#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AKR1A1	10327	hgsc.bcm.edu	37	1	46034873	46034873	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr1:46034873A>G	ENST00000372070.3	+	9	1631	c.884A>G	c.(883-885)aAt>aGt	p.N295S	AKR1A1_ENST00000473038.1_3'UTR|AKR1A1_ENST00000351829.4_Missense_Mutation_p.N295S	NM_001202413.1|NM_001202414.1|NM_006066.3	NP_001189342.1|NP_001189343.1|NP_006057.1	P14550	AK1A1_HUMAN	aldo-keto reductase family 1, member A1 (aldehyde reductase)	295					aldehyde catabolic process (GO:0046185)|cellular aldehyde metabolic process (GO:0006081)|D-glucuronate catabolic process (GO:0042840)|glucose metabolic process (GO:0006006)|L-ascorbic acid biosynthetic process (GO:0019853)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|L-glucuronate reductase activity (GO:0047939)			lung(3)|prostate(1)|urinary_tract(1)	5	Acute lymphoblastic leukemia(166;0.155)				Doxorubicin(DB00997)	CTGAACAAAAATTGGAGATAT	0.483																																					p.N295S		Atlas-SNP	.											.	AKR1A1	25	.	0			c.A884G						PASS	.						122.0	118.0	119.0					1																	46034873		2203	4300	6503	SO:0001583	missense	10327	exon9			ACAAAAATTGGAG	J04794	CCDS523.1	1p33-p32	2010-04-08			ENSG00000117448	ENSG00000117448	1.1.1.2	"""Aldo-keto reductases"""	380	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 3"""	103830				2498333, 10393438	Standard	NM_001202414		Approved	ALR, DD3	uc001coe.3	P14550	OTTHUMG00000007740	ENST00000372070.3:c.884A>G	chr1.hg19:g.46034873A>G	ENSP00000361140:p.Asn295Ser	113.0	0.0	.		112.0	37.0	.	NM_001202413	A8KAL8|D3DQ04|Q6IAZ4	Missense_Mutation	SNP	ENST00000372070.3	hg19	CCDS523.1	.	.	.	.	.	.	.	.	.	.	A	17.53	3.412079	0.62511	.	.	ENSG00000117448	ENST00000372070;ENST00000351829	T;T	0.31247	1.5;1.5	6.04	6.04	0.98038	NADP-dependent oxidoreductase domain (2);	0.088191	0.85682	D	0.000000	T	0.22589	0.0545	N	0.14661	0.345	0.47737	D	0.999502	B	0.13145	0.007	B	0.08055	0.003	T	0.03202	-1.1061	10	0.72032	D	0.01	.	16.6349	0.85050	1.0:0.0:0.0:0.0	.	295	P14550	AK1A1_HUMAN	S	295	ENSP00000361140:N295S;ENSP00000312606:N295S	ENSP00000312606:N295S	N	+	2	0	AKR1A1	45807460	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.649000	0.74364	2.330000	0.79161	0.477000	0.44152	AAT	.	.	.	none		0.483	AKR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020851.1	NM_006066	
PEAR1	375033	hgsc.bcm.edu	37	1	156878561	156878561	+	Silent	SNP	C	C	T			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr1:156878561C>T	ENST00000338302.3	+	11	1455	c.1230C>T	c.(1228-1230)tgC>tgT	p.C410C	PEAR1_ENST00000292357.7_Silent_p.C410C			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	410	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					ACTGTCTCTGCCTGCACGGTG	0.711																																					p.C410C		Atlas-SNP	.											.	PEAR1	118	.	0			c.C1230T						PASS	.						20.0	18.0	18.0					1																	156878561		2191	4287	6478	SO:0001819	synonymous_variant	375033	exon10			TCTCTGCCTGCAC	AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.1230C>T	chr1.hg19:g.156878561C>T		94.0	0.0	.		51.0	12.0	.	NM_001080471	Q8TEK2	Silent	SNP	ENST00000338302.3	hg19	CCDS30892.1																																																																																			.	.	.	none		0.711	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471	
SUCO	51430	hgsc.bcm.edu	37	1	172543034	172543034	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr1:172543034T>A	ENST00000263688.3	+	10	1272	c.1053T>A	c.(1051-1053)ttT>ttA	p.F351L	SUCO_ENST00000367723.4_Missense_Mutation_p.F509L|SUCO_ENST00000610051.1_Missense_Mutation_p.F314L|SUCO_ENST00000608151.1_Missense_Mutation_p.F510L	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	351	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)											TTTGAAGGTTTGTTATTGAAC	0.264																																					p.F351L		Atlas-SNP	.											.	.	.	.	0			c.T1053A						PASS	.						49.0	53.0	52.0					1																	172543034		2199	4287	6486	SO:0001583	missense	51430	exon10			AAGGTTTGTTATT	AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.1053T>A	chr1.hg19:g.172543034T>A	ENSP00000263688:p.Phe351Leu	25.0	0.0	.		61.0	15.0	.	NM_014283	B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Missense_Mutation	SNP	ENST00000263688.3	hg19	CCDS1303.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.038021	0.75617	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	T;T	0.39592	1.07;1.07	5.44	4.32	0.51571	Galactose-binding domain-like (1);Sad1/UNC-like, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.44138	0.1279	L	0.47078	1.49	0.80722	D	1	D;P;D;D	0.76494	0.992;0.861;0.999;0.999	D;P;D;D	0.87578	0.987;0.89;0.998;0.998	T	0.49021	-0.8982	10	0.87932	D	0	-19.703	10.1906	0.43024	0.0:0.0795:0.0:0.9205	.	314;351;510;351	B4DYM4;B4DZJ3;Q5H945;Q9UBS9	.;.;.;OSPT_HUMAN	L	510;351	ENSP00000356696:F510L;ENSP00000263688:F351L	ENSP00000263688:F351L	F	+	3	2	C1orf9	170809657	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.414000	0.52693	0.897000	0.36392	0.383000	0.25322	TTT	.	.	.	none		0.264	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084273.1	NM_016227	
USH2A	7399	hgsc.bcm.edu	37	1	216495239	216495239	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr1:216495239T>A	ENST00000307340.3	-	9	2016	c.1630A>T	c.(1630-1632)Act>Tct	p.T544S	USH2A_ENST00000366942.3_Missense_Mutation_p.T544S|USH2A_ENST00000366943.2_Missense_Mutation_p.T544S	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	544	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGTCCTTCAGTGAAGCTCTCC	0.413										HNSCC(13;0.011)																											p.T544S		Atlas-SNP	.											.	USH2A	1168	.	0			c.A1630T						PASS	.						153.0	141.0	145.0					1																	216495239		2203	4300	6503	SO:0001583	missense	7399	exon9			CTTCAGTGAAGCT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.1630A>T	chr1.hg19:g.216495239T>A	ENSP00000305941:p.Thr544Ser	72.0	0.0	.		113.0	42.0	.	NM_007123	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	hg19	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.029846	0.75504	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.64438	-0.1;-0.1;-0.1	5.65	4.49	0.54785	EGF-like, laminin (3);	0.000000	0.43579	U	0.000554	D	0.86451	0.5936	H	0.98466	4.24	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.87578	0.992;0.998	D	0.90034	0.4137	10	0.87932	D	0	.	12.6812	0.56922	0.0:0.0:0.1379:0.8621	.	544;544	O75445-2;O75445	.;USH2A_HUMAN	S	544	ENSP00000305941:T544S;ENSP00000355910:T544S;ENSP00000355909:T544S	ENSP00000305941:T544S	T	-	1	0	USH2A	214561862	1.000000	0.71417	0.960000	0.40013	0.643000	0.38383	4.814000	0.62627	0.911000	0.36747	0.455000	0.32223	ACT	.	.	.	none		0.413	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
NUP133	55746	hgsc.bcm.edu	37	1	229631660	229631660	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr1:229631660T>A	ENST00000261396.3	-	7	1045	c.954A>T	c.(952-954)gaA>gaT	p.E318D	NUP133_ENST00000537506.1_Missense_Mutation_p.E302D	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	318					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				CGGTAATGTTTTCCTTCAGGG	0.333																																					p.E318D		Atlas-SNP	.											.	NUP133	111	.	0			c.A954T						PASS	.						121.0	122.0	122.0					1																	229631660		2203	4300	6503	SO:0001583	missense	55746	exon7			AATGTTTTCCTTC		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.954A>T	chr1.hg19:g.229631660T>A	ENSP00000261396:p.Glu318Asp	21.0	0.0	.		33.0	13.0	.	NM_018230	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Missense_Mutation	SNP	ENST00000261396.3	hg19	CCDS1579.1	.	.	.	.	.	.	.	.	.	.	T	14.25	2.480586	0.44044	.	.	ENSG00000069248	ENST00000366681;ENST00000261396;ENST00000366679;ENST00000537506	T;T;T	0.26518	1.73;1.73;1.73	5.57	-5.85	0.02311	WD40/YVTN repeat-like-containing domain (1);Nucleoporin, Nup133/Nup155-like, N-terminal (1);	0.045027	0.85682	D	0.000000	T	0.25419	0.0618	L	0.44542	1.39	0.47819	D	0.999526	P	0.46784	0.884	P	0.50490	0.642	T	0.10613	-1.0622	10	0.30854	T	0.27	-4.8162	14.423	0.67196	0.0:0.5307:0.0:0.4693	.	318	Q8WUM0	NU133_HUMAN	D	318;318;318;302	ENSP00000261396:E318D;ENSP00000355640:E318D;ENSP00000443496:E302D	ENSP00000261396:E318D	E	-	3	2	NUP133	227698283	0.689000	0.27690	0.051000	0.19133	0.954000	0.61252	-0.292000	0.08332	-1.201000	0.02659	-0.263000	0.10527	GAA	.	.	.	none		0.333	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	
PREPL	9581	hgsc.bcm.edu	37	2	44549877	44549877	+	Silent	SNP	T	T	C			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr2:44549877T>C	ENST00000409936.1	-	13	2450	c.2013A>G	c.(2011-2013)acA>acG	p.T671T	PREPL_ENST00000409272.1_Silent_p.T671T|PREPL_ENST00000378520.3_Silent_p.T605T|PREPL_ENST00000409411.1_Silent_p.T582T|PREPL_ENST00000378511.3_Silent_p.T609T|PREPL_ENST00000541738.1_Silent_p.T582T|PREPL_ENST00000409957.1_Silent_p.T582T|PREPL_ENST00000260648.6_Silent_p.T671T|PREPL_ENST00000410081.1_Silent_p.T671T	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	671						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TACCTTCACCTGTGTCCTTAG	0.468																																					p.T671T		Atlas-SNP	.											.	PREPL	69	.	0			c.A2013G						PASS	.						218.0	209.0	212.0					2																	44549877		2203	4300	6503	SO:0001819	synonymous_variant	9581	exon13			TTCACCTGTGTCC	AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.2013A>G	chr2.hg19:g.44549877T>C		54.0	0.0	.		95.0	35.0	.	NM_001171603	A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Silent	SNP	ENST00000409936.1	hg19	CCDS33190.1	.	.	.	.	.	.	.	.	.	.	T	8.440	0.850530	0.17034	.	.	ENSG00000138078	ENST00000420756	.	.	.	5.42	-10.8	0.00216	.	.	.	.	.	T	0.14098	0.0341	.	.	.	0.09310	N	0.99999	.	.	.	.	.	.	T	0.07829	-1.0752	4	.	.	.	1.8666	1.7996	0.03068	0.1889:0.2778:0.3326:0.2007	.	.	.	.	R	53	.	.	Q	-	2	0	PREPL	44403381	0.000000	0.05858	0.000000	0.03702	0.264000	0.26372	-2.011000	0.01452	-3.526000	0.00147	-0.256000	0.11100	CAG	.	.	.	none		0.468	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327900.1	NM_006036	
GPD2	2820	hgsc.bcm.edu	37	2	157407170	157407170	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr2:157407170G>A	ENST00000310454.6	+	8	1255	c.883G>A	c.(883-885)Gac>Aac	p.D295N	GPD2_ENST00000409125.4_Missense_Mutation_p.D68N|GPD2_ENST00000409674.1_Missense_Mutation_p.D295N|GPD2_ENST00000438166.2_Missense_Mutation_p.D295N|GPD2_ENST00000540309.1_Missense_Mutation_p.D295N	NM_001083112.2	NP_001076581.2	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2 (mitochondrial)	295					camera-type eye development (GO:0043010)|cellular lipid metabolic process (GO:0044255)|gluconeogenesis (GO:0006094)|glycerol catabolic process (GO:0019563)|glycerol-3-phosphate metabolic process (GO:0006072)|multicellular organism growth (GO:0035264)|small molecule metabolic process (GO:0044281)	glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity (GO:0052591)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|stomach(1)	22						ACCTTTCACGGACTCTGTGCG	0.463																																					p.D295N		Atlas-SNP	.											.	GPD2	59	.	0			c.G883A						PASS	.						130.0	113.0	119.0					2																	157407170		2203	4300	6503	SO:0001583	missense	2820	exon8			TTCACGGACTCTG		CCDS2202.1	2q24.1	2013-01-10			ENSG00000115159	ENSG00000115159	1.1.1.8	"""EF-hand domain containing"""	4456	protein-coding gene	gene with protein product		138430					Standard	NM_001083112		Approved		uc002tzd.4	P43304	OTTHUMG00000131951	ENST00000310454.6:c.883G>A	chr2.hg19:g.157407170G>A	ENSP00000308610:p.Asp295Asn	54.0	0.0	.		65.0	20.0	.	NM_001083112	A8K4V0|B3KSA9|Q59FR1|Q9HAP9	Missense_Mutation	SNP	ENST00000310454.6	hg19	CCDS2202.1	.	.	.	.	.	.	.	.	.	.	G	36	5.650365	0.96714	.	.	ENSG00000115159	ENST00000310454;ENST00000409125;ENST00000438166;ENST00000540309;ENST00000409674	D;D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54;-1.54	5.68	5.68	0.88126	FAD dependent oxidoreductase (1);	0.041854	0.85682	N	0.000000	D	0.92642	0.7662	M	0.86651	2.83	0.80722	D	1	B	0.24920	0.114	P	0.56278	0.795	D	0.91028	0.4862	10	0.87932	D	0	.	19.7855	0.96434	0.0:0.0:1.0:0.0	.	295	P43304	GPDM_HUMAN	N	295;68;295;295;295	ENSP00000308610:D295N;ENSP00000386484:D68N;ENSP00000409708:D295N;ENSP00000440892:D295N;ENSP00000386425:D295N	ENSP00000308610:D295N	D	+	1	0	GPD2	157115416	1.000000	0.71417	0.994000	0.49952	0.958000	0.62258	9.824000	0.99380	2.675000	0.91044	0.563000	0.77884	GAC	.	.	.	none		0.463	GPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254910.3		
ABCB6	10058	hgsc.bcm.edu	37	2	220081117	220081117	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr2:220081117C>G	ENST00000265316.3	-	4	1255	c.939G>C	c.(937-939)aaG>aaC	p.K313N	ABCB6_ENST00000439002.2_Missense_Mutation_p.K267N	NM_005689.2	NP_005680.1	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)	313	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|porphyrin-containing compound biosynthetic process (GO:0006779)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial envelope (GO:0005740)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|efflux transmembrane transporter activity (GO:0015562)|heme binding (GO:0020037)|heme transporter activity (GO:0015232)|heme-transporting ATPase activity (GO:0015439)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	34		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCTGGAGGAACTTGAGGAAGA	0.562																																					p.K313N		Atlas-SNP	.											.	ABCB6	76	.	0			c.G939C						PASS	.						96.0	104.0	101.0					2																	220081117		2203	4300	6503	SO:0001583	missense	10058	exon4			GAGGAACTTGAGG	AF070598	CCDS2436.1	2q36	2014-08-27	2014-08-27		ENSG00000115657	ENSG00000115657		"""ATP binding cassette transporters / subfamily B"""	47	protein-coding gene	gene with protein product	"""ATP-binding cassette half-transporter"""	605452	"""ATP-binding cassette, sub-family B (MDR/TAP), member 6"""			8894702, 9110174	Standard	NM_005689		Approved	EST45597, umat, MTABC3	uc002vkc.2	Q9NP58	OTTHUMG00000133131	ENST00000265316.3:c.939G>C	chr2.hg19:g.220081117C>G	ENSP00000265316:p.Lys313Asn	144.0	0.0	.		151.0	46.0	.	NM_005689	O75542|Q49A66|Q59GQ5|Q6ZME6|Q96ME8|Q9HAQ6|Q9HAQ7	Missense_Mutation	SNP	ENST00000265316.3	hg19	CCDS2436.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.1|25.1	4.601897|4.601897	0.87055|0.87055	.|.	.|.	ENSG00000115657|ENSG00000115657	ENST00000265316;ENST00000439002|ENST00000295750	D;D|.	0.94497|.	-3.39;-3.44|.	5.17|5.17	4.28|4.28	0.50868|0.50868	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78604|0.78604	0.4309|0.4309	M|M	0.86343|0.86343	2.81|2.81	0.80722|0.80722	D|D	1|1	D;D|.	0.71674|.	0.992;0.998|.	D;D|.	0.77004|.	0.948;0.989|.	T|T	0.81326|0.81326	-0.0983|-0.0983	10|5	0.56958|.	D|.	0.05|.	-25.1829|-25.1829	14.1461|14.1461	0.65351|0.65351	0.0:0.927:0.0:0.073|0.0:0.927:0.0:0.073	.|.	267;313|.	Q9NP58-4;Q9NP58|.	.;ABCB6_HUMAN|.	N|T	313;267|161	ENSP00000265316:K313N;ENSP00000394333:K267N|.	ENSP00000265316:K313N|.	K|S	-|-	3|2	2|0	ABCB6|ABCB6	219789361|219789361	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.831000|3.831000	0.55776|0.55776	2.683000|2.683000	0.91414|0.91414	0.650000|0.650000	0.86243|0.86243	AAG|AGT	.	.	.	none		0.562	ABCB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256820.2	NM_005689	
KIF1A	547	hgsc.bcm.edu	37	2	241689964	241689964	+	Splice_Site	SNP	C	C	T			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr2:241689964C>T	ENST00000320389.7	-	26	2714	c.2556G>A	c.(2554-2556)agG>agA	p.R852R	KIF1A_ENST00000498729.2_Splice_Site_p.R953R	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	852					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		ACACGAAGGCCCTGGGGAGAA	0.642																																					p.R953R		Atlas-SNP	.											.	KIF1A	152	.	0			c.G2859A						PASS	.						46.0	53.0	51.0					2																	241689964		2134	4240	6374	SO:0001630	splice_region_variant	547	exon28			GAAGGCCCTGGGG	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2556-1G>A	chr2.hg19:g.241689964C>T		135.0	0.0	.		88.0	29.0	.	NM_001244008	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Silent	SNP	ENST00000320389.7	hg19	CCDS46561.1																																																																																			.	.	.	none		0.642	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	Silent
RBM6	10180	hgsc.bcm.edu	37	3	50103677	50103677	+	Silent	SNP	T	T	G			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr3:50103677T>G	ENST00000266022.4	+	17	2944	c.2685T>G	c.(2683-2685)ccT>ccG	p.P895P	RBM6_ENST00000539992.1_Silent_p.P237P|RBM6_ENST00000442092.1_Silent_p.P373P|RBM6_ENST00000443081.1_Silent_p.P763P|RBM6_ENST00000421682.1_5'Flank|RBM6_ENST00000441115.1_3'UTR|RBM6_ENST00000422955.1_Silent_p.P373P	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	895	Poly-Pro.				RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		CCTTCCAGCCTAAAGTGGTAA	0.463																																					p.P895P		Atlas-SNP	.											.	RBM6	85	.	0			c.T2685G						PASS	.						35.0	38.0	37.0					3																	50103677		2203	4300	6503	SO:0001819	synonymous_variant	10180	exon17			CCAGCCTAAAGTG	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.2685T>G	chr3.hg19:g.50103677T>G		77.0	0.0	.		72.0	25.0	.	NM_005777	O60549|O75524|Q86SS3	Silent	SNP	ENST00000266022.4	hg19	CCDS2809.1																																																																																			.	.	.	none		0.463	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	NM_005777	
HERC6	55008	hgsc.bcm.edu	37	4	89361324	89361324	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr4:89361324C>A	ENST00000264346.7	+	22	2823	c.2764C>A	c.(2764-2766)Caa>Aaa	p.Q922K	HERC6_ENST00000380265.5_Missense_Mutation_p.Q886K	NM_017912.3	NP_060382.3	Q8IVU3	HERC6_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 6	922	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				hematopoietic progenitor cell differentiation (GO:0002244)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		GCAAGGATACCAAAAATCACA	0.368																																					p.Q922K		Atlas-SNP	.											.	HERC6	104	.	0			c.C2764A						PASS	.						58.0	52.0	54.0					4																	89361324		1835	4092	5927	SO:0001583	missense	55008	exon22			GGATACCAAAAAT	AF336798	CCDS47098.1, CCDS54777.1	4q22	2012-02-23	2012-02-23		ENSG00000138642	ENSG00000138642			26072	protein-coding gene	gene with protein product		609249	"""hect domain and RLD 6"""				Standard	NM_001165136		Approved	FLJ20637	uc011cdi.2	Q8IVU3	OTTHUMG00000160983	ENST00000264346.7:c.2764C>A	chr4.hg19:g.89361324C>A	ENSP00000264346:p.Gln922Lys	109.0	0.0	.		152.0	52.0	.	NM_017912	B4DIY5|Q5GC90|Q5GRH3|Q5HYM6|Q5JPB6|Q6PIF4|Q8NAN3|Q9NWS4	Missense_Mutation	SNP	ENST00000264346.7	hg19	CCDS47098.1	.	.	.	.	.	.	.	.	.	.	C	1.116	-0.656611	0.03480	.	.	ENSG00000138642	ENST00000380265;ENST00000264346	T;T	0.56444	0.46;0.46	5.0	-2.57	0.06248	HECT (4);	0.912860	0.09345	N	0.814981	T	0.24624	0.0597	N	0.16903	0.455	0.25165	N	0.990324	B;B	0.16802	0.015;0.019	B;B	0.22152	0.023;0.038	T	0.26467	-1.0102	10	0.05959	T	0.93	.	0.9787	0.01431	0.4096:0.2078:0.1032:0.2795	.	886;922	Q8IVU3-2;Q8IVU3	.;HERC6_HUMAN	K	886;922	ENSP00000369617:Q886K;ENSP00000264346:Q922K	ENSP00000264346:Q922K	Q	+	1	0	HERC6	89580347	0.000000	0.05858	0.001000	0.08648	0.059000	0.15707	-4.663000	0.00201	-0.733000	0.04850	-0.237000	0.12165	CAA	.	.	.	none		0.368	HERC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363259.2		
CMYA5	202333	hgsc.bcm.edu	37	5	79025276	79025276	+	Missense_Mutation	SNP	A	A	C	rs114327893		TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr5:79025276A>C	ENST00000446378.2	+	2	719	c.688A>C	c.(688-690)Aag>Cag	p.K230Q		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	230					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		ATATAAAATTAAGATGTTTAA	0.323																																					p.K230Q		Atlas-SNP	.											.	CMYA5	643	.	0			c.A688C						PASS	.						46.0	45.0	45.0					5																	79025276		1808	4080	5888	SO:0001583	missense	202333	exon2			AAAATTAAGATGT	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.688A>C	chr5.hg19:g.79025276A>C	ENSP00000394770:p.Lys230Gln	134.0	0.0	.		264.0	85.0	.	NM_153610	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	hg19	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	A	15.86	2.956820	0.53293	.	.	ENSG00000164309	ENST00000446378	T	0.61392	0.11	6.06	6.06	0.98353	.	0.000000	0.56097	D	0.000038	T	0.54481	0.1861	L	0.34521	1.04	0.24052	N	0.996045	P	0.52463	0.953	P	0.49387	0.609	T	0.56159	-0.8025	10	0.87932	D	0	.	11.3193	0.49412	0.8036:0.1964:0.0:0.0	.	230	Q8N3K9	CMYA5_HUMAN	Q	230	ENSP00000394770:K230Q	ENSP00000394770:K230Q	K	+	1	0	CMYA5	79061032	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.987000	0.56944	2.315000	0.78130	0.533000	0.62120	AAG	.	A|0.999;G|0.001	.	alt		0.323	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
GPR98	84059	hgsc.bcm.edu	37	5	90073763	90073763	+	Missense_Mutation	SNP	T	T	G			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr5:90073763T>G	ENST00000405460.2	+	62	12665	c.12569T>G	c.(12568-12570)tTc>tGc	p.F4190C		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	4190	Calx-beta 28. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GTCACAGTGTTCTGGAGGATA	0.428																																					p.F4190C		Atlas-SNP	.											.	GPR98	605	.	0			c.T12569G						PASS	.						72.0	73.0	73.0					5																	90073763		1891	4109	6000	SO:0001583	missense	84059	exon62			CAGTGTTCTGGAG	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.12569T>G	chr5.hg19:g.90073763T>G	ENSP00000384582:p.Phe4190Cys	96.0	0.0	.		127.0	57.0	.	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	hg19	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	T	10.71	1.427948	0.25726	.	.	ENSG00000164199	ENST00000405460;ENST00000296619	T	0.27557	1.66	5.24	-5.55	0.02536	.	0.648335	0.17229	N	0.182009	T	0.12008	0.0292	N	0.14661	0.345	0.09310	N	0.999991	P	0.52463	0.953	B	0.43155	0.41	T	0.18429	-1.0337	10	0.38643	T	0.18	.	2.0846	0.03643	0.4047:0.1855:0.0698:0.34	.	4190	Q8WXG9	GPR98_HUMAN	C	4190	ENSP00000384582:F4190C	ENSP00000296619:F4190C	F	+	2	0	GPR98	90109519	0.003000	0.15002	0.106000	0.21319	0.384000	0.30261	-0.029000	0.12329	-1.402000	0.02056	0.368000	0.22195	TTC	.	.	.	none		0.428	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
ZNF318	24149	hgsc.bcm.edu	37	6	43305308	43305308	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr6:43305308G>A	ENST00000361428.2	-	10	6505	c.6428C>T	c.(6427-6429)tCc>tTc	p.S2143F	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	2143					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			GTCTAATTGGGAAGATTCTTT	0.473																																					p.S2143F		Atlas-SNP	.											.	ZNF318	175	.	0			c.C6428T						PASS	.						60.0	57.0	58.0					6																	43305308		2203	4300	6503	SO:0001583	missense	24149	exon10			AATTGGGAAGATT	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.6428C>T	chr6.hg19:g.43305308G>A	ENSP00000354964:p.Ser2143Phe	77.0	0.0	.		89.0	32.0	.	NM_014345	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	ENST00000361428.2	hg19	CCDS4895.2	.	.	.	.	.	.	.	.	.	.	G	11.91	1.778572	0.31502	.	.	ENSG00000171467	ENST00000361428	T	0.12774	2.65	5.86	2.62	0.31277	.	0.382752	0.22732	N	0.056305	T	0.03783	0.0107	N	0.20986	0.625	0.45621	D	0.998558	B	0.14438	0.01	B	0.16722	0.016	T	0.21348	-1.0248	10	0.46703	T	0.11	-2.181	10.7458	0.46179	0.0744:0.2474:0.6782:0.0	.	2143	Q5VUA4	ZN318_HUMAN	F	2143	ENSP00000354964:S2143F	ENSP00000354964:S2143F	S	-	2	0	ZNF318	43413286	0.978000	0.34361	0.993000	0.49108	0.933000	0.57130	1.404000	0.34623	0.786000	0.33708	-0.176000	0.13171	TCC	.	.	.	none		0.473	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345	
CDC5L	988	hgsc.bcm.edu	37	6	44392211	44392211	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr6:44392211A>G	ENST00000371477.3	+	11	1759	c.1460A>G	c.(1459-1461)aAg>aGg	p.K487R		NM_001253.3	NP_001244.1	Q99459	CDC5L_HUMAN	cell division cycle 5-like	487	Interaction with PPP1R8.				cell cycle (GO:0007049)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|WD40-repeat domain binding (GO:0071987)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(4)	29	all_lung(25;0.00433)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CCTGCCCCTAAGAATGATTTT	0.413																																					p.K487R		Atlas-SNP	.											.	CDC5L	86	.	0			c.A1460G						PASS	.						107.0	101.0	103.0					6																	44392211		2203	4300	6503	SO:0001583	missense	988	exon11			CCCCTAAGAATGA	D85423	CCDS4912.1	6p21.1	2013-01-17	2013-01-17		ENSG00000096401	ENSG00000096401			1743	protein-coding gene	gene with protein product		602868	"""CDC5 (cell division cycle 5, S. pombe, homolog)-like"", ""CDC5 cell division cycle 5-like (S. pombe)"""			9598309, 9038199	Standard	NM_001253		Approved	PCDC5RP, hCDC5, CEF1, CDC5	uc003oxl.3	Q99459	OTTHUMG00000014767	ENST00000371477.3:c.1460A>G	chr6.hg19:g.44392211A>G	ENSP00000360532:p.Lys487Arg	78.0	0.0	.		117.0	39.0	.	NM_001253	Q76N46|Q99974	Missense_Mutation	SNP	ENST00000371477.3	hg19	CCDS4912.1	.	.	.	.	.	.	.	.	.	.	A	15.44	2.835675	0.50951	.	.	ENSG00000096401	ENST00000371477	T	0.49139	0.79	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.36358	0.0964	M	0.69248	2.105	0.58432	D	0.999999	B	0.24618	0.107	B	0.27262	0.078	T	0.23084	-1.0198	10	0.33141	T	0.24	-20.4495	16.5932	0.84781	1.0:0.0:0.0:0.0	.	487	Q99459	CDC5L_HUMAN	R	487	ENSP00000360532:K487R	ENSP00000360532:K487R	K	+	2	0	CDC5L	44500189	1.000000	0.71417	0.999000	0.59377	0.960000	0.62799	7.569000	0.82380	2.320000	0.78422	0.528000	0.53228	AAG	.	.	.	none		0.413	CDC5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040743.1		
SYNJ2	8871	hgsc.bcm.edu	37	6	158504535	158504535	+	Silent	SNP	G	G	A			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr6:158504535G>A	ENST00000355585.4	+	21	3015	c.2940G>A	c.(2938-2940)cgG>cgA	p.R980R	SYNJ2_ENST00000367122.2_Silent_p.R980R|SYNJ2_ENST00000367112.1_Silent_p.R65R|SYNJ2_ENST00000367121.3_Silent_p.R980R	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2	980					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		AGATCATTCGGAAACGAGACA	0.532																																					p.R980R		Atlas-SNP	.											.	SYNJ2	111	.	0			c.G2940A						PASS	.						105.0	97.0	100.0					6																	158504535		2203	4300	6503	SO:0001819	synonymous_variant	8871	exon21			CATTCGGAAACGA	AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.2940G>A	chr6.hg19:g.158504535G>A		99.0	0.0	.		76.0	26.0	.	NM_003898	Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Silent	SNP	ENST00000355585.4	hg19	CCDS5254.1																																																																																			.	.	.	none		0.532	SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042858.2		
FAM20C	56975	hgsc.bcm.edu	37	7	208977	208977	+	Splice_Site	SNP	G	G	A			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr7:208977G>A	ENST00000313766.5	+	3	1094		c.e3+1			NM_020223.3	NP_064608.2	Q8IXL6	DMP4_HUMAN	family with sequence similarity 20, member C						dentinogenesis (GO:0097187)|enamel mineralization (GO:0070166)|odontoblast differentiation (GO:0071895)|osteoclast maturation (GO:0036179)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of phosphorus metabolic process (GO:0051174)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|urinary_tract(1)	4		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)		AACCCATGAAGTAAGTGCCGA	0.627																																					.		Atlas-SNP	.											.	FAM20C	18	.	0			c.863+1G>A						PASS	.						46.0	48.0	48.0					7																	208977		2038	4186	6224	SO:0001630	splice_region_variant	56975	exon3			CATGAAGTAAGTG	BC040074	CCDS47522.1	7p22.3	2012-11-29			ENSG00000177706	ENSG00000177706			22140	protein-coding gene	gene with protein product	"""dentin matrix protein 4"""	611061				17369251, 17924334	Standard	NM_020223		Approved	IMAGE:4942737, DKFZp547D065, DMP4	uc003sip.3	Q8IXL6	OTTHUMG00000151401	ENST00000313766.5:c.863+1G>A	chr7.hg19:g.208977G>A		95.0	0.0	.		49.0	12.0	.	NM_020223	A4D2Q5|L8B5W8|Q5I0W9|Q7Z4I0|Q9NPT2	Splice_Site	SNP	ENST00000313766.5	hg19	CCDS47522.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.660989	0.88154	.	.	ENSG00000177706	ENST00000313766	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5659	0.87919	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FAM20C	304060	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	8.213000	0.89758	2.439000	0.82584	0.655000	0.94253	.	.	.	.	none		0.627	FAM20C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322476.2	NM_020223	Intron
SLC4A2	6522	hgsc.bcm.edu	37	7	150771852	150771852	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr7:150771852G>A	ENST00000485713.1	+	19	4011	c.2971G>A	c.(2971-2973)Gtg>Atg	p.V991M	RP11-148K1.12_ENST00000485974.1_RNA|FASTK_ENST00000489884.1_5'Flank|SLC4A2_ENST00000392826.2_Missense_Mutation_p.V982M|SLC4A2_ENST00000413384.2_Missense_Mutation_p.V991M|SLC4A2_ENST00000461735.1_Missense_Mutation_p.V977M|SLC4A2_ENST00000310317.5_Missense_Mutation_p.V909M	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	991	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCCCTTCCCTGTGTGGATGAT	0.582																																					p.V991M		Atlas-SNP	.											.	SLC4A2	98	.	0			c.G2971A						PASS	.						76.0	80.0	79.0					7																	150771852		2203	4300	6503	SO:0001583	missense	6522	exon19			TTCCCTGTGTGGA		CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.2971G>A	chr7.hg19:g.150771852G>A	ENSP00000419412:p.Val991Met	92.0	0.0	.		73.0	24.0	.	NM_003040	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	ENST00000485713.1	hg19	CCDS5917.1	.	.	.	.	.	.	.	.	.	.	G	15.94	2.982076	0.53827	.	.	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	T;T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27;-1.27	5.29	5.29	0.74685	Bicarbonate transporter, C-terminal (1);	0.211754	0.41294	D	0.000916	T	0.78923	0.4360	M	0.73372	2.23	0.40710	D	0.982567	B;B;B	0.34290	0.393;0.393;0.447	B;B;B	0.40329	0.312;0.219;0.326	T	0.77413	-0.2597	10	0.34782	T	0.22	.	13.4146	0.60961	0.0:0.1576:0.8424:0.0	.	982;977;991	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	M	991;991;909;982;977	ENSP00000419412:V991M;ENSP00000405600:V991M;ENSP00000311402:V909M;ENSP00000376571:V982M;ENSP00000419164:V977M	ENSP00000311402:V909M	V	+	1	0	SLC4A2	150402785	0.013000	0.17824	1.000000	0.80357	0.997000	0.91878	0.192000	0.17096	2.756000	0.94617	0.561000	0.74099	GTG	.	.	.	none		0.582	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040	
PTK2	5747	hgsc.bcm.edu	37	8	141669756	141669756	+	Silent	SNP	A	A	G			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr8:141669756A>G	ENST00000522684.1	-	32	3197	c.2968T>C	c.(2968-2970)Ttg>Ctg	p.L990L	PTK2_ENST00000521059.1_Silent_p.L990L|PTK2_ENST00000522950.1_3'UTR|PTK2_ENST00000340930.3_Silent_p.L1003L|PTK2_ENST00000517712.1_Silent_p.L53L|PTK2_ENST00000430260.2_Silent_p.L300L|PTK2_ENST00000517887.1_Silent_p.L1034L|PTK2_ENST00000538769.1_Silent_p.L658L|PTK2_ENST00000535192.1_Silent_p.L944L|PTK2_ENST00000519419.1_Silent_p.L1034L|PTK2_ENST00000519465.1_Silent_p.L618L|PTK2_ENST00000395218.2_Silent_p.L1003L	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	990	Interaction with ARHGEF28. {ECO:0000250}.|Interaction with TGFB1I1.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			TCAGAGTTCAATAGCTTCTGT	0.418																																					p.L1012L		Atlas-SNP	.											.	PTK2	311	.	0			c.T3034C						PASS	.						111.0	95.0	101.0					8																	141669756		2203	4300	6503	SO:0001819	synonymous_variant	5747	exon32			AGTTCAATAGCTT	L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.2968T>C	chr8.hg19:g.141669756A>G		90.0	0.0	.		121.0	42.0	.	NM_005607	B4E2N6|F5H4S4|Q14291|Q9UD85	Silent	SNP	ENST00000522684.1	hg19	CCDS6381.1	.	.	.	.	.	.	.	.	.	.	A	7.471	0.646717	0.14516	.	.	ENSG00000169398	ENST00000519654	.	.	.	5.75	-0.279	0.12890	.	.	.	.	.	T	0.58192	0.2105	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53251	-0.8465	4	.	.	.	.	11.0584	0.47933	0.3482:0.0:0.6518:0.0	.	.	.	.	T	954	.	.	I	-	2	0	PTK2	141738938	1.000000	0.71417	0.967000	0.41034	0.939000	0.58152	1.934000	0.40163	-0.104000	0.12154	-0.256000	0.11100	ATT	.	.	.	none		0.418	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378054.5	NM_005607	
GAPVD1	26130	hgsc.bcm.edu	37	9	128116940	128116940	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr9:128116940G>A	ENST00000495955.1	+	24	3921	c.3631G>A	c.(3631-3633)Gcc>Acc	p.A1211T	GAPVD1_ENST00000394083.2_Missense_Mutation_p.A1145T|GAPVD1_ENST00000470056.1_Missense_Mutation_p.A1166T|GAPVD1_ENST00000297933.6_Missense_Mutation_p.A1193T|GAPVD1_ENST00000312123.9_Missense_Mutation_p.A1172T|GAPVD1_ENST00000394104.2_Missense_Mutation_p.A1211T|GAPVD1_ENST00000394105.2_Missense_Mutation_p.A1220T|GAPVD1_ENST00000265956.4_Missense_Mutation_p.A1185T			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	1211					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						TAGAAAAAGAGCCCCATATAT	0.383																																					p.A1220T		Atlas-SNP	.											.	GAPVD1	124	.	0			c.G3658A						PASS	.						86.0	88.0	87.0					9																	128116940		2203	4300	6503	SO:0001583	missense	26130	exon23			AAAAGAGCCCCAT		CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.3631G>A	chr9.hg19:g.128116940G>A	ENSP00000419063:p.Ala1211Thr	61.0	0.0	.		82.0	25.0	.	NM_015635	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Missense_Mutation	SNP	ENST00000495955.1	hg19		.	.	.	.	.	.	.	.	.	.	G	27.5	4.841442	0.91197	.	.	ENSG00000165219	ENST00000470056;ENST00000394105;ENST00000394104;ENST00000265956;ENST00000394083;ENST00000495955;ENST00000297933;ENST00000312123	.	.	.	6.08	5.19	0.71726	.	0.044268	0.85682	N	0.000000	T	0.58337	0.2115	L	0.39020	1.185	0.80722	D	1	B;P;B;B;B;P	0.40834	0.333;0.73;0.43;0.298;0.298;0.672	B;B;P;P;P;P	0.48334	0.28;0.147;0.471;0.471;0.471;0.574	T	0.62364	-0.6870	9	0.72032	D	0.01	.	14.2482	0.66001	0.0706:0.0:0.9294:0.0	.	1211;226;1166;1172;1193;1220	Q14C86;B3KTX2;Q14C86-3;Q14C86-4;Q14C86-2;Q14C86-6	GAPD1_HUMAN;.;.;.;.;.	T	1166;1220;1211;1185;1145;1211;1193;1172	.	ENSP00000265956:A1185T	A	+	1	0	GAPVD1	127156761	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.562000	0.73960	1.589000	0.49982	0.591000	0.81541	GCC	.	.	.	none		0.383	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000355644.1		
LAMC3	10319	hgsc.bcm.edu	37	9	133884789	133884789	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr9:133884789C>A	ENST00000361069.4	+	1	321	c.188C>A	c.(187-189)cCc>cAc	p.P63H	LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	63	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GACTTCTGTCCCCACGTgggc	0.751																																					p.P63H		Atlas-SNP	.											.	LAMC3	167	.	0			c.C188A						PASS	.						2.0	3.0	3.0					9																	133884789		1613	3200	4813	SO:0001583	missense	10319	exon1			TCTGTCCCCACGT	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.188C>A	chr9.hg19:g.133884789C>A	ENSP00000354360:p.Pro63His	76.0	0.0	.		46.0	21.0	.	NM_006059	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	hg19	CCDS6938.1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.205952	0.58234	.	.	ENSG00000050555	ENST00000361069;ENST00000355048;ENST00000320021	T	0.74947	-0.89	3.94	2.85	0.33270	Laminin, N-terminal (3);	0.116020	0.64402	D	0.000020	T	0.73590	0.3606	L	0.50333	1.59	0.34047	D	0.655667	D	0.55800	0.973	P	0.59115	0.852	T	0.76305	-0.3008	10	0.36615	T	0.2	.	3.1416	0.06457	0.0:0.5194:0.0:0.4806	.	63	Q9Y6N6	LAMC3_HUMAN	H	63	ENSP00000354360:P63H	ENSP00000325873:P63H	P	+	2	0	LAMC3	132874610	1.000000	0.71417	0.987000	0.45799	0.144000	0.21451	3.770000	0.55310	1.709000	0.51313	0.313000	0.20887	CCC	.	.	.	none		0.751	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059	
OR51D1	390038	hgsc.bcm.edu	37	11	4661150	4661150	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr11:4661150C>A	ENST00000357605.2	+	1	206	c.130C>A	c.(130-132)Ctg>Atg	p.L44M		NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	44						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGCTTTCCCACTGTGTTTTAT	0.527																																					p.L44M		Atlas-SNP	.											.	OR51D1	49	.	0			c.C130A						PASS	.						180.0	145.0	157.0					11																	4661150		2201	4298	6499	SO:0001583	missense	390038	exon1			TTCCCACTGTGTT	AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.130C>A	chr11.hg19:g.4661150C>A	ENSP00000350222:p.Leu44Met	82.0	0.0	.		72.0	21.0	.	NM_001004751	B9EIK4	Missense_Mutation	SNP	ENST00000357605.2	hg19	CCDS31357.1	.	.	.	.	.	.	.	.	.	.	C	9.503	1.103608	0.20632	.	.	ENSG00000197428	ENST00000357605	T	0.17054	2.3	4.84	1.95	0.26073	.	0.000000	0.35320	N	0.003294	T	0.30634	0.0771	L	0.49256	1.55	0.31172	N	0.703044	D	0.89917	1.0	D	0.83275	0.996	T	0.17899	-1.0354	10	0.87932	D	0	.	8.0546	0.30598	0.0:0.6497:0.0:0.3503	.	44	Q8NGF3	O51D1_HUMAN	M	44	ENSP00000350222:L44M	ENSP00000350222:L44M	L	+	1	2	OR51D1	4617726	0.006000	0.16342	0.240000	0.24138	0.011000	0.07611	-0.039000	0.12124	0.335000	0.23614	-0.214000	0.12660	CTG	.	.	.	none		0.527	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385956.1	NM_001004751	
OR52E2	119678	hgsc.bcm.edu	37	11	5080608	5080609	+	Missense_Mutation	DNP	GC	GC	AT	rs369925067		TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr11:5080608_5080609GC>AT	ENST00000321522.2	-	1	248_249	c.249_250GC>AT	c.(247-252)atGCtt>atATtt	p.83_84ML>IF		NM_001005164.2	NP_001005164.2	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E, member 2	83						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|lung(13)|ovary(2)|skin(3)	20		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		AAGATTCCAAGCATCTTAGGGA	0.49																																					p.L84F|p.M83I		Atlas-SNP	.											.	OR52E2	63	.	0			c.C250T|c.G249A						PASS	.																																			SO:0001583	missense	119678	exon1			TTCCAAGCATCTT|TCCAAGCATCTTA	AB065800	CCDS31371.1	11p15.4	2012-08-09			ENSG00000176787	ENSG00000176787		"""GPCR / Class A : Olfactory receptors"""	14769	protein-coding gene	gene with protein product							Standard	NM_001005164		Approved		uc010qyw.2	Q8NGJ4	OTTHUMG00000066608	ENST00000321522.2:c.249_250delinsAT	chr11.hg19:g.5080608_5080609delinsAT	ENSP00000322088:p.M83_L84delinsIF	91.0|93.0	0.0	.		126.0	40.0	.	NM_001005164		Missense_Mutation	SNP	ENST00000321522.2	hg19	CCDS31371.1																																																																																			.	.	.	none|alt		0.490	OR52E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142815.1	NM_001005164	
MYBPC3	4607	hgsc.bcm.edu	37	11	47373013	47373013	+	Silent	SNP	T	T	C			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr11:47373013T>C	ENST00000545968.1	-	2	123	c.69A>G	c.(67-69)gcA>gcG	p.A23A	MYBPC3_ENST00000399249.2_Silent_p.A23A|MYBPC3_ENST00000256993.4_Silent_p.A23A	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	23					cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		CAGGGCTGCCTGCGGCCACTT	0.662																																					p.A23A		Atlas-SNP	.											.	MYBPC3	102	.	0			c.A69G						PASS	.						16.0	19.0	18.0					11																	47373013		2102	4223	6325	SO:0001819	synonymous_variant	4607	exon2			GCTGCCTGCGGCC	X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.69A>G	chr11.hg19:g.47373013T>C		49.0	0.0	.		22.0	4.0	.	NM_000256	A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Silent	SNP	ENST00000545968.1	hg19	CCDS53621.1																																																																																			.	.	.	none		0.662	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392271.3		
GRM5	2915	hgsc.bcm.edu	37	11	88300498	88300498	+	Missense_Mutation	SNP	A	A	T			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr11:88300498A>T	ENST00000305447.4	-	7	2502	c.2353T>A	c.(2353-2355)Tgg>Agg	p.W785R	GRM5_ENST00000455756.2_Missense_Mutation_p.W785R|GRM5_ENST00000305432.5_Missense_Mutation_p.W785R|GRM5_ENST00000393297.1_Missense_Mutation_p.W785R|GRM5_ENST00000418177.2_Missense_Mutation_p.W785R	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	785					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	AAAGCTAGCCATATAATGCAG	0.468																																					p.W785R		Atlas-SNP	.											.	GRM5	414	.	0			c.T2353A						PASS	.						168.0	152.0	158.0					11																	88300498		2201	4299	6500	SO:0001583	missense	2915	exon8			CTAGCCATATAAT	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.2353T>A	chr11.hg19:g.88300498A>T	ENSP00000306138:p.Trp785Arg	59.0	0.0	.		56.0	18.0	.	NM_000842	Q6J164	Missense_Mutation	SNP	ENST00000305447.4	hg19	CCDS44694.1	.	.	.	.	.	.	.	.	.	.	A	19.49	3.838346	0.71373	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297	D;D;D;D;D	0.92299	-3.01;-3.01;-3.01;-3.01;-3.01	5.58	5.58	0.84498	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.97402	0.9150	H	0.96239	3.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.98698	1.0699	9	.	.	.	.	15.7446	0.77929	1.0:0.0:0.0:0.0	.	785;785	P41594-2;P41594	.;GRM5_HUMAN	R	785	ENSP00000402912:W785R;ENSP00000405690:W785R;ENSP00000305905:W785R;ENSP00000306138:W785R;ENSP00000376975:W785R	.	W	-	1	0	GRM5	87940146	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.315000	0.96313	2.133000	0.65898	0.459000	0.35465	TGG	.	.	.	none		0.468	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842	
MAML2	84441	hgsc.bcm.edu	37	11	95826314	95826315	+	Missense_Mutation	DNP	CC	CC	GA	rs369905258		TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr11:95826314_95826315CC>GA	ENST00000524717.1	-	2	2164_2165	c.880_881GG>TC	c.(880-882)GGa>TCa	p.G294S		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	294					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				AGGGTCGTCTCCGTACCTATTA	0.48			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.G294A|p.G294X		Atlas-SNP	.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2	94	.	0			c.G881C|c.G880T						PASS	.																																			SO:0001583	missense	84441	exon2			TCGTCTCCGTACC|CGTCTCCGTACCT	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.880_881delinsGA	chr11.hg19:g.95826314_95826315delinsGA	ENSP00000434552:p.Gly294Ser	55.0	0.0	.		82.0|80.0	31.0|28.0	.	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000524717.1	hg19	CCDS44714.1																																																																																			.	.	.	none|alt		0.480	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
ITGA5	3678	hgsc.bcm.edu	37	12	54801981	54801981	+	Missense_Mutation	SNP	A	A	T			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr12:54801981A>T	ENST00000293379.4	-	7	991	c.730T>A	c.(730-732)Tct>Act	p.S244T	RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.5_ENST00000552785.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	244					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						GGGTAATAAGATTCTGCAATC	0.547																																					p.S244T		Atlas-SNP	.											.	ITGA5	99	.	0			c.T730A						PASS	.						81.0	78.0	79.0					12																	54801981		2203	4300	6503	SO:0001583	missense	3678	exon7			AATAAGATTCTGC		CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.730T>A	chr12.hg19:g.54801981A>T	ENSP00000293379:p.Ser244Thr	69.0	0.0	.		53.0	24.0	.	NM_002205	Q96HA5	Missense_Mutation	SNP	ENST00000293379.4	hg19	CCDS8880.1	.	.	.	.	.	.	.	.	.	.	A	8.780	0.928036	0.18131	.	.	ENSG00000161638	ENST00000293379	T	0.22134	1.97	5.13	5.13	0.70059	.	0.062472	0.64402	D	0.000004	T	0.11024	0.0269	N	0.11255	0.115	0.39220	D	0.963471	B	0.23377	0.084	B	0.18871	0.023	T	0.15093	-1.0449	10	0.35671	T	0.21	.	9.438	0.38650	0.8211:0.1789:0.0:0.0	.	244	P08648	ITA5_HUMAN	T	244	ENSP00000293379:S244T	ENSP00000293379:S244T	S	-	1	0	ITGA5	53088248	0.985000	0.35326	0.904000	0.35570	0.413000	0.31143	2.610000	0.46325	2.075000	0.62263	0.391000	0.25812	TCT	.	.	.	none		0.547	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406174.1		
BAZ2A	11176	hgsc.bcm.edu	37	12	56992544	56992544	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr12:56992544G>A	ENST00000551812.1	-	29	5769	c.5576C>T	c.(5575-5577)gCg>gTg	p.A1859V	BAZ2A_ENST00000179765.5_Missense_Mutation_p.A1827V|BAZ2A_ENST00000549884.1_Missense_Mutation_p.A1857V|BAZ2A_ENST00000379441.3_Missense_Mutation_p.A1829V|BAZ2A_ENST00000553222.1_5'Flank	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1859	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						GGCATCAGCCGCAAACTCCTC	0.567																																					p.A1859V		Atlas-SNP	.											.	BAZ2A	263	.	0			c.C5576T						PASS	.						37.0	39.0	38.0					12																	56992544		1979	4155	6134	SO:0001583	missense	11176	exon29			TCAGCCGCAAACT	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.5576C>T	chr12.hg19:g.56992544G>A	ENSP00000446880:p.Ala1859Val	60.0	0.0	.		50.0	15.0	.	NM_013449	B3KN66|O00536|O15030|Q68DI8|Q96H26	Missense_Mutation	SNP	ENST00000551812.1	hg19	CCDS44924.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.553834	0.86231	.	.	ENSG00000076108	ENST00000379441;ENST00000179765;ENST00000551812;ENST00000549787;ENST00000549884	T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61	5.85	5.85	0.93711	Bromodomain (6);Bromodomain, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.38081	0.1027	N	0.20445	0.575	0.80722	D	1	D;P;P;D	0.89917	1.0;0.851;0.877;1.0	D;P;P;D	0.91635	0.995;0.682;0.848;0.999	T	0.02781	-1.1111	10	0.02654	T	1	-13.7142	19.3175	0.94220	0.0:0.0:1.0:0.0	.	1857;1855;1859;1832	F8VU39;Q9UIF9-3;Q9UIF9;Q9UIF9-2	.;.;BAZ2A_HUMAN;.	V	1829;1827;1859;791;1857	ENSP00000368754:A1829V;ENSP00000179765:A1827V;ENSP00000446880:A1859V;ENSP00000448760:A791V;ENSP00000447941:A1857V	ENSP00000179765:A1827V	A	-	2	0	BAZ2A	55278811	1.000000	0.71417	0.995000	0.50966	0.891000	0.51852	7.370000	0.79589	2.941000	0.99782	0.655000	0.94253	GCG	.	.	.	none		0.567	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408561.1	NM_013449	
ATP6V0A2	23545	hgsc.bcm.edu	37	12	124236887	124236887	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr12:124236887C>T	ENST00000330342.3	+	17	2361	c.2113C>T	c.(2113-2115)Caa>Taa	p.Q705*	ATP6V0A2_ENST00000544833.1_5'Flank	NM_012463.3	NP_036595.2	Q9Y487	VPP2_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a2	705					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)		GCTGGGAAGCCAAGATATAGA	0.403																																					p.Q705X		Atlas-SNP	.											.	ATP6V0A2	68	.	0			c.C2113T						PASS	.						128.0	126.0	127.0					12																	124236887		2203	4300	6503	SO:0001587	stop_gained	23545	exon17			GGAAGCCAAGATA	AF112972	CCDS9254.1	12q24.31	2010-04-21	2006-01-20		ENSG00000185344	ENSG00000185344		"""ATPases / V-type"""	18481	protein-coding gene	gene with protein product	"""infantile malignant osteopetrosis"""	611716	"""infantile malignant osteopetrosis"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 2"", ""ATPase, H+ transporting, lysosomal V0 subunit A2"""			2247090, 18157129	Standard	NM_012463		Approved	TJ6, a2, TJ6s, TJ6M, ATP6a2, J6B7, ATP6N1D, Vph1, Stv1	uc001ufr.3	Q9Y487	OTTHUMG00000168723	ENST00000330342.3:c.2113C>T	chr12.hg19:g.124236887C>T	ENSP00000332247:p.Gln705*	83.0	0.0	.		116.0	38.0	.	NM_012463	A8K026|Q6NUM0	Nonsense_Mutation	SNP	ENST00000330342.3	hg19	CCDS9254.1	.	.	.	.	.	.	.	.	.	.	C	40	8.390644	0.98791	.	.	ENSG00000185344	ENST00000330342	.	.	.	5.76	4.86	0.63082	.	0.048315	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-9.4353	16.4274	0.83818	0.0:0.8683:0.1317:0.0	.	.	.	.	X	705	.	ENSP00000332247:Q705X	Q	+	1	0	ATP6V0A2	122802840	0.994000	0.37717	0.333000	0.25482	0.718000	0.41266	3.320000	0.51991	1.409000	0.46915	0.655000	0.94253	CAA	.	.	.	none		0.403	ATP6V0A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400765.2	NM_012463	
HECTD1	25831	hgsc.bcm.edu	37	14	31637663	31637663	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr14:31637663G>A	ENST00000399332.1	-	10	1951	c.1463C>T	c.(1462-1464)cCa>cTa	p.P488L	HECTD1_ENST00000553700.1_Missense_Mutation_p.P488L	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	488					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		TTTATTAACTGGACACATCCA	0.318																																					p.P488L		Atlas-SNP	.											.	HECTD1	159	.	0			c.C1463T						PASS	.						173.0	166.0	168.0					14																	31637663		1802	4072	5874	SO:0001583	missense	25831	exon10			TTAACTGGACACA	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.1463C>T	chr14.hg19:g.31637663G>A	ENSP00000382269:p.Pro488Leu	50.0	0.0	.		65.0	25.0	.	NM_015382	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	hg19	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.688626	0.88639	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000556224	T;T;T	0.71579	1.04;1.04;-0.58	5.23	5.23	0.72850	Ankyrin repeat-containing domain (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80281	0.4594	L	0.43152	1.355	0.80722	D	1	P;D	0.71674	0.702;0.998	B;D	0.73708	0.177;0.981	T	0.81534	-0.0889	10	0.66056	D	0.02	-12.7472	19.1631	0.93543	0.0:0.0:1.0:0.0	.	488;488	D3DS86;Q9ULT8	.;HECD1_HUMAN	L	488	ENSP00000450697:P488L;ENSP00000382269:P488L;ENSP00000452015:P488L	ENSP00000261312:P488L	P	-	2	0	HECTD1	30707414	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.568000	0.98166	2.585000	0.87301	0.467000	0.42956	CCA	.	.	.	none		0.318	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
NAA30	122830	hgsc.bcm.edu	37	14	57857993	57857993	+	Silent	SNP	G	G	C			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr14:57857993G>C	ENST00000556492.1	+	2	472	c.318G>C	c.(316-318)ctG>ctC	p.L106L	NAA30_ENST00000554703.1_Intron|NAA30_ENST00000555166.1_Intron	NM_001011713.2	NP_001011713.2	Q147X3	NAA30_HUMAN	N(alpha)-acetyltransferase 30, NatC catalytic subunit	106					metabolic process (GO:0008152)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)	peptide alpha-N-acetyltransferase activity (GO:0004596)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(2)|skin(2)	13						GCAAGGTCCTGAGCGTAGCAG	0.687																																					p.L106L		Atlas-SNP	.											.	NAA30	30	.	0			c.G318C						PASS	.						17.0	20.0	19.0					14																	57857993		2144	4189	6333	SO:0001819	synonymous_variant	122830	exon2			GGTCCTGAGCGTA	AK092674	CCDS32088.1	14q22.2	2010-05-07	2010-01-14	2010-01-14		ENSG00000139977	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	19844	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 35"", ""N-acetyltransferase 12"", ""N-acetyltransferase 12 (GCN5-related, putative)"""	C14orf35, NAT12		19660095	Standard	NM_001011713		Approved	FLJ35355, MAK3, Mak3p	uc001xcx.4	Q147X3		ENST00000556492.1:c.318G>C	chr14.hg19:g.57857993G>C		146.0	0.0	.		107.0	33.0	.	NM_001011713	Q0IIN2	Silent	SNP	ENST00000556492.1	hg19	CCDS32088.1																																																																																			.	.	.	none		0.687	NAA30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412925.1	NM_001011713	
ZFYVE1	53349	hgsc.bcm.edu	37	14	73442299	73442299	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr14:73442299T>C	ENST00000556143.1	-	9	2486	c.1766A>G	c.(1765-1767)cAg>cGg	p.Q589R	ZFYVE1_ENST00000553891.1_Missense_Mutation_p.Q589R|ZFYVE1_ENST00000318876.5_Missense_Mutation_p.Q575R|ZFYVE1_ENST00000394207.2_Missense_Mutation_p.Q174R|ZFYVE1_ENST00000554145.1_5'UTR|ZFYVE1_ENST00000555072.1_Missense_Mutation_p.Q174R	NM_001281735.1|NM_021260.2	NP_001268664.1|NP_067083.1	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1	589					negative regulation of phosphatase activity (GO:0010923)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|ER-mitochondrion membrane contact site (GO:0044233)|Golgi stack (GO:0005795)|perinuclear region of cytoplasm (GO:0048471)|pre-autophagosomal structure (GO:0000407)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(17)|ovary(1)|prostate(2)|skin(1)	35		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)		AGGGGCGATCTGGTCTGTCAG	0.602																																					p.Q589R		Atlas-SNP	.											.	ZFYVE1	67	.	0			c.A1766G						PASS	.						117.0	101.0	106.0					14																	73442299		2203	4300	6503	SO:0001583	missense	53349	exon9			GCGATCTGGTCTG	AF251025	CCDS9811.1, CCDS41969.1, CCDS61498.1	14q24.2	2014-06-13	2003-02-28	2003-03-07		ENSG00000165861		"""Zinc fingers, FYVE domain containing"""	13180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 172"""	605471	"""zinc finger protein, subfamily 2A (FYVE domain containing), 1"""	ZNFN2A1		11024279, 11256955	Standard	NM_021260		Approved	DFCP1, KIAA1589, TAFF1, PPP1R172	uc001xnm.3	Q9HBF4		ENST00000556143.1:c.1766A>G	chr14.hg19:g.73442299T>C	ENSP00000450742:p.Gln589Arg	90.0	0.0	.		78.0	26.0	.	NM_021260	J3KNL9|Q8WYX7|Q96K57|Q9BXP9|Q9HCI3	Missense_Mutation	SNP	ENST00000556143.1	hg19	CCDS9811.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.232219	0.79688	.	.	ENSG00000165861	ENST00000553891;ENST00000318876;ENST00000556143;ENST00000394207;ENST00000555072	T;T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0;-1.0	6.17	6.17	0.99709	Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.75309	0.3832	M	0.66506	2.035	0.80722	D	1	P;B	0.39071	0.658;0.417	B;B	0.38954	0.286;0.075	T	0.77120	-0.2705	10	0.54805	T	0.06	-28.7588	16.8222	0.85835	0.0:0.0:0.0:1.0	.	589;589	G3V5N8;Q9HBF4	.;ZFYV1_HUMAN	R	589;575;589;174;174	ENSP00000452442:Q589R;ENSP00000326921:Q575R;ENSP00000450742:Q589R;ENSP00000377757:Q174R;ENSP00000452232:Q174R	ENSP00000326921:Q589R	Q	-	2	0	ZFYVE1	72512052	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.040000	0.89188	2.371000	0.80710	0.533000	0.62120	CAG	.	.	.	none		0.602	ZFYVE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413172.1	NM_021260	
C15orf62	643338	hgsc.bcm.edu	37	15	41063134	41063134	+	Silent	SNP	C	C	T			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr15:41063134C>T	ENST00000344320.6	+	1	976	c.441C>T	c.(439-441)ctC>ctT	p.L147L	DNAJC17_ENST00000220496.4_Intron|DNAJC17_ENST00000558727.1_5'Flank	NM_001130448.2	NP_001123920.1	A8K5M9	CO062_HUMAN	chromosome 15 open reading frame 62	147						mitochondrion (GO:0005739)											ATCCCTTCCTCTCCTTCAAAG	0.552																																					p.L147L		Atlas-SNP	.											.	C15orf62	3	.	0			c.C441T						PASS	.						57.0	57.0	57.0					15																	41063134		692	1591	2283	SO:0001819	synonymous_variant	643338	exon1			CTTCCTCTCCTTC		CCDS45229.1	15q15.1	2008-08-07			ENSG00000188277	ENSG00000188277			34489	protein-coding gene	gene with protein product							Standard	NM_001130448		Approved	LOC643338	uc010bby.3	A8K5M9		ENST00000344320.6:c.441C>T	chr15.hg19:g.41063134C>T		101.0	0.0	.		71.0	22.0	.	NM_001130448	A6NK01	Silent	SNP	ENST00000344320.6	hg19	CCDS45229.1																																																																																			.	.	.	none		0.552	C15orf62-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418995.1	NM_001130448	
SSTR5	6755	hgsc.bcm.edu	37	16	1129708	1129708	+	Silent	SNP	C	C	T			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr16:1129708C>T	ENST00000293897.4	+	1	928	c.840C>T	c.(838-840)ccC>ccT	p.P280P	SSTR5_ENST00000397547.2_Silent_p.P280P|SSTR5-AS1_ENST00000569832.1_RNA|SSTR5_ENST00000562758.1_Intron	NM_001053.3	NP_001044.1	P35346	SSR5_HUMAN	somatostatin receptor 5	280					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytokinesis (GO:0032467)|regulation of insulin secretion (GO:0050796)|somatostatin signaling pathway (GO:0038170)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			endometrium(2)|lung(5)|prostate(1)|skin(1)	9		Hepatocellular(780;0.00369)			Octreotide(DB00104)|Pasireotide(DB06663)|Vapreotide(DB04894)	CCCAGGAGCCCGCCTCCGCCG	0.627																																					p.P280P		Atlas-SNP	.											.	SSTR5	36	.	0			c.C840T						PASS	.						97.0	100.0	99.0					16																	1129708		2194	4297	6491	SO:0001819	synonymous_variant	6755	exon2			GGAGCCCGCCTCC	D16827	CCDS10429.1	16p13.3	2012-08-08			ENSG00000162009	ENSG00000162009		"""GPCR / Class A : Somatostatin receptors"""	11334	protein-coding gene	gene with protein product		182455				7607700	Standard	NM_001053		Approved		uc021taf.1	P35346	OTTHUMG00000047842	ENST00000293897.4:c.840C>T	chr16.hg19:g.1129708C>T		64.0	0.0	.		98.0	46.0	.	NM_001172560	P34988|Q541E0|Q9UJI5	Silent	SNP	ENST00000293897.4	hg19	CCDS10429.1																																																																																			.	.	.	none		0.627	SSTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420836.1		
GRIN2A	2903	hgsc.bcm.edu	37	16	10031887	10031887	+	Silent	SNP	G	G	A			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr16:10031887G>A	ENST00000396573.2	-	4	1245	c.936C>T	c.(934-936)taC>taT	p.Y312Y	GRIN2A_ENST00000330684.3_Silent_p.Y312Y|GRIN2A_ENST00000566670.1_5'Flank|GRIN2A_ENST00000404927.2_Silent_p.Y312Y|GRIN2A_ENST00000562109.1_Silent_p.Y312Y|GRIN2A_ENST00000396575.2_Silent_p.Y312Y|GRIN2A_ENST00000535259.1_Silent_p.Y155Y	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	312					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCTCGGGGATGTAGGAGAACT	0.577																																					p.Y312Y		Atlas-SNP	.											.	GRIN2A	366	.	0			c.C936T						PASS	.						73.0	61.0	65.0					16																	10031887		2197	4300	6497	SO:0001819	synonymous_variant	2903	exon4			GGGGATGTAGGAG		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.936C>T	chr16.hg19:g.10031887G>A		94.0	0.0	.		143.0	78.0	.	NM_000833	O00669|Q17RZ6	Silent	SNP	ENST00000396573.2	hg19	CCDS10539.1																																																																																			.	.	.	none		0.577	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
KARS	3735	hgsc.bcm.edu	37	16	75662551	75662551	+	Silent	SNP	C	C	T			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr16:75662551C>T	ENST00000302445.3	-	13	1650	c.1611G>A	c.(1609-1611)ctG>ctA	p.L537L	KARS_ENST00000319410.5_Silent_p.L565L|KARS_ENST00000568378.1_Intron	NM_005548.2	NP_005539.1	Q15046	SYK_HUMAN	lysyl-tRNA synthetase	537					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|lysyl-tRNA aminoacylation (GO:0006430)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)|viral process (GO:0016032)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|microtubule cytoskeleton (GO:0015630)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid binding (GO:0016597)|ATP binding (GO:0005524)|lysine-tRNA ligase activity (GO:0004824)|metal ion binding (GO:0046872)|tRNA binding (GO:0000049)			kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	18					L-Lysine(DB00123)	GCCCATATTCCAGGGCAGTAC	0.517																																					p.L565L		Atlas-SNP	.											.	KARS	77	.	0			c.G1695A						PASS	.						86.0	81.0	82.0					16																	75662551		2198	4300	6498	SO:0001819	synonymous_variant	3735	exon14			ATATTCCAGGGCA	AF285758	CCDS10923.1, CCDS45532.1	16q23.1	2014-09-17			ENSG00000065427	ENSG00000065427	6.1.1.6	"""Aminoacyl tRNA synthetases / Class II"""	6215	protein-coding gene	gene with protein product	"""lysine tRNA ligase"""	601421	"""deafness, autosomal recessive 89"""	DFNB89		8812440, 9278442, 23768514	Standard	NM_005548		Approved	KARS2, KARS1	uc002fer.3	Q15046	OTTHUMG00000137609	ENST00000302445.3:c.1611G>A	chr16.hg19:g.75662551C>T		89.0	0.0	.		129.0	72.0	.	NM_001130089	A8MSK1|D3DUK4|O14946|Q96J25|Q9HB23	Silent	SNP	ENST00000302445.3	hg19	CCDS10923.1																																																																																			.	.	.	none		0.517	KARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269023.1	NM_005548	
RAP1GAP2	23108	hgsc.bcm.edu	37	17	2888281	2888281	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr17:2888281C>A	ENST00000254695.8	+	11	824	c.734C>A	c.(733-735)tCc>tAc	p.S245Y	RAP1GAP2_ENST00000540393.2_Missense_Mutation_p.S226Y|RAP1GAP2_ENST00000366401.4_Missense_Mutation_p.S230Y|RAP1GAP2_ENST00000542807.1_Missense_Mutation_p.S245Y	NM_015085.4	NP_055900.4	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2	245					negative regulation of neuron projection development (GO:0010977)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|nuclear membrane (GO:0031965)	Rap GTPase activator activity (GO:0046582)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	11						TTCCAGGCCTCCCAAATGATT	0.423																																					p.S245Y		Atlas-SNP	.											.	RAP1GAP2	90	.	0			c.C734A						PASS	.						154.0	149.0	151.0					17																	2888281		1902	4130	6032	SO:0001583	missense	23108	exon11			AGGCCTCCCAAAT	AB028962	CCDS45573.1, CCDS45574.1	17p13.3	2009-09-14	2009-09-14	2009-09-14		ENSG00000132359			29176	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 4"", ""GTPase activating Rap/RanGAP domain-like 4"""	GARNL4		15632203	Standard	NM_015085		Approved	KIAA1039	uc010ckd.3	Q684P5		ENST00000254695.8:c.734C>A	chr17.hg19:g.2888281C>A	ENSP00000254695:p.Ser245Tyr	49.0	0.0	.		62.0	20.0	.	NM_015085	B2RTY5|Q684P4|Q6AI00|Q6ZVF0|Q9UPW2	Missense_Mutation	SNP	ENST00000254695.8	hg19	CCDS45573.1	.	.	.	.	.	.	.	.	.	.	C	18.97	3.735492	0.69189	.	.	ENSG00000132359	ENST00000254695;ENST00000366401;ENST00000540393;ENST00000542807	D;D;D;D	0.93811	-3.29;-3.29;-3.29;-3.29	4.02	4.02	0.46733	.	0.189194	0.49305	D	0.000149	D	0.96367	0.8815	M	0.81942	2.565	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.956	D	0.96644	0.9476	10	0.56958	D	0.05	-15.0803	15.585	0.76475	0.0:1.0:0.0:0.0	.	230;245	Q684P5-2;Q684P5	.;RPGP2_HUMAN	Y	245;230;226;245	ENSP00000254695:S245Y;ENSP00000389824:S230Y;ENSP00000439688:S226Y;ENSP00000444890:S245Y	ENSP00000254695:S245Y	S	+	2	0	RAP1GAP2	2835031	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	6.743000	0.74848	2.166000	0.68216	0.462000	0.41574	TCC	.	.	.	none		0.423	RAP1GAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438208.2		
FBF1	85302	hgsc.bcm.edu	37	17	73916469	73916469	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr17:73916469G>C	ENST00000586717.1	-	17	1947	c.1674C>G	c.(1672-1674)agC>agG	p.S558R	FBF1_ENST00000319129.5_Missense_Mutation_p.S557R|FBF1_ENST00000389570.4_Missense_Mutation_p.S558R			Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1	558					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	4						GGTATTCTGTGCTCGGCAGCA	0.647																																					p.S557R		Atlas-SNP	.											.	FBF1	48	.	0			c.C1671G						PASS	.						17.0	21.0	19.0					17																	73916469		1972	4147	6119	SO:0001583	missense	85302	exon17			TTCTGTGCTCGGC	AK074045	CCDS45779.1	17q25.3	2011-04-21			ENSG00000188878	ENSG00000188878			24674	protein-coding gene	gene with protein product	"""albatross"""					11347906	Standard	NM_001080542		Approved	FLJ00103, FBF-1, KIAA1863, ALB	uc002jqc.3	Q8TES7		ENST00000586717.1:c.1674C>G	chr17.hg19:g.73916469G>C	ENSP00000465132:p.Ser558Arg	170.0	0.0	.		107.0	32.0	.	NM_001080542	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000586717.1	hg19		.	.	.	.	.	.	.	.	.	.	G	8.952	0.968338	0.18659	.	.	ENSG00000188878	ENST00000337792;ENST00000389570;ENST00000319129;ENST00000427433	T;T	0.18960	2.18;2.21	5.22	-3.18	0.05186	.	.	.	.	.	T	0.10121	0.0248	N	0.14661	0.345	0.09310	N	1	B;B;B	0.31040	0.256;0.305;0.256	B;B;B	0.34138	0.132;0.175;0.176	T	0.41610	-0.9499	9	0.16896	T	0.51	-12.3052	6.6412	0.22911	0.3899:0.0:0.4887:0.1214	.	572;558;557	Q8TES7-6;Q8TES7;A6NLR5	.;FBF1_HUMAN;.	R	558;558;557;571	ENSP00000374221:S558R;ENSP00000324292:S557R	ENSP00000324292:S557R	S	-	3	2	FBF1	71428064	0.000000	0.05858	0.001000	0.08648	0.171000	0.22731	0.222000	0.17699	-0.141000	0.11374	-0.122000	0.15005	AGC	.	.	.	none		0.647	FBF1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000448945.2	NM_001080542	
TNRC6C	57690	hgsc.bcm.edu	37	17	76087521	76087521	+	Splice_Site	SNP	C	C	G			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr17:76087521C>G	ENST00000588061.1	+	16	4530	c.3803C>G	c.(3802-3804)gCt>gGt	p.A1268G	TNRC6C_ENST00000335749.4_Splice_Site_p.A1265G|TNRC6C_ENST00000544502.1_Splice_Site_p.A1265G|TNRC6C_ENST00000301624.4_Splice_Site_p.A1268G|TNRC6C_ENST00000588847.1_Splice_Site_p.A1265G|TNRC6C_ENST00000541771.1_Splice_Site_p.A1268G			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	1268	Silencing domain; interaction with CNOT1 and PAN3.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			CTCTCTTTAGCTGGACTGAAC	0.498																																					p.A1268G		Atlas-SNP	.											.	TNRC6C	173	.	0			c.C3803G						PASS	.						94.0	90.0	91.0					17																	76087521		1990	4164	6154	SO:0001630	splice_region_variant	57690	exon15			CTTTAGCTGGACT	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.3803-1C>G	chr17.hg19:g.76087521C>G		83.0	0.0	.		91.0	35.0	.	NM_018996	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	ENST00000588061.1	hg19	CCDS45798.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.872451	0.51695	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.15139	2.45;2.45;2.45;2.45	5.97	5.97	0.96955	.	0.218024	0.48286	D	0.000187	T	0.17492	0.0420	L	0.36672	1.1	0.80722	D	1	B;B	0.12630	0.003;0.006	B;B	0.15870	0.011;0.014	T	0.07481	-1.0770	9	.	.	.	.	20.4251	0.99070	0.0:1.0:0.0:0.0	.	1265;1268	G3XAB8;Q9HCJ0	.;TNR6C_HUMAN	G	1268;1265;1265;1268;1268;1265	ENSP00000336783:A1265G;ENSP00000301624:A1268G;ENSP00000440310:A1268G;ENSP00000442421:A1265G	.	A	+	2	0	TNRC6C	73599116	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	6.086000	0.71352	2.829000	0.97493	0.650000	0.86243	GCT	.	.	.	none		0.498	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	NM_018996	Missense_Mutation
USP36	57602	hgsc.bcm.edu	37	17	76802272	76802272	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr17:76802272C>T	ENST00000542802.3	-	15	2625	c.2182G>A	c.(2182-2184)Gtc>Atc	p.V728I	USP36_ENST00000449938.2_Missense_Mutation_p.V428I|USP36_ENST00000312010.6_Missense_Mutation_p.V728I|USP36_ENST00000588467.1_5'Flank			Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	728					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	34			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			GAGGCAACGACGGGGTGAGAG	0.637																																					p.V728I		Atlas-SNP	.											.	USP36	243	.	0			c.G2182A						PASS	.						90.0	83.0	86.0					17																	76802272		2203	4300	6503	SO:0001583	missense	57602	exon15			CAACGACGGGGTG	AB040886	CCDS32755.1	17q25.3	2008-02-05	2005-08-08			ENSG00000055483		"""Ubiquitin-specific peptidases"""	20062	protein-coding gene	gene with protein product		612543	"""ubiquitin specific protease 36"""			12838346	Standard	NM_025090		Approved	KIAA1453, FLJ12851	uc002jvz.1	Q9P275		ENST00000542802.3:c.2182G>A	chr17.hg19:g.76802272C>T	ENSP00000441214:p.Val728Ile	98.0	0.0	.		68.0	17.0	.	NM_025090	Q05C98|Q05DD0|Q6IQ38|Q8NDM8|Q9NVC8	Missense_Mutation	SNP	ENST00000542802.3	hg19	CCDS32755.1	.	.	.	.	.	.	.	.	.	.	C	7.088	0.571496	0.13623	.	.	ENSG00000055483	ENST00000312010;ENST00000449938;ENST00000542802	T;T;T	0.19394	3.17;2.15;3.17	5.36	1.2	0.21068	.	0.950666	0.08909	N	0.876186	T	0.17365	0.0417	L	0.39397	1.21	0.09310	N	1	B;B	0.21309	0.032;0.054	B;B	0.22386	0.017;0.039	T	0.34800	-0.9814	10	0.28530	T	0.3	-11.5013	8.2243	0.31560	0.0:0.678:0.0:0.322	.	728;728	Q9P275;Q9P275-2	UBP36_HUMAN;.	I	728;428;728	ENSP00000310590:V728I;ENSP00000401119:V428I;ENSP00000441214:V728I	ENSP00000310590:V728I	V	-	1	0	USP36	74313867	0.006000	0.16342	0.366000	0.25914	0.382000	0.30200	0.376000	0.20535	0.023000	0.15187	-0.766000	0.03442	GTC	.	.	.	none		0.637	USP36-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437472.3	NM_025090	
PTPRM	5797	hgsc.bcm.edu	37	18	7774145	7774145	+	Splice_Site	SNP	A	A	C			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr18:7774145A>C	ENST00000332175.8	+	2	1110		c.e2-1		PTPRM_ENST00000580170.1_Splice_Site|PTPRM_ENST00000400053.4_Splice_Site|PTPRM_ENST00000400060.4_Splice_Site	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				TTTACATTTTAGGTGGCTGCC	0.398																																					.		Atlas-SNP	.											.	PTPRM	185	.	0			c.74-2A>C						PASS	.						122.0	115.0	117.0					18																	7774145		2203	4300	6503	SO:0001630	splice_region_variant	5797	exon2			CATTTTAGGTGGC	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.74-1A>C	chr18.hg19:g.7774145A>C		64.0	0.0	.		82.0	26.0	.	NM_002845	A7MBN1|D3DUH8|J3QL11	Splice_Site	SNP	ENST00000332175.8	hg19	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	A	18.59	3.657315	0.67586	.	.	ENSG00000173482	ENST00000332175;ENST00000400060	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3444	0.74324	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PTPRM	7764145	1.000000	0.71417	0.994000	0.49952	0.850000	0.48378	6.965000	0.76067	2.324000	0.78689	0.533000	0.62120	.	.	.	.	none		0.398	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		Intron
EPG5	57724	hgsc.bcm.edu	37	18	43503240	43503240	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr18:43503240C>T	ENST00000282041.5	-	15	2866	c.2832G>A	c.(2830-2832)atG>atA	p.M944I		NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	944					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						ATACCTGCTTCATACTTTCAG	0.378																																					p.M944I		Atlas-SNP	.											.	EPG5	199	.	0			c.G2832A						PASS	.						84.0	76.0	79.0					18																	43503240		1843	4098	5941	SO:0001583	missense	57724	exon15			CTGCTTCATACTT	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.2832G>A	chr18.hg19:g.43503240C>T	ENSP00000282041:p.Met944Ile	32.0	0.0	.		34.0	11.0	.	NM_020964	A2BDF3|Q9H8C8	Missense_Mutation	SNP	ENST00000282041.5	hg19	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	C	3.452	-0.111780	0.06881	.	.	ENSG00000152223	ENST00000282041	T	0.06933	3.24	5.49	3.43	0.39272	.	0.084546	0.49916	D	0.000132	T	0.02304	0.0071	N	0.04203	-0.255	0.31848	N	0.622549	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.44314	-0.9336	10	0.02654	T	1	-23.3105	0.8864	0.01245	0.2312:0.3676:0.2247:0.1765	.	944;944	Q9HCE0-2;Q9HCE0	.;EPG5_HUMAN	I	944	ENSP00000282041:M944I	ENSP00000282041:M944I	M	-	3	0	EPG5	41757238	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.851000	0.39338	2.575000	0.86900	0.650000	0.86243	ATG	.	.	.	none		0.378	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
DSEL	92126	hgsc.bcm.edu	37	18	65179563	65179563	+	Silent	SNP	A	A	G			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr18:65179563A>G	ENST00000310045.7	-	2	3786	c.2313T>C	c.(2311-2313)caT>caC	p.H771H	CTD-2541J13.2_ENST00000581951.1_RNA|CTD-2541J13.2_ENST00000583493.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	761					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				TAATCCTATCATGTCTTACAG	0.383																																					p.H771H		Atlas-SNP	.											.	DSEL	196	.	0			c.T2313C						PASS	.						50.0	53.0	52.0					18																	65179563		2203	4300	6503	SO:0001819	synonymous_variant	92126	exon2			CCTATCATGTCTT	AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.2313T>C	chr18.hg19:g.65179563A>G		70.0	0.0	.		87.0	33.0	.	NM_032160	Q17RH1|Q6P5Z3	Silent	SNP	ENST00000310045.7	hg19	CCDS11995.1																																																																																			.	.	.	none		0.383	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
CNDP2	55748	hgsc.bcm.edu	37	18	72186228	72186228	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr18:72186228C>T	ENST00000324262.4	+	11	1571	c.1255C>T	c.(1255-1257)Ccc>Tcc	p.P419S	CNDP2_ENST00000324301.8_Missense_Mutation_p.P335S|CNDP2_ENST00000579847.1_Missense_Mutation_p.P419S	NM_018235.2	NP_060705.2	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2 (metallopeptidase M20 family)	419					cellular nitrogen compound metabolic process (GO:0034641)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)			breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(5)|ovary(2)|skin(2)|stomach(3)	24		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		CGGCAGTATTCCCGTGACCTT	0.547																																					p.P419S		Atlas-SNP	.											.	CNDP2	55	.	0			c.C1255T						PASS	.						99.0	102.0	101.0					18																	72186228		2203	4300	6503	SO:0001583	missense	55748	exon11			AGTATTCCCGTGA	AK001692	CCDS12006.1, CCDS54190.1	18q22.3	2014-07-14	2004-07-12		ENSG00000133313	ENSG00000133313	3.4.13.18		24437	protein-coding gene	gene with protein product	"""cytosolic nonspecific dipeptidase"""	169800	"""peptidase A"""	PEPA		12473676	Standard	NM_018235		Approved	FLJ10830, CN2, HsT2298, CPGL	uc002llm.2	Q96KP4	OTTHUMG00000132853	ENST00000324262.4:c.1255C>T	chr18.hg19:g.72186228C>T	ENSP00000325548:p.Pro419Ser	131.0	0.0	.		108.0	31.0	.	NM_018235	B3KUG4|Q8WY59|Q9BQ94|Q9NVB4	Missense_Mutation	SNP	ENST00000324262.4	hg19	CCDS12006.1	.	.	.	.	.	.	.	.	.	.	C	33	5.255471	0.95336	.	.	ENSG00000133313	ENST00000324262;ENST00000324301	T;T	0.09163	3.01;3.01	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.53465	0.1798	H	0.98295	4.195	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.73855	-0.3851	10	0.87932	D	0	-2.6596	19.1765	0.93604	0.0:1.0:0.0:0.0	.	335;419	Q96KP4-2;Q96KP4	.;CNDP2_HUMAN	S	419;335	ENSP00000325548:P419S;ENSP00000325756:P335S	ENSP00000325548:P419S	P	+	1	0	CNDP2	70337208	1.000000	0.71417	0.841000	0.33234	0.961000	0.63080	7.731000	0.84895	2.538000	0.85594	0.650000	0.86243	CCC	.	.	.	none		0.547	CNDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256327.1	NM_018235	
OXT	5020	hgsc.bcm.edu	37	20	3052889	3052889	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr20:3052889G>A	ENST00000217386.2	+	2	323	c.287G>A	c.(286-288)gGc>gAc	p.G96D		NM_000915.2	NP_000906.1	P01178	NEU1_HUMAN	oxytocin/neurophysin I prepropeptide	96					drinking behavior (GO:0042756)|eating behavior (GO:0042755)|female pregnancy (GO:0007565)|grooming behavior (GO:0007625)|heart development (GO:0007507)|hyperosmotic salinity response (GO:0042538)|male mating behavior (GO:0060179)|maternal aggressive behavior (GO:0002125)|maternal behavior (GO:0042711)|memory (GO:0007613)|negative regulation of blood pressure (GO:0045776)|negative regulation of gastric acid secretion (GO:0060455)|negative regulation of urine volume (GO:0035811)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of female receptivity (GO:0045925)|positive regulation of hindgut contraction (GO:0060450)|positive regulation of norepinephrine secretion (GO:0010701)|positive regulation of ossification (GO:0045778)|positive regulation of penile erection (GO:0060406)|positive regulation of prostaglandin secretion (GO:0032308)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of heart rate (GO:0002027)|regulation of sensory perception of pain (GO:0051930)|response to activity (GO:0014823)|response to amphetamine (GO:0001975)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to ether (GO:0045472)|response to food (GO:0032094)|response to glucocorticoid (GO:0051384)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|response to prostaglandin E (GO:0034695)|response to retinoic acid (GO:0032526)|response to sucrose (GO:0009744)|signal transduction (GO:0007165)|sleep (GO:0030431)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)				lung(2)	2					Oxytocin(DB00107)	GGGAGCGGGGGCCGCTGCGCG	0.766																																					p.G96D		Atlas-SNP	.											OXT,NS,carcinoma,0,1	OXT	9	.	0			c.G287A						PASS	.						7.0	9.0	9.0					20																	3052889		2026	4087	6113	SO:0001583	missense	5020	exon2			GCGGGGGCCGCTG		CCDS13044.1	20p13	2013-02-28	2012-10-23		ENSG00000101405	ENSG00000101405		"""Endogenous ligands"""	8528	protein-coding gene	gene with protein product	"""oxytocin"", ""neurophysin I"""	167050	"""oxytocin, prepro- (neurophysin I)"", ""oxytocin, prepropeptide"""	OT			Standard	NM_000915		Approved	OXT-NPI, OT-NPI	uc002wht.1	P01178	OTTHUMG00000031724	ENST00000217386.2:c.287G>A	chr20.hg19:g.3052889G>A	ENSP00000217386:p.Gly96Asp	434.0	0.0	.		235.0	75.0	.	NM_000915	Q3MIG0	Missense_Mutation	SNP	ENST00000217386.2	hg19	CCDS13044.1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.551282	0.65311	.	.	ENSG00000101405	ENST00000217386	D	0.97404	-4.37	4.35	3.37	0.38596	.	0.106321	0.64402	D	0.000004	D	0.98635	0.9543	M	0.92122	3.275	0.58432	D	0.999997	D	0.76494	0.999	D	0.80764	0.994	D	0.99334	1.0910	10	0.87932	D	0	-22.9506	13.9613	0.64182	0.0:0.1534:0.8466:0.0	.	96	P01178	NEU1_HUMAN	D	96	ENSP00000217386:G96D	ENSP00000217386:G96D	G	+	2	0	OXT	3000889	1.000000	0.71417	0.997000	0.53966	0.212000	0.24457	5.958000	0.70330	0.767000	0.33267	0.491000	0.48974	GGC	.	.	.	none		0.766	OXT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077698.2	NM_000915	
HELZ2	85441	hgsc.bcm.edu	37	20	62199985	62199985	+	Missense_Mutation	SNP	C	C	T	rs547559351		TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr20:62199985C>T	ENST00000467148.1	-	5	1525	c.1456G>A	c.(1456-1458)Gac>Aac	p.D486N	HELZ2_ENST00000427522.2_5'Flank|HELZ2_ENST00000479540.1_5'Flank	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	486					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GGCAGTGTGTCCACTGCCTGG	0.672													C|||	1	0.000199681	0.0	0.0	5008	,	,		16690	0.001		0.0	False		,,,				2504	0.0				p.D486N		Atlas-SNP	.											.	.	.	.	0			c.G1456A						PASS	.						11.0	13.0	12.0					20																	62199985		2171	4255	6426	SO:0001583	missense	85441	exon6			GTGTGTCCACTGC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.1456G>A	chr20.hg19:g.62199985C>T	ENSP00000417401:p.Asp486Asn	47.0	0.0	.		51.0	16.0	.	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	hg19	CCDS33508.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.227891	0.79576	.	.	ENSG00000130589	ENST00000467148	D	0.83755	-1.76	4.67	4.67	0.58626	.	0.124802	0.52532	D	0.000078	D	0.90796	0.7110	M	0.74258	2.255	0.48571	D	0.999675	D	0.89917	1.0	D	0.91635	0.999	D	0.92003	0.5612	10	0.66056	D	0.02	-29.1757	17.577	0.87953	0.0:1.0:0.0:0.0	.	486	Q9BYK8	PR285_HUMAN	N	486	ENSP00000417401:D486N	ENSP00000417401:D486N	D	-	1	0	RP4-697K14.7	61670429	1.000000	0.71417	0.898000	0.35279	0.228000	0.25075	7.448000	0.80631	2.157000	0.67596	0.563000	0.77884	GAC	.	.	.	none		0.672	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
PNPLA5	150379	hgsc.bcm.edu	37	22	44287719	44287719	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr22:44287719G>T	ENST00000597664.1	-	1	171	c.42C>A	c.(40-42)ttC>ttA	p.F14L	PNPLA5_ENST00000593866.1_Missense_Mutation_p.F14L|PNPLA5_ENST00000216177.4_Missense_Mutation_p.F14L|PNPLA5_ENST00000381198.2_Missense_Mutation_p.F14L			Q7Z6Z6	PLPL5_HUMAN	patatin-like phospholipase domain containing 5	14	Patatin.				lipid catabolic process (GO:0016042)		hydrolase activity (GO:0016787)			endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	16		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				CGGCGCCGGAGAAGGACAGGT	0.706																																					p.F14L		Atlas-SNP	.											.	PNPLA5	46	.	0			c.C42A						PASS	.						6.0	7.0	7.0					22																	44287719		1700	3173	4873	SO:0001583	missense	150379	exon1			GCCGGAGAAGGAC	Z97055	CCDS14053.1, CCDS54537.1	22q13.31	2009-01-12			ENSG00000100341	ENSG00000100341		"""Patatin-like phospholipase domain containing"""	24888	protein-coding gene	gene with protein product		611589				16799181, 19029121	Standard	NM_138814		Approved	dJ388M5.4, GS2L	uc003beg.3	Q7Z6Z6	OTTHUMG00000030779	ENST00000597664.1:c.42C>A	chr22.hg19:g.44287719G>T	ENSP00000471069:p.Phe14Leu	347.0	0.0	.		206.0	11.0	.	NM_138814	B1AHL8|B3KPR1|Q6ZST0	Missense_Mutation	SNP	ENST00000597664.1	hg19		.	.	.	.	.	.	.	.	.	.	G	17.99	3.522118	0.64747	.	.	ENSG00000100341	ENST00000216177;ENST00000381198;ENST00000438734	T;T;T	0.66280	-0.2;-0.2;-0.2	5.03	2.9	0.33743	Acyl transferase/acyl hydrolase/lysophospholipase (1);Patatin/Phospholipase A2-related (1);	0.000000	0.64402	D	0.000001	T	0.73125	0.3547	M	0.63843	1.955	0.24854	N	0.99238	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.62955	-0.6744	10	0.51188	T	0.08	-37.3994	10.5912	0.45310	0.1639:0.0:0.8361:0.0	.	14;14	Q7Z6Z6-2;Q7Z6Z6	.;PLPL5_HUMAN	L	14	ENSP00000216177:F14L;ENSP00000370595:F14L;ENSP00000405732:F14L	ENSP00000216177:F14L	F	-	3	2	PNPLA5	42619052	0.904000	0.30761	0.803000	0.32268	0.107000	0.19398	1.167000	0.31847	1.115000	0.41800	0.313000	0.20887	TTC	.	.	.	none		0.706	PNPLA5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000075667.4	NM_138814	
SLC9A7	84679	hgsc.bcm.edu	37	X	46541773	46541773	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chrX:46541773T>C	ENST00000328306.4	-	2	548	c.523A>G	c.(523-525)Aag>Gag	p.K175E		NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	175					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						CAGCTCACCTTCCGTAGCATA	0.463																																					p.K175E	Pancreas(118;454 1696 1930 13865 39976)	Atlas-SNP	.											.	SLC9A7	73	.	0			c.A523G						PASS	.						143.0	97.0	112.0					X																	46541773		2203	4300	6503	SO:0001583	missense	84679	exon2			TCACCTTCCGTAG	AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.523A>G	chrX.hg19:g.46541773T>C	ENSP00000330320:p.Lys175Glu	51.0	0.0	.		60.0	30.0	.	NM_001257291	O75827|Q5JXP9	Missense_Mutation	SNP	ENST00000328306.4	hg19	CCDS14269.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.484663	0.84854	.	.	ENSG00000065923	ENST00000328306	T	0.56776	0.44	5.7	5.7	0.88788	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.66771	0.2823	M	0.65677	2.01	0.80722	D	1	D	0.56287	0.975	P	0.60541	0.876	T	0.64639	-0.6360	10	0.27785	T	0.31	.	14.9741	0.71257	0.0:0.0:0.0:1.0	.	175	Q96T83	SL9A7_HUMAN	E	175	ENSP00000330320:K175E	ENSP00000330320:K175E	K	-	1	0	SLC9A7	46426717	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	7.611000	0.82962	1.918000	0.55548	0.486000	0.48141	AAG	.	.	.	none		0.463	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056370.1	NM_032591	
IQSEC2	23096	hgsc.bcm.edu	37	X	53350189	53350189	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chrX:53350189C>T	ENST00000375368.5	-	1	333	c.133G>A	c.(133-135)Gag>Aag	p.E45K	IQSEC2_ENST00000396435.3_Missense_Mutation_p.E45K			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	45					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						TCCAGCTCCTCGATGCGCCGC	0.677																																					p.E45K		Atlas-SNP	.											.	IQSEC2	195	.	0			c.G133A						PASS	.						3.0	3.0	3.0					X																	53350189		634	1433	2067	SO:0001583	missense	23096	exon1			GCTCCTCGATGCG	AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.133G>A	chrX.hg19:g.53350189C>T	ENSP00000364517:p.Glu45Lys	97.0	0.0	.		46.0	19.0	.	NM_001111125	B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	ENST00000375368.5	hg19		.	.	.	.	.	.	.	.	.	.	c	15.76	2.928174	0.52759	.	.	ENSG00000124313	ENST00000396435;ENST00000375368	T;T	0.17854	2.25;2.27	2.73	2.73	0.32206	.	0.699468	0.11421	U	0.565815	T	0.20007	0.0481	L	0.27053	0.805	0.33140	D	0.544226	D	0.69078	0.997	P	0.53006	0.715	T	0.29941	-0.9995	10	0.72032	D	0.01	.	10.7028	0.45937	0.0:1.0:0.0:0.0	.	45	Q5JU85-2	.	K	45	ENSP00000379712:E45K;ENSP00000364517:E45K	ENSP00000364517:E45K	E	-	1	0	IQSEC2	53366914	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.250000	0.65432	1.641000	0.50575	0.284000	0.19432	GAG	.	.	.	none		0.677	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding		XM_291345	
MT-ND4L	4539	hgsc.bcm.edu	37	M	10535	10535	+	Silent	SNP	T	T	C			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chrM:10535T>C	ENST00000361335.1	+	1	66	c.66T>C	c.(64-66)taT>taC	p.Y22Y	MT-TH_ENST00000387441.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA			P03901	NU4LM_HUMAN	mitochondrially encoded NADH dehydrogenase 4L	22					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(2)|kidney(2)	5						ATACTAGTATATCGCTCACAC	0.358																																					p.Y22Y		Atlas-SNP	.											.	.	.	.	0			c.T66C						PASS	.																																			SO:0001819	synonymous_variant	0	exon1			AGTATATCGCTCA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000212907	ENSG00000212907	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7460	protein-coding gene	gene with protein product	"""complex I ND4L subunit"", ""NADH-ubiquinone oxidoreductase chain 4L"""	516004	"""NADH dehydrogenase 4L"""	MTND4L			Standard			Approved	ND4L, NAD4L		P03901		ENST00000361335.1:c.66T>C	chrM.hg19:g.10535T>C		27.0	0.0	.		8.0	6.0	.	ENST00000361335		Silent	SNP	ENST00000361335.1	hg19																																																																																				.	.	.	none		0.358	MT-ND4L-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024034	
PTEN	5728	hgsc.bcm.edu	37	10	89624274	89624274	+	Frame_Shift_Del	DEL	T	T	-	rs587782187		TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr10:89624274delT	ENST00000371953.3	+	1	1405	c.48delT	c.(46-48)tatfs	p.Y16fs	KLLN_ENST00000445946.3_5'Flank	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	16	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.		Y -> C (loss of phosphatase activity towards Ins(1,3,4,5)P4; retains the ability to bind phospholipid membranes).		activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(13)|p.Y16*(2)|p.Y16fs*1(2)|p.R15fs*23(1)|p.R14fs*26(1)|p.Y16fs*21(1)|p.N12fs*6(1)|p.R14_D22del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AAAGGAGATATCAAGAGGATG	0.473		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.Y16fs		Atlas-Indel,Pindel	.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	PTEN,NS,adenocarcinoma,-1,1	PTEN	3652	.	59	Whole gene deletion(37)|Unknown(13)|Deletion - Frameshift(5)|Substitution - Nonsense(2)|Deletion - In frame(1)|Insertion - Frameshift(1)	prostate(14)|central_nervous_system(12)|skin(7)|endometrium(6)|lung(6)|ovary(3)|haematopoietic_and_lymphoid_tissue(2)|bone(2)|breast(2)|biliary_tract(1)|stomach(1)|soft_tissue(1)|urinary_tract(1)|kidney(1)	c.47delA						PASS	.						184.0	176.0	179.0					10																	89624274		2203	4300	6503	SO:0001589	frameshift_variant	5728	exon1	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.48delT	chr10.hg19:g.89624274delT	ENSP00000361021:p.Tyr16fs	58.0	0.0	0		64.0	39.0	0.609375	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Del	DEL	ENST00000371953.3	hg19	CCDS31238.1																																																																																			.	.	.	none		0.473	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
GAPVD1	26130	hgsc.bcm.edu	37	9	128116938	128116939	+	Frame_Shift_Ins	INS	-	-	A			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr9:128116938_128116939insA	ENST00000495955.1	+	24	3919_3920	c.3629_3630insA	c.(3628-3633)agagccfs	p.A1211fs	GAPVD1_ENST00000394083.2_Frame_Shift_Ins_p.A1145fs|GAPVD1_ENST00000470056.1_Frame_Shift_Ins_p.A1166fs|GAPVD1_ENST00000297933.6_Frame_Shift_Ins_p.A1193fs|GAPVD1_ENST00000312123.9_Frame_Shift_Ins_p.A1172fs|GAPVD1_ENST00000394104.2_Frame_Shift_Ins_p.A1211fs|GAPVD1_ENST00000394105.2_Frame_Shift_Ins_p.A1220fs|GAPVD1_ENST00000265956.4_Frame_Shift_Ins_p.A1185fs			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	1211					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						TTTAGAAAAAGAGCCCCATATA	0.386																																					p.R1219fs		Atlas-INDEL	.											.	GAPVD1	124	.	0			c.3656_3657insA						PASS	.																																			SO:0001589	frameshift_variant	26130	exon23			.		CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.3630dupA	chr9.hg19:g.128116939_128116939dupA	ENSP00000419063:p.Ala1211fs	60.0	0.0	0		79.0	23.0	0.291139	NM_015635	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Frame_Shift_Ins	INS	ENST00000495955.1	hg19																																																																																				.	.	.	none		0.386	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000355644.1		
NUP133	55746	hgsc.bcm.edu	37	1	229631662	229631662	+	Frame_Shift_Del	DEL	C	C	-			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr1:229631662delC	ENST00000261396.3	-	7	1043	c.952delG	c.(952-954)gaafs	p.E318fs	NUP133_ENST00000537506.1_Frame_Shift_Del_p.E302fs	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	318					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				GTAATGTTTTCCTTCAGGGCT	0.333																																					p.E318fs		Atlas-INDEL	.											.	NUP133	111	.	0			c.953delA						PASS	.						120.0	121.0	121.0					1																	229631662		2203	4300	6503	SO:0001589	frameshift_variant	55746	exon7			.		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.952delG	chr1.hg19:g.229631662delC	ENSP00000261396:p.Glu318fs	20.0	0.0	0		34.0	14.0	0.411765	NM_018230	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Frame_Shift_Del	DEL	ENST00000261396.3	hg19	CCDS1579.1																																																																																			.	.	.	none		0.333	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	
KIF26A	26153	hgsc.bcm.edu	37	14	104641420	104641420	+	Frame_Shift_Del	DEL	C	C	-			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr14:104641420delC	ENST00000423312.2	+	12	2295	c.2295delC	c.(2293-2295)gacfs	p.D765fs	KIF26A_ENST00000315264.7_Frame_Shift_Del_p.D626fs	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	765					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		TGGCCCTGGACCCCGACCGCA	0.726																																					p.D765fs		Atlas-Indel,Pindel	.											.	KIF26A	84	.	0			c.2294delA						PASS	.						20.0	24.0	23.0					14																	104641420		2039	4175	6214	SO:0001589	frameshift_variant	26153	exon12			.	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.2295delC	chr14.hg19:g.104641420delC	ENSP00000388241:p.Asp765fs	113.0	0.0	0		66.0	22.0	0.333333	NM_015656	Q8TAZ7|Q96GK3|Q9UFL3	Frame_Shift_Del	DEL	ENST00000423312.2	hg19	CCDS45171.1																																																																																			.	.	.	none		0.726	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
EXTL1	2134	hgsc.bcm.edu	37	1	26358007	26358007	+	Frame_Shift_Del	DEL	C	C	-			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr1:26358007delC	ENST00000374280.3	+	6	2158	c.1291delC	c.(1291-1293)cccfs	p.P432fs	EXTL1_ENST00000484339.1_3'UTR	NM_004455.2	NP_004446.2	Q92935	EXTL1_HUMAN	exostosin-like glycosyltransferase 1	432					protein glycosylation (GO:0006486)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|stomach(1)|urinary_tract(1)	23		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)		CCCAGGCCAGCCCCCTCTGAA	0.662																																					p.Q430fs		Atlas-Indel,Pindel	.											.	EXTL1	61	.	0			c.1290delG						PASS	.						12.0	15.0	14.0					1																	26358007		2197	4291	6488	SO:0001589	frameshift_variant	2134	exon6			.	U67191	CCDS271.1	1p36.1	2013-03-01	2013-03-01		ENSG00000158008	ENSG00000158008	2.4.1.224	"""Exostosin glycosyltransferase family"""	3515	protein-coding gene	gene with protein product	"""glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""alpha-N-acetylglucosaminyltransferase II"", ""glucuronyl-N-acetylglucosaminylproteoglycan alpha-1,4-N- acetylglucosaminyltransferase"", ""exostosin-L"""	601738	"""exostoses (multiple)-like 1"""			9037597	Standard	NM_004455		Approved	EXTL, MGC70794	uc001blf.3	Q92935	OTTHUMG00000007509	ENST00000374280.3:c.1291delC	chr1.hg19:g.26358007delC	ENSP00000363398:p.Pro432fs	168.0	0.0	0		118.0	43.0	0.364407	NM_004455	Q6GSC1	Frame_Shift_Del	DEL	ENST00000374280.3	hg19	CCDS271.1																																																																																			.	.	.	none		0.662	EXTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019749.1	NM_004455	
GDAP2	54834	hgsc.bcm.edu	37	1	118420604	118420614	+	Intron	DEL	TGAGGGAGAAC	TGAGGGAGAAC	-	rs549457373		TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	TGAGGGAGAAC	TGAGGGAGAAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr1:118420604_118420614delTGAGGGAGAAC	ENST00000369443.5	-	13	1696				GDAP2_ENST00000369442.3_Frame_Shift_Del_p.SSPS488fs	NM_017686.3	NP_060156.1	Q9NXN4	GDAP2_HUMAN	ganglioside induced differentiation associated protein 2						response to retinoic acid (GO:0032526)	lysosomal membrane (GO:0005765)				kidney(2)|large_intestine(3)|lung(9)|ovary(2)	16		all_cancers(81;0.0156)|all_lung(203;5.81e-05)|Lung NSC(69;0.000446)|all_epithelial(167;0.00295)		Lung(183;0.0583)|LUSC - Lung squamous cell carcinoma(189;0.194)		CCATACCAGGTGAGGGAGAACTTCTGGTACT	0.408																																					p.488_492del		Atlas-Indel,Pindel	.											.	GDAP2	37	.	0			c.1464_1474del						PASS	.																																			SO:0001627	intron_variant	54834	exon13			.	AK000149	CCDS897.1, CCDS44201.1	1q11	2011-10-20			ENSG00000196505	ENSG00000196505			18010	protein-coding gene	gene with protein product						1021725	Standard	NM_017686		Approved	FLJ20142, dJ776P7.1, MACROD3	uc001ehf.3	Q9NXN4	OTTHUMG00000012199	ENST00000369443.5:c.1446+16GTTCTCCCTCA>-	chr1.hg19:g.118420604_118420614delTGAGGGAGAAC		63.0	0.0	0		92.0	31.0	0.336957	NM_001135589	Q96DZ0	Frame_Shift_Del	DEL	ENST00000369443.5	hg19	CCDS897.1																																																																																			.	.	.	none		0.408	GDAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033732.2	NM_017686	
ZNF285	26974	hgsc.bcm.edu	37	19	44892064	44892064	+	Frame_Shift_Del	DEL	A	A	-			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr19:44892064delA	ENST00000330997.4	-	4	407	c.343delT	c.(343-345)tctfs	p.S115fs	ZNF285_ENST00000544719.2_Frame_Shift_Del_p.S115fs|ZNF285_ENST00000591679.1_Frame_Shift_Del_p.S122fs|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	115					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						ATCTGAAGAGAAATGCCTGCC	0.408																																					p.S115fs		Atlas-Indel,Pindel	.											.	ZNF285	86	.	0			c.344delC						PASS	.						87.0	86.0	86.0					19																	44892064		2203	4300	6503	SO:0001589	frameshift_variant	26974	exon4			.	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.343delT	chr19.hg19:g.44892064delA	ENSP00000333595:p.Ser115fs	79.0	0.0	0		127.0	48.0	0.377953	NM_152354	Q17RJ3|Q6B0A8|Q6ISR5	Frame_Shift_Del	DEL	ENST00000330997.4	hg19	CCDS12638.1																																																																																			.	.	.	none		0.408	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
MYNN	55892	hgsc.bcm.edu	37	3	169496760	169496761	+	Frame_Shift_Ins	INS	-	-	G			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr3:169496760_169496761insG	ENST00000349841.5	+	3	1134_1135	c.471_472insG	c.(472-474)gtafs	p.V158fs	MYNN_ENST00000392733.1_Frame_Shift_Ins_p.V158fs|RP11-362K14.5_ENST00000602342.1_RNA|MYNN_ENST00000356716.4_Frame_Shift_Ins_p.V158fs|MYNN_ENST00000544106.1_Frame_Shift_Ins_p.V158fs	NM_018657.4	NP_061127.1	Q9NPC7	MYNN_HUMAN	myoneurin	158					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;2.19e-58)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			AGAAATCAGAAGTATCTACAGA	0.366																																					p.E157fs		Atlas-Indel,Pindel	.											.	MYNN	36	.	0			c.471_472insG						PASS	.																																			SO:0001589	frameshift_variant	55892	exon3			.	AF148848	CCDS3207.1, CCDS54671.1	3q26.31	2013-01-09			ENSG00000085274	ENSG00000085274		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	14955	protein-coding gene	gene with protein product		606042				10873615	Standard	NM_001185118		Approved	SBBIZ1, ZBTB31, ZNF902	uc010hwo.3	Q9NPC7		ENST00000349841.5:c.472dupG	chr3.hg19:g.169496761_169496761dupG	ENSP00000326240:p.Val158fs	57.0	0.0	0		71.0	23.0	0.323944	NM_018657	B2R6C9|Q6QHA6|Q6QHA7|Q6R3G1|Q6R3G2|Q6R4A0|Q7Z716|Q7Z717|Q86Z11|Q86Z12|Q9NS01|Q9UIW8	Frame_Shift_Ins	INS	ENST00000349841.5	hg19	CCDS3207.1																																																																																			.	.	.	none		0.366	MYNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467801.1	NM_018657	
SETDB1	9869	hgsc.bcm.edu	37	1	150915165	150915168	+	Splice_Site	DEL	GTAT	GTAT	-			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	GTAT	GTAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr1:150915165_150915168delGTAT	ENST00000271640.5	+	6	863		c.e6+1		SETDB1_ENST00000368963.1_Splice_Site|SETDB1_ENST00000368962.2_Splice_Site|SETDB1_ENST00000459773.1_Intron|SETDB1_ENST00000368969.4_Splice_Site	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1						bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			CAGACAGTTGGTATGTGCAAACTT	0.475																																					p.225_225del		Atlas-INDEL	.											.	SETDB1	204	.	0			c.673_673del						PASS	.																																			SO:0001630	splice_region_variant	9869	exon6			.	D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.673+1GTAT>-	chr1.hg19:g.150915165_150915168delGTAT		78.0	0.0	0		110.0	34.0	0.309091	NM_012432	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Frame_Shift_Del	DEL	ENST00000271640.5	hg19	CCDS44217.1																																																																																			.	.	.	none		0.475	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084717.2		Intron
GAPVD1	26130	hgsc.bcm.edu	37	9	128116940	128116941	+	Frame_Shift_Ins	INS	-	-	C			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr9:128116940_128116941insC	ENST00000495955.1	+	24	3921_3922	c.3631_3632insC	c.(3631-3633)gccfs	p.A1211fs	GAPVD1_ENST00000394083.2_Frame_Shift_Ins_p.A1145fs|GAPVD1_ENST00000470056.1_Frame_Shift_Ins_p.A1166fs|GAPVD1_ENST00000297933.6_Frame_Shift_Ins_p.A1193fs|GAPVD1_ENST00000312123.9_Frame_Shift_Ins_p.A1172fs|GAPVD1_ENST00000394104.2_Frame_Shift_Ins_p.A1211fs|GAPVD1_ENST00000394105.2_Frame_Shift_Ins_p.A1220fs|GAPVD1_ENST00000265956.4_Frame_Shift_Ins_p.A1185fs			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	1211					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						TAGAAAAAGAGCCCCATATATT	0.386																																					p.A1220fs		Pindel	.											.	GAPVD1	124	.	0			c.3658_3659insC						PASS	.																																			SO:0001589	frameshift_variant	26130	exon23			.		CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.3635dupC	chr9.hg19:g.128116944_128116944dupC	ENSP00000419063:p.Ala1211fs	61.0	0.0	.		82.0	15.0	0.183	NM_015635	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Frame_Shift_Ins	INS	ENST00000495955.1	hg19																																																																																				.	.	.	none		0.386	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000355644.1		
SETDB1	9869	hgsc.bcm.edu	37	1	150915166	150915170	+	Splice_Site	DEL	TATGT	TATGT	-			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	TATGT	TATGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr1:150915166_150915170delTATGT	ENST00000271640.5	+	6	863		c.e6+2		SETDB1_ENST00000368963.1_Splice_Site|SETDB1_ENST00000368962.2_Splice_Site|SETDB1_ENST00000459773.1_Intron|SETDB1_ENST00000368969.4_Splice_Site	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1						bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			AGACAGTTGGTATGTGCAAACTTGG	0.478																																					.		Pindel	.											.	SETDB1	204	.	0			.						PASS	.																																			SO:0001630	splice_region_variant	9869	.			.	D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.673+2TATGT>-	chr1.hg19:g.150915166_150915170delTATGT		79.0	0.0	.		109.0	27.0	0.248	.	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Splice_Site	DEL	ENST00000271640.5	hg19	CCDS44217.1																																																																																			.	.	.	none		0.478	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084717.2		Intron
NUP133	55746	hgsc.bcm.edu	37	1	229631660	229631662	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	TTC	TTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr1:229631660_229631662delTTC	ENST00000261396.3	-	7	1043_1045	c.952_954delGAA	c.(952-954)gaadel	p.E318del	NUP133_ENST00000537506.1_In_Frame_Del_p.E302del	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	318					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				CGGTAATGTTTTCCTTCAGGGCT	0.33																																					p.318_319del		Pindel	.											.	NUP133	111	.	0			c.953_955del						PASS	.																																			SO:0001651	inframe_deletion	55746	exon7			.		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.952_954delGAA	chr1.hg19:g.229631660_229631662delTTC	ENSP00000261396:p.Glu318del	20.0	0.0	.		34.0	11.0	0.324	NM_018230	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	In_Frame_Del	DEL	ENST00000261396.3	hg19	CCDS1579.1																																																																																			.	.	.	none		0.330	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	
PCNT	5116	hgsc.bcm.edu	37	21	47831328	47831328	+	Frame_Shift_Del	DEL	G	G	-	rs200137805	byFrequency	TCGA-Y8-A897-01A-11D-A35Z-10	TCGA-Y8-A897-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a18fd0a9-7914-410c-8f2f-0b8c86803b88	56e7a4a9-632d-45d1-a1b1-f3ed4e689c9e	g.chr21:47831328delG	ENST00000359568.5	+	28	5448	c.5341delG	c.(5341-5343)gggfs	p.G1782fs	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1782					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.G1781R(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					CTCCCAGGCCGGGGGCCCTCG	0.692																																					p.A1780fs		Pindel	.											.	PCNT	283	.	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.5340delC						PASS	.						27.0	33.0	31.0					21																	47831328		2198	4296	6494	SO:0001589	frameshift_variant	5116	exon28			.	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.5341delG	chr21.hg19:g.47831328delG	ENSP00000352572:p.Gly1782fs	145.0	0.0	.		90.0	24.0	0.267	NM_006031	O43152|Q7Z7C9	Frame_Shift_Del	DEL	ENST00000359568.5	hg19	CCDS33592.1																																																																																			.	.	.	none		0.692	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
