#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ESPN	83715	hgsc.bcm.edu	37	1	6517308	6517308	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr1:6517308A>G	ENST00000377828.1	+	11	2558	c.2390A>G	c.(2389-2391)aAg>aGg	p.K797R	ESPN_ENST00000416731.1_Missense_Mutation_p.K231R|ESPN_ENST00000475228.1_3'UTR|ESPN_ENST00000461727.1_Missense_Mutation_p.K231R	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin	797	Glu-rich.				locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		CTGCGGAAGAAGCTGGAAGAA	0.637																																					p.K797R		Atlas-SNP	.											.	ESPN	32	.	0			c.A2390G						PASS	.						31.0	35.0	34.0					1																	6517308		2203	4300	6503	SO:0001583	missense	83715	exon11			GGAAGAAGCTGGA	AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753	ENST00000377828.1:c.2390A>G	chr1.hg19:g.6517308A>G	ENSP00000367059:p.Lys797Arg	213.0	0.0	.		176.0	48.0	.	NM_031475	Q6XYB2|Q9H0A2|Q9Y329	Missense_Mutation	SNP	ENST00000377828.1	hg19	CCDS70.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.661993	0.88251	.	.	ENSG00000187017	ENST00000377828;ENST00000416731	D;D	0.87650	-2.28;-2.28	5.08	5.08	0.68730	.	0.600841	0.16868	N	0.196249	D	0.91758	0.7393	L	0.56769	1.78	0.39690	D	0.971021	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.993	D	0.92281	0.5833	10	0.66056	D	0.02	-26.7453	13.6632	0.62378	1.0:0.0:0.0:0.0	.	231;797	B1AK53-2;B1AK53	.;ESPN_HUMAN	R	797;231	ENSP00000367059:K797R;ENSP00000399239:K231R	ENSP00000367059:K797R	K	+	2	0	ESPN	6439895	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.312000	0.89976	1.903000	0.55091	0.459000	0.35465	AAG	.	.	.	none		0.637	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001887.3	NM_031475	
SPEN	23013	hgsc.bcm.edu	37	1	16199544	16199544	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr1:16199544G>T	ENST00000375759.3	+	2	521	c.317G>T	c.(316-318)gGg>gTg	p.G106V		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	106					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GAGGTTTCTGGGTTCAGAGGA	0.532																																					p.G106V		Atlas-SNP	.											.	SPEN	374	.	0			c.G317T						PASS	.						113.0	102.0	106.0					1																	16199544		2203	4300	6503	SO:0001583	missense	23013	exon2			TTTCTGGGTTCAG		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.317G>T	chr1.hg19:g.16199544G>T	ENSP00000364912:p.Gly106Val	148.0	0.0	.		119.0	30.0	.	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	hg19	CCDS164.1	.	.	.	.	.	.	.	.	.	.	G	12.51	1.959099	0.34565	.	.	ENSG00000065526	ENST00000375759	T	0.11604	2.76	5.57	5.57	0.84162	.	.	.	.	.	T	0.22781	0.0550	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.72075	0.976	T	0.00327	-1.1814	9	0.62326	D	0.03	0.0158	14.7284	0.69362	0.0713:0.0:0.9287:0.0	.	106	Q96T58	MINT_HUMAN	V	106	ENSP00000364912:G106V	ENSP00000364912:G106V	G	+	2	0	SPEN	16072131	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.659000	0.83766	2.635000	0.89317	0.555000	0.69702	GGG	.	.	.	none		0.532	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
AHDC1	27245	hgsc.bcm.edu	37	1	27874121	27874121	+	Silent	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr1:27874121G>A	ENST00000247087.5	-	5	5102	c.4506C>T	c.(4504-4506)gcC>gcT	p.A1502A	AHDC1_ENST00000374011.2_Silent_p.A1502A			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1502							DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		CCAGGTGAGGGGCACTGAGGC	0.711																																					p.A1502A		Atlas-SNP	.											.	AHDC1	98	.	0			c.C4506T						PASS	.						12.0	11.0	12.0					1																	27874121		2174	4277	6451	SO:0001819	synonymous_variant	27245	exon6			GTGAGGGGCACTG	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.4506C>T	chr1.hg19:g.27874121G>A		111.0	0.0	.		103.0	25.0	.	NM_001029882	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Silent	SNP	ENST00000247087.5	hg19	CCDS30652.1																																																																																			.	.	.	none		0.711	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009523.3		
C1orf123	54987	hgsc.bcm.edu	37	1	53684086	53684086	+	Splice_Site	SNP	C	C	G			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr1:53684086C>G	ENST00000294360.4	-	4	270	c.229G>C	c.(229-231)Gag>Cag	p.E77Q	RP5-1024G6.7_ENST00000569869.1_RNA|C1orf123_ENST00000470385.1_5'UTR	NM_017887.1	NP_060357.1	Q9NWV4	CA123_HUMAN	chromosome 1 open reading frame 123	77						extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|pancreas(2)|skin(1)	6						CCTGACCTACCGATGGAATTT	0.562																																					p.E77Q		Atlas-SNP	.											.	C1orf123	9	.	0			c.G229C						PASS	.						112.0	87.0	96.0					1																	53684086		2203	4300	6503	SO:0001630	splice_region_variant	54987	exon4			ACCTACCGATGGA	BC010908	CCDS576.1	1p32.3	2011-02-18			ENSG00000162384	ENSG00000162384			26059	protein-coding gene	gene with protein product						12477932	Standard	NM_017887		Approved	FLJ20580	uc001cvd.3	Q9NWV4	OTTHUMG00000008940	ENST00000294360.4:c.229+1G>C	chr1.hg19:g.53684086C>G		93.0	0.0	.		96.0	34.0	.	NM_017887		Missense_Mutation	SNP	ENST00000294360.4	hg19	CCDS576.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.173882	0.78452	.	.	ENSG00000162384	ENST00000294360;ENST00000371480	.	.	.	5.15	5.15	0.70609	.	0.259745	0.42420	D	0.000720	T	0.44519	0.1297	N	0.20685	0.6	0.43959	D	0.996632	P;P	0.42908	0.637;0.793	B;B	0.43838	0.33;0.433	T	0.31586	-0.9938	8	.	.	.	-7.8057	18.6318	0.91363	0.0:1.0:0.0:0.0	.	47;77	D3DQ38;Q9NWV4	.;CA123_HUMAN	Q	77;58	.	.	E	-	1	0	C1orf123	53456674	1.000000	0.71417	0.983000	0.44433	0.886000	0.51366	7.300000	0.78841	2.404000	0.81709	0.655000	0.94253	GAG	.	.	.	none		0.562	C1orf123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024751.1	NM_017887	Missense_Mutation
ATXN7L2	127002	hgsc.bcm.edu	37	1	110031671	110031671	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr1:110031671G>A	ENST00000369870.3	+	7	1001	c.986G>A	c.(985-987)aGc>aAc	p.S329N		NM_153340.4	NP_699171.3	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2	329										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)	17		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)		GCTCCCAGCAGCACCTTCTCT	0.612																																					p.S329N		Atlas-SNP	.											.	ATXN7L2	60	.	0			c.G986A						PASS	.						65.0	60.0	61.0					1																	110031671		2203	4300	6503	SO:0001583	missense	127002	exon7			CCAGCAGCACCTT	BC037582	CCDS30794.1	1p13.2	2008-02-05			ENSG00000162650	ENSG00000162650			28713	protein-coding gene	gene with protein product						12477932	Standard	NM_153340		Approved	MGC46534, FLJ00381	uc001dxr.3	Q5T6C5	OTTHUMG00000011027	ENST00000369870.3:c.986G>A	chr1.hg19:g.110031671G>A	ENSP00000358886:p.Ser329Asn	87.0	0.0	.		85.0	24.0	.	NM_153340		Missense_Mutation	SNP	ENST00000369870.3	hg19	CCDS30794.1	.	.	.	.	.	.	.	.	.	.	G	10.37	1.332103	0.24167	.	.	ENSG00000162650	ENST00000369870;ENST00000541125	T	0.32272	1.46	5.97	0.693	0.18056	.	0.533090	0.19790	N	0.106016	T	0.03011	0.0089	N	0.02011	-0.69	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.32587	-0.9901	10	0.19590	T	0.45	-1.696	5.8764	0.18832	0.2166:0.2562:0.5272:0.0	.	329	Q5T6C5	AT7L2_HUMAN	N	329	ENSP00000358886:S329N	ENSP00000358886:S329N	S	+	2	0	ATXN7L2	109833194	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	1.475000	0.35409	0.130000	0.18549	-0.136000	0.14681	AGC	.	.	.	none		0.612	ATXN7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030331.1	NM_153340	
NUP210L	91181	hgsc.bcm.edu	37	1	154099879	154099879	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr1:154099879G>A	ENST00000368559.3	-	9	1164	c.1093C>T	c.(1093-1095)Cct>Tct	p.P365S	NUP210L_ENST00000271854.3_Missense_Mutation_p.P365S	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	365					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CGGTTTCCAGGTTGGACAGTG	0.353																																					p.P365S		Atlas-SNP	.											.	NUP210L	181	.	0			c.C1093T						PASS	.						74.0	68.0	70.0					1																	154099879		1821	4086	5907	SO:0001583	missense	91181	exon9			TTCCAGGTTGGAC	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.1093C>T	chr1.hg19:g.154099879G>A	ENSP00000357547:p.Pro365Ser	106.0	0.0	.		78.0	14.0	.	NM_001159484	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	ENST00000368559.3	hg19	CCDS41399.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.584027	0.46110	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.04406	3.63;3.63	4.44	4.44	0.53790	.	0.000000	0.52532	D	0.000061	T	0.02571	0.0078	L	0.42581	1.335	0.45366	D	0.998358	B;B	0.29766	0.256;0.162	B;B	0.21917	0.037;0.023	T	0.40175	-0.9577	10	0.56958	D	0.05	-0.9036	15.0178	0.71600	0.0:0.0:1.0:0.0	.	365;365	E7EP56;Q5VU65	.;P210L_HUMAN	S	365	ENSP00000357547:P365S;ENSP00000271854:P365S	ENSP00000271854:P365S	P	-	1	0	NUP210L	152366503	1.000000	0.71417	0.933000	0.37362	0.876000	0.50452	4.820000	0.62671	2.302000	0.77476	0.313000	0.20887	CCT	.	.	.	none		0.353	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308	
KCNN3	3782	hgsc.bcm.edu	37	1	154842333	154842333	+	Silent	SNP	C	C	T			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr1:154842333C>T	ENST00000271915.4	-	1	423	c.108G>A	c.(106-108)caG>caA	p.Q36Q	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	36	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	gctgctgttgctgctgctgct	0.672																																					p.Q36Q		Atlas-SNP	.											.	KCNN3	141	.	0			c.G108A						PASS	.						8.0	8.0	8.0					1																	154842333		1967	3874	5841	SO:0001819	synonymous_variant	3782	exon1			CTGTTGCTGCTGC	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.108G>A	chr1.hg19:g.154842333C>T		104.0	0.0	.		93.0	6.0	.	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	ENST00000271915.4	hg19	CCDS30880.1																																																																																			.	.	.	none		0.672	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
F5	2153	hgsc.bcm.edu	37	1	169528453	169528453	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr1:169528453C>A	ENST00000367797.3	-	5	869	c.668G>T	c.(667-669)aGc>aTc	p.S223I	F5_ENST00000546081.1_Missense_Mutation_p.S86I|F5_ENST00000367796.3_Missense_Mutation_p.S223I	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	223	F5/8 type A 1.|Plastocyanin-like 2.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	CTGGCTCCAGCTCTTGCTTTC	0.443																																					p.S223I		Atlas-SNP	.											F5,NS,carcinoma,0,1	F5	301	.	0			c.G668T						PASS	.						172.0	135.0	147.0					1																	169528453		2203	4300	6503	SO:0001583	missense	2153	exon5			CTCCAGCTCTTGC	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.668G>T	chr1.hg19:g.169528453C>A	ENSP00000356771:p.Ser223Ile	98.0	0.0	.		77.0	30.0	.	NM_000130	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	hg19	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.651866	0.88056	.	.	ENSG00000198734	ENST00000367797;ENST00000367796;ENST00000546081	D;D;D	0.99105	-5.43;-5.43;-5.43	5.95	5.04	0.67666	Cupredoxin (2);	0.035814	0.85682	D	0.000000	D	0.99293	0.9753	M	0.89601	3.045	0.42717	D	0.993664	D	0.76494	0.999	D	0.69307	0.963	D	0.98776	1.0730	9	0.87932	D	0	-21.326	15.0853	0.72148	0.0:0.9322:0.0:0.0678	.	223	P12259	FA5_HUMAN	I	223;223;86	ENSP00000356771:S223I;ENSP00000356770:S223I;ENSP00000439664:S86I	ENSP00000356770:S223I	S	-	2	0	F5	167795077	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.733000	0.74796	1.518000	0.48934	0.650000	0.86243	AGC	.	.	.	none		0.443	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130	
LAMC1	3915	hgsc.bcm.edu	37	1	183072766	183072766	+	Splice_Site	SNP	A	A	G			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr1:183072766A>G	ENST00000258341.4	+	2	979	c.722A>G	c.(721-723)cAg>cGg	p.Q241R		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	241	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						CCTGTGCTGCAGGTAAATTCT	0.517																																					p.Q241R		Atlas-SNP	.											.	LAMC1	176	.	0			c.A722G						PASS	.						42.0	43.0	43.0					1																	183072766		2203	4300	6503	SO:0001630	splice_region_variant	3915	exon2			TGCTGCAGGTAAA	J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.723+1A>G	chr1.hg19:g.183072766A>G		99.0	0.0	.		96.0	34.0	.	NM_002293	Q5VYE7	Missense_Mutation	SNP	ENST00000258341.4	hg19	CCDS1351.1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.776337	0.90195	.	.	ENSG00000135862	ENST00000258341	T	0.78003	-1.14	5.23	5.23	0.72850	Laminin, N-terminal (3);	0.000000	0.85682	D	0.000000	D	0.86581	0.5967	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.87578	0.998;0.964	D	0.87656	0.2531	10	0.59425	D	0.04	.	15.1384	0.72590	1.0:0.0:0.0:0.0	.	241;241	P11047;Q6NVY8	LAMC1_HUMAN;.	R	241	ENSP00000258341:Q241R	ENSP00000258341:Q241R	Q	+	2	0	LAMC1	181339389	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.020000	0.93667	1.978000	0.57642	0.533000	0.62120	CAG	.	.	.	none		0.517	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2	NM_002293	Missense_Mutation
PGBD5	79605	hgsc.bcm.edu	37	1	230486768	230486768	+	Missense_Mutation	SNP	T	T	G			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr1:230486768T>G	ENST00000525115.1	-	3	646	c.623A>C	c.(622-624)aAg>aCg	p.K208T	PGBD5_ENST00000391860.1_Missense_Mutation_p.K162T|PGBD5_ENST00000321327.2_Missense_Mutation_p.K307T			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	208						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		CTTTTTCCTCTTTCGCAGCTC	0.557																																					p.K277T		Atlas-SNP	.											.	PGBD5	73	.	0			c.A830C						PASS	.						124.0	112.0	116.0					1																	230486768		2203	4300	6503	SO:0001583	missense	79605	exon3			TTCCTCTTTCGCA	AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.623A>C	chr1.hg19:g.230486768T>G	ENSP00000431404:p.Lys208Thr	72.0	0.0	.		55.0	17.0	.	NM_001258311	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Missense_Mutation	SNP	ENST00000525115.1	hg19		.	.	.	.	.	.	.	.	.	.	T	20.6	4.016450	0.75161	.	.	ENSG00000177614	ENST00000391860;ENST00000321327;ENST00000525115	T;T;T	0.18657	2.2;2.2;2.2	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.31040	0.0784	N	0.24115	0.695	0.58432	D	0.999994	D	0.69078	0.997	P	0.62560	0.904	T	0.06991	-1.0796	10	0.62326	D	0.03	-43.6433	15.9745	0.80049	0.0:0.0:0.0:1.0	.	208	Q8N414	PGBD5_HUMAN	T	162;307;208	ENSP00000375733:K162T;ENSP00000322530:K307T;ENSP00000431404:K208T	ENSP00000322530:K307T	K	-	2	0	PGBD5	228553391	1.000000	0.71417	0.998000	0.56505	0.935000	0.57460	6.086000	0.71352	2.168000	0.68352	0.533000	0.62120	AAG	.	.	.	none		0.557	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554	
ASAP2	8853	hgsc.bcm.edu	37	2	9496455	9496455	+	Silent	SNP	C	C	T			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr2:9496455C>T	ENST00000281419.3	+	14	1648	c.1308C>T	c.(1306-1308)tgC>tgT	p.C436C	ASAP2_ENST00000315273.4_Silent_p.C436C	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	436	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						ATGACGTCTGCTGTGACTGTG	0.498																																					p.C436C		Atlas-SNP	.											.	ASAP2	91	.	0			c.C1308T						PASS	.						55.0	53.0	54.0					2																	9496455		2203	4300	6503	SO:0001819	synonymous_variant	8853	exon14			CGTCTGCTGTGAC	AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.1308C>T	chr2.hg19:g.9496455C>T		111.0	0.0	.		108.0	31.0	.	NM_001135191	D6W4Y8	Silent	SNP	ENST00000281419.3	hg19	CCDS1661.1																																																																																			.	.	.	none		0.498	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1	NM_003887	
ITGB1BP1	9270	hgsc.bcm.edu	37	2	9547719	9547719	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr2:9547719C>A	ENST00000360635.3	-	7	1286	c.390G>T	c.(388-390)ttG>ttT	p.L130F	ITGB1BP1_ENST00000490426.1_5'UTR|ITGB1BP1_ENST00000355346.4_Missense_Mutation_p.L130F|ITGB1BP1_ENST00000238091.4_Intron|ITGB1BP1_ENST00000488451.1_Intron|ITGB1BP1_ENST00000359712.3_Missense_Mutation_p.L130F|ITGB1BP1_ENST00000456913.2_Missense_Mutation_p.L130F			O14713	ITBP1_HUMAN	integrin beta 1 binding protein 1	130	PID.				activation of protein kinase B activity (GO:0032148)|biomineral tissue development (GO:0031214)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|myoblast migration (GO:0051451)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of protein binding (GO:0032091)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|Notch signaling pathway (GO:0007219)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein transport (GO:0015031)|receptor clustering (GO:0043113)|regulation of blood vessel size (GO:0050880)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of integrin-mediated signaling pathway (GO:2001044)|transcription, DNA-templated (GO:0006351)|tube formation (GO:0035148)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	GDP-dissociation inhibitor activity (GO:0005092)|integrin binding (GO:0005178)|protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)			kidney(2)|large_intestine(2)|lung(2)|prostate(2)	8	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.23)		CATGCCTGTGCAAAACATCCT	0.498																																					p.L130F		Atlas-SNP	.											.	ITGB1BP1	13	.	0			c.G390T						PASS	.						97.0	84.0	88.0					2																	9547719		2203	4300	6503	SO:0001583	missense	9270	exon6			CCTGTGCAAAACA	AF012023	CCDS1662.1, CCDS1663.1	2p25.2	2008-02-05			ENSG00000119185	ENSG00000119185			23927	protein-coding gene	gene with protein product	"""integrin cytoplasmic domain-associated protein 1"", ""integrin cytoplasmic domain-associated protein 1-beta"", ""integrin cytoplasmic domain-associated protein 1-alpha"", ""bodenin"""	607153				11854171, 9281591	Standard	NM_004763		Approved	ICAP-1A, ICAP-1B, ICAP1, ICAP1A, ICAP1B, ICAP-1alpha	uc002qzj.3	O14713	OTTHUMG00000090414	ENST00000360635.3:c.390G>T	chr2.hg19:g.9547719C>A	ENSP00000353850:p.Leu130Phe	62.0	0.0	.		64.0	23.0	.	NM_004763	D6W4Y9|O14714|Q53RS0	Missense_Mutation	SNP	ENST00000360635.3	hg19	CCDS1662.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.946386	0.73672	.	.	ENSG00000119185	ENST00000360635;ENST00000355346;ENST00000359712;ENST00000456913;ENST00000492079	.	.	.	5.77	0.913	0.19354	Phosphotyrosine interaction domain (1);Pleckstrin homology-type (1);	0.062448	0.64402	D	0.000005	T	0.62332	0.2419	L	0.32530	0.975	0.58432	D	0.999997	D;P;D	0.76494	0.978;0.713;0.999	P;P;D	0.87578	0.864;0.662;0.998	T	0.60500	-0.7251	9	0.54805	T	0.06	-5.2216	11.4453	0.50120	0.0:0.6025:0.0:0.3975	.	86;130;130	B4DQY5;A8MPU2;O14713	.;.;ITBP1_HUMAN	F	130	.	ENSP00000347504:L130F	L	-	3	2	ITGB1BP1	9465170	0.992000	0.36948	0.414000	0.26521	0.936000	0.57629	0.352000	0.20113	0.167000	0.19631	0.655000	0.94253	TTG	.	.	.	none		0.498	ITGB1BP1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314623.2	NM_004763, NM_022334	
TTC32	130502	hgsc.bcm.edu	37	2	20101507	20101507	+	Silent	SNP	G	G	T	rs138752655		TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr2:20101507G>T	ENST00000333610.3	-	1	240	c.109C>A	c.(109-111)Cgg>Agg	p.R37R	RP11-79O8.1_ENST00000607190.1_lincRNA|TTC32_ENST00000402414.1_Silent_p.R37R	NM_001008237.1	NP_001008238.1	Q5I0X7	TTC32_HUMAN	tetratricopeptide repeat domain 32	37										kidney(2)|large_intestine(1)|lung(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAAGCGCACCGGCGAATGTAA	0.642																																					p.R37R		Atlas-SNP	.											.	TTC32	13	.	0			c.C109A						PASS	.						83.0	80.0	81.0					2																	20101507		2203	4300	6503	SO:0001819	synonymous_variant	130502	exon1			CGCACCGGCGAAT	BC057850	CCDS33151.1	2p24.1	2013-01-10			ENSG00000183891	ENSG00000183891		"""Tetratricopeptide (TTC) repeat domain containing"""	32954	protein-coding gene	gene with protein product							Standard	NM_001008237		Approved		uc002rdg.3	Q5I0X7	OTTHUMG00000151776	ENST00000333610.3:c.109C>A	chr2.hg19:g.20101507G>T		57.0	0.0	.		42.0	15.0	.	NM_001008237		Silent	SNP	ENST00000333610.3	hg19	CCDS33151.1																																																																																			.	G|1.000;A|0.000	.	alt		0.642	TTC32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323868.1	NM_001008237	
ALMS1	7840	hgsc.bcm.edu	37	2	73613036	73613036	+	Missense_Mutation	SNP	G	G	C	rs61156725|rs72319667|rs3074417	byFrequency	TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr2:73613036G>C	ENST00000264448.6	+	1	151	c.40G>C	c.(40-42)Gag>Cag	p.E14Q	ALMS1_ENST00000409009.1_Missense_Mutation_p.E14Q|ALMS1_ENST00000377715.1_Missense_Mutation_p.E14Q	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	14	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.E27_E28delEE(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CGAGCTggaggaggaggagga	0.692																																					p.E14Q		Atlas-SNP	.											.	ALMS1	384	.	1	Deletion - In frame(1)	ovary(1)	c.G40C						PASS	.						3.0	4.0	4.0					2																	73613036		1509	3234	4743	SO:0001583	missense	7840	exon1			CTGGAGGAGGAGG	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.40G>C	chr2.hg19:g.73613036G>C	ENSP00000264448:p.Glu14Gln	203.0	0.0	.		243.0	12.0	.	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	hg19	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.731519	0.48939	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.26373	2.4;2.61;1.74	3.19	3.19	0.36642	.	0.259523	0.20097	U	0.099311	T	0.32436	0.0829	N	0.19112	0.55	0.22317	N	0.999202	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.03493	-1.1031	10	0.87932	D	0	.	10.1262	0.42652	0.0:0.0:1.0:0.0	.	14;14	B8ZZJ3;Q8TCU4	.;ALMS1_HUMAN	Q	14	ENSP00000386627:E14Q;ENSP00000264448:E14Q;ENSP00000366944:E14Q	ENSP00000264448:E14Q	E	+	1	0	ALMS1	73466544	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	2.034000	0.41145	2.070000	0.61991	0.484000	0.47621	GAG	.	.	.	none		0.692	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
ALMS1	7840	hgsc.bcm.edu	37	2	73613065	73613065	+	Silent	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr2:73613065G>A	ENST00000264448.6	+	1	180	c.69G>A	c.(67-69)gaG>gaA	p.E23E	ALMS1_ENST00000409009.1_Silent_p.E23E|ALMS1_ENST00000377715.1_Silent_p.E23E	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	23	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						aggaggaggaggaggaagagg	0.687																																					p.E23E		Atlas-SNP	.											.	ALMS1	384	.	0			c.G69A						PASS	.						6.0	9.0	8.0					2																	73613065		1849	3831	5680	SO:0001819	synonymous_variant	7840	exon1			GGAGGAGGAGGAA	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.69G>A	chr2.hg19:g.73613065G>A		527.0	0.0	.		525.0	43.0	.	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	ENST00000264448.6	hg19	CCDS42697.1																																																																																			.	.	.	none		0.687	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
SEMA4F	10505	hgsc.bcm.edu	37	2	74902678	74902678	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr2:74902678C>T	ENST00000357877.2	+	11	1548	c.1399C>T	c.(1399-1401)Cgg>Tgg	p.R467W	SEMA4F_ENST00000473350.1_3'UTR|SEMA4F_ENST00000339773.5_Missense_Mutation_p.R312W	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	467	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)			biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						CCGAGCAGTGCGGATCGGAGC	0.483																																					p.R467W		Atlas-SNP	.											.	SEMA4F	89	.	0			c.C1399T						PASS	.						121.0	114.0	116.0					2																	74902678		2203	4300	6503	SO:0001583	missense	10505	exon11			GCAGTGCGGATCG	AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.1399C>T	chr2.hg19:g.74902678C>T	ENSP00000350547:p.Arg467Trp	108.0	0.0	.		98.0	24.0	.	NM_004263	Q542Y7|Q9NS35	Missense_Mutation	SNP	ENST00000357877.2	hg19	CCDS1955.1	.	.	.	.	.	.	.	.	.	.	C	13.70	2.315378	0.40996	.	.	ENSG00000135622	ENST00000357877;ENST00000339773	T;T	0.11169	2.8;2.8	4.5	3.62	0.41486	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.422729	0.21018	N	0.081569	T	0.17238	0.0414	L	0.42245	1.32	0.28984	N	0.888469	D;P	0.65815	0.995;0.932	P;P	0.54924	0.764;0.625	T	0.02042	-1.1224	10	0.66056	D	0.02	.	10.0793	0.42379	0.0:0.9018:0.0:0.0982	.	312;467	O95754-2;O95754	.;SEM4F_HUMAN	W	467;312	ENSP00000350547:R467W;ENSP00000342675:R312W	ENSP00000342675:R312W	R	+	1	2	SEMA4F	74756186	0.001000	0.12720	0.818000	0.32626	0.290000	0.27261	0.047000	0.14056	1.116000	0.41820	0.467000	0.42956	CGG	.	.	.	none		0.483	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252214.2	NM_004263	
SLC20A1	6574	hgsc.bcm.edu	37	2	113405235	113405235	+	Missense_Mutation	SNP	T	T	G			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr2:113405235T>G	ENST00000272542.3	+	4	1020	c.481T>G	c.(481-483)Tct>Gct	p.S161A	AC079922.3_ENST00000457336.1_lincRNA	NM_005415.4	NP_005406.3	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate transporter), member 1	161					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	high-affinity inorganic phosphate:sodium symporter activity (GO:0005316)|inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|sodium:phosphate symporter activity (GO:0005436)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|skin(1)|urinary_tract(3)	28						TCCAGTGATGTCTTGGTTCGT	0.363																																					p.S161A		Atlas-SNP	.											.	SLC20A1	59	.	0			c.T481G						PASS	.						210.0	211.0	211.0					2																	113405235		2203	4300	6503	SO:0001583	missense	6574	exon4			GTGATGTCTTGGT		CCDS2099.1	2q13	2013-05-22			ENSG00000144136	ENSG00000144136		"""Solute carriers"""	10946	protein-coding gene	gene with protein product	"""gibbon ape leukemia virus receptor 1"""	137570		GLVR1		8041748	Standard	NM_005415		Approved	PiT-1, Glvr-1	uc002tib.3	Q8WUM9	OTTHUMG00000131317	ENST00000272542.3:c.481T>G	chr2.hg19:g.113405235T>G	ENSP00000272542:p.Ser161Ala	125.0	0.0	.		95.0	31.0	.	NM_005415	Q08344|Q6DHX8|Q9UQ82	Missense_Mutation	SNP	ENST00000272542.3	hg19	CCDS2099.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	28.9|28.9	4.959704|4.959704	0.92791|0.92791	.|.	.|.	ENSG00000144136|ENSG00000144136	ENST00000423633|ENST00000272542	.|D	.|0.91521	.|-2.86	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93458|0.93458	0.7913|0.7913	L|L	0.58925|0.58925	1.835|1.835	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.79784	.|0.993	D|D	0.92321|0.92321	0.5866|0.5866	5|10	.|0.32370	.|T	.|0.25	-11.006|-11.006	13.4819|13.4819	0.61340|0.61340	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|161	.|Q8WUM9	.|S20A1_HUMAN	W|A	8|161	.|ENSP00000272542:S161A	.|ENSP00000272542:S161A	C|S	+|+	3|1	2|0	SLC20A1|SLC20A1	113121706|113121706	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	8.036000|8.036000	0.88901|0.88901	2.067000|2.067000	0.61834|0.61834	0.533000|0.533000	0.62120|0.62120	TGT|TCT	.	.	.	none		0.363	SLC20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254086.2	NM_005415	
INHBB	3625	hgsc.bcm.edu	37	2	121107030	121107030	+	Silent	SNP	C	C	G	rs201383879		TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr2:121107030C>G	ENST00000295228.3	+	2	850	c.804C>G	c.(802-804)ggC>ggG	p.G268G		NM_002193.2	NP_002184.2	P09529	INHBB_HUMAN	inhibin, beta B	268					activin receptor signaling pathway (GO:0032924)|cell differentiation (GO:0030154)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|cellular response to starvation (GO:0009267)|defense response (GO:0006952)|fat cell differentiation (GO:0045444)|growth (GO:0040007)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of hepatocyte growth factor biosynthetic process (GO:0048178)|negative regulation of insulin secretion (GO:0046676)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|response to mechanical stimulus (GO:0009612)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	cytokine activity (GO:0005125)|hormone activity (GO:0005179)|host cell surface receptor binding (GO:0046789)|protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(4)|pancreas(2)|skin(2)	15		Prostate(154;0.122)				TGGACCCAGGCGAAGAGTCGC	0.672																																					p.G268G		Atlas-SNP	.											.	INHBB	29	.	0			c.C804G						PASS	.						59.0	63.0	62.0					2																	121107030		2203	4299	6502	SO:0001819	synonymous_variant	3625	exon2			CCCAGGCGAAGAG		CCDS2132.1	2q14.2	2014-01-30	2007-07-30		ENSG00000163083	ENSG00000163083		"""Endogenous ligands"""	6067	protein-coding gene	gene with protein product		147390	"""inhibin, beta B (activin AB beta polypeptide)"""			3345731	Standard	NM_002193		Approved		uc002tmn.2	P09529	OTTHUMG00000131437	ENST00000295228.3:c.804C>G	chr2.hg19:g.121107030C>G		152.0	0.0	.		143.0	38.0	.	NM_002193	Q53T31|Q8N1D3	Silent	SNP	ENST00000295228.3	hg19	CCDS2132.1																																																																																			.	C|1.000;T|0.000	.	alt		0.672	INHBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254234.1		
ANKAR	150709	hgsc.bcm.edu	37	2	190557049	190557049	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr2:190557049T>C	ENST00000520309.1	+	4	1196	c.1108T>C	c.(1108-1110)Ttt>Ctt	p.F370L	ANKAR_ENST00000313581.4_Missense_Mutation_p.F370L|ANKAR_ENST00000438402.2_Missense_Mutation_p.F370L|ANKAR_ENST00000431575.2_Missense_Mutation_p.F299L|ANKAR_ENST00000461516.1_Intron|ANKAR_ENST00000281412.6_Missense_Mutation_p.F134L	NM_144708.3	NP_653309.3	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	370						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(16)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(2)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			ATGCCAGAATTTTCACTACAA	0.318																																					p.F370L		Atlas-SNP	.											.	ANKAR	184	.	0			c.T1108C						PASS	.						66.0	70.0	69.0					2																	190557049		2203	4299	6502	SO:0001583	missense	150709	exon4			CAGAATTTTCACT	AJ549812	CCDS33351.1, CCDS33351.2	2q32.2	2013-02-14			ENSG00000151687	ENSG00000151687		"""Ankyrin repeat domain containing"", ""Armadillo repeat containing"""	26350	protein-coding gene	gene with protein product		609803				15110750	Standard	NM_144708		Approved	FLJ25415	uc002uqw.2	Q7Z5J8	OTTHUMG00000154398	ENST00000520309.1:c.1108T>C	chr2.hg19:g.190557049T>C	ENSP00000427882:p.Phe370Leu	206.0	0.0	.		206.0	48.0	.	NM_144708	Q3ZCS6|Q4G0M2|Q6ZU02	Missense_Mutation	SNP	ENST00000520309.1	hg19	CCDS33351.2	.	.	.	.	.	.	.	.	.	.	T	30	5.054111	0.93793	.	.	ENSG00000151687	ENST00000520309;ENST00000313581;ENST00000438402;ENST00000431575;ENST00000281412	T;T;T;T;T	0.61040	0.19;0.19;0.14;0.19;0.14	5.65	5.65	0.86999	.	0.266234	0.27016	N	0.021353	T	0.73814	0.3635	M	0.65498	2.005	0.46823	D	0.999216	D	0.69078	0.997	D	0.75020	0.985	T	0.76578	-0.2908	10	0.72032	D	0.01	-2.0555	14.8681	0.70434	0.0:0.0:0.0:1.0	.	370	Q7Z5J8	ANKAR_HUMAN	L	370;370;370;299;134	ENSP00000427882:F370L;ENSP00000313513:F370L;ENSP00000397243:F370L;ENSP00000393043:F299L;ENSP00000281412:F134L	ENSP00000281412:F134L	F	+	1	0	ANKAR	190265294	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	5.531000	0.67148	2.150000	0.67090	0.455000	0.32223	TTT	.	.	.	none		0.318	ANKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335045.3	NM_144708	
FASTKD2	22868	hgsc.bcm.edu	37	2	207631966	207631966	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr2:207631966C>A	ENST00000236980.6	+	2	897	c.549C>A	c.(547-549)aaC>aaA	p.N183K	FASTKD2_ENST00000402774.3_Missense_Mutation_p.N183K|MDH1B_ENST00000392214.2_5'Flank|MDH1B_ENST00000374412.3_5'Flank|FASTKD2_ENST00000403094.3_Missense_Mutation_p.N183K|MDH1B_ENST00000449792.1_5'Flank|MDH1B_ENST00000454776.2_5'Flank	NM_014929.3	NP_055744.2	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	183					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(2)	21				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)		CTAGTAGCAACTATTTCACAG	0.418																																					p.N183K		Atlas-SNP	.											.	FASTKD2	49	.	0			c.C549A						PASS	.						121.0	119.0	120.0					2																	207631966		2203	4300	6503	SO:0001583	missense	22868	exon2			TAGCAACTATTTC	BC001544	CCDS2371.1	2q33.3	2008-02-05	2006-07-07	2006-07-07	ENSG00000118246	ENSG00000118246			29160	protein-coding gene	gene with protein product		612322	"""KIAA0971"""	KIAA0971			Standard	NM_014929		Approved		uc002vbx.3	Q9NYY8	OTTHUMG00000132917	ENST00000236980.6:c.549C>A	chr2.hg19:g.207631966C>A	ENSP00000236980:p.Asn183Lys	103.0	0.0	.		68.0	23.0	.	NM_001136193	Q9NVX6|Q9Y2H7	Missense_Mutation	SNP	ENST00000236980.6	hg19	CCDS2371.1	.	.	.	.	.	.	.	.	.	.	C	13.90	2.374586	0.42105	.	.	ENSG00000118246	ENST00000236980;ENST00000402774;ENST00000403094	T;T;T	0.15603	2.41;2.41;2.41	5.31	1.09	0.20402	.	0.195508	0.41823	N	0.000814	T	0.16128	0.0388	L	0.52573	1.65	0.44234	D	0.997071	B;B	0.25667	0.084;0.131	B;B	0.28916	0.037;0.096	T	0.06180	-1.0841	10	0.42905	T	0.14	-19.5825	10.2914	0.43599	0.2493:0.5094:0.2413:0.0	.	183;183	Q9NYY8-2;Q9NYY8	.;FAKD2_HUMAN	K	183	ENSP00000236980:N183K;ENSP00000385990:N183K;ENSP00000384929:N183K	ENSP00000236980:N183K	N	+	3	2	FASTKD2	207340211	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	1.884000	0.39668	0.194000	0.20326	0.561000	0.74099	AAC	.	.	.	none		0.418	FASTKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256428.2	NM_014929	
ATG9A	79065	hgsc.bcm.edu	37	2	220090237	220090237	+	Silent	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr2:220090237G>A	ENST00000409618.1	-	6	709	c.270C>T	c.(268-270)gaC>gaT	p.D90D	ATG9A_ENST00000361242.4_Silent_p.D90D|ATG9A_ENST00000488833.1_5'Flank|ATG9A_ENST00000409422.1_Silent_p.D29D|ATG9A_ENST00000396761.2_Silent_p.D90D|AC068946.1_ENST00000408417.1_RNA			Q7Z3C6	ATG9A_HUMAN	autophagy related 9A	90					autophagic vacuole assembly (GO:0000045)|late nucleophagy (GO:0044805)|mitochondrion degradation (GO:0000422)|piecemeal microautophagy of nucleus (GO:0034727)|protein localization to pre-autophagosomal structure (GO:0034497)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)				endometrium(2)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(1)	13		Renal(207;0.0474)		Epithelial(149;1.37e-06)|all cancers(144;0.000222)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAAATAGGATGTCATAGTCCA	0.532																																					p.D90D		Atlas-SNP	.											.	ATG9A	50	.	0			c.C270T						PASS	.						109.0	114.0	113.0					2																	220090237		2067	4222	6289	SO:0001819	synonymous_variant	79065	exon6			TAGGATGTCATAG	AK021732	CCDS42820.1	2q35	2014-02-12	2012-06-06	2005-09-11	ENSG00000198925	ENSG00000198925			22408	protein-coding gene	gene with protein product		612204	"""APG9 autophagy 9-like 1 (S. cerevisiae)"", ""ATG9 autophagy related 9 homolog A (S. cerevisiae)"""	APG9L1			Standard	NM_024085		Approved	FLJ22169	uc002vkf.1	Q7Z3C6	OTTHUMG00000154557	ENST00000409618.1:c.270C>T	chr2.hg19:g.220090237G>A		143.0	0.0	.		133.0	38.0	.	NM_001077198	Q3ZAQ6|Q6P0N7|Q7Z317|Q7Z320|Q8NDK6|Q8WU65|Q9BVL5|Q9H6L1|Q9HAG7	Silent	SNP	ENST00000409618.1	hg19	CCDS42820.1																																																																																			.	.	.	none		0.532	ATG9A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335930.1	NM_024085	
CHRND	1144	hgsc.bcm.edu	37	2	233394851	233394851	+	Splice_Site	SNP	T	T	C			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr2:233394851T>C	ENST00000258385.3	+	7	852		c.e7+2		CHRND_ENST00000536614.1_Splice_Site|CHRND_ENST00000543200.1_Splice_Site|CHRND_ENST00000457943.2_Intron	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	CGGCTGACAGTGAGCCTCCAG	0.647																																					.		Atlas-SNP	.											.	CHRND	67	.	0			c.775+2T>C	GRCh37	CD012239	CHRND	D		PASS	.						125.0	106.0	112.0					2																	233394851		2203	4300	6503	SO:0001630	splice_region_variant	1144	exon6			TGACAGTGAGCCT	X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.820+2T>C	chr2.hg19:g.233394851T>C		55.0	0.0	.		38.0	8.0	.	NM_001256657	A8K661|B4DT92|Q52LH4	Splice_Site	SNP	ENST00000258385.3	hg19	CCDS2494.1	.	.	.	.	.	.	.	.	.	.	T	18.45	3.625679	0.66901	.	.	ENSG00000135902	ENST00000543200;ENST00000258385	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3496	0.74373	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	CHRND	233103095	1.000000	0.71417	1.000000	0.80357	0.700000	0.40528	7.896000	0.87350	2.105000	0.64084	0.533000	0.62120	.	.	.	.	none		0.647	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257038.2		Intron
TOP2B	7155	hgsc.bcm.edu	37	3	25675377	25675377	+	Silent	SNP	T	T	C			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr3:25675377T>C	ENST00000264331.4	-	8	980	c.981A>G	c.(979-981)aaA>aaG	p.K327K	TOP2B_ENST00000435706.2_Silent_p.K322K	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	327					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	GCTGGAATCCTTTTTCACTCA	0.348																																					p.K322K		Atlas-SNP	.											TOP2B,right_upper_lobe,carcinoma,0,1	TOP2B	98	.	0			c.A966G						PASS	.						162.0	156.0	158.0					3																	25675377		1848	4087	5935	SO:0001819	synonymous_variant	7155	exon8			GAATCCTTTTTCA	X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.981A>G	chr3.hg19:g.25675377T>C		77.0	0.0	.		74.0	3.0	.	NM_001068	Q13600|Q9UMG8|Q9UQP8	Silent	SNP	ENST00000264331.4	hg19																																																																																				.	.	.	none		0.348	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
FYCO1	79443	hgsc.bcm.edu	37	3	45972569	45972569	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr3:45972569C>G	ENST00000296137.2	-	16	4450	c.4245G>C	c.(4243-4245)caG>caC	p.Q1415H	FYCO1_ENST00000438446.1_Missense_Mutation_p.Q86H|FYCO1_ENST00000535325.1_Missense_Mutation_p.Q1435H	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	1415	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		TTACCTTACACTGATCCAGCG	0.592																																					p.Q1415H		Atlas-SNP	.											.	FYCO1	115	.	0			c.G4245C						PASS	.						73.0	59.0	64.0					3																	45972569		2203	4300	6503	SO:0001583	missense	79443	exon16			CTTACACTGATCC	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.4245G>C	chr3.hg19:g.45972569C>G	ENSP00000296137:p.Gln1415His	147.0	0.0	.		127.0	48.0	.	NM_024513	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	ENST00000296137.2	hg19	CCDS2734.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.61|13.61	2.289406|2.289406	0.40494|0.40494	.|.	.|.	ENSG00000163820|ENSG00000163820	ENST00000296137;ENST00000438446;ENST00000535325|ENST00000433878	T;T;T|.	0.43688|.	0.94;0.94;0.94|.	5.1|5.1	3.28|3.28	0.37604|0.37604	GOLD (2);|.	0.130764|.	0.52532|.	D|.	0.000067|.	T|T	0.50616|0.50616	0.1626|0.1626	L|L	0.37630|0.37630	1.12|1.12	0.43512|0.43512	D|D	0.995777|0.995777	P;B|.	0.35033|.	0.481;0.005|.	B;B|.	0.41135|.	0.348;0.017|.	T|T	0.40327|0.40327	-0.9569|-0.9569	10|5	0.44086|.	T|.	0.13|.	-24.5306|-24.5306	8.1734|8.1734	0.31268|0.31268	0.0:0.7558:0.0:0.2442|0.0:0.7558:0.0:0.2442	.|.	1435;1415|.	B7ZKT7;Q9BQS8|.	.;FYCO1_HUMAN|.	H|T	1415;86;1435|204	ENSP00000296137:Q1415H;ENSP00000398517:Q86H;ENSP00000441178:Q1435H|.	ENSP00000296137:Q1415H|.	Q|S	-|-	3|2	2|0	FYCO1|FYCO1	45947573|45947573	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.702000|0.702000	0.40608|0.40608	1.765000|1.765000	0.38481|0.38481	1.142000|1.142000	0.42291|0.42291	0.655000|0.655000	0.94253|0.94253	CAG|AGT	.	.	.	none		0.592	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513	
SMARCC1	6599	hgsc.bcm.edu	37	3	47680268	47680268	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr3:47680268C>T	ENST00000254480.5	-	22	2442	c.2323G>A	c.(2323-2325)Gga>Aga	p.G775R	SMARCC1_ENST00000425518.1_5'UTR	NM_003074.3	NP_003065.3	Q92922	SMRC1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	775	Glu-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		TCTTCAGCTCCTTCTACAAGT	0.393																																					p.G775R		Atlas-SNP	.											.	SMARCC1	85	.	0			c.G2323A						PASS	.						123.0	122.0	122.0					3																	47680268		2203	4300	6503	SO:0001583	missense	6599	exon22			CAGCTCCTTCTAC	U66615	CCDS2758.1	3p21.31	2008-05-15			ENSG00000173473	ENSG00000173473			11104	protein-coding gene	gene with protein product		601732				8804307	Standard	NM_003074		Approved	BAF155, SRG3, Rsc8, CRACC1	uc003crq.2	Q92922	OTTHUMG00000133519	ENST00000254480.5:c.2323G>A	chr3.hg19:g.47680268C>T	ENSP00000254480:p.Gly775Arg	128.0	0.0	.		97.0	26.0	.	NM_003074	Q17RS0|Q6P172|Q8IWH2	Missense_Mutation	SNP	ENST00000254480.5	hg19	CCDS2758.1	.	.	.	.	.	.	.	.	.	.	C	18.14	3.556937	0.65425	.	.	ENSG00000173473	ENST00000254480	T	0.37915	1.17	5.16	5.16	0.70880	.	0.346611	0.29987	N	0.010684	T	0.32010	0.0815	L	0.40543	1.245	0.53005	D	0.999965	B	0.30763	0.294	B	0.27262	0.078	T	0.13926	-1.0491	10	0.59425	D	0.04	-10.0611	15.7325	0.77817	0.0:1.0:0.0:0.0	.	775	Q92922	SMRC1_HUMAN	R	775	ENSP00000254480:G775R	ENSP00000254480:G775R	G	-	1	0	SMARCC1	47655272	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	4.646000	0.61411	2.564000	0.86499	0.655000	0.94253	GGA	.	.	.	none		0.393	SMARCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257491.1		
CDC25A	993	hgsc.bcm.edu	37	3	48200920	48200920	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr3:48200920G>A	ENST00000302506.3	-	14	1756	c.1348C>T	c.(1348-1350)Cgc>Tgc	p.R450C	CDC25A_ENST00000351231.3_Missense_Mutation_p.R410C	NM_001789.2	NP_001780.2	P30304	MPIP1_HUMAN	cell division cycle 25A	450	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cell proliferation (GO:0008283)|cellular response to UV (GO:0034644)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to radiation (GO:0009314)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.000685)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		TTACCCAGGCGATCTCTCTCT	0.512																																					p.R450C		Atlas-SNP	.											.	CDC25A	40	.	0			c.C1348T						PASS	.						106.0	90.0	96.0					3																	48200920		2203	4300	6503	SO:0001583	missense	993	exon14			CCAGGCGATCTCT	M81933	CCDS2760.1, CCDS2761.1	3p21	2013-01-17	2013-01-17		ENSG00000164045	ENSG00000164045		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1725	protein-coding gene	gene with protein product		116947	"""cell division cycle 25A"", ""cell division cycle 25 homolog A (S. cerevisiae)"", ""cell division cycle 25 homolog A (S. pombe)"""			1836978	Standard	NM_001789		Approved		uc003csh.1	P30304	OTTHUMG00000133535	ENST00000302506.3:c.1348C>T	chr3.hg19:g.48200920G>A	ENSP00000303706:p.Arg450Cys	92.0	0.0	.		67.0	21.0	.	NM_001789	Q8IZH5|Q96IL3|Q9H2F2	Missense_Mutation	SNP	ENST00000302506.3	hg19	CCDS2760.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.344385	0.82022	.	.	ENSG00000164045	ENST00000302506;ENST00000351231	T;T	0.25749	1.78;1.78	5.76	4.86	0.63082	Rhodanese-like (5);	0.000000	0.85682	D	0.000000	T	0.65502	0.2697	H	0.97291	3.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.78298	-0.2258	10	0.87932	D	0	.	13.531	0.61621	0.0:0.0:0.8379:0.1621	.	410;450	P30304-2;P30304	.;MPIP1_HUMAN	C	450;410	ENSP00000303706:R450C;ENSP00000343166:R410C	ENSP00000303706:R450C	R	-	1	0	CDC25A	48175924	1.000000	0.71417	0.930000	0.37139	0.702000	0.40608	3.997000	0.57016	1.369000	0.46134	0.655000	0.94253	CGC	.	.	.	none		0.512	CDC25A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257512.2	NM_001789	
PLXNB1	5364	hgsc.bcm.edu	37	3	48465669	48465669	+	Missense_Mutation	SNP	C	C	A	rs368626600		TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr3:48465669C>A	ENST00000358536.4	-	3	621	c.352G>T	c.(352-354)Gtc>Ttc	p.V118F	PLXNB1_ENST00000358459.4_Missense_Mutation_p.V118F|PLXNB1_ENST00000448774.2_Intron|PLXNB1_ENST00000456774.1_Missense_Mutation_p.V118F|PLXNB1_ENST00000296440.6_Missense_Mutation_p.V118F	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	118	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TGTTCACAGACCCCCTGGTGC	0.667																																					p.V118F		Atlas-SNP	.											.	PLXNB1	150	.	0			c.G352T						PASS	.						17.0	20.0	19.0					3																	48465669		2199	4294	6493	SO:0001583	missense	5364	exon3			CACAGACCCCCTG	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.352G>T	chr3.hg19:g.48465669C>A	ENSP00000351338:p.Val118Phe	123.0	0.0	.		106.0	40.0	.	NM_001130082	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Missense_Mutation	SNP	ENST00000358536.4	hg19	CCDS2765.1	.	.	.	.	.	.	.	.	.	.	C	14.58	2.577137	0.45902	.	.	ENSG00000164050	ENST00000296440;ENST00000358459;ENST00000358536;ENST00000456774	T;T;T;T	0.04862	3.54;3.54;3.54;3.54	4.14	2.3	0.28687	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.184288	0.36338	N	0.002654	T	0.08670	0.0215	L	0.29908	0.895	0.80722	D	1	D;P	0.56521	0.976;0.953	P;P	0.56514	0.563;0.8	T	0.32534	-0.9903	10	0.38643	T	0.18	.	6.0703	0.19885	0.0:0.5327:0.0:0.4673	.	118;118	O43157;O43157-2	PLXB1_HUMAN;.	F	118	ENSP00000296440:V118F;ENSP00000351242:V118F;ENSP00000351338:V118F;ENSP00000414199:V118F	ENSP00000296440:V118F	V	-	1	0	PLXNB1	48440673	0.980000	0.34600	0.607000	0.28956	0.655000	0.38815	2.140000	0.42159	0.216000	0.20781	-0.136000	0.14681	GTC	.	.	.	weak		0.667	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1	NM_002673	
COL7A1	1294	hgsc.bcm.edu	37	3	48619024	48619024	+	Silent	SNP	C	C	T			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr3:48619024C>T	ENST00000328333.8	-	49	4871	c.4764G>A	c.(4762-4764)aaG>aaA	p.K1588K	MIR711_ENST00000390201.1_RNA|COL7A1_ENST00000454817.1_Silent_p.K1588K	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	1588	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CAGGGTCTCCCTTGGGGCCAG	0.587																																					p.K1588K		Atlas-SNP	.											.	COL7A1	320	.	0			c.G4764A						PASS	.						103.0	107.0	106.0					3																	48619024		2203	4300	6503	SO:0001819	synonymous_variant	1294	exon49			GTCTCCCTTGGGG	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.4764G>A	chr3.hg19:g.48619024C>T		96.0	0.0	.		90.0	15.0	.	NM_000094	Q14054|Q16507	Silent	SNP	ENST00000328333.8	hg19	CCDS2773.1																																																																																			.	.	.	none		0.587	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
QRICH1	54870	hgsc.bcm.edu	37	3	49064477	49064477	+	IGR	SNP	T	T	C			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr3:49064477T>C	ENST00000395443.2	-	0	3549				RP13-131K19.6_ENST00000607245.1_RNA|IMPDH2_ENST00000326739.4_Missense_Mutation_p.M179V	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1							nucleus (GO:0005634)				breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CTCTTTGTCATTATCTACGTG	0.507																																					p.M179V		Atlas-SNP	.											.	IMPDH2	47	.	0			c.A535G						PASS	.						159.0	146.0	150.0					3																	49064477		2203	4300	6503	SO:0001628	intergenic_variant	3615	exon6			TTGTCATTATCTA		CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772		chr3.hg19:g.49064477T>C		58.0	0.0	.		65.0	15.0	.	NM_000884	Q4G0F7|Q7L621|Q8TEA5	Missense_Mutation	SNP	ENST00000395443.2	hg19	CCDS2787.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.1|20.1	3.937086|3.937086	0.73557|0.73557	.|.	.|.	ENSG00000178035|ENSG00000178035	ENST00000537036;ENST00000326739;ENST00000442157|ENST00000429182	D;D|.	0.96136|.	-3.92;-3.92|.	6.08|6.08	6.08|6.08	0.98989|0.98989	Aldolase-type TIM barrel (1);Cystathionine beta-synthase, core (2);IMP dehydrogenase/GMP reductase (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88987|0.88987	0.6587|0.6587	H|H	0.97918|0.97918	4.105|4.105	0.80722|0.80722	D|D	1|1	D|.	0.71674|.	0.998|.	D|.	0.91635|.	0.999|.	D|D	0.92898|0.92898	0.6337|0.6337	10|5	0.87932|.	D|.	0|.	-37.003|-37.003	16.6438|16.6438	0.85155|0.85155	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	179|.	P12268|.	IMDH2_HUMAN|.	V|S	179;179;154|110	ENSP00000321584:M179V;ENSP00000403502:M154V|.	ENSP00000321584:M179V|.	M|N	-|-	1|2	0|0	IMPDH2|IMPDH2	49039481|49039481	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.919000|0.919000	0.55068|0.55068	5.943000|5.943000	0.70211|0.70211	2.333000|2.333000	0.79357|0.79357	0.533000|0.533000	0.62120|0.62120	ATG|AAT	.	.	.	none		0.507	QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345669.1	NM_017730	
RNF123	63891	hgsc.bcm.edu	37	3	49734840	49734840	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr3:49734840C>A	ENST00000327697.6	+	5	436	c.292C>A	c.(292-294)Cac>Aac	p.H98N	RNF123_ENST00000432042.1_5'UTR	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	98	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		GGTCCTGGACCACACAGGCGG	0.602																																					p.H98N		Atlas-SNP	.											.	RNF123	100	.	0			c.C292A						PASS	.						53.0	53.0	53.0					3																	49734840		2203	4300	6503	SO:0001583	missense	63891	exon5			CTGGACCACACAG	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.292C>A	chr3.hg19:g.49734840C>A	ENSP00000328287:p.His98Asn	90.0	0.0	.		63.0	18.0	.	NM_022064	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	hg19	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	C	33	5.209517	0.95069	.	.	ENSG00000164068	ENST00000327697;ENST00000389066	T	0.72942	-0.7	6.17	6.17	0.99709	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.144593	0.47852	D	0.000201	T	0.80019	0.4547	L	0.40543	1.245	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	T	0.78404	-0.2217	10	0.52906	T	0.07	-39.2141	19.8676	0.96824	0.0:1.0:0.0:0.0	.	98	Q5XPI4	RN123_HUMAN	N	98	ENSP00000328287:H98N	ENSP00000328287:H98N	H	+	1	0	RNF123	49709844	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.621000	0.67743	2.941000	0.99782	0.655000	0.94253	CAC	.	.	.	none		0.602	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
FXR1	8087	hgsc.bcm.edu	37	3	180688019	180688019	+	Silent	SNP	T	T	C			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr3:180688019T>C	ENST00000357559.4	+	15	1860	c.1476T>C	c.(1474-1476)gaT>gaC	p.D492D	FXR1_ENST00000305586.7_Silent_p.D407D|FXR1_ENST00000491062.1_Silent_p.D443D|FXR1_ENST00000445140.2_Silent_p.D492D|FXR1_ENST00000480918.1_Silent_p.D479D|FXR1_ENST00000468861.1_Silent_p.D407D	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	492					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			CAGACACTGATGCCAGCGAAT	0.433																																					p.D492D		Atlas-SNP	.											.	FXR1	75	.	0			c.T1476C						PASS	.						135.0	117.0	123.0					3																	180688019		2203	4300	6503	SO:0001819	synonymous_variant	8087	exon15			CACTGATGCCAGC	M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.1476T>C	chr3.hg19:g.180688019T>C		146.0	0.0	.		138.0	36.0	.	NM_001013438	A8K9B8|Q7Z450|Q8N6R8	Silent	SNP	ENST00000357559.4	hg19	CCDS3238.1	.	.	.	.	.	.	.	.	.	.	T	10.53	1.376178	0.24857	.	.	ENSG00000114416	ENST00000482125	.	.	.	5.91	0.686	0.18015	.	.	.	.	.	T	0.58293	0.2112	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52283	-0.8596	4	.	.	.	-18.2892	10.2884	0.43581	0.0:0.3977:0.0:0.6023	.	.	.	.	T	93	.	.	M	+	2	0	FXR1	182170713	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.600000	0.24104	0.091000	0.17302	0.528000	0.53228	ATG	.	.	.	none		0.433	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350265.5		
IGF2BP2	10644	hgsc.bcm.edu	37	3	185364916	185364916	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr3:185364916A>G	ENST00000382199.2	-	15	1699	c.1604T>C	c.(1603-1605)cTg>cCg	p.L535P	IGF2BP2_ENST00000457616.2_Missense_Mutation_p.L541P|IGF2BP2_ENST00000494906.1_5'Flank|IGF2BP2_ENST00000421047.2_Missense_Mutation_p.L478P|IGF2BP2_ENST00000346192.3_Missense_Mutation_p.L492P	NM_006548.4	NP_006539.3	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding protein 2	535	KH 4. {ECO:0000255|PROSITE- ProRule:PRU00117}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	20	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			TAAGTTCTGCAGTTCGTTCAC	0.542																																					p.L535P		Atlas-SNP	.											.	IGF2BP2	69	.	0			c.T1604C						PASS	.						174.0	149.0	157.0					3																	185364916		2203	4300	6503	SO:0001583	missense	10644	exon15			TTCTGCAGTTCGT	BC021290	CCDS3273.2, CCDS33903.1	3q27.2	2013-02-12			ENSG00000073792	ENSG00000073792		"""RNA binding motif (RRM) containing"""	28867	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 2"""	608289				10190901, 9891060	Standard	NM_001007225		Approved	IMP-2	uc003fpo.3	Q9Y6M1	OTTHUMG00000074025	ENST00000382199.2:c.1604T>C	chr3.hg19:g.185364916A>G	ENSP00000371634:p.Leu535Pro	56.0	0.0	.		49.0	9.0	.	NM_006548	A0A4Z0|B3FTN2|B3FTN3|B3FTN4	Missense_Mutation	SNP	ENST00000382199.2	hg19	CCDS3273.2	.	.	.	.	.	.	.	.	.	.	A	22.9	4.352874	0.82132	.	.	ENSG00000073792	ENST00000382199;ENST00000421047;ENST00000457616;ENST00000346192	T;T;T;T	0.38240	1.15;1.15;1.15;1.15	5.02	5.02	0.67125	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.075107	0.56097	D	0.000032	T	0.66446	0.2790	M	0.90759	3.145	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	T	0.74705	-0.3575	10	0.87932	D	0	-8.7264	14.0216	0.64558	1.0:0.0:0.0:0.0	.	429;472;478;541;492;535	Q9Y6M1-5;Q9Y6M1-3;Q9Y6M1-4;F8W930;Q9Y6M1-1;Q9Y6M1	.;.;.;.;.;IF2B2_HUMAN	P	535;478;541;492	ENSP00000371634:L535P;ENSP00000413787:L478P;ENSP00000410242:L541P;ENSP00000320204:L492P	ENSP00000320204:L492P	L	-	2	0	IGF2BP2	186847610	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	9.339000	0.96797	2.022000	0.59522	0.454000	0.30748	CTG	.	.	.	none		0.542	IGF2BP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000157087.2	NM_006548	
CDH18	1016	hgsc.bcm.edu	37	5	19473544	19473544	+	Missense_Mutation	SNP	C	C	T	rs376117433		TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr5:19473544C>T	ENST00000507958.1	-	15	3154	c.2164G>A	c.(2164-2166)Gaa>Aaa	p.E722K	CDH18_ENST00000274170.4_Missense_Mutation_p.E722K|CDH18_ENST00000510297.1_5'UTR|CDH18_ENST00000382275.1_Missense_Mutation_p.E722K			Q13634	CAD18_HUMAN	cadherin 18, type 2	722					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					AGGTCTGCTTCTGCCAGTCTT	0.488																																					p.E722K		Atlas-SNP	.											.	CDH18	561	.	0			c.G2164A						PASS	.	C	LYS/GLU,	0,4406		0,0,2203	187.0	172.0	177.0		2164,	6.0	1.0	5		177	1,8599	1.2+/-3.3	0,1,4299	no	missense,utr-3	CDH18	NM_004934.3,NM_001167667.1	56,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,	722/791,	19473544	1,13005	2203	4300	6503	SO:0001583	missense	1016	exon13			CTGCTTCTGCCAG	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.2164G>A	chr5.hg19:g.19473544C>T	ENSP00000425093:p.Glu722Lys	147.0	0.0	.		108.0	33.0	.	NM_004934	A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	hg19	CCDS3889.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.025527	0.93518	0.0	1.16E-4	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170	T;T;T	0.78126	-1.15;-1.15;-1.15	6.01	6.01	0.97437	Cadherin, cytoplasmic domain (1);	0.049556	0.85682	D	0.000000	D	0.86192	0.5874	M	0.71581	2.175	0.58432	D	0.999999	D	0.53619	0.961	P	0.59012	0.85	D	0.84732	0.0746	9	.	.	.	.	19.085	0.93200	0.0:1.0:0.0:0.0	.	722	Q13634	CAD18_HUMAN	K	722	ENSP00000371710:E722K;ENSP00000425093:E722K;ENSP00000274170:E722K	.	E	-	1	0	CDH18	19509301	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	6.085000	0.71343	2.861000	0.98227	0.650000	0.86243	GAA	.	.	.	weak		0.488	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934	
ZSWIM6	57688	hgsc.bcm.edu	37	5	60825930	60825930	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr5:60825930G>A	ENST00000252744.5	+	8	1889	c.1889G>A	c.(1888-1890)gGa>gAa	p.G630E		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	630					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						GGCTGGGTTGGACATCCCCTG	0.483																																					p.G630E		Atlas-SNP	.											.	ZSWIM6	51	.	0			c.G1889A						PASS	.						106.0	91.0	95.0					5																	60825930		692	1591	2283	SO:0001583	missense	57688	exon8			GGGTTGGACATCC	BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.1889G>A	chr5.hg19:g.60825930G>A	ENSP00000252744:p.Gly630Glu	162.0	0.0	.		128.0	35.0	.	NM_020928		Missense_Mutation	SNP	ENST00000252744.5	hg19	CCDS47215.1	.	.	.	.	.	.	.	.	.	.	G	31	5.095776	0.94197	.	.	ENSG00000130449	ENST00000252744	T	0.55413	0.52	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.72120	0.3421	L	0.61387	1.9	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.69734	-0.5065	10	0.48119	T	0.1	-9.1727	20.2139	0.98290	0.0:0.0:1.0:0.0	.	630	Q9HCJ5	ZSWM6_HUMAN	E	630	ENSP00000252744:G630E	ENSP00000252744:G630E	G	+	2	0	ZSWIM6	60861687	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.444000	0.97578	2.782000	0.95742	0.561000	0.74099	GGA	.	.	.	none		0.483	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368710.1	NM_020928	
CMYA5	202333	hgsc.bcm.edu	37	5	79031309	79031309	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr5:79031309G>A	ENST00000446378.2	+	2	6752	c.6721G>A	c.(6721-6723)Gta>Ata	p.V2241I		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2241					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		ATTATCAGAGGTAAAACTTAA	0.363																																					p.V2241I		Atlas-SNP	.											.	CMYA5	643	.	0			c.G6721A						PASS	.						100.0	100.0	100.0					5																	79031309		1821	4086	5907	SO:0001583	missense	202333	exon2			TCAGAGGTAAAAC	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.6721G>A	chr5.hg19:g.79031309G>A	ENSP00000394770:p.Val2241Ile	270.0	0.0	.		231.0	60.0	.	NM_153610	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	hg19	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	G	3.106	-0.183619	0.06340	.	.	ENSG00000164309	ENST00000446378	T	0.19938	2.11	5.94	-0.798	0.10905	.	1.045130	0.07537	N	0.913225	T	0.12732	0.0309	L	0.34521	1.04	0.09310	N	1	B	0.14805	0.011	B	0.08055	0.003	T	0.37291	-0.9712	10	0.19147	T	0.46	.	3.6087	0.08052	0.3329:0.0:0.3348:0.3323	.	2241	Q8N3K9	CMYA5_HUMAN	I	2241	ENSP00000394770:V2241I	ENSP00000394770:V2241I	V	+	1	0	CMYA5	79067065	0.001000	0.12720	0.017000	0.16124	0.000000	0.00434	-0.426000	0.07008	-0.068000	0.12953	-0.912000	0.02778	GTA	.	.	.	none		0.363	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
COX7C	1350	hgsc.bcm.edu	37	5	85915264	85915264	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr5:85915264G>A	ENST00000509578.1	+	2	270	c.170G>A	c.(169-171)aGa>aAa	p.R57K	COX7C_ENST00000515763.1_Intron|COX7C_ENST00000247655.3_Missense_Mutation_p.R57K|MIR3607_ENST00000362392.1_RNA|COX7C_ENST00000513124.1_3'UTR			P15954	COX7C_HUMAN	cytochrome c oxidase subunit VIIc	57					cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)			endometrium(1)|lung(1)	2		all_cancers(142;7e-06)|Lung NSC(167;0.000601)|all_lung(232;0.000693)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;1.56e-40)|Epithelial(54;3.17e-34)|all cancers(79;3.36e-29)		CTTGTAGTAAGACACCAACTG	0.373																																					p.R57K		Atlas-SNP	.											.	COX7C	5	.	0			c.G170A						PASS	.						170.0	160.0	163.0					5																	85915264		2203	4300	6503	SO:0001583	missense	1350	exon2			TAGTAAGACACCA	BC001005	CCDS4063.1	5q14	2011-07-04			ENSG00000127184	ENSG00000127184	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2292	protein-coding gene	gene with protein product		603774				10072584	Standard	NM_001867		Approved		uc003kir.3	P15954	OTTHUMG00000119049	ENST00000509578.1:c.170G>A	chr5.hg19:g.85915264G>A	ENSP00000425759:p.Arg57Lys	69.0	0.0	.		50.0	11.0	.	NM_001867	Q6NR81	Missense_Mutation	SNP	ENST00000509578.1	hg19	CCDS4063.1	.	.	.	.	.	.	.	.	.	.	G	16.60	3.167360	0.57476	.	.	ENSG00000127184	ENST00000247655;ENST00000509578	.	.	.	5.6	5.6	0.85130	Cytochrome c oxidase, subunit VIIc domain (2);	0.000000	0.85682	D	0.000000	T	0.79076	0.4385	.	.	.	0.80722	D	1	D	0.63046	0.992	D	0.76071	0.987	T	0.80130	-0.1511	8	0.54805	T	0.06	-20.5435	15.1019	0.72284	0.0:0.0:1.0:0.0	.	57	P15954	COX7C_HUMAN	K	57	.	ENSP00000247655:R57K	R	+	2	0	COX7C	85951020	1.000000	0.71417	0.999000	0.59377	0.331000	0.28603	6.772000	0.75001	2.622000	0.88805	0.655000	0.94253	AGA	.	.	.	none		0.373	COX7C-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369746.1	NM_001867	
PCDHB1	29930	hgsc.bcm.edu	37	5	140431589	140431589	+	Silent	SNP	C	C	T			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr5:140431589C>T	ENST00000306549.3	+	1	611	c.534C>T	c.(532-534)ttC>ttT	p.F178F		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	178	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATGGGTATTTCCACCTGCACA	0.567																																					p.F178F		Atlas-SNP	.											.	PCDHB1	148	.	0			c.C534T						PASS	.						47.0	47.0	47.0					5																	140431589		2203	4300	6503	SO:0001819	synonymous_variant	29930	exon1			GTATTTCCACCTG	AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.534C>T	chr5.hg19:g.140431589C>T		86.0	0.0	.		89.0	21.0	.	NM_013340	Q2M257	Silent	SNP	ENST00000306549.3	hg19	CCDS4243.1																																																																																			.	.	.	none		0.567	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340	
GLRA1	2741	hgsc.bcm.edu	37	5	151231124	151231124	+	Nonsense_Mutation	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr5:151231124G>A	ENST00000455880.2	-	7	1025	c.739C>T	c.(739-741)Cag>Tag	p.Q247*	GLRA1_ENST00000471351.2_5'UTR|GLRA1_ENST00000545569.1_Nonsense_Mutation_p.Q164*|GLRA1_ENST00000274576.4_Nonsense_Mutation_p.Q247*			P23415	GLRA1_HUMAN	glycine receptor, alpha 1	247					acrosome reaction (GO:0007340)|action potential (GO:0001508)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|muscle contraction (GO:0006936)|negative regulation of transmission of nerve impulse (GO:0051970)|neuromuscular process controlling posture (GO:0050884)|neuropeptide signaling pathway (GO:0007218)|positive regulation of acrosome reaction (GO:2000344)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|external side of plasma membrane (GO:0009897)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|taurine binding (GO:0030977)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	23		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TAACCCATCTGCCGCTCCAGG	0.498																																					p.Q247X		Atlas-SNP	.											.	GLRA1	61	.	0			c.C739T						PASS	.						108.0	102.0	104.0					5																	151231124		2203	4300	6503	SO:0001587	stop_gained	2741	exon7			CCATCTGCCGCTC		CCDS4320.1, CCDS54942.1	5q33.1	2012-02-07	2008-01-24		ENSG00000145888	ENSG00000145888		"""Ligand-gated ion channels / Glycine receptors"""	4326	protein-coding gene	gene with protein product	"""startle disease/hyperekplexia"", ""stiff person syndrome"""	138491	"""glycine receptor, alpha 1 (startle disease/hyperekplexia)"""	STHE		1355335, 8298642	Standard	NM_000171		Approved		uc003lut.3	P23415	OTTHUMG00000130121	ENST00000455880.2:c.739C>T	chr5.hg19:g.151231124G>A	ENSP00000411593:p.Gln247*	124.0	0.0	.		123.0	38.0	.	NM_000171	B2R6T3|Q14C77|Q6DJV9	Nonsense_Mutation	SNP	ENST00000455880.2	hg19	CCDS54942.1	.	.	.	.	.	.	.	.	.	.	G	38	7.160538	0.98103	.	.	ENSG00000145888	ENST00000274576;ENST00000455880;ENST00000545569	.	.	.	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	19.1084	0.93307	0.0:0.0:1.0:0.0	.	.	.	.	X	247;247;164	.	ENSP00000274576:Q247X	Q	-	1	0	GLRA1	151211317	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.640000	0.98453	2.579000	0.87056	0.655000	0.94253	CAG	.	.	.	none		0.498	GLRA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000373959.1		
GRIA1	2890	hgsc.bcm.edu	37	5	153078598	153078598	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr5:153078598G>T	ENST00000285900.5	+	10	1760	c.1417G>T	c.(1417-1419)Gcc>Tcc	p.A473S	GRIA1_ENST00000448073.4_Missense_Mutation_p.A483S|GRIA1_ENST00000518783.1_Missense_Mutation_p.A483S|GRIA1_ENST00000340592.5_Missense_Mutation_p.A473S|GRIA1_ENST00000521843.2_Missense_Mutation_p.A404S|GRIA1_ENST00000518142.1_Missense_Mutation_p.A393S	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	473					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	TGACACGAAGGCCTGGAATGG	0.547																																					p.A483S		Atlas-SNP	.											.	GRIA1	321	.	0			c.G1447T						PASS	.						59.0	58.0	58.0					5																	153078598		2203	4300	6503	SO:0001583	missense	2890	exon10			ACGAAGGCCTGGA		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1417G>T	chr5.hg19:g.153078598G>T	ENSP00000285900:p.Ala473Ser	97.0	0.0	.		79.0	24.0	.	NM_001258021	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	hg19	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	G	6.497	0.459981	0.12342	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45;1.45;1.45	5.44	5.44	0.79542	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.146227	0.64402	D	0.000011	T	0.16171	0.0389	N	0.03115	-0.41	0.41460	D	0.988037	B;B;B;B;B;B	0.21225	0.053;0.053;0.0;0.053;0.012;0.0	B;B;B;B;B;B	0.28465	0.09;0.09;0.005;0.09;0.033;0.01	T	0.11372	-1.0590	10	0.38643	T	0.18	.	11.6187	0.51104	0.0906:0.0:0.9094:0.0	.	483;483;393;483;473;473	E7ESV8;B7Z9G9;B7Z3F6;B7Z2W8;P42261-2;P42261	.;.;.;.;.;GRIA1_HUMAN	S	473;473;393;427;473;404;404;483;483	ENSP00000285900:A473S;ENSP00000427920:A393S;ENSP00000339343:A473S;ENSP00000427864:A404S;ENSP00000442108:A404S;ENSP00000428994:A483S;ENSP00000415569:A483S	ENSP00000285900:A473S	A	+	1	0	GRIA1	153058791	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	3.074000	0.50065	2.548000	0.85928	0.655000	0.94253	GCC	.	.	.	none		0.547	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
GRM4	2914	hgsc.bcm.edu	37	6	34100828	34100828	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr6:34100828C>A	ENST00000538487.2	-	2	889	c.446G>T	c.(445-447)cGt>cTt	p.R149L	GRM4_ENST00000374177.3_Intron|GRM4_ENST00000374181.4_Missense_Mutation_p.R149L	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	149					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						ACCCACCACACGTTCAGGCTT	0.607																																					p.R149L		Atlas-SNP	.											.	GRM4	317	.	0			c.G446T						PASS	.						66.0	54.0	58.0					6																	34100828		2203	4300	6503	SO:0001583	missense	2914	exon2			ACCACACGTTCAG	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.446G>T	chr6.hg19:g.34100828C>A	ENSP00000440556:p.Arg149Leu	85.0	0.0	.		63.0	21.0	.	NM_001256811	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	ENST00000538487.2	hg19	CCDS4787.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.305763	0.40795	.	.	ENSG00000124493	ENST00000374181;ENST00000538487	D;D	0.86694	-2.16;-2.16	4.29	4.29	0.51040	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000002	D	0.86443	0.5934	L	0.52011	1.625	0.80722	D	1	B;P;D	0.53462	0.0;0.8;0.96	B;P;P	0.54965	0.01;0.573;0.765	D	0.85668	0.1293	10	0.37606	T	0.19	.	16.5082	0.84278	0.0:1.0:0.0:0.0	.	149;149;149	B7ZLU9;A1L4F9;Q14833	.;.;GRM4_HUMAN	L	149	ENSP00000363296:R149L;ENSP00000440556:R149L	ENSP00000363296:R149L	R	-	2	0	GRM4	34208806	0.993000	0.37304	0.990000	0.47175	0.980000	0.70556	3.896000	0.56266	2.230000	0.72887	0.467000	0.42956	CGT	.	.	.	none		0.607	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2		
RSPH10B2	728194	hgsc.bcm.edu	37	7	6797488	6797488	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr7:6797488C>A	ENST00000403107.1	+	2	567	c.180C>A	c.(178-180)gaC>gaA	p.D60E	RSPH10B2_ENST00000297186.3_Missense_Mutation_p.D60E|RSPH10B2_ENST00000404077.1_Missense_Mutation_p.D60E|RSPH10B2_ENST00000433859.2_Missense_Mutation_p.D60E|RSPH10B2_ENST00000359718.3_5'UTR			B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B2 (Chlamydomonas)	60										breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|skin(2)	15						CCAAAAAAGACCGCCAAAACG	0.488																																					p.D60E		Atlas-SNP	.											RSPH10B2,NS,carcinoma,0,2	RSPH10B	28	.	0			c.C180A						PASS	.						104.0	117.0	113.0					7																	6797488		2156	4264	6420	SO:0001583	missense	222967	exon3			AAAAGACCGCCAA		CCDS43552.1	7p22.1	2008-07-04			ENSG00000169402	ENSG00000169402			34385	protein-coding gene	gene with protein product							Standard	NM_001099697		Approved		uc003sqw.1	B2RC85	OTTHUMG00000151856	ENST00000403107.1:c.180C>A	chr7.hg19:g.6797488C>A	ENSP00000384766:p.Asp60Glu	294.0	0.0	.		311.0	61.0	.	NM_173565	A6NMW7|B2RXI4|B2RXJ0|Q86ST9|Q8NE68	Missense_Mutation	SNP	ENST00000403107.1	hg19	CCDS43552.1	.	.	.	.	.	.	.	.	.	.	C	0.024	-1.389722	0.01185	.	.	ENSG00000169402	ENST00000403107;ENST00000404077;ENST00000297186;ENST00000433859	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	2.65	-1.66	0.08265	.	29.558000	0.00166	U	0.000000	T	0.18383	0.0441	N	0.02368	-0.58	0.20926	N	0.99983	B	0.06786	0.001	B	0.06405	0.002	T	0.30679	-0.9970	10	0.02654	T	1	.	4.2993	0.10916	0.0:0.3509:0.2772:0.3719	.	60	B2RC85	R10B2_HUMAN	E	60	ENSP00000384766:D60E;ENSP00000386102:D60E;ENSP00000297186:D60E;ENSP00000416710:D60E	ENSP00000297186:D60E	D	+	3	2	RSPH10B2	6764013	0.004000	0.15560	0.001000	0.08648	0.064000	0.16182	-0.256000	0.08757	-0.632000	0.05553	0.392000	0.25879	GAC	.	.	.	none		0.488	RSPH10B2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324184.4	NM_001099697	
HOXA1	3198	hgsc.bcm.edu	37	7	27135159	27135159	+	Nonsense_Mutation	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr7:27135159G>A	ENST00000343060.4	-	1	434	c.373C>T	c.(373-375)Cag>Tag	p.Q125*	HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000434063.3_RNA|HOTAIRM1_ENST00000495032.1_RNA|HOXA1_ENST00000355633.5_Intron|HOTAIRM1_ENST00000425358.2_RNA	NM_005522.4	NP_005513	P49639	HXA1_HUMAN	homeobox A1	125					abducens nerve formation (GO:0021599)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|artery morphogenesis (GO:0048844)|central nervous system neuron differentiation (GO:0021953)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|cognition (GO:0050890)|embryonic neurocranium morphogenesis (GO:0048702)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|inner ear development (GO:0048839)|motor neuron axon guidance (GO:0008045)|multicellular organismal development (GO:0007275)|neuromuscular process (GO:0050905)|optokinetic behavior (GO:0007634)|outer ear morphogenesis (GO:0042473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of behavior (GO:0050795)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|semicircular canal formation (GO:0060876)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GGAGCGCACTGGGGGTACCCA	0.577																																					p.Q125X		Atlas-SNP	.											.	HOXA1	64	.	0			c.C373T						PASS	.						76.0	80.0	79.0					7																	27135159		2203	4300	6503	SO:0001587	stop_gained	3198	exon1			CGCACTGGGGGTA		CCDS5401.1, CCDS5402.2	7p15.2	2011-06-20	2005-12-22		ENSG00000105991	ENSG00000105991		"""Homeoboxes / ANTP class : HOXL subclass"""	5099	protein-coding gene	gene with protein product		142955	"""homeo box A1"""	HOX1F, HOX1		1973146	Standard	NM_153620		Approved		uc003sye.3	P49639	OTTHUMG00000023207	ENST00000343060.4:c.373C>T	chr7.hg19:g.27135159G>A	ENSP00000343246:p.Gln125*	94.0	0.0	.		122.0	25.0	.	NM_005522	A4D184|B2R8U7|O43363	Nonsense_Mutation	SNP	ENST00000343060.4	hg19	CCDS5401.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.982192	0.74474	.	.	ENSG00000105991	ENST00000343060	.	.	.	4.88	-1.21	0.09524	.	0.879495	0.10099	N	0.716190	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	5.9292	0.19130	0.4767:0.1382:0.3852:0.0	.	.	.	.	X	125	.	ENSP00000343246:Q125X	Q	-	1	0	HOXA1	27101684	1.000000	0.71417	0.996000	0.52242	0.957000	0.61999	1.690000	0.37711	-0.079000	0.12707	0.462000	0.41574	CAG	.	.	.	none		0.577	HOXA1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358454.1		
TAX1BP1	8887	hgsc.bcm.edu	37	7	27809433	27809433	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr7:27809433C>A	ENST00000396319.2	+	5	680	c.592C>A	c.(592-594)Caa>Aaa	p.Q198K	TAX1BP1_ENST00000543117.1_Missense_Mutation_p.Q198K|TAX1BP1_ENST00000409980.1_Missense_Mutation_p.Q198K|TAX1BP1_ENST00000265393.6_Missense_Mutation_p.Q198K|TAX1BP1_ENST00000494033.1_3'UTR|TAX1BP1_ENST00000433216.2_Missense_Mutation_p.Q41K	NM_006024.6	NP_006015.4	Q86VP1	TAXB1_HUMAN	Tax1 (human T-cell leukemia virus type I) binding protein 1	198					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)	cytosol (GO:0005829)	kinase binding (GO:0019900)			breast(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(8)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31			GBM - Glioblastoma multiforme(3;0.0823)			AAGATGTGACCAACTGCAAGC	0.368																																					p.Q198K		Atlas-SNP	.											.	TAX1BP1	71	.	0			c.C592A						PASS	.						86.0	78.0	81.0					7																	27809433		2203	4300	6503	SO:0001583	missense	8887	exon5			TGTGACCAACTGC	U33821	CCDS5415.1, CCDS43561.1, CCDS56471.1	7p15	2010-08-05			ENSG00000106052	ENSG00000106052			11575	protein-coding gene	gene with protein product		605326				10435631	Standard	NM_006024		Approved	TXBP151, CALCOCO3	uc003szl.3	Q86VP1	OTTHUMG00000023377	ENST00000396319.2:c.592C>A	chr7.hg19:g.27809433C>A	ENSP00000379612:p.Gln198Lys	264.0	0.0	.		320.0	74.0	.	NM_006024	B4DKU7|E7ENV2|O60398|O95770|Q13311|Q9BQG5|Q9UI88	Missense_Mutation	SNP	ENST00000396319.2	hg19	CCDS5415.1	.	.	.	.	.	.	.	.	.	.	C	16.13	3.037273	0.54896	.	.	ENSG00000106052	ENST00000543117;ENST00000265393;ENST00000409980;ENST00000433216;ENST00000396319	T;T;T;T;T	0.08984	3.03;3.03;3.03;3.03;3.03	5.57	4.68	0.58851	.	0.000000	0.51477	D	0.000093	T	0.14184	0.0343	L	0.42245	1.32	0.53005	D	0.999969	P;P;P	0.49783	0.928;0.605;0.734	P;P;B	0.51266	0.664;0.497;0.302	T	0.04870	-1.0921	10	0.27082	T	0.32	-2.1773	15.6661	0.77230	0.1384:0.8616:0.0:0.0	.	41;198;198	E7ENV2;Q86VP1;Q86VP1-2	.;TAXB1_HUMAN;.	K	198;198;198;41;198	ENSP00000444811:Q198K;ENSP00000265393:Q198K;ENSP00000386515:Q198K;ENSP00000391907:Q41K;ENSP00000379612:Q198K	ENSP00000265393:Q198K	Q	+	1	0	TAX1BP1	27775958	0.991000	0.36638	0.954000	0.39281	0.630000	0.37929	4.066000	0.57520	1.316000	0.45131	0.650000	0.86243	CAA	.	.	.	none		0.368	TAX1BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214142.1	NM_006024	
ZNF727	442319	hgsc.bcm.edu	37	7	63538066	63538066	+	Silent	SNP	A	A	T			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr7:63538066A>T	ENST00000550760.3	+	4	818	c.639A>T	c.(637-639)tcA>tcT	p.S213S	RP11-3N2.13_ENST00000445978.1_RNA	NM_001159522.1	NP_001152994.1	A8MUV8	ZN727_HUMAN	zinc finger protein 727	213					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|skin(1)|stomach(1)|urinary_tract(1)	8						AAAAGTTCTCAAACCTTACTG	0.363																																					p.S213S		Atlas-SNP	.											.	ZNF727	35	.	0			c.A639T						PASS	.						25.0	24.0	24.0					7																	63538066		692	1591	2283	SO:0001819	synonymous_variant	442319	exon4			GTTCTCAAACCTT			7q11.21	2014-09-09	2014-09-09	2014-09-09	ENSG00000214652	ENSG00000214652		"""Zinc fingers, C2H2-type"", ""-"""	22785	pseudogene	pseudogene			"""zinc finger protein 727, pseudogene"""	ZNF727P			Standard	NM_001159522		Approved		uc011kdm.2	A8MUV8	OTTHUMG00000156536	ENST00000550760.3:c.639A>T	chr7.hg19:g.63538066A>T		177.0	0.0	.		170.0	79.0	.	NM_001159522		Silent	SNP	ENST00000550760.3	hg19	CCDS55113.1																																																																																			.	.	.	none		0.363	ZNF727-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001159522	
GNAI1	2770	hgsc.bcm.edu	37	7	79840317	79840317	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr7:79840317G>C	ENST00000351004.3	+	6	996	c.623G>C	c.(622-624)cGg>cCg	p.R208P	GNAI1_ENST00000457358.2_Missense_Mutation_p.R156P	NM_002069.5	NP_002060.4	P63096	GNAI1_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1	208					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|response to peptide hormone (GO:0043434)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.R208Q(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	19						AGATCTGAGCGGAAGAAGTGG	0.423																																					p.R208P		Atlas-SNP	.											GNAI1,colon,carcinoma,0,1	GNAI1	44	.	1	Substitution - Missense(1)	large_intestine(1)	c.G623C						PASS	.						164.0	139.0	148.0					7																	79840317		2203	4300	6503	SO:0001583	missense	2770	exon6			CTGAGCGGAAGAA	AL049933	CCDS5595.1, CCDS59061.1	7q21-q22	2008-07-18			ENSG00000127955	ENSG00000127955			4384	protein-coding gene	gene with protein product	"""Gi1 protein alpha subunit"""	139310				3110783	Standard	NM_002069		Approved		uc003uhb.1	P63096	OTTHUMG00000023523	ENST00000351004.3:c.623G>C	chr7.hg19:g.79840317G>C	ENSP00000343027:p.Arg208Pro	98.0	0.0	.		108.0	28.0	.	NM_002069	A8KA88|B4E2V1|C9J3A4|P04898|P11015|P31871|Q5U074|Q8TAN5|Q9UGA4	Missense_Mutation	SNP	ENST00000351004.3	hg19	CCDS5595.1	.	.	.	.	.	.	.	.	.	.	G	33	5.234999	0.95207	.	.	ENSG00000127955	ENST00000351004;ENST00000457358	D;D	0.92911	-3.13;-3.13	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.97993	0.9339	H	0.98612	4.28	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.99041	1.0824	9	.	.	.	.	19.8478	0.96722	0.0:0.0:1.0:0.0	.	208	P63096	GNAI1_HUMAN	P	208;156	ENSP00000343027:R208P;ENSP00000410572:R156P	.	R	+	2	0	GNAI1	79678253	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.685000	0.91497	0.650000	0.86243	CGG	.	.	.	none		0.423	GNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253254.1	NM_002069	
HGF	3082	hgsc.bcm.edu	37	7	81331961	81331961	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr7:81331961C>T	ENST00000222390.5	-	18	2349	c.2123G>A	c.(2122-2124)cGa>cAa	p.R708Q	HGF_ENST00000457544.2_Missense_Mutation_p.R703Q	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	708	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						ATATGCTACTCGGACAAAAAT	0.398																																					p.R708Q		Atlas-SNP	.											.	HGF	171	.	0			c.G2123A						PASS	.						130.0	124.0	126.0					7																	81331961		2203	4299	6502	SO:0001583	missense	3082	exon18			GCTACTCGGACAA		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.2123G>A	chr7.hg19:g.81331961C>T	ENSP00000222390:p.Arg708Gln	346.0	0.0	.		386.0	175.0	.	NM_000601	A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Missense_Mutation	SNP	ENST00000222390.5	hg19	CCDS5597.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.554522	0.86231	.	.	ENSG00000019991	ENST00000222390;ENST00000457544	D;D	0.84589	-1.87;-1.87	5.3	5.3	0.74995	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.233781	0.41823	D	0.000816	D	0.91882	0.7430	M	0.71920	2.185	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.992;0.995	D	0.90969	0.4818	10	0.42905	T	0.14	.	19.3172	0.94220	0.0:1.0:0.0:0.0	.	703;708	P14210-3;P14210	.;HGF_HUMAN	Q	708;703	ENSP00000222390:R708Q;ENSP00000391238:R703Q	ENSP00000222390:R708Q	R	-	2	0	HGF	81169897	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.736000	0.62059	2.643000	0.89663	0.655000	0.94253	CGA	.	.	.	none		0.398	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253315.2	NM_000601	
TRRAP	8295	hgsc.bcm.edu	37	7	98576479	98576479	+	Silent	SNP	C	C	T			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr7:98576479C>T	ENST00000359863.4	+	57	8774	c.8565C>T	c.(8563-8565)tgC>tgT	p.C2855C	TRRAP_ENST00000446306.3_Silent_p.C2837C|TRRAP_ENST00000355540.3_Silent_p.C2837C	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	2855	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.C2837C(1)|p.C2855C(1)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TCCTGGAGTGCGCCTGGCGGG	0.617																																					p.C2855C		Atlas-SNP	.											TRRAP_ENST00000359863,NS,carcinoma,0,2	TRRAP	863	.	2	Substitution - coding silent(2)	endometrium(2)	c.C8565T						PASS	.						75.0	78.0	77.0					7																	98576479		2203	4300	6503	SO:0001819	synonymous_variant	8295	exon57			GGAGTGCGCCTGG	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.8565C>T	chr7.hg19:g.98576479C>T		72.0	0.0	.		58.0	10.0	.	NM_001244580	A4D265|O75218|Q9Y631|Q9Y6H4	Silent	SNP	ENST00000359863.4	hg19	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	C	10.77	1.443777	0.25987	.	.	ENSG00000196367	ENST00000456197	.	.	.	6.03	-0.483	0.12075	.	.	.	.	.	T	0.57725	0.2073	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51748	-0.8666	4	.	.	.	.	10.7505	0.46207	0.0:0.4332:0.0:0.5668	.	.	.	.	V	2577	.	.	A	+	2	0	TRRAP	98414415	0.995000	0.38212	0.987000	0.45799	0.991000	0.79684	0.304000	0.19228	-0.300000	0.08895	-0.302000	0.09304	GCG	.	.	.	none		0.617	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
POP7	10248	hgsc.bcm.edu	37	7	100304790	100304790	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr7:100304790C>A	ENST00000303151.4	+	2	599	c.337C>A	c.(337-339)Cca>Aca	p.P113T		NM_005837.2	NP_005828.2	O75817	POP7_HUMAN	processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)	113					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ribonuclease P activity (GO:0004526)			endometrium(2)|kidney(1)|ovary(1)	4	Lung NSC(181;0.041)|all_lung(186;0.0581)					TGAGCTGGAGCCAGAGACCGA	0.592																																					p.P113T		Atlas-SNP	.											.	POP7	8	.	0			c.C337A						PASS	.						67.0	68.0	68.0					7																	100304790		2203	4300	6503	SO:0001583	missense	10248	exon2			CTGGAGCCAGAGA	U94316	CCDS5704.1	7q22	2012-05-21	2007-06-26		ENSG00000172336	ENSG00000172336			19949	protein-coding gene	gene with protein product	"""ribonuclease P protein subunit p20"""	606113	"""processing of precursor 7, ribonuclease P subunit (S. cerevisiae)"""			9630247	Standard	NM_005837		Approved	RPP20, RPP2	uc003uwh.4	O75817	OTTHUMG00000044311	ENST00000303151.4:c.337C>A	chr7.hg19:g.100304790C>A	ENSP00000304353:p.Pro113Thr	172.0	0.0	.		177.0	42.0	.	NM_005837	A4D2E0|Q9BV74	Missense_Mutation	SNP	ENST00000303151.4	hg19	CCDS5704.1	.	.	.	.	.	.	.	.	.	.	C	19.83	3.900727	0.72754	.	.	ENSG00000172336	ENST00000303151;ENST00000457480	.	.	.	5.67	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.75199	0.3817	M	0.65975	2.015	0.52501	D	0.999954	D	0.76494	0.999	D	0.70935	0.971	T	0.77576	-0.2536	9	0.87932	D	0	-13.8558	11.755	0.51870	0.176:0.824:0.0:0.0	.	113	O75817	POP7_HUMAN	T	113	.	ENSP00000304353:P113T	P	+	1	0	POP7	100142726	1.000000	0.71417	0.891000	0.34965	0.608000	0.37181	3.598000	0.54038	1.325000	0.45301	0.561000	0.74099	CCA	.	.	.	none		0.592	POP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103070.1	NM_005837	
PODXL	5420	hgsc.bcm.edu	37	7	131241055	131241055	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr7:131241055A>G	ENST00000378555.3	-	1	311	c.64T>C	c.(64-66)Tcg>Ccg	p.S22P	PODXL_ENST00000537928.1_Missense_Mutation_p.S22P|PODXL_ENST00000322985.9_Missense_Mutation_p.S22P|PODXL_ENST00000541194.1_Missense_Mutation_p.S22P|PODXL_ENST00000465001.1_Intron			O00592	PODXL_HUMAN	podocalyxin-like	22					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					gacggcgacgacggcagcagc	0.741																																					p.S22P		Atlas-SNP	.											.	PODXL	53	.	0			c.T64C						PASS	.						5.0	8.0	7.0					7																	131241055		1914	3836	5750	SO:0001583	missense	5420	exon1			GCGACGACGGCAG		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.64T>C	chr7.hg19:g.131241055A>G	ENSP00000367817:p.Ser22Pro	112.0	0.0	.		139.0	14.0	.	NM_001018111	A6NHX8|Q52LZ7|Q53ER6	Missense_Mutation	SNP	ENST00000378555.3	hg19	CCDS34755.1	.	.	.	.	.	.	.	.	.	.	A	10.93	1.488975	0.26686	.	.	ENSG00000128567	ENST00000541194;ENST00000537928;ENST00000378555;ENST00000322985	T;T;T;T	0.12774	2.82;2.65;2.82;2.85	.	.	.	.	7739.210000	0.00166	U	0.000000	T	0.08670	0.0215	N	0.14661	0.345	0.09310	N	0.999994	.	.	.	.	.	.	T	0.24728	-1.0152	6	0.29301	T	0.29	.	.	.	.	.	22;22	O00592-2;O00592	.;PODXL_HUMAN	P	22	ENSP00000440518:S22P;ENSP00000442655:S22P;ENSP00000367817:S22P;ENSP00000319782:S22P	ENSP00000319782:S22P	S	-	1	0	PODXL	130891595	0.001000	0.12720	0.027000	0.17364	0.027000	0.11550	0.743000	0.26231	0.056000	0.16144	0.055000	0.15244	TCG	.	.	.	none		0.741	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
MFHAS1	9258	hgsc.bcm.edu	37	8	8654999	8654999	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr8:8654999C>G	ENST00000276282.6	-	2	3587	c.3001G>C	c.(3001-3003)Gag>Cag	p.E1001Q	MFHAS1_ENST00000520091.1_5'UTR	NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	1001		Breakpoint for translocation to form chimeric MASL1.								endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		CTCAGCAACTCCCCTGTAGGA	0.552																																					p.E1001Q	Melanoma(103;1201 2045 17515 28966)	Atlas-SNP	.											.	MFHAS1	58	.	0			c.G3001C						PASS	.						81.0	68.0	72.0					8																	8654999		2203	4300	6503	SO:0001583	missense	9258	exon2			GCAACTCCCCTGT	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.3001G>C	chr8.hg19:g.8654999C>G	ENSP00000276282:p.Glu1001Gln	93.0	0.0	.		84.0	17.0	.	NM_004225	Q96CI0	Missense_Mutation	SNP	ENST00000276282.6	hg19	CCDS34844.1	.	.	.	.	.	.	.	.	.	.	C	18.02	3.529145	0.64860	.	.	ENSG00000147324	ENST00000276282	T	0.38401	1.14	5.73	5.73	0.89815	.	0.068346	0.56097	D	0.000026	T	0.56292	0.1975	L	0.54323	1.7	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.43956	-0.9359	10	0.29301	T	0.29	.	18.882	0.92358	0.0:1.0:0.0:0.0	.	1001	Q9Y4C4	MFHA1_HUMAN	Q	1001	ENSP00000276282:E1001Q	ENSP00000276282:E1001Q	E	-	1	0	MFHAS1	8692409	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.251000	0.78297	2.703000	0.92315	0.551000	0.68910	GAG	.	.	.	none		0.552	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	NM_004225	
TERF1	7013	hgsc.bcm.edu	37	8	73921213	73921213	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr8:73921213C>G	ENST00000276603.5	+	1	115	c.92C>G	c.(91-93)aCa>aGa	p.T31R	TERF1_ENST00000276602.6_Missense_Mutation_p.T31R	NM_017489.2	NP_059523.2	P54274	TERF1_HUMAN	telomeric repeat binding factor (NIMA-interacting) 1	31	Asp/Glu-rich (acidic).				age-dependent telomere shortening (GO:0001309)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of DNA replication (GO:0008156)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via semi-conservative replication (GO:0032214)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of apoptotic process (GO:0043065)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of mitosis (GO:0045840)|positive regulation of mitotic cell cycle (GO:0045931)|protein homooligomerization (GO:0051260)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere shortening (GO:0010834)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded telomeric DNA binding (GO:0003691)|microtubule binding (GO:0008017)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|telomeric DNA binding (GO:0042162)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9	Breast(64;0.218)		Epithelial(68;0.0984)			ATGGCAGAAACAGAGAGAAAC	0.637																																					p.T31R		Atlas-SNP	.											.	TERF1	48	.	0			c.C92G						PASS	.						21.0	23.0	22.0					8																	73921213		2201	4299	6500	SO:0001583	missense	7013	exon1			CAGAAACAGAGAG	U74382	CCDS6210.1, CCDS6211.1	8q21.11	2011-05-24			ENSG00000147601	ENSG00000147601			11728	protein-coding gene	gene with protein product		600951		TRBF1		9391075	Standard	NM_003218		Approved	PIN2, TRF1, TRF	uc003xzd.2	P54274	OTTHUMG00000164522	ENST00000276603.5:c.92C>G	chr8.hg19:g.73921213C>G	ENSP00000276603:p.Thr31Arg	198.0	0.0	.		183.0	38.0	.	NM_017489	A7XP29|Q15553|Q8NHT6|Q93029	Missense_Mutation	SNP	ENST00000276603.5	hg19	CCDS6211.1	.	.	.	.	.	.	.	.	.	.	C	13.34	2.207086	0.39003	.	.	ENSG00000147601	ENST00000276603;ENST00000276602;ENST00000518874	.	.	.	4.04	-2.49	0.06403	.	1.175850	0.05898	N	0.629573	T	0.22627	0.0546	N	0.24115	0.695	0.09310	N	1	B;B	0.31548	0.328;0.22	B;B	0.32928	0.155;0.074	T	0.29640	-1.0005	9	0.72032	D	0.01	.	3.719	0.08449	0.4111:0.334:0.0:0.255	.	31;31	P54274-2;P54274	.;TERF1_HUMAN	R	31	.	ENSP00000276602:T31R	T	+	2	0	TERF1	74083767	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-2.062000	0.01390	-0.546000	0.06216	0.557000	0.71058	ACA	.	.	.	none		0.637	TERF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379093.1	NM_017489	
FAM91A1	157769	hgsc.bcm.edu	37	8	124799974	124799974	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr8:124799974T>A	ENST00000334705.7	+	14	1508	c.1262T>A	c.(1261-1263)cTt>cAt	p.L421H	FAM91A1_ENST00000521166.1_Missense_Mutation_p.L421H	NM_144963.2	NP_659400	Q658Y4	F91A1_HUMAN	family with sequence similarity 91, member A1	421										breast(4)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00192)			GACAGCTTTCTTATAGAACTA	0.363																																					p.L421H		Atlas-SNP	.											.	FAM91A1	77	.	0			c.T1262A						PASS	.						91.0	88.0	89.0					8																	124799974		1846	4099	5945	SO:0001583	missense	157769	exon14			GCTTTCTTATAGA	AK074370	CCDS6346.2	8q24.13	2005-10-04			ENSG00000176853	ENSG00000176853			26306	protein-coding gene	gene with protein product						12477932	Standard	XM_005250806		Approved	FLJ23790	uc003yqv.3	Q658Y4	OTTHUMG00000133021	ENST00000334705.7:c.1262T>A	chr8.hg19:g.124799974T>A	ENSP00000335082:p.Leu421His	75.0	0.0	.		66.0	23.0	.	NM_144963	B6YY23|Q658T5|Q8TE89	Missense_Mutation	SNP	ENST00000334705.7	hg19	CCDS6346.2	.	.	.	.	.	.	.	.	.	.	T	19.98	3.926656	0.73327	.	.	ENSG00000176853	ENST00000521166;ENST00000334705	T;T	0.43294	0.95;0.95	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.68118	0.2966	M	0.84082	2.675	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.73575	-0.3939	10	0.87932	D	0	.	16.0241	0.80528	0.0:0.0:0.0:1.0	.	421;421	E7ER68;Q658Y4	.;F91A1_HUMAN	H	421	ENSP00000429491:L421H;ENSP00000335082:L421H	ENSP00000335082:L421H	L	+	2	0	FAM91A1	124869155	1.000000	0.71417	0.932000	0.37286	0.493000	0.33554	7.938000	0.87678	2.248000	0.74166	0.533000	0.62120	CTT	.	.	.	none		0.363	FAM91A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256607.1	NM_144963	
ADCY8	114	hgsc.bcm.edu	37	8	132051979	132051979	+	Silent	SNP	A	A	G			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr8:132051979A>G	ENST00000286355.5	-	1	2693	c.601T>C	c.(601-603)Ttg>Ctg	p.L201L	ADCY8_ENST00000377928.3_Silent_p.L201L	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	201					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GCCAGGCTCAAGTGTAGGACC	0.587										HNSCC(32;0.087)																											p.L201L		Atlas-SNP	.											.	ADCY8	291	.	0			c.T601C						PASS	.						83.0	86.0	85.0					8																	132051979		2203	4300	6503	SO:0001819	synonymous_variant	114	exon1			GGCTCAAGTGTAG	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.601T>C	chr8.hg19:g.132051979A>G		148.0	0.0	.		111.0	18.0	.	NM_001115		Silent	SNP	ENST00000286355.5	hg19	CCDS6363.1																																																																																			.	.	.	none		0.587	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
ZFAT	57623	hgsc.bcm.edu	37	8	135596131	135596131	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr8:135596131T>C	ENST00000377838.3	-	10	3005	c.2831A>G	c.(2830-2832)aAg>aGg	p.K944R	ZFAT_ENST00000520214.1_Missense_Mutation_p.K932R|ZFAT_ENST00000517307.1_5'UTR|ZFAT_ENST00000520727.1_Missense_Mutation_p.K932R|ZFAT_ENST00000520356.1_Missense_Mutation_p.K932R|ZFAT_ENST00000523399.1_Missense_Mutation_p.K882R|ZFAT_ENST00000429442.2_Missense_Mutation_p.K932R	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	944					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			TTTGAATTTCTTGCCACACAT	0.438																																					p.K944R		Atlas-SNP	.											.	ZFAT	265	.	0			c.A2831G						PASS	.						162.0	144.0	150.0					8																	135596131		1953	4163	6116	SO:0001583	missense	57623	exon10			AATTTCTTGCCAC	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.2831A>G	chr8.hg19:g.135596131T>C	ENSP00000367069:p.Lys944Arg	128.0	0.0	.		105.0	27.0	.	NM_020863	B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	ENST00000377838.3	hg19	CCDS47924.1	.	.	.	.	.	.	.	.	.	.	T	28.3	4.906547	0.92107	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000318135;ENST00000523399	T;T;T;T;T;T	0.12879	2.64;2.64;2.64;2.64;2.64;2.64	5.68	5.68	0.88126	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.29652	0.0740	L	0.41710	1.295	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.998;0.999;0.996	T	0.01252	-1.1405	10	0.59425	D	0.04	-35.6191	15.1066	0.72326	0.0:0.0:0.0:1.0	.	882;932;944	E9PER3;E9PBN4;Q9P243	.;.;ZFAT_HUMAN	R	932;932;932;944;932;831;882	ENSP00000427879:K932R;ENSP00000427831:K932R;ENSP00000394501:K932R;ENSP00000367069:K944R;ENSP00000428483:K932R;ENSP00000429091:K882R	ENSP00000326997:K831R	K	-	2	0	ZFAT	135665313	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.929000	0.87595	2.156000	0.67533	0.460000	0.39030	AAG	.	.	.	none		0.438	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	NM_001029939	
CER1	9350	hgsc.bcm.edu	37	9	14722265	14722265	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr9:14722265G>C	ENST00000380911.3	-	1	450	c.406C>G	c.(406-408)Cac>Gac	p.H136D		NM_005454.2	NP_005445.1	O95813	CER1_HUMAN	cerberus 1, DAN family BMP antagonist	136					anterior/posterior axis specification (GO:0009948)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|bone mineralization (GO:0030282)|cell migration involved in gastrulation (GO:0042074)|cellular response to BMP stimulus (GO:0071773)|determination of dorsal identity (GO:0048263)|gastrulation (GO:0007369)|growth plate cartilage chondrocyte proliferation (GO:0003419)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mesoderm development (GO:2000381)|nervous system development (GO:0007399)|sequestering of BMP in extracellular matrix (GO:0035582)|signal transduction involved in regulation of gene expression (GO:0023019)|ureteric bud development (GO:0001657)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	BMP binding (GO:0036122)|morphogen activity (GO:0016015)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(3)|lung(6)	11				GBM - Glioblastoma multiforme(50;3.16e-06)		AACATGAAGTGGTGCCAGAAT	0.517																																					p.H136D		Atlas-SNP	.											.	CER1	41	.	0			c.C406G						PASS	.						92.0	92.0	92.0					9																	14722265		2203	4300	6503	SO:0001583	missense	9350	exon1			TGAAGTGGTGCCA	AF090189	CCDS6476.1	9p23-p22	2013-02-26	2013-02-26		ENSG00000147869	ENSG00000147869			1862	protein-coding gene	gene with protein product		603777	"""cerberus 1 (Xenopus laevis) homolog (cysteine knot superfamily)"", ""cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)"""			10049596	Standard	NM_005454		Approved	DAND4	uc003zlj.3	O95813	OTTHUMG00000021022	ENST00000380911.3:c.406C>G	chr9.hg19:g.14722265G>C	ENSP00000370297:p.His136Asp	155.0	0.0	.		99.0	39.0	.	NM_005454	Q6ISJ1|Q6ISJ6|Q6ISQ2|Q6ISS1	Missense_Mutation	SNP	ENST00000380911.3	hg19	CCDS6476.1	.	.	.	.	.	.	.	.	.	.	G	12.53	1.965365	0.34659	.	.	ENSG00000147869	ENST00000380911	T	0.28454	1.61	5.21	2.9	0.33743	DAN (1);	0.482217	0.21040	N	0.081195	T	0.36468	0.0968	L	0.51422	1.61	0.25991	N	0.982241	P	0.48998	0.918	P	0.52386	0.697	T	0.09997	-1.0649	10	0.37606	T	0.19	-4.9758	9.5839	0.39504	0.1638:0.0:0.8362:0.0	.	136	O95813	CER1_HUMAN	D	136	ENSP00000370297:H136D	ENSP00000370297:H136D	H	-	1	0	CER1	14712265	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.053000	0.30442	0.682000	0.31407	0.655000	0.94253	CAC	.	.	.	none		0.517	CER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055453.1	NM_005454	
DENND4C	55667	hgsc.bcm.edu	37	9	19372144	19372144	+	Silent	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr9:19372144G>A	ENST00000380432.2	+	28	5028	c.4995G>A	c.(4993-4995)agG>agA	p.R1665R	RP11-513M16.7_ENST00000609609.1_RNA|DENND4C_ENST00000602925.1_Silent_p.R1901R|DENND4C_ENST00000434457.2_Silent_p.R1950R			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	1665					cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						AGTGGTGCAGGAAGTGTTTTG	0.393																																					p.R1901R		Atlas-SNP	.											.	DENND4C	120	.	0			c.G5703A						PASS	.						117.0	123.0	121.0					9																	19372144		2203	4300	6503	SO:0001819	synonymous_variant	55667	exon32			GTGCAGGAAGTGT	AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.4995G>A	chr9.hg19:g.19372144G>A		156.0	0.0	.		87.0	23.0	.	NM_017925	A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Silent	SNP	ENST00000380432.2	hg19																																																																																				.	.	.	none		0.393	DENND4C-201	KNOWN	basic	protein_coding	protein_coding		NM_017925	
TTC16	158248	hgsc.bcm.edu	37	9	130480052	130480052	+	Splice_Site	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr9:130480052G>A	ENST00000373289.3	+	4	506		c.e4+1		PTRH1_ENST00000423807.1_5'Flank|PTRH1_ENST00000543175.1_5'Flank|TTC16_ENST00000393748.4_Splice_Site|PTRH1_ENST00000419060.1_Intron|PTRH1_ENST00000429848.1_Intron	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16											central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						CTACCTACAGGTGCCTGGGGC	0.622																																					.		Atlas-SNP	.											.	TTC16	55	.	0			c.426+1G>A						PASS	.						44.0	47.0	46.0					9																	130480052		2203	4300	6503	SO:0001630	splice_region_variant	158248	exon4			CTACAGGTGCCTG	AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.426+1G>A	chr9.hg19:g.130480052G>A		78.0	0.0	.		49.0	23.0	.	NM_144965	B4DYG4|B5ME24|Q5JU66|Q96M72	Splice_Site	SNP	ENST00000373289.3	hg19	CCDS6875.1	.	.	.	.	.	.	.	.	.	.	G	10.53	1.374900	0.24857	.	.	ENSG00000167094	ENST00000373289	.	.	.	4.6	4.6	0.57074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8947	0.70636	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TTC16	129519873	1.000000	0.71417	1.000000	0.80357	0.057000	0.15508	6.991000	0.76232	2.132000	0.65825	0.313000	0.20887	.	.	.	.	none		0.622	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054224.1	NM_144965	Intron
STKLD1	169436	hgsc.bcm.edu	37	9	136249679	136249679	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr9:136249679G>A	ENST00000371957.3	+	3	321	c.214G>A	c.(214-216)Gag>Aag	p.E72K	C9orf96_ENST00000426926.2_Missense_Mutation_p.E72K|C9orf96_ENST00000468046.1_3'UTR|C9orf96_ENST00000371955.1_5'UTR	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		72	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		TCAGGCCCTGGAGGAGGTAAC	0.483																																					p.E72K		Atlas-SNP	.											.	C9orf96	77	.	0			c.G214A						PASS	.						218.0	189.0	199.0					9																	136249679		2203	4300	6503	SO:0001583	missense	169436	exon3			GCCCTGGAGGAGG																												ENST00000371957.3:c.214G>A	chr9.hg19:g.136249679G>A	ENSP00000361025:p.Glu72Lys	85.0	0.0	.		74.0	29.0	.	NM_153710	Q5T8U8|Q6ZMP6|Q6ZMQ5	Missense_Mutation	SNP	ENST00000371957.3	hg19	CCDS35169.1	.	.	.	.	.	.	.	.	.	.	G	3.589	-0.083913	0.07141	.	.	ENSG00000198870	ENST00000426926;ENST00000371957	T;T	0.17370	2.28;2.28	3.83	2.92	0.33932	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.477248	0.18996	N	0.125463	T	0.07234	0.0183	N	0.12471	0.22	0.80722	D	1	B	0.12013	0.005	B	0.13407	0.009	T	0.16158	-1.0412	10	0.02654	T	1	-21.1225	8.7429	0.34569	0.1179:0.0:0.8821:0.0	.	72	Q8NE28	SGK71_HUMAN	K	72	ENSP00000398807:E72K;ENSP00000361025:E72K	ENSP00000361025:E72K	E	+	1	0	C9orf96	135239500	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	1.805000	0.38883	2.086000	0.62901	0.379000	0.24179	GAG	.	.	.	none		0.483	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054855.1		
RNF208	727800	hgsc.bcm.edu	37	9	140115231	140115231	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr9:140115231G>A	ENST00000392827.1	-	2	602	c.434C>T	c.(433-435)aCc>aTc	p.T145I	RNF208_ENST00000391553.1_Missense_Mutation_p.T145I			Q9H0X6	RN208_HUMAN	ring finger protein 208	145					protein autoubiquitination (GO:0051865)		ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			lung(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		GTGCCCACAGGTGGGGCACTC	0.647																																					p.T145I		Atlas-SNP	.											.	RNF208	11	.	0			c.C434T						PASS	.						14.0	18.0	17.0					9																	140115231		2180	4291	6471	SO:0001583	missense	727800	exon1			CCACAGGTGGGGC	AF416715	CCDS7037.2	9q34.3	2007-01-19				ENSG00000212864		"""RING-type (C3HC4) zinc fingers"""	25420	protein-coding gene	gene with protein product						11230166	Standard	NM_031297		Approved	DKFZP761H1710	uc004clz.2	Q9H0X6		ENST00000392827.1:c.434C>T	chr9.hg19:g.140115231G>A	ENSP00000376572:p.Thr145Ile	146.0	0.0	.		95.0	35.0	.	NM_031297	A2BFA0	Missense_Mutation	SNP	ENST00000392827.1	hg19	CCDS7037.2	.	.	.	.	.	.	.	.	.	.	G	12.78	2.040448	0.35989	.	.	ENSG00000212864	ENST00000392827;ENST00000391553	T;T	0.46063	0.88;0.88	4.01	4.01	0.46588	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.137415	0.47093	D	0.000241	T	0.13713	0.0332	N	0.00569	-1.365	0.53005	D	0.999961	P	0.50156	0.932	P	0.47470	0.548	T	0.36383	-0.9750	10	0.02654	T	1	-17.7848	8.7913	0.34852	0.1066:0.0:0.8934:0.0	.	145	Q9H0X6	RN208_HUMAN	I	145	ENSP00000376572:T145I;ENSP00000375397:T145I	ENSP00000375397:T145I	T	-	2	0	RNF208	139235052	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	8.150000	0.89634	2.057000	0.61298	0.491000	0.48974	ACC	.	.	.	none		0.647	RNF208-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254714.1	NM_031297	
BMS1	9790	hgsc.bcm.edu	37	10	43326332	43326332	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr10:43326332G>C	ENST00000374518.5	+	23	3700	c.3637G>C	c.(3637-3639)Gct>Cct	p.A1213P	RNU6-885P_ENST00000516607.1_RNA	NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	1213					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						ACTGCTGGATGCTCTGAGTAC	0.512																																					p.A1213P		Atlas-SNP	.											.	BMS1	132	.	0			c.G3637C						PASS	.						33.0	31.0	32.0					10																	43326332		2203	4300	6503	SO:0001583	missense	9790	exon23			CTGGATGCTCTGA	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.3637G>C	chr10.hg19:g.43326332G>C	ENSP00000363642:p.Ala1213Pro	123.0	0.0	.		115.0	32.0	.	NM_014753	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	hg19	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	G	18.46	3.628175	0.66901	.	.	ENSG00000165733	ENST00000374518	T	0.27720	1.65	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.59797	0.2220	M	0.81682	2.555	0.54753	D	0.999981	D	0.76494	0.999	D	0.83275	0.996	T	0.62572	-0.6826	10	0.48119	T	0.1	.	18.6554	0.91452	0.0:0.0:1.0:0.0	.	1213	Q14692	BMS1_HUMAN	P	1213	ENSP00000363642:A1213P	ENSP00000363642:A1213P	A	+	1	0	BMS1	42646338	1.000000	0.71417	1.000000	0.80357	0.670000	0.39368	6.200000	0.72118	2.395000	0.81488	0.462000	0.41574	GCT	.	.	.	none		0.512	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753	
TMEM26	219623	hgsc.bcm.edu	37	10	63188776	63188776	+	Silent	SNP	T	T	C			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr10:63188776T>C	ENST00000399298.3	-	4	881	c.513A>G	c.(511-513)cgA>cgG	p.R171R	TMEM26_ENST00000399293.1_Silent_p.R171R	NM_178505.6	NP_848600.2	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	171						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	18	Prostate(12;0.0112)					AGAGTTGATCTCGAGTGATCC	0.443																																					p.R171R		Atlas-SNP	.											.	TMEM26	47	.	0			c.A513G						PASS	.						112.0	113.0	112.0					10																	63188776		1932	4132	6064	SO:0001819	synonymous_variant	219623	exon4			TTGATCTCGAGTG	BC042872	CCDS41530.1	10q21.3	2008-10-20			ENSG00000196932	ENSG00000196932			28550	protein-coding gene	gene with protein product						12477932	Standard	NM_178505		Approved	MGC35010, Em:AC068892.1	uc001jlo.2	Q6ZUK4	OTTHUMG00000018293	ENST00000399298.3:c.513A>G	chr10.hg19:g.63188776T>C		126.0	0.0	.		97.0	30.0	.	NM_178505	Q6ZVM0|Q8IVN9	Silent	SNP	ENST00000399298.3	hg19	CCDS41530.1																																																																																			.	.	.	none		0.443	TMEM26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359121.1	NM_178505	
JMJD1C	221037	hgsc.bcm.edu	37	10	64966402	64966402	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr10:64966402C>A	ENST00000399262.2	-	10	5245	c.5027G>T	c.(5026-5028)aGg>aTg	p.R1676M	JMJD1C_ENST00000542921.1_Missense_Mutation_p.R1494M|JMJD1C_ENST00000399251.1_Missense_Mutation_p.R1457M|JMJD1C_ENST00000402544.1_Missense_Mutation_p.R1457M	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	1676					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					TTTGGCACTCCTGCTGAGAAC	0.348																																					p.R1676M		Atlas-SNP	.											.	JMJD1C	347	.	0			c.G5027T						PASS	.						141.0	125.0	130.0					10																	64966402		1829	4095	5924	SO:0001583	missense	221037	exon10			GCACTCCTGCTGA	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.5027G>T	chr10.hg19:g.64966402C>A	ENSP00000382204:p.Arg1676Met	81.0	0.0	.		86.0	21.0	.	NM_032776	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	ENST00000399262.2	hg19	CCDS41532.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.84|16.84	3.233815|3.233815	0.58886|0.58886	.|.	.|.	ENSG00000171988|ENSG00000171988	ENST00000327520|ENST00000399262;ENST00000402544;ENST00000399251;ENST00000542921	.|T;T;T;T	.|0.61742	.|0.42;0.08;1.82;0.42	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.75744	.|0.3891	M|M	0.64997|0.64997	1.995|1.995	0.58432|0.58432	D|D	0.999992|0.999992	.|D;D;D	.|0.89917	.|1.0;1.0;0.999	.|D;D;D	.|0.83275	.|0.991;0.996;0.988	.|T	.|0.76669	.|-0.2874	.|10	.|0.87932	.|D	.|0	-12.9833|-12.9833	19.9283|19.9283	0.97112|0.97112	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1217;1676;1494	.|A6PW35;Q15652;A0T124	.|.;JHD2C_HUMAN;.	X|M	362|1676;1457;1457;1494	.|ENSP00000382204:R1676M;ENSP00000384990:R1457M;ENSP00000382195:R1457M;ENSP00000444682:R1494M	.|ENSP00000382195:R1457M	G|R	-|-	1|2	0|0	JMJD1C|JMJD1C	64636408|64636408	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.818000|7.818000	0.86416|0.86416	2.708000|2.708000	0.92522|0.92522	0.585000|0.585000	0.79938|0.79938	GGA|AGG	.	.	.	none		0.348	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
IFIT1	3434	hgsc.bcm.edu	37	10	91162887	91162887	+	Silent	SNP	C	C	T	rs373034374		TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr10:91162887C>T	ENST00000371804.3	+	2	1022	c.855C>T	c.(853-855)gtC>gtT	p.V285V	IFIT1_ENST00000546318.1_Silent_p.V254V|LIPA_ENST00000371837.1_Intron	NM_001270927.1|NM_001548.4	NP_001257856.1|NP_001539.3	P09914	IFIT1_HUMAN	interferon-induced protein with tetratricopeptide repeats 1	285					cellular response to exogenous dsRNA (GO:0071360)|cellular response to type I interferon (GO:0071357)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|intracellular transport of viral protein in host cell (GO:0019060)|negative regulation of defense response to virus by host (GO:0050689)|negative regulation of helicase activity (GO:0051097)|negative regulation of protein binding (GO:0032091)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(2)|prostate(2)|upper_aerodigestive_tract(1)	15						CCACTTCTGTCTTACTGCATC	0.443																																					p.V285V		Atlas-SNP	.											.	IFIT1	30	.	0			c.C855T						PASS	.						71.0	72.0	72.0					10																	91162887		2203	4300	6503	SO:0001819	synonymous_variant	3434	exon3			TTCTGTCTTACTG	M24594	CCDS31243.1, CCDS59220.1	10q23.31	2014-05-22			ENSG00000185745	ENSG00000185745		"""Tetratricopeptide (TTC) repeat domain containing"""	5407	protein-coding gene	gene with protein product		147690		G10P1, IFI56, IFNAI1		1377167, 3360121	Standard	NM_001548		Approved	GARG-16	uc001kgi.4	P09914	OTTHUMG00000018712	ENST00000371804.3:c.855C>T	chr10.hg19:g.91162887C>T		118.0	0.0	.		92.0	25.0	.	NM_001270927	B3KS50|D3DR31|Q5T7J1|Q96QM5	Silent	SNP	ENST00000371804.3	hg19	CCDS31243.1																																																																																			.	.	.	none		0.443	IFIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049302.1	NM_001548	
SLC35G1	159371	hgsc.bcm.edu	37	10	95660559	95660559	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr10:95660559G>A	ENST00000427197.1	+	3	471	c.410G>A	c.(409-411)gGa>gAa	p.G137E	SLC35G1_ENST00000371408.3_Missense_Mutation_p.G136E	NM_001134658.1|NM_153226.2	NP_001128130.1|NP_694958.1	Q2M3R5	S35G1_HUMAN	solute carrier family 35, member G1	137	EamA 1.				calcium ion export from cell (GO:1990034)|cytosolic calcium ion homeostasis (GO:0051480)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											ATTCTCAGAGGAGTCCTTGGT	0.383																																					p.G137E		Atlas-SNP	.											.	.	.	.	0			c.G410A						PASS	.						122.0	114.0	116.0					10																	95660559		2203	4299	6502	SO:0001583	missense	159371	exon3			TCAGAGGAGTCCT	AK091309	CCDS7432.1, CCDS44459.1	10q23.33	2013-05-22	2011-08-03	2011-08-03	ENSG00000176273	ENSG00000176273		"""Solute carriers"""	26607	protein-coding gene	gene with protein product			"""transmembrane protein 20"""	TMEM20		21569384	Standard	NM_153226		Approved	FLJ33990, C10orf60	uc001kjg.2	Q2M3R5	OTTHUMG00000018779	ENST00000427197.1:c.410G>A	chr10.hg19:g.95660559G>A	ENSP00000400932:p.Gly137Glu	91.0	0.0	.		96.0	24.0	.	NM_001134658	Q86YG5|Q8NBA5	Missense_Mutation	SNP	ENST00000427197.1	hg19	CCDS44459.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.268246	0.80469	.	.	ENSG00000176273	ENST00000371408;ENST00000427197	T;T	0.59502	0.26;0.26	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.83575	0.5284	M	0.93375	3.41	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.997	D	0.86713	0.1937	10	0.87932	D	0	.	20.3812	0.98933	0.0:0.0:1.0:0.0	.	120;137;136	B7ZKP0;Q2M3R5;Q2M3R5-2	.;S35G1_HUMAN;.	E	136;137	ENSP00000360462:G136E;ENSP00000400932:G137E	ENSP00000360462:G136E	G	+	2	0	SLC35G1	95650549	1.000000	0.71417	0.977000	0.42913	0.924000	0.55760	7.540000	0.82074	2.821000	0.97095	0.650000	0.86243	GGA	.	.	.	none		0.383	SLC35G1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_153226	
SORBS1	10580	hgsc.bcm.edu	37	10	97143753	97143753	+	Silent	SNP	T	T	C			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr10:97143753T>C	ENST00000361941.3	-	15	1553	c.1527A>G	c.(1525-1527)tcA>tcG	p.S509S	SORBS1_ENST00000371247.2_Silent_p.S509S|SORBS1_ENST00000371241.1_Silent_p.S299S|SORBS1_ENST00000474353.2_5'UTR|SORBS1_ENST00000353505.5_Silent_p.S394S|SORBS1_ENST00000277982.5_Silent_p.S531S|SORBS1_ENST00000393949.1_Silent_p.S479S|SORBS1_ENST00000371249.2_Silent_p.S431S|SORBS1_ENST00000371227.4_Silent_p.S463S|SORBS1_ENST00000371246.2_Silent_p.S531S|SORBS1_ENST00000607232.1_Silent_p.S298S|SORBS1_ENST00000371245.3_Silent_p.S394S|SORBS1_ENST00000347291.4_Silent_p.S377S|SORBS1_ENST00000354106.3_Silent_p.S479S|SORBS1_ENST00000306402.6_Silent_p.S340S|SORBS1_ENST00000371239.1_Silent_p.S308S	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		TTTCTGAGCTTGACTTCAGTG	0.502																																					p.S531S		Atlas-SNP	.											.	SORBS1	185	.	0			c.A1593G						PASS	.						92.0	88.0	89.0					10																	97143753		2203	4300	6503	SO:0001819	synonymous_variant	10580	exon15			TGAGCTTGACTTC	AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.1527A>G	chr10.hg19:g.97143753T>C		136.0	0.0	.		108.0	26.0	.	NM_001034955		Silent	SNP	ENST00000361941.3	hg19	CCDS31255.1																																																																																			.	.	.	none		0.502	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049517.1		
GAL3ST3	89792	hgsc.bcm.edu	37	11	65810751	65810751	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr11:65810751C>T	ENST00000312006.4	-	3	804	c.523G>A	c.(523-525)Gta>Ata	p.V175I	GAL3ST3_ENST00000527878.1_Missense_Mutation_p.V175I	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	175					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)	p.V175I(1)		kidney(1)|lung(9)|ovary(2)|skin(2)	14						GCGTTGGGTACGCGCCGGAAG	0.662																																					p.V175I		Atlas-SNP	.											GAL3ST3,NS,carcinoma,0,1	GAL3ST3	40	.	1	Substitution - Missense(1)	ovary(1)	c.G523A						PASS	.						36.0	40.0	39.0					11																	65810751		2201	4292	6493	SO:0001583	missense	89792	exon3			TGGGTACGCGCCG	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.523G>A	chr11.hg19:g.65810751C>T	ENSP00000308591:p.Val175Ile	160.0	0.0	.		98.0	22.0	.	NM_033036	Q14D05	Missense_Mutation	SNP	ENST00000312006.4	hg19	CCDS8128.1	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919606	0.73098	.	.	ENSG00000175229	ENST00000312006;ENST00000527878	T;T	0.15139	2.45;2.45	4.65	4.65	0.58169	.	0.000000	0.64402	D	0.000002	T	0.30916	0.0780	L	0.51422	1.61	0.49130	D	0.99975	D	0.71674	0.998	P	0.59171	0.853	T	0.01273	-1.1399	10	0.37606	T	0.19	-34.5923	15.4161	0.74970	0.0:1.0:0.0:0.0	.	175	Q96A11	G3ST3_HUMAN	I	175	ENSP00000308591:V175I;ENSP00000434829:V175I	ENSP00000308591:V175I	V	-	1	0	GAL3ST3	65567327	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.992000	0.63889	2.304000	0.77564	0.561000	0.74099	GTA	.	.	.	none		0.662	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
OR2AT4	341152	hgsc.bcm.edu	37	11	74800264	74800264	+	Silent	SNP	T	T	C			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr11:74800264T>C	ENST00000305159.3	-	1	535	c.495A>G	c.(493-495)gtA>gtG	p.V165V		NM_001005285.1	NP_001005285.1	A6NND4	O2AT4_HUMAN	olfactory receptor, family 2, subfamily AT, member 4	165						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(2)	12						AGGTCCTTACTACTGCTGGGA	0.572																																					p.V165V		Atlas-SNP	.											.	OR2AT4	32	.	0			c.A495G						PASS	.						101.0	94.0	96.0					11																	74800264		2200	4293	6493	SO:0001819	synonymous_variant	341152	exon1			CCTTACTACTGCT	BK004820	CCDS31639.1	11q13.4	2012-08-09			ENSG00000171561	ENSG00000171561		"""GPCR / Class A : Olfactory receptors"""	19620	protein-coding gene	gene with protein product							Standard	NM_001005285		Approved		uc010rro.2	A6NND4	OTTHUMG00000165370	ENST00000305159.3:c.495A>G	chr11.hg19:g.74800264T>C		74.0	0.0	.		60.0	15.0	.	NM_001005285	B9EGZ8	Silent	SNP	ENST00000305159.3	hg19	CCDS31639.1																																																																																			.	.	.	none		0.572	OR2AT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383734.1	NM_001005285	
ANKK1	255239	hgsc.bcm.edu	37	11	113270138	113270138	+	Missense_Mutation	SNP	C	C	T	rs533347208		TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr11:113270138C>T	ENST00000303941.3	+	8	1541	c.1447C>T	c.(1447-1449)Cgt>Tgt	p.R483C		NM_178510.1	NP_848605.1	Q8NFD2	ANKK1_HUMAN	ankyrin repeat and kinase domain containing 1	483							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|stomach(1)	29		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)		TCTGGTCTCCCGTCAGGCTGA	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		19582	0.0		0.0	False		,,,				2504	0.001				p.R483C		Atlas-SNP	.											.	ANKK1	83	.	0			c.C1447T						PASS	.						15.0	17.0	17.0					11																	113270138		2044	4191	6235	SO:0001583	missense	255239	exon8			GTCTCCCGTCAGG	AJ541797	CCDS44734.1	11q23.2	2013-01-10			ENSG00000170209	ENSG00000170209		"""Ankyrin repeat domain containing"""	21027	protein-coding gene	gene with protein product		608774				15146457	Standard	NM_178510		Approved	X-kinase	uc001pny.3	Q8NFD2	OTTHUMG00000167715	ENST00000303941.3:c.1447C>T	chr11.hg19:g.113270138C>T	ENSP00000306678:p.Arg483Cys	54.0	0.0	.		60.0	14.0	.	NM_178510		Missense_Mutation	SNP	ENST00000303941.3	hg19	CCDS44734.1	.	.	.	.	.	.	.	.	.	.	C	9.382	1.073302	0.20147	.	.	ENSG00000170209	ENST00000303941	T	0.65732	-0.17	4.72	3.8	0.43715	Ankyrin repeat-containing domain (4);	0.098482	0.44285	D	0.000477	T	0.56558	0.1993	L	0.50993	1.605	0.50467	D	0.999877	B	0.26512	0.151	B	0.28385	0.089	T	0.58075	-0.7700	10	0.54805	T	0.06	-5.0248	12.429	0.55563	0.0:0.918:0.0:0.082	.	483	Q8NFD2	ANKK1_HUMAN	C	483	ENSP00000306678:R483C	ENSP00000306678:R483C	R	+	1	0	ANKK1	112775348	0.033000	0.19621	0.646000	0.29493	0.265000	0.26407	0.648000	0.24828	1.210000	0.43336	0.557000	0.71058	CGT	.	.	.	none		0.607	ANKK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395830.1	NM_178510	
CLSTN3	9746	hgsc.bcm.edu	37	12	7293886	7293886	+	Missense_Mutation	SNP	A	A	C			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr12:7293886A>C	ENST00000266546.6	+	9	1822	c.1372A>C	c.(1372-1374)Aca>Cca	p.T458P	CLSTN3_ENST00000537408.1_Missense_Mutation_p.T470P	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	458					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						CGAGTTCCCCACAGTCACACT	0.562											OREG0021650	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T458P		Atlas-SNP	.											.	CLSTN3	84	.	0			c.A1372C						PASS	.						358.0	263.0	295.0					12																	7293886		2203	4300	6503	SO:0001583	missense	9746	exon9			TTCCCCACAGTCA	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.1372A>C	chr12.hg19:g.7293886A>C	ENSP00000266546:p.Thr458Pro	137.0	0.0	.	640	147.0	36.0	.	NM_014718	D3DUT6|O94831|Q2T9J5|Q5UE57	Missense_Mutation	SNP	ENST00000266546.6	hg19	CCDS8575.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.337391	0.81911	.	.	ENSG00000139182	ENST00000266546;ENST00000537408	T;T	0.76060	-0.99;-0.99	5.38	5.38	0.77491	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.053114	0.85682	D	0.000000	T	0.79764	0.4502	L	0.50333	1.59	0.50632	D	0.99988	D;P	0.59767	0.986;0.888	P;P	0.58928	0.848;0.817	T	0.77814	-0.2448	10	0.30854	T	0.27	-11.2766	15.395	0.74784	1.0:0.0:0.0:0.0	.	470;458	Q5UE57;Q9BQT9	.;CSTN3_HUMAN	P	458;470	ENSP00000266546:T458P;ENSP00000440679:T470P	ENSP00000266546:T458P	T	+	1	0	CLSTN3	7185153	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.596000	0.67570	2.033000	0.60031	0.374000	0.22700	ACA	.	.	.	none		0.562	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718	
PUS7L	83448	hgsc.bcm.edu	37	12	44142290	44142290	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr12:44142290A>G	ENST00000416848.2	-	3	1521	c.1033T>C	c.(1033-1035)Tat>Cat	p.Y345H	PUS7L_ENST00000431332.3_Missense_Mutation_p.Y32H|PUS7L_ENST00000344862.5_Missense_Mutation_p.Y345H|PUS7L_ENST00000551923.1_Missense_Mutation_p.Y345H|PUS7L_ENST00000553166.1_Missense_Mutation_p.Y345H	NM_001098615.1|NM_001271826.1	NP_001092085.1|NP_001258755.1	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S. cerevisiae)-like	345					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)	p.Y345H(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(15)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		ATTGCTTGATAGGTGATGGCT	0.343																																					p.Y345H		Atlas-SNP	.											PUS7L,NS,carcinoma,0,1	PUS7L	73	.	1	Substitution - Missense(1)	kidney(1)	c.T1033C						PASS	.						140.0	144.0	143.0					12																	44142290		2203	4300	6503	SO:0001583	missense	83448	exon3			CTTGATAGGTGAT	BX647494	CCDS8743.1, CCDS61104.1	12q12	2006-02-07				ENSG00000129317			25276	protein-coding gene	gene with protein product						11230166	Standard	NM_001098615		Approved	DKFZP434G1415	uc001rnr.5	Q9H0K6	OTTHUMG00000169423	ENST00000416848.2:c.1033T>C	chr12.hg19:g.44142290A>G	ENSP00000415899:p.Tyr345His	128.0	0.0	.		110.0	24.0	.	NM_001098614	B3KUJ1|Q05CU0|Q6AHZ3|Q6NUP2	Missense_Mutation	SNP	ENST00000416848.2	hg19	CCDS8743.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.483340	0.84854	.	.	ENSG00000129317	ENST00000416848;ENST00000344862;ENST00000551923;ENST00000431332;ENST00000550784;ENST00000547156;ENST00000553166	T;T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98;0.98	4.79	4.79	0.61399	Pseudouridine synthase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.65037	0.2653	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.65138	-0.6241	10	0.23891	T	0.37	-21.9291	15.0286	0.71687	1.0:0.0:0.0:0.0	.	345	Q9H0K6	PUS7L_HUMAN	H	345;345;345;32;32;32;345	ENSP00000415899:Y345H;ENSP00000343081:Y345H;ENSP00000447706:Y345H;ENSP00000398497:Y32H;ENSP00000449222:Y32H;ENSP00000450341:Y32H;ENSP00000446865:Y345H	ENSP00000343081:Y345H	Y	-	1	0	PUS7L	42428557	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.003000	0.93577	2.068000	0.61886	0.460000	0.39030	TAT	.	.	.	none		0.343	PUS7L-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403931.1	NM_031292	
ATP12A	479	hgsc.bcm.edu	37	13	25284611	25284611	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr13:25284611G>C	ENST00000381946.3	+	20	2944	c.2777G>C	c.(2776-2778)aGg>aCg	p.R926T	ATP12A_ENST00000218548.6_Missense_Mutation_p.R932T			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	926					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		AGGTACCAGAGGGAATACCTA	0.453																																					p.R932T	Pancreas(156;1582 1935 18898 22665 26498)	Atlas-SNP	.											.	ATP12A	172	.	0			c.G2795C						PASS	.						90.0	89.0	89.0					13																	25284611		2203	4300	6503	SO:0001583	missense	479	exon20			ACCAGAGGGAATA	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.2777G>C	chr13.hg19:g.25284611G>C	ENSP00000371372:p.Arg926Thr	141.0	0.0	.		143.0	38.0	.	NM_001185085	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	hg19	CCDS31948.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.095193	0.56075	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	D;D	0.88818	-2.43;-2.43	5.19	5.19	0.71726	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.96068	0.8719	H	0.94771	3.58	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.97076	0.9781	10	0.87932	D	0	.	16.5892	0.84760	0.0:0.0:1.0:0.0	.	932;926	P54707-2;P54707	.;AT12A_HUMAN	T	932;926	ENSP00000218548:R932T;ENSP00000371372:R926T	ENSP00000218548:R932T	R	+	2	0	ATP12A	24182611	1.000000	0.71417	0.966000	0.40874	0.025000	0.11179	9.393000	0.97256	2.565000	0.86533	0.655000	0.94253	AGG	.	.	.	none		0.453	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676	
TSC22D1	8848	hgsc.bcm.edu	37	13	45148256	45148256	+	Missense_Mutation	SNP	G	G	A	rs370025988		TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr13:45148256G>A	ENST00000458659.2	-	1	2445	c.1955C>T	c.(1954-1956)cCt>cTt	p.P652L	TSC22D1_ENST00000501704.2_Intron|TSC22D1_ENST00000460842.1_5'Flank	NM_183422.3	NP_904358.2	Q15714	T22D1_HUMAN	TSC22 domain family, member 1	652	Gln-rich.		P -> S (in dbSNP:rs9525983).		negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)		CTCTGAAGCAGGATTTTGAGT	0.502																																					p.P652L		Atlas-SNP	.											.	TSC22D1	88	.	0			c.C1955T						PASS	.	G	LEU/PRO	0,4406		0,0,2203	108.0	102.0	104.0		1955	3.0	0.0	13		104	1,8599		0,1,4299	no	missense	TSC22D1	NM_183422.3	98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	652/1074	45148256	1,13005	2203	4300	6503	SO:0001583	missense	8848	exon1			GAAGCAGGATTTT	AJ222700	CCDS9392.1, CCDS31966.1, CCDS58291.1, CCDS73565.1	13q14	2008-02-05	2005-03-01	2005-03-03	ENSG00000102804	ENSG00000102804			16826	protein-coding gene	gene with protein product		607715	"""transforming growth factor beta 1 induced transcript 4"""	TGFB1I4		8651929, 9022669	Standard	NM_183422		Approved	TSC22, MGC17597	uc001uzn.4	Q15714	OTTHUMG00000016838	ENST00000458659.2:c.1955C>T	chr13.hg19:g.45148256G>A	ENSP00000397435:p.Pro652Leu	55.0	0.0	.		53.0	21.0	.	NM_183422	B3KRL7|B9EGI0|O00666|Q6AHX5|Q6IBU1|Q8NCN1|Q96JS5	Missense_Mutation	SNP	ENST00000458659.2	hg19	CCDS31966.1	.	.	.	.	.	.	.	.	.	.	G	6.215	0.407805	0.11754	0.0	1.16E-4	ENSG00000102804	ENST00000458659	T	0.33654	1.4	4.74	3.02	0.34903	.	0.346611	0.25065	N	0.033401	T	0.23926	0.0579	L	0.27053	0.805	0.23260	N	0.998024	B	0.06786	0.001	B	0.04013	0.001	T	0.15350	-1.0440	10	0.33940	T	0.23	.	9.9987	0.41916	0.1633:0.0:0.8367:0.0	.	652	Q15714	T22D1_HUMAN	L	652	ENSP00000397435:P652L	ENSP00000397435:P652L	P	-	2	0	TSC22D1	44046256	0.997000	0.39634	0.037000	0.18230	0.867000	0.49689	5.011000	0.64011	0.626000	0.30322	0.491000	0.48974	CCT	.	.	.	weak		0.502	TSC22D1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044743.2	NM_006022	
CDC16	8881	hgsc.bcm.edu	37	13	115008769	115008769	+	Silent	SNP	G	G	T			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr13:115008769G>T	ENST00000356221.3	+	7	687	c.579G>T	c.(577-579)ctG>ctT	p.L193L	CDC16_ENST00000375308.1_Silent_p.L99L|CDC16_ENST00000252457.5_Silent_p.L192L|MIR548AR_ENST00000582191.1_RNA|CDC16_ENST00000375312.3_Silent_p.L99L|CDC16_ENST00000375310.1_Silent_p.L99L|CDC16_ENST00000252458.6_Silent_p.L99L|CDC16_ENST00000360383.3_Silent_p.L193L			Q13042	CDC16_HUMAN	cell division cycle 16	193					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of mitosis (GO:0007088)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|spindle (GO:0005819)				endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)			TTAGCAAGCTGTGTAATGAAG	0.308																																					p.L193L		Atlas-SNP	.											.	CDC16	50	.	0			c.G579T						PASS	.						77.0	82.0	81.0					13																	115008769		2203	4298	6501	SO:0001819	synonymous_variant	8881	exon7			CAAGCTGTGTAAT	U18291	CCDS9542.2	13q34	2013-01-17	2013-01-17		ENSG00000130177	ENSG00000130177		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1720	protein-coding gene	gene with protein product	"""anaphase-promoting complex, subunit 6"""	603461	"""CDC16 (cell division cycle 16, S. cerevisiae, homolog)"", ""CDC16 cell division cycle 16 homolog (S. cerevisiae)"", ""cell division cycle 16 homolog (S. cerevisiae)"""			7736578	Standard	NM_001078645		Approved	APC6, ANAPC6, CUT9	uc001vul.1	Q13042	OTTHUMG00000017402	ENST00000356221.3:c.579G>T	chr13.hg19:g.115008769G>T		565.0	0.0	.		467.0	135.0	.	NM_003903	A2A365|Q5T8C8|Q96AE6|Q9Y564	Silent	SNP	ENST00000356221.3	hg19	CCDS9542.2																																																																																			.	.	.	none		0.308	CDC16-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276737.1	NM_003903	
CHMP4A	29082	hgsc.bcm.edu	37	14	24682658	24682658	+	5'UTR	SNP	T	T	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr14:24682658T>A	ENST00000609024.1	-	0	36				MDP1_ENST00000532557.1_5'Flank|CHMP4A_ENST00000530996.1_5'UTR|TM9SF1_ENST00000530611.1_5'UTR|AL136419.6_ENST00000565988.1_RNA|NEDD8-MDP1_ENST00000604306.1_5'Flank|CHMP4A_ENST00000542700.2_5'Flank|TM9SF1_ENST00000556387.1_5'UTR|CHMP4A_ENST00000347519.6_Missense_Mutation_p.R39S			Q9BY43	CHM4A_HUMAN	charged multivesicular body protein 4A						endosomal transport (GO:0016197)|membrane budding (GO:0006900)|membrane organization (GO:0061024)|membrane tubulation (GO:0097320)|negative regulation of autophagic vacuole assembly (GO:1902902)|negative regulation of neuron death (GO:1901215)|posttranslational protein targeting to membrane (GO:0006620)|protein homooligomerization (GO:0051260)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|ESCRT III complex (GO:0000815)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)			NS(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)	9				GBM - Glioblastoma multiforme(265;0.0181)		CGAGCTCGCCTCTCCCGCCTC	0.667																																					p.R39S		Atlas-SNP	.											.	CHMP4A	20	.	0			c.A117T						PASS	.						45.0	42.0	43.0					14																	24682658		2203	4300	6503	SO:0001623	5_prime_UTR_variant	29082	exon1			CTCGCCTCTCCCG	AF212243	CCDS9619.1	14q12	2012-10-04	2011-09-21	2005-04-04	ENSG00000254505	ENSG00000254505		"""Charged multivesicular body proteins"""	20274	protein-coding gene	gene with protein product		610051	"""chromosome 14 open reading frame 123"", ""chromatin modifying protein 4A"""	C14orf123			Standard	NM_014169		Approved	HSPC134, VPS32A		Q9BY43	OTTHUMG00000167036	ENST00000609024.1:c.-13A>T	chr14.hg19:g.24682658T>A		99.0	0.0	.		88.0	23.0	.	NM_014169	Q14D22|Q32Q79|Q86SZ8|Q96QJ9|Q9P026	Missense_Mutation	SNP	ENST00000609024.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.19|13.19	2.163255|2.163255	0.38217|0.38217	.|.	.|.	ENSG00000254505|ENSG00000254505	ENST00000347519|ENST00000548308	T|.	0.60171|.	0.21|.	4.72|4.72	2.17|2.17	0.27698|0.27698	.|.	.|.	.|.	.|.	.|.	T|T	0.18800|0.18800	0.0451|0.0451	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.24186|.	0.099|.	B|.	0.17433|.	0.018|.	T|T	0.19745|0.19745	-1.0296|-1.0296	9|6	0.08599|0.66056	T|D	0.76|0.02	-4.2019|-4.2019	4.1034|4.1034	0.10025|0.10025	0.0:0.1223:0.2032:0.6745|0.0:0.1223:0.2032:0.6745	.|.	39|.	Q14D22|.	.|.	S|W	39|16	ENSP00000324205:R39S|.	ENSP00000324205:R39S|ENSP00000448488:R16W	R|R	-|-	3|1	2|2	AL096870.1|AL096870.1	23752498|23752498	0.004000|0.004000	0.15560|0.15560	0.043000|0.043000	0.18650|0.18650	0.292000|0.292000	0.27327|0.27327	-0.000000|-0.000000	0.12993|0.12993	0.257000|0.257000	0.21650|0.21650	0.533000|0.533000	0.62120|0.62120	AGA|AGG	.	.	.	none		0.667	CHMP4A-012	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471846.1	NM_014169	
NID2	22795	hgsc.bcm.edu	37	14	52534874	52534874	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr14:52534874G>A	ENST00000216286.5	-	2	235	c.236C>T	c.(235-237)aCc>aTc	p.T79I	NID2_ENST00000541773.1_Missense_Mutation_p.T26I	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	79					basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					GATGCCGTTGGTGCCCACCTG	0.582																																					p.T79I		Atlas-SNP	.											.	NID2	201	.	0			c.C236T						PASS	.						44.0	56.0	52.0					14																	52534874		2203	4300	6503	SO:0001583	missense	22795	exon2			CCGTTGGTGCCCA	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.236C>T	chr14.hg19:g.52534874G>A	ENSP00000216286:p.Thr79Ile	54.0	0.0	.		47.0	9.0	.	NM_007361	A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	hg19	CCDS9706.1	.	.	.	.	.	.	.	.	.	.	G	19.93	3.918213	0.73098	.	.	ENSG00000087303	ENST00000216286;ENST00000316204;ENST00000541773;ENST00000395707	T;T	0.26067	1.76;1.76	5.26	4.35	0.52113	.	0.044090	0.85682	D	0.000000	T	0.56470	0.1987	M	0.89840	3.065	0.38188	D	0.939836	D;D;D	0.64830	0.98;0.994;0.993	P;D;D	0.64595	0.837;0.919;0.927	T	0.70880	-0.4752	10	0.72032	D	0.01	.	15.0557	0.71912	0.0:0.0:0.8565:0.1435	.	26;81;79	Q14112-2;Q5CZI2;Q14112	.;.;NID2_HUMAN	I	79;79;26;81	ENSP00000216286:T79I;ENSP00000443730:T26I	ENSP00000216286:T79I	T	-	2	0	NID2	51604624	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.186000	0.94906	1.169000	0.42739	0.563000	0.77884	ACC	.	.	.	none		0.582	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
NAA30	122830	hgsc.bcm.edu	37	14	57863579	57863579	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr14:57863579G>A	ENST00000556492.1	+	3	1035	c.881G>A	c.(880-882)aGg>aAg	p.R294K	NAA30_ENST00000554703.1_Missense_Mutation_p.R36K|NAA30_ENST00000555166.1_Missense_Mutation_p.R36K	NM_001011713.2	NP_001011713.2	Q147X3	NAA30_HUMAN	N(alpha)-acetyltransferase 30, NatC catalytic subunit	294	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				metabolic process (GO:0008152)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)	peptide alpha-N-acetyltransferase activity (GO:0004596)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(2)|skin(2)	13						TCCAAATACAGGAGAAATGGC	0.358																																					p.R294K		Atlas-SNP	.											.	NAA30	30	.	0			c.G881A						PASS	.						136.0	127.0	130.0					14																	57863579		2203	4300	6503	SO:0001583	missense	122830	exon3			AATACAGGAGAAA	AK092674	CCDS32088.1	14q22.2	2010-05-07	2010-01-14	2010-01-14		ENSG00000139977	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	19844	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 35"", ""N-acetyltransferase 12"", ""N-acetyltransferase 12 (GCN5-related, putative)"""	C14orf35, NAT12		19660095	Standard	NM_001011713		Approved	FLJ35355, MAK3, Mak3p	uc001xcx.4	Q147X3		ENST00000556492.1:c.881G>A	chr14.hg19:g.57863579G>A	ENSP00000452521:p.Arg294Lys	96.0	0.0	.		95.0	37.0	.	NM_001011713	Q0IIN2	Missense_Mutation	SNP	ENST00000556492.1	hg19	CCDS32088.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.542518|5.542518	0.96474|0.96474	.|.	.|.	ENSG00000139977|ENSG00000139977	ENST00000298406|ENST00000555166;ENST00000556492;ENST00000554703;ENST00000395257	.|T;T;T	.|0.37584	.|1.19;1.19;1.19	5.95|5.95	5.95|5.95	0.96441|0.96441	.|GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.67173|0.67173	0.2865|0.2865	M|M	0.85373|0.85373	2.75|2.75	0.80722|0.80722	D|D	1|1	.|D	.|0.60160	.|0.987	.|D	.|0.74348	.|0.983	T|T	0.70219|0.70219	-0.4932|-0.4932	5|10	.|0.87932	.|D	.|0	-9.037|-9.037	20.3931|20.3931	0.98965|0.98965	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|294	.|Q147X3	.|NAA30_HUMAN	R|K	106|36;294;36;257	.|ENSP00000450939:R36K;ENSP00000452521:R294K;ENSP00000451255:R36K	.|ENSP00000298406:R294K	G|R	+|+	1|2	0|0	NAA30|NAA30	56933332|56933332	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.600000|9.600000	0.98282|0.98282	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	GGA|AGG	.	.	.	none		0.358	NAA30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412925.1	NM_001011713	
PTPN21	11099	hgsc.bcm.edu	37	14	88935278	88935278	+	Silent	SNP	G	G	C			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr14:88935278G>C	ENST00000556564.1	-	18	3662	c.3378C>G	c.(3376-3378)gcC>gcG	p.A1126A	PTPN21_ENST00000328736.3_Silent_p.A1126A	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	1126	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GTTCCAGGCAGGCGATCATGA	0.532																																					p.A1126A		Atlas-SNP	.											.	PTPN21	113	.	0			c.C3378G						PASS	.						115.0	99.0	105.0					14																	88935278		2203	4300	6503	SO:0001819	synonymous_variant	11099	exon18			CAGGCAGGCGATC	X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.3378C>G	chr14.hg19:g.88935278G>C		99.0	0.0	.		92.0	28.0	.	NM_007039		Silent	SNP	ENST00000556564.1	hg19	CCDS9884.1																																																																																			.	.	.	none		0.532	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410303.1		
ZNF839	55778	hgsc.bcm.edu	37	14	102800982	102800982	+	Splice_Site	SNP	A	A	C			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr14:102800982A>C	ENST00000558850.1	+	4	1510	c.1160A>C	c.(1159-1161)aAg>aCg	p.K387T	ZNF839_ENST00000442396.2_Splice_Site_p.K503T|ZNF839_ENST00000262236.5_Splice_Site_p.K387T|ZNF839_ENST00000559185.1_Splice_Site_p.K387T	NM_001267827.1	NP_001254756.1	A8K0R7	ZN839_HUMAN	zinc finger protein 839	387							metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19						CTTCTGATGAAGGTGAGTACT	0.398																																					p.K503T		Atlas-SNP	.											.	ZNF839	41	.	0			c.A1508C						PASS	.						126.0	116.0	119.0					14																	102800982		1913	4131	6044	SO:0001630	splice_region_variant	55778	exon4			TGATGAAGGTGAG	AK093342	CCDS45164.1, CCDS58336.1	14q32.32	2010-05-06	2008-06-23	2008-06-23	ENSG00000022976	ENSG00000022976			20345	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 131"""	C14orf131			Standard	NM_018335		Approved		uc010awk.2	A8K0R7		ENST00000558850.1:c.1161+1A>C	chr14.hg19:g.102800982A>C		90.0	0.0	.		97.0	33.0	.	NM_018335	B3KSD2|Q53FH5|Q6GPI5|Q86TU1|Q9BQ86|Q9NUU3	Missense_Mutation	SNP	ENST00000558850.1	hg19	CCDS58336.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.215665	0.79352	.	.	ENSG00000022976	ENST00000442396;ENST00000262236;ENST00000398436	T;T	0.37915	1.17;1.17	4.89	4.89	0.63831	.	0.506554	0.19538	N	0.111863	T	0.58906	0.2155	M	0.67397	2.05	0.40741	D	0.982836	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.63875	-0.6538	10	0.87932	D	0	.	14.8202	0.70068	1.0:0.0:0.0:0.0	.	503;387;266;387	A8K0R7-5;A8K0R7-2;Q9NT83;A8K0R7	.;.;.;ZN839_HUMAN	T	503;387;55	ENSP00000399863:K503T;ENSP00000262236:K387T	ENSP00000262236:K387T	K	+	2	0	ZNF839	101870735	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	5.967000	0.70403	1.967000	0.57214	0.459000	0.35465	AAG	.	.	.	none		0.398	ZNF839-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000415492.2	NM_018335	Missense_Mutation
RORA	6095	hgsc.bcm.edu	37	15	60797807	60797807	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr15:60797807G>A	ENST00000335670.6	-	6	942	c.842C>T	c.(841-843)tCt>tTt	p.S281F	RP11-219B17.1_ENST00000558235.1_RNA|RP11-219B17.1_ENST00000558140.1_RNA|RP11-219B17.1_ENST00000559824.1_RNA|RORA_ENST00000449337.2_Missense_Mutation_p.S226F|RORA_ENST00000261523.5_Missense_Mutation_p.S314F|RORA_ENST00000309157.4_Missense_Mutation_p.S306F|RP11-219B17.1_ENST00000501579.2_RNA	NM_134261.2	NP_599023.1	P35398	RORA_HUMAN	RAR-related orphan receptor A	281	Ligand-binding.				angiogenesis (GO:0001525)|cellular response to hypoxia (GO:0071456)|cellular response to sterol (GO:0036315)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|muscle cell differentiation (GO:0042692)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cholesterol homeostasis (GO:2000188)|regulation of glucose metabolic process (GO:0010906)|regulation of macrophage activation (GO:0043030)|regulation of smoothened signaling pathway (GO:0008589)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|regulation of transcription, DNA-templated (GO:0006355)|T-helper 17 cell differentiation (GO:0072539)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator binding (GO:0001223)|transcription corepressor binding (GO:0001222)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	21						ATGCGATTTAGATATATTCTG	0.373																																					p.S314F		Atlas-SNP	.											.	RORA	114	.	0			c.C941T						PASS	.						123.0	127.0	126.0					15																	60797807		2203	4300	6503	SO:0001583	missense	6095	exon7			GATTTAGATATAT	U04897	CCDS10177.1, CCDS10178.1, CCDS10179.1, CCDS45271.1	15q21-q22	2013-01-16			ENSG00000069667	ENSG00000069667		"""Nuclear hormone receptors"""	10258	protein-coding gene	gene with protein product		600825				7926749	Standard	NM_134261		Approved	RZRA, ROR1, ROR2, ROR3, NR1F1	uc002agv.3	P35398	OTTHUMG00000132769	ENST00000335670.6:c.842C>T	chr15.hg19:g.60797807G>A	ENSP00000335087:p.Ser281Phe	102.0	0.0	.		48.0	20.0	.	NM_134260	P35397|P35399|P45445|Q495X4|Q96H83	Missense_Mutation	SNP	ENST00000335670.6	hg19	CCDS10177.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.853080	0.91355	.	.	ENSG00000069667	ENST00000335670;ENST00000449337;ENST00000309157;ENST00000261523	D;D;D;D	0.95001	-3.58;-3.58;-3.58;-3.58	5.78	5.78	0.91487	Nuclear hormone receptor, ligand-binding (2);	0.000000	0.85682	D	0.000000	D	0.94558	0.8247	L	0.29908	0.895	0.80722	D	1	D;D;D;P	0.58620	0.979;0.978;0.983;0.891	P;P;P;P	0.56916	0.809;0.809;0.648;0.707	D	0.93871	0.7162	10	0.44086	T	0.13	.	20.3668	0.98882	0.0:0.0:1.0:0.0	.	281;306;314;226	P35398-2;P35398-3;P35398;P35398-4	.;.;RORA_HUMAN;.	F	281;226;306;314	ENSP00000335087:S281F;ENSP00000402971:S226F;ENSP00000309753:S306F;ENSP00000261523:S314F	ENSP00000261523:S314F	S	-	2	0	RORA	58585099	1.000000	0.71417	0.993000	0.49108	0.985000	0.73830	6.688000	0.74557	2.894000	0.99253	0.655000	0.94253	TCT	.	.	.	none		0.373	RORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256142.2		
PSMD7	5713	hgsc.bcm.edu	37	16	74335517	74335517	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr16:74335517C>G	ENST00000219313.4	+	4	464	c.324C>G	c.(322-324)atC>atG	p.I108M	PSMD7_ENST00000540379.1_Missense_Mutation_p.I31M|PSMD7_ENST00000567958.1_Missense_Mutation_p.I108M|PSMD7_ENST00000568615.2_Missense_Mutation_p.I108M	NM_002811.4	NP_002802.2	P51665	PSMD7_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 7	108	MPN.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	protein homodimerization activity (GO:0042803)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)	15						ACATTGCCATCAACGAACTCA	0.388																																					p.I108M		Atlas-SNP	.											.	PSMD7	29	.	0			c.C324G						PASS	.						127.0	121.0	123.0					16																	74335517		2198	4300	6498	SO:0001583	missense	5713	exon4			TGCCATCAACGAA	D50063	CCDS10910.1	16q22.3	2010-10-15	2007-07-06		ENSG00000103035	ENSG00000103035		"""Proteasome (prosome, macropain) subunits"""	9565	protein-coding gene	gene with protein product	"""Mov34 homolog"""	157970	"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog)"""			7755639	Standard	NM_002811		Approved	S12, P40, MOV34, Rpn8	uc002fcq.3	P51665	OTTHUMG00000137601	ENST00000219313.4:c.324C>G	chr16.hg19:g.74335517C>G	ENSP00000219313:p.Ile108Met	108.0	0.0	.		74.0	15.0	.	NM_002811	D3DWS9|Q6PKI2|Q96E97	Missense_Mutation	SNP	ENST00000219313.4	hg19	CCDS10910.1	.	.	.	.	.	.	.	.	.	.	C	17.95	3.514066	0.64522	.	.	ENSG00000103035	ENST00000219313;ENST00000540379	T;T	0.58060	0.36;0.36	5.71	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.80319	0.4601	H	0.97587	4.035	0.80722	D	1	D	0.71674	0.998	D	0.77004	0.989	D	0.84892	0.0837	10	0.87932	D	0	-19.7916	10.1812	0.42968	0.0:0.8438:0.0:0.1562	.	108	P51665	PSD7_HUMAN	M	108;31	ENSP00000219313:I108M;ENSP00000443925:I31M	ENSP00000219313:I108M	I	+	3	3	PSMD7	72893018	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.033000	0.41136	1.354000	0.45846	0.467000	0.42956	ATC	.	.	.	none		0.388	PSMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269010.2	NM_002811	
CLUH	23277	hgsc.bcm.edu	37	17	2595757	2595757	+	Missense_Mutation	SNP	A	A	C			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr17:2595757A>C	ENST00000570628.2	-	22	3446	c.3341T>G	c.(3340-3342)cTg>cGg	p.L1114R	CLUH_ENST00000538975.1_Missense_Mutation_p.L1114R|CLUH_ENST00000435359.1_Missense_Mutation_p.L1114R			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	1114					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											CACCCCGTGCAGCACCAGCCC	0.711																																					p.L1114R		Atlas-SNP	.											.	.	.	.	0			c.T3341G						PASS	.						22.0	24.0	23.0					17																	2595757		1990	4162	6152	SO:0001583	missense	23277	exon22			CCGTGCAGCACCA	AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.3341T>G	chr17.hg19:g.2595757A>C	ENSP00000458986:p.Leu1114Arg	55.0	0.0	.		36.0	11.0	.	NM_015229	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Missense_Mutation	SNP	ENST00000570628.2	hg19	CCDS45572.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.535700	0.85812	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	D;D	0.95690	-3.78;-3.78	4.79	4.79	0.61399	Tetratricopeptide-like helical (1);	0.000000	0.64402	D	0.000001	D	0.97642	0.9227	M	0.85945	2.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98327	1.0531	10	0.72032	D	0.01	.	13.6522	0.62318	1.0:0.0:0.0:0.0	.	1114;1115	O75153;C9J6D7	K0664_HUMAN;.	R	1114;1115;1114	ENSP00000388872:L1114R;ENSP00000439628:L1114R	ENSP00000320468:L1115R	L	-	2	0	KIAA0664	2542507	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.139000	0.94554	2.017000	0.59298	0.459000	0.35465	CTG	.	.	.	none		0.711	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437807.2	NM_015229	
PER1	5187	hgsc.bcm.edu	37	17	8049997	8049997	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr17:8049997G>T	ENST00000317276.4	-	15	2059	c.1822C>A	c.(1822-1824)Cta>Ata	p.L608I	PER1_ENST00000354903.5_Missense_Mutation_p.L592I|PER1_ENST00000578089.1_5'Flank|PER1_ENST00000581082.1_Missense_Mutation_p.L588I	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	608	Required for phosphorylation by CSNK1E. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						ACCAAGGCTAGTGGGGCCTGG	0.627			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																													p.L608I		Atlas-SNP	.		Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	.	PER1	104	.	0			c.C1822A						PASS	.						41.0	44.0	43.0					17																	8049997		2203	4300	6503	SO:0001583	missense	5187	exon15			AGGCTAGTGGGGC	AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.1822C>A	chr17.hg19:g.8049997G>T	ENSP00000314420:p.Leu608Ile	34.0	0.0	.		38.0	9.0	.	NM_002616	B2RPA8|B4DI49|D3DTR3	Missense_Mutation	SNP	ENST00000317276.4	hg19	CCDS11131.1	.	.	.	.	.	.	.	.	.	.	G	7.390	0.630516	0.14322	.	.	ENSG00000179094	ENST00000317276;ENST00000354903	T;T	0.36340	2.64;1.26	5.16	-0.88	0.10610	.	0.701833	0.13793	N	0.362378	T	0.26048	0.0635	L	0.50333	1.59	0.09310	N	1	B;B	0.22480	0.003;0.07	B;B	0.18263	0.003;0.021	T	0.18967	-1.0320	10	0.28530	T	0.3	-0.3823	5.9627	0.19308	0.2405:0.255:0.5045:0.0	.	592;608	B4DI49;O15534	.;PER1_HUMAN	I	608;592	ENSP00000314420:L608I;ENSP00000346979:L592I	ENSP00000314420:L608I	L	-	1	2	PER1	7990722	0.000000	0.05858	0.000000	0.03702	0.392000	0.30506	-0.131000	0.10482	0.014000	0.14944	0.453000	0.30009	CTA	.	.	.	none		0.627	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2		
KRTAP17-1	83902	hgsc.bcm.edu	37	17	39471774	39471774	+	Silent	SNP	G	G	A	rs368577794|rs386797077		TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr17:39471774G>A	ENST00000334202.3	-	1	173	c.129C>T	c.(127-129)tgC>tgT	p.C43C		NM_031964.1	NP_114170.1	Q9BYP8	KR171_HUMAN	keratin associated protein 17-1	43						intermediate filament (GO:0005882)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			cagagcccccgcagccagagc	0.692													A|||	1	0.000199681	0.0008	0.0	5008	,	,		9728	0.0		0.0	False		,,,				2504	0.0				p.C43C		Atlas-SNP	.											KRTAP17-1,colon,carcinoma,0,3	KRTAP17-1	14	.	0			c.C129T						PASS	.						9.0	13.0	12.0					17																	39471774		2166	4238	6404	SO:0001819	synonymous_variant	83902	exon1			GCCCCCGCAGCCA	AJ406952	CCDS11387.1	17q21.2	2013-06-20			ENSG00000186860	ENSG00000186860		"""Keratin associated proteins"""	18917	protein-coding gene	gene with protein product							Standard	NM_031964		Approved	KAP17.1	uc002hwj.3	Q9BYP8	OTTHUMG00000133433	ENST00000334202.3:c.129C>T	chr17.hg19:g.39471774G>A		60.0	0.0	.		52.0	8.0	.	NM_031964		Silent	SNP	ENST00000334202.3	hg19	CCDS11387.1																																																																																			.	.	.	weak		0.692	KRTAP17-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257296.1		
KRTAP17-1	83902	hgsc.bcm.edu	37	17	39471781	39471781	+	Missense_Mutation	SNP	G	G	C	rs62640394		TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr17:39471781G>C	ENST00000334202.3	-	1	166	c.122C>G	c.(121-123)tCt>tGt	p.S41C		NM_031964.1	NP_114170.1	Q9BYP8	KR171_HUMAN	keratin associated protein 17-1	41						intermediate filament (GO:0005882)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			cccgcagccagagcccccaca	0.687																																					p.S41C		Atlas-SNP	.											KRTAP17-1,caecum,carcinoma,0,1	KRTAP17-1	14	.	0			c.C122G						PASS	.						10.0	13.0	12.0					17																	39471781		2171	4248	6419	SO:0001583	missense	83902	exon1			CAGCCAGAGCCCC	AJ406952	CCDS11387.1	17q21.2	2013-06-20			ENSG00000186860	ENSG00000186860		"""Keratin associated proteins"""	18917	protein-coding gene	gene with protein product							Standard	NM_031964		Approved	KAP17.1	uc002hwj.3	Q9BYP8	OTTHUMG00000133433	ENST00000334202.3:c.122C>G	chr17.hg19:g.39471781G>C	ENSP00000333993:p.Ser41Cys	63.0	0.0	.		51.0	3.0	.	NM_031964		Missense_Mutation	SNP	ENST00000334202.3	hg19	CCDS11387.1	.	.	.	.	.	.	.	.	.	.	G	1.949	-0.441645	0.04604	.	.	ENSG00000186860	ENST00000334202	.	.	.	4.26	-0.59	0.11679	.	.	.	.	.	T	0.20455	0.0492	N	0.02539	-0.55	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.24548	-1.0157	8	0.87932	D	0	0.3694	13.4773	0.61316	0.0:0.6456:0.3544:0.0	rs62640394	41	Q9BYP8	KR171_HUMAN	C	41	.	ENSP00000333993:S41C	S	-	2	0	KRTAP17-1	36725307	0.000000	0.05858	0.000000	0.03702	0.315000	0.28087	-0.356000	0.07661	-0.221000	0.09973	0.462000	0.41574	TCT	.	G|0.984;C|0.016	0.016	weak		0.687	KRTAP17-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257296.1		
EPB41L3	23136	hgsc.bcm.edu	37	18	5397279	5397279	+	Silent	SNP	C	C	T			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr18:5397279C>T	ENST00000341928.2	-	18	2959	c.2619G>A	c.(2617-2619)tcG>tcA	p.S873S	EPB41L3_ENST00000427684.2_Silent_p.S170S|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000540638.2_Silent_p.S651S|EPB41L3_ENST00000400111.3_Silent_p.S651S|EPB41L3_ENST00000342933.3_Silent_p.S873S|EPB41L3_ENST00000544123.1_Silent_p.S704S|EPB41L3_ENST00000542146.1_Silent_p.S178S	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	873	C-terminal (CTD).				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						TGTCTCCCGCCGAGTAAGAAG	0.627																																					p.S873S		Atlas-SNP	.											EPB41L3,NS,carcinoma,0,1	EPB41L3	222	.	0			c.G2619A						PASS	.						73.0	67.0	69.0					18																	5397279		2203	4300	6503	SO:0001819	synonymous_variant	23136	exon18			TCCCGCCGAGTAA	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2619G>A	chr18.hg19:g.5397279C>T		54.0	0.0	.		54.0	16.0	.	NM_012307	B7Z4I5|F5GX05|O95713|Q9BRP5	Silent	SNP	ENST00000341928.2	hg19	CCDS11838.1																																																																																			.	.	.	none		0.627	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
KCTD1	284252	hgsc.bcm.edu	37	18	24056561	24056561	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr18:24056561A>G	ENST00000408011.3	-	3	786	c.227T>C	c.(226-228)tTc>tCc	p.F76S	KCTD1_ENST00000579973.1_Missense_Mutation_p.F76S|KCTD1_ENST00000417602.1_Missense_Mutation_p.F684S|KCTD1_ENST00000580059.1_Missense_Mutation_p.F76S|KCTD1_ENST00000317932.7_Missense_Mutation_p.F76S	NM_001136205.2	NP_001129677.1	Q719H9	KCTD1_HUMAN	potassium channel tetramerization domain containing 1	76	BTB.				negative regulation of transcription, DNA-templated (GO:0045892)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(3)	12	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)			TCTGTCAATGAAATAGTGCTG	0.383																																					p.F684S		Atlas-SNP	.											.	KCTD1	76	.	0			c.T2051C						PASS	.						110.0	93.0	99.0					18																	24056561		2203	4300	6503	SO:0001583	missense	284252	exon3			TCAATGAAATAGT	AF542549	CCDS11888.1	18q11.2	2013-09-20	2013-06-20		ENSG00000134504	ENSG00000134504			18249	protein-coding gene	gene with protein product		613420	"""potassium channel tetramerisation domain containing 1"""	C18orf5			Standard	NM_001142730		Approved		uc010xbj.3	Q719H9	OTTHUMG00000131947	ENST00000408011.3:c.227T>C	chr18.hg19:g.24056561A>G	ENSP00000384367:p.Phe76Ser	100.0	0.0	.		82.0	24.0	.	NM_001142730	A8K1F5	Missense_Mutation	SNP	ENST00000408011.3	hg19	CCDS11888.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.803009	0.90623	.	.	ENSG00000134504	ENST00000317932;ENST00000417602;ENST00000408011	D;D;D	0.84730	-1.89;-1.89;-1.89	5.78	5.78	0.91487	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.95500	0.8538	H	0.98199	4.17	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97229	0.9883	10	0.87932	D	0	.	16.1031	0.81201	1.0:0.0:0.0:0.0	.	76	Q719H9	KCTD1_HUMAN	S	76;684;76	ENSP00000314831:F76S;ENSP00000408405:F684S;ENSP00000384367:F76S	ENSP00000314831:F76S	F	-	2	0	KCTD1	22310559	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.860000	0.92272	2.197000	0.70478	0.528000	0.53228	TTC	.	.	.	none		0.383	KCTD1-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000446265.1	XM_209091	
POLI	11201	hgsc.bcm.edu	37	18	51820257	51820257	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr18:51820257C>A	ENST00000579534.1	+	10	1786	c.1643C>A	c.(1642-1644)tCt>tAt	p.S548Y	POLI_ENST00000579434.1_Missense_Mutation_p.S445Y|POLI_ENST00000217800.5_Missense_Mutation_p.S422Y|POLI_ENST00000406285.3_Missense_Mutation_p.S469Y	NM_007195.2	NP_009126.2	Q9UNA4	POLI_HUMAN	polymerase (DNA directed) iota	548					DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)	intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(5)|ovary(3)|urinary_tract(1)	26				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		TCTGGAAAATCTAGGGAAAAA	0.368								DNA polymerases (catalytic subunits)																													p.S548Y		Atlas-SNP	.											.	POLI	132	.	0			c.C1643A						PASS	.						30.0	31.0	31.0					18																	51820257		2203	4299	6502	SO:0001583	missense	11201	exon10			GAAAATCTAGGGA		CCDS11954.2	18q21.1	2012-05-18			ENSG00000101751	ENSG00000101751		"""DNA polymerases"""	9182	protein-coding gene	gene with protein product		605252		RAD3OB, RAD30B		17609217	Standard	NM_007195		Approved		uc002lfj.4	Q9UNA4	OTTHUMG00000132704	ENST00000579534.1:c.1643C>A	chr18.hg19:g.51820257C>A	ENSP00000462664:p.Ser548Tyr	231.0	0.0	.		231.0	67.0	.	NM_007195	Q8N590|Q9H0S1|Q9NYH6	Missense_Mutation	SNP	ENST00000579534.1	hg19	CCDS11954.2	.	.	.	.	.	.	.	.	.	.	C	8.727	0.915756	0.17907	.	.	ENSG00000101751	ENST00000406285;ENST00000217800	T	0.50277	0.75	5.51	3.72	0.42706	.	0.614028	0.17190	N	0.183543	T	0.55768	0.1941	M	0.62723	1.935	0.36421	D	0.864307	D;D	0.67145	0.996;0.976	P;P	0.56700	0.804;0.726	T	0.61277	-0.7095	10	0.46703	T	0.11	-4.9843	8.2416	0.31662	0.0:0.6203:0.2987:0.081	.	468;548	B7Z780;Q9UNA4	.;POLI_HUMAN	Y	469;548	ENSP00000385196:S469Y	ENSP00000217800:S548Y	S	+	2	0	POLI	50074255	0.135000	0.22499	0.993000	0.49108	0.925000	0.55904	0.998000	0.29744	0.789000	0.33779	-0.176000	0.13171	TCT	.	.	.	none		0.368	POLI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256002.3	NM_007195	
PDE4A	5141	hgsc.bcm.edu	37	19	10563956	10563957	+	Intron	DNP	TC	TC	AA			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr19:10563956_10563957TC>AA	ENST00000352831.6	+	7	893				PDE4A_ENST00000592685.1_Intron|PDE4A_ENST00000380702.2_Intron|PDE4A_ENST00000440014.2_Intron|PDE4A_ENST00000344979.3_Nonsense_Mutation_p.F6*|PDE4A_ENST00000293683.5_Intron	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific						cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	TTGGTGGATTTCTTCTGCGAGA	0.653																																					p.F6Y|p.F6L		Atlas-SNP	.											.	PDE4A	236	.	0			c.T17A|c.C18A						PASS	.																																			SO:0001627	intron_variant	5141	exon1			TGGATTTCTTCTG|GGATTTCTTCTGC		CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		Exception_encountered	chr19.hg19:g.10563956_10563957delinsAA		54.0	0.0	.		36.0	12.0	.	NM_006202	O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Missense_Mutation	SNP	ENST00000352831.6	hg19	CCDS45961.1																																																																																			.	.	.	none		0.653	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451244.1		
ELL	8178	hgsc.bcm.edu	37	19	18555598	18555598	+	Silent	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr19:18555598G>A	ENST00000262809.4	-	12	1901	c.1830C>T	c.(1828-1830)gcC>gcT	p.A610A	ELL_ENST00000596124.3_Silent_p.A477A|CTD-3137H5.1_ENST00000594590.2_RNA	NM_006532.3	NP_006523.1	P55199	ELL_HUMAN	elongation factor RNA polymerase II	610					gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of viral transcription (GO:0050434)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	phosphatase binding (GO:0019902)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(5)|prostate(1)	19				GBM - Glioblastoma multiforme(1328;7.81e-07)		GGTCGTACTCGGCGATGAGCC	0.627			T	MLL	AL																																p.A610A		Atlas-SNP	.		Dom	yes		19	19p13.1	8178	ELL gene (11-19 lysine-rich leukemia gene)		L	.	ELL	52	.	0			c.C1830T						PASS	.						103.0	85.0	91.0					19																	18555598		2203	4300	6503	SO:0001819	synonymous_variant	8178	exon12			GTACTCGGCGATG	U16282	CCDS12380.1	19p13.1	2012-04-17	2005-05-23			ENSG00000105656		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23114	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 68"""	600284	"""chromosome 19 open reading frame 17"""	C19orf17		7991593, 8596958	Standard	NM_006532		Approved	Men, ELL1, PPP1R68	uc002njh.3	P55199		ENST00000262809.4:c.1830C>T	chr19.hg19:g.18555598G>A		25.0	0.0	.		22.0	5.0	.	NM_006532		Silent	SNP	ENST00000262809.4	hg19	CCDS12380.1																																																																																			.	.	.	none		0.627	ELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466362.1	NM_006532	
PSG1	5669	hgsc.bcm.edu	37	19	43376066	43376066	+	Missense_Mutation	SNP	G	G	A	rs368581835		TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr19:43376066G>A	ENST00000436291.2	-	3	678	c.562C>T	c.(562-564)Cct>Tct	p.P188S	PSG1_ENST00000244296.2_Missense_Mutation_p.P188S|PSG1_ENST00000595356.1_Missense_Mutation_p.P188S|PSG1_ENST00000312439.6_Missense_Mutation_p.P188S|PSG1_ENST00000403380.3_Intron|PSG1_ENST00000595124.1_Intron	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	188	Ig-like C2-type 1.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				TGAGTCATAGGGAGGCTCTGA	0.498																																					p.P188S		Atlas-SNP	.											.	PSG1	196	.	0			c.C562T						PASS	.	G	SER/PRO,SER/PRO,SER/PRO	1,4403		0,1,2201	281.0	273.0	276.0		562,562,562	1.5	0.0	19		276	0,8598		0,0,4299	no	missense,missense,missense	PSG1	NM_001184825.1,NM_001184826.1,NM_006905.2	74,74,74	0,1,6500	AA,AG,GG		0.0,0.0227,0.0077	,,	188/420,188/418,188/427	43376066	1,13001	2202	4299	6501	SO:0001583	missense	5669	exon3			TCATAGGGAGGCT		CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.562C>T	chr19.hg19:g.43376066G>A	ENSP00000413041:p.Pro188Ser	104.0	0.0	.		103.0	26.0	.	NM_001184826	O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Missense_Mutation	SNP	ENST00000436291.2	hg19	CCDS54275.1	.	.	.	.	.	.	.	.	.	.	N	9.391	1.075520	0.20227	2.27E-4	0.0	ENSG00000231924	ENST00000436291;ENST00000312439;ENST00000244296	T;T;T	0.11169	2.8;2.8;2.8	1.46	1.46	0.22682	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.23330	0.0564	L	0.58354	1.805	0.09310	N	1	D;D;D;P;P;D;D;D	0.89917	1.0;1.0;0.999;0.533;0.738;0.992;0.994;1.0	D;D;D;B;P;D;D;D	0.87578	0.998;0.991;0.988;0.439;0.522;0.955;0.981;0.994	T	0.06373	-1.0830	9	0.39692	T	0.17	.	6.2767	0.20985	0.0:0.0:1.0:0.0	.	188;188;188;188;188;60;188;188	O75238;P11464-4;P11464;P11464-3;Q9UPK8;B4DTG5;O75237;P11464-2	.;.;PSG1_HUMAN;.;.;.;.;.	S	188	ENSP00000413041:P188S;ENSP00000308970:P188S;ENSP00000244296:P188S	ENSP00000244296:P188S	P	-	1	0	PSG1	48067906	0.003000	0.15002	0.003000	0.11579	0.013000	0.08279	0.913000	0.28611	0.782000	0.33613	0.184000	0.17185	CCT	.	.	.	weak		0.498	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321426.1		
MBOAT7	79143	hgsc.bcm.edu	37	19	54684568	54684568	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr19:54684568G>A	ENST00000245615.1	-	6	1256	c.776C>T	c.(775-777)gCc>gTc	p.A259V	MBOAT7_ENST00000338624.6_Missense_Mutation_p.A186V|MBOAT7_ENST00000431666.2_Missense_Mutation_p.A186V|MBOAT7_ENST00000391754.1_Missense_Mutation_p.A259V|MBOAT7_ENST00000474910.1_5'Flank	NM_024298.3	NP_077274.3	Q96N66	MBOA7_HUMAN	membrane bound O-acyltransferase domain containing 7	259					glycerophospholipid biosynthetic process (GO:0046474)|layer formation in cerebral cortex (GO:0021819)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|ventricular system development (GO:0021591)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipid acyltransferase activity (GO:0071617)			endometrium(4)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	10	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CCCAAAGCCGGCGGCAATGCA	0.716											OREG0003644	type=REGULATORY REGION|Gene=AK123290|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.A259V	NSCLC(97;826 2151 10470 22540)	Atlas-SNP	.											.	MBOAT7	37	.	0			c.C776T						PASS	.						9.0	11.0	10.0					19																	54684568		2158	4240	6398	SO:0001583	missense	79143	exon6			AAGCCGGCGGCAA	AF211969	CCDS12883.1, CCDS54315.1, CCDS54316.1	19q13.4	2008-12-15	2008-01-17	2008-01-17	ENSG00000125505	ENSG00000125505			15505	protein-coding gene	gene with protein product	"""lysophosphatidylinositol acyltransferase"""	606048	"""leukocyte receptor cluster (LRC) member 4"""	LENG4		10941842, 8702217, 18094042	Standard	NM_024298		Approved	BB1, hMBOA-7, LPIAT	uc002qdr.3	Q96N66	OTTHUMG00000066516	ENST00000245615.1:c.776C>T	chr19.hg19:g.54684568G>A	ENSP00000245615:p.Ala259Val	113.0	0.0	.	1002	104.0	27.0	.	NM_001146082	A9C4B6|B0V3I5|B4DQ87|Q05DF0|Q7L5N2|Q99908|Q9BPV2|Q9BRE9	Missense_Mutation	SNP	ENST00000245615.1	hg19	CCDS12883.1	.	.	.	.	.	.	.	.	.	.	g	36	5.810866	0.96975	.	.	ENSG00000125505	ENST00000431666;ENST00000338624;ENST00000245615;ENST00000391754	T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66	4.59	4.59	0.56863	.	0.173558	0.50627	D	0.000116	T	0.80686	0.4670	M	0.77486	2.375	0.80722	D	1	P;D;P	0.61697	0.955;0.99;0.885	P;P;P	0.55011	0.763;0.766;0.666	D	0.83970	0.0326	10	0.62326	D	0.03	-10.7127	16.6251	0.84968	0.0:0.0:1.0:0.0	.	241;186;259	B4DDH8;Q96N66-2;Q96N66	.;.;MBOA7_HUMAN	V	186;186;259;259	ENSP00000410503:A186V;ENSP00000344377:A186V;ENSP00000245615:A259V;ENSP00000375634:A259V	ENSP00000245615:A259V	A	-	2	0	MBOAT7	59376380	1.000000	0.71417	0.983000	0.44433	0.997000	0.91878	8.293000	0.89932	2.296000	0.77279	0.546000	0.68486	GCC	.	.	.	none		0.716	MBOAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142203.1	NM_024298	
ADIG	149685	hgsc.bcm.edu	37	20	37216742	37216742	+	Splice_Site	SNP	A	A	C			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr20:37216742A>C	ENST00000537425.1	+	3	295		c.e3-1			NM_001018082.1	NP_001018092.1			adipogenin											endometrium(1)|kidney(1)	2		Myeloproliferative disorder(115;0.00878)				TTTTGTTTCTAGTTTGGTTTT	0.527																																					.		Atlas-SNP	.											.	ADIG	16	.	0			c.354-2A>C						PASS	.																																			SO:0001630	splice_region_variant	149685	exon3			GTTTCTAGTTTGG	BC029594	CCDS54461.1	20q11.23	2014-02-12	2007-03-29		ENSG00000182035	ENSG00000182035			28606	protein-coding gene	gene with protein product	"""small adipocyte factor 1"""	611396	"""adipogenesis associated"""			15567149, 16132694	Standard	NM_001018082		Approved	MGC39724, SMAF1, RP5-1100H13.2	uc002xjb.1	Q0VDE8	OTTHUMG00000032451	ENST00000537425.1:c.225-1A>C	chr20.hg19:g.37216742A>C		149.0	0.0	.		118.0	29.0	.	NM_001018082		Splice_Site	SNP	ENST00000537425.1	hg19		.	.	.	.	.	.	.	.	.	.	A	3.362	-0.130259	0.06753	.	.	ENSG00000182035	ENST00000537425;ENST00000416116	.	.	.	3.6	-1.06	0.10002	.	.	.	.	.	.	.	.	.	.	.	0.25274	N	0.989499	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.8268	0.23887	0.6729:0.0:0.3271:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADIG	36650156	0.001000	0.12720	0.002000	0.10522	0.020000	0.10135	-0.128000	0.10531	-0.175000	0.10725	-0.456000	0.05471	.	.	.	.	none		0.527	ADIG-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001018082	Intron
SGK2	10110	hgsc.bcm.edu	37	20	42198049	42198049	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr20:42198049A>G	ENST00000341458.4	+	5	652	c.433A>G	c.(433-435)Agt>Ggt	p.S145G	SGK2_ENST00000373100.1_Missense_Mutation_p.S85G|SGK2_ENST00000423407.3_Missense_Mutation_p.S85G|SGK2_ENST00000373092.3_Missense_Mutation_p.S85G|SGK2_ENST00000373077.1_Missense_Mutation_p.S84G|SGK2_ENST00000426287.1_Missense_Mutation_p.S111G	NM_016276.3	NP_057360.2	Q9HBY8	SGK2_HUMAN	serum/glucocorticoid regulated kinase 2	145	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|ion transmembrane transport (GO:0034220)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|sodium channel regulator activity (GO:0017080)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GGCAGAGCGCAGTGTGCTTCT	0.567																																					p.S145G		Atlas-SNP	.											.	SGK2	50	.	0			c.A433G						PASS	.						86.0	65.0	72.0					20																	42198049		2203	4300	6503	SO:0001583	missense	10110	exon5			GAGCGCAGTGTGC	AF169034	CCDS13320.1, CCDS13321.1	20q13.2	2008-07-04			ENSG00000101049	ENSG00000101049			13900	protein-coding gene	gene with protein product		607589				10548550	Standard	NM_016276		Approved		uc002xkv.3	Q9HBY8	OTTHUMG00000033054	ENST00000341458.4:c.433A>G	chr20.hg19:g.42198049A>G	ENSP00000340608:p.Ser145Gly	54.0	0.0	.		40.0	11.0	.	NM_016276	Q52PK5|Q5H8Y6|Q5H8Z1|Q5TZR3|Q9UKG6	Missense_Mutation	SNP	ENST00000341458.4	hg19	CCDS13320.1	.	.	.	.	.	.	.	.	.	.	A	17.13	3.311220	0.60414	.	.	ENSG00000101049	ENST00000373100;ENST00000373092;ENST00000373077;ENST00000412111;ENST00000423407;ENST00000341458;ENST00000426287	T;T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	4.24	4.24	0.50183	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.191710	0.56097	D	0.000040	T	0.63379	0.2506	L	0.41492	1.28	0.36156	D	0.847752	B;B;B	0.25809	0.135;0.117;0.013	B;B;B	0.37601	0.107;0.254;0.062	T	0.71227	-0.4655	10	0.59425	D	0.04	.	13.0383	0.58885	1.0:0.0:0.0:0.0	.	111;145;85	Q9HBY8-3;Q9HBY8;Q9HBY8-2	.;SGK2_HUMAN;.	G	85;85;84;84;85;145;111	ENSP00000362192:S85G;ENSP00000362184:S85G;ENSP00000362168:S84G;ENSP00000396222:S84G;ENSP00000392795:S85G;ENSP00000340608:S145G;ENSP00000412214:S111G	ENSP00000340608:S145G	S	+	1	0	SGK2	41631463	1.000000	0.71417	0.901000	0.35422	0.822000	0.46500	9.255000	0.95524	1.873000	0.54277	0.454000	0.30748	AGT	.	.	.	none		0.567	SGK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080383.1		
SGK2	10110	hgsc.bcm.edu	37	20	42199282	42199282	+	Missense_Mutation	SNP	G	G	A	rs559824768		TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr20:42199282G>A	ENST00000341458.4	+	6	785	c.566G>A	c.(565-567)cGc>cAc	p.R189H	SGK2_ENST00000373100.1_Missense_Mutation_p.R129H|SGK2_ENST00000485914.1_3'UTR|SGK2_ENST00000423407.3_Missense_Mutation_p.R129H|SGK2_ENST00000373092.3_Missense_Mutation_p.R129H|SGK2_ENST00000373077.1_Missense_Mutation_p.R128H|SGK2_ENST00000426287.1_Missense_Mutation_p.R155H	NM_016276.3	NP_057360.2	Q9HBY8	SGK2_HUMAN	serum/glucocorticoid regulated kinase 2	189	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|ion transmembrane transport (GO:0034220)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|sodium channel regulator activity (GO:0017080)	p.R189H(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			CAGCGGGAGCGCCGGTTCCTG	0.637																																					p.R189H		Atlas-SNP	.											SGK2,NS,carcinoma,0,1	SGK2	50	.	2	Substitution - Missense(2)	lung(2)	c.G566A						PASS	.						61.0	62.0	62.0					20																	42199282		2203	4300	6503	SO:0001583	missense	10110	exon6			GGGAGCGCCGGTT	AF169034	CCDS13320.1, CCDS13321.1	20q13.2	2008-07-04			ENSG00000101049	ENSG00000101049			13900	protein-coding gene	gene with protein product		607589				10548550	Standard	NM_016276		Approved		uc002xkv.3	Q9HBY8	OTTHUMG00000033054	ENST00000341458.4:c.566G>A	chr20.hg19:g.42199282G>A	ENSP00000340608:p.Arg189His	58.0	0.0	.		47.0	8.0	.	NM_016276	Q52PK5|Q5H8Y6|Q5H8Z1|Q5TZR3|Q9UKG6	Missense_Mutation	SNP	ENST00000341458.4	hg19	CCDS13320.1	.	.	.	.	.	.	.	.	.	.	G	18.59	3.656820	0.67586	.	.	ENSG00000101049	ENST00000373100;ENST00000373092;ENST00000373077;ENST00000412111;ENST00000423407;ENST00000341458;ENST00000426287	T;T;T;T;T;T;T	0.25579	1.79;1.79;1.79;1.79;1.79;1.79;1.79	4.77	2.75	0.32379	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.148295	0.64402	N	0.000014	T	0.21267	0.0512	L	0.52905	1.665	0.58432	D	0.999999	B;P;B	0.35872	0.424;0.525;0.167	B;B;B	0.28465	0.032;0.09;0.038	T	0.04373	-1.0956	10	0.51188	T	0.08	.	10.9474	0.47308	0.163:0.0:0.837:0.0	.	155;189;129	Q9HBY8-3;Q9HBY8;Q9HBY8-2	.;SGK2_HUMAN;.	H	129;129;128;128;129;189;155	ENSP00000362192:R129H;ENSP00000362184:R129H;ENSP00000362168:R128H;ENSP00000396222:R128H;ENSP00000392795:R129H;ENSP00000340608:R189H;ENSP00000412214:R155H	ENSP00000340608:R189H	R	+	2	0	SGK2	41632696	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.835000	0.48175	0.660000	0.30964	0.655000	0.94253	CGC	.	.	.	none		0.637	SGK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080383.1		
SLC2A4RG	56731	hgsc.bcm.edu	37	20	62373951	62373951	+	Missense_Mutation	SNP	A	A	T			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr20:62373951A>T	ENST00000266077.2	+	6	995	c.943A>T	c.(943-945)Agt>Tgt	p.S315C	RP4-583P15.10_ENST00000447343.2_RNA|RP4-583P15.10_ENST00000433905.2_RNA|SLC2A4RG_ENST00000493772.1_3'UTR	NM_020062.3	NP_064446.2	Q9NR83	S2A4R_HUMAN	SLC2A4 regulator	315					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|kidney(1)|lung(2)|prostate(2)|skin(1)	7	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					GTCCTGTCACAGTGACCGTGT	0.706																																					p.S315C		Atlas-SNP	.											.	SLC2A4RG	20	.	0			c.A943T						PASS	.						8.0	10.0	9.0					20																	62373951		1947	3998	5945	SO:0001583	missense	56731	exon6			TGTCACAGTGACC	AF249267	CCDS13537.1	20q13.33	2010-03-11			ENSG00000125520	ENSG00000125520			15930	protein-coding gene	gene with protein product	"""GLUT4 enhancer factor"", ""Huntington's disease gene regulatory region-binding protein 1"""	609493				10825161	Standard	NM_020062		Approved	GEF, HDBP1, Si-1-2, Si-1-2-19	uc002ygq.3	Q9NR83	OTTHUMG00000032997	ENST00000266077.2:c.943A>T	chr20.hg19:g.62373951A>T	ENSP00000266077:p.Ser315Cys	113.0	0.0	.		99.0	27.0	.	NM_020062	Q2PHL5|Q6F6I6|Q6F6I7|Q6GTK5|Q8TAH5|Q8WVW7|Q96QD3|Q9BV85	Missense_Mutation	SNP	ENST00000266077.2	hg19	CCDS13537.1	.	.	.	.	.	.	.	.	.	.	A	18.77	3.694866	0.68386	.	.	ENSG00000125520	ENST00000266077	T	0.50277	0.75	3.92	-1.6	0.08426	.	1.162140	0.06883	U	0.802854	T	0.50309	0.1608	L	0.55481	1.735	0.25308	N	0.989226	D	0.69078	0.997	P	0.57468	0.821	T	0.38650	-0.9651	10	0.54805	T	0.06	-35.2735	0.6983	0.00903	0.4697:0.1693:0.1973:0.1637	.	315	Q9NR83	S2A4R_HUMAN	C	315	ENSP00000266077:S315C	ENSP00000266077:S315C	S	+	1	0	SLC2A4RG	61844395	0.018000	0.18449	0.010000	0.14722	0.278000	0.26855	1.400000	0.34577	-0.793000	0.04475	0.260000	0.18958	AGT	.	.	.	none		0.706	SLC2A4RG-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080202.1	NM_020062	
MYT1	4661	hgsc.bcm.edu	37	20	62851316	62851316	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr20:62851316G>A	ENST00000328439.1	+	13	2586	c.2222G>A	c.(2221-2223)aGa>aAa	p.R741K	MYT1_ENST00000360149.4_Missense_Mutation_p.R443K|MYT1_ENST00000536311.1_Missense_Mutation_p.R768K	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					AGCCGCCTGAGAGAGGAGGAA	0.662																																					p.R741K	GBM(59;481 1041 20555 21139 33705)	Atlas-SNP	.											.	MYT1	152	.	0			c.G2222A						PASS	.						13.0	12.0	12.0					20																	62851316		2088	4125	6213	SO:0001583	missense	4661	exon13			GCCTGAGAGAGGA	M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.2222G>A	chr20.hg19:g.62851316G>A	ENSP00000327465:p.Arg741Lys	110.0	0.0	.		83.0	26.0	.	NM_004535	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	hg19	CCDS13558.1	.	.	.	.	.	.	.	.	.	.	G	14.42	2.528721	0.44969	.	.	ENSG00000196132	ENST00000360149;ENST00000328439;ENST00000536311	T;T;T	0.42131	0.98;4.41;4.41	5.49	5.49	0.81192	Myelin transcription factor 1 (1);	0.137517	0.48767	D	0.000168	T	0.37945	0.1022	L	0.34521	1.04	0.44843	D	0.997853	B;B;B	0.32781	0.384;0.085;0.061	B;B;B	0.36534	0.227;0.086;0.047	T	0.09443	-1.0674	10	0.19147	T	0.46	-10.7664	19.3807	0.94532	0.0:0.0:1.0:0.0	.	768;741;443	F5H7M8;Q01538;Q6P6D5	.;MYT1_HUMAN;.	K	443;741;768	ENSP00000353269:R443K;ENSP00000327465:R741K;ENSP00000442412:R768K	ENSP00000327465:R741K	R	+	2	0	MYT1	62321760	1.000000	0.71417	0.112000	0.21494	0.991000	0.79684	4.913000	0.63341	2.575000	0.86900	0.561000	0.74099	AGA	.	.	.	none		0.662	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535	
UMODL1	89766	hgsc.bcm.edu	37	21	43529755	43529755	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr21:43529755C>T	ENST00000408910.2	+	10	1603	c.1603C>T	c.(1603-1605)Cag>Tag	p.Q535*	C21orf128_ENST00000329015.2_5'Flank|UMODL1_ENST00000400424.2_Nonsense_Mutation_p.Q463*|UMODL1_ENST00000408989.2_Nonsense_Mutation_p.Q535*|UMODL1_ENST00000400427.1_Nonsense_Mutation_p.Q463*	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	535	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						CTACACCTGCCAGTGCCGTAC	0.692																																					p.Q535X	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	Atlas-SNP	.											.	UMODL1	186	.	0			c.C1603T						PASS	.						44.0	56.0	52.0					21																	43529755		2037	4156	6193	SO:0001587	stop_gained	89766	exon10			ACCTGCCAGTGCC		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.1603C>T	chr21.hg19:g.43529755C>T	ENSP00000386147:p.Gln535*	48.0	0.0	.		34.0	8.0	.	NM_173568	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Nonsense_Mutation	SNP	ENST00000408910.2	hg19	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	C	37	6.085419	0.97271	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910	.	.	.	3.23	2.32	0.28847	.	0.203527	0.22116	N	0.064402	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-8.5657	8.3767	0.32447	0.0:0.758:0.242:0.0	.	.	.	.	X	463;463;535;535	.	ENSP00000383276:Q463X	Q	+	1	0	UMODL1	42402824	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	1.215000	0.32431	0.919000	0.36945	0.655000	0.94253	CAG	.	.	.	none		0.692	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2		
OGT	8473	hgsc.bcm.edu	37	X	70756180	70756180	+	Missense_Mutation	SNP	A	A	C			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chrX:70756180A>C	ENST00000373719.3	+	2	407	c.190A>C	c.(190-192)Ata>Cta	p.I64L	OGT_ENST00000373701.3_Missense_Mutation_p.I54L|OGT_ENST00000498566.1_3'UTR	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	O15294	OGT1_HUMAN	O-linked N-acetylglucosamine (GlcNAc) transferase	64					apoptotic process (GO:0006915)|cellular response to retinoic acid (GO:0071300)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of protein ubiquitination (GO:0031397)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of catalytic activity (GO:0043085)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glycolytic process (GO:0006110)|regulation of insulin receptor signaling pathway (GO:0046626)|regulation of Rac protein signal transduction (GO:0035020)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone acetyltransferase complex (GO:0000123)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	acetylglucosaminyltransferase activity (GO:0008375)|enzyme activator activity (GO:0008047)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein N-acetylglucosaminyltransferase activity (GO:0016262)|protein O-GlcNAc transferase activity (GO:0097363)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|liver(3)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Renal(35;0.156)					ACTTTCATCTATACACTTCCA	0.463																																					p.I64L		Atlas-SNP	.											.	OGT	207	.	0			c.A190C						PASS	.						98.0	70.0	79.0					X																	70756180		2203	4300	6503	SO:0001583	missense	8473	exon2			TCATCTATACACT	U77413	CCDS14414.1, CCDS35502.1	Xq13	2013-07-24	2012-05-04		ENSG00000147162	ENSG00000147162	2.4.1.255	"""Tetratricopeptide (TTC) repeat domain containing"""	8127	protein-coding gene	gene with protein product	"""UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase"""	300255	"""O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)"""			9083068	Standard	NM_181672		Approved	O-GLCNAC, HRNT1, MGC22921, FLJ23071	uc004eaa.2	O15294	OTTHUMG00000033316	ENST00000373719.3:c.190A>C	chrX.hg19:g.70756180A>C	ENSP00000362824:p.Ile64Leu	102.0	0.0	.		79.0	46.0	.	NM_181672	Q7Z3K0|Q8WWM8|Q96CC1|Q9UG57	Missense_Mutation	SNP	ENST00000373719.3	hg19	CCDS14414.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.502221	0.85176	.	.	ENSG00000147162	ENST00000373719;ENST00000373701;ENST00000444774	T;T;T	0.72167	0.47;-0.63;1.22	5.22	5.22	0.72569	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.82623	0.5077	M	0.71206	2.165	0.80722	D	1	B;P;B	0.41748	0.0;0.761;0.001	B;D;B	0.68483	0.0;0.958;0.025	T	0.80195	-0.1483	10	0.27785	T	0.31	-7.2745	14.2165	0.65797	1.0:0.0:0.0:0.0	.	64;54;64	B4DTL6;O15294-3;O15294	.;.;OGT1_HUMAN	L	64;54;47	ENSP00000362824:I64L;ENSP00000362805:I54L;ENSP00000399729:I47L	ENSP00000362805:I54L	I	+	1	0	OGT	70672905	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.929000	0.92859	1.932000	0.55993	0.430000	0.28490	ATA	.	.	.	none		0.463	OGT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000081829.3	NM_003605, NM_181672	
MT-ND4L	4539	hgsc.bcm.edu	37	M	10635	10635	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chrM:10635G>A	ENST00000361335.1	+	1	166	c.166G>A	c.(166-168)Gcc>Acc	p.A56T	MT-TG_ENST00000387429.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-ND4_ENST00000361381.2_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA			P03901	NU4LM_HUMAN	mitochondrially encoded NADH dehydrogenase 4L	56					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(2)|kidney(2)	5						ACTCCCTCTTAGCCAATATTG	0.478																																					p.A56T		Atlas-SNP	.											.	.	.	.	0			c.G166A						PASS	.																																			SO:0001583	missense	0	exon1			CTCTTAGCCAATA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000212907	ENSG00000212907	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7460	protein-coding gene	gene with protein product	"""complex I ND4L subunit"", ""NADH-ubiquinone oxidoreductase chain 4L"""	516004	"""NADH dehydrogenase 4L"""	MTND4L			Standard			Approved	ND4L, NAD4L		P03901		ENST00000361335.1:c.166G>A	chrM.hg19:g.10635G>A	ENSP00000354728:p.Ala56Thr	17.0	0.0	.		12.0	9.0	.	ENST00000361335		Missense_Mutation	SNP	ENST00000361335.1	hg19																																																																																				.	.	.	none		0.478	MT-ND4L-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024034	
UBE4A	9354	hgsc.bcm.edu	37	11	118250311	118250315	+	Frame_Shift_Del	DEL	CATGA	CATGA	-			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	CATGA	CATGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr11:118250311_118250315delCATGA	ENST00000431736.2	+	11	1815_1819	c.1743_1747delCATGA	c.(1741-1749)gccatgacafs	p.MT582fs	UBE4A_ENST00000545354.1_Frame_Shift_Del_p.MT47fs|UBE4A_ENST00000252108.3_Frame_Shift_Del_p.MT575fs					ubiquitination factor E4A											autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(7)|liver(2)|lung(14)|ovary(3)|prostate(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	56	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		CCAAGACTGCCATGACAGAGCCACA	0.493																																					p.581_582del		Atlas-Indel,Pindel	.											.	UBE4A	97	.	0			c.1742_1746del						PASS	.																																			SO:0001589	frameshift_variant	9354	exon11			.	D50916	CCDS8396.1, CCDS55790.1	11q23.3	2013-01-28	2011-05-19					"""U-box domain containing"""	12499	protein-coding gene	gene with protein product		603753	"""ubiquitination factor E4A (homologous to yeast UFD2)"", ""ubiquitination factor E4A (UFD2 homolog, yeast)"""			10089879	Standard	NM_004788		Approved	UBOX2, UFD2, KIAA0126, E4	uc001psv.3	Q14139	OTTHUMG00000168100	ENST00000431736.2:c.1743_1747delCATGA	chr11.hg19:g.118250311_118250315delCATGA	ENSP00000387362:p.Met582fs	152.0	0.0	0		104.0	38.0	0.365385	NM_004788		Frame_Shift_Del	DEL	ENST00000431736.2	hg19	CCDS8396.1																																																																																			.	.	.	none		0.493	UBE4A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398143.1	NM_004788	
NEFH	4744	hgsc.bcm.edu	37	22	29885589	29885590	+	In_Frame_Ins	INS	-	-	CCCCTGAGAAGGCCAAGT	rs200984527|rs267607533		TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr22:29885589_29885590insCCCCTGAGAAGGCCAAGT	ENST00000310624.6	+	4	1993_1994	c.1960_1961insCCCCTGAGAAGGCCAAGT	c.(1960-1962)tcc>tCCCCTGAGAAGGCCAAGTcc	p.654_654S>SPEKAKS		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	660	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GAAGGCCAAGTCCCCAGAGAAG	0.559																																					p.S654delinsSPEKAKS		Atlas-INDEL	.											.,4	NEFH	178	.	0			c.1960_1961insCCCCTGAGAAGGCCAAGT						PASS	.																																			SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1943_1960dupCCCCTGAGAAGGCCAAGT	chr22.hg19:g.29885589_29885590insCCCCTGAGAAGGCCAAGT	ENSP00000311997:p.ProGluLysAlaLysSer654dup	245.0	0.0	0		132.0	41.0	0.310606	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	hg19	CCDS13858.1																																																																																			.	.	.	none		0.559	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
SALL1	6299	hgsc.bcm.edu	37	16	51173002	51173006	+	Frame_Shift_Del	DEL	AAATT	AAATT	-			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	AAATT	AAATT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr16:51173002_51173006delAAATT	ENST00000251020.4	-	2	3160_3164	c.3127_3131delAATTT	c.(3127-3132)aatttgfs	p.NL1043fs	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Frame_Shift_Del_p.NL946fs|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	1043					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GTGCTGCTTCAAATTACCCTTTGTG	0.463																																					p.1043_1044del	GBM(103;1352 1446 1855 4775 8890)	Atlas-Indel,Pindel	.											.	SALL1	301	.	0			c.3128_3132del						PASS	.																																			SO:0001589	frameshift_variant	6299	exon2			.	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.3127_3131delAATTT	chr16.hg19:g.51173002_51173006delAAATT	ENSP00000251020:p.Asn1043fs	83.0	0.0	0		95.0	30.0	0.315789	NM_002968	Q99881|Q9NSC3|Q9P1R0	Frame_Shift_Del	DEL	ENST00000251020.4	hg19	CCDS10747.1																																																																																			.	.	.	none		0.463	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
NF2	4771	hgsc.bcm.edu	37	22	30060995	30060996	+	Frame_Shift_Ins	INS	-	-	GG	rs549225513		TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr22:30060995_30060996insGG	ENST00000338641.4	+	9	1268_1269	c.827_828insGG	c.(826-831)ctggatfs	p.D277fs	NF2_ENST00000361166.4_Frame_Shift_Ins_p.D277fs|NF2_ENST00000334961.7_Frame_Shift_Ins_p.D194fs|NF2_ENST00000361452.4_Frame_Shift_Ins_p.D236fs|NF2_ENST00000347330.5_Frame_Shift_Ins_p.D118fs|NF2_ENST00000403435.1_Frame_Shift_Ins_p.D277fs|NF2_ENST00000353887.4_Frame_Shift_Ins_p.D194fs|NF2_ENST00000413209.2_Intron|NF2_ENST00000361676.4_Frame_Shift_Ins_p.D235fs|NF2_ENST00000397789.3_Frame_Shift_Ins_p.D277fs|NF2_ENST00000403999.3_Frame_Shift_Ins_p.D277fs	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	277	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(3)|p.F271_L295del(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						ATTAAACCACTGGATAAGAAAA	0.386			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												p.L276fs		Atlas-Indel,Pindel	.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	.	NF2	1312	.	4	Unknown(3)|Deletion - In frame(1)	central_nervous_system(2)|large_intestine(1)|stomach(1)	c.827_828insGG						PASS	.																																			SO:0001589	frameshift_variant	4771	exon9	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	.	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.828_829dupGG	chr22.hg19:g.30060996_30060997dupGG	ENSP00000344666:p.Asp277fs	155.0	0.0	0		84.0	36.0	0.428571	NM_181832	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Frame_Shift_Ins	INS	ENST00000338641.4	hg19	CCDS13861.1																																																																																			.	.	.	none		0.386	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	
CAMK1D	57118	hgsc.bcm.edu	37	10	12870792	12870792	+	Frame_Shift_Del	DEL	G	G	-			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr10:12870792delG	ENST00000378847.3	+	11	1401	c.1064delG	c.(1063-1065)agtfs	p.S355fs		NM_153498.2	NP_705718.1	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID	355	Ser-rich.				inflammatory response (GO:0006954)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis (GO:0050766)|positive regulation of respiratory burst (GO:0060267)|regulation of dendrite development (GO:0050773)|regulation of granulocyte chemotaxis (GO:0071622)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)	16				GBM - Glioblastoma multiforme(1;3.16e-05)		ACGCTCTGTAGTTTCATTTCT	0.577																																					p.S355fs		Atlas-INDEL	.											.	CAMK1D	99	.	0			c.1063delA						PASS	.						81.0	78.0	79.0					10																	12870792		2203	4300	6503	SO:0001589	frameshift_variant	57118	exon11			.	AF286366	CCDS7091.1, CCDS7092.1	10p13	2003-11-05			ENSG00000183049	ENSG00000183049			19341	protein-coding gene	gene with protein product		607957				11050006	Standard	XM_006717481		Approved	CKLiK	uc001ilo.3	Q8IU85	OTTHUMG00000017683	ENST00000378847.3:c.1064delG	chr10.hg19:g.12870792delG	ENSP00000368124:p.Ser355fs	48.0	0.0	0		47.0	12.0	0.255319	NM_153498	B0YIY0|Q9HD31	Frame_Shift_Del	DEL	ENST00000378847.3	hg19	CCDS7091.1																																																																																			.	.	.	none		0.577	CAMK1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046820.1	NM_020397	
UBA5	79876	hgsc.bcm.edu	37	3	132395353	132395353	+	Frame_Shift_Del	DEL	A	A	-			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr3:132395353delA	ENST00000356232.4	+	12	2270	c.1198delA	c.(1198-1200)aaafs	p.K400fs	UBA5_ENST00000473651.1_3'UTR|UBA5_ENST00000493720.2_Intron|UBA5_ENST00000494238.2_Frame_Shift_Del_p.K344fs|UBA5_ENST00000264991.4_Frame_Shift_Del_p.K344fs	NM_024818.3	NP_079094.1	Q9GZZ9	UBA5_HUMAN	ubiquitin-like modifier activating enzyme 5	400					protein ufmylation (GO:0071569)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|UFM1 activating enzyme activity (GO:0071566)			breast(2)|endometrium(4)|kidney(4)|large_intestine(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						CCTCATGGCCAAAATGAAGAA	0.323																																					p.A399fs		Atlas-Indel,Pindel	.											.	UBA5	33	.	0			c.1197delC						PASS	.						92.0	92.0	92.0					3																	132395353		2202	4300	6502	SO:0001589	frameshift_variant	79876	exon12			.	AY253672	CCDS3076.1, CCDS3077.1	3q22	2007-11-30	2007-11-30	2007-11-30	ENSG00000081307	ENSG00000081307		"""Ubiquitin-like modifier activating enzymes"""	23230	protein-coding gene	gene with protein product	"""UBA5, ubiquitin-activating enzyme E1 homolog (yeast)"""	610552	"""ubiquitin-activating enzyme E1-domain containing 1"""	UBE1DC1		11230166, 15071506	Standard	NM_198329		Approved	FLJ23251	uc003epa.4	Q9GZZ9	OTTHUMG00000159759	ENST00000356232.4:c.1198delA	chr3.hg19:g.132395353delA	ENSP00000348565:p.Lys400fs	149.0	0.0	0		133.0	31.0	0.233083	NM_024818	A6NJL3|D3DNC8|Q96ST1	Frame_Shift_Del	DEL	ENST00000356232.4	hg19	CCDS3076.1																																																																																			.	.	.	none		0.323	UBA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357187.2	NM_024818	
ABCC5	10057	hgsc.bcm.edu	37	3	183700580	183700580	+	Frame_Shift_Del	DEL	T	T	-			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr3:183700580delT	ENST00000334444.6	-	6	1047	c.807delA	c.(805-807)aaafs	p.K269fs	ABCC5_ENST00000492216.1_5'UTR|ABCC5_ENST00000265586.6_Frame_Shift_Del_p.K269fs	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	269	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	GGGATTTCTCTTTAATGTTCT	0.488																																					p.E270fs		Atlas-Indel,Pindel	.											.	ABCC5	142	.	0			c.808delG						PASS	.						68.0	72.0	71.0					3																	183700580		1908	4132	6040	SO:0001589	frameshift_variant	10057	exon6			.	AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.807delA	chr3.hg19:g.183700580delT	ENSP00000333926:p.Lys269fs	165.0	0.0	0		149.0	31.0	0.208054	NM_005688	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Frame_Shift_Del	DEL	ENST00000334444.6	hg19	CCDS43176.1																																																																																			.	.	.	none		0.488	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688	
AXDND1	126859	hgsc.bcm.edu	37	1	179494536	179494538	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	AGG	AGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr1:179494536_179494538delAGG	ENST00000367618.3	+	22	2951_2953	c.2564_2566delAGG	c.(2563-2568)aaggag>aag	p.E856del		NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	856	Glu-rich.									NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						GAAGAAAGTAAGGAGGATAGGAA	0.335																																					p.855_855del		Atlas-Indel,Pindel	.											.	AXDND1	142	.	0			c.2563_2565del						PASS	.																																			SO:0001651	inframe_deletion	126859	exon22			.	BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.2564_2566delAGG	chr1.hg19:g.179494539_179494541delAGG	ENSP00000356590:p.Glu856del	741.0	0.0	0		705.0	192.0	0.27234	NM_144696	Q6AWB2|Q96LJ3|Q96M01	In_Frame_Del	DEL	ENST00000367618.3	hg19	CCDS30948.1																																																																																			.	.	.	none		0.335	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085312.1	NM_144696	
PDE4A	5141	hgsc.bcm.edu	37	19	10563954	10563954	+	Intron	DEL	T	T	-			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr19:10563954delT	ENST00000352831.6	+	7	893				PDE4A_ENST00000592685.1_Intron|PDE4A_ENST00000380702.2_Intron|PDE4A_ENST00000440014.2_Intron|PDE4A_ENST00000344979.3_Frame_Shift_Del_p.D5fs|PDE4A_ENST00000293683.5_Intron	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific						cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	CCTTGGTGGATTTCTTCTGCG	0.647																																					p.D5fs		Atlas-INDEL	.											.	PDE4A	236	.	0			c.14delA						PASS	.						62.0	47.0	52.0					19																	10563954		2203	4300	6503	SO:0001627	intron_variant	5141	exon1			.		CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.784-1551T>-	chr19.hg19:g.10563954delT		57.0	0.0	0		36.0	12.0	0.333333	NM_006202	O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Frame_Shift_Del	DEL	ENST00000352831.6	hg19	CCDS45961.1																																																																																			.	.	.	none		0.647	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451244.1		
LBX2	85474	hgsc.bcm.edu	37	2	74725195	74725196	+	Frame_Shift_Ins	INS	-	-	GCGA			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr2:74725195_74725196insGCGA	ENST00000377566.4	-	2	633_634	c.455_456insTCGC	c.(454-456)gccfs	p.-152fs	LBX2_ENST00000460508.3_Frame_Shift_Ins_p.-148fs|AC005041.17_ENST00000479098.1_RNA|LBX2_ENST00000341396.2_3'UTR|LBX2_ENST00000550249.1_5'UTR	NM_001282430.1	NP_001269359.1	Q6XYB7	LBX2_HUMAN	ladybird homeobox 2						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(1)	4						CGCGTAGCGAGGCGACGTCGGC	0.688																																					p.A148fs		Atlas-Indel,Pindel	.											.	LBX2	13	.	0			c.444_445insTCGC						PASS	.																																			SO:0001589	frameshift_variant	85474	exon2			.	AC005041	CCDS33228.1, CCDS62938.1	2p13.1	2014-05-06	2007-02-15		ENSG00000179528	ENSG00000179528		"""Homeoboxes / ANTP class : NKL subclass"""	15525	protein-coding gene	gene with protein product		607164	"""ladybird homeobox homolog 2 (Drosophila)"""			11386758	Standard	NM_001282430		Approved		uc002slw.3	Q6XYB7	OTTHUMG00000170595	ENST00000377566.4:c.452_455dupTCGC	chr2.hg19:g.74725196_74725199dupGCGA	ENSP00000366789:p.Ala152fs	154.0	0.0	0		112.0	29.0	0.258929	NM_001009812	Q7Z5Y8	Frame_Shift_Ins	INS	ENST00000377566.4	hg19																																																																																				.	.	.	none		0.688	LBX2-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000328490.1	NM_001009812	
NCF4	4689	hgsc.bcm.edu	37	22	37266586	37266587	+	Splice_Site	DEL	TA	TA	-			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	TA	TA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr22:37266586_37266587delTA	ENST00000248899.6	+	5	654		c.e5+2		CTA-833B7.2_ENST00000431290.1_RNA|CTA-833B7.2_ENST00000330602.2_RNA|NCF4_ENST00000397147.4_Splice_Site	NM_000631.4	NP_000622.2	Q15080	NCF4_HUMAN	neutrophil cytosolic factor 4, 40kDa						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|positive regulation of catalytic activity (GO:0043085)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|membrane (GO:0016020)|NADPH oxidase complex (GO:0043020)|phagolysosome (GO:0032010)	phosphatidylinositol-3-phosphate binding (GO:0032266)|protein dimerization activity (GO:0046983)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			cervix(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16					Dextromethorphan(DB00514)	CCGGAAAGTGTAAGTGACCAGC	0.589																																					.		Atlas-INDEL	.											.	NCF4	66	.	0			.						PASS	.																																			SO:0001630	splice_region_variant	4689	.			.	X77094	CCDS13934.1, CCDS13935.1	22q13.1	2014-09-17	2002-08-29		ENSG00000100365	ENSG00000100365			7662	protein-coding gene	gene with protein product	"""neutrophil NADPH oxidase factor 4"""	601488	"""neutrophil cytosolic factor 4 (40kD)"""			8839867	Standard	NM_013416		Approved	p40phox, SH3PXD4	uc003apy.4	Q15080	OTTHUMG00000150548	ENST00000248899.6:c.470+2TA>-	chr22.hg19:g.37266586_37266587delTA		43.0	0.0	0		29.0	11.0	0.37931	.	A8K4F9|O60808|Q86U56|Q9BU98|Q9NP45	Splice_Site	DEL	ENST00000248899.6	hg19	CCDS13934.1																																																																																			.	.	.	none		0.589	NCF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318863.1	NM_000631	Intron
ZNF24	7572	hgsc.bcm.edu	37	18	32920341	32920349	+	In_Frame_Del	DEL	AGATTTGTT	AGATTTGTT	-	rs570943082		TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	AGATTTGTT	AGATTTGTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr18:32920341_32920349delAGATTTGTT	ENST00000261332.6	-	2	445_453	c.266_274delAACAAATCT	c.(265-276)gaacaaatcttg>gtg	p.89_92EQIL>V	ZNF24_ENST00000589881.1_In_Frame_Del_p.89_92EQIL>V|ZNF24_ENST00000399061.3_In_Frame_Del_p.89_92EQIL>V	NM_006965.2	NP_008896.2	P17028	ZNF24_HUMAN	zinc finger protein 24	89	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				myelination (GO:0042552)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	15						ACCAGCTCCAAGATTTGTTCTTTTGTGTG	0.541																																					p.89_92del	Colon(42;769 913 8916 19469 46270)	Atlas-Indel,Pindel	.											.	ZNF24	40	.	0			c.267_275del						PASS	.																																			SO:0001651	inframe_deletion	7572	exon2			.	AF016052	CCDS11912.1	18q12	2013-01-09	2006-05-10		ENSG00000172466	ENSG00000172466		"""-"", ""Zinc fingers, C2H2-type"""	13032	protein-coding gene	gene with protein product		194534	"""zinc finger protein 24 (KOX 17)"""	ZNF191			Standard	NM_006965		Approved	ZSCAN3, Zfp191, KOX17	uc002kys.2	P17028	OTTHUMG00000132565	ENST00000261332.6:c.266_274delAACAAATCT	chr18.hg19:g.32920341_32920349delAGATTTGTT	ENSP00000261332:p.Glu89_Leu92delinsVal	165.0	0.0	0		148.0	41.0	0.277027	NM_006965	O14754|Q53YE4|Q6ICR5|Q8IZN4	In_Frame_Del	DEL	ENST00000261332.6	hg19	CCDS11912.1																																																																																			.	.	.	none		0.541	ZNF24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255769.1	NM_006965	
PDE4A	5141	hgsc.bcm.edu	37	19	10563955	10563957	+	Intron	DEL	TTC	TTC	-			TCGA-Y8-A896-01A-11D-A35Z-10	TCGA-Y8-A896-10A-01D-A35Z-10	TTC	TTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1d456468-7272-4470-892b-437ed167c716	35a2ebd1-9aa7-4978-92e8-f2b148b69622	g.chr19:10563955_10563957delTTC	ENST00000352831.6	+	7	893				PDE4A_ENST00000592685.1_Intron|PDE4A_ENST00000380702.2_Intron|PDE4A_ENST00000440014.2_Intron|PDE4A_ENST00000344979.3_In_Frame_Del_p.F7del|PDE4A_ENST00000293683.5_Intron	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific						cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	CTTGGTGGATTTCTTCTGCGAGA	0.65																																					p.5_6del		Pindel	.											.	PDE4A	236	.	0			c.15_17del						PASS	.																																			SO:0001627	intron_variant	5141	exon1			.		CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.784-1548TTC>-	chr19.hg19:g.10563958_10563960delTTC		56.0	0.0	.		37.0	10.0	0.270	NM_006202	O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	In_Frame_Del	DEL	ENST00000352831.6	hg19	CCDS45961.1																																																																																			.	.	.	none		0.650	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451244.1		
