#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
USP24	23358	hgsc.bcm.edu	37	1	55603533	55603533	+	Silent	SNP	G	G	T			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr1:55603533G>T	ENST00000294383.6	-	27	2972	c.2973C>A	c.(2971-2973)gcC>gcA	p.A991A	USP24_ENST00000407756.1_Silent_p.A831A	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	991					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						ACAACTGCTTGGCTATTTTCC	0.313																																					p.A991A		Atlas-SNP	.											.	USP24	323	.	0			c.C2973A						PASS	.						61.0	53.0	56.0					1																	55603533		1812	4077	5889	SO:0001819	synonymous_variant	23358	exon27			CTGCTTGGCTATT	AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.2973C>A	chr1.hg19:g.55603533G>T		172.0	0.0	.		187.0	23.0	.	NM_015306	Q6ZSY2|Q8N2Y4|Q9NXD1	Silent	SNP	ENST00000294383.6	hg19	CCDS44154.2																																																																																			.	.	.	none		0.313	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2		
SYPL2	284612	hgsc.bcm.edu	37	1	110009739	110009739	+	Missense_Mutation	SNP	T	T	C			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr1:110009739T>C	ENST00000369872.3	+	2	329	c.113T>C	c.(112-114)aTc>aCc	p.I38T	SYPL2_ENST00000401021.3_Missense_Mutation_p.I38T	NM_001040709.1	NP_001035799.1	Q5VXT5	SYPL2_HUMAN	synaptophysin-like 2	38	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cellular calcium ion homeostasis (GO:0006874)|substantia nigra development (GO:0021762)	integral component of synaptic vesicle membrane (GO:0030285)	transporter activity (GO:0005215)			breast(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	16		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0436)|READ - Rectum adenocarcinoma(129;0.0698)|Epithelial(280;0.0808)|all cancers(265;0.0869)|LUSC - Lung squamous cell carcinoma(189;0.231)		CTGGGCTTCATCAAAGTTCTC	0.701																																					p.I38T		Atlas-SNP	.											.	SYPL2	41	.	0			c.T113C						PASS	.						3.0	4.0	4.0					1																	110009739		1622	3533	5155	SO:0001583	missense	284612	exon2			GCTTCATCAAAGT	AK131459	CCDS41365.1	1p13.3	2008-02-05			ENSG00000143028	ENSG00000143028			27638	protein-coding gene	gene with protein product	"""mitsugumin-29"""					12975309	Standard	NM_001040709		Approved	Mg29	uc001dxp.3	Q5VXT5	OTTHUMG00000010969	ENST00000369872.3:c.113T>C	chr1.hg19:g.110009739T>C	ENSP00000358888:p.Ile38Thr	85.0	0.0	.		93.0	9.0	.	NM_001040709	A8K0E8|A8KAL7|I0IT67|Q6ZMX1	Missense_Mutation	SNP	ENST00000369872.3	hg19	CCDS41365.1	.	.	.	.	.	.	.	.	.	.	t	18.47	3.630048	0.67015	.	.	ENSG00000143028	ENST00000401021;ENST00000369872	T;T	0.28895	1.59;1.59	4.95	3.81	0.43845	Marvel (1);MARVEL-like domain (1);	0.166220	0.50627	D	0.000119	T	0.23370	0.0565	M	0.70842	2.15	0.42041	D	0.991071	P;P;P	0.43826	0.818;0.503;0.557	P;B;B	0.44561	0.453;0.404;0.167	T	0.04723	-1.0931	10	0.87932	D	0	.	9.711	0.40245	0.0:0.0844:0.0:0.9156	.	38;38;38	B4DYR7;Q5VXT5;Q5VXT5-2	.;SYPL2_HUMAN;.	T	38	ENSP00000383805:I38T;ENSP00000358888:I38T	ENSP00000358888:I38T	I	+	2	0	SYPL2	109811262	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.950000	0.63603	0.732000	0.32470	0.454000	0.30748	ATC	.	.	.	none		0.701	SYPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030191.1	NM_001006603	
AHCTF1	25909	hgsc.bcm.edu	37	1	247063492	247063492	+	Missense_Mutation	SNP	A	A	G			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr1:247063492A>G	ENST00000391829.2	-	10	1430	c.1307T>C	c.(1306-1308)gTt>gCt	p.V436A	AHCTF1_ENST00000326225.3_Missense_Mutation_p.V445A|AHCTF1_ENST00000366508.1_Missense_Mutation_p.V471A|AHCTF1_ENST00000470300.1_5'Flank			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	436	Necessary for cytoplasmic localization. {ECO:0000250}.|Seven-bladed beta propeller repeats. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CCTACTTACAACAGACTCCAA	0.378																																					p.V445A	Colon(145;197 1800 4745 15099 26333)	Atlas-SNP	.											.	AHCTF1	187	.	0			c.T1334C						PASS	.						72.0	80.0	77.0					1																	247063492		2199	4295	6494	SO:0001583	missense	25909	exon10			CTTACAACAGACT		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.1307T>C	chr1.hg19:g.247063492A>G	ENSP00000375705:p.Val436Ala	463.0	0.0	.		539.0	103.0	.	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	ENST00000391829.2	hg19		.	.	.	.	.	.	.	.	.	.	A	14.85	2.658875	0.47467	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.35789	1.29;1.29;1.3	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.47040	0.1424	L	0.34521	1.04	0.53688	D	0.999974	D;D	0.69078	0.997;0.997	D;D	0.66351	0.941;0.943	T	0.43972	-0.9358	10	0.48119	T	0.1	-17.8272	14.752	0.69533	1.0:0.0:0.0:0.0	.	471;436	Q8WYP5-2;Q8WYP5	.;ELYS_HUMAN	A	471;445;436	ENSP00000355464:V471A;ENSP00000355465:V445A;ENSP00000375705:V436A	ENSP00000355465:V445A	V	-	2	0	AHCTF1	245130115	1.000000	0.71417	1.000000	0.80357	0.052000	0.14988	8.910000	0.92685	1.936000	0.56123	0.379000	0.24179	GTT	.	.	.	none		0.378	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
OR2L8	391190	hgsc.bcm.edu	37	1	248112664	248112664	+	Nonsense_Mutation	SNP	C	C	T			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr1:248112664C>T	ENST00000357191.3	+	1	505	c.505C>T	c.(505-507)Cga>Tga	p.R169*	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	169						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TCCTTATTGCCGATCCAGGGC	0.478																																					p.R169X		Atlas-SNP	.											.	OR2L8	92	.	0			c.C505T						PASS	.						224.0	146.0	173.0					1																	248112664		2203	4300	6503	SO:0001587	stop_gained	391190	exon1			TATTGCCGATCCA	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.505C>T	chr1.hg19:g.248112664C>T	ENSP00000349719:p.Arg169*	67.0	0.0	.		85.0	6.0	.	NM_001001963	Q6IF03	Nonsense_Mutation	SNP	ENST00000357191.3	hg19	CCDS31101.1	.	.	.	.	.	.	.	.	.	.	.	14.81	2.647421	0.47258	.	.	ENSG00000196936	ENST00000357191	.	.	.	1.79	-1.05	0.10036	.	1.479880	0.05398	U	0.540099	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	4.4365	0.11552	0.5017:0.364:0.0:0.1343	.	.	.	.	X	169	.	ENSP00000349719:R169X	R	+	1	2	OR2L8	246179287	0.000000	0.05858	0.615000	0.29064	0.832000	0.47134	-0.640000	0.05440	0.072000	0.16694	0.479000	0.44913	CGA	.	.	.	none		0.478	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2		
USP34	9736	hgsc.bcm.edu	37	2	61483604	61483604	+	Missense_Mutation	SNP	C	C	G			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr2:61483604C>G	ENST00000398571.2	-	48	6212	c.6136G>C	c.(6136-6138)Gat>Cat	p.D2046H		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2046	USP.				positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			GTAACTTCATCAAGAGATTCC	0.308																																					p.D2046H		Atlas-SNP	.											.	USP34	334	.	0			c.G6136C						PASS	.						72.0	67.0	68.0					2																	61483604		1803	4066	5869	SO:0001583	missense	9736	exon48			CTTCATCAAGAGA	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.6136G>C	chr2.hg19:g.61483604C>G	ENSP00000381577:p.Asp2046His	411.0	0.0	.		442.0	30.0	.	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	hg19	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.233804	0.79688	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000453734	T;T	0.06608	3.28;3.28	5.66	5.66	0.87406	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.32526	0.0832	M	0.89658	3.05	0.80722	D	1	D	0.61697	0.99	D	0.79108	0.992	T	0.15178	-1.0446	10	0.87932	D	0	.	16.043	0.80698	0.1347:0.8653:0.0:0.0	.	2046	Q70CQ2	UBP34_HUMAN	H	1894;1894;2046;324	ENSP00000381577:D2046H;ENSP00000410559:D324H	ENSP00000263989:D1894H	D	-	1	0	USP34	61337108	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.070000	0.71220	2.645000	0.89757	0.650000	0.86243	GAT	.	.	.	none		0.308	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
CEP68	23177	hgsc.bcm.edu	37	2	65299733	65299733	+	Silent	SNP	C	C	A			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr2:65299733C>A	ENST00000377990.2	+	3	1706	c.1503C>A	c.(1501-1503)tcC>tcA	p.S501S	CEP68_ENST00000260569.4_Intron|RAB1A_ENST00000494188.1_Intron|CEP68_ENST00000537589.1_Silent_p.S113S|CEP68_ENST00000546106.1_Silent_p.S501S|CEP68_ENST00000497039.1_Intron	NM_015147.2	NP_055962.2	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	501					centriole-centriole cohesion (GO:0010457)|centrosome organization (GO:0051297)|protein localization to organelle (GO:0033365)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(8)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32						ATCTAGGATCCATTTCTACCT	0.527																																					p.S501S		Atlas-SNP	.											.	CEP68	69	.	0			c.C1503A						PASS	.						98.0	108.0	104.0					2																	65299733		2203	4300	6503	SO:0001819	synonymous_variant	23177	exon3			AGGATCCATTTCT	BC004873	CCDS1880.2	2p14	2014-02-20	2005-12-01	2005-12-01	ENSG00000011523	ENSG00000011523			29076	protein-coding gene	gene with protein product			"""KIAA0582"""	KIAA0582		9628581, 9847074, 14654843	Standard	NM_015147		Approved		uc002sdl.4	Q76N32	OTTHUMG00000129538	ENST00000377990.2:c.1503C>A	chr2.hg19:g.65299733C>A		116.0	0.0	.		93.0	9.0	.	NM_015147	B4DRQ1|D6W5F1|D6W5F2|O60326|Q9BQ18|Q9UDM9	Silent	SNP	ENST00000377990.2	hg19	CCDS1880.2																																																																																			.	.	.	none		0.527	CEP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251727.2	NM_015147	
MAT2A	4144	hgsc.bcm.edu	37	2	85768828	85768828	+	Missense_Mutation	SNP	A	A	G			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr2:85768828A>G	ENST00000306434.3	+	4	488	c.365A>G	c.(364-366)cAt>cGt	p.H122R	MAT2A_ENST00000409017.1_Missense_Mutation_p.H59R|MAT2A_ENST00000490878.1_3'UTR	NM_005911.5	NP_005902.1	P31153	METK2_HUMAN	methionine adenosyltransferase II, alpha	122					cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|methionine adenosyltransferase complex (GO:0048269)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9					L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	CAAGGTGTTCATCTTGACAGA	0.403																																					p.H122R		Atlas-SNP	.											.	MAT2A	23	.	0			c.A365G						PASS	.						99.0	94.0	95.0					2																	85768828		2203	4300	6503	SO:0001583	missense	4144	exon4			GTGTTCATCTTGA		CCDS1977.1	2p11.2	2008-06-03			ENSG00000168906	ENSG00000168906			6904	protein-coding gene	gene with protein product		601468				1426236, 9703951	Standard	NM_005911		Approved	SAMS2, MATA2, MATII	uc002spr.3	P31153	OTTHUMG00000130174	ENST00000306434.3:c.365A>G	chr2.hg19:g.85768828A>G	ENSP00000303147:p.His122Arg	116.0	0.0	.		133.0	22.0	.	NM_005911	A8K511|B4DN45|D6W5L1|Q53SP5	Missense_Mutation	SNP	ENST00000306434.3	hg19	CCDS1977.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.326536	0.81690	.	.	ENSG00000168906	ENST00000306434;ENST00000409017	D;D	0.82433	-1.61;-1.61	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.90456	0.7011	M	0.86178	2.8	0.80722	D	1	D;D;D	0.62365	0.983;0.983;0.991	P;P;P	0.61397	0.598;0.809;0.888	D	0.91853	0.5493	10	0.72032	D	0.01	-20.5989	13.4153	0.60966	1.0:0.0:0.0:0.0	.	59;122;122	B4DN45;B4DEX8;P31153	.;.;METK2_HUMAN	R	122;59	ENSP00000303147:H122R;ENSP00000386353:H59R	ENSP00000303147:H122R	H	+	2	0	MAT2A	85622339	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.936000	0.92931	2.053000	0.61076	0.460000	0.39030	CAT	.	.	.	none		0.403	MAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252491.2	NM_005911	
IMMT	10989	hgsc.bcm.edu	37	2	86385801	86385801	+	Missense_Mutation	SNP	T	T	C			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr2:86385801T>C	ENST00000410111.3	-	10	1463	c.1076A>G	c.(1075-1077)cAt>cGt	p.H359R	IMMT_ENST00000490238.1_5'UTR|IMMT_ENST00000442664.2_Missense_Mutation_p.H358R|IMMT_ENST00000409051.2_Missense_Mutation_p.H312R|IMMT_ENST00000449247.2_Missense_Mutation_p.H348R|IMMT_ENST00000254636.5_Missense_Mutation_p.H260R|Y_RNA_ENST00000363371.1_RNA	NM_001100169.1|NM_001100170.1|NM_006839.2	NP_001093639.1|NP_001093640.1|NP_006830.2	Q16891	MIC60_HUMAN	inner membrane protein, mitochondrial	359					mitochondrial calcium ion homeostasis (GO:0051560)|response to cold (GO:0009409)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CACCAGCTCATGATACTGAGA	0.438																																					p.H359R		Atlas-SNP	.											.	IMMT	65	.	0			c.A1076G						PASS	.						62.0	56.0	58.0					2																	86385801		1878	4125	6003	SO:0001583	missense	10989	exon10			AGCTCATGATACT	D21094	CCDS46355.1, CCDS46356.1, CCDS46357.1	2p11.2	2011-10-04	2010-04-29		ENSG00000132305	ENSG00000132305			6047	protein-coding gene	gene with protein product	"""mitofilin"", ""mitochondrial inner membrane organizing system 2"""	600378	"""inner membrane protein, mitochondrial (mitofilin)"""			9168817, 8039717	Standard	NM_001100169		Approved	P87, P89, HMP, MINOS2	uc002sqz.4	Q16891	OTTHUMG00000153170	ENST00000410111.3:c.1076A>G	chr2.hg19:g.86385801T>C	ENSP00000387262:p.His359Arg	120.0	0.0	.		107.0	15.0	.	NM_006839	B1H0U5|B2R5N6|Q14539|Q15092|Q68D41|Q69HW5|Q6IBL0|Q7Z3X1|Q8TAJ5|Q9P0V2	Missense_Mutation	SNP	ENST00000410111.3	hg19	CCDS46355.1	.	.	.	.	.	.	.	.	.	.	T	13.30	2.195826	0.38806	.	.	ENSG00000132305	ENST00000254636;ENST00000449247;ENST00000410111;ENST00000442664;ENST00000409051;ENST00000545283;ENST00000377310	T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59	5.76	5.76	0.90799	.	0.088283	0.85682	D	0.000000	T	0.32526	0.0832	L	0.39633	1.23	0.48830	D	0.999711	B;B;B;B;B;B;B	0.25486	0.127;0.118;0.034;0.043;0.097;0.097;0.043	B;B;B;B;B;B;B	0.41174	0.349;0.078;0.03;0.05;0.047;0.047;0.05	T	0.06373	-1.0830	10	0.02654	T	1	-17.6143	16.0709	0.80928	0.0:0.0:0.0:1.0	.	312;347;327;261;348;327;359	B9A067;B4DKR1;F8W9I1;B4DS66;Q16891-2;Q16891-3;Q16891	.;.;.;.;.;.;IMMT_HUMAN	R	260;348;359;358;312;348;327	ENSP00000254636:H260R;ENSP00000396899:H348R;ENSP00000387262:H359R;ENSP00000407788:H358R;ENSP00000387227:H312R	ENSP00000254636:H260R	H	-	2	0	IMMT	86239312	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	4.525000	0.60559	2.198000	0.70561	0.528000	0.53228	CAT	.	.	.	none		0.438	IMMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329909.2	NM_006839	
INPP4A	3631	hgsc.bcm.edu	37	2	99156012	99156012	+	Missense_Mutation	SNP	G	G	T			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr2:99156012G>T	ENST00000523221.1	+	8	692	c.692G>T	c.(691-693)cGc>cTc	p.R231L	INPP4A_ENST00000409540.3_Missense_Mutation_p.R231L|INPP4A_ENST00000074304.5_Missense_Mutation_p.R231L|INPP4A_ENST00000409851.3_Missense_Mutation_p.R231L|INPP4A_ENST00000409463.1_Intron|INPP4A_ENST00000409016.4_Missense_Mutation_p.R231L|INPP4A_ENST00000545415.1_Missense_Mutation_p.R231L			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	231					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						GCCATCTGCCGCATGTACCGG	0.602																																					p.R231L		Atlas-SNP	.											INPP4A_ENST00000409540,caecum,carcinoma,0,3	INPP4A	205	.	0			c.G692T						PASS	.						130.0	125.0	126.0					2																	99156012		2074	4209	6283	SO:0001583	missense	3631	exon10			TCTGCCGCATGTA	U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.692G>T	chr2.hg19:g.99156012G>T	ENSP00000427722:p.Arg231Leu	60.0	0.0	.		59.0	7.0	.	NM_004027	O15326|Q13187|Q53TD8|Q8TC02	Missense_Mutation	SNP	ENST00000523221.1	hg19	CCDS46369.1	.	.	.	.	.	.	.	.	.	.	G	33	5.275491	0.95459	.	.	ENSG00000040933	ENST00000409016;ENST00000409851;ENST00000074304;ENST00000545415;ENST00000409540;ENST00000523221	T;T;T;T;T;T	0.34859	1.34;1.34;1.34;1.34;1.34;1.34	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.59004	0.2162	M	0.63843	1.955	0.80722	D	1	D;D;D;D	0.89917	0.998;0.999;1.0;1.0	D;D;D;D	0.91635	0.94;0.956;0.999;0.999	T	0.59553	-0.7433	10	0.59425	D	0.04	-22.292	17.811	0.88616	0.0:0.0:1.0:0.0	.	231;231;231;231	Q96PE3-2;Q96PE3-4;Q96PE3;Q96PE3-3	.;.;INP4A_HUMAN;.	L	231	ENSP00000386704:R231L;ENSP00000386777:R231L;ENSP00000074304:R231L;ENSP00000442149:R231L;ENSP00000387294:R231L;ENSP00000427722:R231L	ENSP00000074304:R231L	R	+	2	0	INPP4A	98522444	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.657000	0.98554	2.684000	0.91462	0.585000	0.79938	CGC	.	.	.	none		0.602	INPP4A-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376095.1	NM_001566	
CFLAR	8837	hgsc.bcm.edu	37	2	202005084	202005084	+	Missense_Mutation	SNP	A	A	T			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr2:202005084A>T	ENST00000309955.3	+	5	1043	c.528A>T	c.(526-528)caA>caT	p.Q176H	CFLAR_ENST00000423241.2_Missense_Mutation_p.Q176H|CFLAR-AS1_ENST00000474886.2_RNA|CFLAR-AS1_ENST00000415011.2_RNA|CFLAR_ENST00000340870.5_Missense_Mutation_p.Q176H|CFLAR_ENST00000341222.6_Missense_Mutation_p.Q176H|CFLAR_ENST00000443227.1_Missense_Mutation_p.Q80H|CFLAR_ENST00000342795.5_Missense_Mutation_p.Q176H|CFLAR_ENST00000355558.4_Missense_Mutation_p.Q176H|RNU7-45P_ENST00000459460.1_RNA|CFLAR_ENST00000494258.1_Missense_Mutation_p.Q80H|CFLAR_ENST00000341582.6_Missense_Mutation_p.Q176H|CFLAR_ENST00000457277.1_Missense_Mutation_p.Q176H|CFLAR_ENST00000479953.2_Missense_Mutation_p.Q80H|CFLAR_ENST00000440180.1_Missense_Mutation_p.Q176H	NM_001202515.1|NM_003879.5	NP_001189444.1|NP_003870.4	O15519	CFLAR_HUMAN	CASP8 and FADD-like apoptosis regulator	176	Interaction with FADD.|Interaction with caspase-8 propeptide.|Interaction with caspase-8.|Not proteolytically processed and involved in apoptosis inhibition.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of myoblast fusion (GO:1901740)|positive regulation of catalytic activity (GO:0043085)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of necroptotic process (GO:0060544)|regulation of satellite cell proliferation (GO:0014842)|skeletal muscle atrophy (GO:0014732)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|skeletal myofibril assembly (GO:0014866)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|ripoptosome (GO:0097342)	cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|enzyme activator activity (GO:0008047)|protease binding (GO:0002020)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|stomach(1)	13						TTATAGTTCAAGGAGCAGGGA	0.378																																					p.Q176H	Pancreas(16;548 657 22190 32864 42338)	Atlas-SNP	.											.	CFLAR	37	.	0			c.A528T						PASS	.						120.0	121.0	121.0					2																	202005084		2203	4300	6503	SO:0001583	missense	8837	exon5			AGTTCAAGGAGCA	AF005774	CCDS2337.1, CCDS46487.1, CCDS56157.1, CCDS56158.1, CCDS59436.1	2q33-q34	2014-01-30			ENSG00000003402	ENSG00000003402		"""Endogenous ligands"""	1876	protein-coding gene	gene with protein product		603599		CASP8AP1		9208847, 9217161	Standard	NM_003879		Approved	CASH, Casper, CLARP, FLAME, FLIP, I-FLICE, MRIT, c-FLIP	uc002uxb.4	O15519	OTTHUMG00000132819	ENST00000309955.3:c.528A>T	chr2.hg19:g.202005084A>T	ENSP00000312455:p.Gln176His	283.0	0.0	.		371.0	36.0	.	NM_001202516	B4DJE0|B7Z9F9|O14673|O14674|O14675|O15137|O15138|O15356|O15510|O43618|O43619|O43620|O60458|O60459|Q53TS6|Q54AF1|Q96TE4|Q9UEW1	Missense_Mutation	SNP	ENST00000309955.3	hg19	CCDS2337.1	.	.	.	.	.	.	.	.	.	.	A	12.71	2.020924	0.35606	.	.	ENSG00000003402	ENST00000309955;ENST00000443227;ENST00000341222;ENST00000355558;ENST00000340870;ENST00000343375;ENST00000341582;ENST00000342795;ENST00000423241;ENST00000440180;ENST00000457277	D;D;D;D;D;D;D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7;-1.7;-1.7;-1.7;-1.7;-1.7;-1.7	4.69	2.29	0.28610	DEATH-like (1);	0.935073	0.09112	N	0.846973	D	0.86234	0.5884	L	0.56769	1.78	0.80722	D	1	D;B;D;D;D;B;D	0.62365	0.964;0.253;0.989;0.989;0.991;0.202;0.966	P;B;P;P;P;B;P	0.60541	0.846;0.173;0.717;0.717;0.876;0.138;0.717	T	0.79918	-0.1600	10	0.56958	D	0.05	-9.6859	5.9993	0.19511	0.784:0.0:0.216:0.0	.	80;176;176;176;176;176;176	O15519-3;C9JK38;O15519-11;O15519-8;O15519;O15519-12;O15519-2	.;.;.;.;CFLAR_HUMAN;.;.	H	176;80;176;176;176;80;176;176;176;176;176	ENSP00000312455:Q176H;ENSP00000413270:Q80H;ENSP00000339335:Q176H;ENSP00000347757:Q176H;ENSP00000339326:Q176H;ENSP00000345807:Q176H;ENSP00000342809:Q176H;ENSP00000399420:Q176H;ENSP00000406775:Q176H;ENSP00000411535:Q176H	ENSP00000312455:Q176H	Q	+	3	2	CFLAR	201713329	0.463000	0.25799	0.485000	0.27403	0.215000	0.24574	0.514000	0.22786	0.521000	0.28445	0.528000	0.53228	CAA	.	.	.	none		0.378	CFLAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256276.3	NM_003879	
KANSL1L	151050	hgsc.bcm.edu	37	2	210894559	210894559	+	Missense_Mutation	SNP	T	T	G			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr2:210894559T>G	ENST00000281772.9	-	10	2502	c.2239A>C	c.(2239-2241)Aac>Cac	p.N747H	KANSL1L_ENST00000418791.1_Missense_Mutation_p.N705H|AC007038.7_ENST00000452057.1_RNA|RP11-260M2.1_ENST00000608095.1_RNA	NM_152519.2	NP_689732.2	A0AUZ9	KAL1L_HUMAN	KAT8 regulatory NSL complex subunit 1-like	747						histone acetyltransferase complex (GO:0000123)											GATAAAACGTTGACATTGGAA	0.328																																					p.N747H		Atlas-SNP	.											.	.	.	.	0			c.A2239C						PASS	.						146.0	145.0	146.0					2																	210894559		2203	4300	6503	SO:0001583	missense	151050	exon10			AAACGTTGACATT	AK074441	CCDS33370.1	2q34	2012-02-20	2012-02-20	2012-02-20	ENSG00000144445	ENSG00000144445			26310	protein-coding gene	gene with protein product	"""KIAA1267-like"""	613833	"""chromosome 2 open reading frame 67"""	C2orf67		12477932	Standard	NM_152519		Approved	FLJ23861, FLJ32349, MSL1v2, KIAA1267L	uc002vds.3	A0AUZ9	OTTHUMG00000154697	ENST00000281772.9:c.2239A>C	chr2.hg19:g.210894559T>G	ENSP00000281772:p.Asn747His	115.0	0.0	.		91.0	13.0	.	NM_152519	B7ZLN1|I6L9A8|Q53TV8|Q53TW3|Q6IS05|Q8TCI1|Q96MI0|Q9UFC3	Missense_Mutation	SNP	ENST00000281772.9	hg19	CCDS33370.1	.	.	.	.	.	.	.	.	.	.	T	11.47	1.649295	0.29336	.	.	ENSG00000144445	ENST00000281772;ENST00000418791	.	.	.	5.5	2.91	0.33838	.	0.298177	0.30930	N	0.008587	T	0.39682	0.1087	L	0.56769	1.78	0.22280	N	0.999231	B;B	0.15930	0.015;0.015	B;B	0.13407	0.009;0.009	T	0.34601	-0.9822	9	0.49607	T	0.09	.	6.1909	0.20524	0.0:0.0811:0.313:0.6059	.	705;747	A0AUZ9-2;A0AUZ9	.;CB067_HUMAN	H	747;705	.	ENSP00000281772:N747H	N	-	1	0	C2orf67	210602804	0.988000	0.35896	0.660000	0.29694	0.791000	0.44710	1.629000	0.37071	0.890000	0.36211	0.533000	0.62120	AAC	.	.	.	none		0.328	KANSL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336633.3	NM_152519	
VHL	7428	hgsc.bcm.edu	37	3	10183797	10183797	+	Missense_Mutation	SNP	T	T	A	rs5030807		TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr3:10183797T>A	ENST00000256474.2	+	1	1106	c.266T>A	c.(265-267)cTc>cAc	p.L89H	VHL_ENST00000345392.2_Missense_Mutation_p.L89H|snoU13_ENST00000458986.1_RNA	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	89			L -> H (in lung cancer).|L -> P (in VHLD; type I; dbSNP:rs5030807). {ECO:0000269|PubMed:8956040}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.L89H(11)|p.L89P(6)|p.L89R(3)|p.R60fs*35(1)|p.V84_E94>E(1)|p.V84fs*69(1)|p.L89fs*67(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CCCGTATGGCTCAACTTCGAC	0.726	L89H(NCIH28_PLEURA)	1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																												p.L89H		Atlas-SNP	.	yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	VHL,NS,carcinoma,0,23	VHL	2192	.	24	Substitution - Missense(20)|Deletion - Frameshift(3)|Complex - deletion inframe(1)	kidney(22)|pancreas(1)|pleura(1)	c.T266A	GRCh37	CM941368	VHL	M	rs5030807	PASS	.						13.0	16.0	15.0					3																	10183797		2106	4156	6262	SO:0001583	missense	7428	exon1	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	TATGGCTCAACTT	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.266T>A	chr3.hg19:g.10183797T>A	ENSP00000256474:p.Leu89His	87.0	1.0	.		46.0	7.0	.	NM_198156	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	hg19	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	T	29.2	4.986585	0.93106	.	.	ENSG00000134086	ENST00000256474;ENST00000345392	D;D	0.99815	-6.9;-6.9	5.06	5.06	0.68205	von Hippel-Lindau disease tumor suppressor,  beta domain (1);von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);	0.185584	0.46442	D	0.000292	D	0.99576	0.9847	L	0.41492	1.28	0.33129	D	0.542832	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.957	D	0.97755	1.0217	10	0.87932	D	0	-8.4916	12.8448	0.57823	0.0:0.0:0.0:1.0	.	89;89	P40337-2;P40337	.;VHL_HUMAN	H	89	ENSP00000256474:L89H;ENSP00000344757:L89H	ENSP00000256474:L89H	L	+	2	0	VHL	10158797	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	4.914000	0.63348	1.920000	0.55613	0.450000	0.29827	CTC	.	T|1.000	.	weak		0.726	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1	NM_000551	
TRIM71	131405	hgsc.bcm.edu	37	3	32859580	32859581	+	Missense_Mutation	DNP	CG	CG	TT			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	C|G	C|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr3:32859580_32859581CG>TT	ENST00000383763.5	+	1	71_72	c.8_9CG>TT	c.(7-9)tCG>tTT	p.S3F		NM_001039111.1	NP_001034200.1	Q2Q1W2	LIN41_HUMAN	tripartite motif containing 71, E3 ubiquitin protein ligase	3					fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|miRNA metabolic process (GO:0010586)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|positive regulation of gene silencing by miRNA (GO:2000637)|protein autoubiquitination (GO:0051865)|regulation of gene silencing by miRNA (GO:0060964)|regulation of neural precursor cell proliferation (GO:2000177)|stem cell proliferation (GO:0072089)	cytoplasmic mRNA processing body (GO:0000932)	ligase activity (GO:0016874)|miRNA binding (GO:0035198)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CAAATGGCTTCGTTCCCCGAGA	0.649																																					p.S3L|p.S3S		Atlas-SNP	.											.	TRIM71	73	.	0			c.C8T|c.G9T						PASS	.																																			SO:0001583	missense	131405	exon1			TGGCTTCGTTCCC|GGCTTCGTTCCCC		CCDS43060.1	3p22.3	2014-02-17	2012-02-29		ENSG00000206557	ENSG00000206557		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32669	protein-coding gene	gene with protein product			"""tripartite motif-containing 71"", ""tripartite motif containing 71"""				Standard	NM_001039111		Approved	LIN41, LIN-41	uc003cff.3	Q2Q1W2	OTTHUMG00000155778	Exception_encountered	chr3.hg19:g.32859580_32859581delinsTT	ENSP00000373272:p.Ser3Phe	65.0|64.0	0.0	.		59.0|56.0	12.0|13.0	.	NM_001039111		Missense_Mutation|Silent	SNP	ENST00000383763.5	hg19	CCDS43060.1																																																																																			.	.	.	none		0.649	TRIM71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341565.3	NM_001039111	
OSBPL11	114885	hgsc.bcm.edu	37	3	125282684	125282684	+	Missense_Mutation	SNP	G	G	C			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr3:125282684G>C	ENST00000296220.5	-	7	1161	c.872C>G	c.(871-873)aCg>aGg	p.T291R		NM_022776.4	NP_073613.2	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	291					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|positive regulation of sequestering of triglyceride (GO:0010890)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)			NS(1)|breast(1)|cervix(1)|kidney(2)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	27						CTCGATTGTCGTTCCTGATGG	0.413																																					p.T291R		Atlas-SNP	.											.	OSBPL11	64	.	0			c.C872G						PASS	.						69.0	70.0	70.0					3																	125282684		2203	4300	6503	SO:0001583	missense	114885	exon7			ATTGTCGTTCCTG	AF392454	CCDS3033.1	3q21	2013-01-10			ENSG00000144909	ENSG00000144909		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16397	protein-coding gene	gene with protein product		606739					Standard	NM_022776		Approved	ORP-11, ORP11, FLJ13012, FLJ13164	uc003eic.3	Q9BXB4	OTTHUMG00000159571	ENST00000296220.5:c.872C>G	chr3.hg19:g.125282684G>C	ENSP00000296220:p.Thr291Arg	46.0	0.0	.		53.0	9.0	.	NM_022776	A8K9I7	Missense_Mutation	SNP	ENST00000296220.5	hg19	CCDS3033.1	.	.	.	.	.	.	.	.	.	.	G	11.15	1.554856	0.27739	.	.	ENSG00000144909	ENST00000296220	T	0.17854	2.25	5.09	4.21	0.49690	.	0.231057	0.44483	D	0.000442	T	0.14960	0.0361	L	0.40543	1.245	0.44012	D	0.996725	B	0.17852	0.024	B	0.14578	0.011	T	0.04579	-1.0941	10	0.25751	T	0.34	-3.2492	13.4431	0.61125	0.0:0.0:0.8432:0.1568	.	291	Q9BXB4	OSB11_HUMAN	R	291	ENSP00000296220:T291R	ENSP00000296220:T291R	T	-	2	0	OSBPL11	126765374	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	6.916000	0.75776	1.349000	0.45751	0.467000	0.42956	ACG	.	.	.	none		0.413	OSBPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356295.1	NM_022776	
CAMK2D	817	hgsc.bcm.edu	37	4	114378666	114378666	+	Missense_Mutation	SNP	G	G	A			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr4:114378666G>A	ENST00000342666.5	-	17	1257	c.1258C>T	c.(1258-1260)Cat>Tat	p.H420Y	CAMK2D_ENST00000394524.3_Missense_Mutation_p.H420Y|CAMK2D_ENST00000296402.5_Missense_Mutation_p.H420Y|CAMK2D_ENST00000394526.2_Missense_Mutation_p.H431Y|CAMK2D_ENST00000394522.3_Missense_Mutation_p.H434Y|CAMK2D_ENST00000418639.2_Missense_Mutation_p.H434Y|CAMK2D_ENST00000379773.2_Missense_Mutation_p.H420Y|CAMK2D_ENST00000429180.1_Missense_Mutation_p.H440Y|CAMK2D_ENST00000511664.1_Missense_Mutation_p.H454Y|CAMK2D_ENST00000508738.1_Missense_Mutation_p.H431Y|CAMK2D_ENST00000505990.1_Missense_Mutation_p.H454Y|CAMK2D_ENST00000454265.2_Missense_Mutation_p.H445Y|CAMK2D_ENST00000515496.1_Missense_Mutation_p.H431Y|CAMK2D_ENST00000514328.1_Missense_Mutation_p.H419Y			Q13557	KCC2D_HUMAN	calcium/calmodulin-dependent protein kinase II delta	420					calcium ion transport (GO:0006816)|cardiac muscle cell contraction (GO:0086003)|cellular response to calcium ion (GO:0071277)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle cell action potential (GO:0098901)|regulation of cardiac muscle cell action potential involved in regulation of contraction (GO:0098909)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cell growth (GO:0001558)|regulation of cellular localization (GO:0060341)|regulation of generation of L-type calcium current (GO:1902514)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of histone deacetylase activity (GO:1901725)|regulation of membrane depolarization (GO:0003254)|regulation of relaxation of cardiac muscle (GO:1901897)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of the force of heart contraction (GO:0002026)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|relaxation of cardiac muscle (GO:0055119)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|calcium channel complex (GO:0034704)|calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intercalated disc (GO:0014704)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|ion channel binding (GO:0044325)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|sodium channel inhibitor activity (GO:0019871)|titin binding (GO:0031432)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	13		Ovarian(17;0.00369)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000271)		CCTACCAGATGTACATGAGGG	0.403																																					p.H434Y		Atlas-SNP	.											.	CAMK2D	55	.	0			c.C1300T						PASS	.						187.0	185.0	186.0					4																	114378666		2203	4300	6503	SO:0001583	missense	817	exon18			CCAGATGTACATG	U50361	CCDS3703.1, CCDS3704.1, CCDS43263.1, CCDS47127.1, CCDS54797.1	4q26	2008-10-30	2008-10-30		ENSG00000145349	ENSG00000145349			1462	protein-coding gene	gene with protein product		607708	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II delta"""	CAMKD			Standard	NM_001221		Approved		uc003ibi.3	Q13557	OTTHUMG00000132910	ENST00000342666.5:c.1258C>T	chr4.hg19:g.114378666G>A	ENSP00000339740:p.His420Tyr	114.0	0.0	.		164.0	15.0	.	NM_172114	A8MVS8|Q52PK4|Q59G21|Q8N553|Q9UGH6|Q9UQE9	Missense_Mutation	SNP	ENST00000342666.5	hg19	CCDS3703.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.2|25.2	4.618401|4.618401	0.87359|0.87359	.|.	.|.	ENSG00000145349|ENSG00000145349	ENST00000394524;ENST00000454265;ENST00000429180;ENST00000418639;ENST00000394526;ENST00000296402;ENST00000511664;ENST00000342666;ENST00000515496;ENST00000514328;ENST00000394522;ENST00000505990;ENST00000379773;ENST00000508738|ENST00000513132	T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.48201|.	0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82|.	5.93|5.93	5.93|5.93	0.95920|0.95920	Protein kinase-like domain (1);Calcium/calmodulin-dependent protein kinase II, association-domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.85318|0.85318	0.5669|0.5669	M|M	0.88704|0.88704	2.975|2.975	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.76494|.	0.996;0.997;0.999;0.97;0.998|.	D;D;D;P;D|.	0.87578|.	0.963;0.995;0.998;0.782;0.997|.	D|D	0.86142|0.86142	0.1582|0.1582	10|5	0.32370|.	T|.	0.25|.	.|.	20.3396|20.3396	0.98756|0.98756	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	454;431;434;420;420|.	E9PF82;Q13557-3;Q13557-6;Q13557-12;Q13557|.	.;.;.;.;KCC2D_HUMAN|.	Y|I	420;445;440;434;431;420;454;420;431;419;434;454;420;431|123	ENSP00000378032:H420Y;ENSP00000415248:H445Y;ENSP00000415707:H440Y;ENSP00000406131:H434Y;ENSP00000378034:H431Y;ENSP00000296402:H420Y;ENSP00000425824:H454Y;ENSP00000339740:H420Y;ENSP00000423482:H431Y;ENSP00000423677:H419Y;ENSP00000378030:H434Y;ENSP00000424245:H454Y;ENSP00000369098:H420Y;ENSP00000422566:H431Y|.	ENSP00000296402:H420Y|.	H|T	-|-	1|2	0|0	CAMK2D|CAMK2D	114598115|114598115	1.000000|1.000000	0.71417|0.71417	0.243000|0.243000	0.24186|0.24186	0.679000|0.679000	0.39708|0.39708	9.409000|9.409000	0.97331|0.97331	2.812000|2.812000	0.96745|0.96745	0.555000|0.555000	0.69702|0.69702	CAT|ACA	.	.	.	none		0.403	CAMK2D-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256420.2		
ZFYVE16	9765	hgsc.bcm.edu	37	5	79745509	79745509	+	Missense_Mutation	SNP	T	T	C			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr5:79745509T>C	ENST00000338008.5	+	8	3383	c.3203T>C	c.(3202-3204)cTc>cCc	p.L1068P	ZFYVE16_ENST00000510158.1_Missense_Mutation_p.L1068P|ZFYVE16_ENST00000505560.1_Missense_Mutation_p.L1068P	NM_001284236.1|NM_014733.3	NP_001271165.1|NP_055548	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	1068					BMP signaling pathway (GO:0030509)|endosomal transport (GO:0016197)|protein targeting to lysosome (GO:0006622)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|intracellular membrane-bounded organelle (GO:0043231)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein transporter activity (GO:0008565)			breast(4)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|liver(1)|lung(6)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		GCTAATCTACTCGTGAATGTC	0.323																																					p.L1068P	Melanoma(150;1452 1854 16018 17851 37292)	Atlas-SNP	.											.	ZFYVE16	100	.	0			c.T3203C						PASS	.						131.0	121.0	124.0					5																	79745509		2202	4299	6501	SO:0001583	missense	9765	exon9			ATCTACTCGTGAA	AB002303	CCDS4050.1	5q14.1	2012-09-20			ENSG00000039319	ENSG00000039319		"""Zinc fingers, FYVE domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20756	protein-coding gene	gene with protein product	"""endofin"", ""protein phosphatase 1, regulatory subunit 69"""	608880				11546807	Standard	NM_014733		Approved	KIAA0305, PPP1R69	uc003kgq.4	Q7Z3T8	OTTHUMG00000108178	ENST00000338008.5:c.3203T>C	chr5.hg19:g.79745509T>C	ENSP00000337159:p.Leu1068Pro	172.0	0.0	.		222.0	34.0	.	NM_001105251	O15023|Q5H9U2|Q7LAU7|Q86T69|Q8N5L3|Q8NEK3	Missense_Mutation	SNP	ENST00000338008.5	hg19	CCDS4050.1	.	.	.	.	.	.	.	.	.	.	T	18.88	3.718416	0.68844	.	.	ENSG00000039319	ENST00000338008;ENST00000510158;ENST00000505560	T;T;T	0.49139	0.79;0.79;0.79	5.91	5.91	0.95273	.	0.118100	0.38436	N	0.001681	T	0.68659	0.3025	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.71712	-0.4510	10	0.72032	D	0.01	-11.6581	16.0084	0.80380	0.0:0.0:0.0:1.0	.	1068	Q7Z3T8	ZFY16_HUMAN	P	1068	ENSP00000337159:L1068P;ENSP00000423663:L1068P;ENSP00000426848:L1068P	ENSP00000337159:L1068P	L	+	2	0	ZFYVE16	79781265	1.000000	0.71417	0.364000	0.25888	0.571000	0.35966	7.286000	0.78671	2.263000	0.75096	0.528000	0.53228	CTC	.	.	.	none		0.323	ZFYVE16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226982.2	NM_014733	
PCDHB7	56129	hgsc.bcm.edu	37	5	140554081	140554081	+	Silent	SNP	C	C	T			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr5:140554081C>T	ENST00000231137.3	+	1	1839	c.1665C>T	c.(1663-1665)aaC>aaT	p.N555N		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	555	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGACGCCAACGACAACTCGC	0.726																																					p.N555N		Atlas-SNP	.											.	PCDHB7	231	.	0			c.C1665T						PASS	.						28.0	32.0	31.0					5																	140554081		2192	4283	6475	SO:0001819	synonymous_variant	56129	exon1			CGCCAACGACAAC	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1665C>T	chr5.hg19:g.140554081C>T		95.0	0.0	.		115.0	10.0	.	NM_018940	A1L3Y8	Silent	SNP	ENST00000231137.3	hg19	CCDS4249.1	.	.	.	.	.	.	.	.	.	.	c	7.905	0.735232	0.15574	.	.	ENSG00000113212	ENST00000543636	.	.	.	4.3	0.795	0.18643	.	.	.	.	.	T	0.60064	0.2240	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59648	-0.7415	5	0.87932	D	0	.	5.9973	0.19501	0.0:0.3365:0.0:0.6635	.	.	.	.	M	338	.	ENSP00000440828:T338M	T	+	2	0	PCDHB7	140534265	0.000000	0.05858	0.992000	0.48379	0.966000	0.64601	-2.009000	0.01455	0.355000	0.24131	0.449000	0.29647	ACG	.	.	.	none		0.726	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
DPCR1	135656	hgsc.bcm.edu	37	6	30919864	30919864	+	Missense_Mutation	SNP	C	C	G			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr6:30919864C>G	ENST00000462446.1	+	2	3651	c.3623C>G	c.(3622-3624)cCt>cGt	p.P1208R	HCG21_ENST00000419481.1_RNA|DPCR1_ENST00000304311.2_Missense_Mutation_p.P50R			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	332						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						CCAGAAAAGCCTACAGAAAAC	0.463																																					p.P1208R		Atlas-SNP	.											.	DPCR1	99	.	0			c.C3623G						PASS	.						152.0	151.0	151.0					6																	30919864		2203	4300	6503	SO:0001583	missense	135656	exon2			AAAAGCCTACAGA	AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.3623C>G	chr6.hg19:g.30919864C>G	ENSP00000417182:p.Pro1208Arg	91.0	0.0	.		128.0	19.0	.	NM_080870	C9IZC0|Q658M7|Q8WYN2	Missense_Mutation	SNP	ENST00000462446.1	hg19	CCDS4692.2	.	.	.	.	.	.	.	.	.	.	C	10.72	1.428353	0.25726	.	.	ENSG00000168631	ENST00000462446;ENST00000450344;ENST00000304311	T;T	0.31247	1.5;1.5	3.26	-0.882	0.10604	.	.	.	.	.	T	0.19685	0.0473	L	0.34521	1.04	0.09310	N	1	D	0.89917	1.0	D	0.68765	0.96	T	0.05068	-1.0908	9	0.66056	D	0.02	0.0343	3.7848	0.08695	0.3285:0.4587:0.0:0.2128	.	1208	E9PEI6	.	R	1208;332;50	ENSP00000417182:P1208R;ENSP00000305948:P50R	ENSP00000305948:P50R	P	+	2	0	DPCR1	31027843	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.083000	0.14871	-0.107000	0.12088	-0.279000	0.10071	CCT	.	.	.	none		0.463	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076173.3	NM_080870	
PNRC1	10957	hgsc.bcm.edu	37	6	89793765	89793765	+	Missense_Mutation	SNP	T	T	G			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr6:89793765T>G	ENST00000336032.3	+	2	951	c.834T>G	c.(832-834)aaT>aaG	p.N278K	PNRC1_ENST00000369472.1_Missense_Mutation_p.N93K|PNRC1_ENST00000354922.3_Missense_Mutation_p.N93K	NM_006813.2	NP_006804.1	Q12796	PNRC1_HUMAN	proline-rich nuclear receptor coactivator 1	278					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(3)	6		all_cancers(76;3.64e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.102)		AAAAGGAAAATTATGCTGGGG	0.383										Multiple Myeloma(7;0.094)																											p.N278K		Atlas-SNP	.											.	PNRC1	17	.	0			c.T834G						PASS	.						74.0	79.0	77.0					6																	89793765		2203	4300	6503	SO:0001583	missense	10957	exon2			GGAAAATTATGCT	U03105	CCDS5018.1	6q16.1	2008-02-05	2003-09-25	2003-09-26	ENSG00000146278	ENSG00000146278			17278	protein-coding gene	gene with protein product		606714	"""proline rich 2"""	PROL2		7578250	Standard	NM_006813		Approved	B4-2, PRR2	uc003pmv.3	Q12796	OTTHUMG00000015191	ENST00000336032.3:c.834T>G	chr6.hg19:g.89793765T>G	ENSP00000336931:p.Asn278Lys	281.0	0.0	.		298.0	32.0	.	NM_006813	B2R6Q0|E1P515|Q5T7J6|Q7Z5N0	Missense_Mutation	SNP	ENST00000336032.3	hg19	CCDS5018.1	.	.	.	.	.	.	.	.	.	.	T	12.65	2.002264	0.35320	.	.	ENSG00000146278	ENST00000369472;ENST00000336032;ENST00000354922	T;T;T	0.49720	0.86;0.77;0.86	5.64	3.26	0.37387	.	0.098076	0.64402	D	0.000001	T	0.52613	0.1745	M	0.73962	2.25	0.38214	D	0.940557	D	0.76494	0.999	D	0.68943	0.961	T	0.58183	-0.7681	10	0.72032	D	0.01	-6.2751	8.7345	0.34519	0.0:0.2152:0.0:0.7848	.	278	Q12796	PNRC1_HUMAN	K	93;278;93	ENSP00000358484:N93K;ENSP00000336931:N278K;ENSP00000347000:N93K	ENSP00000336931:N278K	N	+	3	2	PNRC1	89850484	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.367000	0.44213	0.419000	0.25927	0.533000	0.62120	AAT	.	.	.	none		0.383	PNRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041471.1	NM_006813	
USP42	84132	hgsc.bcm.edu	37	7	6193668	6193668	+	Missense_Mutation	SNP	C	C	G	rs377506977		TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr7:6193668C>G	ENST00000306177.5	+	15	2641	c.2483C>G	c.(2482-2484)gCg>gGg	p.A828G		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	828	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		ACAGGCGATGCGAGCCCGTTG	0.716																																					p.A828G		Atlas-SNP	.											.	USP42	138	.	0			c.C2483G						PASS	.	C	GLY/ALA	1,3789		0,1,1894	31.0	36.0	34.0		2483	-7.6	0.0	7		34	0,8002		0,0,4001	no	missense	USP42	NM_032172.2	60	0,1,5895	GG,GC,CC		0.0,0.0264,0.0085	benign	828/1317	6193668	1,11791	1895	4001	5896	SO:0001583	missense	84132	exon15			GCGATGCGAGCCC	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2483C>G	chr7.hg19:g.6193668C>G	ENSP00000301962:p.Ala828Gly	94.0	0.0	.		97.0	10.0	.	NM_032172	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	hg19	CCDS47535.1	.	.	.	.	.	.	.	.	.	.	C	13.52	2.263117	0.39995	2.64E-4	0.0	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.14516	2.5;2.92	5.73	-7.59	0.01308	.	1.454650	0.03961	N	0.290123	T	0.07143	0.0181	N	0.08118	0	0.09310	N	1	B;B	0.22146	0.065;0.039	B;B	0.19946	0.027;0.012	T	0.27400	-1.0075	10	0.23891	T	0.37	.	13.9596	0.64170	0.1478:0.7122:0.14:0.0	.	828;828	Q9H9J4-2;Q9H9J4	.;UBP42_HUMAN	G	828;674	ENSP00000301962:A828G;ENSP00000408217:A674G	ENSP00000301962:A828G	A	+	2	0	USP42	6160193	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.506000	0.02271	-1.407000	0.02043	-0.262000	0.10625	GCG	.	.	.	weak		0.716	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
GPR141	353345	hgsc.bcm.edu	37	7	37780739	37780739	+	Silent	SNP	C	C	T			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr7:37780739C>T	ENST00000447769.1	+	4	1033	c.744C>T	c.(742-744)taC>taT	p.Y248Y	EPDR1_ENST00000476620.1_Intron|GPR141_ENST00000334425.1_Silent_p.Y248Y|GPR141_ENST00000461610.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	248						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GGATCTATTACTTGAATGTTG	0.398																																					p.Y248Y		Atlas-SNP	.											.	GPR141	79	.	0			c.C744T						PASS	.						177.0	172.0	174.0					7																	37780739		2203	4300	6503	SO:0001819	synonymous_variant	353345	exon1			CTATTACTTGAAT	AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.744C>T	chr7.hg19:g.37780739C>T		104.0	0.0	.		92.0	12.0	.	NM_181791	A4D1X7|Q0VAR5|Q86SP3	Silent	SNP	ENST00000447769.1	hg19	CCDS5451.1																																																																																			.	.	.	none		0.398	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219943.2	NM_181791	
YAE1D1	57002	hgsc.bcm.edu	37	7	39612136	39612136	+	Missense_Mutation	SNP	G	G	C			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr7:39612136G>C	ENST00000223273.2	+	3	555	c.512G>C	c.(511-513)tGt>tCt	p.C171S	YAE1D1_ENST00000432096.2_Intron	NM_020192.3	NP_064577.1	Q9NRH1	YAED1_HUMAN	Yae1 domain containing 1	171																	AACAAAAACTGTAGCAAGAGC	0.388																																					p.C171S		Atlas-SNP	.											.	YAE1D1	2	.	0			c.G512C						PASS	.						105.0	106.0	105.0					7																	39612136		2203	4300	6503	SO:0001583	missense	57002	exon3			AAAACTGTAGCAA	AF226046	CCDS5459.1, CCDS64630.1	7p14.1	2011-11-24	2011-11-24	2011-11-24	ENSG00000241127	ENSG00000241127			24857	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 36"""	C7orf36		12477932	Standard	NM_020192		Approved	GK003	uc003thc.4	Q9NRH1	OTTHUMG00000128689	ENST00000223273.2:c.512G>C	chr7.hg19:g.39612136G>C	ENSP00000223273:p.Cys171Ser	180.0	0.0	.		139.0	16.0	.	NM_020192	A4D1W4|B4DE83|Q6IAF7|Q8WVZ5	Missense_Mutation	SNP	ENST00000223273.2	hg19	CCDS5459.1	.	.	.	.	.	.	.	.	.	.	G	9.647	1.140562	0.21205	.	.	ENSG00000241127	ENST00000223273	T	0.52295	0.67	5.93	4.1	0.47936	.	0.134009	0.64402	D	0.000001	T	0.31199	0.0789	L	0.31065	0.9	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.25745	-1.0123	10	0.62326	D	0.03	-3.9594	3.8091	0.08789	0.1436:0.1357:0.5882:0.1324	.	171	Q9NRH1	CG036_HUMAN	S	171	ENSP00000223273:C171S	ENSP00000223273:C171S	C	+	2	0	C7orf36	39578661	0.010000	0.17322	0.827000	0.32855	0.652000	0.38707	0.587000	0.23909	0.829000	0.34733	0.655000	0.94253	TGT	.	.	.	none		0.388	YAE1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250586.1	NM_020192	
ABCA13	154664	hgsc.bcm.edu	37	7	48317734	48317734	+	Nonsense_Mutation	SNP	C	C	T			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr7:48317734C>T	ENST00000435803.1	+	18	6967	c.6943C>T	c.(6943-6945)Caa>Taa	p.Q2315*		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2315					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GAAACTGGATCAATTTCTTAC	0.239																																					p.Q2315X		Atlas-SNP	.											.	ABCA13	1192	.	0			c.C6943T						PASS	.						19.0	18.0	18.0					7																	48317734		1775	4024	5799	SO:0001587	stop_gained	154664	exon18			CTGGATCAATTTC	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.6943C>T	chr7.hg19:g.48317734C>T	ENSP00000411096:p.Gln2315*	366.0	0.0	.		435.0	43.0	.	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Nonsense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	46	12.263306	0.99651	.	.	ENSG00000179869	ENST00000435803	.	.	.	4.88	3.95	0.45737	.	0.651374	0.13231	N	0.403679	.	.	.	.	.	.	0.47183	D	0.999344	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	8.1462	0.31113	0.0:0.878:0.0:0.122	.	.	.	.	X	2315	.	ENSP00000411096:Q2315X	Q	+	1	0	ABCA13	48288280	0.090000	0.21635	0.028000	0.17463	0.343000	0.28985	0.786000	0.26844	1.097000	0.41459	0.650000	0.86243	CAA	.	.	.	none		0.239	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
EPHB4	2050	hgsc.bcm.edu	37	7	100414914	100414914	+	Silent	SNP	C	C	A			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr7:100414914C>A	ENST00000358173.3	-	8	1956	c.1488G>T	c.(1486-1488)ggG>ggT	p.G496G	EPHB4_ENST00000360620.3_Silent_p.G496G|EPHB4_ENST00000477446.1_5'UTR	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	496	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					CCCGCTTCAGCCCCCGCAGCT	0.687																																					p.G496G	GBM(200;2113 3072 25865 52728)	Atlas-SNP	.											.	EPHB4	106	.	0			c.G1488T						PASS	.						18.0	19.0	18.0					7																	100414914		2200	4296	6496	SO:0001819	synonymous_variant	2050	exon8			CTTCAGCCCCCGC	AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.1488G>T	chr7.hg19:g.100414914C>A		59.0	0.0	.		75.0	13.0	.	NM_004444	B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Silent	SNP	ENST00000358173.3	hg19	CCDS5706.1																																																																																			.	.	.	none		0.687	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	NM_004444	
MUC17	140453	hgsc.bcm.edu	37	7	100684959	100684959	+	Missense_Mutation	SNP	C	C	T			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr7:100684959C>T	ENST00000306151.4	+	3	10326	c.10262C>T	c.(10261-10263)aCa>aTa	p.T3421I		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3421	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ACCCTTTCAACAACTCCTGTG	0.498																																					p.T3421I		Atlas-SNP	.											.	MUC17	804	.	0			c.C10262T						PASS	.						246.0	252.0	250.0					7																	100684959		2203	4300	6503	SO:0001583	missense	140453	exon3			TTTCAACAACTCC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.10262C>T	chr7.hg19:g.100684959C>T	ENSP00000302716:p.Thr3421Ile	98.0	0.0	.		113.0	13.0	.	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	hg19	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	10.54	1.378183	0.24944	.	.	ENSG00000169876	ENST00000306151	T	0.03441	3.93	1.37	1.37	0.22104	.	.	.	.	.	T	0.05547	0.0146	N	0.24115	0.695	0.09310	N	0.999999	D	0.61697	0.99	P	0.56088	0.791	T	0.45818	-0.9235	9	0.36615	T	0.2	.	8.2792	0.31889	0.0:1.0:0.0:0.0	.	3421	Q685J3	MUC17_HUMAN	I	3421	ENSP00000302716:T3421I	ENSP00000302716:T3421I	T	+	2	0	MUC17	100471679	0.007000	0.16637	0.015000	0.15790	0.027000	0.11550	1.274000	0.33132	0.715000	0.32103	0.186000	0.17326	ACA	.	.	.	none		0.498	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
CSMD1	64478	hgsc.bcm.edu	37	8	2910077	2910077	+	Nonsense_Mutation	SNP	C	C	A			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr8:2910077C>A	ENST00000520002.1	-	51	8125	c.7570G>T	c.(7570-7572)Gag>Tag	p.E2524*	CSMD1_ENST00000602557.1_Nonsense_Mutation_p.E2524*|CSMD1_ENST00000537824.1_Nonsense_Mutation_p.E2523*|CSMD1_ENST00000602723.1_Nonsense_Mutation_p.E2524*|CSMD1_ENST00000400186.3_Nonsense_Mutation_p.E2524*|CSMD1_ENST00000542608.1_Nonsense_Mutation_p.E2523*			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2524	Sushi 15. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TTGAAGCCCTCATGACATTCA	0.502																																					p.E2523X		Atlas-SNP	.											.	CSMD1	1469	.	0			c.G7567T						PASS	.						68.0	65.0	66.0					8																	2910077		1951	4141	6092	SO:0001587	stop_gained	64478	exon50			AGCCCTCATGACA			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.7570G>T	chr8.hg19:g.2910077C>A	ENSP00000430733:p.Glu2524*	135.0	0.0	.		129.0	20.0	.	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Nonsense_Mutation	SNP	ENST00000520002.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	48|48	14.850392|14.850392	0.99812|0.99812	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608|ENST00000335551	.|.	.|.	.|.	5.32|5.32	4.43|4.43	0.53597|0.53597	.|.	0.336188|.	0.27482|.	N|.	0.019168|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.24483|.	T|.	0.36|.	.|.	13.7213|13.7213	0.62728|0.62728	0.0:0.9254:0.0:0.0746|0.0:0.9254:0.0:0.0746	.|.	.|.	.|.	.|.	X|L	2524;2524;2385;2523;2523|1940	.|.	ENSP00000320445:E2385X|.	E|X	-|-	1|2	0|2	CSMD1|CSMD1	2897484|2897484	0.959000|0.959000	0.32827|0.32827	0.951000|0.951000	0.38953|0.38953	0.103000|0.103000	0.19146|0.19146	2.127000|2.127000	0.42035|0.42035	2.628000|2.628000	0.89032|0.89032	0.655000|0.655000	0.94253|0.94253	GAG|TGA	.	.	.	none		0.502	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
PTK2B	2185	hgsc.bcm.edu	37	8	27315863	27315863	+	Missense_Mutation	SNP	A	A	T			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr8:27315863A>T	ENST00000397501.1	+	36	3675	c.2867A>T	c.(2866-2868)aAg>aTg	p.K956M	PTK2B_ENST00000346049.5_Missense_Mutation_p.K956M|PTK2B_ENST00000420218.2_Missense_Mutation_p.K914M|PTK2B_ENST00000544172.1_Missense_Mutation_p.K956M|PTK2B_ENST00000517339.1_Missense_Mutation_p.K914M|PTK2B_ENST00000338238.4_Missense_Mutation_p.K914M	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	956	Focal adhesion targeting (FAT).|Interaction with TGFB1I1. {ECO:0000250}.				activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	CTCATCAACAAGATGCGGCTG	0.562																																					p.K956M		Atlas-SNP	.											.	PTK2B	304	.	0			c.A2867T						PASS	.						77.0	57.0	64.0					8																	27315863		2203	4300	6503	SO:0001583	missense	2185	exon36			TCAACAAGATGCG	U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.2867A>T	chr8.hg19:g.27315863A>T	ENSP00000380638:p.Lys956Met	116.0	0.0	.		166.0	19.0	.	NM_173174	D3DST0|Q13475|Q14290|Q16709|Q6PID4	Missense_Mutation	SNP	ENST00000397501.1	hg19	CCDS6057.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.500119	0.85176	.	.	ENSG00000120899	ENST00000397501;ENST00000338238;ENST00000544172;ENST00000346049;ENST00000420218;ENST00000517339	T;T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29;1.29	4.91	4.91	0.64330	Focal adhesion kinase, targeting (FAT) domain (3);	0.000000	0.85682	D	0.000000	T	0.57577	0.2063	M	0.72118	2.19	0.80722	D	1	P;D	0.89917	0.915;1.0	P;D	0.87578	0.596;0.998	T	0.59883	-0.7370	10	0.52906	T	0.07	.	12.5376	0.56150	1.0:0.0:0.0:0.0	.	914;956	Q14289-2;Q14289	.;FAK2_HUMAN	M	956;914;956;956;914;914	ENSP00000380638:K956M;ENSP00000342242:K914M;ENSP00000440926:K956M;ENSP00000332816:K956M;ENSP00000391995:K914M;ENSP00000427931:K914M	ENSP00000342242:K914M	K	+	2	0	PTK2B	27371780	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.139000	0.94554	2.048000	0.60808	0.460000	0.39030	AAG	.	.	.	none		0.562	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219916.1	NM_004103	
ZFHX4	79776	hgsc.bcm.edu	37	8	77775451	77775451	+	Silent	SNP	T	T	A	rs199874527		TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr8:77775451T>A	ENST00000521891.2	+	11	9949	c.9501T>A	c.(9499-9501)ccT>ccA	p.P3167P	ZFHX4_ENST00000455469.2_Silent_p.P3122P|ZFHX4_ENST00000050961.6_Silent_p.P3118P|ZFHX4_ENST00000518282.1_Silent_p.P3141P	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3118					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ctccaccacctcctcctcctc	0.522										HNSCC(33;0.089)																											p.P3167P		Atlas-SNP	.											ZFHX4,colon,carcinoma,0,2	ZFHX4	878	.	0			c.T9501A						PASS	.						52.0	53.0	53.0					8																	77775451		2064	4225	6289	SO:0001819	synonymous_variant	79776	exon11			ACCACCTCCTCCT		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9501T>A	chr8.hg19:g.77775451T>A		75.0	1.0	.		83.0	5.0	.	NM_024721	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	hg19	CCDS47878.2																																																																																			.	.	.	none		0.522	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
FKTN	2218	hgsc.bcm.edu	37	9	108397413	108397413	+	Nonsense_Mutation	SNP	C	C	A			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr9:108397413C>A	ENST00000223528.2	+	10	1378	c.1254C>A	c.(1252-1254)taC>taA	p.Y418*	FKTN_ENST00000357998.5_Nonsense_Mutation_p.Y418*|FKTN_ENST00000540160.1_3'UTR|FKTN_ENST00000602661.1_Nonsense_Mutation_p.Y418*|FKTN_ENST00000448551.2_Nonsense_Mutation_p.Y418*	NM_006731.2	NP_006722.2	O75072	FKTN_HUMAN	fukutin	418					muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|negative regulation of JNK cascade (GO:0046329)|nervous system development (GO:0007399)|regulation of protein glycosylation (GO:0060049)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	transferase activity (GO:0016740)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	25						CCCTCGAATACATTGAAGCCA	0.473																																					p.Y418X		Atlas-SNP	.											.	FKTN	47	.	0			c.C1254A						PASS	.						203.0	181.0	188.0					9																	108397413		2203	4300	6503	SO:0001587	stop_gained	2218	exon10			CGAATACATTGAA		CCDS6766.1	9q31-q33	2014-09-17	2007-11-21	2007-11-21	ENSG00000106692	ENSG00000106692			3622	protein-coding gene	gene with protein product		607440	"""Fukuyama type congenital muscular dystrophy (fukutin)"""	FCMD		8275093, 17036286, 17044012	Standard	NM_001079802		Approved	LGMD2M	uc004bcs.3	O75072	OTTHUMG00000020425	ENST00000223528.2:c.1254C>A	chr9.hg19:g.108397413C>A	ENSP00000223528:p.Tyr418*	140.0	0.0	.		153.0	14.0	.	NM_006731	B4DUX9|J3KP13|Q3MIJ1|Q96TE1|Q9P295	Nonsense_Mutation	SNP	ENST00000223528.2	hg19	CCDS6766.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.282505|5.282505	0.95489|0.95489	.|.	.|.	ENSG00000106692|ENSG00000106692	ENST00000457847|ENST00000223528;ENST00000357998	.|.	.|.	.|.	6.04|6.04	1.09|1.09	0.20402|0.20402	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.29850|.	0.0746|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.17077|.	-1.0381|.	4|.	.|0.02654	.|T	.|1	1.15|1.15	10.5637|10.5637	0.45161|0.45161	0.0:0.5396:0.0:0.4604|0.0:0.5396:0.0:0.4604	.|.	.|.	.|.	.|.	K|X	115|418	.|.	.|ENSP00000223528:Y418X	T|Y	+|+	2|3	0|2	FKTN|FKTN	107437234|107437234	0.964000|0.964000	0.33143|0.33143	0.996000|0.996000	0.52242|0.52242	0.993000|0.993000	0.82548|0.82548	0.154000|0.154000	0.16343|0.16343	0.163000|0.163000	0.19507|0.19507	0.563000|0.563000	0.77884|0.77884	ACA|TAC	.	.	.	none		0.473	FKTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053505.1	NM_006731	
TOR1B	27348	hgsc.bcm.edu	37	9	132569640	132569640	+	Silent	SNP	C	C	T			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr9:132569640C>T	ENST00000259339.2	+	3	699	c.639C>T	c.(637-639)ctC>ctT	p.L213L		NM_014506.1	NP_055321.1	O14657	TOR1B_HUMAN	torsin family 1, member B (torsin B)	213					ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)|endoplasmic reticulum organization (GO:0007029)|nuclear membrane organization (GO:0071763)|protein homooligomerization (GO:0051260)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(3)|kidney(1)|large_intestine(1)|lung(7)	12		Ovarian(14;0.0586)				TCATCTTTCTCAGGTCAGCGG	0.488																																					p.L213L		Atlas-SNP	.											.	TOR1B	20	.	0			c.C639T						PASS	.						172.0	167.0	169.0					9																	132569640		2203	4300	6503	SO:0001819	synonymous_variant	27348	exon3			CTTTCTCAGGTCA	AF007872	CCDS6929.1	9q34	2008-07-21			ENSG00000136816	ENSG00000136816			11995	protein-coding gene	gene with protein product		608050				9288096, 10644435	Standard	NM_014506		Approved	DQ1, MGC4386	uc004byk.1	O14657	OTTHUMG00000020795	ENST00000259339.2:c.639C>T	chr9.hg19:g.132569640C>T		95.0	0.0	.		85.0	7.0	.	NM_014506		Silent	SNP	ENST00000259339.2	hg19	CCDS6929.1																																																																																			.	.	.	none		0.488	TOR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054615.1	NM_014506	
ERCC6	2074	hgsc.bcm.edu	37	10	50708590	50708590	+	Missense_Mutation	SNP	T	T	C			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr10:50708590T>C	ENST00000355832.5	-	7	1757	c.1679A>G	c.(1678-1680)aAt>aGt	p.N560S	ERCC6_ENST00000542458.1_5'UTR	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	560	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						TTGCCTGTAATTTGAACCACG	0.458								Direct reversal of damage;Nucleotide excision repair (NER)																													p.V560G		Atlas-SNP	.											.	ERCC6	162	.	0			c.T1679G						PASS	.						148.0	129.0	135.0					10																	50708590		2203	4300	6503	SO:0001583	missense	2074	exon7			CTGTAATTTGAAC	L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.1679A>G	chr10.hg19:g.50708590T>C	ENSP00000348089:p.Asn560Ser	58.0	0.0	.		62.0	9.0	.	NM_000124	D3DX94|Q5W0L9	Missense_Mutation	SNP	ENST00000355832.5	hg19	CCDS7229.1	.	.	.	.	.	.	.	.	.	.	T	11.32	1.604045	0.28534	.	.	ENSG00000225830	ENST00000355832	D	0.92199	-2.99	5.87	5.87	0.94306	DEAD-like helicase (2);SNF2-related (1);	.	.	.	.	T	0.81230	0.4779	N	0.01800	-0.715	0.80722	D	1	B	0.27068	0.167	B	0.27608	0.081	T	0.78932	-0.2009	9	0.27785	T	0.31	-26.6076	16.5764	0.84681	0.0:0.0:0.0:1.0	.	560	Q03468	ERCC6_HUMAN	S	560	ENSP00000348089:N560S	ENSP00000348089:N560S	N	-	2	0	ERCC6	50378596	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.249000	0.72427	2.371000	0.80710	0.533000	0.62120	AAT	.	.	.	none		0.458	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1	NM_000124	
LRRC32	2615	hgsc.bcm.edu	37	11	76371485	76371485	+	Silent	SNP	G	G	A			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr11:76371485G>A	ENST00000407242.2	-	3	1394	c.1152C>T	c.(1150-1152)gcC>gcT	p.A384A	LRRC32_ENST00000260061.5_Silent_p.A384A|AP001189.4_ENST00000447519.1_RNA|LRRC32_ENST00000464145.1_Intron|LRRC32_ENST00000404995.1_Silent_p.A384A	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	384					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						GAGACCCCAGGGCTCTGGCGC	0.647																																					p.A384A		Atlas-SNP	.											.	LRRC32	74	.	0			c.C1152T						PASS	.						18.0	20.0	19.0					11																	76371485		2199	4289	6488	SO:0001819	synonymous_variant	2615	exon3			CCCCAGGGCTCTG	Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.1152C>T	chr11.hg19:g.76371485G>A		112.0	0.0	.		125.0	7.0	.	NM_005512	Q86V06	Silent	SNP	ENST00000407242.2	hg19	CCDS8245.1																																																																																			.	.	.	none		0.647	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257926.2	NM_005512	
ATM	472	hgsc.bcm.edu	37	11	108143336	108143336	+	Splice_Site	SNP	T	T	A			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr11:108143336T>A	ENST00000452508.2	+	22	3342		c.e22+2		ATM_ENST00000278616.4_Splice_Site			Q13315	ATM_HUMAN	ATM serine/threonine kinase						brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.?(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TTGCTTGAGGTGAGTTTTTGC	0.299			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											.		Atlas-SNP	.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	ATM_ENST00000278616,caecum,carcinoma,0,3	ATM	1657	.	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)	c.3153+2T>A						PASS	.						105.0	108.0	107.0					11																	108143336		2201	4298	6499	SO:0001630	splice_region_variant	472	exon21	Familial Cancer Database	AT, Louis-Bar syndrome	TTGAGGTGAGTTT	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.3153+2T>A	chr11.hg19:g.108143336T>A		199.0	0.0	.		237.0	24.0	.	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Splice_Site	SNP	ENST00000452508.2	hg19	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.163596	0.78226	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7767	0.78228	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATM	107648546	1.000000	0.71417	0.976000	0.42696	0.907000	0.53573	4.461000	0.60115	2.174000	0.68829	0.533000	0.62120	.	.	.	.	none		0.299	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	Intron
HNRNPA1	3178	hgsc.bcm.edu	37	12	54675583	54675583	+	Missense_Mutation	SNP	T	T	C			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr12:54675583T>C	ENST00000340913.6	+	3	190	c.137T>C	c.(136-138)aTg>aCg	p.M46T	CBX5_ENST00000209875.4_5'Flank|RP11-968A15.2_ENST00000547177.1_RNA|RP11-968A15.8_ENST00000553061.1_RNA|HNRNPA1_ENST00000330752.8_Missense_Mutation_p.M46T|HNRNPA1_ENST00000547276.1_Missense_Mutation_p.M46T|HNRNPA1_ENST00000546500.1_Missense_Mutation_p.M46T	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	46	Globular A domain.|RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						TCTCAGGTAATGAGAGATCCA	0.448																																					p.M46T	Colon(83;502 1289 8436 16406 24870)	Atlas-SNP	.											.	HNRNPA1	72	.	0			c.T137C						PASS	.						47.0	47.0	47.0					12																	54675583		1972	4195	6167	SO:0001583	missense	3178	exon3			AGGTAATGAGAGA	BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.137T>C	chr12.hg19:g.54675583T>C	ENSP00000341826:p.Met46Thr	163.0	0.0	.		131.0	16.0	.	NM_002136	A8K4Z8|Q3MIB7|Q6PJZ7	Missense_Mutation	SNP	ENST00000340913.6	hg19	CCDS44909.1	.	.	.	.	.	.	.	.	.	.	T	16.89	3.248556	0.59103	.	.	ENSG00000135486	ENST00000546500;ENST00000547708;ENST00000547617;ENST00000552494;ENST00000340913;ENST00000330752;ENST00000552591;ENST00000551133;ENST00000547276;ENST00000548688;ENST00000550994	D;D;D;D;D;D;D	0.89552	-2.53;-2.53;-2.53;-2.53;-2.53;-2.53;-2.53	3.81	3.81	0.43845	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.64402	D	0.000002	D	0.94489	0.8226	M	0.89214	3.015	0.58432	D	0.999996	D;P;P;P;D;B;P;D	0.89917	0.981;0.453;0.749;0.893;0.99;0.164;0.749;1.0	P;B;P;P;D;B;P;D	0.83275	0.855;0.38;0.631;0.597;0.965;0.161;0.631;0.996	D	0.94901	0.8056	10	0.87932	D	0	.	11.1785	0.48614	0.0:0.0:0.0:1.0	.	24;46;46;46;46;46;46;46	Q9BSM5;F8VRQ1;F8W6I7;F8VSB5;F8VXY0;P09651-3;P09651-2;P09651	.;.;.;.;.;.;.;ROA1_HUMAN	T	46;46;46;46;46;46;46;46;46;65;1	ENSP00000448617:M46T;ENSP00000448229:M46T;ENSP00000341826:M46T;ENSP00000333504:M46T;ENSP00000447260:M46T;ENSP00000447782:M65T;ENSP00000448917:M1T	ENSP00000333504:M46T	M	+	2	0	HNRNPA1	52961850	1.000000	0.71417	1.000000	0.80357	0.459000	0.32528	7.892000	0.87324	1.698000	0.51180	0.260000	0.18958	ATG	.	.	.	none		0.448	HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000405480.1	NM_031157	
GNPTAB	79158	hgsc.bcm.edu	37	12	102147264	102147264	+	Missense_Mutation	SNP	G	G	T	rs281865020		TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr12:102147264G>T	ENST00000299314.7	-	19	3750	c.3488C>A	c.(3487-3489)aCa>aAa	p.T1163K		NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	1163					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						AGCCTTCACTGTCTGAGCATC	0.408																																					p.T1163K		Atlas-SNP	.											.	GNPTAB	120	.	0			c.C3488A						PASS	.						129.0	116.0	120.0					12																	102147264		2203	4300	6503	SO:0001583	missense	79158	exon19			TTCACTGTCTGAG	AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.3488C>A	chr12.hg19:g.102147264G>T	ENSP00000299314:p.Thr1163Lys	110.0	0.0	.		134.0	14.0	.	NM_024312	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Missense_Mutation	SNP	ENST00000299314.7	hg19	CCDS9088.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.654854	0.88056	.	.	ENSG00000111670	ENST00000299314	D	0.81996	-1.56	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.87128	0.6100	L	0.31664	0.95	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.87818	0.2636	10	0.54805	T	0.06	-19.2071	19.2587	0.93959	0.0:0.0:1.0:0.0	.	1163	Q3T906	GNPTA_HUMAN	K	1163	ENSP00000299314:T1163K	ENSP00000299314:T1163K	T	-	2	0	GNPTAB	100671395	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.471000	0.97696	2.547000	0.85894	0.591000	0.81541	ACA	.	.	.	none		0.408	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409182.1		
MYH7	4625	hgsc.bcm.edu	37	14	23902759	23902759	+	Silent	SNP	G	G	T	rs370743876		TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr14:23902759G>T	ENST00000355349.3	-	3	345	c.183C>A	c.(181-183)gcC>gcA	p.A61A		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	61					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		ACTCGGTCTCGGCAGTGACTT	0.567																																					p.A61A		Atlas-SNP	.											MYH7,colon,carcinoma,0,1	MYH7	349	.	0			c.C183A						PASS	.						127.0	98.0	108.0					14																	23902759		2203	4300	6503	SO:0001819	synonymous_variant	4625	exon3			GGTCTCGGCAGTG	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.183C>A	chr14.hg19:g.23902759G>T		62.0	0.0	.		42.0	2.0	.	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	ENST00000355349.3	hg19	CCDS9601.1																																																																																			.	.	.	alt		0.567	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
FAM98B	283742	hgsc.bcm.edu	37	15	38776812	38776812	+	IGR	SNP	T	T	A	rs201831942		TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr15:38776812T>A	ENST00000491535.1	+	0	3111				FAM98B_ENST00000397609.2_Silent_p.G418G	NM_001042429.1	NP_001035894.1	Q52LJ0	FA98B_HUMAN	family with sequence similarity 98, member B							cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-splicing ligase complex (GO:0072669)	poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8		all_cancers(109;3.11e-17)|all_epithelial(112;2.64e-15)|Lung NSC(122;2.11e-11)|all_lung(180;5.61e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;9e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0209)		GAGGAggtggtggtggtggtg	0.463																																					p.G418G		Atlas-SNP	.											.	FAM98B	53	.	0			c.T1254A						PASS	.						24.0	23.0	23.0					15																	38776812		1552	3434	4986	SO:0001628	intergenic_variant	283742	exon8			AGGTGGTGGTGGT		CCDS10047.2	15q14	2006-11-29		2005-11-20	ENSG00000171262	ENSG00000171262			26773	protein-coding gene	gene with protein product						12477932	Standard	NM_173611		Approved	FLJ38426	uc001zkc.3	Q52LJ0	OTTHUMG00000129831		chr15.hg19:g.38776812T>A		62.0	0.0	.		82.0	7.0	.	NM_173611	A8MUW5|Q8N935	Silent	SNP	ENST00000491535.1	hg19	CCDS42015.1																																																																																			.	.	.	none		0.463	FAM98B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252071.2	NM_173611	
FAM98B	283742	hgsc.bcm.edu	37	15	38776815	38776815	+	IGR	SNP	T	T	A	rs201831942		TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr15:38776815T>A	ENST00000491535.1	+	0	3111				FAM98B_ENST00000397609.2_Silent_p.G419G	NM_001042429.1	NP_001035894.1	Q52LJ0	FA98B_HUMAN	family with sequence similarity 98, member B							cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-splicing ligase complex (GO:0072669)	poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8		all_cancers(109;3.11e-17)|all_epithelial(112;2.64e-15)|Lung NSC(122;2.11e-11)|all_lung(180;5.61e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;9e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0209)		GAggtggtggtggtggtggtg	0.458																																					p.G419G		Atlas-SNP	.											.	FAM98B	53	.	0			c.T1257A						PASS	.																																			SO:0001628	intergenic_variant	283742	exon8			TGGTGGTGGTGGT		CCDS10047.2	15q14	2006-11-29		2005-11-20	ENSG00000171262	ENSG00000171262			26773	protein-coding gene	gene with protein product						12477932	Standard	NM_173611		Approved	FLJ38426	uc001zkc.3	Q52LJ0	OTTHUMG00000129831		chr15.hg19:g.38776815T>A		59.0	0.0	.		76.0	10.0	.	NM_173611	A8MUW5|Q8N935	Silent	SNP	ENST00000491535.1	hg19	CCDS42015.1																																																																																			.	.	.	none		0.458	FAM98B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252071.2	NM_173611	
PDE8A	5151	hgsc.bcm.edu	37	15	85652313	85652313	+	Silent	SNP	A	A	C			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr15:85652313A>C	ENST00000310298.4	+	13	1318	c.1066A>C	c.(1066-1068)Aga>Cga	p.R356R	PDE8A_ENST00000557957.1_Silent_p.R284R|PDE8A_ENST00000339708.5_Silent_p.R310R|PDE8A_ENST00000394553.1_Silent_p.R356R|PDE8A_ENST00000557819.2_3'UTR			O60658	PDE8A_HUMAN	phosphodiesterase 8A	356					cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|phosphorelay signal transduction system (GO:0000160)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	25	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)		Caffeine(DB00201)|Ketotifen(DB00920)	TAAAGACAGGAGAAAAGGCTC	0.368																																					p.R356R		Atlas-SNP	.											.	PDE8A	50	.	0			c.A1066C						PASS	.						111.0	106.0	108.0					15																	85652313		2203	4299	6502	SO:0001819	synonymous_variant	5151	exon12			GACAGGAGAAAAG	AF056490	CCDS10336.1, CCDS10337.1, CCDS58397.1	15q25.3	2008-05-14			ENSG00000073417	ENSG00000073417	3.1.4.17	"""Phosphodiesterases"""	8793	protein-coding gene	gene with protein product		602972				9618252	Standard	NM_001243137		Approved	HsT19550	uc002blh.3	O60658	OTTHUMG00000148670	ENST00000310298.4:c.1066A>C	chr15.hg19:g.85652313A>C		375.0	0.0	.		454.0	45.0	.	NM_002605	B3KXE6|H0YMZ7|Q6P9H3|Q969I1|Q96PC9|Q96PD0|Q96PD1|Q96T71|Q9UMB7|Q9UMC3	Silent	SNP	ENST00000310298.4	hg19	CCDS10336.1																																																																																			.	.	.	none		0.368	PDE8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309018.1	NM_002605	
ZNF771	51333	hgsc.bcm.edu	37	16	30419477	30419477	+	Missense_Mutation	SNP	G	G	A			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr16:30419477G>A	ENST00000319296.5	+	2	480	c.103G>A	c.(103-105)Gag>Aag	p.E35K	ZNF771_ENST00000566625.1_Missense_Mutation_p.E35K|ZNF771_ENST00000564550.1_Missense_Mutation_p.E35K|ZNF771_ENST00000434417.1_Missense_Mutation_p.E35K			Q7L3S4	ZN771_HUMAN	zinc finger protein 771	35	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)							Colorectal(24;0.193)			ggagaagtatgaggtggTGAA	0.582																																					p.E35K		Atlas-SNP	.											.	ZNF771	1	.	0			c.G103A						PASS	.						206.0	234.0	225.0					16																	30419477		2176	4264	6440	SO:0001583	missense	51333	exon2			AAGTATGAGGTGG	BC026192	CCDS45460.1	16p11.2	2013-01-08				ENSG00000179965		"""Zinc fingers, C2H2-type"""	29653	protein-coding gene	gene with protein product						12477932	Standard	NM_016643		Approved	DSC43	uc010ver.2	Q7L3S4		ENST00000319296.5:c.103G>A	chr16.hg19:g.30419477G>A	ENSP00000323945:p.Glu35Lys	119.0	0.0	.		156.0	10.0	.	NM_001142305	Q8TAQ7|Q9NYI6	Missense_Mutation	SNP	ENST00000319296.5	hg19	CCDS45460.1	.	.	.	.	.	.	.	.	.	.	G	18.37	3.608829	0.66558	.	.	ENSG00000179965	ENST00000434417;ENST00000319296	T;T	0.07444	3.19;3.19	4.86	3.82	0.43975	.	.	.	.	.	T	0.04003	0.0112	N	0.08118	0	0.28185	N	0.92801	B	0.23854	0.092	B	0.10450	0.005	T	0.30149	-0.9988	9	0.10377	T	0.69	-6.4062	10.3652	0.44019	0.0:0.1994:0.8006:0.0	.	35	Q7L3S4	ZN771_HUMAN	K	35	ENSP00000416197:E35K;ENSP00000323945:E35K	ENSP00000323945:E35K	E	+	1	0	ZNF771	30326978	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.857000	0.39399	2.634000	0.89283	0.491000	0.48974	GAG	.	.	.	none		0.582	ZNF771-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434612.2	NM_016643	
NEURL4	84461	hgsc.bcm.edu	37	17	7225239	7225239	+	Missense_Mutation	SNP	T	T	A			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr17:7225239T>A	ENST00000399464.2	-	17	2831	c.2816A>T	c.(2815-2817)tAt>tTt	p.Y939F	RP11-542C16.2_ENST00000575474.1_5'Flank|NEURL4_ENST00000570460.1_Missense_Mutation_p.Y915F|NEURL4_ENST00000315614.7_Missense_Mutation_p.Y937F	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	939	NHR 5. {ECO:0000255|PROSITE- ProRule:PRU00400}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GCCATGAGCATAGCCAGCGGC	0.587																																					p.Y939F		Atlas-SNP	.											.	NEURL4	192	.	0			c.A2816T						PASS	.						102.0	103.0	103.0					17																	7225239		2139	4239	6378	SO:0001583	missense	84461	exon17			TGAGCATAGCCAG		CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.2816A>T	chr17.hg19:g.7225239T>A	ENSP00000382390:p.Tyr939Phe	22.0	0.0	.		34.0	4.0	.	NM_032442	Q6GPI8|Q96IU9|Q9H0B0	Missense_Mutation	SNP	ENST00000399464.2	hg19	CCDS42251.1	.	.	.	.	.	.	.	.	.	.	T	15.17	2.752850	0.49362	.	.	ENSG00000215041	ENST00000315614;ENST00000399464	T;T	0.24723	1.87;1.84	5.87	5.87	0.94306	NEUZ (3);	0.066390	0.64402	D	0.000005	T	0.19765	0.0475	N	0.03294	-0.36	0.37210	D	0.904753	D;D	0.63046	0.99;0.992	P;P	0.61722	0.829;0.893	T	0.28586	-1.0039	10	0.12430	T	0.62	-12.3966	8.7135	0.34397	0.0:0.084:0.0:0.916	.	937;939	Q96JN8-2;Q96JN8	.;NEUL4_HUMAN	F	937;939	ENSP00000319826:Y937F;ENSP00000382390:Y939F	ENSP00000319826:Y937F	Y	-	2	0	NEURL4	7165963	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	4.145000	0.58065	2.244000	0.73946	0.533000	0.62120	TAT	.	.	.	none		0.587	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255434.2	NM_032442	
MED1	5469	hgsc.bcm.edu	37	17	37595435	37595435	+	Missense_Mutation	SNP	C	C	A			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr17:37595435C>A	ENST00000394287.3	-	6	616	c.411G>T	c.(409-411)gaG>gaT	p.E137D	MED1_ENST00000300651.6_Missense_Mutation_p.E137D			O95243	MBD4_HUMAN	mediator complex subunit 1	0	MBD. {ECO:0000255|PROSITE- ProRule:PRU00338}.				base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		GCTGTACAAGCTCCGGACAGC	0.348										HNSCC(31;0.082)																											p.E137D	Pancreas(21;279 768 2492 4877 24026)	Atlas-SNP	.											.	MED1	123	.	0			c.G411T						PASS	.						92.0	90.0	90.0					17																	37595435		2203	4300	6503	SO:0001583	missense	5469	exon6			TACAAGCTCCGGA	L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000394287.3:c.411G>T	chr17.hg19:g.37595435C>A	ENSP00000377828:p.Glu137Asp	58.0	0.0	.		63.0	7.0	.	NM_004774	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000394287.3	hg19		.	.	.	.	.	.	.	.	.	.	C	11.87	1.768760	0.31320	.	.	ENSG00000125686	ENST00000394287;ENST00000300651	T	0.36699	1.24	5.35	2.31	0.28768	Mediator complex, subunit Med1, metazoa/fungi (1);	.	.	.	.	T	0.48624	0.1510	M	0.70275	2.135	0.46222	D	0.998931	P;P	0.48089	0.905;0.724	P;B	0.55667	0.781;0.183	T	0.42732	-0.9434	9	0.56958	D	0.05	-15.0086	8.7576	0.34654	0.0:0.6417:0.0:0.3583	.	137;137	Q15648;Q15648-3	MED1_HUMAN;.	D	137	ENSP00000300651:E137D	ENSP00000300651:E137D	E	-	3	2	MED1	34848961	0.837000	0.29446	1.000000	0.80357	0.984000	0.73092	-0.167000	0.09940	0.340000	0.23745	0.591000	0.81541	GAG	.	.	.	none		0.348	MED1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000256944.1	NM_004774	
TOB1	10140	hgsc.bcm.edu	37	17	48940877	48940877	+	Missense_Mutation	SNP	T	T	C			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr17:48940877T>C	ENST00000268957.3	-	3	930	c.502A>G	c.(502-504)Atg>Gtg	p.M168V	TOB1_ENST00000509385.1_5'UTR|TOB1_ENST00000499247.2_Missense_Mutation_p.M168V	NM_001243877.1	NP_001230806.1	P50616	TOB1_HUMAN	transducer of ERBB2, 1	168					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060212)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of translation (GO:0017148)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of signal transduction (GO:0009967)|SMAD protein import into nucleus (GO:0007184)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor tyrosine kinase binding (GO:0030971)|SH3/SH2 adaptor activity (GO:0005070)|transcription corepressor activity (GO:0003714)			breast(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			GACCGGGGCATGAAGGTAGGG	0.522											OREG0024576	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M168V	NSCLC(144;643 1919 24513 29423 40686)	Atlas-SNP	.											.	TOB1	40	.	0			c.A502G						PASS	.						91.0	76.0	81.0					17																	48940877		2203	4300	6503	SO:0001583	missense	10140	exon2			GGGGCATGAAGGT	D38305	CCDS11576.1	17q21.33	2012-08-14			ENSG00000141232	ENSG00000141232			11979	protein-coding gene	gene with protein product		605523		TROB1		8632892, 17785442	Standard	NM_005749		Approved	TOB, TROB	uc002isw.3	P50616	OTTHUMG00000162277	ENST00000268957.3:c.502A>G	chr17.hg19:g.48940877T>C	ENSP00000268957:p.Met168Val	113.0	0.0	.	958	143.0	19.0	.	NM_005749	B2R9T0|D3DTY3|Q4KMQ0	Missense_Mutation	SNP	ENST00000268957.3	hg19	CCDS11576.1	.	.	.	.	.	.	.	.	.	.	T	5.997	0.367857	0.11352	.	.	ENSG00000141232	ENST00000499247;ENST00000268957	T;T	0.40225	1.04;1.04	5.67	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.37265	0.0997	L	0.52266	1.64	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.10405	-1.0631	10	0.29301	T	0.29	.	12.9615	0.58462	0.0:0.0:0.1352:0.8648	.	168	P50616	TOB1_HUMAN	V	168	ENSP00000427695:M168V;ENSP00000268957:M168V	ENSP00000268957:M168V	M	-	1	0	TOB1	46295876	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.903000	0.69877	0.964000	0.38108	0.533000	0.62120	ATG	.	.	.	none		0.522	TOB1-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000368364.1		
HELZ	9931	hgsc.bcm.edu	37	17	65163789	65163789	+	Silent	SNP	A	A	T			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr17:65163789A>T	ENST00000358691.5	-	14	1720	c.1554T>A	c.(1552-1554)tcT>tcA	p.S518S	HELZ_ENST00000580168.1_Silent_p.S518S	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	518						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					AAGTATCTTCAGAAAGTGTTT	0.428																																					p.S518S		Atlas-SNP	.											.	HELZ	160	.	0			c.T1554A						PASS	.						112.0	100.0	103.0					17																	65163789		1862	4115	5977	SO:0001819	synonymous_variant	9931	exon14			ATCTTCAGAAAGT	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.1554T>A	chr17.hg19:g.65163789A>T		247.0	0.0	.		308.0	41.0	.	NM_014877	I6L9H4	Silent	SNP	ENST00000358691.5	hg19	CCDS42374.1																																																																																			.	.	.	none		0.428	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
USH1G	124590	hgsc.bcm.edu	37	17	72915897	72915897	+	Missense_Mutation	SNP	C	C	T			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr17:72915897C>T	ENST00000319642.1	-	2	1216	c.1034G>A	c.(1033-1035)cGg>cAg	p.R345Q		NM_001282489.1|NM_173477.2	NP_001269418.1|NP_775748.2	Q495M9	USH1G_HUMAN	Usher syndrome 1G (autosomal recessive)	345					equilibrioception (GO:0050957)|inner ear morphogenesis (GO:0042472)|inner ear receptor cell differentiation (GO:0060113)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	spectrin binding (GO:0030507)		HN1/USH1G(2)	endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(3)	14	all_lung(278;0.172)|Lung NSC(278;0.207)					GCTCTGCAGCCGACCCCGCGG	0.672																																					p.R345Q		Atlas-SNP	.											.	USH1G	40	.	0			c.G1034A						PASS	.						34.0	42.0	39.0					17																	72915897		2202	4293	6495	SO:0001583	missense	124590	exon2			TGCAGCCGACCCC	AK091243	CCDS32725.1	17q25.1	2013-01-10			ENSG00000182040	ENSG00000182040		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	16356	protein-coding gene	gene with protein product		607696				12588794	Standard	NM_001282489		Approved	Sans, FLJ33924, ANKS4A	uc002jme.1	Q495M9	OTTHUMG00000178864	ENST00000319642.1:c.1034G>A	chr17.hg19:g.72915897C>T	ENSP00000320076:p.Arg345Gln	117.0	0.0	.		141.0	16.0	.	NM_173477	Q8N251	Missense_Mutation	SNP	ENST00000319642.1	hg19	CCDS32725.1	.	.	.	.	.	.	.	.	.	.	C	9.720	1.159540	0.21454	.	.	ENSG00000182040	ENST00000319642	T	0.70631	-0.5	4.34	4.34	0.51931	.	0.065307	0.64402	D	0.000009	T	0.53012	0.1770	L	0.34521	1.04	0.46499	D	0.999071	P	0.44006	0.824	B	0.27887	0.084	T	0.56842	-0.7912	10	0.20046	T	0.44	-24.1946	17.0851	0.86609	0.0:1.0:0.0:0.0	.	345	Q495M9	USH1G_HUMAN	Q	345	ENSP00000320076:R345Q	ENSP00000320076:R345Q	R	-	2	0	USH1G	70427492	1.000000	0.71417	0.999000	0.59377	0.901000	0.52897	1.950000	0.40323	2.275000	0.75901	0.555000	0.69702	CGG	.	.	.	none		0.672	USH1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443676.1	NM_173477	
ABCA7	10347	hgsc.bcm.edu	37	19	1054009	1054009	+	Silent	SNP	C	C	T			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr19:1054009C>T	ENST00000263094.6	+	26	3708	c.3477C>T	c.(3475-3477)ggC>ggT	p.G1159G	ABCA7_ENST00000435683.2_Silent_p.G1021G|ABCA7_ENST00000433129.1_Silent_p.G1159G	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	1159					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGCAGATGGCAGCTGCGGGC	0.592																																					p.G1159G		Atlas-SNP	.											.	ABCA7	174	.	0			c.C3477T						PASS	.						75.0	85.0	82.0					19																	1054009		2203	4300	6503	SO:0001819	synonymous_variant	10347	exon26			AGATGGCAGCTGC	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.3477C>T	chr19.hg19:g.1054009C>T		136.0	0.0	.		150.0	6.0	.	NM_019112	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	hg19	CCDS12055.1																																																																																			.	.	.	none		0.592	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
COL5A3	50509	hgsc.bcm.edu	37	19	10112281	10112281	+	Silent	SNP	A	A	G			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr19:10112281A>G	ENST00000264828.3	-	8	1114	c.1029T>C	c.(1027-1029)gaT>gaC	p.D343D		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	343	Nonhelical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CTCCTTCTTCATCCTCCCTGG	0.542											OREG0025228	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D343D		Atlas-SNP	.											.	COL5A3	243	.	0			c.T1029C						PASS	.						103.0	99.0	100.0					19																	10112281		2203	4300	6503	SO:0001819	synonymous_variant	50509	exon8			TTCTTCATCCTCC	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.1029T>C	chr19.hg19:g.10112281A>G		121.0	0.0	.	662	122.0	10.0	.	NM_015719	Q9NZQ6	Silent	SNP	ENST00000264828.3	hg19	CCDS12222.1																																																																																			.	.	.	none		0.542	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	
RYR1	6261	hgsc.bcm.edu	37	19	38997149	38997149	+	Silent	SNP	G	G	A			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr19:38997149G>A	ENST00000359596.3	+	56	8655	c.8655G>A	c.(8653-8655)acG>acA	p.T2885T	RYR1_ENST00000355481.4_Silent_p.T2885T|RYR1_ENST00000360985.3_Silent_p.T2885T			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2885	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.T2885T(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	ACCACAACACGTGGGGACGGA	0.587																																					p.T2885T		Atlas-SNP	.											.	RYR1	708	.	1	Substitution - coding silent(1)	lung(1)	c.G8655A						PASS	.						61.0	59.0	59.0					19																	38997149		2203	4300	6503	SO:0001819	synonymous_variant	6261	exon56			CAACACGTGGGGA	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.8655G>A	chr19.hg19:g.38997149G>A		182.0	0.0	.		175.0	15.0	.	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	hg19	CCDS33011.1																																																																																			.	.	.	none		0.587	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
NUMBL	9253	hgsc.bcm.edu	37	19	41192843	41192843	+	Missense_Mutation	SNP	G	G	T			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr19:41192843G>T	ENST00000252891.4	-	2	249	c.82C>A	c.(82-84)Ccc>Acc	p.P28T	NUMBL_ENST00000540131.1_Intron|NUMBL_ENST00000598779.1_Intron|NUMBL_ENST00000599594.1_5'UTR	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	28					adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			GTTTCTGGGGGCCCCGGGGCC	0.672																																					p.P28T		Atlas-SNP	.											.	NUMBL	49	.	0			c.C82A						PASS	.						3.0	4.0	4.0					19																	41192843		1692	3271	4963	SO:0001583	missense	9253	exon2			CTGGGGGCCCCGG	AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.82C>A	chr19.hg19:g.41192843G>T	ENSP00000252891:p.Pro28Thr	166.0	0.0	.		148.0	24.0	.	NM_004756	Q7Z4J9	Missense_Mutation	SNP	ENST00000252891.4	hg19	CCDS12561.1	.	.	.	.	.	.	.	.	.	.	G	19.52	3.843968	0.71488	.	.	ENSG00000105245	ENST00000252891	T	0.54279	0.58	4.48	4.48	0.54585	.	0.369326	0.19810	N	0.105553	T	0.30103	0.0754	N	0.08118	0	0.80722	D	1	P;P	0.38395	0.629;0.629	B;B	0.33568	0.166;0.166	T	0.17592	-1.0364	10	0.34782	T	0.22	-8.0968	12.5039	0.55970	0.0:0.0:1.0:0.0	.	28;28	A8K033;Q9Y6R0	.;NUMBL_HUMAN	T	28	ENSP00000252891:P28T	ENSP00000252891:P28T	P	-	1	0	NUMBL	45884683	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	2.611000	0.46334	2.335000	0.79485	0.297000	0.19635	CCC	.	.	.	none		0.672	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462749.2	NM_004756	
GEMIN7	79760	hgsc.bcm.edu	37	19	45593461	45593461	+	Missense_Mutation	SNP	G	G	T			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr19:45593461G>T	ENST00000270257.4	+	3	336	c.89G>T	c.(88-90)cGc>cTc	p.R30L	PPP1R37_ENST00000221462.4_5'Flank|GEMIN7_ENST00000391951.2_Missense_Mutation_p.R30L|CTB-179K24.3_ENST00000586556.1_RNA|PPP1R37_ENST00000421905.1_5'Flank|GEMIN7_ENST00000591607.1_Missense_Mutation_p.R30L|GEMIN7_ENST00000591747.1_Missense_Mutation_p.R30L|CTB-179K24.3_ENST00000586744.1_RNA	NM_001007269.1|NM_001007270.1|NM_024707.2	NP_001007270.1|NP_001007271.1|NP_078983.1	Q9H840	GEMI7_HUMAN	gem (nuclear organelle) associated protein 7	30					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				endometrium(1)|kidney(1)|lung(4)|ovary(1)	7		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0131)		CCTGATGGACGCAGAGCCCCC	0.622																																					p.R30L		Atlas-SNP	.											GEMIN7,right_lower_lobe,carcinoma,0,1	GEMIN7	18	.	0			c.G89T						PASS	.						60.0	63.0	62.0					19																	45593461		2203	4300	6503	SO:0001583	missense	79760	exon3			ATGGACGCAGAGC	AK024018	CCDS12654.1	19q13.32	2008-02-05				ENSG00000142252			20045	protein-coding gene	gene with protein product		607419				12065586	Standard	NM_024707		Approved	FLJ13956	uc002pap.1	Q9H840		ENST00000270257.4:c.89G>T	chr19.hg19:g.45593461G>T	ENSP00000270257:p.Arg30Leu	66.0	0.0	.		71.0	3.0	.	NM_024707	Q6IA34	Missense_Mutation	SNP	ENST00000270257.4	hg19	CCDS12654.1	.	.	.	.	.	.	.	.	.	.	G	8.438	0.850206	0.17034	.	.	ENSG00000142252	ENST00000270257;ENST00000391951	.	.	.	4.33	3.19	0.36642	.	0.062984	0.64402	D	0.000006	T	0.47040	0.1424	L	0.51422	1.61	0.80722	D	1	B	0.31519	0.327	B	0.30572	0.117	T	0.41324	-0.9515	9	0.26408	T	0.33	0.2346	10.1352	0.42701	0.0:0.332:0.668:0.0	.	30	Q9H840	GEMI7_HUMAN	L	30	.	ENSP00000270257:R30L	R	+	2	0	GEMIN7	50285301	0.995000	0.38212	0.995000	0.50966	0.373000	0.29922	1.634000	0.37123	2.357000	0.79964	0.555000	0.69702	CGC	.	.	.	none		0.622	GEMIN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457533.1		
TP53RK	112858	hgsc.bcm.edu	37	20	45315710	45315710	+	3'UTR	SNP	C	C	T			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr20:45315710C>T	ENST00000372102.3	-	0	474				RP1-28H20.3_ENST00000606362.1_lincRNA			Q96S44	PRPK_HUMAN	TP53 regulating kinase						lipopolysaccharide biosynthetic process (GO:0009103)|protein phosphorylation (GO:0006468)|tRNA processing (GO:0008033)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|hydrolase activity (GO:0016787)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|large_intestine(1)|lung(4)|skin(1)	7		Myeloproliferative disorder(115;0.0122)				GAGCCAAAACCTGCCCAATTG	0.478																																					p.Q148Q		Atlas-SNP	.											.	TP53RK	13	.	0			c.G444A						PASS	.						138.0	152.0	147.0					20																	45315710		2203	4300	6503	SO:0001624	3_prime_UTR_variant	112858	exon2			CAAAACCTGCCCA		CCDS13401.1	20q13.2	2014-05-14	2004-05-10	2004-05-12	ENSG00000172315	ENSG00000172315			16197	protein-coding gene	gene with protein product		608679	"""chromosome 20 open reading frame 64"""	C20orf64		11546806, 12914926	Standard	NM_033550		Approved	dJ101A2.2, prpk, Nori-2p, BUD32	uc002xsk.3	Q96S44	OTTHUMG00000085887	ENST00000372102.3:c.*83G>A	chr20.hg19:g.45315710C>T		92.0	0.0	.		149.0	15.0	.	NM_033550	B3KU44|Q3T977|Q5JZ01|Q6NZ60|Q96FM7|Q9NQE6	Silent	SNP	ENST00000372102.3	hg19																																																																																				.	.	.	none		0.478	TP53RK-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000193688.1	NM_033550	
DOK5	55816	hgsc.bcm.edu	37	20	53205106	53205106	+	Missense_Mutation	SNP	G	G	A			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr20:53205106G>A	ENST00000262593.5	+	3	609	c.259G>A	c.(259-261)Gat>Aat	p.D87N	DOK5_ENST00000395939.1_5'UTR	NM_018431.3	NP_060901.2	Q9P104	DOK5_HUMAN	docking protein 5	87	PH.				MAPK cascade (GO:0000165)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)		receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|skin(1)	19			Colorectal(105;0.202)			TTTCAATGACGATACCTCCAA	0.418																																					p.D87N		Atlas-SNP	.											.	DOK5	54	.	0			c.G259A						PASS	.						156.0	150.0	152.0					20																	53205106		2203	4300	6503	SO:0001583	missense	55816	exon3			AATGACGATACCT	AF132732	CCDS13446.1, CCDS13447.1	20q13.2	2013-01-10	2002-11-28	2002-11-29	ENSG00000101134	ENSG00000101134		"""Pleckstrin homology (PH) domain containing"""	16173	protein-coding gene	gene with protein product		608334	"""chromosome 20 open reading frame 180"""	C20orf180		11470823	Standard	XM_005260451		Approved	dJ805C22.1	uc002xwy.3	Q9P104	OTTHUMG00000032778	ENST00000262593.5:c.259G>A	chr20.hg19:g.53205106G>A	ENSP00000262593:p.Asp87Asn	159.0	0.0	.		186.0	20.0	.	NM_018431	Q5T7Y0|Q5TE53|Q8TEW7|Q96H13|Q9BZ24|Q9NQF4|Q9Y411	Missense_Mutation	SNP	ENST00000262593.5	hg19	CCDS13446.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.006212	0.54361	.	.	ENSG00000101134	ENST00000262593	D	0.86164	-2.08	5.61	5.61	0.85477	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.044516	0.85682	D	0.000000	T	0.80571	0.4648	L	0.43152	1.355	0.80722	D	1	P	0.39250	0.665	B	0.24155	0.051	T	0.79374	-0.1830	10	0.25106	T	0.35	-18.4349	18.9956	0.92812	0.0:0.0:1.0:0.0	.	87	Q9P104	DOK5_HUMAN	N	87	ENSP00000262593:D87N	ENSP00000262593:D87N	D	+	1	0	DOK5	52638513	1.000000	0.71417	0.372000	0.25991	0.707000	0.40811	4.931000	0.63469	2.807000	0.96579	0.557000	0.71058	GAT	.	.	.	none		0.418	DOK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079777.2		
KDELR3	11015	hgsc.bcm.edu	37	22	38882032	38882032	+	IGR	SNP	G	G	T			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr22:38882032G>T	ENST00000216014.4	+	0	1728				DDX17_ENST00000396821.3_Missense_Mutation_p.P702T|DDX17_ENST00000381633.3_Missense_Mutation_p.P623T|DDX17_ENST00000444597.1_Missense_Mutation_p.P152T	NM_006855.2	NP_006846.1	O43731	ERD23_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein retention in ER lumen (GO:0006621)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ER retention sequence binding (GO:0046923)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13	Melanoma(58;0.0286)					GCTCCCGGAGGCTGTGCAAAC	0.547																																					p.P702T	Ovarian(11;103 529 24120 28493 32980)	Atlas-SNP	.											.	DDX17	73	.	0			c.C2104A						PASS	.						170.0	154.0	160.0					22																	38882032		2203	4300	6503	SO:0001628	intergenic_variant	10521	exon13			CCGGAGGCTGTGC	AL035081	CCDS13972.1, CCDS46705.1	22q13	2008-05-02			ENSG00000100196	ENSG00000100196			6306	protein-coding gene	gene with protein product							Standard	NM_006855		Approved		uc003avu.3	O43731	OTTHUMG00000153520		chr22.hg19:g.38882032G>T		99.0	0.0	.		128.0	14.0	.	NM_001098504	A8K7T7|B8ZZ26|O95557|Q4V750|Q4V767|Q53FP4|Q53GK1	Missense_Mutation	SNP	ENST00000216014.4	hg19	CCDS13972.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756221	0.49362	.	.	ENSG00000100201	ENST00000396821;ENST00000381633;ENST00000415748;ENST00000444597;ENST00000403230;ENST00000404499	T;T;T	0.27104	1.71;1.73;1.69	5.42	5.42	0.78866	.	0.214763	0.37577	N	0.002024	T	0.37019	0.0988	N	0.24115	0.695	0.58432	D	0.999996	P;P;D	0.71674	0.798;0.872;0.998	B;P;D	0.64687	0.284;0.476;0.928	T	0.08889	-1.0700	10	0.36615	T	0.2	-9.9176	19.2201	0.93793	0.0:0.0:1.0:0.0	.	704;700;154	Q59F66;Q92841-4;Q9UQL5	.;.;.	T	702;623;154;152;700;704	ENSP00000380033:P702T;ENSP00000371046:P623T;ENSP00000385536:P700T	ENSP00000371046:P623T	P	-	1	0	DDX17	37211978	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.900000	0.75687	2.524000	0.85096	0.655000	0.94253	CCT	.	.	.	none		0.547	KDELR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331474.1		
RBM10	8241	hgsc.bcm.edu	37	X	47044733	47044733	+	Missense_Mutation	SNP	G	G	C			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chrX:47044733G>C	ENST00000377604.3	+	19	2875	c.2133G>C	c.(2131-2133)atG>atC	p.M711I	RBM10_ENST00000345781.6_Missense_Mutation_p.M634I|RBM10_ENST00000329236.7_Missense_Mutation_p.M633I	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	711					3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						ACACCAGCATGGATCTCCCGA	0.632																																					p.M776I	Melanoma(171;120 2705 19495 39241)	Atlas-SNP	.											.	RBM10	117	.	0			c.G2328C						PASS	.						37.0	34.0	35.0					X																	47044733		2203	4300	6503	SO:0001583	missense	8241	exon19			CAGCATGGATCTC	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.2133G>C	chrX.hg19:g.47044733G>C	ENSP00000366829:p.Met711Ile	77.0	0.0	.		72.0	18.0	.	NM_001204468	C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Missense_Mutation	SNP	ENST00000377604.3	hg19	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	G	8.375	0.836295	0.16891	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	T;T;T	0.18174	2.91;2.23;2.5	5.63	5.63	0.86233	.	0.213638	0.43579	D	0.000543	T	0.16514	0.0397	L	0.48642	1.525	0.32547	N	0.532888	B;B;B;B;B	0.06786	0.001;0.001;0.0;0.0;0.0	B;B;B;B;B	0.10450	0.003;0.005;0.005;0.002;0.002	T	0.10776	-1.0615	10	0.17369	T	0.5	-11.0981	14.1672	0.65486	0.0:0.0:1.0:0.0	.	634;776;710;633;711	P98175-3;Q7Z3D7;P98175-2;P98175-4;P98175	.;.;.;.;RBM10_HUMAN	I	711;633;634	ENSP00000366829:M711I;ENSP00000328848:M633I;ENSP00000329659:M634I	ENSP00000328848:M633I	M	+	3	0	RBM10	46929677	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.567000	0.53813	2.509000	0.84616	0.600000	0.82982	ATG	.	.	.	none		0.632	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676	
CLIP2	7461	hgsc.bcm.edu	37	7	73791021	73791021	+	Frame_Shift_Del	DEL	T	T	-			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr7:73791021delT	ENST00000395060.1	+	9	2290	c.2290delT	c.(2290-2292)ttgfs	p.L764fs	CLIP2_ENST00000361545.5_Frame_Shift_Del_p.L729fs|CLIP2_ENST00000223398.6_Frame_Shift_Del_p.L764fs			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	764						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						GAAGAAGATGTTGGACTACGA	0.612																																					p.M763fs		Atlas-INDEL	.											.	CLIP2	134	.	0			c.2289delG						PASS	.						29.0	34.0	32.0					7																	73791021		2203	4300	6503	SO:0001589	frameshift_variant	7461	exon10			.	AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.2290delT	chr7.hg19:g.73791021delT	ENSP00000378500:p.Leu764fs	204.0	0.0	0		185.0	16.0	0.0864865	NM_003388	O14527|O43611	Frame_Shift_Del	DEL	ENST00000395060.1	hg19	CCDS5569.1																																																																																			.	.	.	none		0.612	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252556.1	NM_003388	
BRAF	673	hgsc.bcm.edu	37	7	140507773	140507774	+	Frame_Shift_Ins	INS	-	-	T			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr7:140507773_140507774insT	ENST00000288602.6	-	5	757_758	c.697_698insA	c.(697-699)acafs	p.T233fs		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	233					activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	GTTGTGTGTTGTAAGTGGAACA	0.312		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												p.T233fs	Colon(40;35 892 2973 5743 27438)	Atlas-INDEL	.		Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	.	BRAF	36346	.	0			c.698_699insA						PASS	.																																			SO:0001589	frameshift_variant	673	exon5	Familial Cancer Database	CFC, CFCS	.	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.698dupA	chr7.hg19:g.140507774_140507774dupT	ENSP00000288602:p.Thr233fs	90.0	0.0	0		90.0	10.0	0.111111	NM_004333	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Frame_Shift_Ins	INS	ENST00000288602.6	hg19	CCDS5863.1																																																																																			.	.	.	none		0.312	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333	
SPOCK3	50859	hgsc.bcm.edu	37	4	167810344	167810344	+	Frame_Shift_Del	DEL	A	A	-			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr4:167810344delA	ENST00000357154.3	-	7	672	c.535delT	c.(535-537)tgtfs	p.C179fs	SPOCK3_ENST00000511531.1_Frame_Shift_Del_p.C179fs|SPOCK3_ENST00000541354.1_Frame_Shift_Del_p.C59fs|SPOCK3_ENST00000504953.1_Frame_Shift_Del_p.C176fs|SPOCK3_ENST00000421836.2_Frame_Shift_Del_p.C128fs|SPOCK3_ENST00000502330.1_Frame_Shift_Del_p.C179fs|SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000357545.4_Frame_Shift_Del_p.C176fs|SPOCK3_ENST00000511269.1_Frame_Shift_Del_p.C176fs|SPOCK3_ENST00000512681.1_Frame_Shift_Del_p.C81fs|SPOCK3_ENST00000534949.1_Frame_Shift_Del_p.C83fs|SPOCK3_ENST00000506886.1_Frame_Shift_Del_p.C179fs|SPOCK3_ENST00000541637.1_Frame_Shift_Del_p.C81fs|SPOCK3_ENST00000510741.1_Frame_Shift_Del_p.C176fs|SPOCK3_ENST00000512648.1_Frame_Shift_Del_p.C176fs|SPOCK3_ENST00000535728.1_Frame_Shift_Del_p.C87fs	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3	179	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		TGTCCTTCACATTTGACTGAG	0.318																																					p.C179fs		Atlas-Indel,Pindel	.											.	SPOCK3	90	.	0			c.536delG						PASS	.						126.0	121.0	123.0					4																	167810344		2203	4300	6503	SO:0001589	frameshift_variant	50859	exon7			.	AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.535delT	chr4.hg19:g.167810344delA	ENSP00000349677:p.Cys179fs	131.0	0.0	0		164.0	27.0	0.164634	NM_016950	B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	Frame_Shift_Del	DEL	ENST00000357154.3	hg19	CCDS54817.1																																																																																			.	.	.	none		0.318	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364091.1		
S1PR3	1903	hgsc.bcm.edu	37	9	91616360	91616361	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr9:91616360_91616361delCT	ENST00000375846.3	+	1	4940_4941	c.245_246delCT	c.(244-246)gctfs	p.A82fs	S1PR3_ENST00000358157.2_Frame_Shift_Del_p.A82fs			Q99500	S1PR3_HUMAN	sphingosine-1-phosphate receptor 3	82					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|anatomical structure morphogenesis (GO:0009653)|cytokine production (GO:0001816)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of establishment of endothelial barrier (GO:1903141)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of interleukin-1 beta production (GO:0032651)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(1)	34						GGCAACCTGGCTCTCTGCGACC	0.495											OREG0019291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.82_82del		Atlas-Indel,Pindel	.											.	S1PR3	49	.	0			c.244_245del						PASS	.																																			SO:0001589	frameshift_variant	1903	exon2			.	AF022139	CCDS6680.1	9q22.1-q22.2	2012-08-08	2008-04-30	2008-04-30	ENSG00000213694	ENSG00000213694		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3167	protein-coding gene	gene with protein product	"""sphingosine-1-phosphate receptor 3"""	601965	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 3"""	EDG3		8878560, 9409733	Standard	NM_005226		Approved	EDG-3	uc004aqe.4	Q99500	OTTHUMG00000020173	ENST00000375846.3:c.245_246delCT	chr9.hg19:g.91616364_91616365delCT	ENSP00000365006:p.Ala82fs	114.0	0.0	0	1283	138.0	14.0	0.101449	NM_005226	Q5SQD8|Q7Z5I2	Frame_Shift_Del	DEL	ENST00000375846.3	hg19	CCDS6680.1																																																																																			.	.	.	none		0.495	S1PR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052979.2	NM_005226	
SPTA1	6708	hgsc.bcm.edu	37	1	158615036	158615047	+	In_Frame_Del	DEL	TCATCTCTCTCT	TCATCTCTCTCT	-			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	TCATCTCTCTCT	TCATCTCTCTCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr1:158615036_158615047delTCATCTCTCTCT	ENST00000368147.4	-	29	4305_4316	c.4125_4136delAGAGAGAGATGA	c.(4123-4137)ctagagagagatgat>ctt	p.ERDD1376del		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1376					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTTCTCCAAATCATCTCTCTCTAGCTTGACAG	0.472																																					p.1376_1379del		Atlas-Indel,Pindel	.											.	SPTA1	720	.	0			c.4126_4137del						PASS	.																																			SO:0001651	inframe_deletion	6708	exon29			.	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4125_4136delAGAGAGAGATGA	chr1.hg19:g.158615036_158615047delTCATCTCTCTCT	ENSP00000357129:p.Glu1376_Asp1379del	95.0	0.0	0		78.0	13.0	0.166667	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	In_Frame_Del	DEL	ENST00000368147.4	hg19	CCDS41423.1																																																																																			.	.	.	none		0.472	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
RNF39	80352	hgsc.bcm.edu	37	6	30039171	30039172	+	Frame_Shift_Ins	INS	-	-	T			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr6:30039171_30039172insT	ENST00000244360.6	-	4	1076_1077	c.979_980insA	c.(979-981)aggfs	p.R327fs	RNF39_ENST00000376751.3_Intron	NM_025236.3	NP_079512.2	Q9H2S5	RNF39_HUMAN	ring finger protein 39	327	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										AGGGCACAGCCTTACGCAGCCC	0.718																																					p.R327fs	NSCLC(8;188 360 1520 20207 31481)	Atlas-INDEL	.											.	RNF39	27	.	0			c.980_981insA						PASS	.																																			SO:0001589	frameshift_variant	80352	exon4			.	AF238315	CCDS4673.1, CCDS4674.1	6p21.3	2013-01-09			ENSG00000204618	ENSG00000204618		"""RING-type (C3HC4) zinc fingers"""	18064	protein-coding gene	gene with protein product		607524				11130983, 11716498	Standard	NM_170769		Approved	HZFw1, LIRF	uc003npe.3	Q9H2S5	OTTHUMG00000031288	ENST00000244360.6:c.980dupA	chr6.hg19:g.30039173_30039173dupT	ENSP00000244360:p.Arg327fs	67.0	0.0	0		61.0	10.0	0.163934	NM_025236	A2BEK3|A6NCD6|B0S858|Q5SPM8|Q5SPM9|Q5SPN0|Q5SRJ9|Q5SRK1|Q5SS29|Q9H2S3|Q9H2S4	Frame_Shift_Ins	INS	ENST00000244360.6	hg19	CCDS4673.1																																																																																			.	.	.	none		0.718	RNF39-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076625.3	NM_170769	
GNA13	10672	hgsc.bcm.edu	37	17	63049759	63049759	+	Frame_Shift_Del	DEL	G	G	-			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr17:63049759delG	ENST00000439174.2	-	2	616	c.371delC	c.(370-372)tcgfs	p.S124fs	GNA13_ENST00000541118.1_Frame_Shift_Del_p.S29fs|RP11-583F2.5_ENST00000581796.1_RNA	NM_006572.4	NP_006563.2	Q14344	GNA13_HUMAN	guanine nucleotide binding protein (G protein), alpha 13	124					activation of phospholipase D activity (GO:0031584)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|in utero embryonic development (GO:0001701)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	D5 dopamine receptor binding (GO:0031752)|G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 1 angiotensin receptor binding (GO:0031702)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(14)|kidney(2)|large_intestine(4)|lung(6)|urinary_tract(1)	34						GGTATCAAACGACATCATCTT	0.468																																					p.S124fs		Atlas-INDEL	.											.	GNA13	69	.	0			c.372delG						PASS	.						148.0	144.0	146.0					17																	63049759		2203	4300	6503	SO:0001589	frameshift_variant	10672	exon2			.	L22075	CCDS11661.1, CCDS62302.1	17q24.1	2014-09-04			ENSG00000120063	ENSG00000120063			4381	protein-coding gene	gene with protein product		604406				7791744	Standard	NM_006572		Approved	G13, MGC46138	uc002jfc.3	Q14344	OTTHUMG00000179316	ENST00000439174.2:c.371delC	chr17.hg19:g.63049759delG	ENSP00000400717:p.Ser124fs	106.0	0.0	0		122.0	12.0	0.0983607	NM_006572	B2R977|B7Z7R0|F5H1G8|Q8TD70	Frame_Shift_Del	DEL	ENST00000439174.2	hg19	CCDS11661.1																																																																																			.	.	.	none		0.468	GNA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445720.1	NM_006572	
MNDA	4332	hgsc.bcm.edu	37	1	158815387	158815387	+	Frame_Shift_Del	DEL	C	C	-			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr1:158815387delC	ENST00000368141.4	+	5	842	c.581delC	c.(580-582)accfs	p.T194fs		NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	194					B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					AATCAGGAAACCCAGGCCCAA	0.512																																					p.T194fs		Atlas-Indel,Pindel	.											MNDA,NS,carcinoma,0,1	MNDA	147	.	0			c.580delA						PASS	.						43.0	44.0	44.0					1																	158815387		2203	4300	6503	SO:0001589	frameshift_variant	4332	exon5			.	BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.581delC	chr1.hg19:g.158815387delC	ENSP00000357123:p.Thr194fs	255.0	0.0	0		338.0	31.0	0.091716	NM_002432		Frame_Shift_Del	DEL	ENST00000368141.4	hg19	CCDS1177.1																																																																																			.	.	.	none		0.512	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059069.1	NM_002432	
TARBP1	6894	hgsc.bcm.edu	37	1	234541785	234541786	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr1:234541785_234541786insAA	ENST00000040877.1	-	24	3851_3852	c.3852_3853insTT	c.(3850-3855)tttagtfs	p.S1285fs	TARBP1_ENST00000483404.1_5'UTR	NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1285					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			AGTCGAACACTAAAATTGTGAT	0.381																																					p.S1285fs		Atlas-Indel,Pindel	.											.	TARBP1	111	.	0			c.3853_3854insTT						PASS	.																																			SO:0001589	frameshift_variant	6894	exon24			.		CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.3851_3852dupTT	chr1.hg19:g.234541788_234541789dupAA	ENSP00000040877:p.Ser1285fs	324.0	0.0	0		383.0	46.0	0.120104	NM_005646	Q9H581	Frame_Shift_Ins	INS	ENST00000040877.1	hg19	CCDS1601.1																																																																																			.	.	.	none		0.381	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092616.1	NM_005646	
ERRFI1	54206	hgsc.bcm.edu	37	1	8073471	8073472	+	Frame_Shift_Ins	INS	-	-	A			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr1:8073471_8073472insA	ENST00000377482.5	-	4	1410_1411	c.1187_1188insT	c.(1186-1188)ctafs	p.L396fs	ERRFI1_ENST00000474874.1_Intron	NM_018948.3	NP_061821.1	Q9UJM3	ERRFI_HUMAN	ERBB receptor feedback inhibitor 1	396					lung alveolus development (GO:0048286)|lung epithelium development (GO:0060428)|lung vasculature development (GO:0060426)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of protein autophosphorylation (GO:0031953)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of keratinocyte differentiation (GO:0045616)|response to stress (GO:0006950)|skin morphogenesis (GO:0043589)	cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(2)|large_intestine(3)|liver(3)|lung(3)|ovary(1)|prostate(1)|skin(2)	16	Ovarian(185;0.06)|all_lung(157;0.151)	all_epithelial(116;1.76e-16)|all_lung(118;3.66e-05)|Lung NSC(185;0.000163)|Renal(390;0.000469)|Colorectal(325;0.0033)|Breast(348;0.0044)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.33e-70)|GBM - Glioblastoma multiforme(8;8.05e-37)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;6.9e-06)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.000985)|READ - Rectum adenocarcinoma(331;0.0642)		GTTCAGGTAGTAGGTAATAATG	0.431																																					p.L396fs		Atlas-Indel,Pindel	.											.	ERRFI1	42	.	0			c.1188_1189insT						PASS	.																																			SO:0001589	frameshift_variant	54206	exon4			.	BC025337	CCDS94.1	1p36.23	2008-02-05			ENSG00000116285	ENSG00000116285			18185	protein-coding gene	gene with protein product		608069				10749885, 2780291, 12226756, 11003669	Standard	NM_018948		Approved	MIG-6, GENE-33, RALT	uc001aoz.3	Q9UJM3	OTTHUMG00000001221	ENST00000377482.5:c.1188dupT	chr1.hg19:g.8073472_8073472dupA	ENSP00000366702:p.Leu396fs	161.0	0.0	0		181.0	21.0	0.116022	NM_018948	B2RDX9|Q9NTG9|Q9UD05	Frame_Shift_Ins	INS	ENST00000377482.5	hg19	CCDS94.1																																																																																			.	.	.	none		0.431	ERRFI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003617.1	NM_018948	
ZNF226	7769	hgsc.bcm.edu	37	19	44680079	44680102	+	In_Frame_Del	DEL	AAATCTTATAGACCCAATGATTAT	AAATCTTATAGACCCAATGATTAT	-	rs376461816|rs371556470|rs533087898	byFrequency	TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	AAATCTTATAGACCCAATGATTAT	AAATCTTATAGACCCAATGATTAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr19:44680079_44680102delAAATCTTATAGACCCAATGATTAT	ENST00000590089.1	+	7	1031_1054	c.664_687delAAATCTTATAGACCCAATGATTAT	c.(664-687)aaatcttatagacccaatgattatdel	p.KSYRPNDY222del	ZNF226_ENST00000454662.2_In_Frame_Del_p.KSYRPNDY222del|ZNF226_ENST00000588883.1_3'UTR|ZNF226_ENST00000337433.5_In_Frame_Del_p.KSYRPNDY222del			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	222					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)						Prostate(69;0.0352)|all_neural(266;0.202)				CAAAAGTGAAAAATCTTATAGACCCAATGATTATGAAAAAGACA	0.339																																					p.221_229del	Pancreas(115;581 1665 13228 19278 50070)	Pindel	.											.	.	.	.	0			c.663_686del						PASS	.																																			SO:0001651	inframe_deletion	7769	exon6			.	AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.664_687delAAATCTTATAGACCCAATGATTAT	chr19.hg19:g.44680079_44680102delAAATCTTATAGACCCAATGATTAT	ENSP00000465121:p.Lys222_Tyr229del	75.0	0.0	.		87.0	10.0	0.115	NM_001032372	Q8WWE6|Q96TE6|Q9NS44	In_Frame_Del	DEL	ENST00000590089.1	hg19	CCDS46102.1																																																																																			.	.	.	none		0.339	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460712.1		
CLIP2	7461	hgsc.bcm.edu	37	7	73791021	73791022	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-WN-A9G9-01A-12D-A36X-10	TCGA-WN-A9G9-10A-01D-A370-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e78e2342-adb4-4c7b-96ae-4e2ccb668d49	394f018a-b0e0-40a9-afd2-2a1a4f552485	g.chr7:73791021_73791022delTT	ENST00000395060.1	+	9	2290_2291	c.2290_2291delTT	c.(2290-2292)ttgfs	p.L764fs	CLIP2_ENST00000361545.5_Frame_Shift_Del_p.L729fs|CLIP2_ENST00000223398.6_Frame_Shift_Del_p.L764fs			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	764						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						GAAGAAGATGTTGGACTACGAG	0.614																																					p.763_764del		Pindel	.											.	CLIP2	134	.	0			c.2289_2290del						PASS	.																																			SO:0001589	frameshift_variant	7461	exon10			.	AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.2290_2291delTT	chr7.hg19:g.73791021_73791022delTT	ENSP00000378500:p.Leu764fs	206.0	0.0	.		189.0	11.0	0.058	NM_003388	O14527|O43611	Frame_Shift_Del	DEL	ENST00000395060.1	hg19	CCDS5569.1																																																																																			.	.	.	none		0.614	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252556.1	NM_003388	
