#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NOL9	79707	hgsc.bcm.edu	37	1	6586011	6586011	+	Missense_Mutation	SNP	A	A	C			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr1:6586011A>C	ENST00000377705.5	-	12	2044	c.2012T>G	c.(2011-2013)cTt>cGt	p.L671R		NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	671					maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		TGCTCCAGGAAGTTTAAAATT	0.453																																					p.L671R		Atlas-SNP	.											.	NOL9	49	.	0			c.T2012G						PASS	.						147.0	143.0	144.0					1																	6586011		2203	4300	6503	SO:0001583	missense	79707	exon12			CCAGGAAGTTTAA	AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.2012T>G	chr1.hg19:g.6586011A>C	ENSP00000366934:p.Leu671Arg	106.0	0.0	.		105.0	47.0	.	NM_024654	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Missense_Mutation	SNP	ENST00000377705.5	hg19	CCDS80.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.159128	0.78226	.	.	ENSG00000162408	ENST00000377705	T	0.25414	1.8	5.29	5.29	0.74685	.	0.313337	0.30483	N	0.009529	T	0.24736	0.0600	N	0.24115	0.695	0.26608	N	0.972888	P	0.38223	0.623	P	0.46718	0.525	T	0.13818	-1.0495	10	0.31617	T	0.26	-17.1771	11.6254	0.51142	1.0:0.0:0.0:0.0	.	671	Q5SY16	NOL9_HUMAN	R	671	ENSP00000366934:L671R	ENSP00000366934:L671R	L	-	2	0	NOL9	6508598	1.000000	0.71417	0.913000	0.36048	0.959000	0.62525	4.940000	0.63533	2.010000	0.58986	0.533000	0.62120	CTT	.	.	.	none		0.453	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002625.1	NM_024654	
CFAP57	149465	hgsc.bcm.edu	37	1	43688643	43688643	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr1:43688643G>A	ENST00000372492.4	+	16	3005	c.2681G>A	c.(2680-2682)gGa>gAa	p.G894E		NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		894										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CGGCTCAAGGGAGAAACAGGC	0.498																																					p.G894E		Atlas-SNP	.											.	WDR65	76	.	0			c.G2681A						PASS	.																																			SO:0001583	missense	149465	exon16			TCAAGGGAGAAAC																												ENST00000372492.4:c.2681G>A	chr1.hg19:g.43688643G>A	ENSP00000361570:p.Gly894Glu	237.0	1.0	.		201.0	98.0	.	NM_001195831	A6NKQ3|Q17RI9|Q5TAI0	Missense_Mutation	SNP	ENST00000372492.4	hg19		.	.	.	.	.	.	.	.	.	.	G	21.4	4.142776	0.77888	.	.	ENSG00000243710	ENST00000372492	T	0.61859	0.07	4.49	4.49	0.54785	.	.	.	.	.	T	0.68632	0.3022	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70846	-0.4761	6	0.48119	T	0.1	.	14.9614	0.71158	0.0:0.0:1.0:0.0	.	.	.	.	E	894	ENSP00000361570:G894E	ENSP00000361570:G894E	G	+	2	0	WDR65	43461230	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.398000	0.73244	2.054000	0.61138	0.460000	0.39030	GGA	.	.	.	none		0.498	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000384325.1		
EVI5	7813	hgsc.bcm.edu	37	1	93029241	93029241	+	Nonsense_Mutation	SNP	A	A	C			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr1:93029241A>C	ENST00000370331.1	-	17	2085	c.2076T>G	c.(2074-2076)taT>taG	p.Y692*	EVI5_ENST00000540033.1_Nonsense_Mutation_p.Y692*|EVI5_ENST00000543509.1_Nonsense_Mutation_p.Y703*|EVI5_ENST00000491940.1_5'UTR	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5	692	Dimerization.|Interaction with AURKB and INCENP.|Targeting to the centrosomes.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		GTTCCCCAATATACTGGTTAG	0.353																																					p.Y692X		Atlas-SNP	.											.	EVI5	94	.	0			c.T2076G						PASS	.						238.0	220.0	226.0					1																	93029241		2203	4300	6503	SO:0001587	stop_gained	7813	exon17			CCCAATATACTGG	AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.2076T>G	chr1.hg19:g.93029241A>C	ENSP00000359356:p.Tyr692*	88.0	0.0	.		60.0	14.0	.	NM_005665	A6NKX8|B9A6J0|Q9H1Y9	Nonsense_Mutation	SNP	ENST00000370331.1	hg19	CCDS30774.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.957523	0.73902	.	.	ENSG00000067208	ENST00000370331;ENST00000540033;ENST00000543509	.	.	.	5.13	-1.66	0.08265	.	0.072010	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-0.5212	12.6233	0.56616	0.5336:0.0:0.4664:0.0	.	.	.	.	X	692;692;703	.	ENSP00000359356:Y692X	Y	-	3	2	EVI5	92801829	1.000000	0.71417	0.994000	0.49952	0.969000	0.65631	1.810000	0.38932	-0.197000	0.10350	0.260000	0.18958	TAT	.	.	.	none		0.353	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030047.1	NM_005665	
SV2A	9900	hgsc.bcm.edu	37	1	149882136	149882136	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr1:149882136G>C	ENST00000369146.3	-	5	1565	c.1075C>G	c.(1075-1077)Cgt>Ggt	p.R359G	SV2A_ENST00000369145.1_Missense_Mutation_p.R359G	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	359					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	AGGAAGAAACGGGGGCTCTCA	0.607																																					p.R359G		Atlas-SNP	.											.	SV2A	123	.	0			c.C1075G						PASS	.						39.0	36.0	37.0					1																	149882136		2203	4299	6502	SO:0001583	missense	9900	exon5			AGAAACGGGGGCT	AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.1075C>G	chr1.hg19:g.149882136G>C	ENSP00000358142:p.Arg359Gly	76.0	0.0	.		68.0	33.0	.	NM_014849	D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Missense_Mutation	SNP	ENST00000369146.3	hg19	CCDS940.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.532504	0.85812	.	.	ENSG00000159164	ENST00000369146;ENST00000369145	T;T	0.79845	-1.31;-1.31	5.09	5.09	0.68999	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.91185	0.7223	H	0.96048	3.76	0.80722	D	1	P	0.51240	0.943	P	0.60117	0.869	D	0.93350	0.6717	10	0.87932	D	0	-13.1584	16.0247	0.80536	0.0:0.0:1.0:0.0	.	359	Q7L0J3	SV2A_HUMAN	G	359	ENSP00000358142:R359G;ENSP00000358141:R359G	ENSP00000358141:R359G	R	-	1	0	SV2A	148148760	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.691000	0.84191	2.638000	0.89438	0.650000	0.86243	CGT	.	.	.	none		0.607	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1		
SETDB1	9869	hgsc.bcm.edu	37	1	150936091	150936091	+	Missense_Mutation	SNP	C	C	A	rs148647469	byFrequency	TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr1:150936091C>A	ENST00000271640.5	+	20	3733	c.3543C>A	c.(3541-3543)aaC>aaA	p.N1181K	RP11-316M1.12_ENST00000560481.1_RNA|CERS2_ENST00000345896.4_5'Flank|RP11-316M1.12_ENST00000561111.1_RNA|SETDB1_ENST00000368969.4_Missense_Mutation_p.N1181K	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	1181	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			AATCAACCAACATGGCCTCTG	0.493																																					p.N1181K		Atlas-SNP	.											.	SETDB1	204	.	0			c.C3543A						PASS	.						194.0	192.0	192.0					1																	150936091		2203	4300	6503	SO:0001583	missense	9869	exon20			AACCAACATGGCC	D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.3543C>A	chr1.hg19:g.150936091C>A	ENSP00000271640:p.Asn1181Lys	223.0	0.0	.		230.0	19.0	.	NM_012432	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Missense_Mutation	SNP	ENST00000271640.5	hg19	CCDS44217.1	.	.	.	.	.	.	.	.	.	.	C	12.41	1.929543	0.34096	.	.	ENSG00000143379	ENST00000271640;ENST00000368969;ENST00000498193	D;D;D	0.81659	-1.52;-1.52;-1.52	5.79	4.88	0.63580	SET domain (3);	0.148570	0.64402	D	0.000009	T	0.47801	0.1465	N	0.19112	0.55	0.80722	D	1	B;P;B	0.43287	0.096;0.802;0.017	B;B;B	0.40477	0.089;0.33;0.025	T	0.59279	-0.7484	10	0.06099	T	0.92	.	11.6707	0.51399	0.0:0.7451:0.1871:0.0678	.	1181;1181;1181	E9PRF4;Q15047-3;Q15047	.;.;SETB1_HUMAN	K	1181	ENSP00000271640:N1181K;ENSP00000357965:N1181K;ENSP00000432348:N1181K	ENSP00000271640:N1181K	N	+	3	2	SETDB1	149202715	1.000000	0.71417	0.998000	0.56505	0.326000	0.28443	1.921000	0.40035	1.454000	0.47793	0.561000	0.74099	AAC	.	C|1.000;T|0.000	.	alt		0.493	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084717.2		
ZNF687	57592	hgsc.bcm.edu	37	1	151259239	151259239	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr1:151259239A>G	ENST00000368879.2	+	2	570	c.472A>G	c.(472-474)Act>Gct	p.T158A		NM_020832.1	NP_065883.1	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	158	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	32	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GGAAGGCAAAACTCCCTTGGA	0.602																																					p.T158A		Atlas-SNP	.											.	ZNF687	94	.	0			c.A472G						PASS	.						58.0	61.0	60.0					1																	151259239		2203	4300	6503	SO:0001583	missense	57592	exon2			GGCAAAACTCCCT		CCDS992.1	1q21.2	2008-05-02			ENSG00000143373	ENSG00000143373			29277	protein-coding gene	gene with protein product		610568				10718198	Standard	NM_020832		Approved	KIAA1441	uc001exq.3	Q8N1G0	OTTHUMG00000012347	ENST00000368879.2:c.472A>G	chr1.hg19:g.151259239A>G	ENSP00000357874:p.Thr158Ala	91.0	0.0	.		74.0	33.0	.	NM_020832	D3DV17|Q68DQ8|Q9H937|Q9P2A7	Missense_Mutation	SNP	ENST00000368879.2	hg19		.	.	.	.	.	.	.	.	.	.	A	0.013	-1.628884	0.00813	.	.	ENSG00000143373	ENST00000336715;ENST00000324048;ENST00000368879	T;T;T	0.00768	5.72;5.72;6.05	4.52	-0.232	0.13082	.	0.511841	0.14589	N	0.310353	T	0.00144	0.0004	N	0.04508	-0.205	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.13388	-1.0511	9	.	.	.	.	5.0653	0.14578	0.5089:0.1725:0.3187:0.0	.	158;158;158	Q8N1G0-2;Q8N1G0;F8WCX2	.;ZN687_HUMAN;.	A	158	ENSP00000336620:T158A;ENSP00000319829:T158A;ENSP00000357874:T158A	.	T	+	1	0	ZNF687	149525863	0.204000	0.23447	0.537000	0.28052	0.887000	0.51463	0.182000	0.16900	0.144000	0.18951	-0.736000	0.03550	ACT	.	.	.	none		0.602	ZNF687-201	KNOWN	basic	protein_coding	protein_coding		NM_020832	
CRTC2	200186	hgsc.bcm.edu	37	1	153921707	153921707	+	Missense_Mutation	SNP	A	A	C			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr1:153921707A>C	ENST00000368633.1	-	12	1685	c.1558T>G	c.(1558-1560)Tca>Gca	p.S520A	CRTC2_ENST00000368630.3_Missense_Mutation_p.S200A|DENND4B_ENST00000361217.4_5'Flank	NM_181715.2	NP_859066.1	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	520					gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|histone H3-K9 acetylation (GO:0043970)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)			NS(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	27	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TGCCCACCTGAGGACTGCACT	0.612																																					p.S520A		Atlas-SNP	.											.	CRTC2	58	.	0			c.T1558G						PASS	.						63.0	61.0	62.0					1																	153921707		2203	4300	6503	SO:0001583	missense	200186	exon12			CACCTGAGGACTG	AY360172	CCDS30875.1	1q21.3	2008-02-05			ENSG00000160741	ENSG00000160741			27301	protein-coding gene	gene with protein product		608972				14506290, 14536081	Standard	NM_181715		Approved	TORC2	uc021pab.1	Q53ET0	OTTHUMG00000037156	ENST00000368633.1:c.1558T>G	chr1.hg19:g.153921707A>C	ENSP00000357622:p.Ser520Ala	139.0	0.0	.		100.0	39.0	.	NM_181715	Q6UUV8|Q7Z3X7|Q8N332	Missense_Mutation	SNP	ENST00000368633.1	hg19	CCDS30875.1	.	.	.	.	.	.	.	.	.	.	a	6.444	0.450124	0.12223	.	.	ENSG00000160741	ENST00000368630;ENST00000368633	T;T	0.44083	0.93;2.76	4.71	0.983	0.19767	.	0.524627	0.17767	N	0.162703	T	0.07369	0.0186	L	0.36672	1.1	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.04013	0.0;0.001	T	0.34279	-0.9835	10	0.06365	T	0.9	-0.5344	2.5058	0.04645	0.5691:0.0:0.2289:0.202	.	520;200	Q53ET0;Q5T4K5	CRTC2_HUMAN;.	A	200;520	ENSP00000357619:S200A;ENSP00000357622:S520A	ENSP00000357619:S200A	S	-	1	0	CRTC2	152188331	0.041000	0.20044	0.971000	0.41717	0.514000	0.34195	0.883000	0.28200	0.298000	0.22638	0.370000	0.22315	TCA	.	.	.	none		0.612	CRTC2-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090272.3	NM_181715	
DCAF8	50717	hgsc.bcm.edu	37	1	160206968	160206968	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr1:160206968C>T	ENST00000368073.3	-	6	1350	c.916G>A	c.(916-918)Gca>Aca	p.A306T	DCAF8_ENST00000608310.1_Missense_Mutation_p.A460T|DCAF8_ENST00000556710.1_Missense_Mutation_p.A460T|DCAF8_ENST00000368074.1_Missense_Mutation_p.A306T|DCAF8_ENST00000326837.2_Missense_Mutation_p.A306T			Q5TAQ9	DCAF8_HUMAN	DDB1 and CUL4 associated factor 8	306					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(16)|skin(3)|upper_aerodigestive_tract(1)	33						AAAACAACTGCATCTTCACCT	0.408																																					p.A306T		Atlas-SNP	.											.	DCAF8	64	.	0			c.G916A						PASS	.						68.0	58.0	62.0					1																	160206968		2203	4297	6500	SO:0001583	missense	50717	exon6			CAACTGCATCTTC	AK093176	CCDS1200.1	1q22-q23	2013-01-09	2009-07-17	2009-07-17	ENSG00000132716	ENSG00000132716		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24891	protein-coding gene	gene with protein product		615820	"""WD repeat domain 42A"""	WDR42A		11401431	Standard	NM_015726		Approved	H326, FLJ35857	uc010pjb.1	Q5TAQ9	OTTHUMG00000031604	ENST00000368073.3:c.916G>A	chr1.hg19:g.160206968C>T	ENSP00000357052:p.Ala306Thr	321.0	0.0	.		249.0	96.0	.	NM_015726	D3DVE6|Q12839|Q4QQI6|Q53F14|Q66K50|Q68CS7|Q96E00	Missense_Mutation	SNP	ENST00000368073.3	hg19	CCDS1200.1	.	.	.	.	.	.	.	.	.	.	C	36	5.645604	0.96704	.	.	ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000258465	ENST00000368073;ENST00000326837;ENST00000368074;ENST00000555195;ENST00000540855;ENST00000556710	T;T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43;-1.43	5.82	5.82	0.92795	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.64402	U	0.000001	D	0.85801	0.5781	L	0.52364	1.645	0.80722	D	1	D;D	0.71674	0.996;0.998	D;D	0.79784	0.993;0.948	D	0.86237	0.1641	10	0.72032	D	0.01	-8.7602	18.8801	0.92352	0.0:1.0:0.0:0.0	.	460;306	G3V3G9;Q5TAQ9	.;DCAF8_HUMAN	T	306;306;306;460;287;460	ENSP00000357052:A306T;ENSP00000318227:A306T;ENSP00000357053:A306T;ENSP00000451989:A460T;ENSP00000451235:A460T	ENSP00000318227:A306T	A	-	1	0	RP11-574F21.3;DCAF8	158473592	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.768000	0.74980	2.756000	0.94617	0.563000	0.77884	GCA	.	.	.	none		0.408	DCAF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077402.2	NM_015726	
CDC42BPA	8476	hgsc.bcm.edu	37	1	227182647	227182647	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr1:227182647C>A	ENST00000366769.3	-	35	6196	c.4905G>T	c.(4903-4905)agG>agT	p.R1635S	CDC42BPA_ENST00000366764.2_Missense_Mutation_p.R1607S|CDC42BPA_ENST00000535525.1_Missense_Mutation_p.R1615S|CDC42BPA_ENST00000366766.2_Missense_Mutation_p.R1670S|RP5-1087E8.3_ENST00000433837.1_RNA|CDC42BPA_ENST00000334218.5_Missense_Mutation_p.R1697S|CDC42BPA_ENST00000366765.3_Missense_Mutation_p.R1648S|CDC42BPA_ENST00000366767.3_Missense_Mutation_p.R1554S	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				CAGAGAATTCCCTCTTTAATG	0.527																																					p.R1635S		Atlas-SNP	.											.	CDC42BPA	528	.	0			c.G4905T						PASS	.						127.0	120.0	122.0					1																	227182647		2203	4300	6503	SO:0001583	missense	8476	exon35			GAATTCCCTCTTT	U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.4905G>T	chr1.hg19:g.227182647C>A	ENSP00000355731:p.Arg1635Ser	52.0	0.0	.		32.0	14.0	.	NM_003607		Missense_Mutation	SNP	ENST00000366769.3	hg19	CCDS1558.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.01|15.01	2.705914|2.705914	0.48412|0.48412	.|.	.|.	ENSG00000143776|ENSG00000143776	ENST00000448940;ENST00000442054|ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000535525;ENST00000366765	.|T;T;T;T;T;T;T	.|0.70164	.|-0.24;-0.23;-0.46;-0.24;-0.3;-0.3;-0.23	5.09|5.09	3.14|3.14	0.36123|0.36123	.|.	.|0.161634	.|0.52532	.|D	.|0.000075	.|T	.|0.66257	.|0.2771	L|L	0.28014|0.28014	0.82|0.82	0.51482|0.51482	D|D	0.999926|0.999926	.|D;D;D;D;D;D	.|0.69078	.|0.997;0.996;0.997;0.996;0.996;0.991	.|D;D;D;D;D;D	.|0.81914	.|0.993;0.99;0.995;0.99;0.99;0.992	.|T	.|0.62728	.|-0.6793	.|10	.|0.34782	.|T	.|0.22	.|.	7.1194|7.1194	0.25435|0.25435	0.0:0.7042:0.0:0.2958|0.0:0.7042:0.0:0.2958	.|.	.|1615;1607;1554;1635;1670;899	.|F5H5N0;Q5VT25-4;Q5VT25-3;Q5VT25-5;Q5VT25-2;Q5T799	.|.;.;.;.;.;.	X|S	900;964|1635;1554;1697;1670;1607;1615;1648	.|ENSP00000355731:R1635S;ENSP00000355729:R1554S;ENSP00000335341:R1697S;ENSP00000355728:R1670S;ENSP00000355726:R1607S;ENSP00000443275:R1615S;ENSP00000355727:R1648S	.|ENSP00000335341:R1697S	G|R	-|-	1|3	0|2	CDC42BPA|CDC42BPA	225249270|225249270	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.345000|1.345000	0.33953|0.33953	1.064000|1.064000	0.40671|0.40671	0.655000|0.655000	0.94253|0.94253	GGA|AGG	.	.	.	none		0.527	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091696.1	NM_014826	
SMYD3	64754	hgsc.bcm.edu	37	1	246021812	246021812	+	Silent	SNP	G	G	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr1:246021812G>A	ENST00000388985.4	-	10	1061	c.1062C>T	c.(1060-1062)acC>acT	p.T354T	SMYD3_ENST00000541742.1_Silent_p.T295T|SMYD3_ENST00000366517.1_5'UTR|SMYD3_ENST00000490107.1_Silent_p.T295T			Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3	354					cellular response to dexamethasone stimulus (GO:0071549)|establishment of protein localization (GO:0045184)|myotube cell development (GO:0014904)|negative regulation of protein kinase activity (GO:0006469)|nucleosome assembly (GO:0006334)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)			breast(3)|large_intestine(5)|lung(8)|skin(1)	17	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		ATGGCTCCATGGTCCGAGTAC	0.532																																					p.T354T		Atlas-SNP	.											.	SMYD3	77	.	0			c.C1062T						PASS	.						90.0	75.0	80.0					1																	246021812		2203	4300	6503	SO:0001819	synonymous_variant	64754	exon10			CTCCATGGTCCGA	AK023594	CCDS31083.1	1q44	2011-07-01	2003-05-14	2003-05-16	ENSG00000185420	ENSG00000185420		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	15513	protein-coding gene	gene with protein product		608783	"""zinc finger, MYND domain containing 1"""	ZNFN3A1, ZMYND1			Standard	NM_022743		Approved	KMT3E	uc001ibl.3	Q9H7B4	OTTHUMG00000040508	ENST00000388985.4:c.1062C>T	chr1.hg19:g.246021812G>A		125.0	0.0	.		86.0	35.0	.	NM_001167740	A8K0P0|B1AN38|Q86TL8|Q8N5Z6|Q96AI5	Silent	SNP	ENST00000388985.4	hg19	CCDS53486.1																																																																																			.	.	.	none		0.532	SMYD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_022743	
HS1BP3	64342	hgsc.bcm.edu	37	2	20840800	20840800	+	Silent	SNP	A	A	G			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr2:20840800A>G	ENST00000304031.3	-	3	364	c.339T>C	c.(337-339)aaT>aaC	p.N113N	HS1BP3_ENST00000406618.3_Silent_p.N113N|HS1BP3_ENST00000402541.1_Silent_p.N113N	NM_022460.3	NP_071905.3	Q53T59	H1BP3_HUMAN	HCLS1 binding protein 3	113	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.						phosphatidylinositol binding (GO:0035091)			endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	15	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCAGGATCTCATTGAACACGG	0.587																																					p.N113N		Atlas-SNP	.											.	HS1BP3	33	.	0			c.T339C						PASS	.						164.0	162.0	163.0					2																	20840800		2203	4300	6503	SO:0001819	synonymous_variant	64342	exon3			GATCTCATTGAAC		CCDS1700.1	2p24.1	2006-08-15			ENSG00000118960	ENSG00000118960			24979	protein-coding gene	gene with protein product		609359				10590261, 15699368	Standard	NM_022460		Approved	HS1-BP3,FLJ14249	uc002rdw.1	Q53T59	OTTHUMG00000122099	ENST00000304031.3:c.339T>C	chr2.hg19:g.20840800A>G		62.0	0.0	.		57.0	21.0	.	NM_022460	B2RAW2|D6W529|Q86VC2|Q8N367	Silent	SNP	ENST00000304031.3	hg19	CCDS1700.1																																																																																			.	.	.	none		0.587	HS1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242863.1	NM_022460	
C2orf78	388960	hgsc.bcm.edu	37	2	74044108	74044108	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr2:74044108T>C	ENST00000409561.1	+	3	2879	c.2758T>C	c.(2758-2760)Tac>Cac	p.Y920H		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	920										cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						ATACTATGGCTACACAATCTA	0.343																																					p.Y920H		Atlas-SNP	.											.	C2orf78	150	.	0			c.T2758C						PASS	.						25.0	27.0	26.0					2																	74044108		1850	4087	5937	SO:0001583	missense	388960	exon3			TATGGCTACACAA	AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.2758T>C	chr2.hg19:g.74044108T>C	ENSP00000387124:p.Tyr920His	100.0	0.0	.		81.0	26.0	.	NM_001080474		Missense_Mutation	SNP	ENST00000409561.1	hg19	CCDS46338.1	.	.	.	.	.	.	.	.	.	.	T	16.94	3.259717	0.59321	.	.	ENSG00000187833	ENST00000409561;ENST00000342345	T	0.59224	0.28	5.34	5.34	0.76211	.	0.000000	0.44483	D	0.000445	T	0.74696	0.3750	M	0.79475	2.455	0.23916	N	0.996475	D	0.89917	1.0	D	0.81914	0.995	T	0.68957	-0.5272	10	0.87932	D	0	-20.0405	12.0119	0.53293	0.0:0.0:0.0:1.0	.	920	A6NCI8	CB078_HUMAN	H	920;890	ENSP00000387124:Y920H	ENSP00000340692:Y890H	Y	+	1	0	C2orf78	73897616	0.987000	0.35691	0.039000	0.18376	0.004000	0.04260	3.487000	0.53222	2.159000	0.67721	0.455000	0.32223	TAC	.	.	.	none		0.343	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328083.1	NM_001080474	
SEPT10	151011	hgsc.bcm.edu	37	2	110323346	110323346	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr2:110323346C>G	ENST00000397712.2	-	7	1231	c.853G>C	c.(853-855)Gta>Cta	p.V285L	SEPT10_ENST00000545389.1_Missense_Mutation_p.V118L|SEPT10_ENST00000334001.6_Missense_Mutation_p.V152L|SEPT10_ENST00000415095.1_Missense_Mutation_p.V285L|SEPT10_ENST00000437928.1_Missense_Mutation_p.V270L|SEPT10_ENST00000468616.1_5'UTR|SEPT10_ENST00000397714.2_Missense_Mutation_p.V262L|SEPT10_ENST00000356688.4_Missense_Mutation_p.V285L	NM_144710.3	NP_653311.1	Q9P0V9	SEP10_HUMAN	septin 10	285	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			breast(2)|endometrium(3)|large_intestine(4)|lung(8)|prostate(1)	18						TTACCTTGTACAACACCCCAA	0.428																																					p.V285L		Atlas-SNP	.											.	SEPT10	58	.	0			c.G853C						PASS	.						210.0	196.0	201.0					2																	110323346		1960	4139	6099	SO:0001583	missense	151011	exon7			CTTGTACAACACC	AF146760	CCDS42726.1, CCDS46383.1	2q13	2013-01-21			ENSG00000186522	ENSG00000186522		"""Septins"""	14349	protein-coding gene	gene with protein product	"""sept1-like"""	611737				12711328	Standard	NM_144710		Approved	FLJ11619	uc002tew.4	Q9P0V9	OTTHUMG00000154957	ENST00000397712.2:c.853G>C	chr2.hg19:g.110323346C>G	ENSP00000380824:p.Val285Leu	101.0	0.0	.		70.0	26.0	.	NM_144710	B3KRQ9|Q86VP5|Q9HAH6	Missense_Mutation	SNP	ENST00000397712.2	hg19	CCDS46383.1	.	.	.	.	.	.	.	.	.	.	C	18.95	3.731374	0.69189	.	.	ENSG00000186522	ENST00000352314;ENST00000356688;ENST00000397712;ENST00000397714;ENST00000334001;ENST00000437928;ENST00000545389;ENST00000415095;ENST00000493445	T;T;T;T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41	5.25	5.25	0.73442	.	0.000000	0.64402	D	0.000007	T	0.71846	0.3388	M	0.67953	2.075	0.80722	D	1	B;D;P;B;B;P	0.76494	0.017;0.999;0.869;0.047;0.014;0.869	B;D;B;B;B;B	0.85130	0.051;0.997;0.433;0.086;0.03;0.433	T	0.71487	-0.4578	10	0.46703	T	0.11	.	18.7996	0.92010	0.0:1.0:0.0:0.0	.	152;118;285;285;262;285	B7Z371;B7Z277;A8K7M3;B5ME97;Q9P0V9-3;Q9P0V9	.;.;.;.;.;SEP10_HUMAN	L	243;285;285;262;152;270;118;285;92	ENSP00000349116:V285L;ENSP00000380824:V285L;ENSP00000380826:V262L;ENSP00000334234:V152L;ENSP00000407790:V270L;ENSP00000439364:V118L;ENSP00000396728:V285L;ENSP00000445707:V92L	ENSP00000334234:V152L	V	-	1	0	SEPT10	109680635	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	7.338000	0.79269	2.600000	0.87896	0.650000	0.86243	GTA	.	.	.	none		0.428	SEPT10-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000337804.1	NM_144710	
MYO1B	4430	hgsc.bcm.edu	37	2	192194689	192194689	+	Missense_Mutation	SNP	T	T	G			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr2:192194689T>G	ENST00000392318.3	+	4	527	c.280T>G	c.(280-282)Tcc>Gcc	p.S94A	MYO1B_ENST00000304164.4_Missense_Mutation_p.S94A|MYO1B_ENST00000339514.4_Missense_Mutation_p.S94A|MYO1B_ENST00000392316.1_Missense_Mutation_p.S94A	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	94	Myosin motor.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			AGCATACAGATCCCTACGAGA	0.413																																					p.S94A		Atlas-SNP	.											.	MYO1B	160	.	0			c.T280G						PASS	.						216.0	213.0	214.0					2																	192194689		2203	4300	6503	SO:0001583	missense	4430	exon4			TACAGATCCCTAC	L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.280T>G	chr2.hg19:g.192194689T>G	ENSP00000376132:p.Ser94Ala	121.0	0.0	.		116.0	8.0	.	NM_012223	O43794|Q7Z6L5	Missense_Mutation	SNP	ENST00000392318.3	hg19	CCDS46477.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.163706	0.78226	.	.	ENSG00000128641	ENST00000418908;ENST00000339514;ENST00000439452;ENST00000392318;ENST00000304164;ENST00000438652;ENST00000451437;ENST00000392316	D;D;D;D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23;-2.23;-2.23;-2.23	5.76	5.76	0.90799	Myosin head, motor domain (2);	0.124736	0.56097	D	0.000027	D	0.84651	0.5519	N	0.26162	0.8	0.80722	D	1	B;P	0.44627	0.333;0.839	B;P	0.51266	0.326;0.664	T	0.82331	-0.0510	10	0.22706	T	0.39	.	13.5956	0.61987	0.0:0.0:0.0:1.0	.	94;94	O43795;O43795-2	MYO1B_HUMAN;.	A	94	ENSP00000401324:S94A;ENSP00000341903:S94A;ENSP00000376132:S94A;ENSP00000306382:S94A;ENSP00000399459:S94A;ENSP00000388140:S94A;ENSP00000376130:S94A	ENSP00000306382:S94A	S	+	1	0	MYO1B	191902934	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.872000	0.75536	2.189000	0.69895	0.528000	0.53228	TCC	.	.	.	none		0.413	MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334774.1	NM_012223	
TAMM41	132001	hgsc.bcm.edu	37	3	11851067	11851067	+	Silent	SNP	A	A	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr3:11851067A>T	ENST00000444133.2	-	6	940	c.798T>A	c.(796-798)ccT>ccA	p.P266P	TAMM41_ENST00000273037.5_Silent_p.P266P|TAMM41_ENST00000455809.1_Silent_p.P266P			Q96BW9	TAM41_HUMAN	TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)	266					cardiolipin biosynthetic process (GO:0032049)|CDP-diacylglycerol biosynthetic process (GO:0016024)	extrinsic component of mitochondrial inner membrane (GO:0031314)	phosphatidate cytidylyltransferase activity (GO:0004605)										TGTTTTTTCCAGGAGGGTCCA	0.428																																					p.P266P		Atlas-SNP	.											.	.	.	.	0			c.T798A						PASS	.						134.0	127.0	129.0					3																	11851067		2203	4300	6503	SO:0001819	synonymous_variant	132001	exon6			TTTTCCAGGAGGG		CCDS2607.1, CCDS68345.1	3p25.2	2013-10-18	2011-08-09	2011-08-09	ENSG00000144559	ENSG00000144559			25187	protein-coding gene	gene with protein product		614948	"""chromosome 3 open reading frame 31"""	C3orf31		19237595	Standard	XM_005264873		Approved	MGC16471, DKFZp434E0519	uc003bwh.3	Q96BW9	OTTHUMG00000129741	ENST00000444133.2:c.798T>A	chr3.hg19:g.11851067A>T		115.0	0.0	.		156.0	38.0	.	NM_138807	B4DIY7|C9J2U4	Silent	SNP	ENST00000444133.2	hg19																																																																																				.	.	.	none		0.428	TAMM41-008	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000339258.2	NM_138807	
LTF	4057	hgsc.bcm.edu	37	3	46477717	46477717	+	Missense_Mutation	SNP	A	A	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr3:46477717A>T	ENST00000231751.4	-	17	2397	c.2102T>A	c.(2101-2103)cTc>cAc	p.L701H	LTF_ENST00000417439.1_Missense_Mutation_p.L699H|LTF_ENST00000493056.1_5'Flank|LTF_ENST00000426532.2_Missense_Mutation_p.L657H	NM_002343.3	NP_002334.2	P02788	TRFL_HUMAN	lactotransferrin	701					antibacterial humoral response (GO:0019731)|antifungal humoral response (GO:0019732)|bone morphogenesis (GO:0060349)|humoral immune response (GO:0006959)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|iron assimilation by chelation and transport (GO:0033214)|iron ion transport (GO:0006826)|negative regulation of apoptotic process (GO:0043066)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of osteoclast development (GO:2001205)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|regulation of cytokine production (GO:0001817)|regulation of tumor necrosis factor production (GO:0032680)|response to host immune response (GO:0052572)|retina homeostasis (GO:0001895)|transcription, DNA-templated (GO:0006351)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|phagocytic vesicle lumen (GO:0097013)|secretory granule (GO:0030141)|specific granule (GO:0042581)	DNA binding (GO:0003677)|ferric iron binding (GO:0008199)|heparin binding (GO:0008201)|iron ion binding (GO:0005506)|protein serine/threonine kinase activator activity (GO:0043539)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	40				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)		GGCTTCCAGGAGGGCTGTGGG	0.453																																					p.L701H		Atlas-SNP	.											.	LTF	98	.	0			c.T2102A						PASS	.						108.0	112.0	110.0					3																	46477717		2203	4296	6499	SO:0001583	missense	4057	exon17			TCCAGGAGGGCTG		CCDS33747.1, CCDS56251.1	3p21.31	2012-10-02			ENSG00000012223	ENSG00000012223			6720	protein-coding gene	gene with protein product		150210				17476971, 3356163	Standard	NM_001199149		Approved	HLF2	uc003cpq.3	P02788	OTTHUMG00000156325	ENST00000231751.4:c.2102T>A	chr3.hg19:g.46477717A>T	ENSP00000231751:p.Leu701His	85.0	0.0	.		100.0	50.0	.	NM_002343	A8K9U8|B2MV13|B7Z4X2|E7EQH5|O00756|Q16780|Q16785|Q16786|Q16789|Q5DSM0|Q8IU92|Q8IZH6|Q8TCD2|Q96KZ4|Q96KZ5|Q9H1Z3|Q9UCY5	Missense_Mutation	SNP	ENST00000231751.4	hg19	CCDS33747.1	.	.	.	.	.	.	.	.	.	.	A	16.44	3.124032	0.56613	.	.	ENSG00000012223	ENST00000231751;ENST00000426532;ENST00000417439;ENST00000443496	T;T;T;T	0.08193	3.12;3.12;3.12;3.12	5.42	4.22	0.49857	.	0.241563	0.35013	N	0.003507	T	0.33147	0.0853	M	0.93016	3.37	0.44110	D	0.996887	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.70227	0.968;0.911;0.968	T	0.16158	-1.0412	10	0.87932	D	0	-3.841	8.6047	0.33767	0.9111:0.0:0.0889:0.0	.	699;688;701	E7ER44;E7EQB2;P02788	.;.;TRFL_HUMAN	H	701;657;699;688	ENSP00000231751:L701H;ENSP00000405719:L657H;ENSP00000405546:L699H;ENSP00000397427:L688H	ENSP00000231751:L701H	L	-	2	0	LTF	46452721	0.951000	0.32395	0.576000	0.28549	0.698000	0.40448	2.102000	0.41796	0.959000	0.37980	0.533000	0.62120	CTC	.	.	.	none		0.453	LTF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343951.2	NM_002343	
MCM2	4171	hgsc.bcm.edu	37	3	127335805	127335805	+	Silent	SNP	G	G	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr3:127335805G>A	ENST00000265056.7	+	10	1861	c.1617G>A	c.(1615-1617)gtG>gtA	p.V539V		NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	539	MCM.				cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)			ovary(3)|skin(2)|stomach(1)	6						TTGAGAAAGTGTCCAGCCGAG	0.597																																					p.V539V		Atlas-SNP	.											.	MCM2	79	.	0			c.G1617A						PASS	.						68.0	72.0	71.0					3																	127335805		2203	4300	6503	SO:0001819	synonymous_variant	4171	exon10			GAAAGTGTCCAGC	X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.1617G>A	chr3.hg19:g.127335805G>A		145.0	0.0	.		166.0	47.0	.	NM_004526	Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Silent	SNP	ENST00000265056.7	hg19	CCDS3043.1	.	.	.	.	.	.	.	.	.	.	G	10.86	1.469285	0.26423	.	.	ENSG00000073111	ENST00000491422	.	.	.	5.7	3.88	0.44766	.	.	.	.	.	T	0.59348	0.2187	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56763	-0.7925	4	.	.	.	-38.8032	9.3198	0.37957	0.2753:0.0:0.7247:0.0	.	.	.	.	Y	471	.	.	C	+	2	0	MCM2	128818495	0.996000	0.38824	0.979000	0.43373	0.983000	0.72400	0.345000	0.19979	1.379000	0.46325	0.585000	0.79938	TGT	.	.	.	none		0.597	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356612.1		
TLR1	7096	hgsc.bcm.edu	37	4	38799493	38799493	+	Nonsense_Mutation	SNP	A	A	T	rs200631178		TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr4:38799493A>T	ENST00000502213.2	-	3	1189	c.960T>A	c.(958-960)taT>taA	p.Y320*	TLR1_ENST00000308979.2_Nonsense_Mutation_p.Y320*			Q15399	TLR1_HUMAN	toll-like receptor 1	320					cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						AAAAGATTTCATAGATATAAC	0.413																																					p.Y320X	GBM(5;216 373 40795 46382)	Atlas-SNP	.											.	TLR1	70	.	0			c.T960A						PASS	.						58.0	61.0	60.0					4																	38799493		2203	4300	6503	SO:0001587	stop_gained	7096	exon4			GATTTCATAGATA	U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.960T>A	chr4.hg19:g.38799493A>T	ENSP00000421259:p.Tyr320*	100.0	0.0	.		68.0	22.0	.	NM_003263	D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Nonsense_Mutation	SNP	ENST00000502213.2	hg19	CCDS33973.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.155114	0.78114	.	.	ENSG00000174125	ENST00000308979;ENST00000502213	.	.	.	4.79	-4.83	0.03161	.	0.000000	0.56097	D	0.000027	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.9609	0.71156	0.6105:0.0:0.3895:0.0	.	.	.	.	X	320	.	ENSP00000354932:Y320X	Y	-	3	2	TLR1	38475888	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.219000	0.09228	-0.993000	0.03467	-1.832000	0.00591	TAT	.	A|0.999;G|0.001	.	alt		0.413	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360510.3		
SHISA3	152573	hgsc.bcm.edu	37	4	42400345	42400345	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr4:42400345C>A	ENST00000319234.4	+	1	490	c.272C>A	c.(271-273)aCt>aAt	p.T91N		NM_001080505.1	NP_001073974.1	A0PJX4	SHSA3_HUMAN	shisa family member 3	91					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	12						CCAGGCATCACTGCGCGTAAG	0.711																																					p.T91N		Atlas-SNP	.											.	SHISA3	27	.	0			c.C272A						PASS	.						6.0	8.0	7.0					4																	42400345		2133	4188	6321	SO:0001583	missense	152573	exon1			GCATCACTGCGCG	BC012029	CCDS33979.1	4p13	2013-07-31	2013-07-31		ENSG00000178343	ENSG00000178343		"""Shisa homologs"""	25159	protein-coding gene	gene with protein product			"""shisa homolog 3 (Xenopus laevis)"""				Standard	NM_001080505		Approved	hShisa3	uc003gwp.3	A0PJX4	OTTHUMG00000161043	ENST00000319234.4:c.272C>A	chr4.hg19:g.42400345C>A	ENSP00000326445:p.Thr91Asn	73.0	0.0	.		64.0	29.0	.	NM_001080505	A0PJX3|Q96EQ5	Missense_Mutation	SNP	ENST00000319234.4	hg19	CCDS33979.1	.	.	.	.	.	.	.	.	.	.	C	13.02	2.113082	0.37339	.	.	ENSG00000178343	ENST00000319234	T	0.46451	0.87	4.08	4.08	0.47627	.	0.156884	0.41605	D	0.000850	T	0.30947	0.0781	L	0.34521	1.04	0.33420	D	0.579773	B	0.27498	0.18	B	0.28305	0.088	T	0.37407	-0.9707	10	0.16896	T	0.51	-5.7558	13.2055	0.59793	0.0:0.6802:0.3198:0.0	.	91	A0PJX4	SHSA3_HUMAN	N	91	ENSP00000326445:T91N	ENSP00000326445:T91N	T	+	2	0	SHISA3	42095102	0.988000	0.35896	0.904000	0.35570	0.554000	0.35429	2.805000	0.47939	2.073000	0.62155	0.467000	0.42956	ACT	.	.	.	none		0.711	SHISA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363539.1	NM_001080505	
CEP135	9662	hgsc.bcm.edu	37	4	56858116	56858116	+	Missense_Mutation	SNP	A	A	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr4:56858116A>T	ENST00000257287.4	+	15	1998	c.1874A>T	c.(1873-1875)tAt>tTt	p.Y625F		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	625					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					AGCGAAAAATATGAATTAAAG	0.274																																					p.Y625F		Atlas-SNP	.											.	CEP135	115	.	0			c.A1874T						PASS	.						20.0	22.0	22.0					4																	56858116		2158	4284	6442	SO:0001583	missense	9662	exon15			AAAAATATGAATT	AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.1874A>T	chr4.hg19:g.56858116A>T	ENSP00000257287:p.Tyr625Phe	515.0	1.0	.		458.0	176.0	.	NM_025009	B2RMY0|O75130|Q58F25|Q9H8H7	Missense_Mutation	SNP	ENST00000257287.4	hg19	CCDS33986.1	.	.	.	.	.	.	.	.	.	.	A	6.409	0.443572	0.12164	.	.	ENSG00000174799	ENST00000257287	T	0.41065	1.01	5.18	1.9	0.25705	.	0.556091	0.21438	N	0.074528	T	0.22936	0.0554	N	0.22421	0.69	0.27898	N	0.939079	B	0.02656	0.0	B	0.06405	0.002	T	0.09400	-1.0676	10	0.34782	T	0.22	.	3.6031	0.08032	0.3009:0.0:0.5027:0.1965	.	625	Q66GS9	CP135_HUMAN	F	625	ENSP00000257287:Y625F	ENSP00000257287:Y625F	Y	+	2	0	CEP135	56552873	0.998000	0.40836	0.999000	0.59377	0.990000	0.78478	0.320000	0.19540	0.530000	0.28619	-0.256000	0.11100	TAT	.	.	.	none		0.274	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	NM_025009	
GPR151	134391	hgsc.bcm.edu	37	5	145894580	145894580	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr5:145894580C>T	ENST00000311104.2	-	1	1173	c.1097G>A	c.(1096-1098)aGc>aAc	p.S366N		NM_194251.2	NP_919227.2	Q8TDV0	GP151_HUMAN	G protein-coupled receptor 151	366						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(2)	14			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGAGGGAGAGCTGGGTTTCTC	0.512																																					p.S366N	Pancreas(78;420 1386 18535 37114 49710)	Atlas-SNP	.											.	GPR151	35	.	0			c.G1097A						PASS	.						150.0	142.0	145.0					5																	145894580		2203	4300	6503	SO:0001583	missense	134391	exon1			GGAGAGCTGGGTT	AY255557	CCDS34266.1	5q32	2012-08-21						"""GPCR / Class A : Orphans"""	23624	protein-coding gene	gene with protein product	"""galanin receptor 4"""					12679517	Standard	NM_194251		Approved	PGR7, GALR4	uc003lod.1	Q8TDV0		ENST00000311104.2:c.1097G>A	chr5.hg19:g.145894580C>T	ENSP00000308733:p.Ser366Asn	102.0	0.0	.		94.0	29.0	.	NM_194251	Q86SN8|Q8NGV2	Missense_Mutation	SNP	ENST00000311104.2	hg19	CCDS34266.1	.	.	.	.	.	.	.	.	.	.	C	2.219	-0.378822	0.05000	.	.	ENSG00000173250	ENST00000311104	T	0.75154	-0.91	6.17	1.22	0.21188	.	0.449653	0.23110	N	0.051804	T	0.50188	0.1601	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.25984	-1.0116	10	0.15952	T	0.53	.	6.8972	0.24262	0.0:0.4445:0.3541:0.2014	.	366	Q8TDV0	GP151_HUMAN	N	366	ENSP00000308733:S366N	ENSP00000308733:S366N	S	-	2	0	GPR151	145874773	0.000000	0.05858	0.003000	0.11579	0.084000	0.17831	0.106000	0.15354	0.138000	0.18790	0.655000	0.94253	AGC	.	.	.	none		0.512	GPR151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373457.1	NM_194251	
DSP	1832	hgsc.bcm.edu	37	6	7578083	7578083	+	Silent	SNP	C	C	G			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr6:7578083C>G	ENST00000379802.3	+	21	3290	c.2949C>G	c.(2947-2949)acC>acG	p.T983T	DSP_ENST00000418664.2_Silent_p.T983T	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	983	Globular 1.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TCAAGAGGACCATGATTCAGT	0.453																																					p.T983T		Atlas-SNP	.											.	DSP	306	.	0			c.C2949G						PASS	.						128.0	122.0	124.0					6																	7578083		2203	4300	6503	SO:0001819	synonymous_variant	1832	exon21			GAGGACCATGATT	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.2949C>G	chr6.hg19:g.7578083C>G		57.0	0.0	.		58.0	23.0	.	NM_004415	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	ENST00000379802.3	hg19	CCDS4501.1																																																																																			.	.	.	none		0.453	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
ZNF76	7629	hgsc.bcm.edu	37	6	35262232	35262232	+	Splice_Site	SNP	G	G	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr6:35262232G>A	ENST00000373953.3	+	13	1760		c.e13-1		ZNF76_ENST00000339411.5_Splice_Site|ZNF76_ENST00000440666.2_Splice_Site	NM_003427.3	NP_003418.2	P36508	ZNF76_HUMAN	zinc finger protein 76						regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						TTGTCTTTCAGGTCACAATCA	0.512											OREG0017373	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.	Esophageal Squamous(52;92 1039 20612 23956 34676)	Atlas-SNP	.											.	ZNF76	37	.	0			c.1495-1G>A						PASS	.						203.0	155.0	171.0					6																	35262232		2203	4300	6503	SO:0001630	splice_region_variant	7629	exon13			CTTTCAGGTCACA	M91592	CCDS4801.1, CCDS75435.1	6p21.31	2013-01-08	2011-02-25		ENSG00000065029	ENSG00000065029		"""Zinc fingers, C2H2-type"""	13149	protein-coding gene	gene with protein product		194549	"""zinc finger protein 76 (expressed in testis)"""	D6S229E		1427894	Standard	XM_005249364		Approved	Zfp523, ZNF523	uc003oki.1	P36508	OTTHUMG00000014564	ENST00000373953.3:c.1495-1G>A	chr6.hg19:g.35262232G>A		123.0	0.0	.	854	88.0	23.0	.	NM_003427	Q9BQB2	Splice_Site	SNP	ENST00000373953.3	hg19	CCDS4801.1	.	.	.	.	.	.	.	.	.	.	G	15.58	2.875635	0.51695	.	.	ENSG00000065029	ENST00000373953;ENST00000440666;ENST00000339411;ENST00000498555	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.846	0.85981	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF76	35370210	1.000000	0.71417	1.000000	0.80357	0.496000	0.33645	8.445000	0.90326	2.648000	0.89879	0.650000	0.86243	.	.	.	.	none		0.512	ZNF76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040279.2	NM_003427	Intron
DNAH8	1769	hgsc.bcm.edu	37	6	38850785	38850785	+	Missense_Mutation	SNP	T	T	G			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr6:38850785T>G	ENST00000359357.3	+	52	7561	c.7307T>G	c.(7306-7308)aTt>aGt	p.I2436S	DNAH8_ENST00000441566.1_Missense_Mutation_p.I2400S|DNAH8_ENST00000449981.2_Missense_Mutation_p.I2653S			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2436	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GTTGACAATATTAGAACAAAT	0.338																																					p.I2653S		Atlas-SNP	.											.	DNAH8	1239	.	0			c.T7958G						PASS	.						89.0	101.0	97.0					6																	38850785		2203	4290	6493	SO:0001583	missense	1769	exon54			ACAATATTAGAAC	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.7307T>G	chr6.hg19:g.38850785T>G	ENSP00000352312:p.Ile2436Ser	452.0	1.0	.		408.0	144.0	.	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	hg19		.	.	.	.	.	.	.	.	.	.	T	13.60	2.285225	0.40394	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.18960	2.18;2.18;2.18	5.87	5.87	0.94306	.	0.571036	0.18592	N	0.136716	T	0.14399	0.0348	M	0.62154	1.92	0.29889	N	0.825339	B	0.26318	0.146	B	0.32928	0.155	T	0.10428	-1.0630	10	0.87932	D	0	.	12.0815	0.53673	0.0:0.0685:0.0:0.9315	.	2436	Q96JB1	DYH8_HUMAN	S	2641;2641;2436;2400	ENSP00000333363:I2641S;ENSP00000352312:I2436S;ENSP00000402294:I2400S	ENSP00000333363:I2641S	I	+	2	0	DNAH8	38958763	0.056000	0.20664	0.802000	0.32245	0.693000	0.40251	2.250000	0.43178	2.239000	0.73571	0.528000	0.53228	ATT	.	.	.	none		0.338	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
TFAP2B	7021	hgsc.bcm.edu	37	6	50791382	50791382	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr6:50791382G>A	ENST00000393655.3	+	2	513	c.344G>A	c.(343-345)gGt>gAt	p.G115D	TFAP2B_ENST00000489228.1_3'UTR|TFAP2B_ENST00000263046.4_Missense_Mutation_p.G124D	NM_003221.3	NP_003212.2	Q92481	AP2B_HUMAN	transcription factor AP-2 beta (activating enhancer binding protein 2 beta)	115	Gln/Pro-rich (transactivation domain).				aorta morphogenesis (GO:0035909)|calcium ion homeostasis (GO:0055074)|cellular ammonia homeostasis (GO:0097275)|cellular creatinine homeostasis (GO:0097276)|cellular urea homeostasis (GO:0097277)|collecting duct development (GO:0072044)|distal tubule development (GO:0072017)|ductus arteriosus closure (GO:0097070)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hindlimb morphogenesis (GO:0035137)|kidney development (GO:0001822)|magnesium ion homeostasis (GO:0010960)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphate ion homeostasis (GO:0055062)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urine volume (GO:0035810)|potassium ion homeostasis (GO:0055075)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell differentiation (GO:0045595)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|renal water homeostasis (GO:0003091)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|retina layer formation (GO:0010842)|skin development (GO:0043588)|sodium ion homeostasis (GO:0055078)|sympathetic nervous system development (GO:0048485)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)	40	Lung NSC(77;0.156)					CAAGAAGTGGGTTCGGAAGCC	0.697																																					p.G115D	Pancreas(116;1373 2332 5475 10752)	Atlas-SNP	.											.	TFAP2B	91	.	0			c.G344A						PASS	.						33.0	36.0	35.0					6																	50791382		2202	4300	6502	SO:0001583	missense	7021	exon2			AAGTGGGTTCGGA	X95694	CCDS4934.2	6p12	2008-02-05	2001-11-28		ENSG00000008196	ENSG00000008196			11743	protein-coding gene	gene with protein product		601601	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)"""			7555706, 8661133	Standard	NM_003221		Approved	AP2-B	uc003pag.3	Q92481	OTTHUMG00000014836	ENST00000393655.3:c.344G>A	chr6.hg19:g.50791382G>A	ENSP00000377265:p.Gly115Asp	203.0	0.0	.		268.0	110.0	.	NM_003221	Q5JYX6|Q9NQ63|Q9NU99|Q9UJI7|Q9Y214|Q9Y3K3	Missense_Mutation	SNP	ENST00000393655.3	hg19	CCDS4934.2	.	.	.	.	.	.	.	.	.	.	G	24.7	4.562855	0.86335	.	.	ENSG00000008196	ENST00000393655;ENST00000344788;ENST00000263046	D;D;D	0.82619	-1.63;-1.63;-1.63	5.36	4.49	0.54785	.	0.245560	0.40064	N	0.001183	T	0.67401	0.2889	L	0.41961	1.31	0.58432	D	0.999999	B	0.24186	0.099	B	0.17098	0.017	T	0.69131	-0.5226	10	0.56958	D	0.05	-1.1452	14.0148	0.64517	0.073:0.0:0.927:0.0	.	115	Q92481	AP2B_HUMAN	D	115;113;124	ENSP00000377265:G115D;ENSP00000342252:G113D;ENSP00000263046:G124D	ENSP00000263046:G124D	G	+	2	0	TFAP2B	50899341	1.000000	0.71417	0.885000	0.34714	0.992000	0.81027	6.504000	0.73704	1.278000	0.44430	0.563000	0.77884	GGT	.	.	.	none		0.697	TFAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040886.3	NM_003221	
PHIP	55023	hgsc.bcm.edu	37	6	79672856	79672856	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr6:79672856A>G	ENST00000275034.4	-	30	3660	c.3493T>C	c.(3493-3495)Tgt>Cgt	p.C1165R	PHIP_ENST00000479165.1_5'UTR|AL356776.1_ENST00000516160.2_RNA	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1165					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		ATTCTTTCACATTCTTCATCC	0.403																																					p.C1165R		Atlas-SNP	.											.	PHIP	177	.	0			c.T3493C						PASS	.						285.0	268.0	274.0					6																	79672856		2203	4300	6503	SO:0001583	missense	55023	exon30			TTTCACATTCTTC	AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.3493T>C	chr6.hg19:g.79672856A>G	ENSP00000275034:p.Cys1165Arg	91.0	0.0	.		96.0	42.0	.	NM_017934	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000275034.4	hg19	CCDS4987.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.626396	0.87560	.	.	ENSG00000146247	ENST00000275034	T	0.17054	2.3	5.89	5.89	0.94794	Bromodomain (3);	0.000000	0.85682	D	0.000000	T	0.42539	0.1207	M	0.89601	3.045	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	T	0.53158	-0.8478	9	.	.	.	-15.5431	15.4894	0.75593	1.0:0.0:0.0:0.0	.	1165;1165	A7J992;Q8WWQ0	.;PHIP_HUMAN	R	1165	ENSP00000275034:C1165R	.	C	-	1	0	PHIP	79729575	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.962000	0.93254	2.250000	0.74265	0.455000	0.32223	TGT	.	.	.	none		0.403	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2		
BCLAF1	9774	hgsc.bcm.edu	37	6	136597062	136597062	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr6:136597062C>T	ENST00000531224.1	-	5	1853	c.1601G>A	c.(1600-1602)aGg>aAg	p.R534K	BCLAF1_ENST00000527759.1_Missense_Mutation_p.R532K|BCLAF1_ENST00000353331.4_Missense_Mutation_p.R532K|BCLAF1_ENST00000392348.2_Missense_Mutation_p.R532K|BCLAF1_ENST00000530767.1_Missense_Mutation_p.R361K|BCLAF1_ENST00000527536.1_Missense_Mutation_p.R534K	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	534					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CATTTTGATCCTAAGTGGGCT	0.428																																					p.R534K	Colon(142;1534 1789 5427 7063 28491)	Atlas-SNP	.											.	BCLAF1	203	.	0			c.G1601A						PASS	.						210.0	212.0	211.0					6																	136597062		2203	4300	6503	SO:0001583	missense	9774	exon5			TTGATCCTAAGTG	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.1601G>A	chr6.hg19:g.136597062C>T	ENSP00000435210:p.Arg534Lys	96.0	0.0	.		138.0	41.0	.	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	hg19	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.184251	0.38609	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.13089	2.62;2.62;2.62;2.62;2.62;2.62;2.62	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000001	T	0.04998	0.0134	N	0.08118	0	0.80722	D	1	P;B;P;B	0.47350	0.894;0.092;0.894;0.192	P;B;P;B	0.53988	0.739;0.043;0.739;0.123	T	0.19192	-1.0313	10	0.05833	T	0.94	-8.9698	13.0391	0.58889	0.0:0.9261:0.0:0.0739	.	532;532;534;361	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	K	534;532;534;361;532;532;534	ENSP00000435210:R534K;ENSP00000229446:R532K;ENSP00000435441:R534K;ENSP00000436501:R361K;ENSP00000434826:R532K;ENSP00000376159:R532K;ENSP00000431734:R534K	ENSP00000229446:R532K	R	-	2	0	BCLAF1	136638755	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.269000	0.43346	2.747000	0.94245	0.460000	0.39030	AGG	.	.	.	none		0.428	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
GRM1	2911	hgsc.bcm.edu	37	6	146720170	146720170	+	Silent	SNP	C	C	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr6:146720170C>T	ENST00000282753.1	+	7	2230	c.1995C>T	c.(1993-1995)ggC>ggT	p.G665G	GRM1_ENST00000492807.2_Silent_p.G665G|GRM1_ENST00000355289.4_Silent_p.G665G|GRM1_ENST00000392299.2_Silent_p.G665G|GRM1_ENST00000507907.1_Silent_p.G665G|GRM1_ENST00000361719.2_Silent_p.G665G			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	665					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		TCTTGGTTGGCCTCTCCTCTG	0.522																																					p.G665G		Atlas-SNP	.											.	GRM1	419	.	0			c.C1995T						PASS	.						325.0	300.0	308.0					6																	146720170		2203	4300	6503	SO:0001819	synonymous_variant	2911	exon8			GGTTGGCCTCTCC	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.1995C>T	chr6.hg19:g.146720170C>T		142.0	0.0	.		127.0	58.0	.	NM_000838	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Silent	SNP	ENST00000282753.1	hg19	CCDS5209.1																																																																																			.	.	.	none		0.522	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838	
SYNE1	23345	hgsc.bcm.edu	37	6	152675910	152675910	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr6:152675910C>G	ENST00000367255.5	-	67	11411	c.10810G>C	c.(10810-10812)Gag>Cag	p.E3604Q	SYNE1_ENST00000341594.5_Missense_Mutation_p.E3575Q|SYNE1_ENST00000265368.4_Missense_Mutation_p.E3604Q|SYNE1_ENST00000423061.1_Missense_Mutation_p.E3611Q|SYNE1_ENST00000448038.1_Missense_Mutation_p.E3611Q	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3604					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AACTTTTGCTCCATTAGCCTC	0.488										HNSCC(10;0.0054)																											p.E3611Q		Atlas-SNP	.											.	SYNE1	3227	.	0			c.G10831C						PASS	.						206.0	181.0	190.0					6																	152675910		2203	4300	6503	SO:0001583	missense	23345	exon67			TTTGCTCCATTAG	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.10810G>C	chr6.hg19:g.152675910C>G	ENSP00000356224:p.Glu3604Gln	110.0	0.0	.		91.0	35.0	.	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	15.34	2.803502	0.50315	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.34859	1.34;1.34;1.34;1.34;1.34	5.26	5.26	0.73747	.	0.000000	0.64402	D	0.000017	T	0.47507	0.1449	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.71656	0.959;0.959;0.959;0.974	T	0.25257	-1.0137	10	0.25751	T	0.34	.	16.2563	0.82519	0.0:0.8675:0.1325:0.0	.	3604;3604;3604;3611	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	Q	3604;3611;3604;3611;3575	ENSP00000356224:E3604Q;ENSP00000396024:E3611Q;ENSP00000265368:E3604Q;ENSP00000390975:E3611Q;ENSP00000341887:E3575Q	ENSP00000265368:E3604Q	E	-	1	0	SYNE1	152717603	1.000000	0.71417	1.000000	0.80357	0.535000	0.34838	5.740000	0.68629	2.607000	0.88179	0.555000	0.69702	GAG	.	.	.	none		0.488	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
FAM20C	56975	hgsc.bcm.edu	37	7	208912	208912	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr7:208912G>A	ENST00000313766.5	+	3	1030	c.799G>A	c.(799-801)Ggc>Agc	p.G267S		NM_020223.3	NP_064608.2	Q8IXL6	DMP4_HUMAN	family with sequence similarity 20, member C	267					dentinogenesis (GO:0097187)|enamel mineralization (GO:0070166)|odontoblast differentiation (GO:0071895)|osteoclast maturation (GO:0036179)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of phosphorus metabolic process (GO:0051174)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|urinary_tract(1)	4		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)		GAAGTCGGGGGGCACGCAGCT	0.597																																					p.G267S		Atlas-SNP	.											.	FAM20C	18	.	0			c.G799A						PASS	.						44.0	52.0	49.0					7																	208912		2079	4193	6272	SO:0001583	missense	56975	exon3			TCGGGGGGCACGC	BC040074	CCDS47522.1	7p22.3	2012-11-29			ENSG00000177706	ENSG00000177706			22140	protein-coding gene	gene with protein product	"""dentin matrix protein 4"""	611061				17369251, 17924334	Standard	NM_020223		Approved	IMAGE:4942737, DKFZp547D065, DMP4	uc003sip.3	Q8IXL6	OTTHUMG00000151401	ENST00000313766.5:c.799G>A	chr7.hg19:g.208912G>A	ENSP00000322323:p.Gly267Ser	117.0	0.0	.		107.0	37.0	.	NM_020223	A4D2Q5|L8B5W8|Q5I0W9|Q7Z4I0|Q9NPT2	Missense_Mutation	SNP	ENST00000313766.5	hg19	CCDS47522.1	.	.	.	.	.	.	.	.	.	.	G	33	5.198539	0.94997	.	.	ENSG00000177706	ENST00000313766	T	0.75704	-0.96	5.1	5.1	0.69264	.	0.802912	0.11006	N	0.610002	D	0.89938	0.6860	M	0.91561	3.22	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89700	0.3904	10	0.87932	D	0	.	17.2657	0.87086	0.0:0.0:1.0:0.0	.	267	Q8IXL6	DMP4_HUMAN	S	267	ENSP00000322323:G267S	ENSP00000322323:G267S	G	+	1	0	FAM20C	303995	1.000000	0.71417	0.850000	0.33497	0.941000	0.58515	8.209000	0.89751	2.369000	0.80426	0.561000	0.74099	GGC	.	.	.	none		0.597	FAM20C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322476.2	NM_020223	
RAPGEF5	9771	hgsc.bcm.edu	37	7	22200164	22200164	+	Nonsense_Mutation	SNP	G	G	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr7:22200164G>A	ENST00000401957.2	-	4	836	c.589C>T	c.(589-591)Caa>Taa	p.Q197*	RAPGEF5_ENST00000344041.6_Nonsense_Mutation_p.Q347*			Q92565	RPGF5_HUMAN	Rap guanine nucleotide exchange factor (GEF) 5	197	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				nervous system development (GO:0007399)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)	GTP-dependent protein binding (GO:0030742)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|ovary(1)	6						AGTATCTTTTGAAATTCTTTC	0.318																																					p.Q347X		Atlas-SNP	.											.	RAPGEF5	96	.	0			c.C1039T						PASS	.						51.0	46.0	48.0					7																	22200164		1774	3985	5759	SO:0001587	stop_gained	9771	exon14			TCTTTTGAAATTC	D87467	CCDS55093.1	7p15.3	2004-03-01			ENSG00000136237	ENSG00000136237			16862	protein-coding gene	gene with protein product	"""M-Ras-regulated GEF"""	609527				9039502, 10486569	Standard	NM_012294		Approved	KIAA0277, GFR, MR-GEF	uc003svg.3	Q92565	OTTHUMG00000152525	ENST00000401957.2:c.589C>T	chr7.hg19:g.22200164G>A	ENSP00000384044:p.Gln197*	43.0	0.0	.		71.0	31.0	.	NM_012294	A4D140|Q8IXU5	Nonsense_Mutation	SNP	ENST00000401957.2	hg19		.	.	.	.	.	.	.	.	.	.	G	40	8.118746	0.98662	.	.	ENSG00000136237	ENST00000344041;ENST00000425852;ENST00000258735;ENST00000401957;ENST00000458533	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	20.5605	0.99326	0.0:0.0:1.0:0.0	.	.	.	.	X	347;197;197;197;85	.	ENSP00000258735:Q197X	Q	-	1	0	RAPGEF5	22166689	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.518000	0.90559	2.868000	0.98415	0.637000	0.83480	CAA	.	.	.	none		0.318	RAPGEF5-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000326590.2	NM_012294	
TRGC1	6966	hgsc.bcm.edu	37	7	38305038	38305038	+	RNA	SNP	T	T	C			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr7:38305038T>C	ENST00000443402.2	-	0	241					NM_001003799.1|NM_001003806.1	NP_001003799.1|NP_001003806.1	P0CF51	TRGC1_HUMAN	T cell receptor gamma constant 1							integral component of membrane (GO:0016021)											CTTTGTCCAGTGACTTTTCTG	0.398																																					p.S19S		Atlas-SNP	.											.	.	.	.	0			c.A57G						PASS	.						196.0	183.0	187.0					7																	38305038		1843	4101	5944			0	exon2			GTCCAGTGACTTT	M14996		7p14	2012-02-07			ENSG00000211689	ENSG00000211689		"""T cell receptors / TRG locus"""	12275	other	T cell receptor gene	"""T-cell receptor, gamma, constant region C1"""	186970		TCRGC1		2879283	Standard	NG_001336		Approved	C1		P0CF51	OTTHUMG00000155219		chr7.hg19:g.38305038T>C		99.0	0.0	.		160.0	31.0	.	NM_001003806		Silent	SNP	ENST00000443402.2	hg19																																																																																				.	.	.	none		0.398	TRGC1-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	TR_C_gene	TR_C_gene	OTTHUMT00000338825.3	NG_001336	
TRRAP	8295	hgsc.bcm.edu	37	7	98562256	98562256	+	Silent	SNP	C	C	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr7:98562256C>A	ENST00000359863.4	+	47	7022	c.6813C>A	c.(6811-6813)acC>acA	p.T2271T	TRRAP_ENST00000446306.3_Silent_p.T2252T|TRRAP_ENST00000355540.3_Silent_p.T2253T	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	2271	Interaction with TP53.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TTTTAGGGACCCTTATGATCC	0.438																																					p.T2271T		Atlas-SNP	.											.	TRRAP	863	.	0			c.C6813A						PASS	.						102.0	97.0	99.0					7																	98562256		2203	4300	6503	SO:0001819	synonymous_variant	8295	exon47			AGGGACCCTTATG	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.6813C>A	chr7.hg19:g.98562256C>A		114.0	0.0	.		140.0	84.0	.	NM_001244580	A4D265|O75218|Q9Y631|Q9Y6H4	Silent	SNP	ENST00000359863.4	hg19	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	C	5.374	0.254196	0.10185	.	.	ENSG00000196367	ENST00000456197	.	.	.	5.17	-7.53	0.01336	.	.	.	.	.	T	0.35008	0.0917	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39820	-0.9595	4	.	.	.	.	1.8561	0.03179	0.3258:0.1995:0.3247:0.15	.	.	.	.	H	1993	.	.	P	+	2	0	TRRAP	98400192	0.004000	0.15560	0.082000	0.20525	0.804000	0.45430	-1.218000	0.02976	-1.446000	0.01945	-0.717000	0.03617	CCC	.	.	.	none		0.438	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
E2F5	1875	hgsc.bcm.edu	37	8	86119659	86119659	+	Splice_Site	SNP	G	G	C			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr8:86119659G>C	ENST00000416274.2	+	5	584		c.e5-1		E2F5_ENST00000521429.1_Splice_Site|E2F5_ENST00000519128.1_Splice_Site|E2F5_ENST00000418930.2_Splice_Site|E2F5_ENST00000256117.5_Splice_Site|E2F5_ENST00000517476.1_Splice_Site	NM_001083588.1|NM_001951.3	NP_001077057.1|NP_001942.2	Q15329	E2F5_HUMAN	E2F transcription factor 5, p130-binding						gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	8						TTTTTGACCAGGTGATACACT	0.383																																					.		Atlas-SNP	.											.	E2F5	31	.	0			c.551-1G>C						PASS	.						39.0	39.0	39.0					8																	86119659		1808	4065	5873	SO:0001630	splice_region_variant	1875	exon5			TGACCAGGTGATA	X86097	CCDS47885.1, CCDS47886.1, CCDS55254.1	8q21.2	2004-01-29			ENSG00000133740	ENSG00000133740			3119	protein-coding gene	gene with protein product		600967				7892279	Standard	NM_001083588		Approved		uc003ycz.4	Q15329	OTTHUMG00000164785	ENST00000416274.2:c.551-1G>C	chr8.hg19:g.86119659G>C		77.0	0.0	.		52.0	15.0	.	NM_001951	E9PBN9|Q16601|Q92756	Splice_Site	SNP	ENST00000416274.2	hg19	CCDS47885.1	.	.	.	.	.	.	.	.	.	.	G	18.95	3.730840	0.69074	.	.	ENSG00000133740	ENST00000418930;ENST00000256117;ENST00000416274;ENST00000517476;ENST00000521429;ENST00000518234	.	.	.	5.98	5.98	0.97165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.4366	0.99092	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	E2F5	86306911	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.029000	0.76477	2.843000	0.97960	0.585000	0.79938	.	.	.	.	none		0.383	E2F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380274.1	NM_001951	Intron
ANGPT1	284	hgsc.bcm.edu	37	8	108509678	108509679	+	IGR	DNP	GA	GA	TC			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr8:108509678_108509679GA>TC								ANGPT1 (160928 upstream) : RNA5SP275 (387042 downstream)														p.Q37K(1)									TGCCCATGTTGAATCCGGTTAT	0.48																																					p.Q37K|p.I36M		Atlas-SNP	.											ANGPT1,rectum,carcinoma,0,1|.	ANGPT1	111	.	1	Substitution - Missense(1)	large_intestine(1)	c.C109A|c.T108G						PASS	.																																			SO:0001628	intergenic_variant	284	exon1			CATGTTGAATCCG|ATGTTGAATCCGG																													chr8.hg19:g.108509678_108509679delinsTC		74.0|75.0	0.0	.		98.0|99.0	38.0|40.0	.	NM_001199859		Missense_Mutation	SNP		hg19																																																																																				.	.	.	none	0	0.480								
SMU1	55234	hgsc.bcm.edu	37	9	33048246	33048246	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr9:33048246C>A	ENST00000397149.3	-	11	1351	c.1301G>T	c.(1300-1302)aGc>aTc	p.S434I	SMU1_ENST00000536631.1_Missense_Mutation_p.S273I	NM_018225.2	NP_060695.2	Q2TAY7	SMU1_HUMAN	smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)	434						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|lung(4)|ovary(2)|prostate(1)	9			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.11)		AGAACTGAAGCTTCTGACAAT	0.448																																					p.S434I		Atlas-SNP	.											.	SMU1	29	.	0			c.G1301T						PASS	.						118.0	107.0	111.0					9																	33048246		2203	4300	6503	SO:0001583	missense	55234	exon11			CTGAAGCTTCTGA	AK001667	CCDS6534.1	9p12	2013-01-10			ENSG00000122692	ENSG00000122692		"""WD repeat domain containing"""	18247	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 57"""					11438655, 11410362	Standard	NM_018225		Approved	SMU-1, FLJ10805, BWD, fSAP57	uc003zsf.1	Q2TAY7	OTTHUMG00000019757	ENST00000397149.3:c.1301G>T	chr9.hg19:g.33048246C>A	ENSP00000380336:p.Ser434Ile	90.0	0.0	.		63.0	20.0	.	NM_018225	B4E3L0|Q9BU59|Q9HA96|Q9NVD1	Missense_Mutation	SNP	ENST00000397149.3	hg19	CCDS6534.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.362286	0.82353	.	.	ENSG00000122692	ENST00000397149;ENST00000536631	T;T	0.81415	-1.49;-1.49	5.25	5.25	0.73442	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.036452	0.85682	D	0.000000	D	0.89047	0.6604	M	0.90595	3.13	0.80722	D	1	P;D;P	0.56287	0.737;0.975;0.737	B;P;B	0.53549	0.374;0.729;0.374	D	0.91156	0.4957	10	0.66056	D	0.02	-19.5603	16.6926	0.85326	0.0:1.0:0.0:0.0	.	434;273;434	A0MNN4;B4E3L0;Q2TAY7	.;.;SMU1_HUMAN	I	434;273	ENSP00000380336:S434I;ENSP00000443639:S273I	ENSP00000380336:S434I	S	-	2	0	SMU1	33038246	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.832000	0.62759	2.596000	0.87737	0.591000	0.81541	AGC	.	.	.	none		0.448	SMU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052022.1	NM_018225	
FAM13C	220965	hgsc.bcm.edu	37	10	61023877	61023877	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr10:61023877T>C	ENST00000373868.2	-	9	1079	c.992A>G	c.(991-993)aAt>aGt	p.N331S	FAM13C_ENST00000422313.2_Missense_Mutation_p.N331S|FAM13C_ENST00000419214.2_Intron|FAM13C_ENST00000277705.6_Missense_Mutation_p.N352S|FAM13C_ENST00000442566.3_Missense_Mutation_p.N352S|FAM13C_ENST00000468840.2_Missense_Mutation_p.N248S|FAM13C_ENST00000373867.3_Missense_Mutation_p.N248S|FAM13C_ENST00000435852.2_Missense_Mutation_p.N331S	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	331										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						AGCCAAATCATTCATCCATTT	0.448																																					p.N331S		Atlas-SNP	.											.	FAM13C	124	.	0			c.A992G						PASS	.						142.0	128.0	133.0					10																	61023877		2203	4300	6503	SO:0001583	missense	220965	exon9			AAATCATTCATCC	U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.992A>G	chr10.hg19:g.61023877T>C	ENSP00000362975:p.Asn331Ser	79.0	0.0	.		65.0	23.0	.	NM_198215	B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	ENST00000373868.2	hg19	CCDS7255.1	.	.	.	.	.	.	.	.	.	.	T	12.24	1.878710	0.33162	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000468840;ENST00000435852;ENST00000422313;ENST00000468696	T;T;T;T;T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02;-1.02;-1.02;-1.02;-1.02	5.93	4.8	0.61643	.	0.064498	0.64402	N	0.000007	D	0.84786	0.5549	M	0.64997	1.995	0.35420	D	0.793198	D;P;P;D	0.89917	1.0;0.663;0.89;1.0	D;B;P;D	0.85130	0.997;0.286;0.6;0.997	D	0.86877	0.2039	10	0.34782	T	0.22	-23.903	11.962	0.53013	0.0:0.0675:0.0:0.9325	.	331;248;331;331	B7Z2K3;B7ZB77;Q8NE31-2;Q8NE31	.;.;.;FA13C_HUMAN	S	248;331;352;352;248;331;331;109	ENSP00000362974:N248S;ENSP00000362975:N331S;ENSP00000395661:N352S;ENSP00000277705:N352S;ENSP00000423896:N248S;ENSP00000392302:N331S;ENSP00000400241:N331S;ENSP00000445068:N109S	ENSP00000277705:N352S	N	-	2	0	FAM13C	60693883	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.771000	0.55318	1.067000	0.40740	-0.256000	0.11100	AAT	.	.	.	none		0.448	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048162.2		
GLUD1	2746	hgsc.bcm.edu	37	10	88819991	88819991	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr10:88819991G>T	ENST00000277865.4	-	9	1301	c.1205C>A	c.(1204-1206)gCt>gAt	p.A402D	GLUD1_ENST00000544149.1_Missense_Mutation_p.A269D|GLUD1_ENST00000537649.1_Missense_Mutation_p.A235D|GLUD1_ENST00000465164.1_5'Flank	NM_005271.3	NP_005262.1	P00367	DHE3_HUMAN	glutamate dehydrogenase 1	402					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamine metabolic process (GO:0006541)|positive regulation of insulin secretion (GO:0032024)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|tricarboxylic acid metabolic process (GO:0072350)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|identical protein binding (GO:0042802)|leucine binding (GO:0070728)|NAD+ binding (GO:0070403)			endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(11)|prostate(1)	22					Hexachlorophene(DB00756)	GGCACCTTCAGCAATGATCTG	0.443																																					p.A402D		Atlas-SNP	.											.	GLUD1	30	.	0			c.C1205A						PASS	.						137.0	135.0	136.0					10																	88819991		2203	4296	6499	SO:0001583	missense	2746	exon9			CCTTCAGCAATGA	M20867	CCDS7382.1	10q23.2	2010-03-17			ENSG00000148672	ENSG00000148672	1.4.1.3		4335	protein-coding gene	gene with protein product		138130		GLUD		2757358	Standard	NM_005271		Approved	GDH	uc001keh.3	P00367	OTTHUMG00000018666	ENST00000277865.4:c.1205C>A	chr10.hg19:g.88819991G>T	ENSP00000277865:p.Ala402Asp	140.0	0.0	.		100.0	37.0	.	NM_005271	B3KV55|B4DGN5|Q5TBU3	Missense_Mutation	SNP	ENST00000277865.4	hg19	CCDS7382.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.996133	0.93167	.	.	ENSG00000148672	ENST00000277865;ENST00000394415;ENST00000537649;ENST00000535802;ENST00000513510;ENST00000544149	D;D;D	0.97186	-4.28;-4.28;-4.28	5.11	5.11	0.69529	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (2);NAD(P)-binding domain (1);	0.051018	0.85682	N	0.000000	D	0.99121	0.9697	H	0.98256	4.185	0.80722	D	1	D;D	0.71674	0.994;0.998	D;D	0.70016	0.967;0.967	D	0.99032	1.0821	10	0.72032	D	0.01	.	18.9599	0.92674	0.0:0.0:1.0:0.0	.	269;402	B4DGN5;P00367	.;DHE3_HUMAN	D	402;359;235;101;334;269	ENSP00000277865:A402D;ENSP00000439291:A235D;ENSP00000444732:A269D	ENSP00000277865:A402D	A	-	2	0	GLUD1	88809971	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.414000	0.97362	2.541000	0.85698	0.558000	0.71614	GCT	.	.	.	none		0.443	GLUD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049188.1	NM_005271	
HMX3	340784	hgsc.bcm.edu	37	10	124896686	124896686	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr10:124896686C>G	ENST00000357878.5	+	2	602	c.513C>G	c.(511-513)agC>agG	p.S171R		NM_001105574.1	NP_001099044.1	A6NHT5	HMX3_HUMAN	H6 family homeobox 3	171					brain development (GO:0007420)|cell differentiation (GO:0030154)|embryo implantation (GO:0007566)|inner ear morphogenesis (GO:0042472)|maternal process involved in female pregnancy (GO:0060135)|neuromuscular process controlling balance (GO:0050885)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			lung(4)	4		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.122)|COAD - Colon adenocarcinoma(40;0.141)		ACTCCAAGAGCCCGGACGAGA	0.682																																					p.S171R		Atlas-SNP	.											.	HMX3	24	.	0			c.C513G						PASS	.						14.0	17.0	16.0					10																	124896686		1934	4150	6084	SO:0001583	missense	340784	exon2			CAAGAGCCCGGAC		CCDS41575.1	10q26.13	2011-06-20	2007-07-09		ENSG00000188620	ENSG00000188620		"""Homeoboxes / ANTP class : NKL subclass"""	5019	protein-coding gene	gene with protein product		613380	"""homeo box (H6 family) 3"""				Standard	NM_001105574		Approved	NKX5-1	uc010quc.2	A6NHT5	OTTHUMG00000019199	ENST00000357878.5:c.513C>G	chr10.hg19:g.124896686C>G	ENSP00000350549:p.Ser171Arg	278.0	0.0	.		200.0	72.0	.	NM_001105574	A8MU06	Missense_Mutation	SNP	ENST00000357878.5	hg19	CCDS41575.1	.	.	.	.	.	.	.	.	.	.	C	17.93	3.508747	0.64410	.	.	ENSG00000188620	ENST00000357878	D	0.91894	-2.93	4.52	3.62	0.41486	.	0.000000	0.85682	D	0.000000	D	0.88983	0.6586	L	0.27053	0.805	0.45118	D	0.998134	D	0.65815	0.995	P	0.53185	0.72	D	0.85166	0.0995	10	0.17369	T	0.5	.	12.1028	0.53794	0.0:0.9151:0.0:0.0849	.	171	A6NHT5	HMX3_HUMAN	R	171	ENSP00000350549:S171R	ENSP00000350549:S171R	S	+	3	2	HMX3	124886676	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.512000	0.53407	1.122000	0.41944	0.455000	0.32223	AGC	.	.	.	none		0.682	HMX3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050842.4	XM_291716	
EPS8L2	64787	hgsc.bcm.edu	37	11	720135	720135	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr11:720135A>G	ENST00000533256.1	+	6	614	c.239A>G	c.(238-240)cAg>cGg	p.Q80R	AP006621.9_ENST00000527021.2_RNA|EPS8L2_ENST00000526198.1_Missense_Mutation_p.Q80R|EPS8L2_ENST00000530636.1_Missense_Mutation_p.Q80R|EPS8L2_ENST00000318562.8_Missense_Mutation_p.Q80R			Q9H6S3	ES8L2_HUMAN	EPS8-like 2	80	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	actin binding (GO:0003779)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|pancreas(1)|prostate(2)|soft_tissue(1)|urinary_tract(1)	13		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AAGCTGGTGCAGCTGAGCTCC	0.622																																					p.Q80R		Atlas-SNP	.											.	EPS8L2	42	.	0			c.A239G						PASS	.						78.0	59.0	65.0					11																	720135		2203	4300	6503	SO:0001583	missense	64787	exon5			TGGTGCAGCTGAG	AF318331	CCDS31328.1	11p15.5	2008-02-05				ENSG00000177106			21296	protein-coding gene	gene with protein product		614988				12620401	Standard	NM_022772		Approved	FLJ21935, FLJ22171, MGC3088	uc001lqt.3	Q9H6S3		ENST00000533256.1:c.239A>G	chr11.hg19:g.720135A>G	ENSP00000435585:p.Gln80Arg	343.0	0.0	.		238.0	87.0	.	NM_022772	B3KSX1|B7ZKL3|Q53GM8|Q8WYW7|Q96K06|Q9H6K9	Missense_Mutation	SNP	ENST00000533256.1	hg19	CCDS31328.1	.	.	.	.	.	.	.	.	.	.	A	16.94	3.261711	0.59431	.	.	ENSG00000177106	ENST00000524763;ENST00000318562;ENST00000533256;ENST00000533500;ENST00000531348;ENST00000530636;ENST00000526198	T;T;T;T;T;T;T	0.30981	1.51;2.0;2.0;1.51;1.51;2.0;1.51	3.81	3.81	0.43845	Phosphotyrosine interaction domain (1);Pleckstrin homology-type (1);Tensin phosphotyrosine-binding domain (1);	0.079131	0.51477	D	0.000096	T	0.36608	0.0973	L	0.49350	1.555	0.37273	D	0.907506	P;P;B	0.45827	0.608;0.867;0.379	B;P;B	0.50082	0.171;0.63;0.171	T	0.36915	-0.9728	10	0.39692	T	0.17	-27.9678	11.9851	0.53142	1.0:0.0:0.0:0.0	.	80;108;80	B7ZKL3;B4DFD2;Q9H6S3	.;.;ES8L2_HUMAN	R	80	ENSP00000435128:Q80R;ENSP00000320828:Q80R;ENSP00000435585:Q80R;ENSP00000433223:Q80R;ENSP00000432765:Q80R;ENSP00000436035:Q80R;ENSP00000436230:Q80R	ENSP00000320828:Q80R	Q	+	2	0	EPS8L2	710135	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.101000	0.50283	1.726000	0.51525	0.418000	0.28097	CAG	.	.	.	none		0.622	EPS8L2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382344.1	NM_022772	
HIPK3	10114	hgsc.bcm.edu	37	11	33373178	33373178	+	Silent	SNP	T	T	C			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr11:33373178T>C	ENST00000303296.4	+	15	3137	c.2832T>C	c.(2830-2832)agT>agC	p.S944S	HIPK3_ENST00000525975.1_Silent_p.S923S|AL122015.1_ENST00000411202.1_RNA|HIPK3_ENST00000456517.1_Silent_p.S923S|HIPK3_ENST00000379016.3_Silent_p.S923S	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	944	Interaction with AR. {ECO:0000250}.|Required for localization to nuclear speckles. {ECO:0000250}.|Ser-rich.				apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						AGCAAGAAAGTAGTTGTGATA	0.388																																					p.S944S		Atlas-SNP	.											.	HIPK3	92	.	0			c.T2832C						PASS	.						89.0	87.0	88.0					11																	33373178		2202	4298	6500	SO:0001819	synonymous_variant	10114	exon15			AGAAAGTAGTTGT	AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	ENST00000303296.4:c.2832T>C	chr11.hg19:g.33373178T>C		276.0	0.0	.		279.0	23.0	.	NM_005734	O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Silent	SNP	ENST00000303296.4	hg19	CCDS7884.1																																																																																			.	.	.	none		0.388	HIPK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255358.1	NM_005734	
MRPL16	54948	hgsc.bcm.edu	37	11	59573911	59573911	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr11:59573911T>A	ENST00000300151.4	-	4	878	c.665A>T	c.(664-666)aAc>aTc	p.N222I		NM_017840.3	NP_060310.1	Q9NX20	RM16_HUMAN	mitochondrial ribosomal protein L16	222					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(1)|liver(1)|lung(8)	11						GCCCAGCATGTTGGCAGTGGC	0.502																																					p.N222I		Atlas-SNP	.											.	MRPL16	25	.	0			c.A665T						PASS	.						267.0	247.0	254.0					11																	59573911		2201	4295	6496	SO:0001583	missense	54948	exon4			AGCATGTTGGCAG	AF183428	CCDS7976.1	11q12.1	2012-09-13			ENSG00000166902	ENSG00000166902		"""Mitochondrial ribosomal proteins / large subunits"""	14476	protein-coding gene	gene with protein product		611829					Standard	NM_017840		Approved	FLJ20484, PNAS-111	uc001noh.2	Q9NX20	OTTHUMG00000167410	ENST00000300151.4:c.665A>T	chr11.hg19:g.59573911T>A	ENSP00000300151:p.Asn222Ile	80.0	0.0	.		82.0	34.0	.	NM_017840	Q9BYD0|Q9HB70	Missense_Mutation	SNP	ENST00000300151.4	hg19	CCDS7976.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.420646	0.83559	.	.	ENSG00000166902	ENST00000300151	T	0.38077	1.16	6.07	4.93	0.64822	.	0.038078	0.85682	N	0.000000	T	0.61800	0.2376	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66360	-0.5943	10	0.87932	D	0	-27.3401	11.7445	0.51811	0.1321:0.0:0.0:0.8679	.	222	Q9NX20	RM16_HUMAN	I	222	ENSP00000300151:N222I	ENSP00000300151:N222I	N	-	2	0	MRPL16	59330487	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.019000	0.88732	1.093000	0.41377	0.533000	0.62120	AAC	.	.	.	none		0.502	MRPL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394521.1	NM_017840	
MRPL16	54948	hgsc.bcm.edu	37	11	59573937	59573937	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr11:59573937C>G	ENST00000300151.4	-	4	852	c.639G>C	c.(637-639)tgG>tgC	p.W213C		NM_017840.3	NP_060310.1	Q9NX20	RM16_HUMAN	mitochondrial ribosomal protein L16	213					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(1)|liver(1)|lung(8)	11						GCTCAAATGTCCAGGGGTTCT	0.512																																					p.W213C		Atlas-SNP	.											.	MRPL16	25	.	0			c.G639C						PASS	.						286.0	265.0	272.0					11																	59573937		2201	4295	6496	SO:0001583	missense	54948	exon4			AAATGTCCAGGGG	AF183428	CCDS7976.1	11q12.1	2012-09-13			ENSG00000166902	ENSG00000166902		"""Mitochondrial ribosomal proteins / large subunits"""	14476	protein-coding gene	gene with protein product		611829					Standard	NM_017840		Approved	FLJ20484, PNAS-111	uc001noh.2	Q9NX20	OTTHUMG00000167410	ENST00000300151.4:c.639G>C	chr11.hg19:g.59573937C>G	ENSP00000300151:p.Trp213Cys	80.0	0.0	.		77.0	37.0	.	NM_017840	Q9BYD0|Q9HB70	Missense_Mutation	SNP	ENST00000300151.4	hg19	CCDS7976.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.421247	0.83559	.	.	ENSG00000166902	ENST00000300151	T	0.27557	1.66	6.07	6.07	0.98685	.	0.049798	0.85682	D	0.000000	T	0.58466	0.2124	M	0.77820	2.39	0.80722	D	1	D	0.89917	1.0	D	0.65987	0.94	T	0.59451	-0.7452	10	0.87932	D	0	-13.0683	19.222	0.93801	0.0:1.0:0.0:0.0	.	213	Q9NX20	RM16_HUMAN	C	213	ENSP00000300151:W213C	ENSP00000300151:W213C	W	-	3	0	MRPL16	59330513	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.797000	0.85911	2.884000	0.98904	0.655000	0.94253	TGG	.	.	.	none		0.512	MRPL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394521.1	NM_017840	
BEST1	7439	hgsc.bcm.edu	37	11	61730245	61730245	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr11:61730245A>G	ENST00000378043.4	+	10	2262	c.1619A>G	c.(1618-1620)aAc>aGc	p.N540S	FTH1_ENST00000529631.1_Intron|BEST1_ENST00000378042.3_Missense_Mutation_p.N453S|BEST1_ENST00000534553.1_3'UTR|BEST1_ENST00000449131.2_Missense_Mutation_p.N480S|FTH1_ENST00000529191.1_Intron|BEST1_ENST00000301774.9_Missense_Mutation_p.N168S	NM_004183.3	NP_004174.1	O76090	BEST1_HUMAN	bestrophin 1	540					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|detection of light stimulus involved in visual perception (GO:0050908)|ion transmembrane transport (GO:0034220)|regulation of calcium ion transport (GO:0051924)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	basolateral plasma membrane (GO:0016323)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|urinary_tract(2)	25						GTGGAGTTTAACCTGACGGAT	0.463																																					p.N540S		Atlas-SNP	.											.	BEST1	85	.	0			c.A1619G						PASS	.						117.0	121.0	119.0					11																	61730245		2202	4299	6501	SO:0001583	missense	7439	exon10			AGTTTAACCTGAC	AF057170	CCDS31580.1, CCDS44623.1	11q12	2013-02-14	2006-10-18	2006-10-18	ENSG00000167995	ENSG00000167995		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	12703	protein-coding gene	gene with protein product	"""Best disease"""	607854	"""vitelliform macular dystrophy 2"""	VMD2		1302019, 17003041	Standard	NM_004183		Approved	BMD, BEST, RP50	uc001nsr.2	O76090	OTTHUMG00000167469	ENST00000378043.4:c.1619A>G	chr11.hg19:g.61730245A>G	ENSP00000367282:p.Asn540Ser	181.0	0.0	.		124.0	36.0	.	NM_004183	A8K0W6|B7Z3J8|B7Z736|O75904|Q53YQ9|Q8IUR9|Q8IZ80	Missense_Mutation	SNP	ENST00000378043.4	hg19	CCDS31580.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.735650	0.89482	.	.	ENSG00000167995	ENST00000378043;ENST00000378042;ENST00000301774;ENST00000449131	D;D;T;D	0.97976	-4.57;-4.46;-0.84;-4.64	5.16	3.86	0.44501	.	0.843087	0.10155	N	0.709046	D	0.93943	0.8061	L	0.32530	0.975	0.80722	D	1	B;B;P	0.37101	0.408;0.075;0.582	B;B;B	0.33392	0.065;0.015;0.163	D	0.91941	0.5563	10	0.59425	D	0.04	-29.6263	6.2971	0.21091	0.8282:0.0:0.1718:0.0	.	453;540;480	O76090-4;O76090;O76090-3	.;BEST1_HUMAN;.	S	540;453;168;480	ENSP00000367282:N540S;ENSP00000367281:N453S;ENSP00000301774:N168S;ENSP00000399709:N480S	ENSP00000301774:N168S	N	+	2	0	BEST1	61486821	1.000000	0.71417	0.980000	0.43619	0.854000	0.48673	2.647000	0.46639	2.089000	0.63090	0.533000	0.62120	AAC	.	.	.	none		0.463	BEST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394715.1	NM_004183	
LTBP3	4054	hgsc.bcm.edu	37	11	65308749	65308749	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr11:65308749T>C	ENST00000301873.5	-	20	3009	c.2741A>G	c.(2740-2742)cAc>cGc	p.H914R	LTBP3_ENST00000322147.4_Missense_Mutation_p.H914R|LTBP3_ENST00000536982.1_Missense_Mutation_p.H540R|LTBP3_ENST00000529189.1_5'UTR|LTBP3_ENST00000530785.1_5'UTR|LTBP3_ENST00000532932.1_Missense_Mutation_p.H344R	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	914					bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						CTTCTTGTGGTGGGGCTGCTC	0.627											OREG0021080	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H914R		Atlas-SNP	.											.	LTBP3	55	.	0			c.A2741G						PASS	.						111.0	99.0	103.0					11																	65308749		2201	4297	6498	SO:0001583	missense	4054	exon20			TTGTGGTGGGGCT	AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.2741A>G	chr11.hg19:g.65308749T>C	ENSP00000301873:p.His914Arg	24.0	0.0	.	1083	22.0	10.0	.	NM_001130144	O15107|Q96HB9|Q9H7K2|Q9UFN4	Missense_Mutation	SNP	ENST00000301873.5	hg19	CCDS44647.1	.	.	.	.	.	.	.	.	.	.	T	13.01	2.108115	0.37242	.	.	ENSG00000168056	ENST00000322147;ENST00000301873;ENST00000532932;ENST00000536982;ENST00000530866	D;D;D;D;D	0.92299	-3.01;-3.01;-3.01;-3.01;-3.01	4.32	4.32	0.51571	Matrix fibril-associated (2);	0.439740	0.23281	U	0.049905	D	0.86802	0.6020	N	0.13327	0.33	0.28670	N	0.90566	D;P;P;D;P;P	0.60575	0.988;0.919;0.867;0.974;0.919;0.645	P;B;B;P;P;B	0.53102	0.718;0.434;0.316;0.621;0.514;0.25	T	0.79482	-0.1785	10	0.24483	T	0.36	.	7.1975	0.25862	0.1989:0.0:0.0:0.8011	.	825;540;797;914;914;344	E9PKW1;F5GWC4;B9EG76;Q9NS15;Q9NS15-2;E9PJR2	.;.;.;LTBP3_HUMAN;.;.	R	914;914;344;540;825	ENSP00000326647:H914R;ENSP00000301873:H914R;ENSP00000435530:H344R;ENSP00000441912:H540R;ENSP00000435276:H825R	ENSP00000301873:H914R	H	-	2	0	LTBP3	65065325	.	.	1.000000	0.80357	0.856000	0.48823	.	.	1.591000	0.50007	0.240000	0.17902	CAC	.	.	.	none		0.627	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390538.1	NM_021070	
KIAA1731	85459	hgsc.bcm.edu	37	11	93455212	93455212	+	Silent	SNP	T	T	C			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr11:93455212T>C	ENST00000325212.6	+	20	6105	c.5943T>C	c.(5941-5943)gaT>gaC	p.D1981D	SCARNA9_ENST00000362805.1_RNA|SCARNA9_ENST00000364329.1_RNA|KIAA1731_ENST00000531700.1_Silent_p.D161D|KIAA1731_ENST00000411936.1_Silent_p.D1981D|KIAA1731_ENST00000344196.4_Silent_p.D161D|SCARNA9_ENST00000530422.1_RNA|Y_RNA_ENST00000363005.1_RNA			Q9C0D2	K1731_HUMAN	KIAA1731	1981						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GCCTTACAGATCCAGGTAATA	0.373																																					p.D1981D		Atlas-SNP	.											.	KIAA1731	173	.	0			c.T5943C						PASS	.						130.0	104.0	112.0					11																	93455212		692	1591	2283	SO:0001819	synonymous_variant	85459	exon20			TACAGATCCAGGT	AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.5943T>C	chr11.hg19:g.93455212T>C		52.0	0.0	.		50.0	24.0	.	NM_033395	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Silent	SNP	ENST00000325212.6	hg19	CCDS44708.1																																																																																			.	.	.	none		0.373	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000394640.1	NM_033395	
MTMR2	8898	hgsc.bcm.edu	37	11	95580921	95580921	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr11:95580921C>A	ENST00000346299.5	-	10	1476	c.1136G>T	c.(1135-1137)tGg>tTg	p.W379L	MTMR2_ENST00000409459.1_Missense_Mutation_p.W307L|MTMR2_ENST00000393223.3_Missense_Mutation_p.W307L|MTMR2_ENST00000352297.7_Missense_Mutation_p.W307L|MTMR2_ENST00000484818.1_5'Flank	NM_016156.5	NP_057240.3	Q13614	MTMR2_HUMAN	myotubularin related protein 2	379	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				cell death (GO:0008219)|dendritic spine maintenance (GO:0097062)|inositol phosphate dephosphorylation (GO:0046855)|myelin assembly (GO:0032288)|negative regulation of endocytosis (GO:0045806)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of myelination (GO:0031642)|negative regulation of receptor catabolic process (GO:2000645)|negative regulation of receptor internalization (GO:0002091)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of early endosome to late endosome transport (GO:2000643)|protein dephosphorylation (GO:0006470)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endosome (GO:0005768)|neuronal postsynaptic density (GO:0097481)|nucleus (GO:0005634)|synaptic membrane (GO:0097060)|synaptic vesicle (GO:0008021)|vacuolar membrane (GO:0005774)	phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	19		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GTTAGACAACCAGTGGGTTTC	0.378																																					p.W379L		Atlas-SNP	.											.	MTMR2	79	.	0			c.G1136T						PASS	.						132.0	133.0	133.0					11																	95580921		2201	4298	6499	SO:0001583	missense	8898	exon10			GACAACCAGTGGG	U58033	CCDS8305.1, CCDS8306.1	11q22	2014-09-17			ENSG00000087053	ENSG00000087053		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7450	protein-coding gene	gene with protein product		603557		CMT4B		8640223, 9736772	Standard	NM_016156		Approved	KIAA1073	uc001pfu.3	Q13614	OTTHUMG00000153837	ENST00000346299.5:c.1136G>T	chr11.hg19:g.95580921C>A	ENSP00000345752:p.Trp379Leu	185.0	0.0	.		143.0	56.0	.	NM_016156	A6NN98|Q9UPS9	Missense_Mutation	SNP	ENST00000346299.5	hg19	CCDS8305.1	.	.	.	.	.	.	.	.	.	.	C	34	5.354464	0.95830	.	.	ENSG00000087053	ENST00000346299;ENST00000393223;ENST00000409459;ENST00000352297;ENST00000444541	D;D;D;D;D	0.92752	-3.1;-3.1;-3.1;-3.1;-3.1	5.69	5.69	0.88448	Myotubularin phosphatase domain (1);	0.000000	0.85682	D	0.000000	D	0.97093	0.9050	M	0.90870	3.155	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	D	0.97490	1.0053	10	0.87932	D	0	.	19.8165	0.96571	0.0:1.0:0.0:0.0	.	379;379	A8K5G2;Q13614	.;MTMR2_HUMAN	L	379;307;307;307;307	ENSP00000345752:W379L;ENSP00000376915:W307L;ENSP00000386882:W307L;ENSP00000343737:W307L;ENSP00000396020:W307L	ENSP00000345752:W379L	W	-	2	0	MTMR2	95220569	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.755000	0.85180	2.683000	0.91414	0.655000	0.94253	TGG	.	.	.	none		0.378	MTMR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332620.1	NM_016156	
C11orf1	64776	hgsc.bcm.edu	37	11	111753128	111753128	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr11:111753128T>A	ENST00000260276.3	+	2	419	c.82T>A	c.(82-84)Tgt>Agt	p.C28S	C11orf1_ENST00000528125.1_De_novo_Start_OutOfFrame|C11orf1_ENST00000530214.1_Missense_Mutation_p.C28S|C11orf1_ENST00000529270.1_Missense_Mutation_p.C68S|ALG9_ENST00000524880.1_5'Flank	NM_022761.2	NP_073598.1	Q9H5F2	CK001_HUMAN	chromosome 11 open reading frame 1	28						nucleus (GO:0005634)				kidney(2)|lung(3)	5		all_cancers(61;1.26e-15)|all_epithelial(67;9.52e-10)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|Medulloblastoma(222;0.0228)|all_neural(223;0.0281)		all cancers(92;6.28e-09)|Epithelial(105;4.11e-08)|OV - Ovarian serous cystadenocarcinoma(223;1.52e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)		AAACCCACACTGTGGCAGCCT	0.428																																					p.C28S		Atlas-SNP	.											.	C11orf1	15	.	0			c.T82A						PASS	.						101.0	82.0	89.0					11																	111753128		2201	4297	6498	SO:0001583	missense	64776	exon2			CCACACTGTGGCA	AJ250229	CCDS8350.1	11q23.1	2012-05-30			ENSG00000137720	ENSG00000137720			1163	protein-coding gene	gene with protein product						10873569	Standard	NM_022761		Approved	FLJ23499	uc001pmd.3	Q9H5F2	OTTHUMG00000166884	ENST00000260276.3:c.82T>A	chr11.hg19:g.111753128T>A	ENSP00000260276:p.Cys28Ser	119.0	0.0	.		122.0	45.0	.	NM_022761	Q6I9X7|Q9NQC6	Missense_Mutation	SNP	ENST00000260276.3	hg19	CCDS8350.1	.	.	.	.	.	.	.	.	.	.	T	7.970	0.748848	0.15710	.	.	ENSG00000137720	ENST00000260276;ENST00000530214;ENST00000530799;ENST00000529270	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	5.33	5.33	0.75918	.	0.795295	0.11705	N	0.537529	T	0.10208	0.0250	N	0.08118	0	0.18873	N	0.999987	B;B	0.16166	0.016;0.001	B;B	0.19391	0.025;0.002	T	0.24728	-1.0152	10	0.23891	T	0.37	-4.0562	4.784	0.13217	0.1655:0.0852:0.0:0.7492	.	68;28	E9PMC1;Q9H5F2	.;CK001_HUMAN	S	28;28;44;68	ENSP00000260276:C28S;ENSP00000435864:C28S;ENSP00000432128:C44S;ENSP00000431180:C68S	ENSP00000260276:C28S	C	+	1	0	C11orf1	111258338	0.312000	0.24545	0.960000	0.40013	0.737000	0.42083	1.146000	0.31589	2.237000	0.73441	0.459000	0.35465	TGT	.	.	.	none		0.428	C11orf1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391650.1	NM_022761	
SORL1	6653	hgsc.bcm.edu	37	11	121430332	121430332	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr11:121430332G>T	ENST00000260197.7	+	21	3144	c.3015G>T	c.(3013-3015)atG>atT	p.M1005I		NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1005					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		CGGGGCTCATGGACATGAAGA	0.488																																					p.M1005I		Atlas-SNP	.											.	SORL1	218	.	0			c.G3015T						PASS	.						91.0	90.0	90.0					11																	121430332		2203	4299	6502	SO:0001583	missense	6653	exon21			GCTCATGGACATG	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.3015G>T	chr11.hg19:g.121430332G>T	ENSP00000260197:p.Met1005Ile	119.0	0.0	.		103.0	42.0	.	NM_003105	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	hg19	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.830325	0.91036	.	.	ENSG00000137642	ENST00000260197	D	0.91124	-2.79	5.24	5.24	0.73138	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.92355	0.7574	M	0.84511	2.7	0.80722	D	1	P	0.45078	0.85	B	0.41917	0.37	D	0.93769	0.7073	10	0.72032	D	0.01	.	18.8284	0.92127	0.0:0.0:1.0:0.0	.	1005	Q92673	SORL_HUMAN	I	1005	ENSP00000260197:M1005I	ENSP00000260197:M1005I	M	+	3	0	SORL1	120935542	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.614000	0.98353	2.441000	0.82636	0.655000	0.94253	ATG	.	.	.	none		0.488	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
SCN3B	55800	hgsc.bcm.edu	37	11	123516378	123516378	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr11:123516378T>A	ENST00000392770.2	-	2	938	c.136A>T	c.(136-138)Atc>Ttc	p.I46F	SCN3B_ENST00000530277.1_Missense_Mutation_p.I46F|SCN3B_ENST00000299333.3_Missense_Mutation_p.I46F	NM_018400.3	NP_060870.1	Q9NY72	SCN3B_HUMAN	sodium channel, voltage-gated, type III, beta subunit	46	Ig-like C2-type.				atrial cardiac muscle cell action potential (GO:0086014)|axon guidance (GO:0007411)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of heart rate (GO:0010460)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|ventricular cardiac muscle cell action potential (GO:0086005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|skin(2)	26		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0227)	Valproic Acid(DB00313)|Zonisamide(DB00909)	ATGCAGGAGATGCAGCGCAGC	0.577																																					p.I46F		Atlas-SNP	.											.	SCN3B	53	.	0			c.A136T						PASS	.						125.0	121.0	122.0					11																	123516378		2202	4299	6501	SO:0001583	missense	55800	exon2			AGGAGATGCAGCG	AJ243396	CCDS8442.1	11q24.1	2014-09-17	2012-02-28		ENSG00000166257	ENSG00000166257		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	20665	protein-coding gene	gene with protein product		608214	"""sodium channel, voltage-gated, type III, beta"""			10688874	Standard	XR_428980		Approved	HSA243396	uc001pzb.1	Q9NY72	OTTHUMG00000166006	ENST00000392770.2:c.136A>T	chr11.hg19:g.123516378T>A	ENSP00000376523:p.Ile46Phe	128.0	0.0	.		93.0	35.0	.	NM_018400	A5H1I5|Q17RL3|Q9ULR2	Missense_Mutation	SNP	ENST00000392770.2	hg19	CCDS8442.1	.	.	.	.	.	.	.	.	.	.	T	34	5.372748	0.95923	.	.	ENSG00000166257	ENST00000392770;ENST00000299333;ENST00000530277;ENST00000527836;ENST00000528267	T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01	5.96	5.96	0.96718	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.79499	0.4456	M	0.75777	2.31	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.81404	-0.0948	10	0.66056	D	0.02	-3.7292	16.443	0.83907	0.0:0.0:0.0:1.0	.	46	Q9NY72	SCN3B_HUMAN	F	46	ENSP00000376523:I46F;ENSP00000299333:I46F;ENSP00000432785:I46F;ENSP00000435554:I46F;ENSP00000434363:I46F	ENSP00000299333:I46F	I	-	1	0	SCN3B	123021588	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.691000	0.84191	2.275000	0.75901	0.496000	0.49642	ATC	.	.	.	none		0.577	SCN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387412.1	NM_018400	
PLCZ1	89869	hgsc.bcm.edu	37	12	18854673	18854673	+	Missense_Mutation	SNP	A	A	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr12:18854673A>T	ENST00000538330.1	-	5	506	c.125T>A	c.(124-126)aTa>aAa	p.I42K	PLCZ1_ENST00000266505.7_Missense_Mutation_p.I301K|PLCZ1_ENST00000435379.1_Missense_Mutation_p.I106K|PLCZ1_ENST00000447925.2_Missense_Mutation_p.I299K|PLCZ1_ENST00000542762.1_5'UTR|PLCZ1_ENST00000541695.1_Missense_Mutation_p.I164K|PLCZ1_ENST00000539875.1_Missense_Mutation_p.I108K					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					TAAGGTTCCTATTTTCTTATT	0.358																																					p.I301K		Atlas-SNP	.											.	PLCZ1	107	.	0			c.T902A						PASS	.						64.0	63.0	63.0					12																	18854673		2203	4297	6500	SO:0001583	missense	89869	exon8			GTTCCTATTTTCT	AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000538330.1:c.125T>A	chr12.hg19:g.18854673A>T	ENSP00000445880:p.Ile42Lys	87.0	0.0	.		74.0	31.0	.	NM_033123		Missense_Mutation	SNP	ENST00000538330.1	hg19		.	.	.	.	.	.	.	.	.	.	A	16.14	3.038007	0.54896	.	.	ENSG00000139151	ENST00000538330;ENST00000266505;ENST00000447925;ENST00000435379;ENST00000541695;ENST00000539875;ENST00000540421;ENST00000543242;ENST00000539072	T;T;T;T;T;T;T;T;T	0.63580	-0.05;0.65;0.65;-0.05;0.65;-0.05;-0.05;0.65;-0.05	5.35	5.35	0.76521	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.571765	0.18358	N	0.143647	T	0.57051	0.2027	L	0.50333	1.59	0.41644	D	0.989096	P;P	0.38335	0.514;0.627	B;B	0.37650	0.106;0.255	T	0.60286	-0.7293	10	0.48119	T	0.1	.	12.02	0.53337	1.0:0.0:0.0:0.0	.	301;42	Q86YW0;Q8N7S5	PLCZ1_HUMAN;.	K	42;301;299;106;164;108;36;42;128	ENSP00000445880:I42K;ENSP00000266505:I301K;ENSP00000402358:I299K;ENSP00000400504:I106K;ENSP00000443349:I164K;ENSP00000445026:I108K;ENSP00000445889:I36K;ENSP00000443762:I42K;ENSP00000438629:I128K	ENSP00000266505:I301K	I	-	2	0	PLCZ1	18745940	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.675000	0.46875	2.156000	0.67533	0.533000	0.62120	ATA	.	.	.	none		0.358	PLCZ1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000401666.3	NM_033123	
SLCO1A2	6579	hgsc.bcm.edu	37	12	21459852	21459852	+	Nonsense_Mutation	SNP	C	C	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr12:21459852C>A	ENST00000307378.6	-	6	1126	c.406G>T	c.(406-408)Gga>Tga	p.G136*	SLCO1A2_ENST00000458504.1_Nonsense_Mutation_p.G4*|SLCO1A2_ENST00000537524.1_Nonsense_Mutation_p.G4*|SLCO1A2_ENST00000452078.1_Nonsense_Mutation_p.G136*|SLCO1A2_ENST00000390670.3_Nonsense_Mutation_p.G134*	NM_134431.3	NP_602307.1	P46721	SO1A2_HUMAN	solute carrier organic anion transporter family, member 1A2	136					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(6)|upper_aerodigestive_tract(1)	48					Aminohippurate(DB00345)|Atorvastatin(DB01076)|Bumetanide(DB00887)|Chlorambucil(DB00291)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Enalapril(DB00584)|Erythromycin(DB00199)|Estradiol(DB00783)|Estriol(DB04573)|Estrone(DB00655)|Fexofenadine(DB00950)|Glyburide(DB01016)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Indinavir(DB00224)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Mirabegron(DB08893)|Naloxone(DB01183)|Naproxen(DB00788)|Nelfinavir(DB00220)|Ouabain(DB01092)|Pravastatin(DB00175)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rocuronium(DB00728)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Simvastatin(DB00641)|Spironolactone(DB00421)|Sumatriptan(DB00669)|Tauroursodeoxycholic acid(DB08834)|Testosterone(DB00624)|Tolbutamide(DB01124)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)	ATCTGGGTTCCATTTTCCATA	0.358																																					p.G136X		Atlas-SNP	.											.	SLCO1A2	107	.	0			c.G406T						PASS	.						119.0	109.0	112.0					12																	21459852		2203	4300	6503	SO:0001587	stop_gained	6579	exon6			GGGTTCCATTTTC		CCDS8686.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000084453	ENSG00000084453		"""Solute carriers"""	10956	protein-coding gene	gene with protein product		602883	"""solute carrier family 21 (organic anion transporter), member 3"""	SLC21A3		9007731	Standard	NM_134431		Approved	OATP, OATP1A2, OATP-A	uc001rer.3	P46721	OTTHUMG00000156259	ENST00000307378.6:c.406G>T	chr12.hg19:g.21459852C>A	ENSP00000305974:p.Gly136*	127.0	0.0	.		127.0	41.0	.	NM_134431	Q9UGP7|Q9UL38	Nonsense_Mutation	SNP	ENST00000307378.6	hg19	CCDS8686.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.530205	0.85706	.	.	ENSG00000084453	ENST00000307378;ENST00000452078;ENST00000458504;ENST00000537524;ENST00000390670;ENST00000413682;ENST00000422327;ENST00000453443	.	.	.	4.2	3.3	0.37823	.	1.613170	0.03170	N	0.170528	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	.	5.1289	0.14899	0.0:0.6678:0.2145:0.1177	.	.	.	.	X	136;136;4;4;134;4;136;136	.	ENSP00000305974:G136X	G	-	1	0	SLCO1A2	21351119	0.980000	0.34600	0.995000	0.50966	0.982000	0.71751	0.404000	0.20999	0.959000	0.37980	0.557000	0.71058	GGA	.	.	.	none		0.358	SLCO1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343648.3	NM_021094	
BAZ2A	11176	hgsc.bcm.edu	37	12	56994768	56994768	+	Missense_Mutation	SNP	T	T	G			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr12:56994768T>G	ENST00000551812.1	-	22	4608	c.4415A>C	c.(4414-4416)cAc>cCc	p.H1472P	BAZ2A_ENST00000179765.5_Missense_Mutation_p.H1440P|BAZ2A_ENST00000549884.1_Missense_Mutation_p.H1470P|BAZ2A_ENST00000553222.1_5'UTR|BAZ2A_ENST00000379441.3_Missense_Mutation_p.H1442P	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1472					chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						GAAGTCCCTGTGCTTGTTAAG	0.537																																					p.H1472P		Atlas-SNP	.											.	BAZ2A	263	.	0			c.A4415C						PASS	.						47.0	51.0	49.0					12																	56994768		1991	4172	6163	SO:0001583	missense	11176	exon22			TCCCTGTGCTTGT	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.4415A>C	chr12.hg19:g.56994768T>G	ENSP00000446880:p.His1472Pro	124.0	0.0	.		101.0	39.0	.	NM_013449	B3KN66|O00536|O15030|Q68DI8|Q96H26	Missense_Mutation	SNP	ENST00000551812.1	hg19	CCDS44924.1	.	.	.	.	.	.	.	.	.	.	T	19.99	3.928810	0.73327	.	.	ENSG00000076108	ENST00000379441;ENST00000179765;ENST00000551812;ENST00000549787;ENST00000549884	T;T;T;T;T	0.28255	1.62;1.62;1.62;1.62;1.62	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.52273	0.1724	L	0.60455	1.87	0.80722	D	1	D;D;B;D	0.89917	0.999;0.988;0.23;1.0	D;D;B;D	0.91635	0.996;0.979;0.305;0.999	T	0.54009	-0.8357	10	0.72032	D	0.01	-16.147	14.9092	0.70743	0.0:0.0:0.0:1.0	.	1470;1468;1472;1445	F8VU39;Q9UIF9-3;Q9UIF9;Q9UIF9-2	.;.;BAZ2A_HUMAN;.	P	1442;1440;1472;404;1470	ENSP00000368754:H1442P;ENSP00000179765:H1440P;ENSP00000446880:H1472P;ENSP00000448760:H404P;ENSP00000447941:H1470P	ENSP00000179765:H1440P	H	-	2	0	BAZ2A	55281035	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.657000	0.83745	2.231000	0.72958	0.459000	0.35465	CAC	.	.	.	none		0.537	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408561.1	NM_013449	
LRP1	4035	hgsc.bcm.edu	37	12	57600368	57600368	+	Silent	SNP	C	C	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr12:57600368C>T	ENST00000243077.3	+	76	12169	c.11703C>T	c.(11701-11703)cgC>cgT	p.R3901R		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3901					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	AGAGTGTCCGCATTGATGCTA	0.597																																					p.R3901R		Atlas-SNP	.											.	LRP1	428	.	0			c.C11703T						PASS	.						218.0	136.0	164.0					12																	57600368		2203	4300	6503	SO:0001819	synonymous_variant	4035	exon76			TGTCCGCATTGAT	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.11703C>T	chr12.hg19:g.57600368C>T		123.0	0.0	.		119.0	56.0	.	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Silent	SNP	ENST00000243077.3	hg19	CCDS8932.1																																																																																			.	.	.	none		0.597	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
KIF5A	3798	hgsc.bcm.edu	37	12	57969029	57969029	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr12:57969029T>A	ENST00000455537.2	+	16	2153	c.1879T>A	c.(1879-1881)Tca>Aca	p.S627T	KIF5A_ENST00000286452.5_Missense_Mutation_p.S538T	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	627					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						GCGGGAGCTCTCATCCTGCCA	0.537																																					p.S627T		Atlas-SNP	.											.	KIF5A	143	.	0			c.T1879A						PASS	.						42.0	41.0	41.0					12																	57969029		2203	4300	6503	SO:0001583	missense	3798	exon16			GAGCTCTCATCCT	U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.1879T>A	chr12.hg19:g.57969029T>A	ENSP00000408979:p.Ser627Thr	98.0	0.0	.		117.0	9.0	.	NM_004984	A6H8M5|Q4LE26	Missense_Mutation	SNP	ENST00000455537.2	hg19	CCDS8945.1	.	.	.	.	.	.	.	.	.	.	T	16.06	3.014980	0.54468	.	.	ENSG00000155980	ENST00000455537;ENST00000286452	D;D	0.85702	-2.02;-2.02	4.52	4.52	0.55395	.	0.000000	0.85682	D	0.000000	T	0.80607	0.4655	L	0.52759	1.655	0.54753	D	0.99998	B;B	0.17852	0.024;0.008	B;B	0.20184	0.028;0.022	T	0.75402	-0.3330	10	0.22706	T	0.39	.	13.2727	0.60170	0.0:0.0:0.0:1.0	.	538;627	B7Z2M7;Q12840	.;KIF5A_HUMAN	T	627;538	ENSP00000408979:S627T;ENSP00000286452:S538T	ENSP00000286452:S538T	S	+	1	0	KIF5A	56255296	0.990000	0.36364	0.947000	0.38551	0.992000	0.81027	2.229000	0.42990	2.027000	0.59764	0.533000	0.62120	TCA	.	.	.	none		0.537	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407634.1	NM_004984	
MED13L	23389	hgsc.bcm.edu	37	12	116460358	116460358	+	Silent	SNP	A	A	G			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr12:116460358A>G	ENST00000281928.3	-	5	734	c.528T>C	c.(526-528)aaT>aaC	p.N176N		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	176						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		TTGTGCATACATTACTTTCTC	0.408																																					p.N176N		Atlas-SNP	.											.	MED13L	193	.	0			c.T528C						PASS	.						98.0	82.0	88.0					12																	116460358		2203	4300	6503	SO:0001819	synonymous_variant	23389	exon5			GCATACATTACTT	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.528T>C	chr12.hg19:g.116460358A>G		92.0	0.0	.		88.0	32.0	.	NM_015335	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Silent	SNP	ENST00000281928.3	hg19	CCDS9177.1																																																																																			.	.	.	none		0.408	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3		
SLC15A4	121260	hgsc.bcm.edu	37	12	129293996	129293996	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr12:129293996T>C	ENST00000266771.5	-	4	1073	c.1034A>G	c.(1033-1035)cAg>cGg	p.Q345R	SLC15A4_ENST00000539703.1_5'UTR|SLC15A4_ENST00000544112.1_Missense_Mutation_p.Q8R	NM_145648.3	NP_663623.1	Q8N697	S15A4_HUMAN	solute carrier family 15 (oligopeptide transporter), member 4	345					ion transport (GO:0006811)|oligopeptide transport (GO:0006857)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	L-histidine transmembrane transporter activity (GO:0005290)|symporter activity (GO:0015293)			endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|skin(1)	22	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.69e-06)|Epithelial(86;1.17e-05)|all cancers(50;5.07e-05)		ATGAAGACTCTGTAAAACATA	0.363																																					p.Q345R		Atlas-SNP	.											.	SLC15A4	41	.	0			c.A1034G						PASS	.						169.0	176.0	174.0					12																	129293996		2203	4300	6503	SO:0001583	missense	121260	exon4			AGACTCTGTAAAA	AY038999	CCDS9264.1	12q24.32	2013-07-18	2013-07-18		ENSG00000139370	ENSG00000139370		"""Solute carriers"""	23090	protein-coding gene	gene with protein product		615806	"""solute carrier family 15, member 4"""			11741232	Standard	NM_145648		Approved	PHT1, PTR4	uc001uhu.2	Q8N697	OTTHUMG00000168415	ENST00000266771.5:c.1034A>G	chr12.hg19:g.129293996T>C	ENSP00000266771:p.Gln345Arg	101.0	0.0	.		82.0	11.0	.	NM_145648	A6H8Y9|B3KTK1|Q71M34|Q7Z5F8|Q8TAH0	Missense_Mutation	SNP	ENST00000266771.5	hg19	CCDS9264.1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.869237	0.91587	.	.	ENSG00000139370	ENST00000266771;ENST00000544112;ENST00000376740	T;T;T	0.58797	0.31;3.61;3.61	5.92	5.92	0.95590	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.81969	0.4935	M	0.92691	3.335	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.86441	0.1767	10	0.87932	D	0	.	16.3544	0.83230	0.0:0.0:0.0:1.0	.	345	Q8N697	S15A4_HUMAN	R	345;8;45	ENSP00000266771:Q345R;ENSP00000439946:Q8R;ENSP00000365930:Q45R	ENSP00000266771:Q345R	Q	-	2	0	SLC15A4	127859949	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	7.246000	0.78247	2.265000	0.75225	0.459000	0.35465	CAG	.	.	.	none		0.363	SLC15A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399663.1	NM_145648	
CCDC168	643677	hgsc.bcm.edu	37	13	103390355	103390355	+	5'Flank	SNP	T	T	C			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr13:103390355T>C	ENST00000322527.2	-	0	0					NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168																		cccttgctctttgtcttctct	0.463																																					p.K4231R		Atlas-SNP	.											.	.	.	.	0			c.A12692G						PASS	.						160.0	127.0	137.0					13																	103390355		692	1591	2283	SO:0001631	upstream_gene_variant	643677	exon4			TGCTCTTTGTCTT		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287		chr13.hg19:g.103390355T>C	Exception_encountered	105.0	0.0	.		87.0	40.0	.	NM_001146197	Q8N800	Missense_Mutation	SNP	ENST00000322527.2	hg19																																																																																				.	.	.	none		0.463	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146197	
FLVCR2	55640	hgsc.bcm.edu	37	14	76045630	76045630	+	Nonsense_Mutation	SNP	C	C	G			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr14:76045630C>G	ENST00000238667.4	+	1	671	c.315C>G	c.(313-315)taC>taG	p.Y105*	AC007182.6_ENST00000455232.1_RNA	NM_017791.2	NP_060261.2	Q9UPI3	FLVC2_HUMAN	feline leukemia virus subgroup C cellular receptor family, member 2	105					heme transport (GO:0015886)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	heme binding (GO:0020037)|heme transporter activity (GO:0015232)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	15				BRCA - Breast invasive adenocarcinoma(234;0.029)		GGATCCAGTACGGCTCCATCA	0.537																																					p.Y105X		Atlas-SNP	.											.	FLVCR2	39	.	0			c.C315G						PASS	.						160.0	129.0	139.0					14																	76045630		2203	4300	6503	SO:0001587	stop_gained	55640	exon1			CCAGTACGGCTCC	AK000378	CCDS9844.1, CCDS55933.1	14q24.3	2013-05-22	2007-05-01	2007-05-01	ENSG00000119686	ENSG00000119686		"""Solute carriers"""	20105	protein-coding gene	gene with protein product		610865	"""chromosome 14 open reading frame 58"", ""feline leukemia virus subgroup C cellular receptor 2"""	C14orf58		16439531, 20206334	Standard	NM_017791		Approved	FLJ20371, MFSD7C	uc001xrs.2	Q9UPI3	OTTHUMG00000171487	ENST00000238667.4:c.315C>G	chr14.hg19:g.76045630C>G	ENSP00000238667:p.Tyr105*	111.0	0.0	.		96.0	11.0	.	NM_017791	B7Z485|Q53ZT9|Q96JY3|Q9NX90	Nonsense_Mutation	SNP	ENST00000238667.4	hg19	CCDS9844.1	.	.	.	.	.	.	.	.	.	.	C	40	8.087835	0.98648	.	.	ENSG00000119686	ENST00000238667	.	.	.	5.9	-0.175	0.13315	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-11.5956	10.1313	0.42680	0.0:0.5239:0.0:0.4761	.	.	.	.	X	105	.	ENSP00000238667:Y105X	Y	+	3	2	AC007182.1	75115383	0.547000	0.26465	0.752000	0.31206	0.929000	0.56500	-0.123000	0.10611	0.116000	0.18110	0.650000	0.86243	TAC	.	.	.	none		0.537	FLVCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413672.1	NM_017791	
KCNK10	54207	hgsc.bcm.edu	37	14	88707144	88707144	+	Missense_Mutation	SNP	A	A	C			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr14:88707144A>C	ENST00000340700.5	-	3	859	c.408T>G	c.(406-408)aaT>aaG	p.N136K	KCNK10_ENST00000319231.5_Missense_Mutation_p.N141K|KCNK10_ENST00000312350.5_Missense_Mutation_p.N141K	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	136					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						TGACTCCCGCATTGTCAGCAT	0.403																																					p.N141K		Atlas-SNP	.											.	KCNK10	273	.	0			c.T423G						PASS	.						91.0	82.0	85.0					14																	88707144		2203	4300	6503	SO:0001583	missense	54207	exon3			TCCCGCATTGTCA	AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.408T>G	chr14.hg19:g.88707144A>C	ENSP00000343104:p.Asn136Lys	50.0	0.0	.		56.0	24.0	.	NM_138318	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	ENST00000340700.5	hg19	CCDS9880.1	.	.	.	.	.	.	.	.	.	.	A	15.61	2.883721	0.51908	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231;ENST00000556282	D;D;D;T	0.90676	-2.7;-2.71;-2.7;0.98	5.91	-7.33	0.01431	.	0.042994	0.85682	D	0.000000	T	0.81427	0.4820	N	0.11789	0.175	0.50632	D	0.999881	B;B;B	0.32467	0.372;0.372;0.027	B;B;B	0.42959	0.314;0.403;0.063	T	0.68792	-0.5315	10	0.18710	T	0.47	.	15.1307	0.72520	0.5942:0.0:0.4058:0.0	.	136;141;141	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	K	136;141;141;124	ENSP00000343104:N136K;ENSP00000310568:N141K;ENSP00000312811:N141K;ENSP00000452587:N124K	ENSP00000310568:N141K	N	-	3	2	KCNK10	87776897	0.346000	0.24844	0.451000	0.26982	0.989000	0.77384	-0.115000	0.10741	-1.842000	0.01181	-0.250000	0.11733	AAT	.	.	.	none		0.403	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	NM_021161	
ZC3H14	79882	hgsc.bcm.edu	37	14	89061310	89061310	+	Intron	SNP	A	A	C			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr14:89061310A>C	ENST00000251038.5	+	10	1504				ZC3H14_ENST00000555755.1_Intron|ZC3H14_ENST00000359301.3_Intron|ZC3H14_ENST00000393514.5_Intron|ZC3H14_ENST00000406216.3_Missense_Mutation_p.K80N|ZC3H14_ENST00000302216.8_Intron|ZC3H14_ENST00000555900.1_Missense_Mutation_p.K80N|ZC3H14_ENST00000556945.1_Intron|ZC3H14_ENST00000318308.6_Missense_Mutation_p.K80N|ZC3H14_ENST00000557607.1_Intron|ZC3H14_ENST00000336693.4_Intron	NM_001160103.1|NM_001160104.1|NM_024824.4	NP_001153575.1|NP_001153576.1|NP_079100.2	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14							cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(2)	21						ATGAAGCAAAAATTTCATCTT	0.318																																					p.K80N		Atlas-SNP	.											.	ZC3H14	71	.	0			c.A240C						PASS	.						48.0	47.0	48.0					14																	89061310		2202	4300	6502	SO:0001627	intron_variant	79882	exon1			AGCAAAAATTTCA	AF155107	CCDS32133.1, CCDS32134.1, CCDS32135.1, CCDS32136.1, CCDS55938.1	14q31.3	2014-08-12			ENSG00000100722	ENSG00000100722		"""Zinc fingers, CCCH-type domain containing"""	20509	protein-coding gene	gene with protein product		613279				10508479	Standard	NM_024824		Approved	FLJ11806, UKp68, NY-REN-37	uc001xww.3	Q6PJT7	OTTHUMG00000170803	ENST00000251038.5:c.1280-1768A>C	chr14.hg19:g.89061310A>C		214.0	0.0	.		148.0	54.0	.	NM_207662	A8MY46|B4DXU8|B4DZW7|B4E2H4|G3V5R4|Q6MZU4|Q6PJ32|Q6PUI6|Q6PUI8|Q86TQ5|Q86TW0|Q86TW1|Q8NCT6|Q8NCZ3|Q8TDE2|Q9HAC9|Q9Y5A0	Missense_Mutation	SNP	ENST00000251038.5	hg19	CCDS32133.1	.	.	.	.	.	.	.	.	.	.	A	15.01	2.707408	0.48412	.	.	ENSG00000100722	ENST00000318308;ENST00000555900;ENST00000406216;ENST00000557737	T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43	5.61	4.47	0.54385	.	.	.	.	.	D	0.84234	0.5427	L	0.47716	1.5	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	D	0.83799	0.0235	9	0.72032	D	0.01	.	8.1105	0.30911	0.9088:0.0:0.0912:0.0	.	80;80	Q6PJT7-8;Q6PJT7-6	.;.	N	80	ENSP00000327176:K80N;ENSP00000451530:K80N;ENSP00000384682:K80N;ENSP00000451941:K80N	ENSP00000327176:K80N	K	+	3	2	ZC3H14	88131063	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.955000	0.29188	0.964000	0.38108	0.533000	0.62120	AAA	.	.	.	none		0.318	ZC3H14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410387.1	NM_024824	
EML5	161436	hgsc.bcm.edu	37	14	89128042	89128042	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr14:89128042C>A	ENST00000380664.5	-	25	3630	c.3631G>T	c.(3631-3633)Ggg>Tgg	p.G1211W	EML5_ENST00000554922.1_Missense_Mutation_p.G1211W|EML5_ENST00000352093.5_Missense_Mutation_p.G1173W			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1211						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						AAATCGTCCCCGGTAGCTAGA	0.363																																					p.G1211W		Atlas-SNP	.											.	EML5	141	.	0			c.G3631T						PASS	.						60.0	57.0	58.0					14																	89128042		1842	4093	5935	SO:0001583	missense	161436	exon25			CGTCCCCGGTAGC	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.3631G>T	chr14.hg19:g.89128042C>A	ENSP00000370039:p.Gly1211Trp	145.0	0.0	.		144.0	57.0	.	NM_183387	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	ENST00000380664.5	hg19	CCDS45148.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.075896	0.76415	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.59083	0.29;0.94;0.29	4.42	4.42	0.53409	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.81163	0.4765	M	0.91768	3.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86422	0.1755	10	0.87932	D	0	-11.0346	17.2287	0.86978	0.0:1.0:0.0:0.0	.	1211;1211	Q05BV3-5;Q05BV3	.;EMAL5_HUMAN	W	1211;1173;1211	ENSP00000451998:G1211W;ENSP00000298315:G1173W;ENSP00000370039:G1211W	ENSP00000298315:G1173W	G	-	1	0	EML5	88197795	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.320000	0.79064	2.284000	0.76573	0.460000	0.39030	GGG	.	.	.	none		0.363	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1		
ADSSL1	122622	hgsc.bcm.edu	37	14	105207480	105207480	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr14:105207480G>T	ENST00000330877.2	+	8	778	c.693G>T	c.(691-693)atG>atT	p.M231I	ADSSL1_ENST00000332972.5_Missense_Mutation_p.M274I	NM_152328.3	NP_689541.1			adenylosuccinate synthase like 1											central_nervous_system(1)|cervix(1)|kidney(1)|lung(5)|ovary(2)|prostate(1)	11		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.18)		TCAGACCCATGGTCCGAGATG	0.612																																					p.M274I		Atlas-SNP	.											.	ADSSL1	37	.	0			c.G822T						PASS	.						88.0	84.0	85.0					14																	105207480		2203	4299	6502	SO:0001583	missense	122622	exon8			ACCCATGGTCCGA	AK095921	CCDS9990.1, CCDS9991.1	14q32.33	2010-08-05			ENSG00000185100	ENSG00000185100			20093	protein-coding gene	gene with protein product		612498					Standard	NM_199165		Approved	FLJ38602	uc001ype.3	Q8N142		ENST00000330877.2:c.693G>T	chr14.hg19:g.105207480G>T	ENSP00000331260:p.Met231Ile	64.0	0.0	.		53.0	23.0	.	NM_199165		Missense_Mutation	SNP	ENST00000330877.2	hg19	CCDS9990.1	.	.	.	.	.	.	.	.	.	.	G	18.37	3.609432	0.66558	.	.	ENSG00000185100	ENST00000330877;ENST00000332972	T;T	0.41065	1.01;1.01	5.14	5.14	0.70334	.	0.040897	0.85682	D	0.000000	T	0.47581	0.1453	M	0.64170	1.965	0.80722	D	1	B;B	0.30634	0.288;0.123	B;B	0.34489	0.113;0.184	T	0.52124	-0.8617	10	0.72032	D	0.01	-9.8453	18.57	0.91132	0.0:0.0:1.0:0.0	.	274;231	Q8N142-2;Q8N142	.;PURA1_HUMAN	I	231;274	ENSP00000331260:M231I;ENSP00000333019:M274I	ENSP00000331260:M231I	M	+	3	0	ADSSL1	104278525	1.000000	0.71417	0.998000	0.56505	0.737000	0.42083	9.711000	0.98735	2.394000	0.81467	0.655000	0.94253	ATG	.	.	.	none		0.612	ADSSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410529.1		
HERC2	8924	hgsc.bcm.edu	37	15	28499655	28499655	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr15:28499655C>T	ENST00000261609.7	-	20	2989	c.2881G>A	c.(2881-2883)Gcc>Acc	p.A961T		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TCTTTTTTGGCTTCAATATCC	0.403																																					p.A961T		Atlas-SNP	.											.	HERC2	501	.	0			c.G2881A						PASS	.						81.0	63.0	69.0					15																	28499655		2203	4300	6503	SO:0001583	missense	8924	exon20			TTTTGGCTTCAAT	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.2881G>A	chr15.hg19:g.28499655C>T	ENSP00000261609:p.Ala961Thr	24.0	0.0	.		20.0	6.0	.	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	hg19	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.957966	0.53400	.	.	ENSG00000128731	ENST00000261609	T	0.37915	1.17	5.67	4.76	0.60689	.	0.055869	0.64402	N	0.000001	T	0.30885	0.0779	L	0.44542	1.39	0.80722	D	1	B	0.21452	0.056	B	0.19666	0.026	T	0.06267	-1.0836	10	0.20046	T	0.44	.	14.1746	0.65532	0.0:0.9285:0.0:0.0715	.	961	O95714	HERC2_HUMAN	T	961	ENSP00000261609:A961T	ENSP00000261609:A961T	A	-	1	0	HERC2	26173250	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.086000	0.71352	1.402000	0.46780	0.585000	0.79938	GCC	.	.	.	none		0.403	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
HERC1	8925	hgsc.bcm.edu	37	15	64025169	64025169	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr15:64025169G>T	ENST00000443617.2	-	14	2909	c.2822C>A	c.(2821-2823)gCt>gAt	p.A941D		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	941					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CAAAATTTCAGCCAGGTGGGT	0.413																																					p.A941D		Atlas-SNP	.											.	HERC1	624	.	0			c.C2822A						PASS	.						60.0	57.0	58.0					15																	64025169		1838	4084	5922	SO:0001583	missense	8925	exon14			ATTTCAGCCAGGT	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.2822C>A	chr15.hg19:g.64025169G>T	ENSP00000390158:p.Ala941Asp	167.0	0.0	.		131.0	50.0	.	NM_003922	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	hg19	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	G	35	5.519645	0.96416	.	.	ENSG00000103657	ENST00000443617	T	0.32988	1.43	5.67	5.67	0.87782	.	0.000000	0.64402	U	0.000001	T	0.47097	0.1427	L	0.29908	0.895	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.45086	-0.9285	10	0.72032	D	0.01	.	19.7607	0.96316	0.0:0.0:1.0:0.0	.	941	Q15751	HERC1_HUMAN	D	941	ENSP00000390158:A941D	ENSP00000390158:A941D	A	-	2	0	HERC1	61812222	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.727000	0.98787	2.658000	0.90341	0.655000	0.94253	GCT	.	.	.	none		0.413	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
PKD1	5310	hgsc.bcm.edu	37	16	2168325	2168325	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr16:2168325G>A	ENST00000262304.4	-	5	876	c.668C>T	c.(667-669)gCc>gTc	p.A223V	RP11-304L19.2_ENST00000562027.1_RNA|PKD1_ENST00000423118.1_Missense_Mutation_p.A223V	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	223	WSC. {ECO:0000255|PROSITE- ProRule:PRU00558}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CTCCGAGAGGGCTGCGAGGCC	0.706																																					p.A223V		Atlas-SNP	.											.	PKD1	184	.	0			c.C668T						PASS	.						1.0	1.0	1.0					16																	2168325		1019	1899	2918	SO:0001583	missense	5310	exon5			GAGAGGGCTGCGA	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.668C>T	chr16.hg19:g.2168325G>A	ENSP00000262304:p.Ala223Val	136.0	0.0	.		150.0	31.0	.	NM_000296	Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	hg19	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	g	9.660	1.143801	0.21205	.	.	ENSG00000008710	ENST00000262304;ENST00000423118	T;T	0.59638	0.25;0.25	5.0	1.54	0.23209	Carbohydrate-binding WSC (2);Carbohydrate-binding WSC, subgroup (1);Polycystin cation channel (1);	0.130110	0.50627	D	0.000102	T	0.65386	0.2686	M	0.63428	1.95	0.09310	N	1	D;D	0.61080	0.989;0.957	P;P	0.58266	0.836;0.799	T	0.58584	-0.7611	10	0.72032	D	0.01	.	10.6659	0.45731	0.0806:0.3285:0.591:0.0	.	223;223	P98161-3;P98161	.;PKD1_HUMAN	V	223	ENSP00000262304:A223V;ENSP00000399501:A223V	ENSP00000262304:A223V	A	-	2	0	PKD1	2108326	0.746000	0.28272	0.021000	0.16686	0.027000	0.11550	0.703000	0.25646	0.516000	0.28340	0.450000	0.29827	GCC	.	.	.	none		0.706	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
ANKS4B	257629	hgsc.bcm.edu	37	16	21261239	21261239	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr16:21261239G>C	ENST00000311620.5	+	2	425	c.352G>C	c.(352-354)Gac>Cac	p.D118H		NM_145865.2	NP_665872.2	Q8N8V4	ANS4B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 4B	118					response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|lung(11)|ovary(2)	20				GBM - Glioblastoma multiforme(48;0.0565)		TGCTCTCCTGGACAAGGCTGC	0.522																																					p.D118H		Atlas-SNP	.											.	ANKS4B	43	.	0			c.G352C						PASS	.						65.0	64.0	65.0					16																	21261239		2106	4244	6350	SO:0001583	missense	257629	exon2			CTCCTGGACAAGG	AK096138	CCDS42130.1	16p12.2	2013-01-10				ENSG00000175311		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26795	protein-coding gene	gene with protein product		609901					Standard	NM_145865		Approved	FLJ38819, HARP	uc010bwp.1	Q8N8V4		ENST00000311620.5:c.352G>C	chr16.hg19:g.21261239G>C	ENSP00000308772:p.Asp118His	106.0	0.0	.		150.0	49.0	.	NM_145865		Missense_Mutation	SNP	ENST00000311620.5	hg19	CCDS42130.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.430655	0.83776	.	.	ENSG00000175311	ENST00000311620	T	0.63913	-0.07	5.81	5.81	0.92471	Ankyrin repeat-containing domain (4);	0.106321	0.64402	D	0.000011	T	0.65344	0.2682	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73193	-0.4060	10	0.72032	D	0.01	-25.3375	19.0439	0.93012	0.0:0.0:1.0:0.0	.	118	Q8N8V4	ANS4B_HUMAN	H	118	ENSP00000308772:D118H	ENSP00000308772:D118H	D	+	1	0	ANKS4B	21168740	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.813000	0.99286	2.741000	0.93983	0.591000	0.81541	GAC	.	.	.	none		0.522	ANKS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436535.1	NM_145865	
IL4R	3566	hgsc.bcm.edu	37	16	27374814	27374814	+	Nonsense_Mutation	SNP	C	C	A	rs370734074		TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr16:27374814C>A	ENST00000395762.2	+	11	2400	c.2141C>A	c.(2140-2142)tCa>tAa	p.S714*	IL4R_ENST00000380922.3_Nonsense_Mutation_p.S699*|IL4R_ENST00000170630.2_Nonsense_Mutation_p.S714*|IL4R_ENST00000543915.2_Nonsense_Mutation_p.S714*	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	714					defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						ATTGTCTACTCAGCCCTTACC	0.627																																					p.S714X		Atlas-SNP	.											.	IL4R	70	.	0			c.C2141A						PASS	.						65.0	62.0	63.0					16																	27374814		2197	4300	6497	SO:0001587	stop_gained	3566	exon11			TCTACTCAGCCCT	X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.2141C>A	chr16.hg19:g.27374814C>A	ENSP00000379111:p.Ser714*	73.0	0.0	.		99.0	35.0	.	NM_000418	B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Nonsense_Mutation	SNP	ENST00000395762.2	hg19	CCDS10629.1	.	.	.	.	.	.	.	.	.	.	C	42	9.662478	0.99233	.	.	ENSG00000077238	ENST00000395762;ENST00000543915;ENST00000380922;ENST00000170630	.	.	.	5.18	5.18	0.71444	.	0.679297	0.12852	N	0.433821	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-28.6605	14.1998	0.65696	0.0:1.0:0.0:0.0	.	.	.	.	X	714;714;699;714	.	ENSP00000170630:S714X	S	+	2	0	IL4R	27282315	0.962000	0.33011	0.972000	0.41901	0.945000	0.59286	2.233000	0.43027	2.415000	0.81967	0.655000	0.94253	TCA	.	.	.	alt		0.627	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214104.4		
ZNF629	23361	hgsc.bcm.edu	37	16	30794005	30794005	+	Silent	SNP	G	G	A	rs372927017		TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr16:30794005G>A	ENST00000262525.4	-	3	1851	c.1644C>T	c.(1642-1644)ggC>ggT	p.G548G	RP11-2C24.6_ENST00000575562.1_RNA	NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	548					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			GCAGGCTGTCGCCCTGGGCCC	0.692																																					p.G548G		Atlas-SNP	.											.	ZNF629	44	.	0			c.C1644T						PASS	.	G		0,4036		0,0,2018	18.0	19.0	18.0		1644	-11.6	0.0	16		18	1,8315		0,1,4157	no	coding-synonymous	ZNF629	NM_001080417.1		0,1,6175	AA,AG,GG		0.012,0.0,0.0081		548/870	30794005	1,12351	2018	4158	6176	SO:0001819	synonymous_variant	23361	exon3			GCTGTCGCCCTGG	AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.1644C>T	chr16.hg19:g.30794005G>A		64.0	0.0	.		72.0	30.0	.	NM_001080417	Q15938	Silent	SNP	ENST00000262525.4	hg19	CCDS45463.1																																																																																			.	.	.	weak		0.692	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434291.1	NM_015309	
CHD9	80205	hgsc.bcm.edu	37	16	53301225	53301225	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr16:53301225C>G	ENST00000398510.3	+	20	4427	c.4340C>G	c.(4339-4341)aCt>aGt	p.T1447S	CHD9_ENST00000447540.1_Missense_Mutation_p.T1447S|CHD9_ENST00000564845.1_Missense_Mutation_p.T1447S|CHD9_ENST00000566029.1_Missense_Mutation_p.T1447S			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1447					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				GTTATTGACACTCCAAGAATT	0.358																																					p.T1447S		Atlas-SNP	.											.	CHD9	203	.	0			c.C4340G						PASS	.						78.0	75.0	76.0					16																	53301225		1862	4111	5973	SO:0001583	missense	80205	exon21			TTGACACTCCAAG	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.4340C>G	chr16.hg19:g.53301225C>G	ENSP00000381522:p.Thr1447Ser	94.0	0.0	.		126.0	7.0	.	NM_025134	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	ENST00000398510.3	hg19		.	.	.	.	.	.	.	.	.	.	C	23.3	4.396994	0.83120	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000219084	D;D	0.85702	-2.02;-2.02	5.24	5.24	0.73138	.	0.206501	0.33631	N	0.004702	D	0.90225	0.6944	L	0.57536	1.79	0.80722	D	1	B;B;D;D	0.67145	0.024;0.198;0.993;0.996	B;B;D;D	0.73380	0.041;0.343;0.956;0.98	D	0.86487	0.1795	10	0.16420	T	0.52	-6.1431	19.1729	0.93588	0.0:1.0:0.0:0.0	.	973;1447;1447;1447	B4DR07;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	S	1447;1447;973	ENSP00000396345:T1447S;ENSP00000381522:T1447S	ENSP00000219084:T973S	T	+	2	0	CHD9	51858726	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.973000	0.70456	2.588000	0.87417	0.650000	0.86243	ACT	.	.	.	none		0.358	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
RPA1	6117	hgsc.bcm.edu	37	17	1787152	1787152	+	Silent	SNP	C	C	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr17:1787152C>T	ENST00000254719.5	+	13	1398	c.1288C>T	c.(1288-1290)Cta>Tta	p.L430L		NM_002945.3	NP_002936.1	P27694	RFA1_HUMAN	replication protein A1, 70kDa	430					base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of cell proliferation (GO:0008284)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|DNA replication factor A complex (GO:0005662)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|metal ion binding (GO:0046872)|single-stranded DNA binding (GO:0003697)			breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)	10						CATCTCTGATCTAAAGAGCGG	0.502								Nucleotide excision repair (NER)																													p.L430L		Atlas-SNP	.											.	RPA1	48	.	0			c.C1288T						PASS	.						169.0	145.0	153.0					17																	1787152		2203	4300	6503	SO:0001819	synonymous_variant	6117	exon13			TCTGATCTAAAGA	M63488	CCDS11014.1	17p13.3	2008-02-05	2002-08-29		ENSG00000132383	ENSG00000132383			10289	protein-coding gene	gene with protein product		179835	"""replication protein A1 (70kD)"""			8454588	Standard	NM_002945		Approved	REPA1, RPA70, HSSB, RF-A, RP-A	uc002fto.2	P27694	OTTHUMG00000090579	ENST00000254719.5:c.1288C>T	chr17.hg19:g.1787152C>T		188.0	0.0	.		240.0	50.0	.	NM_002945	A8K0Y9|Q59ES9	Silent	SNP	ENST00000254719.5	hg19	CCDS11014.1																																																																																			.	.	.	none		0.502	RPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207118.2	NM_002945	
TBC1D16	125058	hgsc.bcm.edu	37	17	77987194	77987194	+	Silent	SNP	C	C	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr17:77987194C>T	ENST00000310924.2	-	2	268	c.153G>A	c.(151-153)ggG>ggA	p.G51G		NM_001271844.1|NM_001271845.1|NM_019020.2	NP_001258773.1|NP_001258774.1|NP_061893.2	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16	51							Rab GTPase activator activity (GO:0005097)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(3)	28	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			GCCCCTGCAGCCCCTCCGGCG	0.667																																					p.G51G	Ovarian(14;397 562 4850 31922 49378)	Atlas-SNP	.											.	TBC1D16	48	.	0			c.G153A						PASS	.						11.0	13.0	12.0					17																	77987194		2197	4290	6487	SO:0001819	synonymous_variant	125058	exon2			CTGCAGCCCCTCC	AL157485	CCDS11766.1, CCDS62351.1, CCDS62352.1, CCDS62353.1	17q25.3	2013-07-10				ENSG00000167291			28356	protein-coding gene	gene with protein product						23019362	Standard	NM_019020		Approved	MGC25062, FLJ20748	uc002jxj.4	Q8TBP0		ENST00000310924.2:c.153G>A	chr17.hg19:g.77987194C>T		117.0	0.0	.		115.0	61.0	.	NM_019020	B9A6L7|I3L1E0|I3L4U2|Q8N3Z4|Q96DH7	Silent	SNP	ENST00000310924.2	hg19	CCDS11766.1																																																																																			.	.	.	none		0.667	TBC1D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437145.1	NM_019020	
CACNA1A	773	hgsc.bcm.edu	37	19	13394119	13394119	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr19:13394119C>T	ENST00000360228.5	-	22	3783	c.3784G>A	c.(3784-3786)Gcc>Acc	p.A1262T	CACNA1A_ENST00000573710.2_Missense_Mutation_p.A1263T	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1263					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GGGTCCTCGGCGGCCAGGGCG	0.602																																					p.A1263T		Atlas-SNP	.											.	CACNA1A	715	.	0			c.G3787A						PASS	.						96.0	104.0	101.0					19																	13394119		2181	4283	6464	SO:0001583	missense	773	exon22			CCTCGGCGGCCAG	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.3784G>A	chr19.hg19:g.13394119C>T	ENSP00000353362:p.Ala1262Thr	118.0	0.0	.		117.0	46.0	.	NM_001127221	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	hg19	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.103620	0.76983	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.97505	-4.41	4.92	3.86	0.44501	.	0.000000	0.85682	D	0.000000	D	0.97785	0.9273	M	0.75777	2.31	0.80722	D	1	D;D;D	0.69078	0.987;0.997;0.994	P;P;P	0.62014	0.777;0.897;0.521	D	0.98041	1.0382	10	0.87932	D	0	.	13.5836	0.61917	0.1565:0.8435:0.0:0.0	.	1263;1266;1262	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	T	1262;1266;1263;1263	ENSP00000353362:A1262T	ENSP00000317661:A1263T	A	-	1	0	CACNA1A	13255119	1.000000	0.71417	0.987000	0.45799	0.998000	0.95712	5.699000	0.68310	1.054000	0.40438	0.561000	0.74099	GCC	.	.	.	none		0.602	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
UNC13A	23025	hgsc.bcm.edu	37	19	17740112	17740112	+	Silent	SNP	G	G	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr19:17740112G>A	ENST00000519716.2	-	31	3689	c.3690C>T	c.(3688-3690)ctC>ctT	p.L1230L	UNC13A_ENST00000552293.1_Silent_p.L1230L|UNC13A_ENST00000428389.2_Silent_p.L1318L|UNC13A_ENST00000551649.1_Silent_p.L1230L|UNC13A_ENST00000550896.1_Silent_p.L1228L|UNC13A_ENST00000252773.7_Silent_p.L1230L	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	1230	MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						CTGCATACTGGAGGAGCACAT	0.572																																					p.L1230L		Atlas-SNP	.											.	UNC13A	299	.	0			c.C3690T						PASS	.						86.0	83.0	84.0					19																	17740112		2083	4212	6295	SO:0001819	synonymous_variant	23025	exon30			ATACTGGAGGAGC	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.3690C>T	chr19.hg19:g.17740112G>A		70.0	0.0	.		50.0	15.0	.	NM_001080421	E5RHY9	Silent	SNP	ENST00000519716.2	hg19	CCDS46013.2																																																																																			.	.	.	none		0.572	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604	
KLHL26	55295	hgsc.bcm.edu	37	19	18778568	18778568	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr19:18778568G>A	ENST00000300976.4	+	3	451	c.361G>A	c.(361-363)Gcc>Acc	p.A121T	KLHL26_ENST00000596843.1_3'UTR|KLHL26_ENST00000599006.1_Missense_Mutation_p.A121T	NM_018316.1	NP_060786.1	Q53HC5	KLH26_HUMAN	kelch-like family member 26	121	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.									breast(1)|central_nervous_system(1)|kidney(1)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						CATCGACTTCGCCTACAGCGC	0.667																																					p.A121T		Atlas-SNP	.											.	KLHL26	43	.	0			c.G361A						PASS	.						71.0	68.0	69.0					19																	18778568		2203	4298	6501	SO:0001583	missense	55295	exon3			GACTTCGCCTACA		CCDS12384.1	19p13.11	2013-10-15	2013-02-22		ENSG00000167487	ENSG00000167487		"""Kelch-like"", ""BTB/POZ domain containing"""	25623	protein-coding gene	gene with protein product			"""kelch-like 26 (Drosophila)"""				Standard	XM_006722785		Approved		uc002njz.1	Q53HC5	OTTHUMG00000183114	ENST00000300976.4:c.361G>A	chr19.hg19:g.18778568G>A	ENSP00000300976:p.Ala121Thr	92.0	0.0	.		87.0	27.0	.	NM_018316	Q8TAP0|Q9NUX3	Missense_Mutation	SNP	ENST00000300976.4	hg19	CCDS12384.1	.	.	.	.	.	.	.	.	.	.	G	16.94	3.261341	0.59431	.	.	ENSG00000167487	ENST00000431920;ENST00000300976	T	0.71461	-0.57	5.04	5.04	0.67666	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.82121	0.4968	M	0.68317	2.08	0.80722	D	1	D	0.71674	0.998	D	0.67725	0.953	T	0.83101	-0.0128	10	0.51188	T	0.08	.	17.3648	0.87360	0.0:0.0:1.0:0.0	.	121	Q53HC5	KLH26_HUMAN	T	121	ENSP00000300976:A121T	ENSP00000300976:A121T	A	+	1	0	KLHL26	18639568	1.000000	0.71417	0.988000	0.46212	0.027000	0.11550	6.507000	0.73717	2.341000	0.79615	0.591000	0.81541	GCC	.	.	.	none		0.667	KLHL26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465145.1	NM_018316	
ZNF790	388536	hgsc.bcm.edu	37	19	37309949	37309949	+	Missense_Mutation	SNP	A	A	C			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr19:37309949A>C	ENST00000356725.4	-	5	1417	c.1297T>G	c.(1297-1299)Tgg>Ggg	p.W433G	CTD-2162K18.5_ENST00000588906.1_RNA|CTD-2162K18.5_ENST00000587278.1_RNA	NM_001242802.1|NM_206894.3	NP_001229731.1|NP_996777.2	Q6PG37	ZN790_HUMAN	zinc finger protein 790	433					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	32	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			TACGAAGCCCAAGTAAAAGTC	0.413																																					p.W433G		Atlas-SNP	.											.	ZNF790	89	.	0			c.T1297G						PASS	.						91.0	92.0	92.0					19																	37309949		2203	4300	6503	SO:0001583	missense	388536	exon5			AAGCCCAAGTAAA	BC057245	CCDS12496.1	19q13.12	2013-01-08			ENSG00000197863	ENSG00000197863		"""Zinc fingers, C2H2-type"", ""-"""	33114	protein-coding gene	gene with protein product							Standard	NM_206894		Approved	MGC62100, FLJ20350	uc021utm.1	Q6PG37	OTTHUMG00000165616	ENST00000356725.4:c.1297T>G	chr19.hg19:g.37309949A>C	ENSP00000349161:p.Trp433Gly	107.0	0.0	.		91.0	39.0	.	NM_206894		Missense_Mutation	SNP	ENST00000356725.4	hg19	CCDS12496.1	.	.	.	.	.	.	.	.	.	.	A	3.322	-0.138613	0.06669	.	.	ENSG00000197863	ENST00000356725	T	0.07327	3.2	3.14	0.93	0.19454	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04770	0.0129	N	0.22421	0.69	0.09310	N	1	P	0.42123	0.771	B	0.39217	0.294	T	0.35101	-0.9802	9	0.27785	T	0.31	.	2.8271	0.05488	0.5719:0.0:0.2386:0.1895	.	433	Q6PG37	ZN790_HUMAN	G	433	ENSP00000349161:W433G	ENSP00000349161:W433G	W	-	1	0	ZNF790	42001789	0.000000	0.05858	0.004000	0.12327	0.486000	0.33341	-2.685000	0.00834	0.021000	0.15133	0.402000	0.26972	TGG	.	.	.	none		0.413	ZNF790-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385341.2	NM_206894	
ZNF546	339327	hgsc.bcm.edu	37	19	40521132	40521132	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr19:40521132T>A	ENST00000347077.4	+	7	2171	c.1955T>A	c.(1954-1956)cTc>cAc	p.L652H	ZNF546_ENST00000596894.1_Intron|ZNF546_ENST00000600094.1_Missense_Mutation_p.L626H	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	652			L -> F (in dbSNP:rs12373540).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AGCACTCATCTCACGCAACAT	0.413																																					p.L652H		Atlas-SNP	.											.	ZNF546	93	.	0			c.T1955A						PASS	.						68.0	65.0	66.0					19																	40521132		2203	4300	6503	SO:0001583	missense	339327	exon7			CTCATCTCACGCA	BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.1955T>A	chr19.hg19:g.40521132T>A	ENSP00000339823:p.Leu652His	101.0	0.0	.		107.0	39.0	.	NM_178544	A8K913	Missense_Mutation	SNP	ENST00000347077.4	hg19	CCDS12548.1	.	.	.	.	.	.	.	.	.	.	t	15.45	2.835827	0.50951	.	.	ENSG00000187187	ENST00000347077;ENST00000392042	T	0.54071	0.59	2.91	2.91	0.33838	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.81024	0.4737	H	0.98612	4.28	0.09310	N	1	D	0.89917	1.0	D	0.81914	0.995	T	0.70662	-0.4810	9	0.72032	D	0.01	.	9.5661	0.39400	0.0:0.0:0.0:1.0	.	652	Q86UE3	ZN546_HUMAN	H	652;261	ENSP00000339823:L652H	ENSP00000339823:L652H	L	+	2	0	ZNF546	45212972	0.327000	0.24678	0.218000	0.23776	0.862000	0.49288	3.930000	0.56522	1.564000	0.49628	0.482000	0.46254	CTC	.	.	.	none		0.413	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462495.2	NM_178544	
ZNF600	162966	hgsc.bcm.edu	37	19	53268927	53268927	+	Nonsense_Mutation	SNP	G	G	C			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr19:53268927G>C	ENST00000338230.3	-	3	2349	c.2082C>G	c.(2080-2082)taC>taG	p.Y694*		NM_198457.2	NP_940859	Q6ZNG1	ZN600_HUMAN	zinc finger protein 600	694					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|kidney(4)|large_intestine(9)|liver(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(262;0.0241)|GBM - Glioblastoma multiforme(134;0.0404)		CATTACACTTGTAAGGTTTCT	0.408																																					p.Y694X	Esophageal Squamous(196;1235 2112 2375 33339 34207)	Atlas-SNP	.											.	ZNF600	75	.	0			c.C2082G						PASS	.						107.0	100.0	102.0					19																	53268927		2203	4300	6503	SO:0001587	stop_gained	162966	exon3			ACACTTGTAAGGT	U52096	CCDS12856.1	19q13.42	2013-01-08				ENSG00000189190		"""Zinc fingers, C2H2-type"""	30951	protein-coding gene	gene with protein product						12576331	Standard	NM_198457		Approved	KR-ZNF1, DKFZp686F06123	uc002qab.4	Q6ZNG1		ENST00000338230.3:c.2082C>G	chr19.hg19:g.53268927G>C	ENSP00000344791:p.Tyr694*	117.0	0.0	.		110.0	43.0	.	NM_198457	Q6MZR0	Nonsense_Mutation	SNP	ENST00000338230.3	hg19	CCDS12856.1	.	.	.	.	.	.	.	.	.	.	.	23.9	4.472178	0.84533	.	.	ENSG00000189190	ENST00000338230	.	.	.	1.62	0.531	0.17108	.	.	.	.	.	.	.	.	.	.	.	0.47862	D	0.999534	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.0679	0.14591	0.3334:0.0:0.6666:0.0	.	.	.	.	X	694	.	ENSP00000344791:Y694X	Y	-	3	2	ZNF600	57960739	0.000000	0.05858	0.014000	0.15608	0.009000	0.06853	-1.193000	0.03049	0.938000	0.37419	0.289000	0.19496	TAC	.	.	.	none		0.408	ZNF600-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463093.1	NM_198457	
TMEM190	147744	hgsc.bcm.edu	37	19	55889460	55889460	+	Silent	SNP	G	G	C			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr19:55889460G>C	ENST00000291934.3	+	5	441	c.423G>C	c.(421-423)acG>acC	p.T141T	CTD-2105E13.15_ENST00000595064.1_RNA	NM_139172.1	NP_631911.1	Q8WZ59	TM190_HUMAN	transmembrane protein 190	141					hematopoietic progenitor cell differentiation (GO:0002244)	inner acrosomal membrane (GO:0002079)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	5	Breast(117;0.191)		BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		CGCCGTCCACGGGCAGCGTGC	0.647																																					p.T141T		Atlas-SNP	.											.	TMEM190	17	.	0			c.G423C						PASS	.						36.0	35.0	35.0					19																	55889460		2200	4300	6500	SO:0001819	synonymous_variant	147744	exon5			GTCCACGGGCAGC	AF442729	CCDS33113.1	19q13.42	2011-09-28				ENSG00000160472			29632	protein-coding gene	gene with protein product						21273369	Standard	NM_139172		Approved	MDAC1	uc002qkt.1	Q8WZ59		ENST00000291934.3:c.423G>C	chr19.hg19:g.55889460G>C		115.0	0.0	.		88.0	26.0	.	NM_139172	A6NJL5	Silent	SNP	ENST00000291934.3	hg19	CCDS33113.1																																																																																			.	.	.	none		0.647	TMEM190-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453042.1	NM_139172	
ZNF444	55311	hgsc.bcm.edu	37	19	56671522	56671522	+	Silent	SNP	T	T	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr19:56671522T>A	ENST00000337080.3	+	5	1303	c.936T>A	c.(934-936)gcT>gcA	p.A312A	ZNF444_ENST00000592949.1_Silent_p.A311A	NM_001253792.1|NM_018337.3	NP_001240721.1|NP_060807.2	Q8N0Y2	ZN444_HUMAN	zinc finger protein 444	312					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|endometrium(1)|lung(5)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0531)		GGGCGGTAGCTCCGGGCCCGG	0.766																																					p.A312A		Atlas-SNP	.											.	ZNF444	15	.	0			c.T936A						PASS	.						2.0	3.0	3.0					19																	56671522		1380	3123	4503	SO:0001819	synonymous_variant	55311	exon5			GGTAGCTCCGGGC	AB052954	CCDS12939.1, CCDS59426.1	19q13.43	2013-01-09			ENSG00000167685	ENSG00000167685		"""-"", ""Zinc fingers, C2H2-type"""	16052	protein-coding gene	gene with protein product		607874				11978792, 19760602	Standard	NM_001253792		Approved	ZSCAN17, FLJ11137, EZF2	uc002qmm.3	Q8N0Y2		ENST00000337080.3:c.936T>A	chr19.hg19:g.56671522T>A		36.0	0.0	.		23.0	10.0	.	NM_018337	Q8TEQ9|Q8WU35|Q9NUU1	Silent	SNP	ENST00000337080.3	hg19	CCDS12939.1																																																																																			.	.	.	none		0.766	ZNF444-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457503.1	NM_018337	
COMMD7	149951	hgsc.bcm.edu	37	20	31292673	31292673	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr20:31292673C>T	ENST00000278980.6	-	6	975	c.370G>A	c.(370-372)Gcc>Acc	p.A124T	COMMD7_ENST00000446419.2_Missense_Mutation_p.A123T	NM_001099339.1|NM_053041.2	NP_001092809.1|NP_444269.2	Q86VX2	COMD7_HUMAN	COMM domain containing 7	124					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	extracellular vesicular exosome (GO:0070062)	NF-kappaB binding (GO:0051059)			breast(1)|endometrium(1)|lung(3)	5						TGACCTATGGCCCATCGAGCA	0.458																																					p.A124T		Atlas-SNP	.											COMMD7,NS,carcinoma,0,1	COMMD7	16	.	0			c.G370A						PASS	.						96.0	90.0	92.0					20																	31292673		1935	4140	6075	SO:0001583	missense	149951	exon6			CTATGGCCCATCG	AY542162	CCDS42864.1, CCDS46587.1	20q11	2004-03-02	2004-02-13	2004-02-18	ENSG00000149600	ENSG00000149600			16223	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 92"""	C20orf92		15799966	Standard	NM_001099339		Approved	dJ1085F17.3	uc002wya.4	Q86VX2	OTTHUMG00000032229	ENST00000278980.6:c.370G>A	chr20.hg19:g.31292673C>T	ENSP00000278980:p.Ala124Thr	103.0	0.0	.		103.0	28.0	.	NM_053041	A2BHJ2|B3KTZ2|Q5JYB0|Q96SI7|Q9BW53	Missense_Mutation	SNP	ENST00000278980.6	hg19	CCDS42864.1	.	.	.	.	.	.	.	.	.	.	c	20.1	3.936810	0.73557	.	.	ENSG00000149600	ENST00000278980;ENST00000446419	T;T	0.10288	2.89;2.89	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.24928	0.0605	M	0.72894	2.215	0.80722	D	1	P;D	0.58268	0.873;0.982	P;P	0.53988	0.523;0.739	T	0.00216	-1.1910	10	0.35671	T	0.21	.	15.9723	0.80031	0.0:1.0:0.0:0.0	.	123;124	Q86VX2-2;Q86VX2	.;COMD7_HUMAN	T	124;123	ENSP00000278980:A124T;ENSP00000395339:A123T	ENSP00000278980:A124T	A	-	1	0	COMMD7	30756334	1.000000	0.71417	0.995000	0.50966	0.359000	0.29487	5.844000	0.69430	2.788000	0.95919	0.650000	0.86243	GCC	.	.	.	none		0.458	COMMD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078648.2	NM_053041	
MYH7B	57644	hgsc.bcm.edu	37	20	33585257	33585257	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr20:33585257G>T	ENST00000262873.7	+	30	3779	c.3687G>T	c.(3685-3687)gaG>gaT	p.E1229D		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	1187						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			AGCTGGAGGAGGCGGCGCTGC	0.786																																					p.E1229D		Atlas-SNP	.											.	MYH7B	145	.	0			c.G3687T						PASS	.						3.0	5.0	5.0					20																	33585257		1494	3137	4631	SO:0001583	missense	57644	exon32			GGAGGAGGCGGCG	AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.3687G>T	chr20.hg19:g.33585257G>T	ENSP00000262873:p.Glu1229Asp	32.0	0.0	.		64.0	40.0	.	NM_020884	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	ENST00000262873.7	hg19	CCDS42869.1	.	.	.	.	.	.	.	.	.	.	G	18.63	3.664731	0.67700	.	.	ENSG00000078814	ENST00000262873	D	0.86865	-2.18	4.73	1.66	0.24008	Myosin tail (1);	0.000000	0.38326	N	0.001738	D	0.83575	0.5284	M	0.71036	2.16	0.42950	D	0.994374	B	0.25235	0.121	B	0.22601	0.04	T	0.79626	-0.1725	10	0.54805	T	0.06	.	8.5311	0.33335	0.3076:0.0:0.6924:0.0	.	1187	A7E2Y1	MYH7B_HUMAN	D	1229	ENSP00000262873:E1229D	ENSP00000262873:E1229D	E	+	3	2	MYH7B	33048918	1.000000	0.71417	0.980000	0.43619	0.956000	0.61745	2.850000	0.48294	0.612000	0.30071	0.563000	0.77884	GAG	.	.	.	none		0.786	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2	NM_020884	
BCR	613	hgsc.bcm.edu	37	22	23632573	23632573	+	Missense_Mutation	SNP	T	T	G			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr22:23632573T>G	ENST00000305877.8	+	14	3506	c.2755T>G	c.(2755-2757)Tca>Gca	p.S919A	BCR_ENST00000359540.3_Missense_Mutation_p.S919A	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	919	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	CATCGTCCACTCAGCCACTGG	0.557			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""						OREG0026390	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S919A		Atlas-SNP	.		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	.	BCR	74	.	0			c.T2755G						PASS	.						216.0	206.0	209.0					22																	23632573		2203	4300	6503	SO:0001583	missense	613	exon14			GTCCACTCAGCCA		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.2755T>G	chr22.hg19:g.23632573T>G	ENSP00000303507:p.Ser919Ala	70.0	0.0	.	765	58.0	29.0	.	NM_021574	P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	ENST00000305877.8	hg19	CCDS13806.1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.807539	0.90623	.	.	ENSG00000186716	ENST00000305877;ENST00000359540;ENST00000334149	T;T	0.81078	0.94;-1.45	4.47	4.47	0.54385	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.82875	0.5132	L	0.49126	1.545	0.80722	D	1	D;P;P	0.55605	0.972;0.924;0.877	P;P;P	0.55615	0.679;0.747;0.78	T	0.82853	-0.0252	10	0.41790	T	0.15	.	13.6416	0.62255	0.0:0.0:0.0:1.0	.	508;919;919	B4E065;P11274-2;P11274	.;.;BCR_HUMAN	A	919;919;584	ENSP00000303507:S919A;ENSP00000352535:S919A	ENSP00000303507:S919A	S	+	1	0	BCR	21962573	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.790000	0.85794	1.961000	0.56991	0.529000	0.55759	TCA	.	.	.	none		0.557	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075819.1	NM_004327	
AKAP4	8852	hgsc.bcm.edu	37	X	49957181	49957181	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chrX:49957181G>T	ENST00000376056.2	-	5	2306	c.2156C>A	c.(2155-2157)gCa>gAa	p.A719E	AKAP4_ENST00000376064.3_Missense_Mutation_p.A719E|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Missense_Mutation_p.A345E|AKAP4_ENST00000358526.2_Missense_Mutation_p.A728E					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					TGCCGAGGCTGCTTGTTCTTC	0.448																																					p.A728E		Atlas-SNP	.											.	AKAP4	131	.	0			c.C2183A						PASS	.						100.0	73.0	82.0					X																	49957181		2203	4300	6503	SO:0001583	missense	8852	exon5			GAGGCTGCTTGTT	AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.2156C>A	chrX.hg19:g.49957181G>T	ENSP00000365224:p.Ala719Glu	46.0	0.0	.		52.0	11.0	.	NM_003886		Missense_Mutation	SNP	ENST00000376056.2	hg19	CCDS14330.1	.	.	.	.	.	.	.	.	.	.	G	9.242	1.038460	0.19669	.	.	ENSG00000147081	ENST00000376056;ENST00000376058;ENST00000358526;ENST00000376064	T;T;T;T	0.07327	3.2;3.2;3.2;3.2	4.82	3.94	0.45596	A-kinase anchor 110kDa, C-terminal (1);	0.251365	0.27927	N	0.017300	T	0.09598	0.0236	M	0.63428	1.95	0.28373	N	0.9199	B;P	0.34934	0.018;0.476	B;B	0.32393	0.031;0.145	T	0.09952	-1.0651	9	.	.	.	-6.048	9.5338	0.39209	0.0:0.0:0.7893:0.2107	.	728;345	Q5JQC9;A6ND82	AKAP4_HUMAN;.	E	719;345;728;719	ENSP00000365224:A719E;ENSP00000365226:A345E;ENSP00000351327:A728E;ENSP00000365232:A719E	.	A	-	2	0	AKAP4	49843921	0.109000	0.22037	0.627000	0.29227	0.261000	0.26267	0.407000	0.21049	0.805000	0.34159	0.529000	0.55759	GCA	.	.	.	none		0.448	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056552.1	NM_003886	
DNAH9	1770	hgsc.bcm.edu	37	17	11584061	11584062	+	Frame_Shift_Ins	INS	-	-	AC			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr17:11584061_11584062insAC	ENST00000262442.4	+	19	3666_3667	c.3598_3599insAC	c.(3598-3600)aacfs	p.N1200fs	DNAH9_ENST00000454412.2_Frame_Shift_Ins_p.N1200fs	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1200	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GAAATGGAACAACATAAAAAAG	0.535																																					p.N1200fs		Atlas-Indel,Pindel	.											.	DNAH9	695	.	0			c.3598_3599insAC						PASS	.																																			SO:0001589	frameshift_variant	1770	exon19			.	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.3599_3600dupAC	chr17.hg19:g.11584062_11584063dupAC	ENSP00000262442:p.Asn1200fs	175.0	0.0	0		235.0	66.0	0.280851	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Frame_Shift_Ins	INS	ENST00000262442.4	hg19	CCDS11160.1																																																																																			.	.	.	none		0.535	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
MYH11	4629	hgsc.bcm.edu	37	16	15820719	15820720	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr16:15820719_15820720insTT	ENST00000300036.5	-	28	3952_3953	c.3843_3844insAA	c.(3841-3846)aaagtcfs	p.V1282fs	MYH11_ENST00000452625.2_Frame_Shift_Ins_p.V1289fs|AF001548.5_ENST00000574212.1_RNA|MYH11_ENST00000396324.3_Frame_Shift_Ins_p.V1289fs|MYH11_ENST00000576790.2_Frame_Shift_Ins_p.V1282fs	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1282					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						AGCTTGTGGACTTTGTCATTGA	0.639			T	CBFB	AML																																p.V1289fs		Atlas-INDEL	.		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	MYH11	520	.	0			c.3865_3866insAA						PASS	.																																			SO:0001589	frameshift_variant	4629	exon29			.	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.3842_3843dupAA	chr16.hg19:g.15820720_15820721dupTT	ENSP00000300036:p.Val1282fs	60.0	0.0	0		47.0	10.0	0.212766	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Frame_Shift_Ins	INS	ENST00000300036.5	hg19	CCDS10565.1																																																																																			.	.	.	none		0.639	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
KRT15	3866	hgsc.bcm.edu	37	17	39674603	39674617	+	In_Frame_Del	DEL	GGTCTTGAAGTATTG	GGTCTTGAAGTATTG	-	rs373600329|rs139517360	byFrequency	TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	GGTCTTGAAGTATTG	GGTCTTGAAGTATTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr17:39674603_39674617delGGTCTTGAAGTATTG	ENST00000254043.3	-	1	4048_4062	c.463_477delCAATACTTCAAGACC	c.(463-477)caatacttcaagaccdel	p.QYFKT155del	KRT15_ENST00000393981.3_In_Frame_Del_p.NTSRP18del|KRT15_ENST00000393976.2_In_Frame_Del_p.QYFKT155del|KRT15_ENST00000393974.3_In_Frame_Del_p.NTSRP18del	NM_002275.3	NP_002266	P19012	K1C15_HUMAN	keratin 15	155	Linker 1.|Rod.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)	p.Q155R(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		Breast(137;0.000286)				GCTCTTCAATGGTCTTGAAGTATTGGCTGTAGTCG	0.544																																					p.155_160del		Atlas-Indel,Pindel	.											.	KRT15	60	.	1	Substitution - Missense(1)	endometrium(1)	c.464_478del						PASS	.																																			SO:0001651	inframe_deletion	3866	exon1			.		CCDS11398.1	17q21.2	2013-06-20			ENSG00000171346	ENSG00000171346		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6421	protein-coding gene	gene with protein product	"""keratin-15, basic"", ""keratin-15, beta"", ""type I cytoskeletal 15"", ""cytokeratin 15"""	148030				16831889	Standard	NM_002275		Approved	K15, CK15, K1CO	uc002hwy.3	P19012	OTTHUMG00000133435	ENST00000254043.3:c.463_477delCAATACTTCAAGACC	chr17.hg19:g.39674603_39674617delGGTCTTGAAGTATTG	ENSP00000254043:p.Gln155_Thr159del	87.0	0.0	0		68.0	27.0	0.397059	NM_002275	B3KQY1|B3KRA2|E0CX14|Q53XV8|Q9BUG4	In_Frame_Del	DEL	ENST00000254043.3	hg19	CCDS11398.1																																																																																			.	.	.	none		0.544	KRT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257301.1	NM_002275	
COG3	83548	hgsc.bcm.edu	37	13	46054274	46054274	+	Frame_Shift_Del	DEL	A	A	-			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr13:46054274delA	ENST00000349995.5	+	4	510	c.398delA	c.(397-399)tacfs	p.Y133fs		NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3	133					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		ATGAGGGATTACTTGTCTGGG	0.398																																					p.Y133fs	Ovarian(150;1048 1859 18083 21577 42700)	Atlas-Indel,Pindel	.											.	COG3	52	.	0			c.397delT						PASS	.						125.0	126.0	126.0					13																	46054274		2203	4300	6503	SO:0001589	frameshift_variant	83548	exon4			.	AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.398delA	chr13.hg19:g.46054274delA	ENSP00000258654:p.Tyr133fs	137.0	0.0	0		93.0	30.0	0.322581	NM_031431	B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Frame_Shift_Del	DEL	ENST00000349995.5	hg19	CCDS9398.1																																																																																			.	.	.	none		0.398	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044777.2		
TMEM190	147744	hgsc.bcm.edu	37	19	55889450	55889456	+	Frame_Shift_Del	DEL	CGCCGTC	CGCCGTC	-	rs200141569|rs558548585|rs77912983	byFrequency	TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	CGCCGTC	CGCCGTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr19:55889450_55889456delCGCCGTC	ENST00000291934.3	+	5	431_437	c.413_419delCGCCGTC	c.(412-420)acgccgtccfs	p.TPS138fs	CTD-2105E13.15_ENST00000595064.1_RNA	NM_139172.1	NP_631911.1	Q8WZ59	TM190_HUMAN	transmembrane protein 190	138					hematopoietic progenitor cell differentiation (GO:0002244)	inner acrosomal membrane (GO:0002079)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	5	Breast(117;0.191)		BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		ACCAAGAAGACGCCGTCCACGGGCAGC	0.657																																					p.138_140del		Atlas-Indel,Pindel	.											.	TMEM190	17	.	0			c.412_418del						PASS	.																																			SO:0001589	frameshift_variant	147744	exon5			.	AF442729	CCDS33113.1	19q13.42	2011-09-28				ENSG00000160472			29632	protein-coding gene	gene with protein product						21273369	Standard	NM_139172		Approved	MDAC1	uc002qkt.1	Q8WZ59		ENST00000291934.3:c.413_419delCGCCGTC	chr19.hg19:g.55889450_55889456delCGCCGTC	ENSP00000291934:p.Thr138fs	107.0	0.0	0		80.0	17.0	0.2125	NM_139172	A6NJL5	Frame_Shift_Del	DEL	ENST00000291934.3	hg19	CCDS33113.1																																																																																			.	.	.	none		0.657	TMEM190-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453042.1	NM_139172	
GNA14	9630	hgsc.bcm.edu	37	9	80043875	80043875	+	Frame_Shift_Del	DEL	A	A	-			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr9:80043875delA	ENST00000341700.6	-	5	1184	c.671delT	c.(670-672)ttcfs	p.F224fs	GNA14_ENST00000464095.1_5'UTR	NM_004297.3	NP_004288.1	O95837	GNA14_HUMAN	guanine nucleotide binding protein (G protein), alpha 14	224					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			endometrium(3)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	24						AGCAACCAAGAAAATAATGGA	0.502																																					p.F224fs		Atlas-Indel,Pindel	.											.	GNA14	50	.	0			c.672delC						PASS	.						199.0	188.0	192.0					9																	80043875		2203	4300	6503	SO:0001589	frameshift_variant	9630	exon5			.	AF105201	CCDS6657.1	9q21	2008-05-23			ENSG00000156049	ENSG00000156049			4382	protein-coding gene	gene with protein product		604397				10191087, 17620339	Standard	NM_004297		Approved		uc004aku.3	O95837	OTTHUMG00000020058	ENST00000341700.6:c.671delT	chr9.hg19:g.80043875delA	ENSP00000365807:p.Phe224fs	122.0	0.0	0		117.0	46.0	0.393162	NM_004297	B1ALW3	Frame_Shift_Del	DEL	ENST00000341700.6	hg19	CCDS6657.1																																																																																			.	.	.	none		0.502	GNA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052759.1		
KIF20A	10112	hgsc.bcm.edu	37	5	137519054	137519055	+	Splice_Site	INS	-	-	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr5:137519054_137519055insA	ENST00000394894.3	+	8	1253		c.e8+2		KIF20A_ENST00000508792.1_Splice_Site	NM_005733.2	NP_005724.1	O95235	KI20A_HUMAN	kinesin family member 20A						ATP catabolic process (GO:0006200)|cytokinesis (GO:0000910)|metabolic process (GO:0008152)|microtubule bundle formation (GO:0001578)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|liver(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(1)	27			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ATGTGAAAGGTAAAGGAACATG	0.515																																					.		Atlas-Indel,Pindel	.											.	KIF20A	53	.	0			c.1027+2->A						PASS	.																																			SO:0001630	splice_region_variant	10112	exon8			.	AF070672	CCDS4199.1	5q31	2008-02-05	2003-01-13	2003-01-17	ENSG00000112984	ENSG00000112984		"""Kinesins"""	9787	protein-coding gene	gene with protein product		605664	"""RAB6 interacting, kinesin-like (rabkinesin6)"""	RAB6KIFL		11416179, 10806357	Standard	NM_005733		Approved		uc003lcj.3	O95235	OTTHUMG00000129195	ENST00000394894.3:c.1027+2->A	chr5.hg19:g.137519057_137519057dupA		102.0	0.0	0		99.0	21.0	0.212121	NM_005733	B4DL79|D3DQB6	Splice_Site	INS	ENST00000394894.3	hg19	CCDS4199.1																																																																																			.	.	.	none		0.515	KIF20A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251272.1	NM_005733	Intron
SLC34A1	6569	hgsc.bcm.edu	37	5	176815315	176815316	+	Frame_Shift_Ins	INS	-	-	TGAGTCCC			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr5:176815315_176815316insTGAGTCCC	ENST00000324417.5	+	8	969_970	c.878_879insTGAGTCCC	c.(877-882)gatgagfs	p.-296fs	SLC34A1_ENST00000512593.1_Frame_Shift_Ins_p.-296fs	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1						arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCACTGGTGATGAGTCCCTGA	0.579																																					p.D293fs		Atlas-Indel,Pindel	.											.	SLC34A1	73	.	0			c.878_879insTGAGTCCC						PASS	.																																			SO:0001589	frameshift_variant	6569	exon8			.	L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.879_886dupTGAGTCCC	chr5.hg19:g.176815316_176815323dupTGAGTCCC	ENSP00000321424:p.Leu296fs	117.0	0.0	0		72.0	13.0	0.180556	NM_003052	B4DPE3	Frame_Shift_Ins	INS	ENST00000324417.5	hg19	CCDS4418.1																																																																																			.	.	.	none		0.579	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253431.1	NM_003052	
CSMD3	114788	hgsc.bcm.edu	37	8	113662424	113662425	+	Frame_Shift_Ins	INS	-	-	T			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr8:113662424_113662425insT	ENST00000297405.5	-	19	3402_3403	c.3158_3159insA	c.(3157-3159)aacfs	p.N1053fs	CSMD3_ENST00000455883.2_Frame_Shift_Ins_p.N949fs|CSMD3_ENST00000343508.3_Frame_Shift_Ins_p.N1013fs|CSMD3_ENST00000352409.3_Frame_Shift_Ins_p.N1053fs	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1053	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TCCACCAGTGGTTTTTTTCGCA	0.376										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.N1053fs		Atlas-Indel,Pindel	.											.	CSMD3	2325	.	0			c.3159_3160insA						PASS	.																																			SO:0001589	frameshift_variant	114788	exon19			.	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3159dupA	chr8.hg19:g.113662431_113662431dupT	ENSP00000297405:p.Asn1053fs	228.0	0.0	0		228.0	26.0	0.114035	NM_198123	Q96PZ3	Frame_Shift_Ins	INS	ENST00000297405.5	hg19	CCDS6315.1																																																																																			.	.	.	none		0.376	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
FAM134C	162427	hgsc.bcm.edu	37	17	40744166	40744171	+	In_Frame_Del	DEL	GTCAGG	GTCAGG	-			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	GTCAGG	GTCAGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr17:40744166_40744171delGTCAGG	ENST00000309428.5	-	2	308_313	c.249_254delCCTGAC	c.(247-255)gccctgaca>gca	p.LT84del	FAM134C_ENST00000543197.1_5'UTR|FAM134C_ENST00000585894.1_5'UTR	NM_178126.3	NP_835227.1	Q86VR2	F134C_HUMAN	family with sequence similarity 134, member C	84						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	11		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.134)		ACGAAGAGATGTCAGGGCAAAAAACC	0.379																																					p.84_85del		Atlas-Indel,Pindel	.											.	FAM134C	26	.	0			c.250_255del						PASS	.																																			SO:0001651	inframe_deletion	162427	exon2			.	BC049370	CCDS11432.1	17q21.2	2007-05-01							27258	protein-coding gene	gene with protein product						12477932	Standard	NM_178126		Approved	DKFZp686B1036, FLJ33806	uc002ial.2	Q86VR2		ENST00000309428.5:c.249_254delCCTGAC	chr17.hg19:g.40744166_40744171delGTCAGG	ENSP00000309432:p.Leu84_Thr85del	75.0	0.0	0		59.0	31.0	0.525424	NM_178126	B3KR75	In_Frame_Del	DEL	ENST00000309428.5	hg19	CCDS11432.1																																																																																			.	.	.	none		0.379	FAM134C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450536.1	NM_178126	
MIDN	90007	hgsc.bcm.edu	37	19	1251579	1251580	+	Frame_Shift_Ins	INS	-	-	C	rs375683589		TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr19:1251579_1251580insC	ENST00000591446.2	+	2	661_662	c.252_253insC	c.(253-255)ctgfs	p.L85fs	MIDN_ENST00000300952.2_Frame_Shift_Ins_p.L85fs			Q504T8	MIDN_HUMAN	midnolin	85	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.					cytosol (GO:0005829)|nucleolus (GO:0005730)				NS(1)|endometrium(3)|kidney(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTTCGGGGAAGCTGCAGGAGTT	0.668																																					p.K84fs		Atlas-Indel,Pindel	.											.	MIDN	34	.	0			c.252_253insC						PASS	.																																			SO:0001589	frameshift_variant	90007	exon3			.	AC004221	CCDS32864.1	19p13.3	2013-09-20			ENSG00000167470	ENSG00000167470			16298	protein-coding gene	gene with protein product		606700				10974535	Standard	XM_005259671		Approved		uc002lrp.3	Q504T8	OTTHUMG00000180144	ENST00000591446.2:c.253dupC	chr19.hg19:g.1251580_1251580dupC	ENSP00000467679:p.Leu85fs	88.0	0.0	0		72.0	22.0	0.305556	NM_177401	Q96BW8	Frame_Shift_Ins	INS	ENST00000591446.2	hg19	CCDS32864.1																																																																																			.	.	.	none		0.668	MIDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449965.2		
PLAG1	5324	hgsc.bcm.edu	37	8	57079249	57079250	+	Frame_Shift_Ins	INS	-	-	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr8:57079249_57079250insA	ENST00000316981.3	-	5	1534_1535	c.1055_1056insT	c.(1054-1056)ttafs	p.L352fs	PLAG1_ENST00000429357.2_Frame_Shift_Ins_p.L352fs|PLAG1_ENST00000423799.2_Frame_Shift_Ins_p.L270fs	NM_001114634.1|NM_002655.2	NP_001108106.1|NP_002646.2	Q6DJT9	PLAG1_HUMAN	pleiomorphic adenoma gene 1	352	Activates transcription; Inhibition of nuclear import due to lack of NLS and KPNA2 interaction.|Repression domain; contains 3 sumoylation motifs and massively decrease transcription activity.				gland morphogenesis (GO:0022612)|multicellular organism growth (GO:0035264)|negative regulation of gene expression (GO:0010629)|organ growth (GO:0035265)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		CTNNB1/PLAG1(60)|LIFR_ENST00000263409/PLAG1(10)|HAS2/PLAG1(10)|FGFR1_ENST00000447712/PLAG1(28)|COL1A2/PLAG1(3)|CHCHD7/PLAG1(12)|TCEA1_ENST00000521604/PLAG1(3)	breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	Epithelial(17;0.00179)|all cancers(17;0.0125)			TTTCCCCCTTTAATGGCTGTTC	0.426			T	"""TCEA1, LIFR, CTNNB1, CHCHD7"""	salivary adenoma																																p.L352fs		Atlas-Indel,Pindel	.		Dom	yes		8	8q12	5324	pleiomorphic adenoma gene 1		E	.	PLAG1	123	.	0			c.1056_1057insT						PASS	.																																			SO:0001589	frameshift_variant	5324	exon5			.	U65002	CCDS6165.1, CCDS47860.1	8q12	2010-07-30				ENSG00000181690		"""Zinc fingers, C2H2-type"""	9045	protein-coding gene	gene with protein product		603026				9268638	Standard	NM_002655		Approved	ZNF912	uc010lyi.3	Q6DJT9		ENST00000316981.3:c.1056dupT	chr8.hg19:g.57079251_57079251dupA	ENSP00000325546:p.Leu352fs	102.0	0.0	0		93.0	40.0	0.430108	NM_002655	B4DLC2|Q59GH8|Q9Y4L2	Frame_Shift_Ins	INS	ENST00000316981.3	hg19	CCDS6165.1																																																																																			.	.	.	none		0.426	PLAG1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378212.1	NM_002655	
FAM208A	23272	hgsc.bcm.edu	37	3	56680758	56680758	+	Frame_Shift_Del	DEL	T	T	-			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr3:56680758delT	ENST00000493960.2	-	14	2017	c.2007delA	c.(2005-2007)agafs	p.R669fs	FAM208A_ENST00000355628.5_Frame_Shift_Del_p.R669fs|FAM208A_ENST00000431842.2_Frame_Shift_Del_p.R273fs	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	669							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						AATGAGATGATCTTTGCTTTC	0.343																																					p.S670fs		Atlas-Indel,Pindel	.											.	FAM208A	113	.	0			c.2008delT						PASS	.						138.0	128.0	132.0					3																	56680758		2203	4300	6503	SO:0001589	frameshift_variant	23272	exon14			.	AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.2007delA	chr3.hg19:g.56680758delT	ENSP00000417509:p.Arg669fs	110.0	0.0	0		130.0	73.0	0.561538	NM_001112736	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Frame_Shift_Del	DEL	ENST00000493960.2	hg19	CCDS46853.1																																																																																			.	.	.	none		0.343	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224	
NAIP	4671	hgsc.bcm.edu	37	5	70316605	70316606	+	5'UTR	INS	-	-	A			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr5:70316605_70316606insA	ENST00000517649.1	-	0	167_168				NAIP_ENST00000508426.2_5'Flank|NAIP_ENST00000523981.1_Frame_Shift_Ins_p.L21fs|NAIP_ENST00000194097.4_5'UTR|NAIP_ENST00000503719.2_Frame_Shift_Ins_p.L21fs	NM_004536.2	NP_004527.2	Q13075	BIRC1_HUMAN	NLR family, apoptosis inhibitory protein						inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|metal ion binding (GO:0046872)			central_nervous_system(1)	1		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		AGAAAATATTTAAGGAACTAAA	0.406																																					p.L21fs		Atlas-Indel,Pindel	.											.	NAIP	38	.	0			c.63_64insT						PASS	.																																			SO:0001623	5_prime_UTR_variant	4671	exon3			.	U19251	CCDS4009.1, CCDS43327.1	5q13.2	2010-06-16	2006-12-08	2006-12-08	ENSG00000249437	ENSG00000249437		"""Baculoviral IAP repeat containing"", ""Nucleotide-binding domain and leucine rich repeat containing"""	7634	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and BIR domain containing 1"", ""NLR family, BIR domain containing 1"""	600355	"""baculoviral IAP repeat-containing 1"""	BIRC1		7813013	Standard	NM_022892		Approved	NLRB1	uc003jyj.1	Q13075	OTTHUMG00000163318	ENST00000517649.1:c.-124->T	chr5.hg19:g.70316607_70316607dupA		214.0	0.0	0		199.0	17.0	0.0854271	NM_022892	B9EG72|E9PHD1|O75857|Q13730|Q59GI6|Q8TDZ4|Q99796	Frame_Shift_Ins	INS	ENST00000517649.1	hg19	CCDS4009.1																																																																																			.	.	.	none		0.406	NAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372649.6	NM_004536	
HSCB	150274	hgsc.bcm.edu	37	22	29138082	29138085	+	Start_Codon_Del	DEL	AGAT	AGAT	-			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	AGAT	AGAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr22:29138082_29138085delAGAT	ENST00000216027.3	+	0	64_67				CHEK2_ENST00000382565.1_5'Flank|CHEK2_ENST00000544772.1_5'UTR|CHEK2_ENST00000348295.3_5'Flank|CHEK2_ENST00000328354.6_5'Flank|CHEK2_ENST00000405598.1_5'Flank|HSCB_ENST00000398941.2_Start_Codon_Del|CHEK2_ENST00000382578.1_5'Flank|CHEK2_ENST00000382580.2_5'Flank|CHEK2_ENST00000382566.1_5'Flank	NM_172002.3	NP_741999.3	Q8IWL3	HSC20_HUMAN	HscB mitochondrial iron-sulfur cluster co-chaperone						iron-sulfur cluster assembly (GO:0016226)|protein folding (GO:0006457)|protein oligomerization (GO:0051259)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			kidney(1)|lung(2)|skin(1)	4						GCCGCCGGCCAGATGTGGCGGGGG	0.642																																					.		Atlas-Indel,Pindel	.											.	HSCB	16	.	0			.						PASS	.																																			SO:0001582	initiator_codon_variant	150274	wholegene			.	AY191719	CCDS13845.1	22q12.1	2013-09-12	2013-09-12		ENSG00000100209	ENSG00000100209		"""Heat shock proteins / DNAJ (HSP40)"""	28913	protein-coding gene	gene with protein product	"""DnaJ (Hsp40) homolog, subfamily C, member 20"""	608142	"""HscB iron-sulfur cluster co-chaperone homolog (E. coli)"""			12938016, 16952052	Standard	NM_172002		Approved	HSC20, DNAJC20, Jac1	uc003aea.3	Q8IWL3	OTTHUMG00000151092		chr22.hg19:g.29138082_29138085delAGAT		93.0	0.0	0		86.0	43.0	0.5	NM_172002	Q9BWS7	Frame_Shift_Del	DEL	ENST00000216027.3	hg19	CCDS13845.1																																																																																			.	.	.	none		0.642	HSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321263.1	NM_172002	
THY1	7070	hgsc.bcm.edu	37	11	119290952	119290959	+	Frame_Shift_Del	DEL	TGCTTCTT	TGCTTCTT	-			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	TGCTTCTT	TGCTTCTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr11:119290952_119290959delTGCTTCTT	ENST00000284240.5	-	3	1214_1221	c.175_182delAAGAAGCA	c.(175-183)aagaagcacfs	p.KKH59fs	THY1_ENST00000527590.1_5'UTR|RP11-334E6.12_ENST00000578216.1_RNA|THY1_ENST00000580275.1_Frame_Shift_Del_p.KKH42fs|USP2-AS1_ENST00000498979.2_RNA|USP2-AS1_ENST00000578923.1_RNA|USP2-AS1_ENST00000500970.1_RNA|USP2-AS1_ENST00000530002.1_RNA|THY1_ENST00000528522.1_Frame_Shift_Del_p.KKH59fs	NM_006288.3	NP_006279.2	P04216	THY1_HUMAN	Thy-1 cell surface antigen	59	Ig-like V-type.				angiogenesis (GO:0001525)|cytoskeleton organization (GO:0007010)|focal adhesion assembly (GO:0048041)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of GTPase activity (GO:0043547)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of T cell activation (GO:0050870)|retinal cone cell development (GO:0046549)|single organismal cell-cell adhesion (GO:0016337)|T cell receptor signaling pathway (GO:0050852)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	GPI anchor binding (GO:0034235)|integrin binding (GO:0005178)|Rho GTPase activator activity (GO:0005100)	p.K59N(1)		breast(1)|kidney(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.83e-05)		AAAGAGCACGTGCTTCTTTGTCTCACGG	0.553																																					p.59_61del		Atlas-Indel,Pindel	.											.	THY1	21	.	1	Substitution - Missense(1)	breast(1)	c.176_183del						PASS	.																																			SO:0001589	frameshift_variant	7070	exon3			.	M11749	CCDS8424.1	11q23.3	2013-01-14				ENSG00000154096		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11801	protein-coding gene	gene with protein product		188230				2864690	Standard	NM_006288		Approved	CD90	uc001pwr.3	P04216		ENST00000284240.5:c.175_182delAAGAAGCA	chr11.hg19:g.119290952_119290959delTGCTTCTT	ENSP00000284240:p.Lys59fs	98.0	0.0	0		80.0	23.0	0.2875	NM_006288	Q16008|Q9NSP1	Frame_Shift_Del	DEL	ENST00000284240.5	hg19	CCDS8424.1																																																																																			.	.	.	none		0.553	THY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388370.2	NM_006288	
GMEB2	26205	hgsc.bcm.edu	37	20	62236196	62236212	+	Intron	DEL	GGTGAAGTGAAGGGAGG	GGTGAAGTGAAGGGAGG	-			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	GGTGAAGTGAAGGGAGG	GGTGAAGTGAAGGGAGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr20:62236196_62236212delGGTGAAGTGAAGGGAGG	ENST00000266068.1	-	2	610				GMEB2_ENST00000370069.1_5'UTR|GMEB2_ENST00000370077.1_Intron			Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding protein 2						regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	18	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)			GGTCGCCCCTGGTGAAGTGAAGGGAGGAGAGAATAGA	0.539																																					.		Pindel	.											.	GMEB2	44	.	0			.						PASS	.																																			SO:0001627	intron_variant	26205	.			.	AF173867	CCDS13528.1	20q13.33	2008-07-02			ENSG00000101216	ENSG00000101216			4371	protein-coding gene	gene with protein product		607451				10523663, 11743720	Standard	NM_012384		Approved	P79PIF, KIAA1269, PIF79	uc002yfq.1	Q9UKD1	OTTHUMG00000032988	ENST00000266068.1:c.132-3CCTCCCTTCACTTCACC>-	chr20.hg19:g.62236196_62236212delGGTGAAGTGAAGGGAGG		37.0	0.0	.		47.0	10.0	0.213	.	E1P5J3|Q5TDS0|Q9H431|Q9H4X7|Q9H4X8|Q9UF78|Q9ULF1	Splice_Site	DEL	ENST00000266068.1	hg19	CCDS13528.1																																																																																			.	.	.	none		0.539	GMEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080166.1	NM_012384	
CFAP69	79846	hgsc.bcm.edu	37	7	89936365	89936368	+	Frame_Shift_Del	DEL	AGCC	AGCC	-			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	AGCC	AGCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr7:89936365_89936368delAGCC	ENST00000389297.4	+	20	2667_2670	c.2416_2419delAGCC	c.(2416-2421)agccaafs	p.SQ806fs	C7orf63_ENST00000497910.1_Frame_Shift_Del_p.SQ788fs|C7orf63_ENST00000316089.8_Frame_Shift_Del_p.SQ760fs	NM_001039706.2|NM_001160138.1	NP_001034795.2|NP_001153610.1	A5D8W1	CG063_HUMAN		806										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|prostate(3)	37						TATAATTGAAAGCCAAGCATGCCA	0.373																																					p.805_806del		Pindel	.											.	C7orf63	158	.	0			c.2415_2418del						PASS	.																																			SO:0001589	frameshift_variant	79846	exon20			.																												ENST00000389297.4:c.2416_2419delAGCC	chr7.hg19:g.89936365_89936368delAGCC	ENSP00000373948:p.Ser806fs	306.0	0.0	.		329.0	101.0	0.307	NM_001039706	A3KMP9|B4DYW6|B4DZP7|B9EIM7|Q6V705|Q8IY89|Q9H7C2	Frame_Shift_Del	DEL	ENST00000389297.4	hg19	CCDS43613.2																																																																																			.	.	.	none		0.373	C7orf63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139891.4		
TROAP	10024	hgsc.bcm.edu	37	12	49717698	49717698	+	Frame_Shift_Del	DEL	C	C	-			TCGA-Y8-A895-01A-11D-A35Z-10	TCGA-Y8-A895-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ddcb521-adce-4fcc-8f3b-0cfd15f4274b	404c87ca-74c1-4140-bb3c-0186ece2d39e	g.chr12:49717698delC	ENST00000257909.3	+	3	291	c.215delC	c.(214-216)gccfs	p.A72fs	TROAP_ENST00000380327.5_Frame_Shift_Del_p.A72fs|TROAP_ENST00000551245.1_Frame_Shift_Del_p.A72fs|TROAP_ENST00000547923.1_5'Flank|RP11-161H23.9_ENST00000553259.1_RNA|TROAP_ENST00000549275.1_Intron|TROAP_ENST00000550709.1_Frame_Shift_Del_p.A72fs|TROAP_ENST00000549534.1_3'UTR|TROAP_ENST00000548311.1_Frame_Shift_Del_p.A72fs	NM_005480.3	NP_005471.3	Q12815	TROAP_HUMAN	trophinin associated protein	72					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	32						AGGCCGAAAGCCAGGCACCAG	0.582																																					p.A72fs		Pindel	.											.	TROAP	80	.	0			c.214delG						PASS	.						83.0	83.0	83.0					12																	49717698		2203	4300	6503	SO:0001589	frameshift_variant	10024	exon3			.	U04810	CCDS8784.1, CCDS41779.1, CCDS61117.1	12q13.12	2012-10-17	2012-10-17		ENSG00000135451	ENSG00000135451			12327	protein-coding gene	gene with protein product	"""tastin"""	603872				7758945	Standard	NM_005480		Approved	TASTIN	uc001rtx.4	Q12815	OTTHUMG00000169486	ENST00000257909.3:c.215delC	chr12.hg19:g.49717698delC	ENSP00000257909:p.Ala72fs	130.0	0.0	.		101.0	25.0	0.248	NM_001100620	F8VSF9|Q6PJU7|Q8N5B2	Frame_Shift_Del	DEL	ENST00000257909.3	hg19	CCDS8784.1																																																																																			.	.	.	none		0.582	TROAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404300.1	NM_005480	
