#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MMEL1	79258	hgsc.bcm.edu	37	1	2560821	2560821	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr1:2560821G>C	ENST00000378412.3	-	2	264	c.103C>G	c.(103-105)Ctg>Gtg	p.L35V	MMEL1_ENST00000511099.1_5'Flank|MMEL1_ENST00000502556.1_Missense_Mutation_p.L35V|MMEL1_ENST00000288709.6_Missense_Mutation_p.L26V			Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	35						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|urinary_tract(1)	27	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		GCGGTCACcagcagcagcagc	0.741																																					p.L35V		Atlas-SNP	.											.	MMEL1	64	.	0			c.C103G						PASS	.						11.0	12.0	12.0					1																	2560821		1935	3820	5755	SO:0001583	missense	79258	exon2			TCACCAGCAGCAG	AF336981	CCDS30569.1, CCDS30569.2	1p36	2008-02-05			ENSG00000142606	ENSG00000142606			14668	protein-coding gene	gene with protein product			"""membrane metallo-endopeptidase-like 2"""	MMEL2			Standard	NM_033467		Approved	SEP, NL1, NL2, NEPII	uc001ajy.2	Q495T6	OTTHUMG00000000846	ENST00000378412.3:c.103C>G	chr1.hg19:g.2560821G>C	ENSP00000367668:p.Leu35Val	137.0	0.0	.		211.0	10.0	.	NM_033467	B9DI79|Q495T7|Q495T8|Q5SZS6|Q96PH9	Missense_Mutation	SNP	ENST00000378412.3	hg19	CCDS30569.2	.	.	.	.	.	.	.	.	.	.	g	11.62	1.692616	0.30052	.	.	ENSG00000142606	ENST00000378411;ENST00000288709;ENST00000378412;ENST00000502556	D;D;D	0.91295	-1.94;-2.1;-2.82	3.02	2.09	0.27110	.	0.745425	0.11907	N	0.518068	D	0.91199	0.7227	L	0.47016	1.485	0.36062	D	0.84151	D	0.69078	0.997	D	0.78314	0.991	D	0.86623	0.1880	10	0.19590	T	0.45	-17.4114	6.0244	0.19646	0.1499:0.0:0.8501:0.0	.	35	Q495T6	MMEL1_HUMAN	V	35;26;35;35	ENSP00000288709:L26V;ENSP00000367668:L35V;ENSP00000422492:L35V	ENSP00000288709:L26V	L	-	1	2	MMEL1	2550681	0.981000	0.34729	0.993000	0.49108	0.754000	0.42855	4.457000	0.60088	0.604000	0.29930	0.455000	0.32223	CTG	.	.	.	none		0.741	MMEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002395.2	NM_033467	
RNF19B	127544	hgsc.bcm.edu	37	1	33429684	33429684	+	Silent	SNP	G	G	T	rs369366328	byFrequency	TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr1:33429684G>T	ENST00000373456.7	-	1	602	c.603C>A	c.(601-603)ccC>ccA	p.P201P	RNF19B_ENST00000235150.4_Silent_p.P201P|RNF19B_ENST00000356990.5_Silent_p.P201P	NM_153341.2	NP_699172.2	Q6ZMZ0	RN19B_HUMAN	ring finger protein 19B	201					interferon-gamma secretion (GO:0072643)|natural killer cell mediated cytotoxicity (GO:0042267)|protein ubiquitination (GO:0016567)	cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)	13		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				AGCGGCAGTCGGGGTCCGAGG	0.736																																					p.P201P		Atlas-SNP	.											.	RNF19B	43	.	0			c.C603A						PASS	.						15.0	12.0	13.0					1																	33429684		1776	3352	5128	SO:0001819	synonymous_variant	127544	exon1			GCAGTCGGGGTCC	AK074486	CCDS372.2, CCDS44107.1, CCDS72754.1	1p35.1	2010-05-11	2007-08-20	2007-08-20	ENSG00000116514	ENSG00000116514		"""RING-type (C3HC4) zinc fingers"""	26886	protein-coding gene	gene with protein product		610872	"""IBR domain containing 3"""	IBRDC3		12477932	Standard	XM_006710356		Approved	FLJ90005	uc010oho.2	Q6ZMZ0	OTTHUMG00000004013	ENST00000373456.7:c.603C>A	chr1.hg19:g.33429684G>T		85.0	0.0	.		94.0	44.0	.	NM_001127361	B7ZLB2|E9PAW6|G3XA82|Q0VG77|Q5TH44|Q5TH45|Q6P6A4|Q8N2S8|Q8WUF3	Silent	SNP	ENST00000373456.7	hg19	CCDS372.2																																																																																			.	.	.	none		0.736	RNF19B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011465.3	NM_153341	
MOV10	4343	hgsc.bcm.edu	37	1	113237494	113237494	+	Silent	SNP	C	C	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr1:113237494C>A	ENST00000413052.2	+	10	1986	c.1596C>A	c.(1594-1596)gtC>gtA	p.V532V	MOV10_ENST00000468624.1_3'UTR|MOV10_ENST00000369644.1_Silent_p.V476V|RP11-426L16.3_ENST00000421943.1_RNA|MOV10_ENST00000369645.1_Silent_p.V532V|MOV10_ENST00000357443.2_Silent_p.V532V	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	532					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		GCAAGACTGTCACGTTAGTGG	0.582																																					p.V532V		Atlas-SNP	.											.	MOV10	74	.	0			c.C1596A						PASS	.						58.0	53.0	55.0					1																	113237494		2203	4300	6503	SO:0001819	synonymous_variant	4343	exon10			GACTGTCACGTTA	AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.1596C>A	chr1.hg19:g.113237494C>A		139.0	0.0	.		202.0	86.0	.	NM_020963	Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	Silent	SNP	ENST00000413052.2	hg19	CCDS853.1																																																																																			.	.	.	none		0.582	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032906.1	NM_020963	
LCE4A	199834	hgsc.bcm.edu	37	1	152681689	152681689	+	Silent	SNP	G	G	C	rs200223098	byFrequency	TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr1:152681689G>C	ENST00000368777.1	+	2	394	c.138G>C	c.(136-138)ggG>ggC	p.G46G	LCE4A_ENST00000335535.3_Silent_p.G46G			Q5TA78	LCE4A_HUMAN	late cornified envelope 4A	46	Cys-rich.				keratinization (GO:0031424)					endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.116)			CCAGCTCTGGGGGCTGTGGTT	0.577													G|||	245	0.0489217	0.003	0.0821	5008	,	,		16464	0.129		0.0109	False		,,,				2504	0.044				p.G46G		Atlas-SNP	.											.,2	LCE4A	37	.	0			c.G138C						PASS	.						81.0	94.0	90.0					1																	152681689		2203	4300	6503	SO:0001819	synonymous_variant	199834	exon1			CTCTGGGGGCTGT	BI670517	CCDS1022.1	1q22	2008-02-05	2004-10-11	2004-10-15	ENSG00000187170	ENSG00000187170		"""Late cornified envelopes"""	16613	protein-coding gene	gene with protein product		612618	"""small proline rich-like (epidermal differentiation complex) 4A"""	SPRL4A		11698679	Standard	NM_178356		Approved	LEP8	uc001fak.2	Q5TA78	OTTHUMG00000014394	ENST00000368777.1:c.138G>C	chr1.hg19:g.152681689G>C		132.0	0.0	.		241.0	66.0	.	NM_178356	Q14D97	Silent	SNP	ENST00000368777.1	hg19	CCDS1022.1																																																																																			.	G|0.999;C|0.001	0.001	weak		0.577	LCE4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040048.1	NM_178356	
RGS4	5999	hgsc.bcm.edu	37	1	163039075	163039075	+	5'UTR	SNP	G	G	C			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr1:163039075G>C	ENST00000367909.6	+	0	141				RGS4_ENST00000531057.1_5'Flank|RGS4_ENST00000367908.4_5'Flank|RGS4_ENST00000421743.2_Missense_Mutation_p.G31A|RGS4_ENST00000367906.3_5'Flank|RGS4_ENST00000527809.1_5'Flank	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4						inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						AGAGGAGCTGGTACTGCAGAG	0.517											OREG0013952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G31A	Ovarian(76;1257 1738 3039 6086)	Atlas-SNP	.											.	RGS4	97	.	0			c.G92C						PASS	.						13.0	17.0	15.0					1																	163039075		1269	2285	3554	SO:0001623	5_prime_UTR_variant	5999	exon2			GAGCTGGTACTGC	BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.-200G>C	chr1.hg19:g.163039075G>C		141.0	0.0	.	1828	231.0	105.0	.	NM_001102445	A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Missense_Mutation	SNP	ENST00000367909.6	hg19	CCDS1243.1	.	.	.	.	.	.	.	.	.	.	G	17.42	3.384567	0.61845	.	.	ENSG00000117152	ENST00000421743	T	0.60548	0.18	4.35	2.27	0.28462	.	.	.	.	.	T	0.15522	0.0374	N	0.08118	0	0.20403	N	0.999902	B	0.22800	0.075	B	0.17433	0.018	T	0.05194	-1.0900	8	0.87932	D	0	.	5.0814	0.14659	0.3474:0.0:0.6526:0.0	.	31	A7XA59	.	A	31	ENSP00000397181:G31A	ENSP00000397181:G31A	G	+	2	0	RGS4	161305699	0.000000	0.05858	0.000000	0.03702	0.655000	0.38815	0.346000	0.19997	0.424000	0.26061	0.563000	0.77884	GGT	.	.	.	none		0.517	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083197.2	NM_005613	
GREB1	9687	hgsc.bcm.edu	37	2	11725936	11725936	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr2:11725936C>T	ENST00000381486.2	+	9	1364	c.1064C>T	c.(1063-1065)gCt>gTt	p.A355V	GREB1_ENST00000381483.2_Missense_Mutation_p.A355V|GREB1_ENST00000234142.5_Missense_Mutation_p.A355V|RN7SL674P_ENST00000463397.2_RNA|GREB1_ENST00000263834.5_Missense_Mutation_p.A355V	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	355						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GTGGGACCAGCTTCAGTCACC	0.507																																					p.A355V	Ovarian(39;850 945 2785 23371 33093)	Atlas-SNP	.											.	GREB1	308	.	0			c.C1064T						PASS	.						95.0	83.0	87.0					2																	11725936		2203	4300	6503	SO:0001583	missense	9687	exon9			GACCAGCTTCAGT		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.1064C>T	chr2.hg19:g.11725936C>T	ENSP00000370896:p.Ala355Val	133.0	0.0	.		178.0	79.0	.	NM_148903	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	hg19	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	C	19.08	3.757093	0.69648	.	.	ENSG00000196208	ENST00000381486;ENST00000263834;ENST00000381483;ENST00000234142	T;T;T;T	0.17528	3.28;2.27;2.28;3.28	4.93	4.93	0.64822	.	0.493025	0.20158	N	0.098007	T	0.18299	0.0439	L	0.50333	1.59	0.33208	D	0.552986	B;B;B	0.28419	0.015;0.006;0.211	B;B;B	0.21360	0.014;0.011;0.034	T	0.11060	-1.0603	10	0.25106	T	0.35	-11.9668	18.3234	0.90246	0.0:1.0:0.0:0.0	.	355;355;355	Q4ZG55-2;Q4ZG55-3;Q4ZG55	.;.;GREB1_HUMAN	V	355	ENSP00000370896:A355V;ENSP00000263834:A355V;ENSP00000370892:A355V;ENSP00000234142:A355V	ENSP00000234142:A355V	A	+	2	0	GREB1	11643387	0.090000	0.21635	0.506000	0.27664	0.870000	0.49936	2.467000	0.45093	2.568000	0.86640	0.650000	0.86243	GCT	.	.	.	none		0.507	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
RGPD4	285190	hgsc.bcm.edu	37	2	108488143	108488143	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr2:108488143C>T	ENST00000408999.3	+	20	3760	c.3683C>T	c.(3682-3684)gCg>gTg	p.A1228V	RGPD4_ENST00000354986.4_Missense_Mutation_p.A1228V	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1228					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						GGTACAGGTGCGGCCGGTGCC	0.408																																					p.A1228V		Atlas-SNP	.											.	RGPD4	112	.	0			c.C3683T						PASS	.						10.0	8.0	9.0					2																	108488143		683	1575	2258	SO:0001583	missense	285190	exon20			CAGGTGCGGCCGG	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3683C>T	chr2.hg19:g.108488143C>T	ENSP00000386810:p.Ala1228Val	141.0	0.0	.		227.0	92.0	.	NM_182588	B9A029	Missense_Mutation	SNP	ENST00000408999.3	hg19	CCDS46381.1	.	.	.	.	.	.	.	.	.	.	-	5.045	0.194017	0.09599	.	.	ENSG00000196862	ENST00000354986;ENST00000408999	T;T	0.44482	0.92;0.92	2.33	2.33	0.28932	.	.	.	.	.	T	0.22322	0.0538	N	0.17082	0.46	0.09310	N	1	B	0.28512	0.214	B	0.16289	0.015	T	0.11421	-1.0588	9	0.15066	T	0.55	-3.8053	9.6885	0.40114	0.0:1.0:0.0:0.0	.	1228	Q7Z3J3	RGPD4_HUMAN	V	1228	ENSP00000347081:A1228V;ENSP00000386810:A1228V	ENSP00000347081:A1228V	A	+	2	0	RGPD4	107854575	0.105000	0.21958	0.001000	0.08648	0.006000	0.05464	3.069000	0.50026	1.303000	0.44873	0.162000	0.16502	GCG	.	.	.	none		0.408	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581	
PSD4	23550	hgsc.bcm.edu	37	2	113956437	113956437	+	Silent	SNP	C	C	A	rs369985754	byFrequency	TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr2:113956437C>A	ENST00000245796.6	+	15	2940	c.2745C>A	c.(2743-2745)ccC>ccA	p.P915P	PSD4_ENST00000441564.3_Silent_p.P886P	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	915					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CCATCCTGCCCGTGGGCCCCG	0.721																																					p.P915P		Atlas-SNP	.											.	PSD4	74	.	0			c.C2745A						PASS	.						8.0	9.0	9.0					2																	113956437		2162	4208	6370	SO:0001819	synonymous_variant	23550	exon15			CCTGCCCGTGGGC	U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.2745C>A	chr2.hg19:g.113956437C>A		44.0	0.0	.		52.0	31.0	.	NM_012455	A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Silent	SNP	ENST00000245796.6	hg19	CCDS33276.1																																																																																			.	.	.	alt		0.721	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330789.1	NM_012455	
METTL21A	151194	hgsc.bcm.edu	37	2	208486600	208486600	+	Silent	SNP	C	C	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr2:208486600C>T	ENST00000411432.1	-	3	405	c.189G>A	c.(187-189)gaG>gaA	p.E63E	METTL21A_ENST00000432416.1_Silent_p.E63E|METTL21A_ENST00000272839.3_Silent_p.E63E|METTL21A_ENST00000458426.1_Silent_p.E63E|METTL21A_ENST00000448007.2_Silent_p.E63E|METTL21A_ENST00000425132.1_Silent_p.E63E|METTL21A_ENST00000448823.2_Intron|METTL21A_ENST00000442521.1_Silent_p.E63E|METTL21A_ENST00000426075.1_Silent_p.E63E|METTL21A_ENST00000406927.2_Silent_p.E63E	NM_001127395.1	NP_001120867.1	Q8WXB1	MT21A_HUMAN	methyltransferase like 21A	63					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	cytoplasm (GO:0005737)	ATPase binding (GO:0051117)|Hsp70 protein binding (GO:0030544)|protein-lysine N-methyltransferase activity (GO:0016279)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|stomach(1)	10						GGCCCCTGAGCTCCACAGCTC	0.567																																					p.E63E		Atlas-SNP	.											.	METTL21A	24	.	0			c.G189A						PASS	.						78.0	73.0	75.0					2																	208486600		2203	4300	6503	SO:0001819	synonymous_variant	151194	exon3			CCTGAGCTCCACA	AK093812, AF455817	CCDS2376.1	2q33.3	2013-09-30	2011-03-03	2011-03-03	ENSG00000144401	ENSG00000144401			30476	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 557b"", ""heat shock protein 70kDa lysine (K) methyltransferase"""	615257	"""family with sequence similarity 119, member A"""	FAM119A		23921388	Standard	NM_145280		Approved	LOC151194, HCA557b, HSPA-KMT	uc010fuk.1	Q8WXB1	OTTHUMG00000132934	ENST00000411432.1:c.189G>A	chr2.hg19:g.208486600C>T		128.0	0.0	.		161.0	11.0	.	NM_145280	Q53RV0|Q8N1Z9|Q96GH6	Silent	SNP	ENST00000411432.1	hg19	CCDS2376.1																																																																																			.	.	.	none		0.567	METTL21A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337044.1	NM_145280	
ESPNL	339768	hgsc.bcm.edu	37	2	239039152	239039153	+	Missense_Mutation	DNP	GG	GG	AT	rs199652360		TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr2:239039152_239039153GG>AT	ENST00000343063.3	+	9	2060_2061	c.1797_1798GG>AT	c.(1795-1800)ctGGta>ctATta	p.V600L	ESPNL_ENST00000409169.1_Missense_Mutation_p.V556L|ESPNL_ENST00000477241.1_3'UTR|ESPNL_ENST00000409506.1_Missense_Mutation_p.V232L	NM_194312.2	NP_919288.2	Q6ZVH7	ESPNL_HUMAN	espin-like	600										endometrium(1)|lung(8)|pancreas(2)|skin(2)	13		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		TCTCCCGCCTGGTACGCAGCCT	0.693																																					p.L599L|p.V600L		Atlas-SNP	.											.	ESPNL	63	.	0			c.G1797A|c.G1798T						PASS	.																																			SO:0001583	missense	339768	exon9			CCGCCTGGTACGC|CGCCTGGTACGCA	AK124559	CCDS2525.1	2q37.3	2013-01-10			ENSG00000144488	ENSG00000144488		"""Ankyrin repeat domain containing"""	27937	protein-coding gene	gene with protein product						12975309	Standard	NM_194312		Approved	FLJ42568	uc002vxq.4	Q6ZVH7	OTTHUMG00000133335	Exception_encountered	chr2.hg19:g.239039152_239039153delinsAT	ENSP00000339115:p.Val600Leu	105.0|106.0	0.0	.		119.0|122.0	62.0|64.0	.	NM_194312	Q66K27|Q6ZVG1|Q8IVU2	Silent|Missense_Mutation	SNP	ENST00000343063.3	hg19	CCDS2525.1																																																																																			.	.|G|1.000;C|0.000	.	none|alt		0.693	ESPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257164.2	NM_194312	
KIF1A	547	hgsc.bcm.edu	37	2	241696843	241696843	+	Intron	SNP	C	C	A	rs537608637|rs10594016|rs533559120		TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr2:241696843C>A	ENST00000320389.7	-	25	2714				KIF1A_ENST00000498729.2_Missense_Mutation_p.E917D	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A						anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		cctcctcatcctcctcctcct	0.682													C|||	1	0.000199681	0.0	0.0014	5008	,	,		8551	0.0		0.0	False		,,,				2504	0.0				p.E917D		Atlas-SNP	.											.	KIF1A	152	.	0			c.G2751T						PASS	.																																			SO:0001627	intron_variant	547	exon27			CTCATCCTCCTCC	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2555+933G>T	chr2.hg19:g.241696843C>A		86.0	0.0	.		150.0	12.0	.	NM_001244008	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	hg19	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	C	8.327	0.825706	0.16749	.	.	ENSG00000130294	ENST00000498729;ENST00000373308;ENST00000404283	T;T	0.73047	-0.63;-0.71	4.04	3.16	0.36331	.	.	.	.	.	T	0.50429	0.1615	.	.	.	0.27599	N	0.949023	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.21690	-1.0238	8	0.08381	T	0.77	.	12.6857	0.56946	0.1669:0.833:0.0:0.0	.	917;917	F5H045;Q12756-2	.;.	D	917	ENSP00000438388:E917D;ENSP00000384231:E917D	ENSP00000362405:E917D	E	-	3	2	KIF1A	241345516	0.997000	0.39634	0.999000	0.59377	0.888000	0.51559	0.203000	0.17315	0.685000	0.31468	-0.372000	0.07161	GAG	.	.	.	none		0.682	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
FBLN2	2199	hgsc.bcm.edu	37	3	13611885	13611885	+	Silent	SNP	C	C	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr3:13611885C>A	ENST00000295760.7	+	2	99	c.30C>A	c.(28-30)gcC>gcA	p.A10A	FBLN2_ENST00000535798.1_Silent_p.A36A|FBLN2_ENST00000492059.1_Silent_p.A10A|FBLN2_ENST00000404922.3_Silent_p.A10A	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	10					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CTGCAGGAGCCTGGCTTGCTC	0.692																																					p.A10A		Atlas-SNP	.											.	FBLN2	137	.	0			c.C30A						PASS	.						6.0	8.0	8.0					3																	13611885		1993	4145	6138	SO:0001819	synonymous_variant	2199	exon2			AGGAGCCTGGCTT	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.30C>A	chr3.hg19:g.13611885C>A		47.0	0.0	.		83.0	44.0	.	NM_001998	B7Z9C5|Q8IUI0|Q8IUI1	Silent	SNP	ENST00000295760.7	hg19	CCDS46762.1																																																																																			.	.	.	none		0.692	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019	
MON1A	84315	hgsc.bcm.edu	37	3	49949382	49949382	+	Nonsense_Mutation	SNP	C	C	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr3:49949382C>A	ENST00000417270.1	-	4	907	c.214G>T	c.(214-216)Gag>Tag	p.E72*	MON1A_ENST00000455683.2_Intron|MON1A_ENST00000483022.1_5'UTR|CTD-2330K9.3_ENST00000419183.1_Intron|MON1A_ENST00000296473.3_Nonsense_Mutation_p.E161*			Q86VX9	MON1A_HUMAN	MON1 secretory trafficking family member A	64										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GCCCCATCCTCTGACTCAGTC	0.622																																					p.E161X		Atlas-SNP	.											.	MON1A	41	.	0			c.G481T						PASS	.						40.0	41.0	41.0					3																	49949382		2203	4300	6503	SO:0001587	stop_gained	84315	exon3			CATCCTCTGACTC	AK074404	CCDS2808.2, CCDS46830.1	3p21.31	2013-08-21	2013-08-21		ENSG00000164077	ENSG00000164077			28207	protein-coding gene	gene with protein product		611464	"""MON1 homolog A (yeast)"""			12477932	Standard	NM_032355		Approved	MGC13272, SAND1	uc003cxz.3	Q86VX9	OTTHUMG00000156737	ENST00000417270.1:c.214G>T	chr3.hg19:g.49949382C>A	ENSP00000399613:p.Glu72*	70.0	0.0	.		106.0	47.0	.	NM_032355	B2RDQ1|G5E9N1|Q8NAV7|Q9BRF3	Nonsense_Mutation	SNP	ENST00000417270.1	hg19		.	.	.	.	.	.	.	.	.	.	C	36	5.611852	0.96637	.	.	ENSG00000164077	ENST00000296473;ENST00000417270	.	.	.	5.0	5.0	0.66597	.	0.269864	0.42682	D	0.000679	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-21.7631	18.2971	0.90150	0.0:1.0:0.0:0.0	.	.	.	.	X	161;72	.	.	E	-	1	0	MON1A	49924386	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.799000	0.62517	2.319000	0.78375	0.561000	0.74099	GAG	.	.	.	none		0.622	MON1A-005	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000345538.2	NM_032355	
C3orf38	285237	hgsc.bcm.edu	37	3	88205465	88205465	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr3:88205465T>A	ENST00000318887.3	+	3	980	c.670T>A	c.(670-672)Tgt>Agt	p.C224S	C3orf38_ENST00000486971.1_3'UTR	NM_173824.3	NP_776185.2	Q5JPI3	CC038_HUMAN	chromosome 3 open reading frame 38	224					apoptotic process (GO:0006915)					breast(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	12		Lung NSC(201;0.17)		UCEC - Uterine corpus endometrioid carcinoma (27;0.194)|LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00661)		TGGACTGAAATGTGCATCTTC	0.438																																					p.C224S		Atlas-SNP	.											.	C3orf38	29	.	0			c.T670A						PASS	.						134.0	129.0	131.0					3																	88205465		2203	4300	6503	SO:0001583	missense	285237	exon3			CTGAAATGTGCAT	AL832398	CCDS2921.1, CCDS2921.2	3p11.1	2011-01-25			ENSG00000179021	ENSG00000179021			28384	protein-coding gene	gene with protein product						12477932	Standard	NM_173824		Approved	MGC26717	uc003dqw.3	Q5JPI3	OTTHUMG00000155752	ENST00000318887.3:c.670T>A	chr3.hg19:g.88205465T>A	ENSP00000322469:p.Cys224Ser	75.0	0.0	.		164.0	80.0	.	NM_173824	B2R8X6|Q8TC85	Missense_Mutation	SNP	ENST00000318887.3	hg19	CCDS2921.2	.	.	.	.	.	.	.	.	.	.	T	14.70	2.614253	0.46631	.	.	ENSG00000179021	ENST00000318887	.	.	.	5.73	5.73	0.89815	.	0.250711	0.49305	D	0.000154	T	0.50429	0.1615	L	0.52759	1.655	0.80722	D	1	P	0.39282	0.666	B	0.35312	0.2	T	0.48906	-0.8993	9	0.24483	T	0.36	-3.1452	15.1867	0.73009	0.0:0.0:0.0:1.0	.	224	Q5JPI3	CC038_HUMAN	S	224	.	ENSP00000322469:C224S	C	+	1	0	C3orf38	88288155	1.000000	0.71417	0.992000	0.48379	0.963000	0.63663	5.952000	0.70282	2.175000	0.68902	0.455000	0.32223	TGT	.	.	.	none		0.438	C3orf38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341513.1	NM_173824	
KIAA2018	205717	hgsc.bcm.edu	37	3	113377181	113377181	+	Silent	SNP	T	T	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr3:113377181T>A	ENST00000478658.1	-	5	3365	c.3348A>T	c.(3346-3348)gcA>gcT	p.A1116A	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Silent_p.A1116A			Q68DE3	K2018_HUMAN	KIAA2018	1116						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TATTAGTTGTTGCATTGCTGG	0.458																																					p.A1116A		Atlas-SNP	.											.	KIAA2018	180	.	0			c.A3348T						PASS	.						143.0	134.0	137.0					3																	113377181		1982	4170	6152	SO:0001819	synonymous_variant	205717	exon7			AGTTGTTGCATTG	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.3348A>T	chr3.hg19:g.113377181T>A		55.0	0.0	.		92.0	48.0	.	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	hg19	CCDS43133.1																																																																																			.	.	.	none		0.458	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
ZNF148	7707	hgsc.bcm.edu	37	3	125032253	125032253	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr3:125032253C>T	ENST00000360647.4	-	4	717	c.232G>A	c.(232-234)Gat>Aat	p.D78N	ZNF148_ENST00000485866.1_Missense_Mutation_p.D78N|ZNF148_ENST00000492394.1_Missense_Mutation_p.D78N|ZNF148_ENST00000544464.1_Intron|ZNF148_ENST00000484491.1_Missense_Mutation_p.D78N|ZNF148_ENST00000468369.1_Intron	NM_021964.2	NP_068799.2	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	78					cellular defense response (GO:0006968)|gamete generation (GO:0007276)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein complex assembly (GO:0006461)|substantia nigra development (GO:0021762)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)	28						ATGAGTTCATCATGTGATATC	0.413																																					p.D78N		Atlas-SNP	.											.	ZNF148	84	.	0			c.G232A						PASS	.						332.0	271.0	292.0					3																	125032253		2203	4300	6503	SO:0001583	missense	7707	exon4			GTTCATCATGTGA	U09851	CCDS3031.1	3q21.2	2013-01-08	2006-06-13		ENSG00000163848	ENSG00000163848		"""Zinc fingers, C2H2-type"""	12933	protein-coding gene	gene with protein product		601897	"""zinc finger protein 148 (pHZ-52)"""			7557990, 9925940	Standard	NM_021964		Approved	BERF-1, ZBP-89, BFCOL1, HT-BETA, ZFP148, pHZ-52	uc003ehx.4	Q9UQR1	OTTHUMG00000159448	ENST00000360647.4:c.232G>A	chr3.hg19:g.125032253C>T	ENSP00000353863:p.Asp78Asn	83.0	0.0	.		152.0	72.0	.	NM_021964	D3DN27|O00389|O43591|Q58EY5|Q6PJ98	Missense_Mutation	SNP	ENST00000360647.4	hg19	CCDS3031.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.030061	0.93575	.	.	ENSG00000163848	ENST00000360647;ENST00000484491;ENST00000492394;ENST00000485866;ENST00000543574;ENST00000465763	T;T;T;T	0.08282	3.11;3.11;3.11;3.11	5.15	5.15	0.70609	.	0.050494	0.85682	D	0.000000	T	0.18383	0.0441	N	0.24115	0.695	0.80722	D	1	D	0.63880	0.993	D	0.72338	0.977	T	0.02560	-1.1141	10	0.49607	T	0.09	-16.8398	18.8154	0.92075	0.0:1.0:0.0:0.0	.	78	Q9UQR1	ZN148_HUMAN	N	78	ENSP00000353863:D78N;ENSP00000420335:D78N;ENSP00000419322:D78N;ENSP00000420448:D78N	ENSP00000353863:D78N	D	-	1	0	ZNF148	126514943	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.845000	0.69437	2.669000	0.90835	0.650000	0.86243	GAT	.	.	.	none		0.413	ZNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355452.4	NM_021964	
PSMD2	5708	hgsc.bcm.edu	37	3	184025149	184025149	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr3:184025149G>C	ENST00000310118.4	+	17	2597	c.2039G>C	c.(2038-2040)aGa>aCa	p.R680T	PSMD2_ENST00000435761.1_Missense_Mutation_p.R521T|EIF2B5_ENST00000444495.1_Intron|PSMD2_ENST00000439383.1_Missense_Mutation_p.R550T	NM_002808.3	NP_002799.3	Q13200	PSMD2_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 2	680					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|liver(1)|lung(12)|prostate(3)|upper_aerodigestive_tract(2)	27	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	CATCAGCTGAGATATGGGGAG	0.463																																					p.R680T	Colon(24;313 636 6917 9932 15554)	Atlas-SNP	.											.	PSMD2	56	.	0			c.G2039C						PASS	.						101.0	92.0	95.0					3																	184025149		2203	4300	6503	SO:0001583	missense	5708	exon17			AGCTGAGATATGG	AK095245	CCDS3258.1, CCDS63853.1, CCDS63854.1	3q27.3	2008-05-22			ENSG00000175166	ENSG00000175166		"""Proteasome (prosome, macropain) subunits"""	9559	protein-coding gene	gene with protein product		606223				8774743	Standard	NM_002808		Approved	S2, P97, TRAP2, MGC14274, Rpn1	uc003fnn.1	Q13200	OTTHUMG00000156796	ENST00000310118.4:c.2039G>C	chr3.hg19:g.184025149G>C	ENSP00000310129:p.Arg680Thr	56.0	0.0	.		75.0	42.0	.	NM_002808	B4DX07|B4DXY1|E7EW34|E9PCS3|Q12932|Q15321|Q53XQ4|Q96I12	Missense_Mutation	SNP	ENST00000310118.4	hg19	CCDS3258.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.0|23.0	4.362690|4.362690	0.82353|0.82353	.|.	.|.	ENSG00000175166|ENSG00000175166	ENST00000432855|ENST00000310118;ENST00000358216;ENST00000538096;ENST00000435761;ENST00000439383	.|T;T;T	.|0.40476	.|1.03;1.03;1.03	5.66|5.66	5.66|5.66	0.87406|0.87406	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.66509|0.66509	0.2796|0.2796	M|M	0.79123|0.79123	2.44|2.44	0.80722|0.80722	D|D	1|1	.|P;D	.|0.54601	.|0.668;0.967	.|B;D	.|0.63597	.|0.441;0.916	T|T	0.68577|0.68577	-0.5372|-0.5372	5|10	.|0.66056	.|D	.|0.02	-12.9315|-12.9315	19.7566|19.7566	0.96296|0.96296	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|521;680	.|E9PCS3;Q13200	.|.;PSMD2_HUMAN	H|T	113|680;352;672;521;550	.|ENSP00000310129:R680T;ENSP00000402618:R521T;ENSP00000416028:R550T	.|ENSP00000310129:R680T	D|R	+|+	1|2	0|0	PSMD2|PSMD2	185507843|185507843	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.940000|0.940000	0.58332|0.58332	9.321000|9.321000	0.96353|0.96353	2.671000|2.671000	0.90904|0.90904	0.563000|0.563000	0.77884|0.77884	GAT|AGA	.	.	.	none		0.463	PSMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345843.1	NM_002808	
MUC4	4585	hgsc.bcm.edu	37	3	195505805	195505805	+	Missense_Mutation	SNP	A	A	C	rs540560059	byFrequency	TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr3:195505805A>C	ENST00000463781.3	-	2	13105	c.12646T>G	c.(12646-12648)Tca>Gca	p.S4216A	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S4216A	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGGATGCTGAGGAAGTGTCG	0.592													.|||	14	0.00279553	0.0015	0.0029	5008	,	,		14788	0.001		0.004	False		,,,				2504	0.0051				p.S4216A		Atlas-SNP	.											.	MUC4	1505	.	0			c.T12646G						PASS	.						31.0	26.0	28.0					3																	195505805		692	1581	2273	SO:0001583	missense	4585	exon2			ATGCTGAGGAAGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12646T>G	chr3.hg19:g.195505805A>C	ENSP00000417498:p.Ser4216Ala	114.0	0.0	.		146.0	8.0	.	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	hg19	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	1.575	-0.533159	0.04082	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29655	1.56;1.58	0.93	-0.342	0.12635	.	.	.	.	.	T	0.12646	0.0307	N	0.19112	0.55	0.09310	N	1	P	0.37985	0.613	B	0.28139	0.086	T	0.15954	-1.0419	8	.	.	.	.	2.8918	0.05678	0.6746:0.0:0.3254:0.0	.	4088	E7ESK3	.	A	4216	ENSP00000417498:S4216A;ENSP00000420243:S4216A	.	S	-	1	0	MUC4	196990584	.	.	0.001000	0.08648	0.002000	0.02628	.	.	-0.091000	0.12440	0.421000	0.28195	TCA	.	.	.	none		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
GALNTL6	442117	hgsc.bcm.edu	37	4	173961238	173961238	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr4:173961238A>G	ENST00000506823.1	+	13	2450	c.1793A>G	c.(1792-1794)cAt>cGt	p.H598R	GALNTL6_ENST00000508122.1_Missense_Mutation_p.H581R	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	598					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						TTTAACCACCATGCCAACTCC	0.378																																					p.H598R		Atlas-SNP	.											.	GALNTL6	102	.	0			c.A1793G						PASS	.						57.0	57.0	57.0					4																	173961238		2203	4300	6503	SO:0001583	missense	442117	exon13			ACCACCATGCCAA		CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.1793A>G	chr4.hg19:g.173961238A>G	ENSP00000423313:p.His598Arg	90.0	0.0	.		98.0	48.0	.	NM_001034845	Q2L4S6	Missense_Mutation	SNP	ENST00000506823.1	hg19	CCDS34104.1	.	.	.	.	.	.	.	.	.	.	A	2.776	-0.254643	0.05829	.	.	ENSG00000174473	ENST00000506823;ENST00000508122	T;T	0.54675	0.57;0.56	5.7	5.7	0.88788	.	0.322502	0.26407	N	0.024559	T	0.32852	0.0843	N	0.08118	0	0.24470	N	0.994397	B	0.09022	0.002	B	0.08055	0.003	T	0.08513	-1.0718	10	0.15066	T	0.55	.	15.9765	0.80071	1.0:0.0:0.0:0.0	.	598	Q49A17	GLTL6_HUMAN	R	598;581	ENSP00000423313:H598R;ENSP00000423827:H581R	ENSP00000423313:H598R	H	+	2	0	GALNTL6	174197813	0.981000	0.34729	1.000000	0.80357	0.385000	0.30292	2.146000	0.42216	2.172000	0.68678	0.533000	0.62120	CAT	.	.	.	none		0.378	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362395.1	NM_001034845	
GALNT7	51809	hgsc.bcm.edu	37	4	174239640	174239640	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr4:174239640G>C	ENST00000265000.4	+	11	1849	c.1766G>C	c.(1765-1767)gGa>gCa	p.G589A		NM_017423.2	NP_059119.2	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	589	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|kidney(3)|large_intestine(5)|liver(1)|lung(9)	19		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		TTGACAAAGGGAGCTGATGGA	0.343																																					p.G589A		Atlas-SNP	.											.	GALNT7	61	.	0			c.G1766C						PASS	.						115.0	118.0	117.0					4																	174239640		2203	4300	6503	SO:0001583	missense	51809	exon11			CAAAGGGAGCTGA	AJ002744	CCDS3815.1	4q31.1	2014-03-13	2014-03-13		ENSG00000109586	ENSG00000109586		"""Glycosyltransferase family 2 domain containing"""	4129	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 7"""	605005	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)"""			10544240	Standard	NM_017423		Approved	GALNAC-T7	uc003isz.4	Q86SF2	OTTHUMG00000160817	ENST00000265000.4:c.1766G>C	chr4.hg19:g.174239640G>C	ENSP00000265000:p.Gly589Ala	156.0	0.0	.		205.0	99.0	.	NM_017423	B3KQU3|Q7Z5W7|Q9UJ28	Missense_Mutation	SNP	ENST00000265000.4	hg19	CCDS3815.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.595|9.595	1.127164|1.127164	0.20959|0.20959	.|.	.|.	ENSG00000109586|ENSG00000109586	ENST00000505308|ENST00000265000	.|T	.|0.77229	.|-1.08	4.92|4.92	4.92|4.92	0.64577|0.64577	.|Ricin B-related lectin (1);Ricin B lectin (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.63462|0.63462	0.2513|0.2513	N|N	0.16266|0.16266	0.395|0.395	0.80722|0.80722	D|D	1|1	.|B	.|0.22983	.|0.078	.|B	.|0.18871	.|0.023	T|T	0.59616|0.59616	-0.7421|-0.7421	5|10	.|0.10111	.|T	.|0.7	.|.	18.9993|18.9993	0.92826|0.92826	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|589	.|Q86SF2	.|GALT7_HUMAN	Q|A	386|589	.|ENSP00000265000:G589A	.|ENSP00000265000:G589A	E|G	+|+	1|2	0|0	GALNT7|GALNT7	174476215|174476215	1.000000|1.000000	0.71417|0.71417	0.957000|0.957000	0.39632|0.39632	0.831000|0.831000	0.47069|0.47069	5.713000|5.713000	0.68415|0.68415	2.645000|2.645000	0.89757|0.89757	0.555000|0.555000	0.69702|0.69702	GAG|GGA	.	.	.	none		0.343	GALNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362456.2	NM_017423	
TENM3	55714	hgsc.bcm.edu	37	4	183245238	183245238	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr4:183245238G>A	ENST00000511685.1	+	2	188	c.65G>A	c.(64-66)cGc>cAc	p.R22H	TENM3_ENST00000406950.2_Missense_Mutation_p.R22H			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	22	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										AAGGAACGGCGCTACACAAAT	0.512																																					p.R22H		Atlas-SNP	.											.	.	.	.	0			c.G65A						PASS	.						101.0	103.0	102.0					4																	183245238		1988	4168	6156	SO:0001583	missense	55714	exon1			AACGGCGCTACAC	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.65G>A	chr4.hg19:g.183245238G>A	ENSP00000424226:p.Arg22His	97.0	0.0	.		129.0	65.0	.	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	hg19	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.691681	0.68271	.	.	ENSG00000218336	ENST00000512480;ENST00000511685;ENST00000406950	T;T;T	0.45668	0.89;0.89;0.89	5.65	5.65	0.86999	Teneurin intracellular, N-terminal (2);	.	.	.	.	T	0.55065	0.1897	L	0.27053	0.805	0.51482	D	0.999923	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.991	T	0.55560	-0.8122	9	0.62326	D	0.03	.	19.9142	0.97043	0.0:0.0:1.0:0.0	.	22;22	D6RGC5;Q9P273	.;TEN3_HUMAN	H	22	ENSP00000421320:R22H;ENSP00000424226:R22H;ENSP00000385276:R22H	ENSP00000385276:R22H	R	+	2	0	ODZ3	183482232	1.000000	0.71417	0.974000	0.42286	0.613000	0.37349	7.379000	0.79691	2.941000	0.99782	0.655000	0.94253	CGC	.	.	.	none		0.512	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
TLR3	7098	hgsc.bcm.edu	37	4	187004353	187004353	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr4:187004353C>A	ENST00000296795.3	+	4	1617	c.1513C>A	c.(1513-1515)Ctt>Att	p.L505I	TLR3_ENST00000504367.1_Missense_Mutation_p.L228I	NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	505					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		ATTCCAGCCTCTTCGTAACTT	0.453																																					p.L505I		Atlas-SNP	.											.	TLR3	83	.	0			c.C1513A						PASS	.						100.0	104.0	103.0					4																	187004353		2203	4300	6503	SO:0001583	missense	7098	exon4			CAGCCTCTTCGTA	U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.1513C>A	chr4.hg19:g.187004353C>A	ENSP00000296795:p.Leu505Ile	111.0	0.0	.		152.0	63.0	.	NM_003265	B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Missense_Mutation	SNP	ENST00000296795.3	hg19	CCDS3846.1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.244447	0.39697	.	.	ENSG00000164342	ENST00000296795;ENST00000542020;ENST00000504367	T;T	0.70749	-0.51;-0.51	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.85809	0.5783	M	0.89904	3.07	0.58432	D	0.999996	D	0.56035	0.974	D	0.66602	0.945	D	0.88167	0.2861	10	0.87932	D	0	.	13.9953	0.64392	0.0:0.9278:0.0:0.0722	.	505	O15455	TLR3_HUMAN	I	505;505;228	ENSP00000296795:L505I;ENSP00000423684:L228I	ENSP00000296795:L505I	L	+	1	0	TLR3	187241347	0.985000	0.35326	0.813000	0.32504	0.060000	0.15804	2.694000	0.47035	2.683000	0.91414	0.557000	0.71058	CTT	.	.	.	none		0.453	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360313.4		
PCDHB2	56133	hgsc.bcm.edu	37	5	140476411	140476411	+	Silent	SNP	A	A	C			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr5:140476411A>C	ENST00000194155.4	+	1	2185	c.2037A>C	c.(2035-2037)gcA>gcC	p.A679A		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	679					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A679A(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGAGGCGGCACCGGCCCAGG	0.687																																					p.A679A		Atlas-SNP	.											PCDHB2,NS,carcinoma,0,1	PCDHB2	163	.	1	Substitution - coding silent(1)	lung(1)	c.A2037C						PASS	.						65.0	67.0	66.0					5																	140476411		2178	4247	6425	SO:0001819	synonymous_variant	56133	exon1			GGCGGCACCGGCC	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.2037A>C	chr5.hg19:g.140476411A>C		66.0	1.0	.		127.0	7.0	.	NM_018936	Q4KMU1	Silent	SNP	ENST00000194155.4	hg19	CCDS4244.1																																																																																			.	.	.	none		0.687	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
DCTN4	51164	hgsc.bcm.edu	37	5	150133041	150133041	+	Splice_Site	SNP	C	C	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr5:150133041C>A	ENST00000447998.2	-	3	500	c.385G>T	c.(385-387)Gct>Tct	p.A129S	DCTN4_ENST00000446090.2_Splice_Site_p.A129S|DCTN4_ENST00000424236.1_Splice_Site_p.A72S|DCTN4_ENST00000521093.1_5'UTR	NM_016221.3	NP_057305.1	Q9UJW0	DCTN4_HUMAN	dynactin 4 (p62)	129					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	10		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCTCACTCACCTACAGATTTG	0.438																																					p.A129S		Atlas-SNP	.											.	DCTN4	35	.	0			c.G385T						PASS	.						95.0	83.0	87.0					5																	150133041		2203	4300	6503	SO:0001630	splice_region_variant	51164	exon3			ACTCACCTACAGA	AF195120	CCDS4310.1, CCDS47310.1, CCDS47311.1	5q31-q32	2008-05-23			ENSG00000132912	ENSG00000132912			15518	protein-coding gene	gene with protein product		614758				10843801, 16554302	Standard	NM_016221		Approved		uc010jhi.3	Q9UJW0	OTTHUMG00000130079	ENST00000447998.2:c.385+1G>T	chr5.hg19:g.150133041C>A		48.0	0.0	.		66.0	30.0	.	NM_016221	B3KWW0|D3DQH0|E5RGT5|Q8TAN8	Missense_Mutation	SNP	ENST00000447998.2	hg19	CCDS4310.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.383083	0.82792	.	.	ENSG00000132912	ENST00000447998;ENST00000424236;ENST00000446090;ENST00000518015;ENST00000521533	T;T;T;T;T	0.48201	2.08;2.09;2.11;0.82;0.86	5.99	5.99	0.97316	.	0.050995	0.85682	D	0.000000	T	0.69278	0.3093	M	0.70275	2.135	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.996;0.998	T	0.66416	-0.5929	9	.	.	.	-21.9701	18.6582	0.91462	0.0:1.0:0.0:0.0	.	129;129	Q9UJW0-3;Q9UJW0	.;DCTN4_HUMAN	S	129;72;129;72;72	ENSP00000416968:A129S;ENSP00000411251:A72S;ENSP00000414906:A129S;ENSP00000430993:A72S;ENSP00000430183:A72S	.	A	-	1	0	DCTN4	150113234	1.000000	0.71417	1.000000	0.80357	0.356000	0.29392	7.734000	0.84928	2.840000	0.97914	0.655000	0.94253	GCT	.	.	.	none		0.438	DCTN4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252372.1		Missense_Mutation
ITK	3702	hgsc.bcm.edu	37	5	156671455	156671455	+	Nonsense_Mutation	SNP	C	C	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr5:156671455C>A	ENST00000422843.3	+	13	1568	c.1416C>A	c.(1414-1416)taC>taA	p.Y472*	ITK_ENST00000519749.1_3'UTR	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	472	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	GCATGGCCTACCTGGAAGAGG	0.552			T	SYK	peripheral T-cell lymphoma																																p.Y472X	Esophageal Squamous(70;1378 1469 8785 19883)	Atlas-SNP	.		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	.	ITK	136	.	0			c.C1416A						PASS	.						87.0	83.0	84.0					5																	156671455		2203	4300	6503	SO:0001587	stop_gained	3702	exon13			GGCCTACCTGGAA	D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.1416C>A	chr5.hg19:g.156671455C>A	ENSP00000398655:p.Tyr472*	46.0	0.0	.		80.0	41.0	.	NM_005546	B2R752|Q32ML7	Nonsense_Mutation	SNP	ENST00000422843.3	hg19	CCDS4336.1	.	.	.	.	.	.	.	.	.	.	C	39	7.388191	0.98252	.	.	ENSG00000113263	ENST00000422843	.	.	.	6.08	4.31	0.51392	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.2076	0.31465	0.0:0.7457:0.0:0.2543	.	.	.	.	X	472	.	ENSP00000398655:Y472X	Y	+	3	2	ITK	156604033	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.970000	0.40520	1.590000	0.49995	0.591000	0.81541	TAC	.	.	.	none		0.552	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2		
FLT4	2324	hgsc.bcm.edu	37	5	180045796	180045796	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr5:180045796G>A	ENST00000261937.6	-	21	3053	c.2975C>T	c.(2974-2976)gCg>gTg	p.A992V	FLT4_ENST00000393347.3_Missense_Mutation_p.A992V|FLT4_ENST00000502649.1_Missense_Mutation_p.A992V|FLT4_ENST00000424276.2_5'Flank	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	992	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AGCCCGCCTCGCTCCGCCCTC	0.672																																					p.A992V	Colon(97;1075 1466 27033 27547 35871)	Atlas-SNP	.											.	FLT4	356	.	0			c.C2975T						PASS	.						17.0	23.0	21.0					5																	180045796		2181	4288	6469	SO:0001583	missense	2324	exon21			CGCCTCGCTCCGC	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2975C>T	chr5.hg19:g.180045796G>A	ENSP00000261937:p.Ala992Val	71.0	0.0	.		88.0	47.0	.	NM_182925	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	hg19	CCDS4457.1	.	.	.	.	.	.	.	.	.	.	G	0.021	-1.422924	0.01126	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000512795	T;T;T;T	0.79940	-1.08;-1.08;-1.08;-1.32	4.91	3.13	0.36017	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.63271	0.2497	N	0.12746	0.255	0.09310	N	1	B;B	0.16396	0.001;0.017	B;B	0.19148	0.005;0.024	T	0.49072	-0.8977	9	0.24483	T	0.36	.	8.8003	0.34905	0.1751:0.0:0.8249:0.0	.	992;992	E9PD35;P35916	.;VGFR3_HUMAN	V	992;992;992;30	ENSP00000261937:A992V;ENSP00000377016:A992V;ENSP00000426057:A992V;ENSP00000421535:A30V	ENSP00000261937:A992V	A	-	2	0	FLT4	179978402	0.019000	0.18553	0.011000	0.14972	0.002000	0.02628	1.930000	0.40124	0.605000	0.29947	0.542000	0.68232	GCG	.	.	.	none		0.672	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		
TJAP1	93643	hgsc.bcm.edu	37	6	43466745	43466745	+	Silent	SNP	T	T	C			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr6:43466745T>C	ENST00000372445.5	+	4	382	c.6T>C	c.(4-6)acT>acC	p.T2T	TJAP1_ENST00000259751.1_Silent_p.T2T|TJAP1_ENST00000372452.1_Silent_p.T2T|TJAP1_ENST00000372449.1_Silent_p.T2T|TJAP1_ENST00000438588.2_Silent_p.T2T|TJAP1_ENST00000372444.2_Silent_p.T2T|TJAP1_ENST00000483640.1_3'UTR|TJAP1_ENST00000436109.2_Silent_p.T2T	NM_001146016.1	NP_001139488.1	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 (peripheral)	2					Golgi organization (GO:0007030)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|urinary_tract(2)	21	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CCAGAATGACTAGTGCCGCCC	0.567																																					p.T2T		Atlas-SNP	.											.	TJAP1	35	.	0			c.T6C						PASS	.						72.0	60.0	64.0					6																	43466745		2203	4300	6503	SO:0001819	synonymous_variant	93643	exon4			AATGACTAGTGCC	AK024269	CCDS4898.1, CCDS55004.1	6p21.1	2008-02-05	2005-07-05	2005-07-05	ENSG00000137221	ENSG00000137221			17949	protein-coding gene	gene with protein product		612658	"""tight junction protein 4 (peripheral)"""	TJP4		11602598	Standard	NM_001146016		Approved	PILT	uc011dvh.1	Q5JTD0	OTTHUMG00000014736	ENST00000372445.5:c.6T>C	chr6.hg19:g.43466745T>C		30.0	0.0	.		69.0	40.0	.	NM_080604	Q05BH9|Q5JTD1|Q5JWW1|Q68DB2|Q6P2P3|Q9H7V7	Silent	SNP	ENST00000372445.5	hg19	CCDS55004.1																																																																																			.	.	.	none		0.567	TJAP1-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040629.1	NM_080604	
STX11	8676	hgsc.bcm.edu	37	6	144508308	144508308	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr6:144508308G>T	ENST00000367568.4	+	2	727	c.544G>T	c.(544-546)Gag>Tag	p.E182*		NM_003764.3	NP_003755.2	O75558	STX11_HUMAN	syntaxin 11	182					cytotoxic T cell degranulation (GO:0043316)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|natural killer cell degranulation (GO:0043320)|neutrophil degranulation (GO:0043312)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	SNAP receptor activity (GO:0005484)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	12				OV - Ovarian serous cystadenocarcinoma(155;2.17e-06)|GBM - Glioblastoma multiforme(68;0.0492)		GGACATGTTCGAGCAGGGTAA	0.627									Familial Hemophagocytic Lymphohistiocytosis																												p.E182X		Atlas-SNP	.											.	STX11	34	.	0			c.G544T						PASS	.						51.0	57.0	55.0					6																	144508308		2203	4300	6503	SO:0001587	stop_gained	8676	exon2	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	ATGTTCGAGCAGG	AF044309	CCDS5205.1	6q24.1	2014-09-17			ENSG00000135604	ENSG00000135604			11429	protein-coding gene	gene with protein product		605014				9553086	Standard	NM_003764		Approved		uc003qks.4	O75558	OTTHUMG00000015739	ENST00000367568.4:c.544G>T	chr6.hg19:g.144508308G>T	ENSP00000356540:p.Glu182*	109.0	0.0	.		118.0	61.0	.	NM_003764	E1P598|O75378|O95148|Q5TCL6	Nonsense_Mutation	SNP	ENST00000367568.4	hg19	CCDS5205.1	.	.	.	.	.	.	.	.	.	.	G	37	6.277586	0.97435	.	.	ENSG00000135604	ENST00000367568	.	.	.	5.45	4.56	0.56223	.	0.050373	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-31.1219	15.5981	0.76602	0.0:0.1384:0.8616:0.0	.	.	.	.	X	182	.	ENSP00000356540:E182X	E	+	1	0	STX11	144550001	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.844000	0.86867	1.246000	0.43901	0.655000	0.94253	GAG	.	.	.	none		0.627	STX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042544.1		
PLEKHG1	57480	hgsc.bcm.edu	37	6	151054930	151054930	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr6:151054930G>A	ENST00000358517.2	+	2	324	c.113G>A	c.(112-114)aGc>aAc	p.S38N	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.S38N			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	38							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		GTTTCAAATAGCCACATGGGC	0.547																																					p.S38N		Atlas-SNP	.											.	PLEKHG1	97	.	0			c.G113A						PASS	.						77.0	78.0	78.0					6																	151054930		2203	4300	6503	SO:0001583	missense	57480	exon3			CAAATAGCCACAT	AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.113G>A	chr6.hg19:g.151054930G>A	ENSP00000351318:p.Ser38Asn	82.0	0.0	.		118.0	59.0	.	NM_001029884	Q5T1F2	Missense_Mutation	SNP	ENST00000358517.2	hg19	CCDS34552.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.604559	0.87157	.	.	ENSG00000120278	ENST00000367328;ENST00000367326;ENST00000535018;ENST00000358517	T;T	0.62639	0.01;0.01	5.81	5.81	0.92471	.	0.125351	0.64402	D	0.000001	T	0.63546	0.2520	M	0.63428	1.95	0.34174	D	0.670101	D;D	0.53619	0.961;0.961	P;P	0.49637	0.617;0.617	T	0.68685	-0.5343	10	0.62326	D	0.03	.	20.0762	0.97745	0.0:0.0:1.0:0.0	.	38;38	Q5JYA6;Q9ULL1	.;PKHG1_HUMAN	N	38	ENSP00000356297:S38N;ENSP00000351318:S38N	ENSP00000351318:S38N	S	+	2	0	PLEKHG1	151096623	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	5.440000	0.66563	2.756000	0.94617	0.655000	0.94253	AGC	.	.	.	none		0.547	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
RSPH3	83861	hgsc.bcm.edu	37	6	159420999	159420999	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr6:159420999T>C	ENST00000252655.1	-	1	199	c.10A>G	c.(10-12)Aag>Gag	p.K4E	RSPH3_ENST00000367069.2_5'UTR|RP1-111C20.4_ENST00000606470.1_RNA|RSPH3_ENST00000297262.3_Missense_Mutation_p.K4E|RP1-111C20.4_ENST00000607391.1_RNA|RP1-111C20.4_ENST00000607796.1_RNA|RSPH3_ENST00000449822.1_5'Flank	NM_031924.4	NP_114130.3	Q86UC2	RSPH3_HUMAN	radial spoke 3 homolog (Chlamydomonas)	4										endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|skin(1)|stomach(7)	23		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.36e-16)|BRCA - Breast invasive adenocarcinoma(81;5.92e-06)		TTGGCTGGCTTGACCGTCATC	0.667																																					p.K4E		Atlas-SNP	.											.	RSPH3	48	.	0			c.A10G						PASS	.						15.0	14.0	14.0					6																	159420999		2149	4219	6368	SO:0001583	missense	83861	exon1			CTGGCTTGACCGT	AF353618	CCDS5260.1	6q25.3	2014-05-16	2008-07-04	2007-06-26	ENSG00000130363	ENSG00000130363			21054	protein-coding gene	gene with protein product		615876	"""radial spokehead-like 2"""	RSHL2		12477932	Standard	NM_031924		Approved	dJ111C20.1, RSP3	uc003qrx.3	Q86UC2	OTTHUMG00000015924	ENST00000252655.1:c.10A>G	chr6.hg19:g.159420999T>C	ENSP00000252655:p.Lys4Glu	104.0	0.0	.		175.0	82.0	.	NM_031924	Q96LQ5|Q96LX2|Q9BX75	Missense_Mutation	SNP	ENST00000252655.1	hg19	CCDS5260.1	.	.	.	.	.	.	.	.	.	.	T	11.10	1.538607	0.27475	.	.	ENSG00000130363	ENST00000252655;ENST00000297262	T;T	0.17370	2.42;2.28	1.12	-0.411	0.12370	.	8.538430	0.00166	U	0.000002	T	0.02727	0.0082	N	0.24115	0.695	0.09310	N	1	B;B	0.27625	0.183;0.115	B;B	0.17722	0.019;0.009	T	0.31194	-0.9952	10	0.23891	T	0.37	.	2.954	0.05870	0.4349:0.0:0.0:0.5651	.	4;4	Q86UC2-2;Q86UC2	.;RSPH3_HUMAN	E	4	ENSP00000252655:K4E;ENSP00000297262:K4E	ENSP00000252655:K4E	K	-	1	0	RSPH3	159340987	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-1.681000	0.01937	-0.117000	0.11872	0.379000	0.24179	AAG	.	.	.	none		0.667	RSPH3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_031924	
CAMK2B	816	hgsc.bcm.edu	37	7	44268995	44268995	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr7:44268995G>T	ENST00000395749.2	-	18	1407	c.1331C>A	c.(1330-1332)cCa>cAa	p.P444Q	CAMK2B_ENST00000489429.1_5'UTR|CAMK2B_ENST00000457475.1_Intron|CAMK2B_ENST00000358707.3_Intron|CAMK2B_ENST00000502837.2_Intron|CAMK2B_ENST00000440254.2_Intron|CAMK2B_ENST00000346990.4_Intron|CAMK2B_ENST00000350811.3_Intron|CAMK2B_ENST00000353625.4_Intron|CAMK2B_ENST00000347193.4_Intron|CAMK2B_ENST00000258682.6_Intron|CAMK2B_ENST00000395747.2_Intron	NM_001220.4	NP_001211.3	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II beta	444					activation of meiosis involved in egg activation (GO:0060466)|calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibitory G-protein coupled receptor phosphorylation (GO:0002030)|interferon-gamma-mediated signaling pathway (GO:0060333)|neuromuscular process controlling balance (GO:0050885)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neuron projection development (GO:0010976)|positive regulation of synapse maturation (GO:0090129)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of calcium ion transport (GO:0051924)|regulation of dendritic spine development (GO:0060998)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of skeletal muscle adaptation (GO:0014733)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, cholinergic (GO:0032222)|response to cadmium ion (GO:0046686)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)	18						ACATGGGGCTGGCAGGGGGCT	0.687																																					p.P444Q		Atlas-SNP	.											.	CAMK2B	56	.	0			c.C1331A						PASS	.						5.0	5.0	5.0					7																	44268995		1932	3820	5752	SO:0001583	missense	816	exon18			GGGGCTGGCAGGG	U50358	CCDS5483.1, CCDS5484.1, CCDS5485.1, CCDS5486.1, CCDS5487.1, CCDS5488.1, CCDS5489.1, CCDS43573.1	7p14.3-p14.1	2008-10-30	2008-10-30		ENSG00000058404	ENSG00000058404			1461	protein-coding gene	gene with protein product	"""CaM-kinase II beta chain"", ""calcium/calmodulin-dependent protein kinase type II beta chain"", ""CaM kinase II beta subunit"", ""proline rich calmodulin-dependent protein kinase"""	607707	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II beta"""	CAMKB			Standard	NM_172079		Approved	CAM2, CAMK2	uc003tkq.2	Q13554	OTTHUMG00000023491	ENST00000395749.2:c.1331C>A	chr7.hg19:g.44268995G>T	ENSP00000379098:p.Pro444Gln	314.0	0.0	.		456.0	231.0	.	NM_001220	A4D2K0|A4D2K1|A4D2K2|A4D2K3|A4D2K4|A4D2K5|A4D2K6|O95437|O95438|O95599|Q9UGH7|Q9UGH8|Q9UGH9|Q9UNX0|Q9UNX7|Q9UP00|Q9Y5N4|Q9Y6F4	Missense_Mutation	SNP	ENST00000395749.2	hg19	CCDS5483.1	.	.	.	.	.	.	.	.	.	.	g	11.40	1.628866	0.28978	.	.	ENSG00000058404	ENST00000395749	T	0.66995	-0.24	3.66	-0.42	0.12336	Protein kinase-like domain (1);	.	.	.	.	T	0.46639	0.1403	L	0.38175	1.15	0.24473	N	0.994385	B	0.34015	0.435	B	0.29524	0.103	T	0.27365	-1.0076	9	0.12430	T	0.62	.	6.8313	0.23911	0.4498:0.0:0.5502:0.0	.	444	Q13554	KCC2B_HUMAN	Q	444	ENSP00000379098:P444Q	ENSP00000379098:P444Q	P	-	2	0	CAMK2B	44235520	0.000000	0.05858	0.458000	0.27068	0.879000	0.50718	0.020000	0.13466	-0.092000	0.12417	0.558000	0.71614	CCA	.	.	.	none		0.687	CAMK2B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251138.2	NM_172084	
STEAP4	79689	hgsc.bcm.edu	37	7	87912402	87912402	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr7:87912402G>T	ENST00000380079.4	-	3	639	c.538C>A	c.(538-540)Caa>Aaa	p.Q180K	AC003991.3_ENST00000595121.1_RNA|STEAP4_ENST00000301959.5_Intron|AC003991.3_ENST00000447758.1_RNA|AC003991.3_ENST00000600908.1_RNA|STEAP4_ENST00000414498.1_Missense_Mutation_p.Q180K|AC003991.3_ENST00000434733.1_RNA	NM_001205315.1|NM_024636.3	NP_001192244.1|NP_078912.2	Q687X5	STEA4_HUMAN	STEAP family member 4	180					copper ion import (GO:0015677)|fat cell differentiation (GO:0045444)|ferric iron import into cell (GO:0097461)|iron ion homeostasis (GO:0055072)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(3)	15	Esophageal squamous(14;0.00802)					AGTGATCCTTGATCCATTGGA	0.418																																					p.Q180K		Atlas-SNP	.											.	STEAP4	54	.	0			c.C538A						PASS	.						82.0	77.0	79.0					7																	87912402		1901	4131	6032	SO:0001583	missense	79689	exon4			ATCCTTGATCCAT	AK026806	CCDS43611.1, CCDS56494.1	7q21.13	2014-01-28	2005-06-15	2005-06-15	ENSG00000127954	ENSG00000127954			21923	protein-coding gene	gene with protein product		611098	"""tumor necrosis factor, alpha-induced protein 9"""	TNFAIP9		11443137, 15897894	Standard	NM_024636		Approved	FLJ23153, TIARP, STAMP2	uc003ujs.3	Q687X5	OTTHUMG00000153853	ENST00000380079.4:c.538C>A	chr7.hg19:g.87912402G>T	ENSP00000369419:p.Gln180Lys	78.0	0.0	.		101.0	57.0	.	NM_001205315	Q658Q9|Q687X4|Q8WWB0|Q9H5R1	Missense_Mutation	SNP	ENST00000380079.4	hg19	CCDS43611.1	.	.	.	.	.	.	.	.	.	.	G	0.091	-1.167648	0.01660	.	.	ENSG00000127954	ENST00000380079;ENST00000414498	T;T	0.16597	2.33;2.33	5.98	3.12	0.35913	NAD(P)-binding domain (1);	0.395807	0.33691	N	0.004657	T	0.10078	0.0247	N	0.16862	0.45	0.29002	N	0.887404	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.19095	-1.0316	10	0.27785	T	0.31	-1.2064	10.4832	0.44706	0.0633:0.0:0.358:0.5787	.	180;180	C9JS50;Q687X5	.;STEA4_HUMAN	K	180	ENSP00000369419:Q180K;ENSP00000394399:Q180K	ENSP00000369419:Q180K	Q	-	1	0	STEAP4	87750338	1.000000	0.71417	0.998000	0.56505	0.557000	0.35523	1.336000	0.33850	0.375000	0.24679	0.591000	0.81541	CAA	.	.	.	none		0.418	STEAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332712.4	NM_024636	
LAMB1	3912	hgsc.bcm.edu	37	7	107577548	107577548	+	Silent	SNP	T	T	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr7:107577548T>A	ENST00000222399.6	-	26	4166	c.3936A>T	c.(3934-3936)tcA>tcT	p.S1312S	LAMB1_ENST00000474380.1_5'UTR|LAMB1_ENST00000393561.1_Silent_p.S1336S	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1312	Domain II.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						CCCGAATATCTGAGTTTTTGA	0.383																																					p.S1312S		Atlas-SNP	.											.	LAMB1	185	.	0			c.A3936T						PASS	.						163.0	143.0	150.0					7																	107577548		2203	4300	6503	SO:0001819	synonymous_variant	3912	exon26			AATATCTGAGTTT	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.3936A>T	chr7.hg19:g.107577548T>A		78.0	0.0	.		101.0	50.0	.	NM_002291	Q14D91	Silent	SNP	ENST00000222399.6	hg19	CCDS5750.1																																																																																			.	.	.	none		0.383	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291	
ZNF395	55893	hgsc.bcm.edu	37	8	28209284	28209284	+	Missense_Mutation	SNP	A	A	C			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr8:28209284A>C	ENST00000344423.5	-	7	1092	c.961T>G	c.(961-963)Ttc>Gtc	p.F321V	ZNF395_ENST00000523095.1_Missense_Mutation_p.F321V|ZNF395_ENST00000523202.1_Missense_Mutation_p.F321V	NM_018660.2	NP_061130.1	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	321					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(5)|large_intestine(6)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		GTGTAGTAGAAATCCTCCTCC	0.617																																					p.F321V		Atlas-SNP	.											.	ZNF395	54	.	0			c.T961G						PASS	.						102.0	108.0	106.0					8																	28209284		2203	4300	6503	SO:0001583	missense	55893	exon7			AGTAGAAATCCTC	AB044750	CCDS6067.1	8p21	2008-05-02			ENSG00000186918	ENSG00000186918		"""Zinc fingers, C2H2-type"""	18737	protein-coding gene	gene with protein product		609494				14625278	Standard	NM_018660		Approved	PRF-1, HDBP2, PBF, DKFZp434K1210	uc003xgr.3	Q9H8N7	OTTHUMG00000102137	ENST00000344423.5:c.961T>G	chr8.hg19:g.28209284A>C	ENSP00000340494:p.Phe321Val	7.0	0.0	.		14.0	7.0	.	NM_018660	B3KUY7|D3DST4|Q6F6H2|Q9BY72|Q9NPB2|Q9NS57|Q9NS58|Q9NS59	Missense_Mutation	SNP	ENST00000344423.5	hg19	CCDS6067.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.695035	0.88830	.	.	ENSG00000186918	ENST00000344423;ENST00000523202;ENST00000523095	T;T;T	0.60040	0.22;0.22;0.22	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.76622	0.4013	M	0.83384	2.64	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.80560	-0.1328	10	0.87932	D	0	-20.2258	12.6693	0.56858	1.0:0.0:0.0:0.0	.	321	Q9H8N7	ZN395_HUMAN	V	321	ENSP00000340494:F321V;ENSP00000429640:F321V;ENSP00000428452:F321V	ENSP00000340494:F321V	F	-	1	0	ZNF395	28265203	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.081000	0.94049	1.895000	0.54865	0.459000	0.35465	TTC	.	.	.	none		0.617	ZNF395-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219976.1		
PKHD1L1	93035	hgsc.bcm.edu	37	8	110477416	110477416	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr8:110477416G>T	ENST00000378402.5	+	49	8459	c.8355G>T	c.(8353-8355)aaG>aaT	p.K2785N		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2785					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CACCGAACAAGGCTGGCTTTC	0.403										HNSCC(38;0.096)																											p.K2785N		Atlas-SNP	.											.	PKHD1L1	522	.	0			c.G8355T						PASS	.						85.0	88.0	87.0					8																	110477416		1953	4133	6086	SO:0001583	missense	93035	exon49			GAACAAGGCTGGC	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.8355G>T	chr8.hg19:g.110477416G>T	ENSP00000367655:p.Lys2785Asn	125.0	0.0	.		185.0	83.0	.	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	hg19	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	11.62	1.693236	0.30052	.	.	ENSG00000205038	ENST00000378402	D	0.87650	-2.28	5.82	3.62	0.41486	.	0.000000	0.85682	D	0.000000	D	0.87485	0.6189	M	0.80422	2.495	0.32991	D	0.524954	B	0.25667	0.131	B	0.33690	0.168	D	0.88712	0.3223	10	0.48119	T	0.1	.	10.1947	0.43047	0.2039:0.0:0.7961:0.0	.	2785	Q86WI1	PKHL1_HUMAN	N	2785	ENSP00000367655:K2785N	ENSP00000367655:K2785N	K	+	3	2	PKHD1L1	110546592	1.000000	0.71417	1.000000	0.80357	0.140000	0.21249	2.278000	0.43426	1.382000	0.46385	0.557000	0.71058	AAG	.	.	.	none		0.403	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
FAM91A1	157769	hgsc.bcm.edu	37	8	124786386	124786386	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr8:124786386C>T	ENST00000334705.7	+	2	385	c.139C>T	c.(139-141)Cga>Tga	p.R47*	FAM91A1_ENST00000521166.1_Nonsense_Mutation_p.R47*	NM_144963.2	NP_659400	Q658Y4	F91A1_HUMAN	family with sequence similarity 91, member A1	47										breast(4)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00192)			CAATCAGTTACGATATAGAAA	0.333																																					p.R47X		Atlas-SNP	.											.	FAM91A1	77	.	0			c.C139T						PASS	.						146.0	151.0	149.0					8																	124786386		1842	4096	5938	SO:0001587	stop_gained	157769	exon2			CAGTTACGATATA	AK074370	CCDS6346.2	8q24.13	2005-10-04			ENSG00000176853	ENSG00000176853			26306	protein-coding gene	gene with protein product						12477932	Standard	XM_005250806		Approved	FLJ23790	uc003yqv.3	Q658Y4	OTTHUMG00000133021	ENST00000334705.7:c.139C>T	chr8.hg19:g.124786386C>T	ENSP00000335082:p.Arg47*	91.0	0.0	.		134.0	46.0	.	NM_144963	B6YY23|Q658T5|Q8TE89	Nonsense_Mutation	SNP	ENST00000334705.7	hg19	CCDS6346.2	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890996	0.91889	.	.	ENSG00000176853	ENST00000521166;ENST00000334705;ENST00000395537	.	.	.	5.73	5.73	0.89815	.	0.000000	0.64402	U	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.7109	0.69232	0.1448:0.8551:0.0:0.0	.	.	.	.	X	47	.	ENSP00000335082:R47X	R	+	1	2	FAM91A1	124855567	1.000000	0.71417	1.000000	0.80357	0.385000	0.30292	4.279000	0.58953	2.706000	0.92434	0.655000	0.94253	CGA	.	.	.	none		0.333	FAM91A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256607.1	NM_144963	
FAM122A	116224	hgsc.bcm.edu	37	9	71395705	71395705	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr9:71395705G>A	ENST00000394264.3	+	1	742	c.625G>A	c.(625-627)Gaa>Aaa	p.E209K	PIP5K1B_ENST00000265382.3_Intron|PIP5K1B_ENST00000541509.1_Intron	NM_138333.3	NP_612206.3	Q96E09	F122A_HUMAN	family with sequence similarity 122A	209										endometrium(1)|lung(2)	3						ATGTGAAATGGAAACTGAATA	0.468																																					p.E209K		Atlas-SNP	.											.	FAM122A	14	.	0			c.G625A						PASS	.						98.0	97.0	97.0					9																	71395705		2203	4300	6503	SO:0001583	missense	116224	exon1			GAAATGGAAACTG	AK126379	CCDS6623.1	9q21.13	2011-02-10	2006-07-11	2006-07-11	ENSG00000187866	ENSG00000187866			23490	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 42"""	C9orf42		12477932	Standard	NM_138333		Approved	MGC17347	uc004agw.1	Q96E09	OTTHUMG00000019971	ENST00000394264.3:c.625G>A	chr9.hg19:g.71395705G>A	ENSP00000377807:p.Glu209Lys	85.0	0.0	.		127.0	59.0	.	NM_138333		Missense_Mutation	SNP	ENST00000394264.3	hg19	CCDS6623.1	.	.	.	.	.	.	.	.	.	.	G	19.45	3.829420	0.71258	.	.	ENSG00000187866	ENST00000394264;ENST00000377279	T	0.55234	0.53	4.42	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.67316	0.2880	M	0.64404	1.975	0.40534	D	0.980958	D	0.67145	0.996	D	0.73708	0.981	T	0.69247	-0.5195	10	0.59425	D	0.04	-51.6435	12.8382	0.57786	0.0:0.0:1.0:0.0	.	209	Q96E09	F122A_HUMAN	K	209;193	ENSP00000377807:E209K	ENSP00000366492:E193K	E	+	1	0	FAM122A	70585525	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.304000	0.78882	2.758000	0.94735	0.563000	0.77884	GAA	.	.	.	none		0.468	FAM122A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052556.1	NM_138333	
KIF27	55582	hgsc.bcm.edu	37	9	86495384	86495384	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr9:86495384C>A	ENST00000297814.2	-	11	2614	c.2471G>T	c.(2470-2472)aGt>aTt	p.S824I	KIF27_ENST00000376347.1_Missense_Mutation_p.S215I|KIF27_ENST00000413982.1_Intron|KIF27_ENST00000334204.2_Missense_Mutation_p.S824I	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	824					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						CAGTTTCTTACTATCTTGTTG	0.343																																					p.S824I		Atlas-SNP	.											.	KIF27	103	.	0			c.G2471T						PASS	.						179.0	161.0	167.0					9																	86495384		2203	4300	6503	SO:0001583	missense	55582	exon11			TTCTTACTATCTT	AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.2471G>T	chr9.hg19:g.86495384C>A	ENSP00000297814:p.Ser824Ile	27.0	0.0	.		26.0	13.0	.	NM_017576	B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Missense_Mutation	SNP	ENST00000297814.2	hg19	CCDS6665.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.849807	0.51270	.	.	ENSG00000165115	ENST00000297814;ENST00000334204;ENST00000376347	T;T;T	0.31247	1.5;1.5;1.5	4.92	1.56	0.23342	.	0.214282	0.30320	N	0.009884	T	0.24547	0.0595	L	0.54323	1.7	0.32967	D	0.5218	P;P	0.42620	0.785;0.679	B;B	0.39258	0.295;0.231	T	0.34204	-0.9838	10	0.23891	T	0.37	.	9.2369	0.37473	0.0:0.3622:0.5428:0.095	.	824;824	Q86VH2-3;Q86VH2	.;KIF27_HUMAN	I	824;824;215	ENSP00000297814:S824I;ENSP00000333928:S824I;ENSP00000365525:S215I	ENSP00000297814:S824I	S	-	2	0	KIF27	85685204	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	4.424000	0.59868	0.561000	0.29186	0.484000	0.47621	AGT	.	.	.	none		0.343	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052861.1	NM_017576	
LHX6	26468	hgsc.bcm.edu	37	9	124979514	124979514	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr9:124979514C>A	ENST00000373755.2	-	4	536	c.428G>T	c.(427-429)tGg>tTg	p.W143L	LHX6_ENST00000340587.3_Missense_Mutation_p.W172L|LHX6_ENST00000559895.1_5'UTR|LHX6_ENST00000373754.2_Missense_Mutation_p.W143L|LHX6_ENST00000394319.4_Missense_Mutation_p.W172L|LHX6_ENST00000541397.2_Missense_Mutation_p.W161L	NM_001242334.1	NP_001229263.1	Q9UPM6	LHX6_HUMAN	LIM homeobox 6	143	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.|Required for interaction with LDB1. {ECO:0000250}.				cell maturation (GO:0048469)|cerebral cortex GABAergic interneuron migration (GO:0021853)|cerebral cortex radially oriented cell migration (GO:0021799)|cerebral cortex tangential migration (GO:0021800)|forebrain neuron fate commitment (GO:0021877)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(5)	8						TCTCCGCACCCAGTCGCTGGC	0.667																																					p.W172L		Atlas-SNP	.											.	LHX6	73	.	0			c.G515T						PASS	.						48.0	48.0	48.0					9																	124979514		2203	4300	6503	SO:0001583	missense	26468	exon5			CGCACCCAGTCGC	AB031041	CCDS6837.2, CCDS6838.2, CCDS56583.1, CCDS56584.1, CCDS59144.1	9q33.2	2011-06-20			ENSG00000106852	ENSG00000106852		"""Homeoboxes / LIM class"""	21735	protein-coding gene	gene with protein product		608215				10393337	Standard	NM_014368		Approved	LHX6.1	uc004blx.4	Q9UPM6	OTTHUMG00000020601	ENST00000373755.2:c.428G>T	chr9.hg19:g.124979514C>A	ENSP00000362860:p.Trp143Leu	64.0	0.0	.		143.0	91.0	.	NM_014368	A6PVQ1|A6PVQ2|A8K1B2|B7Z4D0|H0YN76|Q5T7S7|Q5T7S8|Q9NTK3|Q9UPM5	Missense_Mutation	SNP	ENST00000373755.2	hg19	CCDS56583.1	.	.	.	.	.	.	.	.	.	.	C	35	5.590064	0.96590	.	.	ENSG00000106852	ENST00000373755;ENST00000373754;ENST00000394319;ENST00000340587;ENST00000541397	D;D;D;D;D	0.85629	-2.01;-2.01;-2.01;-2.01;-2.01	5.87	5.87	0.94306	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	D	0.85427	0.5694	N	0.11789	0.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.82366	-0.0493	10	0.17369	T	0.5	.	19.1961	0.93690	0.0:1.0:0.0:0.0	.	143;172;172	Q9UPM6;Q9UPM6-4;Q9UPM6-3	LHX6_HUMAN;.;.	L	143;143;172;172;161	ENSP00000362860:W143L;ENSP00000362859:W143L;ENSP00000377854:W172L;ENSP00000340137:W172L;ENSP00000441464:W161L	ENSP00000340137:W172L	W	-	2	0	LHX6	124019335	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.920000	0.70017	2.781000	0.95711	0.655000	0.94253	TGG	.	.	.	none		0.667	LHX6-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053924.2	NM_014368	
MAPKAP1	79109	hgsc.bcm.edu	37	9	128230280	128230280	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr9:128230280G>A	ENST00000373498.1	-	9	1384	c.1316C>T	c.(1315-1317)gCc>gTc	p.A439V	MAPKAP1_ENST00000265960.3_Missense_Mutation_p.A439V|MAPKAP1_ENST00000350766.3_Missense_Mutation_p.A403V|MAPKAP1_ENST00000373511.2_Missense_Mutation_p.A392V|MAPKAP1_ENST00000483937.1_5'UTR|MAPKAP1_ENST00000373503.3_Missense_Mutation_p.A247V|MAPKAP1_ENST00000394063.1_Missense_Mutation_p.A247V|MAPKAP1_ENST00000373497.5_Missense_Mutation_p.A152V			Q9BPZ7	SIN1_HUMAN	mitogen-activated protein kinase associated protein 1	439					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of Ras protein signal transduction (GO:0046580)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|substantia nigra development (GO:0021762)|T cell costimulation (GO:0031295)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein kinase binding (GO:0019901)|Ras GTPase binding (GO:0017016)			endometrium(2)|kidney(1)|large_intestine(2)|lung(15)|ovary(3)	23						AAGGTCACAGGCACAGAGCAG	0.468																																					p.A439V		Atlas-SNP	.											.	MAPKAP1	68	.	0			c.C1316T						PASS	.						175.0	170.0	172.0					9																	128230280		2203	4300	6503	SO:0001583	missense	79109	exon10			TCACAGGCACAGA	M37191	CCDS6864.1, CCDS35139.1, CCDS35140.1, CCDS35141.1, CCDS48020.1	9q34.11	2008-02-05			ENSG00000119487	ENSG00000119487			18752	protein-coding gene	gene with protein product	"""stress-activated protein kinase-interacting 1"""	610558				15363842	Standard	NM_001006620		Approved	MGC2745, SIN1, MIP1	uc004bpv.3	Q9BPZ7	OTTHUMG00000020683	ENST00000373498.1:c.1316C>T	chr9.hg19:g.128230280G>A	ENSP00000362597:p.Ala439Val	82.0	0.0	.		227.0	66.0	.	NM_001006617	A8K1Z5|B1AMA4|B7Z309|Q00426|Q5JSV5|Q5JSV6|Q5JSV9|Q658R0|Q699U1|Q699U2|Q699U3|Q699U4|Q6GVJ0|Q6GVJ1|Q6GVJ2	Missense_Mutation	SNP	ENST00000373498.1	hg19	CCDS35140.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.959084	0.74016	.	.	ENSG00000119487	ENST00000373511;ENST00000350766;ENST00000373503;ENST00000373498;ENST00000265960;ENST00000394063;ENST00000373497;ENST00000420643	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.67239	0.2872	M	0.69823	2.125	0.80722	D	1	P;P;P;P	0.40534	0.72;0.702;0.649;0.629	B;B;B;B	0.42959	0.335;0.342;0.254;0.403	T	0.61802	-0.6988	9	0.17369	T	0.5	-9.146	20.6593	0.99626	0.0:0.0:1.0:0.0	.	152;392;403;439	B7Z5E5;Q9BPZ7-3;Q9BPZ7-2;Q9BPZ7	.;.;.;SIN1_HUMAN	V	392;403;247;439;439;247;152;211	.	ENSP00000265960:A439V	A	-	2	0	MAPKAP1	127270101	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.885000	0.99019	0.655000	0.94253	GCC	.	.	.	none		0.468	MAPKAP1-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054092.1		
PITRM1	10531	hgsc.bcm.edu	37	10	3208566	3208567	+	Missense_Mutation	DNP	CT	CT	TG	rs28416720|rs33996077|rs4266975|rs148472807|rs114690446	byFrequency	TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C|T	C|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr10:3208566_3208567CT>TG	ENST00000224949.4	-	4	306_307	c.272_273AG>CA	c.(271-273)cAG>cCA	p.Q91P	PITRM1-AS1_ENST00000598280.1_RNA|PITRM1_ENST00000451104.2_Missense_Mutation_p.Q59P|PITRM1-AS1_ENST00000601046.1_RNA|PITRM1_ENST00000380989.2_Missense_Mutation_p.Q91P			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	91					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						TAGTACGGAACTGCACGCTAGG	0.49																																					p.Q91Q|p.Q91P		Atlas-SNP	.											PITRM1,colon,carcinoma,-1,3|PITRM1,colon,carcinoma,0,3	PITRM1	109	.	0			c.G273A|c.A272C						PASS	.																																			SO:0001583	missense	10531	exon4			ACGGAACTGCACG|CGGAACTGCACGC	AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.272_273delinsTG	chr10.hg19:g.3208566_3208567delinsTG	ENSP00000224949:p.Gln91Pro	48.0|47.0	0.0	.		58.0|57.0	6.0	.	NM_014889	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Silent|Missense_Mutation	SNP	ENST00000224949.4	hg19	CCDS59208.1																																																																																			.	.	.	weak		0.490	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046469.2		
ANK3	288	hgsc.bcm.edu	37	10	61868591	61868591	+	Nonsense_Mutation	SNP	A	A	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr10:61868591A>T	ENST00000280772.2	-	27	3361	c.3170T>A	c.(3169-3171)tTa>tAa	p.L1057*	ANK3_ENST00000355288.2_Nonsense_Mutation_p.L191*|ANK3_ENST00000503366.1_Nonsense_Mutation_p.L1058*|ANK3_ENST00000373827.2_Nonsense_Mutation_p.L1051*	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1057	ZU5 1. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						AACTTACCCTAAAAATTGTGC	0.433																																					p.L1058X		Atlas-SNP	.											.	ANK3	703	.	0			c.T3173A						PASS	.						55.0	59.0	58.0					10																	61868591		2203	4300	6503	SO:0001587	stop_gained	288	exon28			TACCCTAAAAATT	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.3170T>A	chr10.hg19:g.61868591A>T	ENSP00000280772:p.Leu1057*	101.0	0.0	.		145.0	66.0	.	NM_001204404	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Nonsense_Mutation	SNP	ENST00000280772.2	hg19	CCDS7258.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	42|42	9.181035|9.181035	0.99092|0.99092	.|.	.|.	ENSG00000151150|ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000355288;ENST00000423532;ENST00000503366;ENST00000395299;ENST00000373817;ENST00000395293;ENST00000395304;ENST00000544789;ENST00000536348;ENST00000373815|ENST00000467420	.|.	.|.	.|.	6.04|6.04	6.04|6.04	0.98038|0.98038	.|.	0.000000|.	0.33401|.	N|.	0.004958|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.02654|.	T|.	1|.	.|.	16.5885|16.5885	0.84745|0.84745	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	X|K	1057;1051;191;191;1058;1037;292;692;692;190;590;182|82	.|.	ENSP00000280772:L1057X|.	L|X	-|-	2|1	0|0	ANK3|ANK3	61538597|61538597	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.339000|9.339000	0.96797|0.96797	2.317000|2.317000	0.78254|0.78254	0.460000|0.460000	0.39030|0.39030	TTA|TAG	.	.	.	none		0.433	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
VCL	7414	hgsc.bcm.edu	37	10	75877813	75877813	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr10:75877813C>G	ENST00000211998.4	+	22	3385	c.3291C>G	c.(3289-3291)aaC>aaG	p.N1097K	RP11-178G16.4_ENST00000598318.1_lincRNA|VCL_ENST00000417648.2_Missense_Mutation_p.N290K|VCL_ENST00000372755.3_Missense_Mutation_p.N1029K|RP11-178G16.5_ENST00000599110.1_lincRNA	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	1097	C-terminal tail.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					ATGCCCAGAACCTCATGCAGT	0.493																																					p.N1097K		Atlas-SNP	.											.	VCL	77	.	0			c.C3291G						PASS	.						160.0	144.0	149.0					10																	75877813		2203	4300	6503	SO:0001583	missense	7414	exon22			CCAGAACCTCATG	M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.3291C>G	chr10.hg19:g.75877813C>G	ENSP00000211998:p.Asn1097Lys	68.0	0.0	.		104.0	51.0	.	NM_014000	Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Missense_Mutation	SNP	ENST00000211998.4	hg19	CCDS7341.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.228247	0.79576	.	.	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000417648;ENST00000537043;ENST00000436396	T;T;T;T	0.61980	0.06;0.06;0.06;0.06	5.5	4.6	0.57074	.	0.043322	0.85682	D	0.000000	T	0.77458	0.4133	M	0.75777	2.31	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.999;0.999	D;D;D;D	0.85130	0.997;0.978;0.977;0.945	T	0.79971	-0.1578	10	0.87932	D	0	.	12.3333	0.55051	0.0:0.8596:0.0:0.1404	.	290;956;1029;1097	B4DTM7;F5H7T3;P18206-2;P18206	.;.;.;VINC_HUMAN	K	1029;1097;290;956;769	ENSP00000361841:N1029K;ENSP00000211998:N1097K;ENSP00000411887:N290K;ENSP00000415489:N769K	ENSP00000211998:N1097K	N	+	3	2	VCL	75547819	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.553000	0.36255	1.325000	0.45301	0.655000	0.94253	AAC	.	.	.	none		0.493	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003373, NM_014000	
RRP12	23223	hgsc.bcm.edu	37	10	99120318	99120318	+	Missense_Mutation	SNP	G	G	A	rs370146748		TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr10:99120318G>A	ENST00000370992.4	-	31	3736	c.3625C>T	c.(3625-3627)Ccc>Tcc	p.P1209S	RRP12_ENST00000479481.1_5'UTR|RRP12_ENST00000536831.1_Missense_Mutation_p.P927S|RRP12_ENST00000414986.1_Missense_Mutation_p.P1148S|RRP12_ENST00000315563.6_Missense_Mutation_p.P1109S	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	1209						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		TACTGAGGGGGTATCTCCAGC	0.557																																					p.P1209S		Atlas-SNP	.											.	RRP12	97	.	0			c.C3625T						PASS	.	G	SER/PRO,SER/PRO	1,4405	2.1+/-5.4	0,1,2202	178.0	150.0	160.0		3442,3625	4.5	0.4	10		160	0,8600		0,0,4300	no	missense,missense	RRP12	NM_001145114.1,NM_015179.3	74,74	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	1148/1237,1209/1298	99120318	1,13005	2203	4300	6503	SO:0001583	missense	23223	exon31			GAGGGGGTATCTC		CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.3625C>T	chr10.hg19:g.99120318G>A	ENSP00000360031:p.Pro1209Ser	36.0	0.0	.		69.0	37.0	.	NM_015179	B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Missense_Mutation	SNP	ENST00000370992.4	hg19	CCDS7457.1	.	.	.	.	.	.	.	.	.	.	G	10.48	1.361285	0.24684	2.27E-4	0.0	ENSG00000052749	ENST00000370992;ENST00000315563;ENST00000414986;ENST00000536831	T;T;T;T	0.26957	1.7;1.7;1.7;1.7	5.44	4.52	0.55395	.	0.325404	0.32459	N	0.006067	T	0.13329	0.0323	N	0.25060	0.705	0.09310	N	1	B;B;B;B	0.31769	0.339;0.154;0.332;0.121	B;B;B;B	0.30572	0.055;0.02;0.117;0.021	T	0.23940	-1.0174	10	0.08599	T	0.76	-13.4716	7.0747	0.25197	0.087:0.0:0.7401:0.1729	.	1148;1109;927;1209	E9PCK7;Q5JTH9-2;F5H456;Q5JTH9	.;.;.;RRP12_HUMAN	S	1209;1109;1148;927	ENSP00000360031:P1209S;ENSP00000324315:P1109S;ENSP00000414863:P1148S;ENSP00000446184:P927S	ENSP00000324315:P1109S	P	-	1	0	RRP12	99110308	0.708000	0.27876	0.416000	0.26546	0.833000	0.47200	3.456000	0.53000	1.253000	0.44018	0.462000	0.41574	CCC	.	.	.	none		0.557	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049699.4	NM_015179	
RRP12	23223	hgsc.bcm.edu	37	10	99126540	99126540	+	Silent	SNP	C	C	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr10:99126540C>T	ENST00000370992.4	-	27	3285	c.3174G>A	c.(3172-3174)gaG>gaA	p.E1058E	RRP12_ENST00000479481.1_5'UTR|RRP12_ENST00000536831.1_Silent_p.E776E|RRP12_ENST00000414986.1_Silent_p.E997E|RRP12_ENST00000315563.6_Silent_p.E958E	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	1058	Glu-rich.					integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		cctcctcctcctcttcttcct	0.662																																					p.E1058E		Atlas-SNP	.											.	RRP12	97	.	0			c.G3174A						PASS	.						94.0	108.0	103.0					10																	99126540		2203	4300	6503	SO:0001819	synonymous_variant	23223	exon27			CTCCTCCTCTTCT		CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.3174G>A	chr10.hg19:g.99126540C>T		32.0	0.0	.		69.0	6.0	.	NM_015179	B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Silent	SNP	ENST00000370992.4	hg19	CCDS7457.1																																																																																			.	.	.	none		0.662	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049699.4	NM_015179	
GBF1	8729	hgsc.bcm.edu	37	10	104136491	104136491	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr10:104136491A>G	ENST00000369983.3	+	32	4479	c.4219A>G	c.(4219-4221)Aca>Gca	p.T1407A		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	1407					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		TGCCCACATCACACCTGACAA	0.552																																					p.T1408A		Atlas-SNP	.											.	GBF1	142	.	0			c.A4222G						PASS	.						91.0	86.0	88.0					10																	104136491		2203	4300	6503	SO:0001583	missense	8729	exon32			CACATCACACCTG	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.4219A>G	chr10.hg19:g.104136491A>G	ENSP00000359000:p.Thr1407Ala	29.0	0.0	.		48.0	26.0	.	NM_001199378	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	ENST00000369983.3	hg19	CCDS7533.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.437435	0.83885	.	.	ENSG00000107862	ENST00000369983	T	0.24350	1.86	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.54447	0.1859	M	0.82193	2.58	0.80722	D	1	D;D;P	0.89917	1.0;0.997;0.901	D;P;P	0.85130	0.997;0.872;0.458	T	0.61686	-0.7012	10	0.72032	D	0.01	-11.5608	14.8604	0.70376	1.0:0.0:0.0:0.0	.	1407;1407;1407	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	A	1407	ENSP00000359000:T1407A	ENSP00000359000:T1407A	T	+	1	0	GBF1	104126481	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.139000	0.94554	2.100000	0.63781	0.379000	0.24179	ACA	.	.	.	none		0.552	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
SCAF11	9169	hgsc.bcm.edu	37	12	46327006	46327006	+	Silent	SNP	A	A	G			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr12:46327006A>G	ENST00000369367.3	-	9	875	c.642T>C	c.(640-642)ttT>ttC	p.F214F	SCAF11_ENST00000419565.2_Silent_p.F214F|SCAF11_ENST00000549162.1_Silent_p.F22F	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	214					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						TGGCTTCTATAAATTCTGTAC	0.328																																					p.F214F		Atlas-SNP	.											.	SCAF11	145	.	0			c.T642C						PASS	.						78.0	73.0	75.0					12																	46327006		1813	4064	5877	SO:0001819	synonymous_variant	9169	exon9			TTCTATAAATTCT	Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.642T>C	chr12.hg19:g.46327006A>G		33.0	0.0	.		67.0	23.0	.	NM_004719	A6NEU9|A6NLW5|Q8IW59	Silent	SNP	ENST00000369367.3	hg19	CCDS8748.2																																																																																			.	.	.	none		0.328	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719	
GRASP	160622	hgsc.bcm.edu	37	12	52401044	52401044	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr12:52401044C>T	ENST00000293662.4	+	1	321	c.241C>T	c.(241-243)Cga>Tga	p.R81*		NM_181711.2	NP_859062.1	Q7Z6J2	GRASP_HUMAN	GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein	81					protein localization (GO:0008104)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				central_nervous_system(1)|large_intestine(1)|lung(1)|skin(2)	5				BRCA - Breast invasive adenocarcinoma(357;0.0967)		CCTGCCCCGCCGAAAGGTGCG	0.731																																					p.R81X		Atlas-SNP	.											.	GRASP	23	.	0			c.C241T						PASS	.						9.0	10.0	10.0					12																	52401044		1849	3898	5747	SO:0001587	stop_gained	160622	exon1			CCCCGCCGAAAGG	AC019244	CCDS8817.1, CCDS61124.1	12q13.13	2011-09-02			ENSG00000161835	ENSG00000161835			18707	protein-coding gene	gene with protein product		612027				10828067	Standard	NM_001271856		Approved		uc001rzo.2	Q7Z6J2	OTTHUMG00000169595	ENST00000293662.4:c.241C>T	chr12.hg19:g.52401044C>T	ENSP00000293662:p.Arg81*	38.0	0.0	.		71.0	35.0	.	NM_181711	Q6PIF8|Q7Z741	Nonsense_Mutation	SNP	ENST00000293662.4	hg19	CCDS8817.1	.	.	.	.	.	.	.	.	.	.	C	33	5.198082	0.94997	.	.	ENSG00000161835	ENST00000293662	.	.	.	4.74	3.78	0.43462	.	0.563109	0.17616	N	0.167905	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-0.1895	10.1004	0.42502	0.0:0.7959:0.2041:0.0	.	.	.	.	X	81	.	ENSP00000293662:R81X	R	+	1	2	GRASP	50687311	1.000000	0.71417	1.000000	0.80357	0.333000	0.28666	1.223000	0.32527	2.194000	0.70268	0.549000	0.68633	CGA	.	.	.	none		0.731	GRASP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404972.1		
ANKS1B	56899	hgsc.bcm.edu	37	12	99478796	99478796	+	Silent	SNP	G	G	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr12:99478796G>A	ENST00000547776.2	-	16	2531	c.2532C>T	c.(2530-2532)agC>agT	p.S844S	ANKS1B_ENST00000546960.1_Silent_p.S70S|ANKS1B_ENST00000550693.2_Silent_p.S70S|ANKS1B_ENST00000547446.1_Silent_p.S39S|ANKS1B_ENST00000549025.2_Silent_p.S13S|ANKS1B_ENST00000329257.7_Silent_p.S844S|ANKS1B_ENST00000549493.2_Silent_p.S70S|ANKS1B_ENST00000547010.1_Silent_p.S420S|RNA5SP366_ENST00000365454.1_RNA|ANKS1B_ENST00000549558.2_Silent_p.S70S|ANKS1B_ENST00000332712.7_Silent_p.S70S|ANKS1B_ENST00000546568.1_Silent_p.S70S	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	844	SAM 1. {ECO:0000255|PROSITE- ProRule:PRU00184}.					cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		CCATAACATTGCTTCCCTGAA	0.358																																					p.S844S		Atlas-SNP	.											.	ANKS1B	180	.	0			c.C2532T						PASS	.						70.0	66.0	67.0					12																	99478796		1839	4088	5927	SO:0001819	synonymous_variant	56899	exon16			AACATTGCTTCCC	AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.2532C>T	chr12.hg19:g.99478796G>A		70.0	0.0	.		131.0	55.0	.	NM_152788	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Silent	SNP	ENST00000547776.2	hg19	CCDS55872.1	.	.	.	.	.	.	.	.	.	.	G	9.174	1.021948	0.19433	.	.	ENSG00000185046	ENST00000550778	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	T	0.71745	0.3376	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70554	-0.4840	4	.	.	.	-9.1482	15.8445	0.78876	0.0:0.0:1.0:0.0	.	.	.	.	V	116	.	.	A	-	2	0	ANKS1B	98002927	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.521000	0.45563	2.491000	0.84063	0.561000	0.74099	GCA	.	.	.	none		0.358	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3	NM_020140	
CCDC63	160762	hgsc.bcm.edu	37	12	111345141	111345141	+	Missense_Mutation	SNP	A	A	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr12:111345141A>T	ENST00000308208.5	+	12	1795	c.1553A>T	c.(1552-1554)cAg>cTg	p.Q518L	CCDC63_ENST00000545036.1_Missense_Mutation_p.Q478L|CCDC63_ENST00000552694.1_Missense_Mutation_p.Q439L	NM_152591.1	NP_689804.1	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	518										NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(1)	39						GCAGTGGAACAGCCCCTGGAC	0.567																																					p.Q518L		Atlas-SNP	.											.	CCDC63	89	.	0			c.A1553T						PASS	.						47.0	42.0	44.0					12																	111345141		2203	4300	6503	SO:0001583	missense	160762	exon12			TGGAACAGCCCCT	AK093162	CCDS9151.1, CCDS66470.1, CCDS73528.1	12q24.11	2013-02-19				ENSG00000173093			26669	protein-coding gene	gene with protein product	"""outer row dynein assembly 5 homolog (Chlamydomonas)"""						Standard	NM_001286243		Approved	ODA5, FLJ35843	uc001trv.1	Q8NA47	OTTHUMG00000169534	ENST00000308208.5:c.1553A>T	chr12.hg19:g.111345141A>T	ENSP00000312399:p.Gln518Leu	40.0	0.0	.		48.0	25.0	.	NM_152591	B4DY03|Q0P603|Q6P2E1	Missense_Mutation	SNP	ENST00000308208.5	hg19	CCDS9151.1	.	.	.	.	.	.	.	.	.	.	A	0.037	-1.304034	0.01353	.	.	ENSG00000173093	ENST00000545036;ENST00000308208;ENST00000552694	T;T;T	0.31247	1.51;1.5;1.5	4.01	2.83	0.33086	.	0.831369	0.10661	N	0.648749	T	0.27967	0.0689	L	0.60455	1.87	0.09310	N	1	B	0.25904	0.137	B	0.18561	0.022	T	0.18461	-1.0336	10	0.35671	T	0.21	.	7.749	0.28886	0.7879:0.2121:0.0:0.0	.	518	Q8NA47	CCD63_HUMAN	L	478;518;439	ENSP00000445881:Q478L;ENSP00000312399:Q518L;ENSP00000450217:Q439L	ENSP00000312399:Q518L	Q	+	2	0	CCDC63	109829524	0.002000	0.14202	0.164000	0.22755	0.032000	0.12392	1.254000	0.32897	0.679000	0.31345	0.444000	0.29173	CAG	.	.	.	none		0.567	CCDC63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404673.2	NM_152591	
WDR66	144406	hgsc.bcm.edu	37	12	122406042	122406042	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr12:122406042A>G	ENST00000288912.4	+	17	3592	c.2738A>G	c.(2737-2739)gAt>gGt	p.D913G	WDR66_ENST00000397454.2_Missense_Mutation_p.D913G|WDR66_ENST00000545752.1_3'UTR	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	913							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		GGAGGGCACGATCGCTCGGTG	0.527																																					p.D913G	Esophageal Squamous(85;849 1794 49757 52143)	Atlas-SNP	.											.	WDR66	143	.	0			c.A2738G						PASS	.						57.0	58.0	58.0					12																	122406042		1997	4168	6165	SO:0001583	missense	144406	exon17			GGCACGATCGCTC	AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.2738A>G	chr12.hg19:g.122406042A>G	ENSP00000288912:p.Asp913Gly	69.0	0.0	.		120.0	72.0	.	NM_001178003	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Missense_Mutation	SNP	ENST00000288912.4	hg19	CCDS41853.1	.	.	.	.	.	.	.	.	.	.	A	16.56	3.157682	0.57368	.	.	ENSG00000158023	ENST00000288912;ENST00000397454	T;T	0.64803	-0.12;0.59	5.19	5.19	0.71726	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.80171	0.4574	M	0.88979	2.995	0.58432	D	0.999997	D	0.71674	0.998	P	0.61003	0.882	D	0.84817	0.0794	10	0.87932	D	0	.	15.0447	0.71819	1.0:0.0:0.0:0.0	.	913	Q8TBY9	WDR66_HUMAN	G	913	ENSP00000288912:D913G;ENSP00000380595:D913G	ENSP00000288912:D913G	D	+	2	0	WDR66	120890425	1.000000	0.71417	0.039000	0.18376	0.027000	0.11550	7.687000	0.84139	1.960000	0.56953	0.459000	0.35465	GAT	.	.	.	none		0.527	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401700.1	NM_144668	
SHISA2	387914	hgsc.bcm.edu	37	13	26621071	26621071	+	Silent	SNP	C	C	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr13:26621071C>A	ENST00000319420.3	-	2	523	c.468G>T	c.(466-468)ggG>ggT	p.G156G		NM_001007538.1	NP_001007539.1	Q6UWI4	SHSA2_HUMAN	shisa family member 2	156					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)|skin(1)	17						AGCGGTTACCCCCTGGGGCTC	0.632																																					p.G156G		Atlas-SNP	.											.	SHISA2	43	.	0			c.G468T						PASS	.						39.0	40.0	40.0					13																	26621071		2203	4300	6503	SO:0001819	synonymous_variant	387914	exon2			GTTACCCCCTGGG		CCDS31951.1	13q12.13	2013-07-31	2013-07-31	2008-04-01	ENSG00000180730	ENSG00000180730		"""Shisa homologs"""	20366	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 13"", ""transmembrane protein 46"", ""shisa homolog 2 (Xenopus laevis)"""	C13orf13, TMEM46			Standard	NM_001007538		Approved	bA398O19.2, PRO28631, WGAR9166, hShisa	uc001uqm.1	Q6UWI4	OTTHUMG00000016612	ENST00000319420.3:c.468G>T	chr13.hg19:g.26621071C>A		68.0	0.0	.		110.0	54.0	.	NM_001007538	B9EH70|Q5W0G8	Silent	SNP	ENST00000319420.3	hg19	CCDS31951.1																																																																																			.	.	.	none		0.632	SHISA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044239.2	NM_001007538	
TSC22D1	8848	hgsc.bcm.edu	37	13	45149121	45149121	+	Missense_Mutation	SNP	A	A	C			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr13:45149121A>C	ENST00000458659.2	-	1	1580	c.1090T>G	c.(1090-1092)Ttg>Gtg	p.L364V	TSC22D1_ENST00000501704.2_Missense_Mutation_p.L364V|TSC22D1_ENST00000460842.1_5'Flank	NM_183422.3	NP_904358.2	Q15714	T22D1_HUMAN	TSC22 domain family, member 1	364					negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)		ATGCCACTCAAGATATTCACA	0.463																																					p.L364V		Atlas-SNP	.											.	TSC22D1	88	.	0			c.T1090G						PASS	.						112.0	96.0	102.0					13																	45149121		2203	4300	6503	SO:0001583	missense	8848	exon1			CACTCAAGATATT	AJ222700	CCDS9392.1, CCDS31966.1, CCDS58291.1, CCDS73565.1	13q14	2008-02-05	2005-03-01	2005-03-03	ENSG00000102804	ENSG00000102804			16826	protein-coding gene	gene with protein product		607715	"""transforming growth factor beta 1 induced transcript 4"""	TGFB1I4		8651929, 9022669	Standard	NM_183422		Approved	TSC22, MGC17597	uc001uzn.4	Q15714	OTTHUMG00000016838	ENST00000458659.2:c.1090T>G	chr13.hg19:g.45149121A>C	ENSP00000397435:p.Leu364Val	53.0	0.0	.		77.0	44.0	.	NM_183422	B3KRL7|B9EGI0|O00666|Q6AHX5|Q6IBU1|Q8NCN1|Q96JS5	Missense_Mutation	SNP	ENST00000458659.2	hg19	CCDS31966.1	.	.	.	.	.	.	.	.	.	.	A	13.02	2.111211	0.37242	.	.	ENSG00000102804	ENST00000458659;ENST00000501704	T;T	0.26067	1.76;1.76	4.49	3.31	0.37934	.	0.000000	0.43260	D	0.000582	T	0.21962	0.0529	L	0.29908	0.895	0.26148	N	0.980186	P;P	0.50528	0.936;0.895	P;P	0.50934	0.654;0.452	T	0.04467	-1.0949	10	0.27785	T	0.31	.	6.2454	0.20813	0.7965:0.0:0.2035:0.0	.	364;364	B3KRL7;Q15714	.;T22D1_HUMAN	V	364	ENSP00000397435:L364V;ENSP00000437414:L364V	ENSP00000397435:L364V	L	-	1	2	TSC22D1	44047121	0.151000	0.22747	1.000000	0.80357	0.998000	0.95712	0.029000	0.13666	1.874000	0.54306	0.459000	0.35465	TTG	.	.	.	none		0.463	TSC22D1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044743.2	NM_006022	
EDDM3A	10876	hgsc.bcm.edu	37	14	21215972	21215972	+	Missense_Mutation	SNP	G	G	C	rs149270684	byFrequency	TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr14:21215972G>C	ENST00000326842.2	+	2	360	c.233G>C	c.(232-234)cGt>cCt	p.R78P		NM_006683.4	NP_006674.2	Q14507	EP3A_HUMAN	epididymal protein 3A	78					sperm displacement (GO:0007321)	extracellular space (GO:0005615)				breast(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6						AAAATTCAGCGTGCATGCATC	0.438																																					p.R78P		Atlas-SNP	.											.	EDDM3A	15	.	0			c.G233C						PASS	.						103.0	100.0	101.0					14																	21215972		2203	4300	6503	SO:0001583	missense	10876	exon2			TTCAGCGTGCATG	X76383	CCDS9556.1	14q11.1	2010-03-19	2010-01-27	2010-01-27	ENSG00000181562	ENSG00000181562			16978	protein-coding gene	gene with protein product		611580	"""family with sequence similarity 12, member A"""	FAM12A		7514008	Standard	NM_006683		Approved	HE3-ALPHA	uc001vyc.3	Q14507	OTTHUMG00000029581	ENST00000326842.2:c.233G>C	chr14.hg19:g.21215972G>C	ENSP00000315098:p.Arg78Pro	67.0	0.0	.		92.0	35.0	.	NM_006683	Q4KN33	Missense_Mutation	SNP	ENST00000326842.2	hg19	CCDS9556.1	.	.	.	.	.	.	.	.	.	.	G	12.09	1.833295	0.32421	.	.	ENSG00000181562	ENST00000326842	T	0.73469	-0.75	2.46	-0.0476	0.13842	Ribonuclease A, domain (2);	1.533360	0.04073	N	0.308328	T	0.73636	0.3612	L	0.40543	1.245	0.09310	N	1	P	0.52842	0.956	P	0.53224	0.721	T	0.59188	-0.7501	10	0.66056	D	0.02	.	4.437	0.11555	0.6155:0.0:0.3845:0.0	.	78	Q14507	EP3A_HUMAN	P	78	ENSP00000315098:R78P	ENSP00000315098:R78P	R	+	2	0	EDDM3A	20285812	0.000000	0.05858	0.002000	0.10522	0.167000	0.22549	0.137000	0.15995	-0.150000	0.11195	0.313000	0.20887	CGT	.	G|0.999;A|0.001	.	alt		0.438	EDDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073742.3		
PPP2R5E	5529	hgsc.bcm.edu	37	14	63860645	63860645	+	Splice_Site	SNP	T	T	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr14:63860645T>A	ENST00000337537.3	-	8	1344	c.742A>T	c.(742-744)Att>Ttt	p.I248F	PPP2R5E_ENST00000553266.1_5'UTR|PPP2R5E_ENST00000422769.2_Splice_Site_p.I172F|PPP2R5E_ENST00000555899.1_Splice_Site_p.I248F	NM_001282179.1|NM_001282180.1|NM_001282181.1|NM_001282182.1|NM_006246.2	NP_001269108.1|NP_001269109.1|NP_001269110.1|NP_001269111.1|NP_006237.1	Q16537	2A5E_HUMAN	protein phosphatase 2, regulatory subunit B', epsilon isoform	248					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)	15				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)		CCATTGATAATACTAGGGAGA	0.353																																					p.I248F		Atlas-SNP	.											.	PPP2R5E	43	.	0			c.A742T						PASS	.						69.0	68.0	68.0					14																	63860645		2203	4300	6503	SO:0001630	splice_region_variant	5529	exon8			TGATAATACTAGG	L76703	CCDS9758.1, CCDS61467.1, CCDS61468.1	14q23.2	2010-06-18	2007-01-22		ENSG00000154001	ENSG00000154001		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9313	protein-coding gene	gene with protein product		601647	"""protein phosphatase 2, regulatory subunit B (B56), epsilon isoform"""			7592815	Standard	NM_006246		Approved		uc001xgd.1	Q16537	OTTHUMG00000140341	ENST00000337537.3:c.741-1A>T	chr14.hg19:g.63860645T>A		47.0	0.0	.		83.0	40.0	.	NM_006246	A4FU37|B7ZAW5|B7ZKK8|B7ZKK9|J3KQN6|Q52LW4	Missense_Mutation	SNP	ENST00000337537.3	hg19	CCDS9758.1	.	.	.	.	.	.	.	.	.	.	T	29.3	4.990233	0.93106	.	.	ENSG00000154001	ENST00000337537;ENST00000555899;ENST00000422769	.	.	.	5.66	5.66	0.87406	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.88070	0.6338	H	0.97186	3.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92017	0.5623	9	0.87932	D	0	-10.0146	16.1852	0.81946	0.0:0.0:0.0:1.0	.	248;248	B7ZKK9;Q16537	.;2A5E_HUMAN	F	248;248;172	.	ENSP00000337641:I248F	I	-	1	0	PPP2R5E	62930398	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	7.936000	0.87665	2.277000	0.76020	0.528000	0.53228	ATT	.	.	.	none		0.353	PPP2R5E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276973.1	NM_006246	Missense_Mutation
DDX24	57062	hgsc.bcm.edu	37	14	94545834	94545834	+	Silent	SNP	C	C	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr14:94545834C>T	ENST00000330836.5	-	2	386	c.255G>A	c.(253-255)gaG>gaA	p.E85E	IFI27L1_ENST00000554544.1_5'Flank|IFI27L1_ENST00000555523.1_5'Flank|DDX24_ENST00000544005.1_Intron|IFI27L1_ENST00000393115.3_5'Flank|IFI27L1_ENST00000553664.1_5'Flank|DDX24_ENST00000555054.1_Silent_p.E42E|IFI27L1_ENST00000556381.1_5'Flank|IFI27L1_ENST00000557066.1_5'Flank|IFI27L1_ENST00000557218.1_5'Flank	NM_020414.3	NP_065147.1	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 24	85	Poly-Glu.				RNA metabolic process (GO:0016070)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			cervix(3)|endometrium(4)|kidney(4)|large_intestine(5)|lung(3)|ovary(2)|skin(1)|urinary_tract(1)	23		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		CCTCCTCCTCCTCTTCTTCTG	0.438																																					p.E85E		Atlas-SNP	.											.	DDX24	82	.	0			c.G255A						PASS	.						165.0	161.0	163.0					14																	94545834		2203	4300	6503	SO:0001819	synonymous_variant	57062	exon2			CTCCTCCTCTTCT	AF214731	CCDS9918.1	14q32	2013-07-16	2013-07-16			ENSG00000089737		"""DEAD-boxes"""	13266	protein-coding gene	gene with protein product		606181	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 24"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 24"""			10936056, 18289627	Standard	NM_020414		Approved		uc001ycj.3	Q9GZR7		ENST00000330836.5:c.255G>A	chr14.hg19:g.94545834C>T		61.0	0.0	.		91.0	4.0	.	NM_020414	E7EMJ4|Q4V9L5	Silent	SNP	ENST00000330836.5	hg19	CCDS9918.1																																																																																			.	.	.	none		0.438	DDX24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412861.1	NM_020414	
DICER1	23405	hgsc.bcm.edu	37	14	95590600	95590600	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr14:95590600G>C	ENST00000526495.1	-	10	1600	c.1309C>G	c.(1309-1311)Cct>Gct	p.P437A	DICER1_ENST00000343455.3_Missense_Mutation_p.P437A|DICER1_ENST00000393063.1_Missense_Mutation_p.P437A|DICER1_ENST00000541352.1_Missense_Mutation_p.P437A|DICER1_ENST00000527414.1_Missense_Mutation_p.P437A			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	437	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Required for interaction with PRKRA and TARBP2.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		TTGGTAAAAGGAGAAGGAAAA	0.353			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																												p.P437A		Atlas-SNP	.	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	.	DICER1	181	.	0			c.C1309G						PASS	.						80.0	85.0	83.0					14																	95590600		2203	4300	6503	SO:0001583	missense	23405	exon9	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	TAAAAGGAGAAGG	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.1309C>G	chr14.hg19:g.95590600G>C	ENSP00000437256:p.Pro437Ala	47.0	0.0	.		74.0	42.0	.	NM_030621	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	ENST00000526495.1	hg19	CCDS9931.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.568453	0.86439	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000541352	T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56;-0.56	5.41	5.41	0.78517	Helicase, C-terminal (1);	0.219441	0.48286	D	0.000182	T	0.63534	0.2519	N	0.19112	0.55	0.80722	D	1	P	0.39717	0.684	P	0.45037	0.467	T	0.58595	-0.7609	10	0.13853	T	0.58	-14.9718	19.1956	0.93686	0.0:0.0:1.0:0.0	.	437	Q9UPY3	DICER_HUMAN	A	437	ENSP00000343745:P437A;ENSP00000437256:P437A;ENSP00000376783:P437A;ENSP00000435681:P437A;ENSP00000444719:P437A	ENSP00000343745:P437A	P	-	1	0	DICER1	94660353	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.187000	0.94912	2.524000	0.85096	0.591000	0.81541	CCT	.	.	.	none		0.353	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1		
MYO5A	4644	hgsc.bcm.edu	37	15	52615613	52615613	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr15:52615613G>C	ENST00000399231.3	-	36	4907	c.4664C>G	c.(4663-4665)tCc>tGc	p.S1555C	MYO5A_ENST00000358212.6_Missense_Mutation_p.S1580C|MYO5A_ENST00000356338.6_Missense_Mutation_p.S1528C|MYO5A_ENST00000553916.1_Missense_Mutation_p.S1553C|MYO5A_ENST00000399233.2_Missense_Mutation_p.S1552C	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	1555	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		GAGCCAGAAGGAGACGGTTTC	0.373																																					p.S1555C		Atlas-SNP	.											.	MYO5A	145	.	0			c.C4664G						PASS	.						130.0	120.0	123.0					15																	52615613		1837	4087	5924	SO:0001583	missense	4644	exon36			CAGAAGGAGACGG		CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.4664C>G	chr15.hg19:g.52615613G>C	ENSP00000382177:p.Ser1555Cys	96.0	0.0	.		138.0	59.0	.	NM_000259	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	ENST00000399231.3	hg19	CCDS42037.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.538273	0.85917	.	.	ENSG00000197535	ENST00000399231;ENST00000399229;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	T;T;T;T;T	0.25414	1.8;1.8;1.8;1.8;1.8	6.17	6.17	0.99709	Dilute (1);	0.000000	0.85682	D	0.000000	T	0.54334	0.1852	M	0.78637	2.42	0.80722	D	1	D;D;D	0.63880	0.993;0.967;0.992	D;P;P	0.64687	0.928;0.806;0.863	T	0.48502	-0.9030	10	0.51188	T	0.08	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	285;1555;1528	B5LY56;Q9Y4I1;Q9Y4I1-2	.;MYO5A_HUMAN;.	C	1555;1062;1552;1528;1580;1158;1553	ENSP00000382177:S1555C;ENSP00000382179:S1552C;ENSP00000348693:S1528C;ENSP00000350945:S1580C;ENSP00000451109:S1553C	ENSP00000348693:S1528C	S	-	2	0	MYO5A	50402905	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.876000	0.87215	2.941000	0.99782	0.655000	0.94253	TCC	.	.	.	none		0.373	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259	
CGNL1	84952	hgsc.bcm.edu	37	15	57730578	57730578	+	Silent	SNP	T	T	C			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr15:57730578T>C	ENST00000281282.5	+	2	459	c.381T>C	c.(379-381)aaT>aaC	p.N127N		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	127	Head.					myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		AGGGCAAGAATGGAGTTCTAG	0.493																																					p.N127N		Atlas-SNP	.											.	CGNL1	125	.	0			c.T381C						PASS	.						50.0	50.0	50.0					15																	57730578		2192	4292	6484	SO:0001819	synonymous_variant	84952	exon3			CAAGAATGGAGTT	AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.381T>C	chr15.hg19:g.57730578T>C		108.0	0.0	.		146.0	69.0	.	NM_001252335	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Silent	SNP	ENST00000281282.5	hg19	CCDS10161.1																																																																																			.	.	.	none		0.493	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	NM_032866	
LRRC49	54839	hgsc.bcm.edu	37	15	71193333	71193333	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr15:71193333T>C	ENST00000260382.5	+	4	526	c.266T>C	c.(265-267)aTt>aCt	p.I89T	LRRC49_ENST00000560691.1_5'UTR|LRRC49_ENST00000544974.2_Missense_Mutation_p.I79T|LRRC49_ENST00000560369.1_Missense_Mutation_p.I94T|LRRC49_ENST00000443425.2_Missense_Mutation_p.I45T|LRRC49_ENST00000436542.2_3'UTR	NM_001199017.1|NM_017691.3	NP_001185946.1|NP_060161.2	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	89						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(3)|skin(3)	34						GAAGAGAAAATTCTTTACTCA	0.318																																					p.I94T		Atlas-SNP	.											.	LRRC49	73	.	0			c.T281C						PASS	.						79.0	82.0	81.0					15																	71193333		2199	4295	6494	SO:0001583	missense	54839	exon4			AGAAAATTCTTTA		CCDS32282.1, CCDS55971.1, CCDS58376.1, CCDS61694.1	15q23	2005-08-09				ENSG00000137821			25965	protein-coding gene	gene with protein product						12477932	Standard	NM_001199017		Approved	FLJ20156	uc010ukf.2	Q8IUZ0		ENST00000260382.5:c.266T>C	chr15.hg19:g.71193333T>C	ENSP00000260382:p.Ile89Thr	160.0	0.0	.		297.0	144.0	.	NM_001199017	B3KVX1|B7Z366|F5H1J4|G5E9T5|H0YLN4|Q9NXM6	Missense_Mutation	SNP	ENST00000260382.5	hg19	CCDS32282.1	.	.	.	.	.	.	.	.	.	.	T	7.971	0.749171	0.15710	.	.	ENSG00000137821	ENST00000544974;ENST00000260382;ENST00000443425;ENST00000436542	T;T;T	0.33865	1.4;1.93;1.39	5.86	2.15	0.27550	.	0.459688	0.21102	N	0.080154	T	0.17704	0.0425	N	0.14661	0.345	0.25035	N	0.99125	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.001;0.001;0.002;0.001;0.001	T	0.18618	-1.0331	10	0.24483	T	0.36	-4.7976	5.7854	0.18331	0.0:0.0863:0.3278:0.5859	.	94;61;45;89;79	B7Z366;G5E9Q1;G5E9T5;Q8IUZ0;F5H1J4	.;.;.;LRC49_HUMAN;.	T	79;89;45;61	ENSP00000439600:I79T;ENSP00000260382:I89T;ENSP00000414065:I45T	ENSP00000260382:I89T	I	+	2	0	LRRC49	68980387	0.991000	0.36638	0.985000	0.45067	0.999000	0.98932	0.715000	0.25822	0.170000	0.19704	0.528000	0.53228	ATT	.	.	.	none		0.318	LRRC49-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417209.3	NM_017691	
ARIH1	25820	hgsc.bcm.edu	37	15	72874471	72874471	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr15:72874471G>C	ENST00000379887.4	+	13	1846	c.1532G>C	c.(1531-1533)cGa>cCa	p.R511P	ARIH1_ENST00000562891.1_3'UTR	NM_005744.3	NP_005735.2	Q9Y4X5	ARI1_HUMAN	ariadne RBR E3 ubiquitin protein ligase 1	511					cytokine-mediated signaling pathway (GO:0019221)|protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ubiquitin ligase complex (GO:0000151)	small conjugating protein ligase activity (GO:0019787)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R511Q(1)		endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	14						TACCTTGAACGAGATATTTCC	0.363																																					p.R511P		Atlas-SNP	.											ARIH1,face,carcinoma,0,1	ARIH1	42	.	1	Substitution - Missense(1)	skin(1)	c.G1532C						PASS	.						102.0	105.0	104.0					15																	72874471		2198	4297	6495	SO:0001583	missense	25820	exon13			TTGAACGAGATAT	AF072832	CCDS10244.1	15q24	2013-10-03	2013-10-03		ENSG00000166233	ENSG00000166233			689	protein-coding gene	gene with protein product	"""ariadne, Drosophila, homolog of"""	605624	"""ariadne (Drosophila) homolog, ubiquitin-conjugating enzyme E2-binding protein, 1"", ""ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)"""			10521492, 24058416	Standard	NM_005744		Approved	HARI, HHARI, UBCH7BP, ARI	uc002aut.4	Q9Y4X5	OTTHUMG00000133474	ENST00000379887.4:c.1532G>C	chr15.hg19:g.72874471G>C	ENSP00000369217:p.Arg511Pro	225.0	0.0	.		318.0	149.0	.	NM_005744	B2R6U3|O76026|Q9H3T6|Q9UEN0|Q9UP39	Missense_Mutation	SNP	ENST00000379887.4	hg19	CCDS10244.1	.	.	.	.	.	.	.	.	.	.	G	32	5.162819	0.94727	.	.	ENSG00000166233	ENST00000379887;ENST00000299305	D	0.87491	-2.26	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.95494	0.8536	M	0.93763	3.455	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.96236	0.9172	10	0.87932	D	0	.	19.5444	0.95285	0.0:0.0:1.0:0.0	.	511	Q9Y4X5	ARI1_HUMAN	P	511;481	ENSP00000369217:R511P	ENSP00000299305:R481P	R	+	2	0	ARIH1	70661525	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.356000	0.97091	2.621000	0.88768	0.644000	0.83932	CGA	.	.	.	none		0.363	ARIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257350.1	NM_005744	
BLM	641	hgsc.bcm.edu	37	15	91298123	91298123	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr15:91298123A>G	ENST00000355112.3	+	5	1160	c.1042A>G	c.(1042-1044)Atg>Gtg	p.M348V	BLM_ENST00000560509.1_Missense_Mutation_p.M348V|SNORD18_ENST00000363807.1_RNA	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	348	Necessary for interaction with SPIDR.				alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			ACCTGAGAAAATGAGTATGCA	0.363			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																												p.M348V		Atlas-SNP	.	yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	.	BLM	122	.	0			c.A1042G						PASS	.						93.0	89.0	91.0					15																	91298123		2198	4298	6496	SO:0001583	missense	641	exon5	Familial Cancer Database		GAGAAAATGAGTA	U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.1042A>G	chr15.hg19:g.91298123A>G	ENSP00000347232:p.Met348Val	63.0	0.0	.		103.0	49.0	.	NM_000057	Q52M96	Missense_Mutation	SNP	ENST00000355112.3	hg19	CCDS10363.1	.	.	.	.	.	.	.	.	.	.	A	13.23	2.175834	0.38413	.	.	ENSG00000197299	ENST00000355112;ENST00000536925	T	0.42513	0.97	5.33	0.151	0.14888	.	0.794395	0.11183	N	0.590713	T	0.31327	0.0793	M	0.63428	1.95	0.09310	N	1	B;B	0.22480	0.07;0.07	B;B	0.19148	0.024;0.024	T	0.30387	-0.9980	10	0.22706	T	0.39	-15.1694	1.0454	0.01568	0.5054:0.1741:0.1756:0.145	.	348;348	B2RAN0;P54132	.;BLM_HUMAN	V	348;1	ENSP00000347232:M348V	ENSP00000347232:M348V	M	+	1	0	BLM	89099127	0.808000	0.29022	0.000000	0.03702	0.430000	0.31655	1.450000	0.35134	-0.233000	0.09797	0.374000	0.22700	ATG	.	.	.	none		0.363	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1		
SNRPA1	6627	hgsc.bcm.edu	37	15	101833253	101833253	+	Silent	SNP	C	C	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr15:101833253C>T	ENST00000254193.6	-	2	279	c.207G>A	c.(205-207)ttG>ttA	p.L69L	RP11-299G20.2_ENST00000558838.1_RNA|SNRPA1_ENST00000560856.1_5'UTR	NM_003090.2	NP_003081.2	P09661	RU2A_HUMAN	small nuclear ribonucleoprotein polypeptide A'	69					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U2 snRNP (GO:0005686)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6	Lung NSC(78;0.00156)|all_lung(78;0.00195)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00113)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TGTTCACTAACAATGTTTTCA	0.383																																					p.L69L		Atlas-SNP	.											.	SNRPA1	11	.	0			c.G207A						PASS	.						86.0	79.0	81.0					15																	101833253		2203	4300	6503	SO:0001819	synonymous_variant	6627	exon2			CACTAACAATGTT	AJ130971	CCDS10391.1	15q26.3	2011-10-11			ENSG00000131876	ENSG00000131876			11152	protein-coding gene	gene with protein product		603521				2928112	Standard	NM_003090		Approved	Lea1	uc002bww.3	P09661	OTTHUMG00000149871	ENST00000254193.6:c.207G>A	chr15.hg19:g.101833253C>T		258.0	0.0	.		387.0	101.0	.	NM_003090	B2R5I6|Q8TBD2	Silent	SNP	ENST00000254193.6	hg19	CCDS10391.1																																																																																			.	.	.	none		0.383	SNRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313621.2	NM_003090	
AXIN1	8312	hgsc.bcm.edu	37	16	343699	343699	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr16:343699G>A	ENST00000262320.3	-	8	2346	c.1975C>T	c.(1975-1977)Cca>Tca	p.P659S	AXIN1_ENST00000354866.3_Missense_Mutation_p.P659S	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	659	Interaction with PPP2CA.|Interaction with RNF111.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				TGGGGCTGTGGCTTCCTCGTC	0.622																																					p.P659S		Atlas-SNP	.											.	AXIN1	290	.	0			c.C1975T						PASS	.						96.0	107.0	103.0					16																	343699		2203	4300	6503	SO:0001583	missense	8312	exon8			GCTGTGGCTTCCT	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.1975C>T	chr16.hg19:g.343699G>A	ENSP00000262320:p.Pro659Ser	29.0	0.0	.		39.0	13.0	.	NM_181050	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Missense_Mutation	SNP	ENST00000262320.3	hg19	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	G	3.721	-0.057561	0.07317	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	T;T	0.58060	0.36;0.38	4.17	4.17	0.49024	.	0.581013	0.19003	N	0.125294	T	0.40423	0.1116	L	0.38175	1.15	0.23210	N	0.998116	B;B	0.10296	0.003;0.001	B;B	0.15052	0.012;0.005	T	0.16600	-1.0397	10	0.06757	T	0.87	-2.6259	15.6374	0.76966	0.0:0.0:1.0:0.0	.	659;659	O15169-2;O15169	.;AXIN1_HUMAN	S	659	ENSP00000262320:P659S;ENSP00000346935:P659S	ENSP00000262320:P659S	P	-	1	0	AXIN1	283700	1.000000	0.71417	1.000000	0.80357	0.402000	0.30811	3.455000	0.52993	2.185000	0.69588	0.478000	0.44815	CCA	.	.	.	none		0.622	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
TUSC5	286753	hgsc.bcm.edu	37	17	1183315	1183315	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr17:1183315C>A	ENST00000333813.3	+	1	359	c.20C>A	c.(19-21)tCc>tAc	p.S7Y		NM_172367.2	NP_758955.2	Q8IXB3	TUSC5_HUMAN	tumor suppressor candidate 5	7					response to biotic stimulus (GO:0009607)	integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|prostate(4)|skin(2)	15				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CCGGTGCAGTCCGAGTTTCCT	0.657																																					p.S7Y		Atlas-SNP	.											.	TUSC5	25	.	0			c.C20A						PASS	.						33.0	38.0	36.0					17																	1183315		1975	4144	6119	SO:0001583	missense	286753	exon1			TGCAGTCCGAGTT	AB090231	CCDS42225.1	17p13.3	2009-10-16			ENSG00000184811	ENSG00000184811			29592	protein-coding gene	gene with protein product	"""located at seventeen p thirteen point three 1"", ""interferon induced transmembrane protein domain containing 3"""	612211				12660825	Standard	NM_172367		Approved	LOST1, IFITMD3	uc002fsi.1	Q8IXB3	OTTHUMG00000132196	ENST00000333813.3:c.20C>A	chr17.hg19:g.1183315C>A	ENSP00000329548:p.Ser7Tyr	88.0	0.0	.		161.0	88.0	.	NM_172367	A6NMK4	Missense_Mutation	SNP	ENST00000333813.3	hg19	CCDS42225.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.956707	0.53293	.	.	ENSG00000184811	ENST00000333813	T	0.72394	-0.65	5.22	4.24	0.50183	.	0.684498	0.13729	U	0.366858	T	0.50394	0.1613	N	0.14661	0.345	0.23401	N	0.997759	B	0.31519	0.327	B	0.24541	0.054	T	0.47661	-0.9100	10	0.87932	D	0	-2.8288	8.7819	0.34795	0.0:0.8988:0.0:0.1012	.	7	Q8IXB3	TUSC5_HUMAN	Y	7	ENSP00000329548:S7Y	ENSP00000329548:S7Y	S	+	2	0	TUSC5	1130065	0.041000	0.20044	1.000000	0.80357	0.013000	0.08279	0.831000	0.27476	2.475000	0.83589	0.537000	0.68136	TCC	.	.	.	none		0.657	TUSC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255249.1	NM_172367	
MYH8	4626	hgsc.bcm.edu	37	17	10315977	10315977	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr17:10315977T>A	ENST00000403437.2	-	13	1310	c.1216A>T	c.(1216-1218)Agg>Tgg	p.R406W	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	406	Myosin motor.				ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						ACCTTGACCCTAGGGTAGCAG	0.507									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																												p.R406W		Atlas-SNP	.											.	MYH8	346	.	0			c.A1216T						PASS	.						317.0	277.0	290.0					17																	10315977		2203	4300	6503	SO:0001583	missense	4626	exon13	Familial Cancer Database	Carney Complex Variant	TGACCCTAGGGTA		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.1216A>T	chr17.hg19:g.10315977T>A	ENSP00000384330:p.Arg406Trp	120.0	0.0	.		213.0	104.0	.	NM_002472	Q14910	Missense_Mutation	SNP	ENST00000403437.2	hg19	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	T	17.44	3.389055	0.61956	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.88509	-2.39	4.6	3.51	0.40186	Myosin head, motor domain (2);	0.000000	0.43919	U	0.000513	D	0.96371	0.8816	H	0.98629	4.285	0.50171	D	0.999856	D	0.89917	1.0	D	0.97110	1.0	D	0.96185	0.9133	10	0.87932	D	0	.	11.3654	0.49668	0.0:0.0:0.3067:0.6933	.	406	P13535	MYH8_HUMAN	W	406	ENSP00000384330:R406W	ENSP00000252173:R406W	R	-	1	2	MYH8	10256702	0.997000	0.39634	1.000000	0.80357	0.749000	0.42624	1.754000	0.38369	0.789000	0.33779	-0.299000	0.09455	AGG	.	.	.	none		0.507	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472	
ERBB2	2064	hgsc.bcm.edu	37	17	37880219	37880220	+	Missense_Mutation	DNP	TT	TT	CC	rs121913470|rs121913469		TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr17:37880219_37880220TT>CC	ENST00000269571.5	+	19	2422_2423	c.2263_2264TT>CC	c.(2263-2265)TTg>CCg	p.L755P	ERBB2_ENST00000584450.1_Missense_Mutation_p.L755P|ERBB2_ENST00000540147.1_Missense_Mutation_p.L725P|MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000584601.1_Missense_Mutation_p.L725P|ERBB2_ENST00000406381.2_Missense_Mutation_p.L725P|ERBB2_ENST00000541774.1_Missense_Mutation_p.L740P|ERBB2_ENST00000445658.2_Missense_Mutation_p.L479P			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	755	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> P (in a lung adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:15457249}.		axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.L755S(10)|p.L755P(2)|p.L755_S760>A(1)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	CATCAAAGTGTTGAGGGAAAAC	0.53	L755S(LN229_CENTRAL_NERVOUS_SYSTEM)	1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.L755L|p.L755S		Atlas-SNP	.		Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	ERBB2,NS,carcinoma,-1,1|ERBB2,NS,carcinoma,0,20	ERBB2	429	.	13	Substitution - Missense(12)|Complex - insertion inframe(1)	breast(7)|lung(3)|stomach(2)|large_intestine(1)	c.T2263C|c.T2264C						PASS	.																																			SO:0001583	missense	2064	exon19			AAAGTGTTGAGGG|AAGTGTTGAGGGA	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		Exception_encountered	chr17.hg19:g.37880219_37880220delinsCC	ENSP00000269571:p.Leu755Pro	57.0|56.0	0.0	.		60.0	27.0	.	NM_004448	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Silent|Missense_Mutation	SNP	ENST00000269571.5	hg19	CCDS32642.1																																																																																			.	.	.	alt|weak		0.530	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2		
RHBDF2	79651	hgsc.bcm.edu	37	17	74473013	74473013	+	Silent	SNP	C	C	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr17:74473013C>T	ENST00000313080.4	-	9	1374	c.1101G>A	c.(1099-1101)cgG>cgA	p.R367R	RHBDF2_ENST00000592378.1_5'Flank|RHBDF2_ENST00000591885.1_Silent_p.R338R|RHBDF2_ENST00000389760.4_Silent_p.R338R	NM_024599.5	NP_078875.4	Q6PJF5	RHDF2_HUMAN	rhomboid 5 homolog 2 (Drosophila)	367					negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(4)|skin(1)	27						GGCCGTAGTGCCGCTTCTTCC	0.667																																					p.R367R		Atlas-SNP	.											.	RHBDF2	57	.	0			c.G1101A						PASS	.						37.0	48.0	44.0					17																	74473013		2202	4300	6502	SO:0001819	synonymous_variant	79651	exon9			GTAGTGCCGCTTC	BC016034	CCDS32743.1, CCDS32744.1	17q25.3	2014-09-17	2006-02-22	2006-02-22		ENSG00000129667			20788	protein-coding gene	gene with protein product		614404	"""rhomboid, veinlet-like 6 (Drosophila)"", ""tylosis with oesophageal cancer"""	RHBDL6, TOC		12838346, 22265016	Standard	NM_024599		Approved	FLJ22341, RHBDL5, TOCG	uc002jrq.2	Q6PJF5		ENST00000313080.4:c.1101G>A	chr17.hg19:g.74473013C>T		81.0	0.0	.		135.0	62.0	.	NM_024599	A6NEM3|A8K801|Q5U607|Q5YGQ8|Q9H6E9	Silent	SNP	ENST00000313080.4	hg19	CCDS32743.1																																																																																			.	.	.	none		0.667	RHBDF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450134.1	NM_024599	
ZNF728	388523	hgsc.bcm.edu	37	19	23159254	23159254	+	Silent	SNP	C	C	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr19:23159254C>T	ENST00000594710.1	-	4	1030	c.885G>A	c.(883-885)aaG>aaA	p.K295K		NM_001267716.1	NP_001254645.1	P0DKX0	ZN728_HUMAN	zinc finger protein 728	295					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										GGGTTGAGGCCTTACTAAAGG	0.448																																					p.K295K		Atlas-SNP	.											.	.	.	.	0			c.G885A						PASS	.																																			SO:0001819	synonymous_variant	388523	exon4			TGAGGCCTTACTA	BC128130	CCDS59370.1	19p12	2014-02-14			ENSG00000269067	ENSG00000269067		"""Zinc fingers, C2H2-type"", ""-"""	32463	protein-coding gene	gene with protein product							Standard	NM_001267716		Approved		uc002nqz.2	P0DKX0	OTTHUMG00000183124	ENST00000594710.1:c.885G>A	chr19.hg19:g.23159254C>T		21.0	0.0	.		39.0	22.0	.	NM_001267716		Silent	SNP	ENST00000594710.1	hg19	CCDS59370.1																																																																																			.	.	.	none		0.448	ZNF728-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465176.1	NM_001267716	
ZNF814	730051	hgsc.bcm.edu	37	19	58385790	58385790	+	Missense_Mutation	SNP	G	G	T	rs111727691		TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr19:58385790G>T	ENST00000435989.2	-	3	1202	c.968C>A	c.(967-969)cCt>cAt	p.P323H	ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	323					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ACATTCATAAGGTCTTTTCCC	0.358																																					p.P323H		Atlas-SNP	.											.	ZNF814	93	.	0			c.C968A						PASS	.						15.0	12.0	13.0					19																	58385790		688	1563	2251	SO:0001583	missense	730051	exon3			TCATAAGGTCTTT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.968C>A	chr19.hg19:g.58385790G>T	ENSP00000410545:p.Pro323His	48.0	0.0	.		101.0	10.0	.	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	hg19	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	8.139	0.784825	0.16189	.	.	ENSG00000204514	ENST00000435989	T	0.29397	1.57	2.27	1.18	0.20946	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.57080	0.2029	M	0.90019	3.08	0.20764	N	0.999853	D	0.89917	1.0	D	0.67231	0.95	T	0.46247	-0.9205	9	0.66056	D	0.02	.	9.258	0.37595	0.0:0.0:0.7811:0.2189	.	323	B7Z6K7	ZN814_HUMAN	H	323	ENSP00000410545:P323H	ENSP00000410545:P323H	P	-	2	0	ZNF814	63077602	0.000000	0.05858	0.028000	0.17463	0.016000	0.09150	-0.439000	0.06897	0.330000	0.23485	-1.407000	0.01130	CCT	.	G|0.500;T|0.500	0.500	weak		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZNF814	730051	hgsc.bcm.edu	37	19	58385793	58385793	+	Missense_Mutation	SNP	C	C	T	rs113623532		TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr19:58385793C>T	ENST00000435989.2	-	3	1199	c.965G>A	c.(964-966)aGa>aAa	p.R322K	ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	322					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TTCATAAGGTCTTTTCCCAGT	0.358																																					p.R322K		Atlas-SNP	.											.	ZNF814	93	.	0			c.G965A						PASS	.						15.0	12.0	13.0					19																	58385793		687	1562	2249	SO:0001583	missense	730051	exon3			TAAGGTCTTTTCC		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.965G>A	chr19.hg19:g.58385793C>T	ENSP00000410545:p.Arg322Lys	45.0	0.0	.		96.0	11.0	.	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	hg19	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	0.023	-1.395361	0.01175	.	.	ENSG00000204514	ENST00000435989	T	0.12361	2.69	2.27	9.47E-4	0.14044	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03608	0.0103	N	0.02225	-0.63	0.09310	N	0.999999	B	0.29301	0.241	B	0.28916	0.096	T	0.40534	-0.9558	9	0.02654	T	1	.	4.6969	0.12808	0.0:0.4166:0.0:0.5834	.	322	B7Z6K7	ZN814_HUMAN	K	322	ENSP00000410545:R322K	ENSP00000410545:R322K	R	-	2	0	ZNF814	63077605	0.000000	0.05858	0.024000	0.17045	0.009000	0.06853	-1.883000	0.01623	0.331000	0.23511	-1.381000	0.01174	AGA	.	C|0.500;T|0.500	0.500	weak		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZNF512B	57473	hgsc.bcm.edu	37	20	62595674	62595674	+	Splice_Site	SNP	T	T	C			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr20:62595674T>C	ENST00000450537.1	-	7	1392	c.1332A>G	c.(1330-1332)aaA>aaG	p.K444K	ZNF512B_ENST00000369888.1_Splice_Site_p.K444K|ZNF512B_ENST00000217130.3_Splice_Site_p.K444K			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	444					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GGGTCTTACCTTTGAGCCCAA	0.587																																					p.K444K		Atlas-SNP	.											.	ZNF512B	72	.	0			c.A1332G						PASS	.						161.0	176.0	171.0					20																	62595674		2203	4300	6503	SO:0001630	splice_region_variant	57473	exon7			CTTACCTTTGAGC	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.1333+1A>G	chr20.hg19:g.62595674T>C		64.0	0.0	.		102.0	45.0	.	NM_020713	Q08AK9|Q9ULM4	Silent	SNP	ENST00000450537.1	hg19	CCDS13548.1																																																																																			.	.	.	none		0.587	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	Silent
DYRK1A	1859	hgsc.bcm.edu	37	21	38878548	38878548	+	Intron	SNP	T	T	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr21:38878548T>A	ENST00000398960.2	+	10	1746				DYRK1A_ENST00000451934.1_Missense_Mutation_p.L565M|DYRK1A_ENST00000455387.2_Intron|DYRK1A_ENST00000339659.4_Intron|DYRK1A_ENST00000398956.2_Intron|DYRK1A_ENST00000321219.8_Intron|DYRK1A_ENST00000338785.3_Missense_Mutation_p.L565M	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A						circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)			breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CGTGGTTCATTTGCTTGTGTC	0.567																																					p.L565M	Melanoma(114;464 1602 31203 43785 45765)	Atlas-SNP	.											.	DYRK1A	85	.	0			c.T1693A						PASS	.						89.0	81.0	83.0					21																	38878548		2203	4300	6503	SO:0001627	intron_variant	1859	exon12			GTTCATTTGCTTG	U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.1671+22T>A	chr21.hg19:g.38878548T>A		91.0	0.0	.		126.0	67.0	.	NM_101395	O60769|Q92582|Q92810|Q9UNM5	Missense_Mutation	SNP	ENST00000398960.2	hg19	CCDS42925.1	.	.	.	.	.	.	.	.	.	.	T	8.552	0.875746	0.17395	.	.	ENSG00000157540	ENST00000338785;ENST00000451934	T;T	0.59502	0.26;0.26	1.61	-1.09	0.09904	.	.	.	.	.	T	0.57799	0.2078	.	.	.	0.09310	N	1	P	0.47106	0.89	P	0.57425	0.82	T	0.48198	-0.9056	8	0.34782	T	0.22	.	2.9833	0.05960	0.0:0.1875:0.2532:0.5593	.	565	Q13627-5	.	M	565	ENSP00000342690:L565M;ENSP00000416089:L565M	ENSP00000342690:L565M	L	+	1	2	DYRK1A	37800418	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.375000	0.07475	-0.286000	0.09076	0.477000	0.44152	TTG	.	.	.	none		0.567	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194804.1	NM_001396	
GGT5	2687	hgsc.bcm.edu	37	22	24622177	24622177	+	Missense_Mutation	SNP	C	C	T	rs372349468		TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr22:24622177C>T	ENST00000327365.4	-	8	1512	c.1096G>A	c.(1096-1098)Gat>Aat	p.D366N	GGT5_ENST00000418439.2_Missense_Mutation_p.D289N|GGT5_ENST00000263112.7_Missense_Mutation_p.D334N|GGT5_ENST00000398292.3_Missense_Mutation_p.D366N	NM_001099781.1|NM_004121.2	NP_001093251.1|NP_004112.2	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5	366					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(3)|skin(3)	28						CCCCGGCCATCGATCTGTTGG	0.697																																					p.D366N		Atlas-SNP	.											.	GGT5	61	.	0			c.G1096A						PASS	.	C	ASN/ASP,ASN/ASP,ASN/ASP	0,4406		0,0,2203	31.0	34.0	33.0		1096,1000,1096	1.2	0.1	22		33	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense,missense	GGT5	NM_001099781.1,NM_001099782.1,NM_004121.2	23,23,23	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	366/588,334/555,366/587	24622177	1,13003	2203	4299	6502	SO:0001583	missense	2687	exon8			GGCCATCGATCTG	M64099	CCDS13825.1, CCDS42989.1, CCDS42990.1	22q11.23	2008-03-25	2008-03-10	2008-03-10	ENSG00000099998	ENSG00000099998		"""Gamma-glutamyltransferases"""	4260	protein-coding gene	gene with protein product		137168	"""gamma-glutamyltransferase-like activity 1"""	GGTLA1		1676842, 8095916, 18357469	Standard	NM_004121		Approved	GGT-REL	uc002zzp.4	P36269	OTTHUMG00000150796	ENST00000327365.4:c.1096G>A	chr22.hg19:g.24622177C>T	ENSP00000330080:p.Asp366Asn	42.0	0.0	.		61.0	32.0	.	NM_001099781	Q53XM9|Q6GMP0|Q96FC1|Q9UFM5	Missense_Mutation	SNP	ENST00000327365.4	hg19	CCDS13825.1	.	.	.	.	.	.	.	.	.	.	C	1.035	-0.680699	0.03353	0.0	1.16E-4	ENSG00000099998	ENST00000327365;ENST00000263112;ENST00000438024;ENST00000398292;ENST00000418439	T;T;T;T	0.23552	1.9;1.9;1.9;1.9	4.51	1.16	0.20824	.	0.478235	0.23454	N	0.048014	T	0.16938	0.0407	L	0.37466	1.105	0.09310	N	1	B;B;B;B;B	0.29766	0.256;0.0;0.005;0.001;0.005	B;B;B;B;B	0.29524	0.103;0.002;0.013;0.005;0.013	T	0.14615	-1.0466	10	0.35671	T	0.21	-24.4893	7.3329	0.26592	0.0:0.6111:0.0:0.3889	.	289;334;366;366;366	E7EUG3;P36269-2;Q53XM9;Q6GMP0;P36269	.;.;.;.;GGT5_HUMAN	N	366;334;281;366;289	ENSP00000330080:D366N;ENSP00000263112:D334N;ENSP00000381340:D366N;ENSP00000392146:D289N	ENSP00000263112:D334N	D	-	1	0	GGT5	22952177	0.044000	0.20184	0.083000	0.20561	0.267000	0.26476	0.520000	0.22878	0.480000	0.27534	-0.440000	0.05779	GAT	.	.	.	weak		0.697	GGT5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320119.1	NM_004121	
INPP5J	27124	hgsc.bcm.edu	37	22	31529898	31529898	+	Splice_Site	SNP	G	G	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr22:31529898G>T	ENST00000331075.5	+	13	2563		c.e13-1		INPP5J_ENST00000404390.3_Splice_Site|INPP5J_ENST00000412277.2_Splice_Site|INPP5J_ENST00000405300.1_Splice_Site|INPP5J_ENST00000401755.1_Splice_Site|INPP5J_ENST00000400294.2_Splice_Site|INPP5J_ENST00000402238.1_Splice_Site|INPP5J_ENST00000404453.1_Splice_Site	NM_001284285.1	NP_001271214.1	Q15735	PI5PA_HUMAN	inositol polyphosphate-5-phosphatase J						inositol phosphate metabolic process (GO:0043647)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of neuron projection development (GO:0010977)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase activity (GO:0034485)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	12						ATTTCCCCCAGATCTCGCTGC	0.632																																					.		Atlas-SNP	.											.	INPP5J	94	.	0			c.1411-1G>T						PASS	.						29.0	33.0	32.0					22																	31529898		2138	4236	6374	SO:0001630	splice_region_variant	27124	exon13			CCCCCAGATCTCG	U45975	CCDS46687.1, CCDS63453.1, CCDS63454.1, CCDS63455.1, CCDS74847.1	22q12.2	2008-09-09	2008-09-09	2008-09-09	ENSG00000185133	ENSG00000185133			8956	protein-coding gene	gene with protein product		606481	"""phosphatidylinositol (4,5) bisphosphate 5-phosphatase, A"""	PIB5PA		10591208	Standard	NM_001284287		Approved	INPP5	uc003aju.4	Q15735	OTTHUMG00000151206	ENST00000331075.5:c.2515-1G>T	chr22.hg19:g.31529898G>T		86.0	0.0	.		105.0	59.0	.	NM_001002837	B3KS54|Q32M61|Q6ZTH6|Q8N902|Q9UDT9	Splice_Site	SNP	ENST00000331075.5	hg19		.	.	.	.	.	.	.	.	.	.	G	11.73	1.726006	0.30593	.	.	ENSG00000185133	ENST00000331075;ENST00000412277;ENST00000400294;ENST00000405300;ENST00000404390;ENST00000402238;ENST00000404453;ENST00000401755	.	.	.	5.54	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2368	0.59974	0.0781:0.0:0.9219:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	INPP5J	29859898	1.000000	0.71417	0.996000	0.52242	0.284000	0.27059	8.400000	0.90200	1.338000	0.45544	0.655000	0.94253	.	.	.	.	none		0.632	INPP5J-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000321784.1	NM_001002837	Intron
CDKL5	6792	hgsc.bcm.edu	37	X	18598004	18598004	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chrX:18598004G>T	ENST00000379989.3	+	7	604	c.319G>T	c.(319-321)Gtt>Ttt	p.V107F	CDKL5_ENST00000379996.3_Missense_Mutation_p.V107F	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	107	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					GCCAAATGGAGTTCCACCTGA	0.348																																					p.V107F		Atlas-SNP	.											.	CDKL5	124	.	0			c.G319T						PASS	.						104.0	96.0	99.0					X																	18598004		2203	4300	6503	SO:0001583	missense	6792	exon6			AATGGAGTTCCAC	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.319G>T	chrX.hg19:g.18598004G>T	ENSP00000369325:p.Val107Phe	222.0	0.0	.		310.0	151.0	.	NM_003159	G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Missense_Mutation	SNP	ENST00000379989.3	hg19	CCDS14186.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.812212	0.90707	.	.	ENSG00000008086	ENST00000379996;ENST00000379989	T;T	0.64991	-0.13;-0.13	5.98	5.98	0.97165	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.053035	0.85682	D	0.000000	T	0.54255	0.1847	N	0.00738	-1.235	0.58432	D	0.99999	D	0.76494	0.999	D	0.71184	0.972	T	0.77297	-0.2640	10	0.87932	D	0	-18.1427	19.3864	0.94557	0.0:0.0:1.0:0.0	.	107	O76039	CDKL5_HUMAN	F	107	ENSP00000369332:V107F;ENSP00000369325:V107F	ENSP00000369325:V107F	V	+	1	0	CDKL5	18507925	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.532000	0.85374	0.594000	0.82650	GTT	.	.	.	none		0.348	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159	
YIPF6	286451	hgsc.bcm.edu	37	X	67731818	67731818	+	Splice_Site	SNP	T	T	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chrX:67731818T>A	ENST00000462683.1	+	2	929	c.185T>A	c.(184-186)aTc>aAc	p.I62N	YIPF6_ENST00000374622.2_Intron|YIPF6_ENST00000470730.1_3'UTR	NM_173834.3	NP_776195.2	Q96EC8	YIPF6_HUMAN	Yip1 domain family, member 6	62					intestinal epithelial cell development (GO:0060576)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(1)	7						CGCAATACCATCGTAAGTTAG	0.383																																					p.I62N		Atlas-SNP	.											.	YIPF6	27	.	0			c.T185A						PASS	.						127.0	110.0	116.0					X																	67731818		2203	4300	6503	SO:0001630	splice_region_variant	286451	exon2			ATACCATCGTAAG	BC012469	CCDS14389.1, CCDS56604.1	Xq13.1	2008-02-05			ENSG00000181704	ENSG00000181704		"""Yip1 domain family"""	28304	protein-coding gene	gene with protein product						12477932	Standard	NM_173834		Approved	MGC21416, FinGER6	uc004dwz.3	Q96EC8	OTTHUMG00000021745	ENST00000462683.1:c.186+1T>A	chrX.hg19:g.67731818T>A		47.0	0.0	.		49.0	29.0	.	NM_173834	B4E1U7|G5E997|Q5JP08	Missense_Mutation	SNP	ENST00000462683.1	hg19	CCDS14389.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.566668	0.86439	.	.	ENSG00000181704	ENST00000462683	T	0.48836	0.8	5.66	5.66	0.87406	Yip1 domain (1);	0.175871	0.51477	D	0.000083	T	0.70228	0.3200	M	0.86651	2.83	0.80722	D	1	P	0.50528	0.936	P	0.62813	0.907	T	0.75944	-0.3139	10	0.87932	D	0	0.0812	12.7643	0.57383	0.0:0.0:0.0:1.0	.	62	Q96EC8	YIPF6_HUMAN	N	62	ENSP00000417573:I62N	ENSP00000417573:I62N	I	+	2	0	YIPF6	67648543	1.000000	0.71417	0.905000	0.35620	0.893000	0.52053	6.142000	0.71750	1.921000	0.55644	0.427000	0.28365	ATC	.	.	.	none		0.383	YIPF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057016.1	NM_173834	Missense_Mutation
TEX11	56159	hgsc.bcm.edu	37	X	69844743	69844743	+	Missense_Mutation	SNP	A	A	C			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chrX:69844743A>C	ENST00000395889.2	-	20	1840	c.1685T>G	c.(1684-1686)tTg>tGg	p.L562W	TEX11_ENST00000344304.3_Missense_Mutation_p.L562W|TEX11_ENST00000374333.2_Missense_Mutation_p.L547W|TEX11_ENST00000374320.2_Missense_Mutation_p.L237W	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	562					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					TAAATATTCCAAAGCTTTTTC	0.323																																					p.L562W		Atlas-SNP	.											.	TEX11	132	.	0			c.T1685G						PASS	.						128.0	110.0	116.0					X																	69844743		2202	4300	6502	SO:0001583	missense	56159	exon20			TATTCCAAAGCTT	AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.1685T>G	chrX.hg19:g.69844743A>C	ENSP00000379226:p.Leu562Trp	92.0	0.0	.		162.0	67.0	.	NM_001003811	A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	ENST00000395889.2	hg19	CCDS35323.1	.	.	.	.	.	.	.	.	.	.	A	16.42	3.117493	0.56505	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000374320;ENST00000344304	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	3.73	3.73	0.42828	.	0.000000	0.56097	D	0.000027	T	0.67692	0.2920	M	0.76328	2.33	0.29556	N	0.850963	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.64093	-0.6488	9	.	.	.	-4.4846	8.0729	0.30699	1.0:0.0:0.0:0.0	.	547;562	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	W	547;562;237;562	ENSP00000363453:L547W;ENSP00000379226:L562W;ENSP00000363440:L237W;ENSP00000340995:L562W	.	L	-	2	0	TEX11	69761468	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.154000	0.58125	1.494000	0.48533	0.477000	0.44152	TTG	.	.	.	none		0.323	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1		
MED12	9968	hgsc.bcm.edu	37	X	70350038	70350038	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chrX:70350038C>T	ENST00000374080.3	+	28	4053	c.4021C>T	c.(4021-4023)Cgg>Tgg	p.R1341W	MED12_ENST00000333646.6_Missense_Mutation_p.R1341W|MED12_ENST00000374102.1_Missense_Mutation_p.R1341W			Q93074	MED12_HUMAN	mediator complex subunit 12	1341					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					AAACCCCCAGCGGCAGCGCAT	0.577			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																														p.R1341W		Atlas-SNP	.		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	.	MED12	984	.	0			c.C4021T						PASS	.						32.0	30.0	31.0					X																	70350038		1982	4146	6128	SO:0001583	missense	9968	exon28			CCCCAGCGGCAGC	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.4021C>T	chrX.hg19:g.70350038C>T	ENSP00000363193:p.Arg1341Trp	317.0	0.0	.		521.0	255.0	.	NM_005120	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	ENST00000374080.3	hg19	CCDS43970.1	.	.	.	.	.	.	.	.	.	.	C	17.18	3.324558	0.60634	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072;ENST00000439750	D;D;D;D;T	0.84298	-1.83;-1.83;-1.83;-1.83;1.22	4.93	3.09	0.35607	.	0.060839	0.64402	D	0.000005	D	0.89989	0.6875	M	0.64404	1.975	0.58432	D	0.999992	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.79108	0.992;0.989;0.992;0.982	D	0.89606	0.3838	10	0.87932	D	0	-21.2152	12.2156	0.54404	0.4466:0.5534:0.0:0.0	.	1341;1188;1341;1341	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	W	1341;1341;1341;1341;1309;86	ENSP00000333125:R1341W;ENSP00000363215:R1341W;ENSP00000363193:R1341W;ENSP00000414203:R1309W;ENSP00000408388:R86W	ENSP00000333125:R1341W	R	+	1	2	MED12	70266763	1.000000	0.71417	0.993000	0.49108	0.987000	0.75469	0.934000	0.28910	0.539000	0.28788	0.544000	0.68410	CGG	.	.	.	none		0.577	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120	
VGLL1	51442	hgsc.bcm.edu	37	X	135630875	135630875	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chrX:135630875G>C	ENST00000370634.3	+	3	512	c.342G>C	c.(340-342)caG>caC	p.Q114H	MIR934_ENST00000401241.1_RNA	NM_016267.3	NP_057351.1	Q99990	VGLL1_HUMAN	vestigial-like family member 1	114					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;0.000127)					CTGTGAATCAGTTCTCACCGT	0.587																																					p.Q114H		Atlas-SNP	.											.	VGLL1	41	.	0			c.G342C						PASS	.						267.0	214.0	232.0					X																	135630875		2203	4300	6503	SO:0001583	missense	51442	exon3			GAATCAGTTCTCA	AF137387	CCDS14658.1	Xq26.3	2014-03-03	2014-03-03		ENSG00000102243	ENSG00000102243			20985	protein-coding gene	gene with protein product		300583	"""vestigial like 1 (Drosophila)"""			10518497	Standard	NM_016267		Approved	TONDU, TDU	uc004ezy.3	Q99990	OTTHUMG00000022509	ENST00000370634.3:c.342G>C	chrX.hg19:g.135630875G>C	ENSP00000359668:p.Gln114His	78.0	0.0	.		112.0	53.0	.	NM_016267	Q5H915	Missense_Mutation	SNP	ENST00000370634.3	hg19	CCDS14658.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.891|2.891	-0.229591|-0.229591	0.06022|0.06022	.|.	.|.	ENSG00000102243|ENSG00000102243	ENST00000370634|ENST00000440515	T|.	0.48836|.	0.8|.	5.48|5.48	0.23|0.23	0.15372|0.15372	.|.	1.039970|.	0.07456|.	N|.	0.899768|.	T|T	0.18467|0.18467	0.0443|0.0443	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B|.	0.09022|.	0.002|.	B|.	0.06405|.	0.002|.	T|T	0.21999|0.21999	-1.0229|-1.0229	10|5	0.13853|.	T|.	0.58|.	1.3295|1.3295	1.6736|1.6736	0.02817|0.02817	0.1814:0.2982:0.3651:0.1553|0.1814:0.2982:0.3651:0.1553	.|.	114|.	Q99990|.	VGLL1_HUMAN|.	H|L	114|79	ENSP00000359668:Q114H|.	ENSP00000359668:Q114H|.	Q|V	+|+	3|1	2|0	VGLL1|VGLL1	135458541|135458541	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.006000|0.006000	0.05464|0.05464	-0.138000|-0.138000	0.10374|0.10374	-0.018000|-0.018000	0.14079|0.14079	0.600000|0.600000	0.82982|0.82982	CAG|GTT	.	.	.	none		0.587	VGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058493.1	NM_016267	
BCAP31	10134	hgsc.bcm.edu	37	X	152988658	152988658	+	Silent	SNP	C	C	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chrX:152988658C>T	ENST00000345046.6	-	2	449	c.42G>A	c.(40-42)gcG>gcA	p.A14A	BCAP31_ENST00000458587.2_Silent_p.A81A|BCAP31_ENST00000441714.1_Silent_p.A14A|ABCD1_ENST00000218104.3_5'Flank|BCAP31_ENST00000468947.1_5'Flank|ABCD1_ENST00000370129.4_5'Flank	NM_001256447.1	NP_001243376.1	P51572	BAP31_HUMAN	B-cell receptor-associated protein 31	14					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein localization to endoplasmic reticulum exit site (GO:0070973)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lipid particle (GO:0005811)|membrane (GO:0016020)				endometrium(2)|large_intestine(2)|lung(2)|prostate(1)	7	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAAAGACCTCCGCATAGAGGA	0.522																																					p.A81A		Atlas-SNP	.											.	BCAP31	33	.	0			c.G243A						PASS	.						103.0	81.0	89.0					X																	152988658		2203	4299	6502	SO:0001819	synonymous_variant	10134	exon2			GACCTCCGCATAG	X81109	CCDS14727.1, CCDS48191.1	Xq28	2005-10-11			ENSG00000185825	ENSG00000185825			16695	protein-coding gene	gene with protein product		300398					Standard	NM_001139441		Approved	DXS1357E, BAP31, 6C6-Ag, CDM	uc011mza.1	P51572	OTTHUMG00000024218	ENST00000345046.6:c.42G>A	chrX.hg19:g.152988658C>T		314.0	1.0	.		473.0	206.0	.	NM_001139457	B3KQ79|D3DWV5|Q13836|Q96CF0	Silent	SNP	ENST00000345046.6	hg19	CCDS14727.1																																																																																			.	.	.	none		0.522	BCAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061071.1	NM_005745	
HCFC1	3054	hgsc.bcm.edu	37	X	153216353	153216353	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chrX:153216353A>G	ENST00000310441.7	-	23	6580	c.5614T>C	c.(5614-5616)Tgt>Cgt	p.C1872R	HCFC1_ENST00000354233.3_Missense_Mutation_p.C1803R|HCFC1_ENST00000369984.4_Missense_Mutation_p.C1917R	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	1872	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCCCGGCCACAGGCATTGATT	0.547																																					p.C1872R		Atlas-SNP	.											.	HCFC1	284	.	0			c.T5614C						PASS	.						136.0	147.0	143.0					X																	153216353		1983	4139	6122	SO:0001583	missense	3054	exon23			GGCCACAGGCATT		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.5614T>C	chrX.hg19:g.153216353A>G	ENSP00000309555:p.Cys1872Arg	275.0	0.0	.		360.0	177.0	.	NM_005334	Q6P4G5	Missense_Mutation	SNP	ENST00000310441.7	hg19	CCDS44020.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.0|22.0	4.232555|4.232555	0.79688|0.79688	.|.	.|.	ENSG00000172534|ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233|ENST00000444191	T;T;T|.	0.52526|.	0.66;0.66;0.66|.	5.64|5.64	5.64|5.64	0.86602|0.86602	Fibronectin, type III (2);Immunoglobulin-like fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78253|0.78253	0.4254|0.4254	M|M	0.85630|0.85630	2.765|2.765	0.58432|0.58432	D|D	0.999999|0.999999	D|.	0.71674|.	0.998|.	P|.	0.61940|.	0.896|.	T|T	0.80933|0.80933	-0.1161|-0.1161	10|5	0.87932|.	D|.	0|.	.|.	13.8588|13.8588	0.63548|0.63548	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1872|.	P51610|.	HCFC1_HUMAN|.	R|P	1872;1917;1803|447	ENSP00000309555:C1872R;ENSP00000359001:C1917R;ENSP00000346174:C1803R|.	ENSP00000309555:C1872R|.	C|L	-|-	1|2	0|0	HCFC1|HCFC1	152869547|152869547	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	7.161000|7.161000	0.77505|0.77505	1.917000|1.917000	0.55516|0.55516	0.424000|0.424000	0.28305|0.28305	TGT|CTG	.	.	.	none		0.547	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061099.4	NM_005334	
MT-CYB	4519	hgsc.bcm.edu	37	M	14760	14760	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chrM:14760G>A	ENST00000361789.2	+	1	14	c.14G>A	c.(13-15)cGc>cAc	p.R5H	MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TP_ENST00000387461.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	5					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						GACCCCAATACGCAAAATTAA	0.423																																					p.R5H		Atlas-SNP	.											.	.	.	.	0			c.G14A						PASS	.																																			SO:0001583	missense	0	exon1			CAATACGCAAAAC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.14G>A	chrM.hg19:g.14760G>A	ENSP00000354554:p.Arg5His	129.0	0.0	.		99.0	7.0	.	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.	.	none		0.423	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
LRRC58	116064	hgsc.bcm.edu	37	3	120054774	120054774	+	Frame_Shift_Del	DEL	T	T	-			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr3:120054774delT	ENST00000295628.3	-	2	622	c.527delA	c.(526-528)aatfs	p.N176fs		NM_001099678.1	NP_001093148.1	Q96CX6	LRC58_HUMAN	leucine rich repeat containing 58	176										large_intestine(2)|lung(5)	7				GBM - Glioblastoma multiforme(114;0.147)		TTTAATGAAATTTCCTCCAAG	0.308																																					p.N176fs		Atlas-Indel,Pindel	.											.	LRRC58	18	.	0			c.528delT						PASS	.						72.0	67.0	68.0					3																	120054774		1796	4060	5856	SO:0001589	frameshift_variant	116064	exon2			.	BC013757	CCDS46892.1	3q13.33	2006-01-06			ENSG00000163428	ENSG00000163428			26968	protein-coding gene	gene with protein product							Standard	NM_001099678		Approved		uc003edr.2	Q96CX6	OTTHUMG00000159407	ENST00000295628.3:c.527delA	chr3.hg19:g.120054774delT	ENSP00000295628:p.Asn176fs	55.0	0.0	0		58.0	20.0	0.344828	NM_001099678		Frame_Shift_Del	DEL	ENST00000295628.3	hg19	CCDS46892.1																																																																																			.	.	.	none		0.308	LRRC58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355142.1	XM_057296	
CAMK2N1	55450	hgsc.bcm.edu	37	1	20811794	20811796	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	AGG	AGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr1:20811794_20811796delAGG	ENST00000375078.3	-	1	917_919	c.77_79delCCT	c.(76-81)tcctgc>tgc	p.S26del	CAMK2N1_ENST00000489020.1_5'Flank	NM_018584.5	NP_061054.2	Q7Z7J9	CK2N1_HUMAN	calcium/calmodulin-dependent protein kinase II inhibitor 1	26						cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	calcium-dependent protein kinase inhibitor activity (GO:0008427)			lung(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000247)|Lung NSC(340;0.000285)|Breast(348;0.0013)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|COAD - Colon adenocarcinoma(152;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000132)|Kidney(64;0.00016)|GBM - Glioblastoma multiforme(114;0.00116)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.195)		TGCAGGCGGCAGGAGAAGATCTG	0.709																																					p.26_27del		Atlas-Indel,Pindel	.											.	CAMK2N1	7	.	0			c.78_80del						PASS	.																																			SO:0001651	inframe_deletion	55450	exon1			.	AY204901	CCDS207.1	1p36.12	2008-02-05			ENSG00000162545	ENSG00000162545			24190	protein-coding gene	gene with protein product		614986				12477932	Standard	NM_018584		Approved	CaMKIINalpha	uc001bdh.3	Q7Z7J9	OTTHUMG00000002837	ENST00000375078.3:c.77_79delCCT	chr1.hg19:g.20811794_20811796delAGG	ENSP00000364219:p.Ser26del	59.0	0.0	0		78.0	48.0	0.615385	NM_018584		In_Frame_Del	DEL	ENST00000375078.3	hg19	CCDS207.1																																																																																			.	.	.	none		0.709	CAMK2N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007949.1	NM_018584	
HSPA14	51182	hgsc.bcm.edu	37	10	14909284	14909284	+	Frame_Shift_Del	DEL	T	T	-			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr10:14909284delT	ENST00000378372.3	+	11	1435	c.1196delT	c.(1195-1197)attfs	p.I399fs		NM_016299.2	NP_057383.2	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14	399					'de novo' cotranslational protein folding (GO:0051083)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)			breast(4)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	17						GCCAGAGATATTTTAGTTAAG	0.318																																					p.I399fs		Atlas-Indel,Pindel	.											.	HSPA14	42	.	0			c.1195delA						PASS	.						80.0	82.0	81.0					10																	14909284		2203	4300	6503	SO:0001589	frameshift_variant	51182	exon11			.	AF112210	CCDS7103.1, CCDS60487.1	10p13	2011-09-02			ENSG00000187522	ENSG00000187522		"""Heat shock proteins / HSP70"""	29526	protein-coding gene	gene with protein product		610369				12477932	Standard	NM_016299		Approved	HSP70-4, HSP70L1	uc001ind.4	Q0VDF9	OTTHUMG00000017712	ENST00000378372.3:c.1196delT	chr10.hg19:g.14909284delT	ENSP00000367623:p.Ile399fs	74.0	0.0	0		127.0	66.0	0.519685	NM_016299	A8K8F8|B0YIY9|Q9P0X2|Q9UI07	Frame_Shift_Del	DEL	ENST00000378372.3	hg19	CCDS7103.1																																																																																			.	.	.	none		0.318	HSPA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046910.1	NM_016299	
RSG1	79363	hgsc.bcm.edu	37	1	16563166	16563167	+	Frame_Shift_Ins	INS	-	-	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr1:16563166_16563167insT	ENST00000375599.3	-	1	490_491	c.71_72insA	c.(70-72)tacfs	p.Y24fs		NM_030907.3	NP_112169.2	Q9BU20	RSG1_HUMAN	REM2 and RAB-like small GTPase 1	24					cellular protein localization (GO:0034613)|cilium assembly (GO:0042384)|exocytosis (GO:0006887)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of vesicle fusion (GO:0031338)|small GTPase mediated signal transduction (GO:0007264)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)	GTP binding (GO:0005525)			large_intestine(2)|lung(2)|pancreas(1)|prostate(1)	6						TGCAAGCCAGGTACTCCTTGCC	0.639																																					p.Y24_L25delinsX		Atlas-Indel,Pindel	.											.	RSG1	18	.	0			c.72_73insA						PASS	.																																			SO:0001589	frameshift_variant	79363	exon1			.	BC008702	CCDS171.1	1p36.13	2014-02-21	2011-02-22	2011-02-22	ENSG00000132881	ENSG00000132881			28127	protein-coding gene	gene with protein product	"""Rem/Rab-Similar GTPase 1"""		"""chromosome 1 open reading frame 89"""	C1orf89		19767740	Standard	NM_030907		Approved	MGC10731	uc001ayd.3	Q9BU20	OTTHUMG00000002214	ENST00000375599.3:c.72dupA	chr1.hg19:g.16563167_16563167dupT	ENSP00000364749:p.Tyr24fs	133.0	0.0	0		205.0	85.0	0.414634	NM_030907	Q5TEV7	Frame_Shift_Ins	INS	ENST00000375599.3	hg19	CCDS171.1																																																																																			.	.	.	none		0.639	RSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006279.2	NM_030907	
URM1	81605	hgsc.bcm.edu	37	9	131151666	131151667	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr9:131151666_131151667delGG	ENST00000452446.1	+	4	377_378	c.315_316delGG	c.(313-318)caggcafs	p.QA105fs	RP11-339B21.11_ENST00000609303.1_lincRNA|URM1_ENST00000483206.1_3'UTR|URM1_ENST00000372853.4_Intron|URM1_ENST00000372850.1_3'UTR	NM_001135947.2	NP_001129419.1			ubiquitin related modifier 1											cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	5						CCTCTCCTCAGGCACATATAGA	0.629																																					p.105_105del		Atlas-Indel,Pindel	.											.	URM1	19	.	0			c.314_315del						PASS	.																																			SO:0001589	frameshift_variant	81605	exon4			.	AK097029	CCDS6900.1, CCDS48035.1, CCDS59148.1	9q34.13	2010-06-24	2010-06-24	2006-11-28	ENSG00000167118	ENSG00000167118			28378	protein-coding gene	gene with protein product		612693	"""chromosome 9 open reading frame 74"", ""ubiquitin related modifier 1 homolog (S. cerevisiae)"""	C9orf74		16046629, 16864801	Standard	NM_030914		Approved	MGC2668	uc011may.2	Q9BTM9	OTTHUMG00000020742	ENST00000452446.1:c.315_316delGG	chr9.hg19:g.131151666_131151667delGG	ENSP00000412922:p.Gln105fs	62.0	0.0	0		169.0	41.0	0.242604	NM_001135947		Frame_Shift_Del	DEL	ENST00000452446.1	hg19	CCDS48035.1																																																																																			.	.	.	none		0.629	URM1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_030914	
PRAMEF1	65121	hgsc.bcm.edu	37	1	12855755	12855756	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr1:12855755_12855756insAA	ENST00000332296.7	+	4	1138_1139	c.1035_1036insAA	c.(1036-1038)aaafs	p.K346fs	PRAMEF1_ENST00000400814.3_Frame_Shift_Ins_p.K101fs	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	346					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CTCTGCTGGAGAAAATTGCTGC	0.559																																					p.E345fs		Atlas-Indel,Pindel	.											.	PRAMEF1	78	.	0			c.1035_1036insAA						PASS	.																																			SO:0001589	frameshift_variant	65121	exon4			.	AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.1038_1039dupAA	chr1.hg19:g.12855758_12855759dupAA	ENSP00000332134:p.Lys346fs	179.0	0.0	0		261.0	99.0	0.37931	NM_023013	Q9UQP2	Frame_Shift_Ins	INS	ENST00000332296.7	hg19	CCDS148.1																																																																																			.	.	.	none		0.559	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	NM_023013	
PPM1M	132160	hgsc.bcm.edu	37	3	52282984	52282984	+	Frame_Shift_Del	DEL	G	G	-			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr3:52282984delG	ENST00000296487.4	+	8	912	c.508delG	c.(508-510)ggafs	p.G170fs	PPM1M_ENST00000323588.4_Frame_Shift_Del_p.G170fs|PPM1M_ENST00000457351.2_Frame_Shift_Del_p.G331fs|PPM1M_ENST00000409502.3_Frame_Shift_Del_p.G119fs			Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1M	170	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			prostate(1)|urinary_tract(1)	2				BRCA - Breast invasive adenocarcinoma(193;2.4e-05)|Kidney(197;0.00171)|KIRC - Kidney renal clear cell carcinoma(197;0.00194)		TCGGTTACTAGGAACACTGGC	0.572																																					p.L330fs	NSCLC(151;810 2688 34365 49863)	Atlas-Indel,Pindel	.											.	PPM1M	9	.	0			c.990delA						PASS	.						48.0	46.0	47.0					3																	52282984		2203	4299	6502	SO:0001589	frameshift_variant	132160	exon8			.	AK096681	CCDS46840.1	3p21.31	2012-04-17	2010-03-05		ENSG00000164088	ENSG00000164088		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	26506	protein-coding gene	gene with protein product	"""protein phosphatase 2C eta"""	608979	"""protein phosphatase 1M (PP2C domain containing)"""			12477932	Standard	NM_001122870		Approved	PP2Ceta, FLJ32332	uc011bed.2	Q96MI6	OTTHUMG00000153046	ENST00000296487.4:c.508delG	chr3.hg19:g.52282984delG	ENSP00000296487:p.Gly170fs	58.0	0.0	0		94.0	53.0	0.56383	NM_144641	Q8N8J9|Q96DB8	Frame_Shift_Del	DEL	ENST00000296487.4	hg19																																																																																				.	.	.	none		0.572	PPM1M-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000329230.2	NM_144641	
PIGM	93183	hgsc.bcm.edu	37	1	160001302	160001303	+	Frame_Shift_Ins	INS	-	-	T			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr1:160001302_160001303insT	ENST00000368090.2	-	1	480_481	c.227_228insA	c.(226-228)tacfs	p.Y76fs		NM_145167.2	NP_660150.1	Q9H3S5	PIGM_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class M	76					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			kidney(1)|large_intestine(4)|lung(9)|ovary(2)|skin(1)	17	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GCAGCGGGGTGTAACGGTACGT	0.594																																					p.Y76_T77delinsX		Atlas-Indel,Pindel	.											.	PIGM	27	.	0			c.228_229insA						PASS	.																																			SO:0001589	frameshift_variant	93183	exon1			.	AB028127	CCDS1192.1	1q23.2	2013-02-26	2006-06-28		ENSG00000143315	ENSG00000143315		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	18858	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 1"", ""DPM:GlcN-(acyl-)PI mannosyltransferase"", ""dol-P-Man dependent GPI mannosyltransferase"""	610273	"""phosphatidylinositol glycan, class M"""			11226175	Standard	NM_145167		Approved	GPI-MT-I	uc001fuv.1	Q9H3S5	OTTHUMG00000024081	ENST00000368090.2:c.228dupA	chr1.hg19:g.160001303_160001303dupT	ENSP00000357069:p.Tyr76fs	233.0	0.0	0		380.0	171.0	0.45	NM_145167		Frame_Shift_Ins	INS	ENST00000368090.2	hg19	CCDS1192.1																																																																																			.	.	.	none		0.594	PIGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060643.2	NM_145167	
EDDM3A	10876	hgsc.bcm.edu	37	14	21215972	21215973	+	Frame_Shift_Ins	INS	-	-	CA	rs149270684	byFrequency	TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr14:21215972_21215973insCA	ENST00000326842.2	+	2	360_361	c.233_234insCA	c.(232-237)cgtgcafs	p.A79fs		NM_006683.4	NP_006674.2	Q14507	EP3A_HUMAN	epididymal protein 3A	79					sperm displacement (GO:0007321)	extracellular space (GO:0005615)				breast(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6						AAAATTCAGCGTGCATGCATCA	0.436																																					p.R78fs		Atlas-Indel,Pindel	.											.	EDDM3A	15	.	0			c.233_234insCA						PASS	.																																			SO:0001589	frameshift_variant	10876	exon2			.	X76383	CCDS9556.1	14q11.1	2010-03-19	2010-01-27	2010-01-27	ENSG00000181562	ENSG00000181562			16978	protein-coding gene	gene with protein product		611580	"""family with sequence similarity 12, member A"""	FAM12A		7514008	Standard	NM_006683		Approved	HE3-ALPHA	uc001vyc.3	Q14507	OTTHUMG00000029581	Exception_encountered	chr14.hg19:g.21215972_21215973insCA	ENSP00000315098:p.Ala79fs	67.0	0.0	0		92.0	29.0	0.315217	NM_006683	Q4KN33	Frame_Shift_Ins	INS	ENST00000326842.2	hg19	CCDS9556.1																																																																																			.	.	.	none		0.436	EDDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073742.3		
LRRK1	79705	hgsc.bcm.edu	37	15	101589985	101589985	+	Frame_Shift_Del	DEL	C	C	-			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr15:101589985delC	ENST00000388948.3	+	23	3795	c.3436delC	c.(3436-3438)cccfs	p.P1146fs	RP11-505E24.2_ENST00000559857.1_RNA|LRRK1_ENST00000284395.5_Frame_Shift_Del_p.P1143fs|RP11-505E24.3_ENST00000558979.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TCAGTGGTTTCCCGGTAAGAG	0.473																																					p.F1145fs		Atlas-Indel,Pindel	.											.	LRRK1	310	.	0			c.3435delT						PASS	.						67.0	67.0	67.0					15																	101589985		1922	4123	6045	SO:0001589	frameshift_variant	79705	exon23			.	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.3436delC	chr15.hg19:g.101589985delC	ENSP00000373600:p.Pro1146fs	41.0	0.0	0		62.0	28.0	0.451613	NM_024652		Frame_Shift_Del	DEL	ENST00000388948.3	hg19	CCDS42086.1																																																																																			.	.	.	none		0.473	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
EDDM3A	10876	hgsc.bcm.edu	37	14	21215971	21215972	+	Frame_Shift_Ins	INS	-	-	CT	rs149270684	byFrequency	TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr14:21215971_21215972insCT	ENST00000326842.2	+	2	359_360	c.232_233insCT	c.(232-234)cgtfs	p.R78fs		NM_006683.4	NP_006674.2	Q14507	EP3A_HUMAN	epididymal protein 3A	78					sperm displacement (GO:0007321)	extracellular space (GO:0005615)				breast(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6						CAAAATTCAGCGTGCATGCATC	0.436																																					p.R78fs		Atlas-INDEL	.											.	EDDM3A	15	.	0			c.232_233insCT						PASS	.																																			SO:0001589	frameshift_variant	10876	exon2			.	X76383	CCDS9556.1	14q11.1	2010-03-19	2010-01-27	2010-01-27	ENSG00000181562	ENSG00000181562			16978	protein-coding gene	gene with protein product		611580	"""family with sequence similarity 12, member A"""	FAM12A		7514008	Standard	NM_006683		Approved	HE3-ALPHA	uc001vyc.3	Q14507	OTTHUMG00000029581	Exception_encountered	chr14.hg19:g.21215971_21215972insCT	ENSP00000315098:p.Arg78fs	68.0	0.0	0		93.0	29.0	0.311828	NM_006683	Q4KN33	Frame_Shift_Ins	INS	ENST00000326842.2	hg19	CCDS9556.1																																																																																			.	.	.	none		0.436	EDDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073742.3		
CLUH	23277	hgsc.bcm.edu	37	17	2599551	2599552	+	Splice_Site	DEL	CC	CC	-			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr17:2599551_2599552delCC	ENST00000570628.2	-	13	2280_2281	c.2175_2176delGG	c.(2173-2178)ggggtt>ggtt	p.V726fs	CLUH_ENST00000435359.1_Splice_Site_p.V726fs|CLUH_ENST00000538975.1_Splice_Site_p.V726fs			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	726					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											GGGAAACGAACCCCTGGAGGAG	0.634																																					p.726_726del		Atlas-Indel,Pindel	.											.	.	.	.	0			c.2176_2177del						PASS	.																																			SO:0001630	splice_region_variant	23277	exon13			.	AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.2174-1GG>-	chr17.hg19:g.2599553_2599554delCC		122.0	0.0	0		169.0	91.0	0.538462	NM_015229	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Frame_Shift_Del	DEL	ENST00000570628.2	hg19	CCDS45572.1																																																																																			.	.	.	none		0.634	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437807.2	NM_015229	Frame_Shift_Del
MUC5B	727897	hgsc.bcm.edu	37	11	1256589	1256589	+	Frame_Shift_Del	DEL	C	C	-			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr11:1256589delC	ENST00000529681.1	+	23	2884	c.2826delC	c.(2824-2826)atcfs	p.I942fs	MUC5B_ENST00000447027.1_Frame_Shift_Del_p.I945fs	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	942	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCGAGAACATCCCCTGTGGGA	0.647																																					p.I942fs		Atlas-Indel,Pindel	.											.	MUC5B	473	.	0			c.2825delT						PASS	.						53.0	60.0	58.0					11																	1256589		2118	4223	6341	SO:0001589	frameshift_variant	727897	exon23			.	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2826delC	chr11.hg19:g.1256589delC	ENSP00000436812:p.Ile942fs	105.0	0.0	0		124.0	57.0	0.459677	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Frame_Shift_Del	DEL	ENST00000529681.1	hg19	CCDS44515.2																																																																																			.	.	.	weak		0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
ANGPTL3	27329	hgsc.bcm.edu	37	1	63070461	63070462	+	Frame_Shift_Ins	INS	-	-	C			TCGA-Y8-A894-01A-11D-A35Z-10	TCGA-Y8-A894-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5b9ebe3e-3992-4806-934e-c135aa155ff9	a1ac890b-98dd-4011-aee1-b4409f2a659a	g.chr1:63070461_63070462insC	ENST00000371129.3	+	7	1436_1437	c.1356_1357insC	c.(1357-1359)ccafs	p.P453fs	DOCK7_ENST00000404627.2_Intron|DOCK7_ENST00000251157.5_Intron|DOCK7_ENST00000340370.5_Intron|AL138847.1_ENST00000593719.1_5'Flank	NM_014495.2	NP_055310.1	Q9Y5C1	ANGL3_HUMAN	angiopoietin-like 3	453	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				acylglycerol homeostasis (GO:0055090)|artery morphogenesis (GO:0048844)|cell-matrix adhesion (GO:0007160)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|fatty acid metabolic process (GO:0006631)|glycerol metabolic process (GO:0006071)|integrin-mediated signaling pathway (GO:0007229)|lipid homeostasis (GO:0055088)|lipid storage (GO:0019915)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of phospholipase activity (GO:0010519)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of lipid catabolic process (GO:0050996)|response to hormone (GO:0009725)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	cell surface (GO:0009986)|extracellular space (GO:0005615)	enzyme inhibitor activity (GO:0004857)|growth factor activity (GO:0008083)|integrin binding (GO:0005178)|phospholipase inhibitor activity (GO:0004859)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|urinary_tract(1)	13						TGTTGATCCATCCAACAGATTC	0.337																																					p.N452fs		Pindel	.											.	ANGPTL3	42	.	0			c.1356_1357insC						PASS	.																																			SO:0001589	frameshift_variant	27329	exon7			.	AF152562	CCDS622.1	1p31.3	2013-02-06			ENSG00000132855	ENSG00000132855		"""Fibrinogen C domain containing"""	491	protein-coding gene	gene with protein product	"""angiopoietin 5"""	604774		ANGPT5		10644446	Standard	NM_014495		Approved		uc001das.2	Q9Y5C1	OTTHUMG00000009146	ENST00000371129.3:c.1358dupC	chr1.hg19:g.63070463_63070463dupC	ENSP00000360170:p.Pro453fs	234.0	0.0	.		363.0	90.0	0.248	NM_014495	A0JLS0|B1ALJ0|B2RCW1	Frame_Shift_Ins	INS	ENST00000371129.3	hg19	CCDS622.1																																																																																			.	.	.	none		0.337	ANGPTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025344.1	NM_014495	
