TSHZ2	128553	hgsc.bcm.edu	37	20	51871547	51871547	+	Missense_Mutation	SNP	T	T	G			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr20:51871547T>G	ENST00000371497.5	+	2	2437	c.1550T>G	c.(1549-1551)tTg>tGg	p.L517W	TSHZ2_ENST00000329613.6_Missense_Mutation_p.L514W|TSHZ2_ENST00000603338.2_Missense_Mutation_p.L514W|RP4-678D15.1_ENST00000606932.1_RNA	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	517					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			GGGGACATTTTGAAATCTTTG	0.483																																					p.L517W		Atlas-SNP	.											.	TSHZ2	209	.	0			c.T1550G						PASS	.						56.0	60.0	59.0					20																	51871547		2203	4300	6503	SO:0001583	missense	128553	exon2			ACATTTTGAAATC	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.1550T>G	chr20.hg19:g.51871547T>G	ENSP00000360552:p.Leu517Trp	98.0	0.0	.		126.0	66.0	.	NM_173485	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	hg19	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	T	19.69	3.874271	0.72180	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.54866	0.55;0.55	5.95	5.95	0.96441	.	0.000000	0.64402	D	0.000001	T	0.74015	0.3661	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.77437	-0.2588	10	0.87932	D	0	-12.7719	16.3964	0.83607	0.0:0.0:0.0:1.0	.	517	Q9NRE2	TSH2_HUMAN	W	517;514;43	ENSP00000360552:L517W;ENSP00000333114:L514W	ENSP00000333114:L514W	L	+	2	0	TSHZ2	51304954	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	7.693000	0.84214	2.275000	0.75901	0.523000	0.50628	TTG	.	.	.	none		0.483	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
NELFCD	51497	hgsc.bcm.edu	37	20	57568776	57568776	+	Missense_Mutation	SNP	A	A	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr20:57568776A>T	ENST00000344018.3	+	13	1592	c.1565A>T	c.(1564-1566)aAg>aTg	p.K522M	NELFCD_ENST00000479207.1_Intron|NELFCD_ENST00000602795.1_Missense_Mutation_p.K531M			Q8IXH7	NELFD_HUMAN	negative elongation factor complex member C/D	522					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	membrane (GO:0016020)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)											TGTCTGGAGAAGCTGGACACT	0.453																																					p.K531M		Atlas-SNP	.											.	.	.	.	0			c.A1592T						PASS	.						198.0	176.0	183.0					20																	57568776		2203	4300	6503	SO:0001583	missense	51497	exon13			TGGAGAAGCTGGA	AF161479	CCDS13473.1, CCDS13473.2	20q13	2013-01-31	2013-01-31	2013-01-31	ENSG00000101158	ENSG00000101158			15934	protein-coding gene	gene with protein product	"""trihydrophobin 1"""	605297	"""TH1-like (Drosophila homolog)"", ""TH1-like (Drosophila)"""	TH1L		11030415, 11042152	Standard	NM_198976		Approved	HSPC130, TH1, NELF-C, NELF-D	uc002yag.4	Q8IXH7	OTTHUMG00000032861	ENST00000344018.3:c.1565A>T	chr20.hg19:g.57568776A>T	ENSP00000342300:p.Lys522Met	80.0	0.0	.		74.0	35.0	.	NM_198976	B4DE06|Q9BYL2|Q9H405|Q9H888|Q9H8T3|Q9NVX5|Q9P029|Q9UGN1|Q9UGN2|Q9UGN3	Missense_Mutation	SNP	ENST00000344018.3	hg19		.	.	.	.	.	.	.	.	.	.	A	18.47	3.631340	0.67015	.	.	ENSG00000101158	ENST00000344018	.	.	.	4.35	4.35	0.52113	.	0.000000	0.85682	D	0.000000	T	0.65678	0.2714	L	0.47716	1.5	0.58432	D	0.999995	D	0.69078	0.997	P	0.60345	0.873	T	0.68519	-0.5387	9	0.56958	D	0.05	-49.9271	13.982	0.64310	1.0:0.0:0.0:0.0	.	522	Q8IXH7	NELFD_HUMAN	M	522	.	ENSP00000342300:K522M	K	+	2	0	TH1L	57002171	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.301000	0.78850	1.953000	0.56701	0.455000	0.32223	AAG	.	.	.	none		0.453	NELFCD-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_198976	
RBBP8NL	140893	hgsc.bcm.edu	37	20	60992327	60992327	+	Silent	SNP	C	C	A			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr20:60992327C>A	ENST00000252998.1	-	4	309	c.153G>T	c.(151-153)cgG>cgT	p.R51R		NM_080833.2	NP_543023.2	Q8NC74	RB8NL_HUMAN	RBBP8 N-terminal like	51						extracellular space (GO:0005615)											TCTGCTGTTCCCGGAGCTGGT	0.612																																					p.R51R		Atlas-SNP	.											.	.	.	.	0			c.G153T						PASS	.						108.0	75.0	86.0					20																	60992327		2203	4296	6499	SO:0001819	synonymous_variant	140893	exon4			CTGTTCCCGGAGC	AL121832	CCDS13498.1	20q13.33	2012-10-30	2012-10-30	2012-10-30	ENSG00000130701	ENSG00000130701			16144	protein-coding gene	gene with protein product	"""hypothetical protein LOC140893"""		"""chromosome 20 open reading frame 151"""	C20orf151		11780052	Standard	NM_080833		Approved	dJ908M14.3	uc002ycw.2	Q8NC74	OTTHUMG00000032913	ENST00000252998.1:c.153G>T	chr20.hg19:g.60992327C>A		59.0	0.0	.		46.0	17.0	.	NM_080833	B2RP98|Q8N4Z9|Q9BR75|Q9H0Y9	Silent	SNP	ENST00000252998.1	hg19	CCDS13498.1																																																																																			.	.	.	none		0.612	RBBP8NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080029.1	NM_080833	
PTK6	5753	hgsc.bcm.edu	37	20	62168575	62168575	+	Silent	SNP	C	C	T	rs370151198		TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr20:62168575C>T	ENST00000217185.2	-	1	120	c.93G>A	c.(91-93)gcG>gcA	p.A31A	PTK6_ENST00000542869.1_5'UTR	NM_005975.3	NP_005966.1	Q13882	PTK6_HUMAN	protein tyrosine kinase 6	31	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|intestinal epithelial cell differentiation (GO:0060575)|negative regulation of growth (GO:0045926)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ruffle (GO:0001726)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(1)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	15	all_cancers(38;2.51e-11)		Epithelial(9;1.5e-08)|all cancers(9;8.67e-08)|BRCA - Breast invasive adenocarcinoma(10;6.43e-06)		Vandetanib(DB05294)	AGACGTCCCCCGCGCGGAAGC	0.701																																					p.A31A		Atlas-SNP	.											.	PTK6	33	.	0			c.G93A						PASS	.	A		1,4369	2.1+/-5.4	0,1,2184	33.0	28.0	30.0		93	-9.0	0.0	20		30	0,8580		0,0,4290	no	coding-synonymous	PTK6	NM_005975.2		0,1,6474	TT,TC,CC		0.0,0.0229,0.0077		31/452	62168575	1,12949	2185	4290	6475	SO:0001819	synonymous_variant	5753	exon1			GTCCCCCGCGCGG	U61412	CCDS13524.1, CCDS74750.1	20q13.3	2013-02-18	2013-02-18		ENSG00000101213	ENSG00000101213	2.7.10.1	"""SH2 domain containing"""	9617	protein-coding gene	gene with protein product		602004	"""PTK6 protein tyrosine kinase 6"""			8247543, 9284935	Standard	NM_005975		Approved	BRK	uc002yfg.4	Q13882	OTTHUMG00000033039	ENST00000217185.2:c.93G>A	chr20.hg19:g.62168575C>T		76.0	0.0	.		69.0	20.0	.	NM_001256358	B2RCR3|B4DW46|Q58F01	Silent	SNP	ENST00000217185.2	hg19	CCDS13524.1																																																																																			.	.	.	weak		0.701	PTK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080313.1		
ZBTB21	49854	hgsc.bcm.edu	37	21	43411959	43411959	+	Missense_Mutation	SNP	A	A	G			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr21:43411959A>G	ENST00000310826.5	-	3	2429	c.2246T>C	c.(2245-2247)gTc>gCc	p.V749A	ZBTB21_ENST00000465968.1_5'UTR|ZBTB21_ENST00000398511.3_Missense_Mutation_p.V749A|ZBTB21_ENST00000398499.1_Missense_Mutation_p.V749A|ZBTB21_ENST00000398505.3_Missense_Mutation_p.V548A	NM_001098402.1	NP_001091872.1	Q9ULJ3	ZBT21_HUMAN	zinc finger and BTB domain containing 21	749					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)										GTAAGGGCAGACGGCCGCGTT	0.557																																					p.V749A		Atlas-SNP	.											.	.	.	.	0			c.T2246C						PASS	.						141.0	162.0	155.0					21																	43411959		2203	4300	6503	SO:0001583	missense	49854	exon3			GGGCAGACGGCCG	AB033053	CCDS13678.1, CCDS42934.1	21q22.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000173276	ENSG00000173276		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13083	protein-coding gene	gene with protein product			"""zinc finger protein 295"""	ZNF295			Standard	NM_020727		Approved	KIAA1227	uc002yzy.4	Q9ULJ3	OTTHUMG00000086789	ENST00000310826.5:c.2246T>C	chr21.hg19:g.43411959A>G	ENSP00000308759:p.Val749Ala	59.0	0.0	.		79.0	38.0	.	NM_001098402	Q5R2W1|Q5R2W2|Q6P4R0	Missense_Mutation	SNP	ENST00000310826.5	hg19	CCDS13678.1	.	.	.	.	.	.	.	.	.	.	A	19.02	3.745708	0.69418	.	.	ENSG00000173276	ENST00000398505;ENST00000310826;ENST00000398499;ENST00000398511	T;T;T;T	0.07567	3.24;3.18;3.18;3.18	5.62	4.47	0.54385	Zinc finger, C2H2-like (1);	0.000000	0.64402	D	0.000003	T	0.21307	0.0513	L	0.58101	1.795	0.42558	D	0.993131	D;D	0.76494	0.999;0.989	D;P	0.75484	0.986;0.81	T	0.02683	-1.1124	10	0.21540	T	0.41	-20.3315	11.354	0.49605	0.9292:0.0:0.0708:0.0	.	548;749	Q9ULJ3-2;Q9ULJ3	.;ZN295_HUMAN	A	548;749;749;749	ENSP00000381517:V548A;ENSP00000308759:V749A;ENSP00000381512:V749A;ENSP00000381523:V749A	ENSP00000308759:V749A	V	-	2	0	ZNF295	42285028	1.000000	0.71417	0.838000	0.33150	0.895000	0.52256	8.724000	0.91462	0.964000	0.38108	0.460000	0.39030	GTC	.	.	.	none		0.557	ZBTB21-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195308.1	NM_020727	
PIM3	415116	hgsc.bcm.edu	37	22	50354605	50354605	+	Missense_Mutation	SNP	T	T	C			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr22:50354605T>C	ENST00000360612.4	+	1	445	c.10T>C	c.(10-12)Tcc>Ccc	p.S4P		NM_001001852.3	NP_001001852.2	Q86V86	PIM3_HUMAN	Pim-3 proto-oncogene, serine/threonine kinase	4					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|histone phosphorylation (GO:0016572)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)						all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.196)|LUAD - Lung adenocarcinoma(64;0.247)		GATGCTGCTCTCCAAGTTCGG	0.796																																					p.S4P		Atlas-SNP	.											.	PIM3	15	.	0			c.T10C						PASS	.						2.0	3.0	3.0					22																	50354605		1697	3572	5269	SO:0001583	missense	415116	exon1			CTGCTCTCCAAGT	BC052239	CCDS33678.1	22q13	2014-06-25	2014-06-25		ENSG00000198355	ENSG00000198355			19310	protein-coding gene	gene with protein product		610580	"""pim-3 oncogene"""			12477932	Standard	NM_001001852		Approved		uc003bjb.3	Q86V86	OTTHUMG00000150290	ENST00000360612.4:c.10T>C	chr22.hg19:g.50354605T>C	ENSP00000353824:p.Ser4Pro	11.0	0.0	.		16.0	8.0	.	NM_001001852	A5D8X8|A8K7J0|B1B0P0|Q68BM2	Missense_Mutation	SNP	ENST00000360612.4	hg19	CCDS33678.1	.	.	.	.	.	.	.	.	.	.	t	14.84	2.655437	0.47467	.	.	ENSG00000198355	ENST00000360612	T	0.58060	0.36	2.45	2.45	0.29901	.	0.370508	0.18727	U	0.132860	T	0.63248	0.2495	L	0.59436	1.845	0.46376	D	0.999016	D	0.71674	0.998	D	0.64877	0.93	T	0.64504	-0.6392	10	0.72032	D	0.01	.	9.6248	0.39743	0.0:0.0:0.0:1.0	.	4	Q86V86	PIM3_HUMAN	P	4	ENSP00000353824:S4P	ENSP00000353824:S4P	S	+	1	0	PIM3	48740609	0.997000	0.39634	0.992000	0.48379	0.091000	0.18340	1.814000	0.38972	1.031000	0.39867	0.382000	0.24955	TCC	.	.	.	none		0.796	PIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317406.1	NM_001001852	
MAGEB16	139604	hgsc.bcm.edu	37	X	35821036	35821036	+	Silent	SNP	C	C	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chrX:35821036C>T	ENST00000399989.1	+	2	1002	c.723C>T	c.(721-723)ttC>ttT	p.F241F	MAGEB16_ENST00000399988.1_Silent_p.F241F|MAGEB16_ENST00000399985.1_Silent_p.F241F|MAGEB16_ENST00000399987.1_Silent_p.F241F|MAGEB16_ENST00000399992.1_Silent_p.F273F	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	241	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						AGAAGCACTTCATCTTTGGAG	0.483																																					p.F241F		Atlas-SNP	.											.	MAGEB16	64	.	0			c.C723T						PASS	.						51.0	50.0	50.0					X																	35821036		2161	4280	6441	SO:0001819	synonymous_variant	139604	exon2			GCACTTCATCTTT		CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.723C>T	chrX.hg19:g.35821036C>T		255.0	0.0	.		309.0	142.0	.	NM_001099921	A8MU30	Silent	SNP	ENST00000399989.1	hg19	CCDS43927.1																																																																																			.	.	.	none		0.483	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251034.1		
AR	367	hgsc.bcm.edu	37	X	66765152	66765152	+	Missense_Mutation	SNP	T	T	A			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chrX:66765152T>A	ENST00000374690.3	+	1	688	c.164T>A	c.(163-165)cTg>cAg	p.L55Q	AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Missense_Mutation_p.L55Q|AR_ENST00000504326.1_Missense_Mutation_p.L55Q	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	55	Modulating.|Poly-Leu.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	GCCAGTTTGCTGCTGCTgcag	0.662									Androgen Insensitivity Syndrome																												p.L55Q		Atlas-SNP	.											.	AR	249	.	0			c.T164A						PASS	.						11.0	14.0	13.0					X																	66765152		2169	4252	6421	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	GTTTGCTGCTGCT	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.164T>A	chrX.hg19:g.66765152T>A	ENSP00000363822:p.Leu55Gln	217.0	0.0	.		278.0	13.0	.	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	hg19	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	N	7.392	0.630975	0.14322	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.58797	0.31;0.31;0.31	.	.	.	.	0.268702	0.26919	N	0.021823	T	0.26666	0.0652	N	0.08118	0	0.09310	N	0.999996	B;B	0.17852	0.006;0.024	B;B	0.04013	0.0;0.001	T	0.17107	-1.0380	8	0.10111	T	0.7	.	.	.	.	.	55;55	E7EVX6;D3YPQ2	.;.	Q	55	ENSP00000363822:L55Q;ENSP00000421155:L55Q;ENSP00000379359:L55Q	ENSP00000363822:L55Q	L	+	2	0	AR	66681877	0.998000	0.40836	0.922000	0.36590	0.480000	0.33159	0.009000	0.13219	0.000000	0.14550	0.000000	0.15137	CTG	.	.	.	none		0.662	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
ATP7A	538	hgsc.bcm.edu	37	X	77254011	77254011	+	Missense_Mutation	SNP	C	C	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chrX:77254011C>T	ENST00000341514.6	+	5	1528	c.1373C>T	c.(1372-1374)tCa>tTa	p.S458L	ATP7A_ENST00000350425.4_Intron|ATP7A_ENST00000343533.5_Missense_Mutation_p.S458L	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	458					blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	GCTCAGCCTTCATCGGAAATG	0.393																																					p.S458L		Atlas-SNP	.											.	ATP7A	248	.	0			c.C1373T						PASS	.						166.0	155.0	158.0					X																	77254011		2203	4296	6499	SO:0001583	missense	538	exon5			AGCCTTCATCGGA	L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.1373C>T	chrX.hg19:g.77254011C>T	ENSP00000345728:p.Ser458Leu	293.0	0.0	.		286.0	115.0	.	NM_000052	B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	ENST00000341514.6	hg19	CCDS35339.1	.	.	.	.	.	.	.	.	.	.	C	9.335	1.061539	0.19987	.	.	ENSG00000165240	ENST00000343533;ENST00000341514;ENST00000355691	D;D	0.96300	-3.97;-3.97	5.23	4.34	0.51931	.	0.427019	0.23409	N	0.048483	D	0.91061	0.7187	N	0.19112	0.55	0.39495	D	0.968115	B;B	0.17667	0.001;0.023	B;B	0.17098	0.002;0.017	D	0.87643	0.2523	10	0.29301	T	0.29	-6.2236	11.0442	0.47849	0.0:0.7938:0.1285:0.0777	.	458;468	Q04656;Q59HD1	ATP7A_HUMAN;.	L	458;458;468	ENSP00000343026:S458L;ENSP00000345728:S458L	ENSP00000345728:S458L	S	+	2	0	ATP7A	77140667	0.774000	0.28592	0.851000	0.33527	0.190000	0.23558	1.694000	0.37752	2.315000	0.78130	0.600000	0.82982	TCA	.	.	.	none		0.393	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057306.1	NM_000052	
SEC24B	10427	hgsc.bcm.edu	37	4	110433149	110433169	+	In_Frame_Del	DEL	TGCCGATCCTGTCGAACGTAT	TGCCGATCCTGTCGAACGTAT	-	rs534235016|rs574648225		TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	TGCCGATCCTGTCGAACGTAT	TGCCGATCCTGTCGAACGTAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr4:110433149_110433169delTGCCGATCCTGTCGAACGTAT	ENST00000265175.5	+	9	1868_1888	c.1813_1833delTGCCGATCCTGTCGAACGTAT	c.(1813-1833)tgccgatcctgtcgaacgtatdel	p.CRSCRTY605del	SEC24B_ENST00000504968.2_In_Frame_Del_p.CRSCRTY635del|SEC24B_ENST00000399100.2_In_Frame_Del_p.CRSCRTY570del	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	605	Zinc finger-like.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		CATTGTGAGGTGCCGATCCTGTCGAACGTATATTAACCCCT	0.367																																					p.604_611del		Atlas-Indel,Pindel	.											.	SEC24B	186	.	0			c.1812_1832del						PASS	.																																			SO:0001651	inframe_deletion	10427	exon9			.	AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.1813_1833delTGCCGATCCTGTCGAACGTAT	chr4.hg19:g.110433149_110433169delTGCCGATCCTGTCGAACGTAT	ENSP00000265175:p.Cys605_Tyr611del	104.0	0.0	0		70.0	15.0	0.214286	NM_006323	B7ZKM8|B7ZKN4|Q0VG08	In_Frame_Del	DEL	ENST00000265175.5	hg19	CCDS47124.1																																																																																			.	.	.	none		0.367	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364693.2		
ST8SIA2	8128	hgsc.bcm.edu	37	15	92981704	92981704	+	Frame_Shift_Del	DEL	A	A	-			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr15:92981704delA	ENST00000268164.3	+	4	649	c.412delA	c.(412-414)aacfs	p.N138fs	ST8SIA2_ENST00000539113.1_Frame_Shift_Del_p.N117fs	NM_006011.3	NP_006002.1	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2	138					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	early endosome (GO:0005769)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|recycling endosome (GO:0055037)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			endometrium(2)|large_intestine(6)|lung(9)|skin(2)|urinary_tract(1)	20	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			TGTGTCCCAGAACCTCTACGA	0.512																																					p.Q137fs		Atlas-Indel,Pindel	.											.	ST8SIA2	41	.	0			c.411delG						PASS	.						143.0	144.0	144.0					15																	92981704		2198	4298	6496	SO:0001589	frameshift_variant	8128	exon4			.	U33551	CCDS10372.1	15q26	2013-03-01	2003-01-14	2005-02-07	ENSG00000140557	ENSG00000140557		"""Sialyltransferases"""	10870	protein-coding gene	gene with protein product		602546	"""sialyltransferase 8 (alpha-2, 8-sialytransferase) B"""	SIAT8B		7559389	Standard	NM_006011		Approved	STX, ST8SIA-II, HsT19690	uc002bra.3	Q92186	OTTHUMG00000149843	ENST00000268164.3:c.412delA	chr15.hg19:g.92981704delA	ENSP00000268164:p.Asn138fs	123.0	0.0	0		155.0	54.0	0.348387	NM_006011	Q4VAZ0|Q92470|Q92746	Frame_Shift_Del	DEL	ENST00000268164.3	hg19	CCDS10372.1																																																																																			.	.	.	none		0.512	ST8SIA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313526.1	NM_006011	
PCMT1	5110	hgsc.bcm.edu	37	6	150070882	150070883	+	5'UTR	INS	-	-	GCGGCA			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr6:150070882_150070883insGCGGCA	ENST00000367380.5	+	0	52_53				PCMT1_ENST00000367378.1_In_Frame_Ins_p.9_10insGS|PCMT1_ENST00000464889.1_In_Frame_Ins_p.9_10insGS|NUP43_ENST00000463048.3_5'Flank|PCMT1_ENST00000367384.2_In_Frame_Ins_p.9_10insGS|PCMT1_ENST00000544496.1_5'Flank	NM_001252049.1|NM_001252050.1|NM_001252051.1|NM_001252052.1|NM_005389.2	NP_001238978.1|NP_001238979.1|NP_001238980.1|NP_001238981.1|NP_005380.2	P22061	PIMT_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase						protein methylation (GO:0006479)|protein repair (GO:0030091)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.221)	OV - Ovarian serous cystadenocarcinoma(155;5.63e-13)|GBM - Glioblastoma multiforme(68;0.207)		AGCGCgcagtggcggcagcggc	0.743																																					p.G7delinsGGS		Atlas-Indel,Pindel	.											.	PCMT1	27	.	0			c.19_20insGCGGCA						PASS	.																																			SO:0001623	5_prime_UTR_variant	5110	exon1			.		CCDS5219.1, CCDS5219.2, CCDS59041.1, CCDS75533.1, CCDS75534.1	6q22.3-q24	2008-02-05			ENSG00000120265	ENSG00000120265	2.1.1.77		8728	protein-coding gene	gene with protein product		176851				1478665, 10343128	Standard	NM_005389		Approved		uc003qne.3	P22061	OTTHUMG00000015794	ENST00000367380.5:c.-155->GCGGCA	chr6.hg19:g.150070883_150070888dupGCGGCA		28.0	0.0	0		47.0	13.0	0.276596	NM_001252050	A8K109|J3KP72|Q14661|Q16556|Q5VYC1|Q5VYC2|Q93061|Q96II9|Q99625|Q9BQV7|Q9BQV8|Q9NP03	In_Frame_Ins	INS	ENST00000367380.5	hg19																																																																																				.	.	.	none		0.743	PCMT1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
FNIP2	57600	hgsc.bcm.edu	37	4	159753052	159753054	+	In_Frame_Del	DEL	ATG	ATG	-			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	ATG	ATG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr4:159753052_159753054delATG	ENST00000264433.6	+	4	496_498	c.421_423delATG	c.(421-423)atgdel	p.M142del	FNIP2_ENST00000379346.3_In_Frame_Del_p.M165del	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	142					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		GTTAGGGGAAATGATGTTTGGCT	0.409																																					p.140_141del		Atlas-Indel,Pindel	.											.	FNIP2	90	.	0			c.420_422del						PASS	.																																			SO:0001651	inframe_deletion	57600	exon4			.	AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.421_423delATG	chr4.hg19:g.159753055_159753057delATG	ENSP00000264433:p.Met142del	135.0	0.0	0		151.0	60.0	0.397351	NM_020840	Q05DC3|Q96I31|Q9H994	In_Frame_Del	DEL	ENST00000264433.6	hg19	CCDS47155.1																																																																																			.	.	.	none		0.409	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1	NM_020840	
ACVR2A	92	hgsc.bcm.edu	37	2	148683732	148683732	+	Splice_Site	DEL	T	T	-			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr2:148683732delT	ENST00000241416.7	+	10	1983		c.e10+2		ACVR2A_ENST00000535787.1_Splice_Site|ACVR2A_ENST00000495775.1_Splice_Site|ACVR2A_ENST00000404590.1_Splice_Site	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA						activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		AAACATGCTGTAAGTTATCCA	0.353																																					.		Atlas-Indel,Pindel	.											.,1	ACVR2A	125	.	0			c.1347+1T>-						PASS	.						115.0	95.0	102.0					2																	148683732		2203	4299	6502	SO:0001630	splice_region_variant	92	exon10			.		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.1347+2T>-	chr2.hg19:g.148683732delT		66.0	0.0	0		70.0	22.0	0.314286	NM_001616	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Splice_Site	DEL	ENST00000241416.7	hg19	CCDS33301.1																																																																																			.	.	.	none		0.353	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	Intron
C11orf63	79864	hgsc.bcm.edu	37	11	122830003	122830007	+	Frame_Shift_Del	DEL	GACTC	GACTC	-	rs369261311		TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	GACTC	GACTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr11:122830003_122830007delGACTC	ENST00000531316.1	+	8	2279_2283	c.2187_2191delGACTC	c.(2185-2193)ctgactcatfs	p.TH730fs	C11orf63_ENST00000227349.2_Frame_Shift_Del_p.TH730fs			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	730					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)					breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		CATCAAATCTGACTCATCAAGCATC	0.4																																					p.729_730del		Atlas-Indel,Pindel	.											.	C11orf63	116	.	0			c.2186_2190del						PASS	.																																			SO:0001589	frameshift_variant	79864	exon9			.	BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.2187_2191delGACTC	chr11.hg19:g.122830003_122830007delGACTC	ENSP00000431669:p.Thr730fs	283.0	0.0	0		289.0	118.0	0.408305	NM_024806	A8K6G0|Q96GB5|Q9H5D6	Frame_Shift_Del	DEL	ENST00000531316.1	hg19	CCDS8438.1																																																																																			.	.	.	none		0.400	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387511.1	NM_024806	
ADAMTS7	11173	hgsc.bcm.edu	37	15	79088990	79088991	+	Frame_Shift_Ins	INS	-	-	T			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr15:79088990_79088991insT	ENST00000388820.4	-	4	970_971	c.760_761insA	c.(760-762)atgfs	p.M254fs	ADAMTS7_ENST00000566303.1_5'UTR	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	254	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GTACTCCACCATTTTGGCATCA	0.614																																					p.M254fs		Atlas-Indel,Pindel	.											.	ADAMTS7	142	.	0			c.761_762insA						PASS	.																																			SO:0001589	frameshift_variant	11173	exon4			.	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.761dupA	chr15.hg19:g.79088994_79088994dupT	ENSP00000373472:p.Met254fs	70.0	0.0	0		75.0	34.0	0.453333	NM_014272	Q14F51|Q6P7J9	Frame_Shift_Ins	INS	ENST00000388820.4	hg19	CCDS32303.1																																																																																			.	.	.	none		0.614	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
ARHGAP32	9743	hgsc.bcm.edu	37	11	128840378	128840379	+	Frame_Shift_Ins	INS	-	-	AGCTCAAAGA			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr11:128840378_128840379insAGCTCAAAGA	ENST00000310343.9	-	22	4686_4687	c.4687_4688insTCTTTGAGCT	c.(4687-4689)tccfs	p.S1563fs	ARHGAP32_ENST00000524655.1_3'UTR|ARHGAP32_ENST00000527272.1_Frame_Shift_Ins_p.S1214fs|ARHGAP32_ENST00000392657.3_Frame_Shift_Ins_p.S1214fs	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	1563	Interaction with GAB2.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						CCTGACAGAGGAGCTCAAAGAA	0.535																																					p.S1563fs		Atlas-Indel,Pindel	.											.	ARHGAP32	307	.	0			c.4688_4689insTCTTTGAGCT						PASS	.																																			SO:0001589	frameshift_variant	9743	exon22			.	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.4678_4687dupTCTTTGAGCT	chr11.hg19:g.128840379_128840388dupAGCTCAAAGA	ENSP00000310561:p.Ser1563fs	135.0	0.0	0		133.0	21.0	0.157895	NM_001142685	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Frame_Shift_Ins	INS	ENST00000310343.9	hg19	CCDS44769.1																																																																																			.	.	.	none		0.535	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
FLNB	2317	hgsc.bcm.edu	37	3	58104719	58104719	+	Intron	DEL	A	A	-			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr3:58104719delA	ENST00000295956.4	+	19	3028				FLNB_ENST00000357272.4_Intron|FLNB_ENST00000348383.5_Intron|FLNB_ENST00000419752.2_Intron|FLNB_ENST00000429972.2_Intron|FLNB_ENST00000490882.1_Intron|FLNB_ENST00000493452.1_Intron|FLNB_ENST00000358537.3_Intron	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta						actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		GGAAAACAGTAAGTGCCTGAA	0.478																																					.		Atlas-Indel,Pindel	.											.	FLNB	430	.	0			c.2863+2A>-						PASS	.						125.0	110.0	115.0					3																	58104719		2203	4300	6503	SO:0001627	intron_variant	2317	exon19			.	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.2863+3A>-	chr3.hg19:g.58104719delA		134.0	0.0	0		210.0	114.0	0.542857	NM_001164317	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Splice_Site	DEL	ENST00000295956.4	hg19	CCDS2885.1																																																																																			.	.	.	none		0.478	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	
OR7A10	390892	hgsc.bcm.edu	37	19	14952156	14952157	+	Frame_Shift_Ins	INS	-	-	A			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr19:14952156_14952157insA	ENST00000248058.1	-	1	532_533	c.533_534insT	c.(532-534)ttcfs	p.F178fs		NM_001005190.1	NP_001005190.1	O76100	OR7AA_HUMAN	olfactory receptor, family 7, subfamily A, member 10	178						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|stomach(1)	19	Ovarian(108;0.203)					TAATTTCACAGAAAAAATGAGG	0.45																																					p.F178fs		Atlas-Indel,Pindel	.											.	OR7A10	33	.	0			c.534_535insT						PASS	.																																			SO:0001589	frameshift_variant	390892	exon1			.		CCDS32936.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8356	protein-coding gene	gene with protein product							Standard	NM_001005190		Approved		uc002mzx.1	O76100		ENST00000248058.1:c.534dupT	chr19.hg19:g.14952162_14952162dupA	ENSP00000248058:p.Phe178fs	140.0	0.0	0		181.0	68.0	0.375691	NM_001005190	Q6IFP0|Q96R97	Frame_Shift_Ins	INS	ENST00000248058.1	hg19	CCDS32936.1																																																																																			.	.	.	none		0.450	OR7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466520.1	NM_001005190	
ATP6V1C2	245973	hgsc.bcm.edu	37	2	10922432	10922436	+	Frame_Shift_Del	DEL	GCGTT	GCGTT	-	rs377277646		TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	GCGTT	GCGTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr2:10922432_10922436delGCGTT	ENST00000272238.4	+	13	1234_1238	c.1125_1129delGCGTT	c.(1123-1131)aagcgtttafs	p.KRL375fs	ATP6V1C2_ENST00000381661.3_Frame_Shift_Del_p.KRL329fs	NM_001039362.1	NP_001034451.1	Q8NEY4	VATC2_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2	375					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of Wnt signaling pathway (GO:0030177)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|protein dimerization activity (GO:0046983)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		CATCCACCAAGCGTTTAAGAGAGGT	0.449																																					p.375_376del	NSCLC(188;1042 2136 10807 16813 47705)	Atlas-Indel,Pindel	.											.	ATP6V1C2	73	.	0			c.1124_1128del						PASS	.																																			SO:0001589	frameshift_variant	245973	exon13			.	AY039759	CCDS1674.1, CCDS42653.1	2p25.1	2010-04-21	2006-01-13		ENSG00000143882	ENSG00000143882		"""ATPases / V-type"""	18264	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 42kD, V1 subunit C isoform 2"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C isoform 2"""			12384298	Standard	XR_426949		Approved	VMA5, ATP6C2	uc002ras.3	Q8NEY4	OTTHUMG00000090459	ENST00000272238.4:c.1125_1129delGCGTT	chr2.hg19:g.10922432_10922436delGCGTT	ENSP00000272238:p.Lys375fs	123.0	0.0	0		103.0	32.0	0.31068	NM_001039362	Q96EL8	Frame_Shift_Del	DEL	ENST00000272238.4	hg19	CCDS42653.1																																																																																			.	.	.	none		0.449	ATP6V1C2-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000323555.1	NM_144583	
PTH1R	5745	hgsc.bcm.edu	37	3	46935466	46935467	+	Frame_Shift_Ins	INS	-	-	A			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr3:46935466_46935467insA	ENST00000313049.5	+	2	348_349	c.145_146insA	c.(145-147)gaafs	p.E49fs	PTH1R_ENST00000490109.1_3'UTR|PTH1R_ENST00000418619.1_Frame_Shift_Ins_p.E49fs|PTH1R_ENST00000430002.2_Frame_Shift_Ins_p.E49fs|PTH1R_ENST00000449590.1_Frame_Shift_Ins_p.E49fs			Q03431	PTH1R_HUMAN	parathyroid hormone 1 receptor	49					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|bone mineralization (GO:0030282)|bone resorption (GO:0045453)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cell proliferation (GO:0008285)|osteoblast development (GO:0002076)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|skeletal system development (GO:0001501)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	parathyroid hormone receptor activity (GO:0004991)|peptide hormone binding (GO:0017046)|protein self-association (GO:0043621)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(2)|stomach(1)|urinary_tract(2)	19					Preotact(DB05829)|Teriparatide(DB06285)	GGCCCAGTGCGAAAAACGGCTC	0.609																																					p.E49fs		Pindel	.											.	PTH1R	49	.	0			c.145_146insA						PASS	.																																			SO:0001589	frameshift_variant	5745	exon3			.		CCDS2747.1	3p22-p21.1	2012-08-10	2008-11-18	2008-11-18	ENSG00000160801	ENSG00000160801		"""GPCR / Class B : Parathyroid hormone receptors"""	9608	protein-coding gene	gene with protein product		168468	"""parathyroid hormone receptor 1"""	PTHR, PTHR1		8020952	Standard	NM_001184744		Approved		uc021wxg.1	Q03431	OTTHUMG00000133515	ENST00000313049.5:c.150dupA	chr3.hg19:g.46935471_46935471dupA	ENSP00000321999:p.Glu49fs	190.0	0.0	.		281.0	86.0	0.306	NM_001184744	Q2M1U3	Frame_Shift_Ins	INS	ENST00000313049.5	hg19	CCDS2747.1																																																																																			.	.	.	none		0.609	PTH1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257481.1	NM_000316	
STEAP4	79689	hgsc.bcm.edu	37	7	87913338	87913349	+	In_Frame_Del	DEL	TGTGGATTGCTA	TGTGGATTGCTA	-	rs149348409	byFrequency	TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	TGTGGATTGCTA	TGTGGATTGCTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr7:87913338_87913349delTGTGGATTGCTA	ENST00000380079.4	-	2	337_348	c.236_247delTAGCAATCCACA	c.(235-249)atagcaatccacaga>aga	p.IAIH79del	AC003991.3_ENST00000595121.1_RNA|AC003991.3_ENST00000434733.1_RNA|AC003991.3_ENST00000447758.1_RNA|STEAP4_ENST00000414498.1_In_Frame_Del_p.IAIH79del|STEAP4_ENST00000301959.5_In_Frame_Del_p.IAIH79del|AC003991.3_ENST00000600908.1_RNA	NM_001205315.1|NM_024636.3	NP_001192244.1|NP_078912.2	Q687X5	STEA4_HUMAN	STEAP family member 4	79					copper ion import (GO:0015677)|fat cell differentiation (GO:0045444)|ferric iron import into cell (GO:0097461)|iron ion homeostasis (GO:0055072)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(3)	15	Esophageal squamous(14;0.00802)					TAATGCTCTCTGTGGATTGCTATGATTATGAT	0.415																																					p.79_83del		Pindel	.											.	STEAP4	54	.	0			c.237_248del						PASS	.																																			SO:0001651	inframe_deletion	79689	exon3			.	AK026806	CCDS43611.1, CCDS56494.1	7q21.13	2014-01-28	2005-06-15	2005-06-15	ENSG00000127954	ENSG00000127954			21923	protein-coding gene	gene with protein product		611098	"""tumor necrosis factor, alpha-induced protein 9"""	TNFAIP9		11443137, 15897894	Standard	NM_024636		Approved	FLJ23153, TIARP, STAMP2	uc003ujs.3	Q687X5	OTTHUMG00000153853	ENST00000380079.4:c.236_247delTAGCAATCCACA	chr7.hg19:g.87913338_87913349delTGTGGATTGCTA	ENSP00000369419:p.Ile79_His82del	80.0	0.0	.		131.0	18.0	0.137	NM_001205315	Q658Q9|Q687X4|Q8WWB0|Q9H5R1	In_Frame_Del	DEL	ENST00000380079.4	hg19	CCDS43611.1																																																																																			.	.	.	none		0.415	STEAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332712.4	NM_024636	
ZNF597	146434	hgsc.bcm.edu	37	16	3487452	3487453	+	Frame_Shift_Ins	INS	-	-	A			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr16:3487452_3487453insA	ENST00000301744.4	-	4	481_482	c.246_247insT	c.(244-249)attgctfs	p.A83fs		NM_152457.1	NP_689670.1	Q96LX8	ZN597_HUMAN	zinc finger protein 597	83	KRAB.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	13						AGGGGTGCAGCAATGGGGTACT	0.45																																					p.A83fs		Pindel	.											.	ZNF597	41	.	0			c.247_248insT						PASS	.																																			SO:0001589	frameshift_variant	146434	exon4			.	AK057633	CCDS10505.1	16p13.3	2013-01-08			ENSG00000167981	ENSG00000167981		"""Zinc fingers, C2H2-type"", ""-"""	26573	protein-coding gene	gene with protein product		614685				12477932	Standard	NM_152457		Approved	FLJ33071	uc002cvd.3	Q96LX8	OTTHUMG00000129359	ENST00000301744.4:c.247dupT	chr16.hg19:g.3487454_3487454dupA	ENSP00000301744:p.Ala83fs	91.0	0.0	.		121.0	43.0	0.355	NM_152457		Frame_Shift_Ins	INS	ENST00000301744.4	hg19	CCDS10505.1																																																																																			.	.	.	none		0.450	ZNF597-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251511.2	NM_152457	
MORF4L2	9643	hgsc.bcm.edu	37	X	102931211	102931211	+	Frame_Shift_Del	DEL	G	G	-			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chrX:102931211delG	ENST00000441076.2	-	4	1049	c.745delC	c.(745-747)cttfs	p.L249fs	MORF4L2_ENST00000360458.1_Frame_Shift_Del_p.L249fs|MORF4L2_ENST00000433176.2_Frame_Shift_Del_p.L249fs|MORF4L2_ENST00000492116.1_5'Flank|MORF4L2_ENST00000451301.1_Frame_Shift_Del_p.L249fs|MORF4L2_ENST00000423833.2_Frame_Shift_Del_p.L249fs|MORF4L2_ENST00000422154.2_Frame_Shift_Del_p.L249fs	NM_001142419.1|NM_012286.2	NP_001135891.1|NP_036418.1	Q15014	MO4L2_HUMAN	mortality factor 4 like 2	249	MRG. {ECO:0000255|PROSITE- ProRule:PRU00972}.				chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|DNA repair (GO:0006281)|positive regulation of striated muscle cell differentiation (GO:0051155)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)	13						AATAATGCAAGGCTTTTCTCA	0.418																																					p.L249fs		Pindel	.											.	MORF4L2	35	.	0			c.746delT						PASS	.						94.0	82.0	86.0					X																	102931211		2203	4300	6503	SO:0001589	frameshift_variant	9643	exon5			.	AF100620	CCDS14512.1	Xq22	2010-11-24			ENSG00000123562	ENSG00000123562			16849	protein-coding gene	gene with protein product	"""MORF-related gene X"""	300409				9891081, 7584026	Standard	NM_012286		Approved	KIAA0026, MRGX	uc011msa.2	Q15014	OTTHUMG00000022104	ENST00000441076.2:c.745delC	chrX.hg19:g.102931211delG	ENSP00000391969:p.Leu249fs	234.0	0.0	.		292.0	76.0	0.260	NM_001142422	B3KP92|D3DXA5|Q567V0|Q8J026	Frame_Shift_Del	DEL	ENST00000441076.2	hg19	CCDS14512.1																																																																																			.	.	.	none		0.418	MORF4L2-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057732.1	NM_012286	
OR4F5	79501	hgsc.bcm.edu	37	1	69618	69629	+	In_Frame_Del	DEL	GGTAATCAAACT	GGTAATCAAACT	-			TCGA-UZ-A9Q1-01A-11D-A42J-10	TCGA-UZ-A9Q1-10A-01D-A42M-10	GGTAATCAAACT	GGTAATCAAACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	69f0f324-fc06-44ab-b056-8fb3fb4706ae	1a85c2bb-8b95-429a-b782-c05a44345d4c	g.chr1:69618_69629delGGTAATCAAACT	ENST00000335137.3	+	1	528_539	c.528_539delGGTAATCAAACT	c.(526-540)agggtaatcaaactt>agt	p.176_180RVIKL>S		NM_001005484.1	NP_001005484.1	Q8NH21	OR4F5_HUMAN	olfactory receptor, family 4, subfamily F, member 5	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(1)|ovary(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;3.48e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.21e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000469)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		ACCTTCCTAGGGTAATCAAACTTGCCTGTACA	0.434																																					p.176_180del		Pindel	.											.	OR4F5	7	.	0			c.527_538del						PASS	.																																			SO:0001651	inframe_deletion	79501	exon1			.	AB065592	CCDS30547.1	1p36.33	2012-08-09			ENSG00000186092	ENSG00000186092		"""GPCR / Class A : Olfactory receptors"""	14825	protein-coding gene	gene with protein product							Standard	NM_001005484		Approved		uc001aal.1	Q8NH21	OTTHUMG00000001094	ENST00000335137.3:c.528_539delGGTAATCAAACT	chr1.hg19:g.69618_69629delGGTAATCAAACT	ENSP00000334393:p.Arg176_Leu180delinsSer	276.0	0.0	.		365.0	20.0	0.055	NM_001005484	Q5VT22	In_Frame_Del	DEL	ENST00000335137.3	hg19	CCDS30547.1																																																																																			.	.	.	none		0.434	OR4F5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003223.1	NM_001005484	
