#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CAMTA1	23261	hgsc.bcm.edu	37	1	7724719	7724719	+	Silent	SNP	G	G	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr1:7724719G>T	ENST00000303635.7	+	9	2319	c.2112G>T	c.(2110-2112)ctG>ctT	p.L704L	CAMTA1_ENST00000439411.2_Silent_p.L704L	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	704					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		GCGAGGTCCTGCTCAAGTCTG	0.662			T	WWTR1	epitheliod hemangioendothelioma																																p.L704L		Atlas-SNP	.		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	CAMTA1	226	.	0			c.G2112T						PASS	.						43.0	46.0	45.0					1																	7724719		2203	4300	6503	SO:0001819	synonymous_variant	23261	exon9			GGTCCTGCTCAAG	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.2112G>T	chr1.hg19:g.7724719G>T		32.0	0.0	.		48.0	13.0	.	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Silent	SNP	ENST00000303635.7	hg19	CCDS30576.1																																																																																			.	.	.	none		0.662	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
PDPN	10630	hgsc.bcm.edu	37	1	13910573	13910573	+	Silent	SNP	G	G	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr1:13910573G>T	ENST00000294489.6	+	1	614	c.273G>T	c.(271-273)tcG>tcT	p.S91S	PDPN_ENST00000513143.1_5'Flank|PDPN_ENST00000475043.1_5'Flank|PDPN_ENST00000376061.4_5'Flank|PDPN_ENST00000509009.1_5'Flank|PDPN_ENST00000376057.4_Silent_p.S91S|PDPN_ENST00000487038.1_5'Flank					podoplanin									p.S91S(1)		endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	16	Ovarian(185;0.249)	all_lung(284;2.29e-05)|Lung NSC(185;4.37e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00969)|Colorectal(212;4.48e-06)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000347)|Kidney(185;0.00087)|KIRC - Kidney renal clear cell carcinoma(229;0.0027)|STAD - Stomach adenocarcinoma(313;0.00802)|READ - Rectum adenocarcinoma(331;0.0678)		GAAGCGCGTCGCTCTGGGTCC	0.612																																					p.S91S		Atlas-SNP	.											PDPN,colon,carcinoma,0,1	PDPN	44	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G273T						PASS	.						41.0	31.0	35.0					1																	13910573		2194	4272	6466	SO:0001819	synonymous_variant	10630	exon1			CGCGTCGCTCTGG	AB127958, AY194238	CCDS30602.1, CCDS41266.1, CCDS44060.1, CCDS53270.1	1p36.21	2008-02-05			ENSG00000162493	ENSG00000162493			29602	protein-coding gene	gene with protein product	"""lung type I cell membrane associated glycoprotein"""	608863				10393083, 9651190	Standard	NM_006474		Approved	T1A-2, Gp38, aggrus, GP40, PA2.26	uc001avd.3	Q86YL7	OTTHUMG00000007912	ENST00000294489.6:c.273G>T	chr1.hg19:g.13910573G>T		35.0	0.0	.		58.0	3.0	.	NM_006474		Silent	SNP	ENST00000294489.6	hg19	CCDS30602.1																																																																																			.	.	.	none		0.612	PDPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021783.2	NM_006474	
XKR8	55113	hgsc.bcm.edu	37	1	28290159	28290159	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr1:28290159G>C	ENST00000373884.5	+	2	1053	c.445G>C	c.(445-447)Gtg>Ctg	p.V149L	XKR8_ENST00000481387.1_3'UTR	NM_018053.2	NP_060523.2	Q9H6D3	XKR8_HUMAN	XK, Kell blood group complex subunit-related family, member 8	149					engulfment of apoptotic cell (GO:0043652)|phosphatidylserine exposure on apoptotic cell surface (GO:0070782)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(2)|lung(1)	4		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;4.72e-24)|Colorectal(126;1.52e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00572)|READ - Rectum adenocarcinoma(331;0.0526)		GCTCACGCTGGTGCTGGCCAT	0.622																																					p.V149L		Atlas-SNP	.											.	XKR8	15	.	0			c.G445C						PASS	.						22.0	19.0	20.0					1																	28290159		2203	4300	6503	SO:0001583	missense	55113	exon2			ACGCTGGTGCTGG	AK091615	CCDS315.1	1p35.3	2008-02-05	2006-01-12		ENSG00000158156	ENSG00000158156			25508	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 8"""			12477932	Standard	NM_018053		Approved	FLJ10307	uc001bph.1	Q9H6D3	OTTHUMG00000003912	ENST00000373884.5:c.445G>C	chr1.hg19:g.28290159G>C	ENSP00000362991:p.Val149Leu	97.0	0.0	.		128.0	32.0	.	NM_018053		Missense_Mutation	SNP	ENST00000373884.5	hg19	CCDS315.1	.	.	.	.	.	.	.	.	.	.	G	4.622	0.115616	0.08831	.	.	ENSG00000158156	ENST00000373884	T	0.61980	0.06	5.58	3.68	0.42216	.	0.247521	0.39834	N	0.001241	T	0.48714	0.1515	L	0.31752	0.955	0.27758	N	0.943911	B	0.09022	0.002	B	0.10450	0.005	T	0.40720	-0.9548	10	0.39692	T	0.17	.	11.5401	0.50661	0.0735:0.5532:0.3733:0.0	.	149	Q9H6D3	XKR8_HUMAN	L	149	ENSP00000362991:V149L	ENSP00000362991:V149L	V	+	1	0	XKR8	28162746	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	1.076000	0.30729	0.680000	0.31366	0.655000	0.94253	GTG	.	.	.	none		0.622	XKR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011175.1	NM_018053	
EBNA1BP2	10969	hgsc.bcm.edu	37	1	43632514	43632514	+	Silent	SNP	G	G	A			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr1:43632514G>A	ENST00000236051.2	-	7	831	c.690C>T	c.(688-690)ggC>ggT	p.G230G	EBNA1BP2_ENST00000431635.2_Silent_p.G285G	NM_006824.2	NP_006815.2	Q99848	EBP2_HUMAN	EBNA1 binding protein 2	230					ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(4)|lung(9)	16	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TCATCTGCTGGCCTTTGGCTC	0.507																																					p.G285G		Atlas-SNP	.											.	EBNA1BP2	37	.	0			c.C855T						PASS	.						177.0	169.0	172.0					1																	43632514		2203	4300	6503	SO:0001819	synonymous_variant	10969	exon8			CTGCTGGCCTTTG	U86602	CCDS478.1, CCDS53308.1	1p35-p33	2011-02-10	2001-11-28		ENSG00000117395	ENSG00000117395			15531	protein-coding gene	gene with protein product		614443	"""EBNA1-binding protein 2"""			10074103, 11438656	Standard	NM_001159936		Approved	NOBP, EBP2, P40	uc010ojx.2	Q99848	OTTHUMG00000007284	ENST00000236051.2:c.690C>T	chr1.hg19:g.43632514G>A		70.0	0.0	.		84.0	26.0	.	NM_001159936	Q96A66	Silent	SNP	ENST00000236051.2	hg19	CCDS478.1																																																																																			.	.	.	none		0.507	EBNA1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019015.1		
MPL	4352	hgsc.bcm.edu	37	1	43814558	43814558	+	Silent	SNP	G	G	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr1:43814558G>T	ENST00000372470.3	+	9	1395	c.1353G>T	c.(1351-1353)ctG>ctT	p.L451L	MPL_ENST00000413998.2_Silent_p.L451L	NM_005373.2	NP_005364.1	P40238	TPOR_HUMAN	MPL proto-oncogene, thrombopoietin receptor	451	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|platelet activation (GO:0030168)|regulation of chemokine production (GO:0032642)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(551)|large_intestine(3)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	567	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			Eltrombopag(DB06210)|Romiplostim(DB05332)	CCCTGGAGCTGCGCCCGCGAT	0.687			Mis		MPD	MPD	congenital amegakaryocytic thrombocytopenia																														p.L451L	NSCLC(52;534 1204 10016 41452 44427)	Atlas-SNP	.	yes	Dom	yes	Familial essential thrombocythemia	1	p34	4352	"""myeloproliferative leukemia virus oncogene, thrombopoietin receptor"""	yes	L	.	MPL	651	.	0			c.G1353T						PASS	.						9.0	12.0	11.0					1																	43814558		2132	4173	6305	SO:0001819	synonymous_variant	4352	exon9			GGAGCTGCGCCCG	M90102	CCDS483.1	1p34	2014-09-17	2014-06-26		ENSG00000117400	ENSG00000117400		"""CD molecules"", ""Fibronectin type III domain containing"""	7217	protein-coding gene	gene with protein product		159530	"""myeloproliferative leukemia virus oncogene"""			1608974	Standard	NM_005373		Approved	CD110, TPOR	uc001ciw.3	P40238	OTTHUMG00000007429	ENST00000372470.3:c.1353G>T	chr1.hg19:g.43814558G>T		55.0	0.0	.		64.0	20.0	.	NM_005373	Q5JUZ0	Silent	SNP	ENST00000372470.3	hg19	CCDS483.1																																																																																			.	.	.	none		0.687	MPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019522.1	NM_005373	
CCBL2	56267	hgsc.bcm.edu	37	1	89418774	89418774	+	Missense_Mutation	SNP	G	G	T	rs577169250		TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr1:89418774G>T	ENST00000260508.4	-	10	1263	c.926C>A	c.(925-927)aCg>aAg	p.T309K	CCBL2_ENST00000370485.2_3'UTR|CCBL2_ENST00000370491.3_Missense_Mutation_p.T275K|CCBL2_ENST00000446900.2_5'UTR	NM_001008661.2	NP_001008661.1	Q6YP21	KAT3_HUMAN	cysteine conjugate-beta lyase 2	309					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine metabolic process (GO:0097052)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	mitochondrion (GO:0005739)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|kynurenine-glyoxylate transaminase activity (GO:0047315)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|poly(A) RNA binding (GO:0044822)|pyridoxal phosphate binding (GO:0030170)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|ovary(2)|skin(2)|soft_tissue(1)	18		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)		AGTATAAATCGTGTTTTGTTG	0.333																																					p.T309K		Atlas-SNP	.											.	CCBL2	138	.	0			c.C926A						PASS	.						125.0	126.0	125.0					1																	89418774		2203	4300	6503	SO:0001583	missense	56267	exon10			TAAATCGTGTTTT	AF091090	CCDS30766.1, CCDS30767.1	1p22.2	2009-06-23			ENSG00000137944	ENSG00000137944			33238	protein-coding gene	gene with protein product		610656				16376499	Standard	NM_001008662		Approved	RBM1, RP11-82K18.3, KAT3	uc001dmp.2	Q6YP21	OTTHUMG00000010617	ENST00000260508.4:c.926C>A	chr1.hg19:g.89418774G>T	ENSP00000260508:p.Thr309Lys	108.0	0.0	.		154.0	36.0	.	NM_001008661	B3KQ13|O95335|Q5JS27|Q5T9T7|Q5T9T8|Q6AI27|Q6ICW1|Q9BVY5	Missense_Mutation	SNP	ENST00000260508.4	hg19	CCDS30766.1	.	.	.	.	.	.	.	.	.	.	G	15.04	2.715737	0.48622	.	.	ENSG00000137944	ENST00000370491;ENST00000260508	D;D	0.90676	-2.71;-2.71	5.72	-1.29	0.09288	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.489469	0.24876	N	0.034886	D	0.86932	0.6052	M	0.86502	2.82	0.19300	N	0.99998	B	0.34103	0.437	B	0.41946	0.371	D	0.83437	0.0041	10	0.51188	T	0.08	-2.7189	10.0336	0.42116	0.0618:0.5605:0.2757:0.102	.	309	Q6YP21	KAT3_HUMAN	K	275;309	ENSP00000359522:T275K;ENSP00000260508:T309K	ENSP00000260508:T309K	T	-	2	0	CCBL2	89191362	0.407000	0.25352	0.015000	0.15790	0.808000	0.45660	0.714000	0.25808	-0.200000	0.10300	0.585000	0.79938	ACG	.	.	.	none		0.333	CCBL2-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000029300.3	NM_001008661	
CNST	163882	hgsc.bcm.edu	37	1	246811232	246811232	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr1:246811232C>G	ENST00000366513.4	+	9	1998	c.1729C>G	c.(1729-1731)Caa>Gaa	p.Q577E	CNST_ENST00000366512.3_Missense_Mutation_p.Q577E|CNST_ENST00000483271.1_3'UTR	NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	577					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						CGATCTCCTTCAAGATCTCTC	0.408																																					p.Q577E		Atlas-SNP	.											.	CNST	73	.	0			c.C1729G						PASS	.						118.0	125.0	122.0					1																	246811232		2203	4300	6503	SO:0001583	missense	163882	exon9			CTCCTTCAAGATC	AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.1729C>G	chr1.hg19:g.246811232C>G	ENSP00000355470:p.Gln577Glu	161.0	0.0	.		239.0	69.0	.	NM_152609	Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Missense_Mutation	SNP	ENST00000366513.4	hg19	CCDS1628.1	.	.	.	.	.	.	.	.	.	.	C	2.651	-0.282026	0.05642	.	.	ENSG00000162852	ENST00000366513;ENST00000366512	T;T	0.18960	2.18;2.22	5.5	5.5	0.81552	.	0.394117	0.24537	N	0.037675	T	0.24967	0.0606	M	0.66939	2.045	0.80722	D	1	P;P	0.46142	0.571;0.873	B;P	0.44811	0.359;0.461	T	0.02560	-1.1141	10	0.09338	T	0.73	-12.0106	12.3059	0.54902	0.0:0.9218:0.0:0.0782	.	577;577	Q6PJW8;Q6PJW8-2	CNST_HUMAN;.	E	577	ENSP00000355470:Q577E;ENSP00000355469:Q577E	ENSP00000355469:Q577E	Q	+	1	0	CNST	244877855	1.000000	0.71417	0.936000	0.37596	0.562000	0.35680	3.027000	0.49697	2.750000	0.94351	0.467000	0.42956	CAA	.	.	.	none		0.408	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096780.1	NM_152609	
ADAM17	6868	hgsc.bcm.edu	37	2	9668056	9668056	+	Nonsense_Mutation	SNP	T	T	A			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr2:9668056T>A	ENST00000310823.3	-	5	660	c.478A>T	c.(478-480)Aaa>Taa	p.K160*	ADAM17_ENST00000497134.1_Nonsense_Mutation_p.K160*	NM_003183.4	NP_003174.3	P78536	ADA17_HUMAN	ADAM metallopeptidase domain 17	160					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell motility (GO:0048870)|collagen catabolic process (GO:0030574)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|germinal center formation (GO:0002467)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil mediated immunity (GO:0002446)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of chemokine production (GO:0032722)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|proteolysis (GO:0006508)|regulation of mast cell apoptotic process (GO:0033025)|response to drug (GO:0042493)|response to high density lipoprotein particle (GO:0055099)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|wound healing, spreading of epidermal cells (GO:0035313)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|interleukin-6 receptor binding (GO:0005138)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|Notch binding (GO:0005112)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)			breast(1)|cervix(4)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	28	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		CTTTTGTCTTTGGTATCATTA	0.294																																					p.K160X		Atlas-SNP	.											.	ADAM17	61	.	0			c.A478T						PASS	.						69.0	68.0	69.0					2																	9668056		2203	4300	6503	SO:0001587	stop_gained	6868	exon5			TGTCTTTGGTATC	U69611	CCDS1665.1	2p25	2010-08-05	2008-07-31		ENSG00000151694	ENSG00000151694		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	195	protein-coding gene	gene with protein product		603639	"""tumor necrosis factor, alpha, converting enzyme"""	TACE		9034190, 9574564	Standard	NM_003183		Approved	cSVP, CD156B	uc002qzu.3	P78536	OTTHUMG00000090425	ENST00000310823.3:c.478A>T	chr2.hg19:g.9668056T>A	ENSP00000309968:p.Lys160*	95.0	0.0	.		132.0	37.0	.	NM_003183	O60226	Nonsense_Mutation	SNP	ENST00000310823.3	hg19	CCDS1665.1	.	.	.	.	.	.	.	.	.	.	T	17.99	3.524081	0.64747	.	.	ENSG00000151694	ENST00000310823;ENST00000497134;ENST00000538558	.	.	.	5.43	-8.22	0.01037	.	1.461700	0.03587	N	0.231252	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.1158	0.10081	0.1471:0.3652:0.3488:0.139	.	.	.	.	X	160	.	ENSP00000309968:K160X	K	-	1	0	ADAM17	9585507	0.000000	0.05858	0.001000	0.08648	0.916000	0.54674	-0.458000	0.06737	-0.879000	0.04002	-0.644000	0.03951	AAA	.	.	.	none		0.294	ADAM17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206857.1		
SLC35F5	80255	hgsc.bcm.edu	37	2	114513109	114513109	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr2:114513109G>T	ENST00000245680.2	-	2	466	c.53C>A	c.(52-54)tCt>tAt	p.S18Y	SLC35F5_ENST00000409342.1_Missense_Mutation_p.S12Y	NM_025181.2	NP_079457.2	Q8WV83	S35F5_HUMAN	solute carrier family 35, member F5	18					transport (GO:0006810)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|ovary(2)|prostate(3)|skin(1)	20						AGGAGGTGAAGAACTCAGCAC	0.398																																					p.S18Y		Atlas-SNP	.											.	SLC35F5	60	.	0			c.C53A						PASS	.						98.0	95.0	96.0					2																	114513109		2203	4300	6503	SO:0001583	missense	80255	exon2			GGTGAAGAACTCA	AF529364	CCDS2119.1	2q14.1	2013-05-22			ENSG00000115084	ENSG00000115084		"""Solute carriers"""	23617	protein-coding gene	gene with protein product							Standard	XM_005263799		Approved	FLJ22004	uc002tku.1	Q8WV83	OTTHUMG00000131361	ENST00000245680.2:c.53C>A	chr2.hg19:g.114513109G>T	ENSP00000245680:p.Ser18Tyr	105.0	0.0	.		144.0	48.0	.	NM_025181	Q9H6P8|Q9H7D8	Missense_Mutation	SNP	ENST00000245680.2	hg19	CCDS2119.1	.	.	.	.	.	.	.	.	.	.	G	14.72	2.620816	0.46736	.	.	ENSG00000115084	ENST00000245680;ENST00000409106;ENST00000409342	T;T	0.50548	0.75;0.74	5.36	1.42	0.22433	.	0.141760	0.33895	N	0.004453	T	0.28665	0.0710	N	0.22421	0.69	0.27104	N	0.962557	B;B;B	0.26809	0.099;0.16;0.005	B;B;B	0.26969	0.034;0.075;0.007	T	0.19160	-1.0314	10	0.87932	D	0	-7.2459	4.9691	0.14105	0.2587:0.1537:0.5875:0.0	.	18;12;18	B2RDY0;B8ZZV6;Q8WV83	.;.;S35F5_HUMAN	Y	18;12;12	ENSP00000245680:S18Y;ENSP00000386754:S12Y	ENSP00000245680:S18Y	S	-	2	0	SLC35F5	114229579	0.999000	0.42202	0.989000	0.46669	0.778000	0.44026	0.739000	0.26173	0.377000	0.24735	0.650000	0.86243	TCT	.	.	.	none		0.398	SLC35F5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254150.1	NM_025181	
ITGA6	3655	hgsc.bcm.edu	37	2	173335733	173335733	+	Silent	SNP	T	T	C			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr2:173335733T>C	ENST00000264106.6	+	5	878	c.675T>C	c.(673-675)acT>acC	p.T225T	ITGA6_ENST00000409080.1_Silent_p.T225T|ITGA6_ENST00000264107.7_Silent_p.T225T|ITGA6_ENST00000375221.2_Silent_p.T225T|ITGA6_ENST00000409532.1_Intron|ITGA6_ENST00000343713.4_Intron			P23229	ITA6_HUMAN	integrin, alpha 6	225					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			AGAATAACACTTTTTTTGACA	0.348																																					p.T225T		Atlas-SNP	.											.,2	ITGA6	171	.	0			c.T675C						PASS	.						119.0	105.0	110.0					2																	173335733		2203	4300	6503	SO:0001819	synonymous_variant	3655	exon5			TAACACTTTTTTT		CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.675T>C	chr2.hg19:g.173335733T>C		81.0	0.0	.		95.0	26.0	.	NM_000210	B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Silent	SNP	ENST00000264106.6	hg19																																																																																				.	.	.	none		0.348	ITGA6-201	KNOWN	basic	protein_coding	protein_coding			
FARP2	9855	hgsc.bcm.edu	37	2	242312532	242312532	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr2:242312532A>G	ENST00000264042.3	+	2	180	c.10A>G	c.(10-12)Ata>Gta	p.I4V	FARP2_ENST00000373287.4_Missense_Mutation_p.I4V|FARP2_ENST00000545004.1_Missense_Mutation_p.I4V|FARP2_ENST00000479427.1_3'UTR	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	4					actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		AATGGGGGAGATAGAAGGAAC	0.448																																					p.I4V		Atlas-SNP	.											.	FARP2	92	.	0			c.A10G						PASS	.						50.0	52.0	51.0					2																	242312532		2203	4300	6503	SO:0001583	missense	9855	exon2			GGGGAGATAGAAG	AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.10A>G	chr2.hg19:g.242312532A>G	ENSP00000264042:p.Ile4Val	101.0	0.0	.		139.0	35.0	.	NM_014808	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Missense_Mutation	SNP	ENST00000264042.3	hg19	CCDS33424.1	.	.	.	.	.	.	.	.	.	.	A	17.59	3.426334	0.62733	.	.	ENSG00000006607	ENST00000264042;ENST00000545004;ENST00000373287;ENST00000418082;ENST00000445489	T;D;D;T;T	0.82167	-0.95;-1.57;-1.58;-0.18;-1.02	5.65	3.27	0.37495	.	0.114499	0.56097	D	0.000032	D	0.85932	0.5812	M	0.75447	2.3	0.30670	N	0.753496	D;B;D	0.61697	0.988;0.42;0.99	P;B;P	0.55713	0.741;0.09;0.782	T	0.83177	-0.0091	10	0.54805	T	0.06	.	7.4465	0.27213	0.7743:0.1525:0.0732:0.0	.	4;4;4	O94887-2;F5GZ84;O94887	.;.;FARP2_HUMAN	V	4	ENSP00000264042:I4V;ENSP00000443876:I4V;ENSP00000362384:I4V;ENSP00000393376:I4V;ENSP00000388167:I4V	ENSP00000264042:I4V	I	+	1	0	FARP2	241961205	1.000000	0.71417	0.987000	0.45799	0.873000	0.50193	3.527000	0.53517	0.407000	0.25591	0.460000	0.39030	ATA	.	.	.	none		0.448	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1		
PLXNB1	5364	hgsc.bcm.edu	37	3	48461649	48461649	+	Silent	SNP	T	T	A			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr3:48461649T>A	ENST00000358536.4	-	11	2315	c.2046A>T	c.(2044-2046)ccA>ccT	p.P682P	PLXNB1_ENST00000358459.4_Silent_p.P682P|PLXNB1_ENST00000456774.1_Silent_p.P682P|PLXNB1_ENST00000296440.6_Silent_p.P682P|PLXNB1_ENST00000448774.2_Intron	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	682	Pro-rich.				axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CAGGAGGGTCTGGGGAGACAA	0.677																																					p.P682P		Atlas-SNP	.											.	PLXNB1	150	.	0			c.A2046T						PASS	.						3.0	3.0	3.0					3																	48461649		1845	3666	5511	SO:0001819	synonymous_variant	5364	exon11			AGGGTCTGGGGAG	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.2046A>T	chr3.hg19:g.48461649T>A		23.0	0.0	.		28.0	11.0	.	NM_001130082	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Silent	SNP	ENST00000358536.4	hg19	CCDS2765.1																																																																																			.	.	.	none		0.677	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1	NM_002673	
SMIM4	440957	hgsc.bcm.edu	37	3	52570837	52570837	+	Silent	SNP	C	C	A			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr3:52570837C>A	ENST00000477703.1	+	1	217	c.66C>A	c.(64-66)atC>atA	p.I22I	SMIM4_ENST00000476842.1_Silent_p.I22I|NT5DC2_ENST00000307076.4_5'Flank|SMIM4_ENST00000307106.3_Intron|SMIM4_ENST00000482728.1_Intron	NM_001124767.1	NP_001118239.1	Q8WVI0	SMIM4_HUMAN	small integral membrane protein 4	22						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)											GATTTGGCATCTACCGGTTCC	0.572																																					p.I22I		Atlas-SNP	.											.	.	.	.	0			c.C66A						PASS	.						169.0	171.0	171.0					3																	52570837		692	1591	2283	SO:0001819	synonymous_variant	440957	exon1			TGGCATCTACCGG	AK095910	CCDS46844.1	3p21.1	2012-10-08	2012-10-08	2012-10-08	ENSG00000168273	ENSG00000168273			37257	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 78"""	C3orf78			Standard	NM_001124767		Approved		uc003dep.2	Q8WVI0	OTTHUMG00000158726	ENST00000477703.1:c.66C>A	chr3.hg19:g.52570837C>A		95.0	0.0	.		123.0	34.0	.	NM_001124767		Silent	SNP	ENST00000477703.1	hg19	CCDS46844.1																																																																																			.	.	.	none		0.572	SMIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351920.1	NM_001124767	
BBX	56987	hgsc.bcm.edu	37	3	107508715	107508715	+	Missense_Mutation	SNP	C	C	T	rs374184448		TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr3:107508715C>T	ENST00000325805.8	+	14	2572	c.2285C>T	c.(2284-2286)cCg>cTg	p.P762L	BBX_ENST00000402543.1_Intron|BBX_ENST00000416476.2_Missense_Mutation_p.R426W|BBX_ENST00000406780.1_Intron|BBX_ENST00000415149.2_Intron|BBX_ENST00000473542.1_3'UTR			Q8WY36	BBX_HUMAN	bobby sox homolog (Drosophila)	762	Lys-rich.				bone development (GO:0060348)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(18)|ovary(4)|pancreas(1)|skin(2)	49			OV - Ovarian serous cystadenocarcinoma(3;0.112)			CCCAATGTTCCGGAAAAAGGT	0.413																																					p.P762L		Atlas-SNP	.											.	BBX	156	.	0			c.C2285T						PASS	.						94.0	87.0	89.0					3																	107508715		692	1591	2283	SO:0001583	missense	56987	exon14			ATGTTCCGGAAAA	AF168718	CCDS2950.1, CCDS46881.1, CCDS63712.1	3q13.1	2008-07-18			ENSG00000114439	ENSG00000114439			14422	protein-coding gene	gene with protein product	"""x 001 protein"""					11680820	Standard	NM_001142568		Approved	MDS001, HSPC339, HBP2	uc010hpr.4	Q8WY36	OTTHUMG00000150360	ENST00000325805.8:c.2285C>T	chr3.hg19:g.107508715C>T	ENSP00000319974:p.Pro762Leu	297.0	0.0	.		401.0	90.0	.	NM_001142568	A2RRM7|Q2TAJ1|Q7L3J8|Q7LBY8|Q8NDB0|Q8WY35|Q9H0J6	Missense_Mutation	SNP	ENST00000325805.8	hg19	CCDS46881.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.37|18.37	3.609699|3.609699	0.66558|0.66558	.|.	.|.	ENSG00000114439|ENSG00000114439	ENST00000325805|ENST00000416476	T|D	0.56611|0.99098	0.45|-5.42	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	0.373129|.	0.27245|.	N|.	0.020258|.	D|D	0.97626|0.97626	0.9222|0.9222	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	B|D	0.30709|0.65815	0.291|0.995	B|P	0.16289|0.49387	0.015|0.609	D|D	0.98570|0.98570	1.0645|1.0645	10|9	0.19590|0.87932	T|D	0.45|0	-5.4091|-5.4091	19.0118|19.0118	0.92875|0.92875	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	762|426	Q8WY36|A2RRM7	BBX_HUMAN|.	L|W	762|426	ENSP00000319974:P762L|ENSP00000403860:R426W	ENSP00000319974:P762L|ENSP00000403860:R426W	P|R	+|+	2|1	0|2	BBX|BBX	108991405|108991405	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	3.061000|3.061000	0.49963|0.49963	2.809000|2.809000	0.96659|0.96659	0.655000|0.655000	0.94253|0.94253	CCG|CGG	.	.	.	weak		0.413	BBX-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317820.1	NM_020235	
COL6A5	256076	hgsc.bcm.edu	37	3	130159453	130159453	+	Missense_Mutation	SNP	T	T	C	rs550946747		TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr3:130159453T>C	ENST00000432398.2	+	35	6765	c.6271T>C	c.(6271-6273)Tat>Cat	p.Y2091H	COL6A5_ENST00000265379.6_Missense_Mutation_p.Y2091H	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	2091	Nonhelical region.|VWFA 9. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TGGAGAAAATTATGAGAGAAA	0.403																																					p.Y2091H		Atlas-SNP	.											.	COL6A5	205	.	0			c.T6271C						PASS	.						82.0	79.0	80.0					3																	130159453		1841	4089	5930	SO:0001583	missense	256076	exon35			GAAAATTATGAGA	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.6271T>C	chr3.hg19:g.130159453T>C	ENSP00000390895:p.Tyr2091His	96.0	0.0	.		93.0	23.0	.	NM_153264	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	1.170|1.170	-0.641239|-0.641239	0.03557|0.03557	.|.	.|.	ENSG00000172752|ENSG00000172752	ENST00000512836|ENST00000432398;ENST00000265379;ENST00000373157	.|D;D;T	.|0.82803	.|-1.65;-1.65;2.59	5.76|5.76	3.56|3.56	0.40772|0.40772	.|von Willebrand factor, type A (3);	.|1.326970	.|0.05194	.|N	.|0.503656	T|T	0.58552|0.58552	0.2130|0.2130	N|N	0.01352|0.01352	-0.895|-0.895	0.09310|0.09310	N|N	1|1	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.06405	.|0.002;0.001	T|T	0.54248|0.54248	-0.8322|-0.8322	5|10	.|0.10377	.|T	.|0.69	.|.	6.7824|6.7824	0.23654|0.23654	0.1484:0.6619:0.0:0.1897|0.1484:0.6619:0.0:0.1897	.|.	.|2091;2091	.|A8TX70;A8TX70-2	.|CO6A5_HUMAN;.	S|H	342|2091;2091;34	.|ENSP00000390895:Y2091H;ENSP00000265379:Y2091H;ENSP00000362250:Y34H	.|ENSP00000265379:Y2091H	L|Y	+|+	2|1	0|0	COL6A5|COL6A5	131642143|131642143	0.000000|0.000000	0.05858|0.05858	0.055000|0.055000	0.19348|0.19348	0.233000|0.233000	0.25261|0.25261	-0.242000|-0.242000	0.08928|0.08928	1.242000|1.242000	0.43836|0.43836	-0.408000|-0.408000	0.06270|0.06270	TTA|TAT	.	.	.	none		0.403	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
VPS8	23355	hgsc.bcm.edu	37	3	184714225	184714225	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr3:184714225T>A	ENST00000437079.3	+	44	3943	c.3772T>A	c.(3772-3774)Tgc>Agc	p.C1258S	VPS8_ENST00000436792.2_Missense_Mutation_p.C1256S|VPS8_ENST00000446204.2_Missense_Mutation_p.C1166S|VPS8_ENST00000287546.4_Missense_Mutation_p.C1258S	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	1258							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			ACAAGATTACTGCTCTATATG	0.418																																					p.C1258S		Atlas-SNP	.											.	VPS8	109	.	0			c.T3772A						PASS	.						82.0	79.0	80.0					3																	184714225		1896	4114	6010	SO:0001583	missense	23355	exon43			GATTACTGCTCTA	AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.3772T>A	chr3.hg19:g.184714225T>A	ENSP00000397879:p.Cys1258Ser	41.0	0.0	.		89.0	36.0	.	NM_001009921	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	ENST00000437079.3	hg19	CCDS46971.1	.	.	.	.	.	.	.	.	.	.	T	32	5.159102	0.94686	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	D;D;D;D	0.99809	-6.86;-6.86;-6.86;-6.86	6.03	6.03	0.97812	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.000000	0.85682	D	0.000000	D	0.99729	0.9894	M	0.78916	2.43	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	D	0.97382	0.9983	10	0.87932	D	0	-15.9436	16.5655	0.84588	0.0:0.0:0.0:1.0	.	1258;1166;1256	Q8N3P4;Q8N3P4-2;Q8N3P4-3	VPS8_HUMAN;.;.	S	1258;1258;1256;1166	ENSP00000287546:C1258S;ENSP00000397879:C1258S;ENSP00000404704:C1256S;ENSP00000405483:C1166S	ENSP00000287546:C1258S	C	+	1	0	VPS8	186196919	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.446000	0.80609	2.302000	0.77476	0.533000	0.62120	TGC	.	.	.	none		0.418	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015303	
WDR19	57728	hgsc.bcm.edu	37	4	39218827	39218827	+	Silent	SNP	T	T	C			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr4:39218827T>C	ENST00000399820.3	+	13	1477	c.1323T>C	c.(1321-1323)gcT>gcC	p.A441A	WDR19_ENST00000288634.7_Silent_p.A281A|WDR19_ENST00000506503.1_Silent_p.A441A	NM_025132.3	NP_079408.3	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	441					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium assembly (GO:0042384)|digestive system development (GO:0055123)|ear morphogenesis (GO:0042471)|embryonic camera-type eye development (GO:0031076)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|intraciliary retrograde transport (GO:0035721)|myotome development (GO:0061055)|neurological system process (GO:0050877)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|photoreceptor connecting cilium (GO:0032391)				large_intestine(1)	1						ACTATGCTGCTGCACTTTTTG	0.368																																					p.A441A		Atlas-SNP	.											.	WDR19	96	.	0			c.T1323C						PASS	.						82.0	77.0	78.0					4																	39218827		1844	4096	5940	SO:0001819	synonymous_variant	57728	exon13			TGCTGCTGCACTT	AB046858, AY029257	CCDS47042.1	4p14	2014-02-21			ENSG00000157796	ENSG00000157796		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	18340	protein-coding gene	gene with protein product	"""intraflagellar transport 144 homolog (Chlamydomonas)"""	608151				12906858, 22019273	Standard	XM_005262658		Approved	Pwdmp, KIAA1638, FLJ23127, ORF26, DYF-2, Oseg6, IFT144, NPHP13	uc003gtv.3	Q8NEZ3	OTTHUMG00000160466	ENST00000399820.3:c.1323T>C	chr4.hg19:g.39218827T>C		82.0	0.0	.		95.0	28.0	.	NM_025132	B5MEF2|Q8N5B4|Q9H5S0|Q9HCD4	Silent	SNP	ENST00000399820.3	hg19	CCDS47042.1																																																																																			.	.	.	none		0.368	WDR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360689.1		
WDFY3	23001	hgsc.bcm.edu	37	4	85636511	85636511	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr4:85636511C>T	ENST00000295888.4	-	50	8308	c.7901G>A	c.(7900-7902)gGa>gAa	p.G2634E	WDFY3_ENST00000322366.6_Missense_Mutation_p.G2617E	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2634	Interaction with SQSTM1.|Sufficient for translocalization to p62 bodies/ALIS.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.G2634E(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CCGTCCATCTCCAGAGAAAAC	0.328																																					p.G2634E		Atlas-SNP	.											WDFY3,colon,carcinoma,+1,1	WDFY3	314	.	1	Substitution - Missense(1)	skin(1)	c.G7901A						PASS	.						86.0	91.0	89.0					4																	85636511		2203	4300	6503	SO:0001583	missense	23001	exon50			CCATCTCCAGAGA	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.7901G>A	chr4.hg19:g.85636511C>T	ENSP00000295888:p.Gly2634Glu	50.0	0.0	.		75.0	21.0	.	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	hg19	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	C	9.744	1.165669	0.21538	.	.	ENSG00000163625	ENST00000322366;ENST00000295888;ENST00000514711	T;T;T	0.62105	0.05;0.06;0.08	5.7	5.7	0.88788	PH-BEACH domain (1);	0.053412	0.85682	D	0.000000	T	0.48259	0.1490	L	0.28192	0.835	0.80722	D	1	B	0.22746	0.074	B	0.18263	0.021	T	0.48790	-0.9004	10	0.02654	T	1	.	19.8448	0.96704	0.0:1.0:0.0:0.0	.	2634	Q8IZQ1	WDFY3_HUMAN	E	2617;2634;237	ENSP00000318466:G2617E;ENSP00000295888:G2634E;ENSP00000424987:G237E	ENSP00000295888:G2634E	G	-	2	0	WDFY3	85855535	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.825000	0.69286	2.686000	0.91538	0.650000	0.86243	GGA	.	.	.	none		0.328	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
KIAA0922	23240	hgsc.bcm.edu	37	4	154478175	154478175	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr4:154478175G>T	ENST00000409663.3	+	6	542	c.490G>T	c.(490-492)Gga>Tga	p.G164*	KIAA0922_ENST00000409959.3_Nonsense_Mutation_p.G164*|KIAA0922_ENST00000440693.1_Nonsense_Mutation_p.G164*	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	164						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				TACTGAAGAAGGAAGCATTGA	0.398																																					p.G164X		Atlas-SNP	.											.	KIAA0922	214	.	0			c.G490T						PASS	.						91.0	94.0	93.0					4																	154478175		2203	4300	6503	SO:0001587	stop_gained	23240	exon6			GAAGAAGGAAGCA	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.490G>T	chr4.hg19:g.154478175G>T	ENSP00000386574:p.Gly164*	172.0	0.0	.		223.0	87.0	.	NM_001131007	B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Nonsense_Mutation	SNP	ENST00000409663.3	hg19	CCDS3783.2	.	.	.	.	.	.	.	.	.	.	G	36	5.615280	0.96649	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	.	.	.	5.64	4.78	0.61160	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.5311	15.6869	0.77418	0.0:0.0:0.862:0.138	.	.	.	.	X	164;164;164;25	.	ENSP00000240487:G25X	G	+	1	0	KIAA0922	154697625	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.124000	0.77185	1.333000	0.45449	0.650000	0.86243	GGA	.	.	.	none		0.398	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196	
PALLD	23022	hgsc.bcm.edu	37	4	169842683	169842683	+	Splice_Site	SNP	A	A	G			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr4:169842683A>G	ENST00000505667.1	+	18	3023		c.e18-1		CBR4_ENST00000509108.1_Intron|PALLD_ENST00000507735.1_Splice_Site|PALLD_ENST00000335742.7_Splice_Site|PALLD_ENST00000512127.1_Splice_Site|PALLD_ENST00000261509.6_Splice_Site			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein						cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		TTTATGATTTAGGTCAGTGGG	0.433									Pancreatic Cancer, Familial Clustering of																												.	Esophageal Squamous(109;1482 1532 18347 40239 51172)	Atlas-SNP	.											.	PALLD	179	.	0			c.2800-2A>G						PASS	.						30.0	27.0	28.0					4																	169842683		2203	4300	6503	SO:0001630	splice_region_variant	23022	exon17	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	TGATTTAGGTCAG	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.2851-1A>G	chr4.hg19:g.169842683A>G		48.0	0.0	.		60.0	19.0	.	NM_016081	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Splice_Site	SNP	ENST00000505667.1	hg19	CCDS54818.1	.	.	.	.	.	.	.	.	.	.	A	13.19	2.162369	0.38217	.	.	ENSG00000129116	ENST00000261509;ENST00000335742;ENST00000505667;ENST00000512127;ENST00000507735	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5257	0.75901	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PALLD	170079258	1.000000	0.71417	0.960000	0.40013	0.319000	0.28217	9.339000	0.96797	2.075000	0.62263	0.454000	0.30748	.	.	.	.	none		0.433	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363762.1	NM_016081	Intron
DMXL1	1657	hgsc.bcm.edu	37	5	118484771	118484771	+	Silent	SNP	T	T	C			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr5:118484771T>C	ENST00000311085.8	+	18	3329	c.3249T>C	c.(3247-3249)tgT>tgC	p.C1083C	DMXL1_ENST00000539542.1_Silent_p.C1083C	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1083										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TTTTTGAATGTGAGTCAACAG	0.393																																					p.C1083C		Atlas-SNP	.											.	DMXL1	268	.	0			c.T3249C						PASS	.						162.0	164.0	163.0					5																	118484771		2202	4300	6502	SO:0001819	synonymous_variant	1657	exon18			TGAATGTGAGTCA	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.3249T>C	chr5.hg19:g.118484771T>C		97.0	0.0	.		185.0	57.0	.	NM_005509		Silent	SNP	ENST00000311085.8	hg19	CCDS4125.1																																																																																			.	.	.	none		0.393	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
CTNNA1	1495	hgsc.bcm.edu	37	5	138145868	138145869	+	Missense_Mutation	DNP	AC	AC	CT			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr5:138145868_138145869AC>CT	ENST00000302763.7	+	4	533_534	c.443_444AC>CT	c.(442-444)tAC>tCT	p.Y148S	CTNNA1_ENST00000355078.5_Missense_Mutation_p.Y45S|CTNNA1_ENST00000518825.1_Missense_Mutation_p.Y148S	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	148	Interaction with JUP and CTNNB1.|Involved in homodimerization.				adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)			NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GCAGATGTCTACAAATTACTTG	0.46																																					p.Y148S|p.Y148Y		Atlas-SNP	.											.	CTNNA1	114	.	0			c.A443C|c.C444T						PASS	.																																			SO:0001583	missense	1495	exon4			ATGTCTACAAATT|TGTCTACAAATTA	D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		Exception_encountered	chr5.hg19:g.138145868_138145869delinsCT	ENSP00000304669:p.Tyr148Ser	82.0	0.0	.		133.0|131.0	35.0|36.0	.	NM_001903	Q12795|Q8N1C0	Missense_Mutation|Silent	SNP	ENST00000302763.7	hg19	CCDS34243.1																																																																																			.	.	.	none		0.460	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373868.1	NM_001903	
SKIV2L	6499	hgsc.bcm.edu	37	6	31930543	31930543	+	Missense_Mutation	SNP	T	T	G			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr6:31930543T>G	ENST00000375394.2	+	12	1377	c.1264T>G	c.(1264-1266)Ttt>Gtt	p.F422V	SKIV2L_ENST00000544581.1_Missense_Mutation_p.F229V	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	422	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						GTGGGTCATCTTTGATGAGGT	0.557																																					p.F422V		Atlas-SNP	.											.	SKIV2L	97	.	0			c.T1264G						PASS	.						136.0	128.0	131.0					6																	31930543		1511	2709	4220	SO:0001583	missense	6499	exon12			GTCATCTTTGATG		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.1264T>G	chr6.hg19:g.31930543T>G	ENSP00000364543:p.Phe422Val	69.0	0.0	.		67.0	15.0	.	NM_006929	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	hg19	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	T	31	5.081039	0.94050	.	.	ENSG00000204351	ENST00000375394;ENST00000433155;ENST00000544581	T;T	0.13538	2.58;2.58	5.49	5.49	0.81192	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.25975	0.0633	M	0.63208	1.945	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.01889	-1.1253	10	0.87932	D	0	-13.5265	14.575	0.68240	0.0:0.0:0.0:1.0	.	422	Q15477	SKIV2_HUMAN	V	422;264;229	ENSP00000364543:F422V;ENSP00000442645:F229V	ENSP00000364543:F422V	F	+	1	0	SKIV2L	32038522	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.359000	0.79477	2.094000	0.63399	0.533000	0.62120	TTT	.	.	.	none		0.557	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3		
KIAA1244	57221	hgsc.bcm.edu	37	6	138615186	138615186	+	Missense_Mutation	SNP	A	A	C			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr6:138615186A>C	ENST00000251691.4	+	20	3591	c.3425A>C	c.(3424-3426)tAc>tCc	p.Y1142S		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		GGTTTTCTTTACCAGCTGAAG	0.423																																					p.Y1142S		Atlas-SNP	.											.	KIAA1244	236	.	0			c.A3425C						PASS	.						153.0	138.0	143.0					6																	138615186		2203	4300	6503	SO:0001583	missense	57221	exon20			TTCTTTACCAGCT	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.3425A>C	chr6.hg19:g.138615186A>C	ENSP00000251691:p.Tyr1142Ser	88.0	0.0	.		115.0	25.0	.	NM_020340		Missense_Mutation	SNP	ENST00000251691.4	hg19	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	A	14.05	2.421030	0.42918	.	.	ENSG00000112379	ENST00000251691	T	0.16457	2.34	5.56	5.56	0.83823	.	0.467432	0.26828	N	0.022290	T	0.08846	0.0219	L	0.36672	1.1	0.49130	D	0.999755	B	0.32245	0.361	B	0.32980	0.156	T	0.07065	-1.0792	10	0.46703	T	0.11	-28.8225	15.7152	0.77663	1.0:0.0:0.0:0.0	.	1142	Q5TH69	BIG3_HUMAN	S	1142	ENSP00000251691:Y1142S	ENSP00000251691:Y1142S	Y	+	2	0	KIAA1244	138656879	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	8.516000	0.90552	2.119000	0.64992	0.533000	0.62120	TAC	.	.	.	none		0.423	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
FNDC1	84624	hgsc.bcm.edu	37	6	159653341	159653341	+	Silent	SNP	G	G	A			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr6:159653341G>A	ENST00000297267.9	+	11	1997	c.1797G>A	c.(1795-1797)aaG>aaA	p.K599K	FNDC1_ENST00000340366.6_Silent_p.K536K	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	599					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		GCGTAGATAAGCCTGGCTTTT	0.701																																					p.K599K		Atlas-SNP	.											.	FNDC1	250	.	0			c.G1797A						PASS	.						20.0	25.0	24.0					6																	159653341		2008	4175	6183	SO:0001819	synonymous_variant	84624	exon11			AGATAAGCCTGGC	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.1797G>A	chr6.hg19:g.159653341G>A		42.0	0.0	.		46.0	22.0	.	NM_032532	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Silent	SNP	ENST00000297267.9	hg19	CCDS47512.1	.	.	.	.	.	.	.	.	.	.	G	4.335	0.061579	0.08339	.	.	ENSG00000164694	ENST00000329629	.	.	.	4.54	1.64	0.23874	.	.	.	.	.	T	0.09291	0.0229	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24657	-1.0154	4	.	.	.	-0.0117	2.6758	0.05081	0.2678:0.0:0.3704:0.3618	.	.	.	.	T	495	.	.	A	+	1	0	FNDC1	159573331	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	0.540000	0.23191	1.126000	0.42016	-0.140000	0.14226	GCC	.	.	.	none		0.701	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
POLM	27434	hgsc.bcm.edu	37	7	44116188	44116188	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr7:44116188T>A	ENST00000242248.5	-	6	856	c.755A>T	c.(754-756)gAc>gTc	p.D252V	POLM_ENST00000492971.1_5'UTR|POLM_ENST00000335195.6_Missense_Mutation_p.D252V|POLM_ENST00000395831.3_Intron	NM_013284.2	NP_037416.1	Q9NP87	DPOLM_HUMAN	polymerase (DNA directed), mu	252					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(3)|skin(2)	22						GTACCACCGGTCAGCAGTCTT	0.592								DNA polymerases (catalytic subunits)																													p.D252V		Atlas-SNP	.											.	POLM	50	.	0			c.A755T						PASS	.						114.0	107.0	109.0					7																	44116188		2203	4300	6503	SO:0001583	missense	27434	exon6			CACCGGTCAGCAG	AF176097	CCDS34625.1, CCDS64635.1, CCDS64636.1	7p13	2012-05-18			ENSG00000122678	ENSG00000122678		"""DNA polymerases"""	9185	protein-coding gene	gene with protein product	"""Pol iota"""	606344				10982892	Standard	XM_005249708		Approved	Tdt-N	uc003tjt.3	Q9NP87	OTTHUMG00000155353	ENST00000242248.5:c.755A>T	chr7.hg19:g.44116188T>A	ENSP00000242248:p.Asp252Val	72.0	0.0	.		99.0	43.0	.	NM_013284	D3DVK4|Q6P5X8|Q86WQ9	Missense_Mutation	SNP	ENST00000242248.5	hg19	CCDS34625.1	.	.	.	.	.	.	.	.	.	.	T	16.81	3.225055	0.58668	.	.	ENSG00000122678	ENST00000335195;ENST00000242248	T;T	0.44881	0.91;0.91	5.68	4.49	0.54785	DNA-directed DNA polymerase X (1);DNA polymerase lambda, fingers domain (2);	.	.	.	.	T	0.55146	0.1902	L	0.58101	1.795	0.80722	D	1	D;D	0.62365	0.991;0.972	D;P	0.64877	0.93;0.824	T	0.56269	-0.8007	9	0.87932	D	0	.	8.717	0.34416	0.0:0.0875:0.0:0.9125	.	252;252	Q6P5X8;Q9NP87	.;DPOLM_HUMAN	V	252	ENSP00000335141:D252V;ENSP00000242248:D252V	ENSP00000242248:D252V	D	-	2	0	POLM	44082713	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.366000	0.34193	0.935000	0.37341	0.528000	0.53228	GAC	.	.	.	none		0.592	POLM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339594.1	NM_013284	
MAGI2	9863	hgsc.bcm.edu	37	7	77764393	77764393	+	Silent	SNP	C	C	A			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr7:77764393C>A	ENST00000354212.4	-	17	3229	c.2976G>T	c.(2974-2976)gtG>gtT	p.V992V	MAGI2_ENST00000419488.1_Silent_p.V978V|MAGI2_ENST00000522391.1_Silent_p.V992V	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	992	PDZ 5. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TGATGAGCTTCACGATGTCAG	0.537																																					p.V992V		Atlas-SNP	.											.	MAGI2	246	.	0			c.G2976T						PASS	.						264.0	194.0	217.0					7																	77764393		2203	4300	6503	SO:0001819	synonymous_variant	9863	exon17			GAGCTTCACGATG	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.2976G>T	chr7.hg19:g.77764393C>A		110.0	0.0	.		209.0	42.0	.	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Silent	SNP	ENST00000354212.4	hg19	CCDS5594.1																																																																																			.	.	.	none		0.537	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
SLC35G5	83650	hgsc.bcm.edu	37	8	11189416	11189416	+	Silent	SNP	C	C	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr8:11189416C>T	ENST00000382435.4	+	1	1020	c.801C>T	c.(799-801)ttC>ttT	p.F267F		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	267						integral component of membrane (GO:0016021)											TGGTCTCCTTCACATGTGTGG	0.597																																					p.F267F		Atlas-SNP	.											.	.	.	.	0			c.C801T						PASS	.						113.0	111.0	112.0					8																	11189416		2203	4300	6503	SO:0001819	synonymous_variant	83650	exon1			CTCCTTCACATGT	AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.801C>T	chr8.hg19:g.11189416C>T		90.0	0.0	.		113.0	6.0	.	NM_054028	A2RRL6	Silent	SNP	ENST00000382435.4	hg19	CCDS5980.1																																																																																			.	.	.	none		0.597	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207313.2	NM_054028	
NRG1	3084	hgsc.bcm.edu	37	8	31497511	31497511	+	Missense_Mutation	SNP	G	G	C	rs367543150	byFrequency	TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr8:31497511G>C	ENST00000520407.1	+	1	241	c.11G>C	c.(10-12)cGa>cCa	p.R4P	NRG1_ENST00000519301.1_Intron	NM_013962.2	NP_039256.2	Q02297	NRG1_HUMAN	neuregulin 1	0					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		ATGAGATGGCGAcgcgccccg	0.761																																					p.R4P		Atlas-SNP	.											.	NRG1	260	.	0			c.G11C						PASS	.						2.0	2.0	2.0					8																	31497511		1218	2257	3475	SO:0001583	missense	3084	exon1			GATGGCGACGCGC	L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000520407.1:c.11G>C	chr8.hg19:g.31497511G>C	ENSP00000434640:p.Arg4Pro	1.0	0.0	.		5.0	4.0	.	NM_013962	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	ENST00000520407.1	hg19	CCDS47836.1	.	.	.	.	.	.	.	.	.	.	G	12.38	1.919846	0.33908	.	.	ENSG00000157168	ENST00000520407	T	0.78707	-1.2	2.91	1.98	0.26296	.	.	.	.	.	T	0.61652	0.2364	.	.	.	0.80722	D	1	P	0.47409	0.895	B	0.34346	0.18	T	0.64339	-0.6431	8	0.87932	D	0	.	5.1615	0.15064	0.1749:0.0:0.8251:0.0	.	4	Q02297-9	.	P	4	ENSP00000434640:R4P	ENSP00000434640:R4P	R	+	2	0	NRG1	31617053	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	3.653000	0.54446	1.332000	0.45431	0.297000	0.19635	CGA	.	.	.	weak		0.761	NRG1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376412.2		
ADAM32	203102	hgsc.bcm.edu	37	8	39044451	39044451	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr8:39044451G>C	ENST00000379907.4	+	11	1066	c.939G>C	c.(937-939)gaG>gaC	p.E313D	ADAM32_ENST00000437682.2_Intron|ADAM32_ENST00000519315.1_Intron	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	313	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			TAACTCTGGAGGCATTTGCAG	0.353																																					p.E313D		Atlas-SNP	.											.	ADAM32	70	.	0			c.G939C						PASS	.						77.0	73.0	74.0					8																	39044451		1813	4075	5888	SO:0001583	missense	203102	exon11			TCTGGAGGCATTT	BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.939G>C	chr8.hg19:g.39044451G>C	ENSP00000369238:p.Glu313Asp	72.0	0.0	.		86.0	19.0	.	NM_145004	Q8TC42	Missense_Mutation	SNP	ENST00000379907.4	hg19	CCDS47846.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.974271	0.34848	.	.	ENSG00000197140	ENST00000379907	T	0.10099	2.91	5.47	2.72	0.32119	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.33591	U	0.004753	T	0.24928	0.0605	M	0.81341	2.54	0.26818	N	0.968841	D	0.55172	0.97	D	0.63283	0.913	T	0.12218	-1.0556	10	0.15952	T	0.53	.	7.6636	0.28417	0.2647:0.0:0.7353:0.0	.	313	Q8TC27	ADA32_HUMAN	D	313	ENSP00000369238:E313D	ENSP00000369238:E313D	E	+	3	2	ADAM32	39163608	0.973000	0.33851	0.979000	0.43373	0.049000	0.14656	0.873000	0.28052	0.378000	0.24764	-0.142000	0.14014	GAG	.	.	.	none		0.353	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377089.1	NM_145004	
NKAIN3	286183	hgsc.bcm.edu	37	8	63659504	63659504	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr8:63659504T>A	ENST00000523211.1	+	4	419	c.287T>A	c.(286-288)aTg>aAg	p.M96K	NKAIN3_ENST00000328472.5_Missense_Mutation_p.M96K|NKAIN3_ENST00000519049.1_3'UTR	NM_173688.2	NP_775959.1	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3	96						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(3)|large_intestine(2)|lung(8)	13	Breast(64;0.127)	Lung NSC(129;0.187)				ACCGATCTAATGACATTCAAT	0.463																																					p.M96K		Atlas-SNP	.											.	NKAIN3	32	.	0			c.T287A						PASS	.						121.0	116.0	117.0					8																	63659504		2002	4170	6172	SO:0001583	missense	286183	exon4			ATCTAATGACATT	AK096949	CCDS55239.1	8q12.3	2014-08-12	2007-10-04	2007-10-04	ENSG00000185942	ENSG00000185942		"""Na+/K+ transporting ATPase interacting"""	26829	protein-coding gene	gene with protein product		612872	"""family with sequence similarity 77, member D"""	FAM77D		17606467	Standard	NM_173688		Approved	FLJ39630	uc010lyq.1	Q8N8D7	OTTHUMG00000164361	ENST00000523211.1:c.287T>A	chr8.hg19:g.63659504T>A	ENSP00000429073:p.Met96Lys	56.0	0.0	.		68.0	21.0	.	NM_173688		Missense_Mutation	SNP	ENST00000523211.1	hg19	CCDS55239.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.632134	0.87660	.	.	ENSG00000185942	ENST00000545532;ENST00000523211;ENST00000524201;ENST00000328472	T;T;T	0.15487	2.42;2.42;2.42	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.22166	0.0534	L	0.41824	1.3	0.54753	D	0.99998	P	0.44877	0.845	P	0.46172	0.506	T	0.00745	-1.1584	10	0.87932	D	0	-2.0704	15.1705	0.72869	0.0:0.0:0.0:1.0	.	96	Q8N8D7	NKAI3_HUMAN	K	96;96;69;96	ENSP00000429073:M96K;ENSP00000429393:M69K;ENSP00000333627:M96K	ENSP00000333627:M96K	M	+	2	0	NKAIN3	63822058	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.608000	0.82898	2.181000	0.69327	0.528000	0.53228	ATG	.	.	.	none		0.463	NKAIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378447.2	NM_173688	
COPS5	10987	hgsc.bcm.edu	37	8	67955532	67955532	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr8:67955532G>T	ENST00000357849.4	-	8	1261	c.941C>A	c.(940-942)gCt>gAt	p.A314D	PPP1R42_ENST00000517834.1_Intron|COPS5_ENST00000517736.1_3'UTR	NM_006837.2	NP_006828.2	Q92905	CSN5_HUMAN	COP9 signalosome subunit 5	314					cullin deneddylation (GO:0010388)|exosomal secretion (GO:1990182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein deneddylation (GO:0000338)|protein deubiquitination (GO:0016579)|regulation of cell cycle (GO:0051726)|regulation of JNK cascade (GO:0046328)|transcription from RNA polymerase II promoter (GO:0006366)|translation (GO:0006412)|translational initiation (GO:0006413)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|eukaryotic translation initiation factor 3 complex (GO:0005852)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|transcription coactivator activity (GO:0003713)|translation initiation factor activity (GO:0003743)|ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|skin(3)	14	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00389)|OV - Ovarian serous cystadenocarcinoma(28;0.00691)|all cancers(69;0.0205)|BRCA - Breast invasive adenocarcinoma(89;0.153)			TCCATGGATAGCTTCTATGGT	0.338																																					p.A314D		Atlas-SNP	.											.	COPS5	29	.	0			c.C941A						PASS	.						84.0	80.0	82.0					8																	67955532		2201	4300	6501	SO:0001583	missense	10987	exon8			TGGATAGCTTCTA	U65928	CCDS6198.1	8q13.1	2013-03-14	2013-03-14		ENSG00000121022	ENSG00000121022			2240	protein-coding gene	gene with protein product		604850	"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 5"", ""COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)"""			8837781, 9341143	Standard	NM_006837		Approved	JAB1, SGN5, MOV-34, CSN5	uc003xxe.3	Q92905	OTTHUMG00000164563	ENST00000357849.4:c.941C>A	chr8.hg19:g.67955532G>T	ENSP00000350512:p.Ala314Asp	98.0	0.0	.		103.0	22.0	.	NM_006837	O15386|Q6AW95|Q86WQ4|Q9BQ17	Missense_Mutation	SNP	ENST00000357849.4	hg19	CCDS6198.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.319312	0.41096	.	.	ENSG00000121022	ENST00000357849	.	.	.	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.71400	0.3335	M	0.70903	2.155	0.80722	D	1	B	0.27380	0.177	B	0.37780	0.258	T	0.67102	-0.5755	9	0.22109	T	0.4	-10.6585	18.5697	0.91130	0.0:0.0:1.0:0.0	.	314	Q92905	CSN5_HUMAN	D	314	.	ENSP00000350512:A314D	A	-	2	0	COPS5	68118086	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.965000	0.87945	2.559000	0.86315	0.555000	0.69702	GCT	.	.	.	none		0.338	COPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379245.2		
POLR2K	5440	hgsc.bcm.edu	37	8	101163593	101163593	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr8:101163593C>G	ENST00000353107.3	+	2	145	c.10C>G	c.(10-12)Cag>Gag	p.Q4E	POLR2K_ENST00000522439.1_Missense_Mutation_p.Q4E|POLR2K_ENST00000519765.1_3'UTR	NM_005034.3	NP_005025.1	P53803	RPAB4_HUMAN	polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa	4					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|RNA splicing (GO:0008380)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase II, core complex (GO:0005665)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|prostate(1)	3	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.59e-09)|all cancers(13;1.74e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			AATGGACACCCAGAAGGACGT	0.393																																					p.Q4E		Atlas-SNP	.											.	POLR2K	6	.	0			c.C10G						PASS	.						100.0	99.0	99.0					8																	101163593		2203	4300	6503	SO:0001583	missense	5440	exon2			GACACCCAGAAGG		CCDS6285.1	8q22	2013-01-21	2002-08-29		ENSG00000147669	ENSG00000147669		"""RNA polymerase subunits"""	9198	protein-coding gene	gene with protein product		606033	"""polymerase (RNA) II (DNA directed) polypeptide K (7.0kD)"""				Standard	NM_005034		Approved	RPB10alpha	uc003yjf.3	P53803	OTTHUMG00000164705	ENST00000353107.3:c.10C>G	chr8.hg19:g.101163593C>G	ENSP00000342889:p.Gln4Glu	73.0	0.0	.		88.0	24.0	.	NM_005034	Q6IBD4	Missense_Mutation	SNP	ENST00000353107.3	hg19	CCDS6285.1	.	.	.	.	.	.	.	.	.	.	C	18.34	3.602006	0.66445	.	.	ENSG00000147669	ENST00000353107;ENST00000522439	.	.	.	5.96	5.96	0.96718	.	0.069273	0.64402	D	0.000017	T	0.54464	0.1860	.	.	.	0.51233	D	0.999916	B	0.13594	0.008	B	0.12156	0.007	T	0.44667	-0.9313	8	0.22706	T	0.39	.	20.017	0.97481	0.0:1.0:0.0:0.0	.	4	P53803	RPAB4_HUMAN	E	4	.	ENSP00000342889:Q4E	Q	+	1	0	POLR2K	101232769	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.451000	0.60047	2.832000	0.97577	0.655000	0.94253	CAG	.	.	.	none		0.393	POLR2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379849.1	NM_005034	
TRMT12	55039	hgsc.bcm.edu	37	8	125463695	125463695	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr8:125463695G>T	ENST00000328599.3	+	1	648	c.527G>T	c.(526-528)cGa>cTa	p.R176L	TRMT12_ENST00000521443.1_Intron	NM_017956.3	NP_060426.2	Q53H54	TYW2_HUMAN	tRNA methyltransferase 12 homolog (S. cerevisiae)	176					tRNA processing (GO:0008033)		transferase activity (GO:0016740)			breast(2)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			TTGGCAAAACGAGGGCGGGTA	0.542																																					p.R176L		Atlas-SNP	.											.	TRMT12	28	.	0			c.G527T						PASS	.						96.0	91.0	93.0					8																	125463695		2203	4300	6503	SO:0001583	missense	55039	exon1			CAAAACGAGGGCG	AF313041	CCDS6349.1	8q24.13	2011-05-09	2006-11-16		ENSG00000183665	ENSG00000183665			26091	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 2"""	611244	"""tRNA methyltranferase 12 homolog (S. cerevisiae)"""			16005430, 17150819	Standard	NM_017956		Approved	FLJ20772, Trm12, TYW2	uc003yra.4	Q53H54	OTTHUMG00000165022	ENST00000328599.3:c.527G>T	chr8.hg19:g.125463695G>T	ENSP00000329858:p.Arg176Leu	60.0	0.0	.		93.0	37.0	.	NM_017956	Q6PKB9|Q96F21|Q9NWK6	Missense_Mutation	SNP	ENST00000328599.3	hg19	CCDS6349.1	.	.	.	.	.	.	.	.	.	.	G	19.18	3.777863	0.70107	.	.	ENSG00000183665	ENST00000328599	T	0.23950	1.88	4.65	3.76	0.43208	.	0.201412	0.45126	D	0.000382	T	0.26448	0.0646	L	0.45581	1.43	0.37375	D	0.911792	P	0.43973	0.823	P	0.47891	0.56	T	0.11567	-1.0582	10	0.35671	T	0.21	-10.3012	6.4557	0.21928	0.0944:0.0:0.7222:0.1834	.	176	Q53H54	TYW2_HUMAN	L	176	ENSP00000329858:R176L	ENSP00000329858:R176L	R	+	2	0	TRMT12	125532876	1.000000	0.71417	0.968000	0.41197	0.984000	0.73092	3.567000	0.53813	1.245000	0.43885	0.561000	0.74099	CGA	.	.	.	none		0.542	TRMT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381465.1	NM_017956	
LRRC19	64922	hgsc.bcm.edu	37	9	26999703	26999703	+	Splice_Site	SNP	T	T	C			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr9:26999703T>C	ENST00000380055.5	-	2	102		c.e2-2		IFT74_ENST00000429045.2_Intron|IFT74_ENST00000380062.5_Intron|IFT74_ENST00000433700.1_Intron|IFT74_ENST00000443698.1_Intron|LRRC19_ENST00000482770.1_5'Flank	NM_022901.2	NP_075052.1	Q9H756	LRC19_HUMAN	leucine rich repeat containing 19							integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|lung(2)	6		all_neural(11;1.81e-09)		Lung(218;1.06e-05)|LUSC - Lung squamous cell carcinoma(38;0.0001)		GTTGCAGACCTGATAGAAAAG	0.323																																					.		Atlas-SNP	.											.	LRRC19	24	.	0			.						PASS	.						61.0	67.0	65.0					9																	26999703		2202	4300	6502	SO:0001630	splice_region_variant	64922	.			CAGACCTGATAGA	AK024955	CCDS6518.1	9p21.1	2008-02-05			ENSG00000184434	ENSG00000184434			23379	protein-coding gene	gene with protein product							Standard	NM_022901		Approved	FLJ21302	uc003zqh.3	Q9H756	OTTHUMG00000019710	ENST00000380055.5:c.9-2A>G	chr9.hg19:g.26999703T>C		35.0	0.0	.		53.0	16.0	.	.	A0AV00|B9EG91	Splice_Site	SNP	ENST00000380055.5	hg19	CCDS6518.1																																																																																			.	.	.	none		0.323	LRRC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051961.2	NM_022901	Intron
QSOX2	169714	hgsc.bcm.edu	37	9	139100813	139100813	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr9:139100813C>A	ENST00000358701.5	-	12	1895	c.1858G>T	c.(1858-1860)Gcc>Tcc	p.A620S		NM_181701.3	NP_859052.3	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2	620					cell redox homeostasis (GO:0045454)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	thiol oxidase activity (GO:0016972)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		TCTGGAAGGGCAGGCCTGGGG	0.657																																					p.A620S		Atlas-SNP	.											.	QSOX2	63	.	0			c.G1858T						PASS	.						69.0	68.0	68.0					9																	139100813		2203	4300	6503	SO:0001583	missense	169714	exon12			GAAGGGCAGGCCT	AJ318051	CCDS35178.1	9q34.3	2008-02-05	2007-04-23	2007-04-23	ENSG00000165661	ENSG00000165661			30249	protein-coding gene	gene with protein product		612860	"""quiescin Q6-like 1"""	QSCN6L1		12176051	Standard	NM_181701		Approved	SOXN, DKFZp762A2013	uc010nbi.2	Q6ZRP7	OTTHUMG00000020923	ENST00000358701.5:c.1858G>T	chr9.hg19:g.139100813C>A	ENSP00000351536:p.Ala620Ser	51.0	0.0	.		75.0	25.0	.	NM_181701	A2CEE0|A6NLB0|Q5TB37|Q7Z7B6|Q86VV7|Q8N3G2	Missense_Mutation	SNP	ENST00000358701.5	hg19	CCDS35178.1	.	.	.	.	.	.	.	.	.	.	C	3.024	-0.201068	0.06219	.	.	ENSG00000165661	ENST00000358701	T	0.04809	3.55	4.38	-1.36	0.09085	.	5.338950	0.00508	N	0.000160	T	0.03095	0.0091	N	0.08118	0	0.09310	N	1	B	0.25105	0.118	B	0.19946	0.027	T	0.43376	-0.9395	10	0.08179	T	0.78	2.4215	12.0025	0.53240	0.0:0.6163:0.269:0.1147	.	620	Q6ZRP7	QSOX2_HUMAN	S	620	ENSP00000351536:A620S	ENSP00000351536:A620S	A	-	1	0	QSOX2	138240634	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.007000	0.13174	-0.531000	0.06340	-0.448000	0.05591	GCC	.	.	.	none		0.657	QSOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055046.2	NM_181701	
MYO3A	53904	hgsc.bcm.edu	37	10	26385347	26385347	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr10:26385347G>C	ENST00000265944.5	+	16	1766	c.1600G>C	c.(1600-1602)Gct>Cct	p.A534P	MYO3A_ENST00000543632.1_Missense_Mutation_p.A534P	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	534	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						CTACATTTATGCTGGTTTGGC	0.323																																					p.A534P		Atlas-SNP	.											.	MYO3A	371	.	0			c.G1600C						PASS	.						51.0	55.0	53.0					10																	26385347		2200	4298	6498	SO:0001583	missense	53904	exon16			ATTTATGCTGGTT	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.1600G>C	chr10.hg19:g.26385347G>C	ENSP00000265944:p.Ala534Pro	193.0	0.0	.		246.0	65.0	.	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	hg19	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.126447	0.77549	.	.	ENSG00000095777	ENST00000265944;ENST00000543632	D;D	0.89196	-2.48;-2.48	5.13	4.23	0.50019	Myosin head, motor domain (2);	0.049751	0.85682	D	0.000000	D	0.95692	0.8599	H	0.95470	3.675	0.80722	D	1	D;D;D	0.57899	0.971;0.977;0.981	P;P;D	0.69142	0.763;0.847;0.962	D	0.96034	0.9019	10	0.48119	T	0.1	.	13.983	0.64317	0.0734:0.0:0.9266:0.0	.	534;534;534	F5H0U9;Q0VD65;Q8NEV4	.;.;MYO3A_HUMAN	P	534	ENSP00000265944:A534P;ENSP00000445909:A534P	ENSP00000265944:A534P	A	+	1	0	MYO3A	26425353	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.600000	0.82769	1.304000	0.44892	0.655000	0.94253	GCT	.	.	.	none		0.323	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
MUC15	143662	hgsc.bcm.edu	37	11	26582626	26582626	+	Missense_Mutation	SNP	G	G	T	rs375176901		TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr11:26582626G>T	ENST00000455601.2	-	4	1109	c.991C>A	c.(991-993)Cgt>Agt	p.R331S	MUC15_ENST00000281268.8_Missense_Mutation_p.R308S|MUC15_ENST00000529533.1_Missense_Mutation_p.R358S|ANO3_ENST00000525139.1_Intron|ANO3_ENST00000529242.1_Intron|MUC15_ENST00000436318.2_Missense_Mutation_p.R358S|MUC15_ENST00000527569.1_Missense_Mutation_p.R308S|ANO3_ENST00000537978.1_Intron|ANO3_ENST00000531568.1_Intron|ANO3_ENST00000256737.3_Intron	NM_145650.3	NP_663625.2	Q8N387	MUC15_HUMAN	mucin 15, cell surface associated	331					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25						ACAGAAGTACGAAGTGGAGGT	0.383																																					p.R358S		Atlas-SNP	.											.	MUC15	88	.	0			c.C1072A						PASS	.						180.0	165.0	170.0					11																	26582626		2203	4300	6503	SO:0001583	missense	143662	exon5			AAGTACGAAGTGG	AJ417818	CCDS7859.1, CCDS44556.1, CCDS44557.1	11p14.3	2007-01-17	2006-03-14					"""Mucins"""	14956	protein-coding gene	gene with protein product		608566				12047385	Standard	NM_145650		Approved		uc001mqw.3	Q8N387		ENST00000455601.2:c.991C>A	chr11.hg19:g.26582626G>T	ENSP00000397339:p.Arg331Ser	114.0	0.0	.		165.0	51.0	.	NM_001135091	B3KY00|E9PII6|F8W945|Q6UWS3|Q8IXI8|Q8WW41	Missense_Mutation	SNP	ENST00000455601.2	hg19	CCDS7859.1	.	.	.	.	.	.	.	.	.	.	G	18.19	3.569502	0.65765	.	.	ENSG00000169550	ENST00000455601;ENST00000436318;ENST00000281268;ENST00000529533;ENST00000527569	T;T;T;T;T	0.39229	1.14;1.09;1.14;1.09;1.14	5.33	5.33	0.75918	.	0.000000	0.49916	D	0.000136	T	0.55641	0.1933	L	0.32530	0.975	0.19300	N	0.999979	D;D;D	0.89917	1.0;0.998;0.998	D;D;D	0.79108	0.992;0.955;0.955	T	0.52260	-0.8599	10	0.87932	D	0	-10.0199	18.1491	0.89668	0.0:0.0:1.0:0.0	.	308;331;358	F8W945;Q8N387;E9PII6	.;MUC15_HUMAN;.	S	331;358;308;358;308	ENSP00000397339:R331S;ENSP00000416753:R358S;ENSP00000281268:R308S;ENSP00000431983:R358S;ENSP00000431945:R308S	ENSP00000281268:R308S	R	-	1	0	MUC15	26539202	0.953000	0.32496	0.797000	0.32132	0.278000	0.26855	3.311000	0.51919	2.652000	0.90054	0.591000	0.81541	CGT	.	.	.	alt		0.383	MUC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387866.1	NM_145650	
ATG13	9776	hgsc.bcm.edu	37	11	46671731	46671731	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr11:46671731G>A	ENST00000434074.1	+	6	1011	c.322G>A	c.(322-324)Gat>Aat	p.D108N	ATG13_ENST00000451945.1_Missense_Mutation_p.D108N|ATG13_ENST00000312040.4_Missense_Mutation_p.D108N|ATG13_ENST00000526508.1_Missense_Mutation_p.D108N|ATG13_ENST00000524625.1_Missense_Mutation_p.D108N|ATG13_ENST00000528494.1_Missense_Mutation_p.D108N|ATG13_ENST00000359513.4_Missense_Mutation_p.D108N|ATG13_ENST00000529655.1_Missense_Mutation_p.D108N|ATG13_ENST00000530500.1_Missense_Mutation_p.D29N	NM_001205120.1	NP_001192049.1	O75143	ATG13_HUMAN	autophagy related 13	108					autophagic vacuole assembly (GO:0000045)	ATG1/UKL1 signaling complex (GO:0034273)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)|ULK1-ATG13-FIP200 complex (GO:0070969)	protein kinase binding (GO:0019901)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|prostate(1)|skin(1)	15						TGGCAGGTGTGATAAAGAAAT	0.428																																					p.D108N		Atlas-SNP	.											ATG13_ENST00000528494,NS,carcinoma,0,2	ATG13	60	.	0			c.G322A						PASS	.						114.0	108.0	110.0					11																	46671731		2201	4299	6500	SO:0001583	missense	9776	exon7			AGGTGTGATAAAG	AB014552	CCDS7921.1, CCDS44582.1, CCDS55760.1, CCDS55761.1	11p11.2	2014-02-12	2012-06-06	2010-06-29	ENSG00000175224	ENSG00000175224			29091	protein-coding gene	gene with protein product		615088	"""KIAA0652"", ""ATG13 autophagy related 13 homolog (S. cerevisiae)"""	KIAA0652		15169610, 18339812, 17204848	Standard	NM_001205120		Approved		uc001nda.3	O75143	OTTHUMG00000166538	ENST00000434074.1:c.322G>A	chr11.hg19:g.46671731G>A	ENSP00000400642:p.Asp108Asn	28.0	0.0	.		31.0	9.0	.	NM_001142673	B4DFI4|D3DQQ1|D3DQQ2|E9PQZ8|Q53EN6|Q9BRL3|Q9H8B0	Missense_Mutation	SNP	ENST00000434074.1	hg19	CCDS44582.1	.	.	.	.	.	.	.	.	.	.	G	35	5.431312	0.96150	.	.	ENSG00000175224	ENST00000395549;ENST00000434074;ENST00000312040;ENST00000451945;ENST00000529655;ENST00000533325;ENST00000530500;ENST00000526508;ENST00000524625;ENST00000359513;ENST00000528494;ENST00000526078	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.75339	0.3836	L	0.46157	1.445	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.996;0.997;0.997;0.983	T	0.73126	-0.4081	9	0.42905	T	0.14	-12.925	19.7319	0.96186	0.0:0.0:1.0:0.0	.	29;108;108;108	B4DFI4;O75143;E9PQZ8;O75143-2	.;ATG13_HUMAN;.;.	N	108;108;108;108;108;108;29;108;108;108;108;108	.	ENSP00000310321:D108N	D	+	1	0	ATG13	46628307	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.827000	0.99397	2.668000	0.90789	0.655000	0.94253	GAT	.	.	.	none		0.428	ATG13-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390300.2	NM_014741	
MADD	8567	hgsc.bcm.edu	37	11	47298344	47298344	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr11:47298344T>A	ENST00000311027.5	+	5	1190	c.1025T>A	c.(1024-1026)aTg>aAg	p.M342K	MADD_ENST00000395336.3_Missense_Mutation_p.M342K|MADD_ENST00000406482.1_Missense_Mutation_p.M342K|MADD_ENST00000402799.1_Missense_Mutation_p.M342K|MADD_ENST00000342922.4_Missense_Mutation_p.M342K|MADD_ENST00000407859.3_Missense_Mutation_p.M342K|MADD_ENST00000349238.3_Missense_Mutation_p.M342K|MADD_ENST00000402192.2_Missense_Mutation_p.M342K|MADD_ENST00000395344.3_Missense_Mutation_p.M342K|MADD_ENST00000489415.1_3'UTR	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		TTCGTGGCAATGATCTACCCA	0.512																																					p.M342K		Atlas-SNP	.											.	MADD	172	.	0			c.T1025A						PASS	.						286.0	217.0	241.0					11																	47298344		2201	4298	6499	SO:0001583	missense	8567	exon5			TGGCAATGATCTA	AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.1025T>A	chr11.hg19:g.47298344T>A	ENSP00000310933:p.Met342Lys	70.0	0.0	.		97.0	21.0	.	NM_130474		Missense_Mutation	SNP	ENST00000311027.5	hg19	CCDS7930.1	.	.	.	.	.	.	.	.	.	.	T	30	5.056526	0.93793	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000428807;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192	T;T;T;T;T;T;T;T;T;T	0.11821	2.74;2.74;2.74;2.74;2.74;2.74;2.74;2.74;2.74;2.74	5.93	5.93	0.95920	DENN (3);	0.000000	0.85682	D	0.000000	T	0.40372	0.1114	M	0.79258	2.445	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.65815	0.992;0.98;0.995;0.988;0.988;0.988;0.988;0.994;0.99;0.995	D;P;D;P;P;P;P;D;D;D	0.74348	0.91;0.845;0.961;0.836;0.836;0.836;0.883;0.983;0.952;0.962	T	0.27640	-1.0068	10	0.87932	D	0	-26.4751	16.3943	0.83563	0.0:0.0:0.0:1.0	.	342;342;342;342;342;342;342;342;342;342	B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;MADD_HUMAN;.	K	342;342;120;342;342;342;342;342;342;342;342	ENSP00000343902:M342K;ENSP00000398167:M120K;ENSP00000385585:M342K;ENSP00000384435:M342K;ENSP00000304505:M342K;ENSP00000310933:M342K;ENSP00000384204:M342K;ENSP00000378753:M342K;ENSP00000378745:M342K;ENSP00000384287:M342K	ENSP00000310933:M342K	M	+	2	0	MADD	47254920	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.698000	0.84413	2.281000	0.76405	0.533000	0.62120	ATG	.	.	.	none		0.512	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317746.1		
DDB1	1642	hgsc.bcm.edu	37	11	61079364	61079364	+	Silent	SNP	C	C	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr11:61079364C>T	ENST00000301764.7	-	18	2566	c.2169G>A	c.(2167-2169)aaG>aaA	p.K723K	DDB1_ENST00000545930.1_5'Flank|DDB1_ENST00000450997.2_Intron	NM_001923.4	NP_001914.3	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1, 127kDa	723	Interaction with CDT1.|WD repeat beta-propeller C.				DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of mitotic cell cycle phase transition (GO:1901990)|UV-damage excision repair (GO:0070914)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	48						GGTAGCAGATCTTCCTGCAGA	0.567								Nucleotide excision repair (NER)																													p.K723K		Atlas-SNP	.											.	DDB1	100	.	0			c.G2169A						PASS	.						109.0	101.0	104.0					11																	61079364		2203	4299	6502	SO:0001819	synonymous_variant	1642	exon18			GCAGATCTTCCTG	AJ002955	CCDS31576.1	11q12-q13	2014-09-17	2002-08-29		ENSG00000167986	ENSG00000167986			2717	protein-coding gene	gene with protein product		600045	"""damage-specific DNA binding protein 1 (127kD)"""			8530102, 10574459	Standard	NM_001923		Approved	XPE	uc001nrc.5	Q16531	OTTHUMG00000168209	ENST00000301764.7:c.2169G>A	chr11.hg19:g.61079364C>T		55.0	0.0	.		51.0	10.0	.	NM_001923	A6NG77|B2R648|B4DG00|O15176|Q13289|Q58F96	Silent	SNP	ENST00000301764.7	hg19	CCDS31576.1																																																																																			.	.	.	none		0.567	DDB1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398816.1	NM_001923	
MAP4K2	5871	hgsc.bcm.edu	37	11	64557689	64557689	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr11:64557689A>G	ENST00000294066.2	-	29	2310	c.2219T>C	c.(2218-2220)cTg>cCg	p.L740P	MAP4K2_ENST00000377350.3_Missense_Mutation_p.L732P	NM_004579.3	NP_004570.2	Q12851	M4K2_HUMAN	mitogen-activated protein kinase kinase kinase kinase 2	740	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JUN kinase activity (GO:0007257)|immune response (GO:0006955)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|positive regulation of JNK cascade (GO:0046330)|protein phosphorylation (GO:0006468)|vesicle targeting (GO:0006903)	Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(1)|lung(3)|ovary(1)|pancreas(1)|urinary_tract(2)	8						ATCAAAGGTCAGCTCAGGTGC	0.632																																					p.L740P		Atlas-SNP	.											.	MAP4K2	83	.	0			c.T2219C						PASS	.						118.0	107.0	111.0					11																	64557689		2201	4297	6498	SO:0001583	missense	5871	exon29			AAGGTCAGCTCAG	BC047865	CCDS8082.1	11q13.1	2011-06-09			ENSG00000168067	ENSG00000168067		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6864	protein-coding gene	gene with protein product		603166		RAB8IP		7515885	Standard	NM_004579		Approved	GCK, BL44	uc001obh.3	Q12851	OTTHUMG00000045328	ENST00000294066.2:c.2219T>C	chr11.hg19:g.64557689A>G	ENSP00000294066:p.Leu740Pro	34.0	0.0	.		27.0	9.0	.	NM_004579	Q86VU3	Missense_Mutation	SNP	ENST00000294066.2	hg19	CCDS8082.1	.	.	.	.	.	.	.	.	.	.	A	16.08	3.022010	0.54576	.	.	ENSG00000168067	ENST00000294066;ENST00000377350	T;T	0.08370	3.1;3.1	5.28	5.28	0.74379	Citron-like (3);	0.090204	0.46442	D	0.000281	T	0.23766	0.0575	L	0.58510	1.815	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.75484	0.961;0.986	T	0.00415	-1.1753	10	0.87932	D	0	.	11.6762	0.51432	1.0:0.0:0.0:0.0	.	732;740	Q86VU3;Q12851	.;M4K2_HUMAN	P	740;732	ENSP00000294066:L740P;ENSP00000366567:L732P	ENSP00000294066:L740P	L	-	2	0	MAP4K2	64314265	1.000000	0.71417	0.995000	0.50966	0.867000	0.49689	7.737000	0.84957	2.019000	0.59389	0.454000	0.30748	CTG	.	.	.	none		0.632	MAP4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105239.1	NM_004579	
MAML2	84441	hgsc.bcm.edu	37	11	95825254	95825254	+	Silent	SNP	C	C	T	rs61749250		TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr11:95825254C>T	ENST00000524717.1	-	2	3225	c.1941G>A	c.(1939-1941)caG>caA	p.Q647Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	647					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q647Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgttgttgct	0.512			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q647Q		Atlas-SNP	.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	MAML2,caecum,carcinoma,0,2	MAML2	94	.	1	Substitution - coding silent(1)	endometrium(1)	c.G1941A						PASS	.	C		0,4198		0,0,2099	35.0	40.0	38.0		1941	1.7	0.1	11	dbSNP_129	38	5,8237		0,5,4116	no	coding-synonymous	MAML2	NM_032427.1		0,5,6215	TT,TC,CC		0.0607,0.0,0.0402		647/1157	95825254	5,12435	2099	4121	6220	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGTTGT	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1941G>A	chr11.hg19:g.95825254C>T		122.0	1.0	.		143.0	6.0	.	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	hg19	CCDS44714.1																																																																																			.	.	.	weak		0.512	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
DYNC2H1	79659	hgsc.bcm.edu	37	11	103128412	103128412	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr11:103128412A>G	ENST00000375735.2	+	69	10681	c.10537A>G	c.(10537-10539)Aat>Gat	p.N3513D	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.N3520D|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3513					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GTCCAAAATTAATAACATGTA	0.443																																					p.N3520D		Atlas-SNP	.											.	DYNC2H1	246	.	0			c.A10558G						PASS	.						146.0	133.0	137.0					11																	103128412		1861	4099	5960	SO:0001583	missense	79659	exon70			AAAATTAATAACA	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.10537A>G	chr11.hg19:g.103128412A>G	ENSP00000364887:p.Asn3513Asp	73.0	0.0	.		93.0	20.0	.	NM_001080463	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	hg19	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	A	31	5.077452	0.94000	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.36520	1.25;1.25	6.06	6.06	0.98353	.	0.152305	0.56097	D	0.000024	T	0.48447	0.1500	L	0.45228	1.405	0.80722	D	1	P;D	0.64830	0.931;0.994	P;P	0.61592	0.688;0.891	T	0.26087	-1.0113	10	0.19590	T	0.45	.	16.6093	0.84858	1.0:0.0:0.0:0.0	.	3513;3520	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	D	3513;3520	ENSP00000364887:N3513D;ENSP00000381167:N3520D	ENSP00000364887:N3513D	N	+	1	0	DYNC2H1	102633622	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.228000	0.95250	2.324000	0.78689	0.533000	0.62120	AAT	.	.	.	none		0.443	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
SIK3	23387	hgsc.bcm.edu	37	11	116717228	116717228	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr11:116717228T>C	ENST00000292055.4	-	23	3711	c.3676A>G	c.(3676-3678)Agt>Ggt	p.S1226G	SIK3_ENST00000434315.2_Missense_Mutation_p.S1065G|SIK3_ENST00000488337.1_5'UTR|SIK3_ENST00000446921.2_Missense_Mutation_p.S1224G|AP006216.12_ENST00000444200.1_RNA|SIK3_ENST00000542607.1_Missense_Mutation_p.S1166G|SIK3_ENST00000375300.1_Missense_Mutation_p.S1284G|SIK3_ENST00000375288.1_Missense_Mutation_p.S561G	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	1226					protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						CTGCCATCACTCAGGTCTGGG	0.517																																					p.S1226G		Atlas-SNP	.											.	SIK3	112	.	0			c.A3676G						PASS	.						145.0	123.0	130.0					11																	116717228		2201	4292	6493	SO:0001583	missense	23387	exon23			CATCACTCAGGTC	AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.3676A>G	chr11.hg19:g.116717228T>C	ENSP00000292055:p.Ser1226Gly	63.0	0.0	.		93.0	21.0	.	NM_025164	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	ENST00000292055.4	hg19	CCDS8379.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.38|11.38	1.620458|1.620458	0.28801|0.28801	.|.	.|.	ENSG00000160584|ENSG00000160584	ENST00000445177;ENST00000446921|ENST00000375300;ENST00000292055;ENST00000375288;ENST00000542607;ENST00000434315	.|T;T;T;T;T	.|0.70869	.|-0.46;-0.5;1.46;-0.52;-0.12	5.13|5.13	0.277|0.277	0.15668|0.15668	.|.	.|0.839139	.|0.09863	.|N	.|0.745920	T|T	0.42177|0.42177	0.1191|0.1191	N|N	0.04880|0.04880	-0.145|-0.145	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.02656	.|0.0;0.0;0.0;0.0	.|B;B;B;B	.|0.01281	.|0.0;0.0;0.0;0.0	T|T	0.26744|0.26744	-1.0094|-1.0094	5|10	.|0.02654	.|T	.|1	.|.	8.8093|8.8093	0.34956|0.34956	0.0:0.5814:0.0:0.4186|0.0:0.5814:0.0:0.4186	.|.	.|1166;1065;1226;561	.|A1A5A8;A1A5A9;Q9Y2K2;Q9Y2K2-2	.|.;.;SIK3_HUMAN;.	G|G	1325;1188|1284;1226;561;1166;1065	.|ENSP00000364449:S1284G;ENSP00000292055:S1226G;ENSP00000364437:S561G;ENSP00000438108:S1166G;ENSP00000415873:S1065G	.|ENSP00000292055:S1226G	E|S	-|-	2|1	0|0	SIK3|SIK3	116222438|116222438	0.561000|0.561000	0.26578|0.26578	0.405000|0.405000	0.26409|0.26409	0.996000|0.996000	0.88848|0.88848	0.821000|0.821000	0.27338|0.27338	0.012000|0.012000	0.14892|0.14892	0.533000|0.533000	0.62120|0.62120	GAG|AGT	.	.	.	none		0.517	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_025164	
ATN1	1822	hgsc.bcm.edu	37	12	7045900	7045900	+	Missense_Mutation	SNP	G	G	C	rs377147612|rs60216939		TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr12:7045900G>C	ENST00000356654.4	+	5	1707	c.1470G>C	c.(1468-1470)caG>caC	p.Q490H	ATN1_ENST00000396684.2_Missense_Mutation_p.Q490H	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	490	Poly-Gln.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						aacagcagcagcagcagcagc	0.642																																					p.Q490H		Atlas-SNP	.											.	ATN1	95	.	0			c.G1470C						PASS	.						50.0	62.0	58.0					12																	7045900		2202	4291	6493	SO:0001583	missense	1822	exon5			GCAGCAGCAGCAG	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1470G>C	chr12.hg19:g.7045900G>C	ENSP00000349076:p.Gln490His	18.0	0.0	.		43.0	7.0	.	NM_001007026	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	ENST00000356654.4	hg19	CCDS31734.1	.	.	.	.	.	.	.	.	.	.	g	0.018	-1.486452	0.01018	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.50277	0.75;0.75;0.75	2.95	-0.471	0.12119	.	.	.	.	.	T	0.19167	0.0460	N	0.08118	0	0.22412	N	0.999122	B	0.02656	0.0	B	0.04013	0.001	T	0.19614	-1.0300	9	0.15499	T	0.54	.	0.8057	0.01084	0.255:0.248:0.3392:0.1578	.	490	P54259	ATN1_HUMAN	H	490;490;490;75	ENSP00000349076:Q490H;ENSP00000379915:Q490H;ENSP00000441744:Q490H	ENSP00000229279:Q75H	Q	+	3	2	ATN1	6916161	0.012000	0.17670	0.065000	0.19835	0.080000	0.17528	0.084000	0.14891	0.105000	0.17753	-0.342000	0.07992	CAG	.	.	.	none		0.642	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
PLBD2	196463	hgsc.bcm.edu	37	12	113825565	113825565	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr12:113825565C>T	ENST00000280800.3	+	11	1487	c.1456C>T	c.(1456-1458)Cat>Tat	p.H486Y	PLBD2_ENST00000545182.2_Missense_Mutation_p.H454Y	NM_173542.3	NP_775813.2	Q8NHP8	PLBL2_HUMAN	phospholipase B domain containing 2	486					lipid catabolic process (GO:0016042)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						TGACTTCCTCCATGACCCTCT	0.592																																					p.H486Y		Atlas-SNP	.											.	PLBD2	33	.	0			c.C1456T						PASS	.						331.0	324.0	326.0					12																	113825565		2203	4300	6503	SO:0001583	missense	196463	exon11			TTCCTCCATGACC	BC030618	CCDS9168.1, CCDS53834.1	12q24.13	2013-10-11				ENSG00000151176			27283	protein-coding gene	gene with protein product	"""PLB homolog 2 (Dictyostelium)"", ""mannose-6-phosphate protein associated protein p76"""					17105447, 15193148, 19019078	Standard	NM_001159727		Approved	p76	uc001tve.2	Q8NHP8	OTTHUMG00000169567	ENST00000280800.3:c.1456C>T	chr12.hg19:g.113825565C>T	ENSP00000280800:p.His486Tyr	54.0	0.0	.		62.0	15.0	.	NM_173542	F5H5E2	Missense_Mutation	SNP	ENST00000280800.3	hg19	CCDS9168.1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.405656	0.42715	.	.	ENSG00000151176	ENST00000545182;ENST00000280800	T;T	0.17691	2.26;2.26	5.07	5.07	0.68467	.	0.296342	0.38272	N	0.001754	T	0.20577	0.0495	L	0.53249	1.67	0.28038	N	0.933883	B;B	0.29571	0.166;0.249	B;B	0.31495	0.063;0.131	T	0.12837	-1.0532	10	0.72032	D	0.01	-36.6143	14.5605	0.68133	0.1469:0.8531:0.0:0.0	.	454;486	F5H5E2;Q8NHP8	.;PLBL2_HUMAN	Y	454;486	ENSP00000443463:H454Y;ENSP00000280800:H486Y	ENSP00000280800:H486Y	H	+	1	0	PLBD2	112309948	0.977000	0.34250	0.996000	0.52242	0.981000	0.71138	1.463000	0.35277	2.533000	0.85409	0.555000	0.69702	CAT	.	.	.	none		0.592	PLBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404835.1	NM_173542	
SLC7A8	23428	hgsc.bcm.edu	37	14	23634614	23634615	+	Missense_Mutation	DNP	TC	TC	AT	rs371235147		TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr14:23634614_23634615TC>AT	ENST00000316902.7	-	3	1112_1113	c.387_388GA>AT	c.(385-390)gtGAtc>gtATtc	p.I130F	SLC7A8_ENST00000469263.1_Missense_Mutation_p.I130F	NM_012244.3	NP_036376.2	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 8	130					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)			autonomic_ganglia(1)|endometrium(6)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|skin(1)	24	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	GTGGGGTAGATCACCAGCACAG	0.629																																					p.I130F|p.V129V		Atlas-SNP	.											.	SLC7A8	54	.	0			c.A388T|c.G387A						PASS	.																																			SO:0001583	missense	23428	exon3			GGTAGATCACCAG|GTAGATCACCAGC	Y18483	CCDS9590.1, CCDS41924.1, CCDS58304.1, CCDS58305.1	14q11.2	2013-05-22	2011-07-12		ENSG00000092068	ENSG00000092068		"""Solute carriers"""	11066	protein-coding gene	gene with protein product		604235				10080183, 10391915	Standard	NM_001267036		Approved	LPI-PC1, LAT2	uc001wiz.4	Q9UHI5	OTTHUMG00000028720	ENST00000316902.7:c.387_388delinsAT	chr14.hg19:g.23634614_23634615delinsAT	ENSP00000320378:p.Ile130Phe	31.0|30.0	0.0	.		41.0	14.0	.	NM_012244	B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Missense_Mutation|Silent	SNP	ENST00000316902.7	hg19	CCDS9590.1																																																																																			.	.	.	alt|none		0.629	SLC7A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071718.3		
KIAA0391	9692	hgsc.bcm.edu	37	14	35735939	35735939	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr14:35735939A>G	ENST00000557565.1	+	6	1663	c.1282A>G	c.(1282-1284)Aat>Gat	p.N428D	KIAA0391_ENST00000604948.1_Missense_Mutation_p.N333D|KIAA0391_ENST00000534898.4_Missense_Mutation_p.N428D|KIAA0391_ENST00000605870.1_Missense_Mutation_p.N56D|KIAA0391_ENST00000603544.1_Missense_Mutation_p.N412D|KIAA0391_ENST00000321130.10_Missense_Mutation_p.N412D|KIAA0391_ENST00000250377.7_Missense_Mutation_p.N333D	NM_001282234.1	NP_001269163.1	O15091	MRRP3_HUMAN	KIAA0391	428					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)				central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)		TTAGCTCTTGAATGTCGTCTC	0.488																																					p.N428D		Atlas-SNP	.											.	KIAA0391	35	.	0			c.A1282G						PASS	.						179.0	173.0	175.0					14																	35735939		2203	4300	6503	SO:0001583	missense	9692	exon6			CTCTTGAATGTCG	AB002389	CCDS32063.1, CCDS58312.1, CCDS58313.1, CCDS58314.1	14q13.2	2013-06-18			ENSG00000100890	ENSG00000100890			19958	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 3"", ""proteinaceous RNase P"""	609947				9205841, 18984158	Standard	NM_001256678		Approved	MRPP3, PRORP	uc001wsy.2	O15091		ENST00000557565.1:c.1282A>G	chr14.hg19:g.35735939A>G	ENSP00000454657:p.Asn428Asp	135.0	0.0	.		172.0	59.0	.	NM_014672	B4DXD9|B4E0S8|B4E211|C4AM93|D3DS99|D3DSA1|Q86SZ4|Q86YB5|Q8N5L5	Missense_Mutation	SNP	ENST00000557565.1	hg19	CCDS32063.1	.	.	.	.	.	.	.	.	.	.	A	2.018	-0.425485	0.04701	.	.	ENSG00000100890	ENST00000554896;ENST00000250377;ENST00000321130;ENST00000534898;ENST00000556121;ENST00000556912;ENST00000557404	T;T;T;T	0.46063	0.88;0.9;0.9;0.99	5.62	-4.39	0.03611	.	1.007910	0.07948	N	0.980404	T	0.20088	0.0483	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.36648	-0.9739	10	0.11485	T	0.65	1.9621	12.9831	0.58575	0.6052:0.0:0.3948:0.0	.	412;428	O15091-2;O15091	.;MRRP3_HUMAN	D	333;333;412;428;412;56;56	ENSP00000250377:N333D;ENSP00000324697:N412D;ENSP00000440915:N428D;ENSP00000450898:N56D	ENSP00000250377:N333D	N	+	1	0	KIAA0391	34805690	0.521000	0.26258	0.002000	0.10522	0.342000	0.28953	0.425000	0.21346	-1.023000	0.03342	-0.248000	0.11899	AAT	.	.	.	none		0.488	KIAA0391-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000411280.1	NM_014672	
ARID4A	5926	hgsc.bcm.edu	37	14	58832872	58832872	+	Missense_Mutation	SNP	A	A	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr14:58832872A>T	ENST00000355431.3	+	22	3820	c.3447A>T	c.(3445-3447)aaA>aaT	p.K1149N	ARID4A_ENST00000348476.3_Intron|ARID4A_ENST00000395168.3_Intron|ARID4A_ENST00000431317.2_Intron	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	1149					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						CGCACATCAAAGATGGAGAGA	0.388																																					p.K1149N		Atlas-SNP	.											.	ARID4A	222	.	0			c.A3447T						PASS	.						154.0	163.0	160.0					14																	58832872		2203	4300	6503	SO:0001583	missense	5926	exon22			CATCAAAGATGGA	S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.3447A>T	chr14.hg19:g.58832872A>T	ENSP00000347602:p.Lys1149Asn	79.0	0.0	.		105.0	24.0	.	NM_002892	Q15991|Q15992|Q15993	Missense_Mutation	SNP	ENST00000355431.3	hg19	CCDS9732.1	.	.	.	.	.	.	.	.	.	.	A	19.90	3.913602	0.72983	.	.	ENSG00000032219	ENST00000355431	T	0.20200	2.09	5.12	3.97	0.46021	.	0.000000	0.85682	D	0.000000	T	0.41328	0.1154	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.23762	-1.0179	10	0.87932	D	0	-27.7345	9.6558	0.39925	0.8524:0.0:0.1476:0.0	.	1149	P29374	ARI4A_HUMAN	N	1149	ENSP00000347602:K1149N	ENSP00000347602:K1149N	K	+	3	2	ARID4A	57902625	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.682000	0.46934	0.890000	0.36211	0.528000	0.53228	AAA	.	.	.	none		0.388	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2	NM_023001	
GTF2A1	2957	hgsc.bcm.edu	37	14	81662499	81662499	+	Missense_Mutation	SNP	T	T	C	rs535983219		TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr14:81662499T>C	ENST00000553612.1	-	6	968	c.565A>G	c.(565-567)Ata>Gta	p.I189V	GTF2A1_ENST00000434192.2_Missense_Mutation_p.I150V	NM_001278940.1|NM_015859.3	NP_001265869.1|NP_056943.1	P52655	TF2AA_HUMAN	general transcription factor IIA, 1, 19/37kDa	189					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(234;0.0287)		ATTTGTGGTATAACCTGTTGT	0.428																																					p.I189V		Atlas-SNP	.											.	GTF2A1	34	.	0			c.A565G						PASS	.						182.0	163.0	169.0					14																	81662499		2203	4300	6503	SO:0001583	missense	2957	exon6			GTGGTATAACCTG	X75383	CCDS9873.1, CCDS9874.1	14q31	2010-03-23	2002-08-29					"""General transcription factors"""	4646	protein-coding gene	gene with protein product		600520	"""glucose regulated protein, 58kD pseudogene"""			8224848	Standard	NM_015859		Approved	TFIIA	uc001xvf.2	P52655		ENST00000553612.1:c.565A>G	chr14.hg19:g.81662499T>C	ENSP00000452454:p.Ile189Val	58.0	0.0	.		87.0	29.0	.	NM_015859	Q3KNQ9	Missense_Mutation	SNP	ENST00000553612.1	hg19	CCDS9873.1	.	.	.	.	.	.	.	.	.	.	T	10.86	1.470284	0.26423	.	.	ENSG00000165417	ENST00000553612;ENST00000344860;ENST00000434192	T;T	0.40756	1.02;1.02	5.38	5.38	0.77491	.	0.181773	0.47455	D	0.000232	T	0.37919	0.1021	L	0.46614	1.455	0.35724	D	0.817382	B	0.26445	0.149	B	0.29663	0.105	T	0.42378	-0.9455	10	0.16420	T	0.52	-13.0773	15.3865	0.74706	0.0:0.0:0.0:1.0	.	189	P52655	TF2AA_HUMAN	V	189;150;150	ENSP00000452454:I189V;ENSP00000409492:I150V	ENSP00000298173:I189V	I	-	1	0	GTF2A1	80732252	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.640000	0.61368	2.025000	0.59659	0.459000	0.35465	ATA	.	.	.	none		0.428	GTF2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413309.1	NM_015859	
SYNE3	161176	hgsc.bcm.edu	37	14	95903278	95903278	+	Missense_Mutation	SNP	A	A	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr14:95903278A>T	ENST00000334258.5	-	14	2431	c.2417T>A	c.(2416-2418)tTc>tAc	p.F806Y	SYNE3_ENST00000554873.1_Missense_Mutation_p.F563Y|SYNE3_ENST00000557275.1_Missense_Mutation_p.F801Y	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	806					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						GAGCTGGGAGAAATCTTCATG	0.517																																					p.F806Y		Atlas-SNP	.											.	SYNE3	130	.	0			c.T2417A						PASS	.						100.0	96.0	97.0					14																	95903278		2203	4300	6503	SO:0001583	missense	161176	exon14			TGGGAGAAATCTT	AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.2417T>A	chr14.hg19:g.95903278A>T	ENSP00000334308:p.Phe806Tyr	71.0	0.0	.		68.0	18.0	.	NM_152592	A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	ENST00000334258.5	hg19	CCDS9935.1	.	.	.	.	.	.	.	.	.	.	A	8.638	0.895334	0.17613	.	.	ENSG00000176438	ENST00000334258;ENST00000554873;ENST00000557275	T;T;T	0.12672	3.49;2.66;3.5	5.13	-6.79	0.01715	.	1.951040	0.02897	N	0.134895	T	0.07052	0.0179	L	0.40543	1.245	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	T	0.40683	-0.9550	10	0.02654	T	1	-0.2886	0.1537	0.00096	0.2263:0.2228:0.217:0.3339	.	801;806	Q6ZMZ3-2;Q6ZMZ3	.;SYNE3_HUMAN	Y	806;563;801	ENSP00000334308:F806Y;ENSP00000452154:F563Y;ENSP00000450562:F801Y	ENSP00000334308:F806Y	F	-	2	0	C14orf49	94973031	0.011000	0.17503	0.000000	0.03702	0.134000	0.20937	0.178000	0.16820	-1.516000	0.01782	0.459000	0.35465	TTC	.	.	.	none		0.517	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420529.2	NM_152592	
HERC2	8924	hgsc.bcm.edu	37	15	28437274	28437274	+	Missense_Mutation	SNP	G	G	C	rs543946257		TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr15:28437274G>C	ENST00000261609.7	-	53	8392	c.8284C>G	c.(8284-8286)Cgt>Ggt	p.R2762G		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.R2762G(3)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TTTCCAGAACGGCCACAAAAT	0.493											OREG0022997	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0008	0.0	5008	,	,		17962	0.0		0.0	False		,,,				2504	0.0				p.R2762G		Atlas-SNP	.											HERC2,colon,carcinoma,+2,3	HERC2	501	.	3	Substitution - Missense(3)	ovary(1)|NS(1)|central_nervous_system(1)	c.C8284G						PASS	.						97.0	96.0	96.0					15																	28437274		2203	4300	6503	SO:0001583	missense	8924	exon53			CAGAACGGCCACA	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.8284C>G	chr15.hg19:g.28437274G>C	ENSP00000261609:p.Arg2762Gly	38.0	0.0	.	801	60.0	13.0	.	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	hg19	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874685	0.72180	.	.	ENSG00000128731	ENST00000261609	T	0.62788	0.0	5.67	5.67	0.87782	Anaphase-promoting complex, subunit 10/DOC domain (1);Galactose-binding domain-like (1);	0.054132	0.85682	D	0.000000	T	0.77157	0.4089	L	0.53249	1.67	0.80722	D	1	D;D	0.69078	0.997;0.987	D;D	0.76071	0.987;0.953	T	0.77861	-0.2430	10	0.72032	D	0.01	.	19.7646	0.96335	0.0:0.0:1.0:0.0	.	229;2762	A8KAQ8;O95714	.;HERC2_HUMAN	G	2762	ENSP00000261609:R2762G	ENSP00000261609:R2762G	R	-	1	0	HERC2	26110869	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.808000	0.99193	2.675000	0.91044	0.471000	0.43371	CGT	.	.	.	none		0.493	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
CCPG1	9236	hgsc.bcm.edu	37	15	55652607	55652607	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr15:55652607G>C	ENST00000310958.6	-	8	1662	c.1364C>G	c.(1363-1365)gCa>gGa	p.A455G	CCPG1_ENST00000569205.1_Missense_Mutation_p.A455G|CCPG1_ENST00000442196.3_Missense_Mutation_p.A455G|DYX1C1-CCPG1_ENST00000565113.1_RNA|CCPG1_ENST00000425574.3_Intron	NM_001204450.1|NM_001204451.1|NM_004748.4|NM_020739.3	NP_001191379.1|NP_001191380.1|NP_004739.3|NP_065790.2	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1	455					cell cycle (GO:0007049)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001106)	integral component of membrane (GO:0016021)				autonomic_ganglia(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|stomach(3)	30				all cancers(107;0.0354)		TTGATCTTTTGCCTCAACATA	0.418																																					p.A455G		Atlas-SNP	.											.	CCPG1	74	.	0			c.C1364G						PASS	.						257.0	236.0	243.0					15																	55652607		1848	4104	5952	SO:0001583	missense	9236	exon8			TCTTTTGCCTCAA	AF212228	CCDS42039.1, CCDS55966.1, CCDS55967.1	15q21.1	2011-04-20				ENSG00000260916			24227	protein-coding gene	gene with protein product		611326				9383053, 10574462	Standard	NM_004748		Approved	KIAA1254, CPR8	uc010bfk.2	Q9ULG6		ENST00000310958.6:c.1364C>G	chr15.hg19:g.55652607G>C	ENSP00000311656:p.Ala455Gly	83.0	0.0	.		95.0	27.0	.	NM_020739	A0PJH3|A8K9T0|O14712|Q05DG4|Q5U5S7|Q8IYV8|Q9BY53|Q9HA17	Missense_Mutation	SNP	ENST00000310958.6	hg19	CCDS42039.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.382990	0.82792	.	.	ENSG00000256061	ENST00000310958;ENST00000442196	T;T	0.37058	1.22;1.22	5.93	5.93	0.95920	.	0.207171	0.50627	D	0.000102	T	0.59514	0.2199	M	0.63843	1.955	0.58432	D	0.999998	D;D;D;D	0.76494	0.998;0.999;0.998;0.999	D;D;D;D	0.70935	0.947;0.947;0.947;0.971	T	0.56823	-0.7915	10	0.56958	D	0.05	.	19.3421	0.94347	0.0:0.0:1.0:0.0	.	455;455;455;311	A8K9T0;Q9ULG6-4;Q9ULG6;Q9ULG6-2	.;.;CCPG1_HUMAN;.	G	455	ENSP00000311656:A455G;ENSP00000403400:A455G	ENSP00000311656:A455G	A	-	2	0	DYX1C1	53439899	1.000000	0.71417	0.999000	0.59377	0.959000	0.62525	3.604000	0.54081	2.826000	0.97356	0.655000	0.94253	GCA	.	.	.	none		0.418	CCPG1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419850.1	NM_004748	
SPESP1	246777	hgsc.bcm.edu	37	15	69238832	69238832	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr15:69238832C>T	ENST00000310673.3	+	2	1113	c.959C>T	c.(958-960)cCa>cTa	p.P320L	RP11-809H16.2_ENST00000557966.1_RNA|NOX5_ENST00000448182.3_Intron|NOX5_ENST00000455873.3_Intron|NOX5_ENST00000260364.5_Intron	NM_145658.3	NP_663633.1	Q6UW49	SPESP_HUMAN	sperm equatorial segment protein 1	320					acrosome reaction (GO:0007340)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organismal development (GO:0007275)	acrosomal vesicle (GO:0001669)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	19						AAATGTGTTCCACCAGAGATG	0.294																																					p.P320L		Atlas-SNP	.											.	SPESP1	39	.	0			c.C959T						PASS	.						51.0	58.0	56.0					15																	69238832		2172	4265	6437	SO:0001583	missense	246777	exon2			GTGTTCCACCAGA	AF275321	CCDS10230.1	15q22.31	2011-04-15				ENSG00000258484			15570	protein-coding gene	gene with protein product		609399				12773409	Standard	NM_145658		Approved	SP-ESP	uc002arn.2	Q6UW49		ENST00000310673.3:c.959C>T	chr15.hg19:g.69238832C>T	ENSP00000312284:p.Pro320Leu	80.0	0.0	.		99.0	30.0	.	NM_145658	Q8NG22|Q8WVH8	Missense_Mutation	SNP	ENST00000310673.3	hg19	CCDS10230.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.346513	0.61073	.	.	ENSG00000258484	ENST00000310673	T	0.24908	1.83	5.33	5.33	0.75918	.	0.000000	0.47455	D	0.000236	T	0.41719	0.1171	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.22487	-1.0215	10	0.87932	D	0	-14.4125	14.8728	0.70471	0.0:1.0:0.0:0.0	.	320	Q6UW49	SPESP_HUMAN	L	320	ENSP00000312284:P320L	ENSP00000312284:P320L	P	+	2	0	SPESP1	67025886	0.918000	0.31147	0.972000	0.41901	0.486000	0.33341	3.109000	0.50345	2.651000	0.90000	0.655000	0.94253	CCA	.	.	.	none		0.294	SPESP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257125.1	NM_145658	
CHSY1	22856	hgsc.bcm.edu	37	15	101718483	101718483	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr15:101718483G>A	ENST00000254190.3	-	3	1994	c.1519C>T	c.(1519-1521)Ctc>Ttc	p.L507F	CHSY1_ENST00000543813.1_5'UTR	NM_014918.4	NP_055733.2	Q86X52	CHSS1_HUMAN	chondroitin sulfate synthase 1	507					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of ossification (GO:0030279)|response to nutrient levels (GO:0031667)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(5)|skin(1)	24	Lung NSC(78;0.00217)|all_lung(78;0.00271)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GAGTTTGAGAGAAAGGACAAG	0.453																																					p.L507F		Atlas-SNP	.											.	CHSY1	60	.	0			c.C1519T						PASS	.						84.0	89.0	87.0					15																	101718483		2203	4300	6503	SO:0001583	missense	22856	exon3			TTGAGAGAAAGGA	AB023207	CCDS10390.1	15q26.3	2013-02-19	2008-01-24	2008-01-24	ENSG00000131873	ENSG00000131873	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	17198	protein-coding gene	gene with protein product		608183	"""carbohydrate (chondroitin) synthase 1"""			11514575	Standard	NM_014918		Approved	KIAA0990, CSS1	uc021sxt.1	Q86X52	OTTHUMG00000149873	ENST00000254190.3:c.1519C>T	chr15.hg19:g.101718483G>A	ENSP00000254190:p.Leu507Phe	65.0	0.0	.		69.0	19.0	.	NM_014918	Q6UX38|Q7LFU5|Q9Y2J5	Missense_Mutation	SNP	ENST00000254190.3	hg19	CCDS10390.1	.	.	.	.	.	.	.	.	.	.	G	9.498	1.102392	0.20632	.	.	ENSG00000131873	ENST00000254190;ENST00000543813	T	0.37411	1.2	5.69	5.69	0.88448	.	0.073492	0.53938	N	0.000046	T	0.26846	0.0657	N	0.25890	0.77	0.80722	D	1	B	0.18741	0.03	B	0.24006	0.05	T	0.06516	-1.0822	10	0.21540	T	0.41	-56.0537	13.0568	0.58984	0.0732:0.0:0.9268:0.0	.	507	Q86X52	CHSS1_HUMAN	F	507;235	ENSP00000254190:L507F	ENSP00000254190:L507F	L	-	1	0	CHSY1	99536006	1.000000	0.71417	0.966000	0.40874	0.457000	0.32468	4.748000	0.62148	2.676000	0.91093	0.655000	0.94253	CTC	.	.	.	none		0.453	CHSY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313624.1	NM_014918	
SRRM2	23524	hgsc.bcm.edu	37	16	2819139	2819139	+	Silent	SNP	C	C	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr16:2819139C>T	ENST00000301740.8	+	12	8424	c.7875C>T	c.(7873-7875)tcC>tcT	p.S2625S	AC092117.2_ENST00000581119.1_RNA|SRRM2_ENST00000574593.1_3'UTR	NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2625	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						cctcctcctcctcttcttcct	0.592																																					p.S2625S		Atlas-SNP	.											.	SRRM2	263	.	0			c.C7875T						PASS	.						141.0	121.0	128.0					16																	2819139		2198	4300	6498	SO:0001819	synonymous_variant	23524	exon12			CTCCTCCTCTTCT	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.7875C>T	chr16.hg19:g.2819139C>T		22.0	0.0	.		46.0	5.0	.	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	ENST00000301740.8	hg19	CCDS32373.1																																																																																			.	.	.	none		0.592	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
NLRC3	197358	hgsc.bcm.edu	37	16	3599167	3599167	+	RNA	SNP	C	C	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr16:3599167C>T	ENST00000301749.7	-	0	2983				NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000419350.2_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GTGCTGTTGGCGCAGAGGGCA	0.597																																					p.A860T		Atlas-SNP	.											NLRC3,colon,carcinoma,0,1	NLRC3	103	.	0			c.G2578A						PASS	.						36.0	39.0	38.0					16																	3599167		2092	4208	6300			197358	exon14			TGTTGGCGCAGAG	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		chr16.hg19:g.3599167C>T		55.0	0.0	.		105.0	26.0	.	NM_178844	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	ENST00000301749.7	hg19		.	.	.	.	.	.	.	.	.	.	C	0.013	-1.640859	0.00799	.	.	ENSG00000167984	ENST00000301749;ENST00000359128;ENST00000448023	T;T;T	0.52754	0.65;0.65;0.65	4.95	0.257	0.15574	.	0.860278	0.10393	N	0.680227	T	0.22975	0.0555	N	0.11364	0.135	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.04013	0.001;0.0	T	0.26395	-1.0104	10	0.10111	T	0.7	.	7.158	0.25649	0.0:0.3789:0.0:0.6211	.	860;906	Q7RTR2;C9JLH9	NLRC3_HUMAN;.	T	860;859;906	ENSP00000301749:A860T;ENSP00000352039:A859T;ENSP00000414415:A906T	ENSP00000301749:A860T	A	-	1	0	NLRC3	3539168	0.000000	0.05858	0.021000	0.16686	0.019000	0.09904	-0.096000	0.11059	-0.005000	0.14395	-1.287000	0.01368	GCC	.	.	.	none		0.597	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		NM_178844	
C16orf96	342346	hgsc.bcm.edu	37	16	4650116	4650116	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr16:4650116C>G	ENST00000444310.4	+	16	3224	c.3224C>G	c.(3223-3225)tCc>tGc	p.S1075C		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						TGCCCCCGCTCCAGTGCCTGC	0.627																																					p.S1075C		Atlas-SNP	.											.	C16orf96	28	.	0			c.C3224G						PASS	.						27.0	34.0	32.0					16																	4650116		692	1591	2283	SO:0001583	missense	342346	exon16			CCCGCTCCAGTGC		CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.3224C>G	chr16.hg19:g.4650116C>G	ENSP00000415027:p.Ser1075Cys	74.0	0.0	.		109.0	17.0	.	NM_001145011		Missense_Mutation	SNP	ENST00000444310.4	hg19	CCDS53986.1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.768671	0.31320	.	.	ENSG00000205832	ENST00000444310	T	0.62639	0.01	3.19	-3.05	0.05396	.	.	.	.	.	T	0.33469	0.0864	N	0.08118	0	0.09310	N	1	P	0.34546	0.456	B	0.34242	0.178	T	0.21930	-1.0231	9	0.56958	D	0.05	.	2.0531	0.03575	0.3125:0.2783:0.3069:0.1023	.	1075	A6NNT2	CP096_HUMAN	C	1075	ENSP00000415027:S1075C	ENSP00000415027:S1075C	S	+	2	0	C16orf96	4590117	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.658000	0.05329	-0.565000	0.06061	-0.398000	0.06409	TCC	.	.	.	none		0.627	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432384.1	NM_001145011	
NUDT16L1	84309	hgsc.bcm.edu	37	16	4744082	4744082	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr16:4744082T>A	ENST00000304301.6	+	2	290	c.257T>A	c.(256-258)cTg>cAg	p.L86Q	NUDT16L1_ENST00000586252.1_Missense_Mutation_p.L86Q|NUDT16L1_ENST00000405142.1_Missense_Mutation_p.L86Q|NUDT16L1_ENST00000586536.1_Missense_Mutation_p.L86Q	NM_032349.3	NP_115725.1	Q9BRJ7	SDOS_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1	86						cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			endometrium(1)|large_intestine(1)|lung(1)|skin(1)	4						GGCCTGGGCCTGGGCTGCCTG	0.721																																					p.L86Q		Atlas-SNP	.											.	NUDT16L1	13	.	0			c.T257A						PASS	.						17.0	21.0	19.0					16																	4744082		2185	4292	6477	SO:0001583	missense	84309	exon2			TGGGCCTGGGCTG	BC006223	CCDS10519.1, CCDS59257.1	16p13.3	2008-02-05			ENSG00000168101	ENSG00000168101		"""Nudix motif containing"""	28154	protein-coding gene	gene with protein product						11805099	Standard	NM_032349		Approved	SDOS	uc002cxe.3	Q9BRJ7	OTTHUMG00000129471	ENST00000304301.6:c.257T>A	chr16.hg19:g.4744082T>A	ENSP00000306670:p.Leu86Gln	36.0	0.0	.		75.0	34.0	.	NM_032349	Q8NAI2	Missense_Mutation	SNP	ENST00000304301.6	hg19	CCDS10519.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.362056	0.82353	.	.	ENSG00000168101	ENST00000304301;ENST00000405142	.	.	.	4.28	4.28	0.50868	NUDIX hydrolase domain-like (1);	0.305277	0.26499	N	0.024037	T	0.75064	0.3799	M	0.61703	1.905	0.45883	D	0.998732	D;D	0.89917	1.0;0.96	D;P	0.83275	0.996;0.463	T	0.77720	-0.2482	9	0.87932	D	0	.	12.2661	0.54679	0.0:0.0:0.0:1.0	.	86;86	Q9BRJ7-2;Q9BRJ7	.;SDOS_HUMAN	Q	86	.	ENSP00000306670:L86Q	L	+	2	0	NUDT16L1	4684083	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	2.439000	0.44846	1.583000	0.49898	0.528000	0.53228	CTG	.	.	.	none		0.721	NUDT16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251634.1	NM_032349	
CLEC18A	348174	hgsc.bcm.edu	37	16	69988435	69988436	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr16:69988435_69988436GG>AA	ENST00000288040.6	+	3	602_603	c.415_416GG>AA	c.(415-417)GGa>AAa	p.G139K	CLEC18A_ENST00000393701.2_Missense_Mutation_p.G139K|CLEC18A_ENST00000568461.1_Missense_Mutation_p.G139K|CLEC18A_ENST00000449317.2_Missense_Mutation_p.G139K	NM_001136214.2	NP_001129686.1	A5D8T8	CL18A_HUMAN	C-type lectin domain family 18, member A	139	SCP.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(2)|lung(1)|skin(1)	5						CCACGCGGCAGGAGAGTGTGCT	0.624																																					p.G139R|p.G139E		Atlas-SNP	.											.	CLEC18A	9	.	0			c.G415A|c.G416A						PASS	.																																			SO:0001583	missense	348174	exon4			GCGGCAGGAGAGT|CGGCAGGAGAGTG	AF428259	CCDS10886.1	16q22.1	2010-04-27	2009-03-10	2009-03-10		ENSG00000157322		"""C-type lectin domain containing"""	30388	protein-coding gene	gene with protein product	"""mannose receptor-like"""					12975309	Standard	NM_001136214		Approved	MRCL	uc010vlo.3	A5D8T8		Exception_encountered	chr16.hg19:g.69988435_69988436delinsAA	ENSP00000288040:p.Gly139Lys	222.0|220.0	0.0	.		284.0|283.0	51.0|52.0	.	NM_001271197	A8K1G9|Q6DCB3|Q7Z5K9|Q96HH2	Missense_Mutation	SNP	ENST00000288040.6	hg19	CCDS10886.1																																																																																			.	.	.	none		0.624	CLEC18A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268955.2	NM_182619	
HYDIN	54768	hgsc.bcm.edu	37	16	70977738	70977738	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr16:70977738G>T	ENST00000393567.2	-	42	6796	c.6646C>A	c.(6646-6648)Cag>Aag	p.Q2216K		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2216					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GCCAGGATCTGCACGAGAAGT	0.632																																					p.Q2216K		Atlas-SNP	.											.	HYDIN	788	.	0			c.C6646A						PASS	.						32.0	33.0	32.0					16																	70977738		2048	4193	6241	SO:0001583	missense	54768	exon42			GGATCTGCACGAG	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.6646C>A	chr16.hg19:g.70977738G>T	ENSP00000377197:p.Gln2216Lys	22.0	0.0	.		28.0	9.0	.	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	hg19	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	G	12.01	1.809392	0.31961	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.20598	2.06	4.95	3.92	0.45320	.	0.789986	0.09983	U	0.730756	T	0.21509	0.0518	L	0.51422	1.61	0.80722	D	1	P	0.37500	0.597	B	0.34722	0.188	T	0.06427	-1.0827	10	0.39692	T	0.17	.	12.555	0.56248	0.0:0.352:0.648:0.0	.	2215	F8WD23	.	K	2216;2215	ENSP00000377197:Q2216K	ENSP00000313052:Q2215K	Q	-	1	0	HYDIN	69535239	0.999000	0.42202	0.944000	0.38274	0.128000	0.20619	3.698000	0.54771	2.442000	0.82660	0.609000	0.83330	CAG	.	.	.	none		0.632	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
CHMP1A	5119	hgsc.bcm.edu	37	16	89715757	89715757	+	Splice_Site	SNP	A	A	G			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr16:89715757A>G	ENST00000397901.3	-	4	509		c.e4+1		CHMP1A_ENST00000550102.1_Intron|CHMP1A_ENST00000547614.1_Splice_Site|CHMP1A_ENST00000535997.2_Splice_Site|CHMP1A_ENST00000253475.5_Splice_Site	NM_002768.3	NP_002759.2	Q9HD42	CHM1A_HUMAN	charged multivesicular body protein 1A						cytokinesis (GO:0000910)|gene silencing (GO:0016458)|mitotic chromosome condensation (GO:0007076)|negative regulation of transcription by glucose (GO:0045014)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|proteolysis (GO:0006508)|transcription, DNA-templated (GO:0006351)|vesicle-mediated transport (GO:0016192)	condensed nuclear chromosome (GO:0000794)|early endosome (GO:0005769)|endomembrane system (GO:0012505)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|nuclear matrix (GO:0016363)	metallopeptidase activity (GO:0008237)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|ovary(1)	3		all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.048)		CCCAGCACTCACCCCCTTCAT	0.617																																					.		Atlas-SNP	.											.	CHMP1A	15	.	0			c.232+2T>C						PASS	.						102.0	119.0	113.0					16																	89715757		2180	4282	6462	SO:0001630	splice_region_variant	5119	exon4			GCACTCACCCCCT	U58048	CCDS45552.1	16q24.3	2011-09-21	2011-09-21	2007-03-20	ENSG00000131165	ENSG00000131165		"""Charged multivesicular body proteins"""	8740	protein-coding gene	gene with protein product		164010	"""procollagen (type III) N-endopeptidase"", ""chromatin modifying protein 1A"""	PRSM1, PCOLN3		11559748, 11559747	Standard	NM_002768		Approved	KIAA0047, CHMP1, Vps46A	uc002fnu.4	Q9HD42	OTTHUMG00000169521	ENST00000397901.3:c.252+1T>C	chr16.hg19:g.89715757A>G		46.0	0.0	.		66.0	19.0	.	NM_001083314	A2RU09|Q14468|Q15779|Q96G31	Splice_Site	SNP	ENST00000397901.3	hg19	CCDS45552.1	.	.	.	.	.	.	.	.	.	.	.	18.86	3.712432	0.68730	.	.	ENSG00000131165	ENST00000397901;ENST00000253475;ENST00000535997	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7909	0.78364	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CHMP1A	88243258	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	8.591000	0.90824	2.128000	0.65567	0.459000	0.35465	.	.	.	.	none		0.617	CHMP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404581.1	NM_002768	Intron
TMEM98	26022	hgsc.bcm.edu	37	17	31258638	31258638	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr17:31258638A>G	ENST00000579849.1	+	3	523	c.92A>G	c.(91-93)tAc>tGc	p.Y31C	TMEM98_ENST00000578289.1_Missense_Mutation_p.Y31C|TMEM98_ENST00000394642.3_Missense_Mutation_p.Y31C	NM_015544.2	NP_056359.2	Q9Y2Y6	TMM98_HUMAN	transmembrane protein 98	31						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(2)|large_intestine(1)	3		Ovarian(249;0.182)|Breast(31;0.244)	BRCA - Breast invasive adenocarcinoma(9;0.0769)			AGGCAGCGCTACTGCCGGCCG	0.552																																					p.Y31C		Atlas-SNP	.											TMEM98,NS,malignant_melanoma,0,1	TMEM98	23	.	0			c.A92G						PASS	.						96.0	74.0	82.0					17																	31258638		2203	4300	6503	SO:0001583	missense	26022	exon2			AGCGCTACTGCCG	CR605381	CCDS11274.1	17q11.2	2005-12-16			ENSG00000006042	ENSG00000006042			24529	protein-coding gene	gene with protein product		615949				11230166	Standard	NM_001301746		Approved	DKFZP564K1964	uc002hhr.3	Q9Y2Y6	OTTHUMG00000132882	ENST00000579849.1:c.92A>G	chr17.hg19:g.31258638A>G	ENSP00000463245:p.Tyr31Cys	88.0	0.0	.		151.0	69.0	.	NM_001033504	E1P631|Q9UFK2	Missense_Mutation	SNP	ENST00000579849.1	hg19	CCDS11274.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.199358	0.79015	.	.	ENSG00000006042	ENST00000394642;ENST00000261713;ENST00000395149;ENST00000439138	T;T;T;T	0.52057	0.68;0.8;0.78;0.7	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.54208	0.1844	L	0.32530	0.975	0.58432	D	0.999998	D	0.71674	0.998	P	0.62813	0.907	T	0.56366	-0.7991	10	0.59425	D	0.04	-5.672	12.5682	0.56322	1.0:0.0:0.0:0.0	.	31	Q9Y2Y6	TMM98_HUMAN	C	31	ENSP00000378138:Y31C;ENSP00000261713:Y31C;ENSP00000398446:Y31C;ENSP00000406394:Y31C	ENSP00000261713:Y31C	Y	+	2	0	TMEM98	28282751	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.376000	0.90138	1.289000	0.44618	0.655000	0.94253	TAC	.	.	.	none		0.552	TMEM98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256372.2	NM_015544	
VMP1	81671	hgsc.bcm.edu	37	17	57917269	57917269	+	Silent	SNP	A	A	G			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr17:57917269A>G	ENST00000262291.4	+	12	1528	c.1218A>G	c.(1216-1218)aaA>aaG	p.K406K	VMP1_ENST00000588617.1_3'UTR|VMP1_ENST00000537567.1_Silent_p.K272K|VMP1_ENST00000536180.1_Silent_p.K309K|VMP1_ENST00000539763.1_Silent_p.K214K|VMP1_ENST00000545362.1_Silent_p.K350K|MIR21_ENST00000362134.1_RNA	NM_030938.3	NP_112200.2	Q96GC9	VMP1_HUMAN	vacuole membrane protein 1	406					autophagy (GO:0006914)|cell junction assembly (GO:0034329)|embryo implantation (GO:0007566)|regulation of autophagy (GO:0010506)|single organismal cell-cell adhesion (GO:0016337)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|pre-autophagosomal structure (GO:0000407)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|skin(2)	16						AGAAAACTAAATAAGTAGAGA	0.418																																					p.K406K		Atlas-SNP	.											.	VMP1	49	.	0			c.A1218G						PASS	.						91.0	88.0	89.0					17																	57917269		2203	4300	6503	SO:0001819	synonymous_variant	81671	exon12			AACTAAATAAGTA		CCDS11619.1	17q23.1	2014-05-20	2011-03-02	2011-03-02	ENSG00000062716	ENSG00000062716			29559	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 3 homolog (C. elegans)"", ""transport and golgi organization 5 homolog (Drosophila)"""	611753	"""transmembrane protein 49"""	TMEM49		11230166, 11785947	Standard	NM_030938		Approved	EPG3, TANGO5	uc002ixu.4	Q96GC9	OTTHUMG00000179882	ENST00000262291.4:c.1218A>G	chr17.hg19:g.57917269A>G		79.0	0.0	.		173.0	15.0	.	NM_030938	B4DVV9|Q9H0P4|Q9P089	Silent	SNP	ENST00000262291.4	hg19	CCDS11619.1																																																																																			.	.	.	none		0.418	VMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448793.1	NM_030938	
COLEC12	81035	hgsc.bcm.edu	37	18	321780	321780	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr18:321780G>C	ENST00000400256.3	-	9	2298	c.2091C>G	c.(2089-2091)aaC>aaG	p.N697K	RP11-720L2.4_ENST00000580756.1_lincRNA	NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	697	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)	p.N697K(1)		cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				CATGACCCCAGTTATCCGGCT	0.443																																					p.N697K		Atlas-SNP	.											COLEC12,NS,NS,0,1	COLEC12	121	.	1	Substitution - Missense(1)	pancreas(1)	c.C2091G						PASS	.						126.0	131.0	129.0					18																	321780		2203	4300	6503	SO:0001583	missense	81035	exon9			ACCCCAGTTATCC	AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.2091C>G	chr18.hg19:g.321780G>C	ENSP00000383115:p.Asn697Lys	82.0	0.0	.		100.0	29.0	.	NM_130386	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Missense_Mutation	SNP	ENST00000400256.3	hg19	CCDS32782.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.957920	0.73902	.	.	ENSG00000158270	ENST00000400256	T	0.21361	2.01	5.68	4.8	0.61643	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.152725	0.56097	D	0.000026	T	0.46776	0.1410	M	0.90369	3.11	0.80722	D	1	D	0.56746	0.977	P	0.57776	0.827	T	0.55147	-0.8186	10	0.59425	D	0.04	-14.8511	11.0473	0.47865	0.1436:0.0:0.8564:0.0	.	697	Q5KU26	COL12_HUMAN	K	697	ENSP00000383115:N697K	ENSP00000383115:N697K	N	-	3	2	COLEC12	311780	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.866000	0.63005	1.375000	0.46248	0.563000	0.77884	AAC	.	.	.	none		0.443	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440746.1		
EID2	163126	hgsc.bcm.edu	37	19	40030283	40030283	+	Missense_Mutation	SNP	A	A	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr19:40030283A>T	ENST00000390658.2	-	1	587	c.437T>A	c.(436-438)cTt>cAt	p.L146H		NM_153232.3	NP_694964.3			EP300 interacting inhibitor of differentiation 2											large_intestine(2)|lung(1)|urinary_tract(1)	4	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;3.2e-25)|all cancers(26;8.83e-23)|LUSC - Lung squamous cell carcinoma(53;0.00281)			TAAAACGCTAAGTGGGTGGCG	0.592																																					p.L146H		Atlas-SNP	.											.	EID2	14	.	0			c.T437A						PASS	.						89.0	100.0	96.0					19																	40030283		1982	4149	6131	SO:0001583	missense	163126	exon1			ACGCTAAGTGGGT	BC030137	CCDS12540.2	19q13.2	2008-10-24	2006-10-12	2006-10-12	ENSG00000176396	ENSG00000176396			28292	protein-coding gene	gene with protein product		609773	"""CREBBP/EP300 inhibitory protein 2"", ""CREBBP/EP300 inhibitor 2"""	CRI2		14585496	Standard	NM_153232		Approved	EID-2, MGC20452	uc002oma.3	Q8N6I1	OTTHUMG00000074073	ENST00000390658.2:c.437T>A	chr19.hg19:g.40030283A>T	ENSP00000375073:p.Leu146His	43.0	0.0	.		68.0	25.0	.	NM_153232		Missense_Mutation	SNP	ENST00000390658.2	hg19	CCDS12540.2	.	.	.	.	.	.	.	.	.	.	.	16.21	3.057749	0.55325	.	.	ENSG00000176396	ENST00000390658;ENST00000539700	T	0.57107	0.42	3.71	2.69	0.31865	.	0.226724	0.22676	N	0.057002	T	0.58538	0.2129	L	0.50333	1.59	0.09310	N	1	D	0.76494	0.999	D	0.64237	0.923	T	0.47328	-0.9126	10	0.87932	D	0	.	5.5698	0.17190	0.8743:0.0:0.1257:0.0	.	146	Q8N6I1	EID2_HUMAN	H	146;97	ENSP00000375073:L146H	ENSP00000375073:L146H	L	-	2	0	EID2	44722123	0.078000	0.21339	0.003000	0.11579	0.103000	0.19146	2.696000	0.47052	0.797000	0.33971	0.445000	0.29226	CTT	.	.	.	none		0.592	EID2-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157251.1	NM_153232	
ETFB	2109	hgsc.bcm.edu	37	19	51857559	51857559	+	Nonsense_Mutation	SNP	G	G	A	rs374288379		TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr19:51857559G>A	ENST00000309244.4	-	2	152	c.61C>T	c.(61-63)Cga>Tga	p.R21*	ETFB_ENST00000354232.4_Nonsense_Mutation_p.R112*|CTD-2616J11.11_ENST00000600067.1_Missense_Mutation_p.P40L|CTD-2616J11.9_ENST00000600974.1_RNA	NM_001985.2	NP_001976.1	P38117	ETFB_HUMAN	electron-transfer-flavoprotein, beta polypeptide	21					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)			kidney(2)|large_intestine(1)|lung(3)	6		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000226)|OV - Ovarian serous cystadenocarcinoma(262;0.00661)		GGCTTCACTCGGATCTGCCCA	0.627																																					p.R112X		Atlas-SNP	.											.	ETFB	46	.	0			c.C334T						PASS	.	G	stop/ARG,stop/ARG	0,4406		0,0,2203	79.0	67.0	71.0		334,61	4.2	1.0	19		71	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained,stop-gained	ETFB	NM_001014763.1,NM_001985.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	112/347,21/256	51857559	1,13005	2203	4300	6503	SO:0001587	stop_gained	2109	exon1			TCACTCGGATCTG	X71129	CCDS12828.1, CCDS33085.1	19q13.3-q13.4	2008-02-05				ENSG00000105379			3482	protein-coding gene	gene with protein product		130410					Standard	NM_001014763		Approved		uc002pwg.3	P38117		ENST00000309244.4:c.61C>T	chr19.hg19:g.51857559G>A	ENSP00000311930:p.Arg21*	37.0	0.0	.		37.0	8.0	.	NM_001014763	A8K766|B3KNY2|Q6IBH7|Q71RF6|Q9Y3S7	Nonsense_Mutation	SNP	ENST00000309244.4	hg19	CCDS12828.1	.	.	.	.	.	.	.	.	.	.	g	36	5.716959	0.96830	0.0	1.16E-4	ENSG00000105379	ENST00000309244;ENST00000354232	.	.	.	5.22	4.17	0.49024	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.901	0.58125	0.0:0.0:0.8361:0.1639	.	.	.	.	X	21;112	.	ENSP00000311930:R21X	R	-	1	2	ETFB	56549371	1.000000	0.71417	0.991000	0.47740	0.168000	0.22595	5.166000	0.64965	1.194000	0.43101	-0.187000	0.12897	CGA	.	.	.	weak		0.627	ETFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464273.1		
ZNF841	284371	hgsc.bcm.edu	37	19	52568431	52568431	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr19:52568431C>T	ENST00000426391.2	-	5	2907	c.2356G>A	c.(2356-2358)Gag>Aag	p.E786K	ZNF841_ENST00000389534.4_Missense_Mutation_p.E902K|CTC-471J1.2_ENST00000569091.1_RNA|ZNF841_ENST00000594295.1_Missense_Mutation_p.E902K|ZNF432_ENST00000598446.1_Intron|ZNF841_ENST00000359973.2_Missense_Mutation_p.E478K			Q6ZN19	ZN841_HUMAN	zinc finger protein 841	786					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(3)|lung(3)	11						GTAAGGTTCTCTCCAGCATGT	0.363																																					p.E902K		Atlas-SNP	.											.	ZNF841	183	.	0			c.G2704A						PASS	.						259.0	217.0	230.0					19																	52568431		692	1591	2283	SO:0001583	missense	284371	exon7			GGTTCTCTCCAGC	AK131409	CCDS46161.1	19q13.41	2013-01-08			ENSG00000197608	ENSG00000197608		"""Zinc fingers, C2H2-type"", ""-"""	27611	protein-coding gene	gene with protein product							Standard	NM_001136499		Approved	LOC284371	uc010ydh.1	Q6ZN19		ENST00000426391.2:c.2356G>A	chr19.hg19:g.52568431C>T	ENSP00000415453:p.Glu786Lys	156.0	0.0	.		194.0	59.0	.	NM_001136499	B9EG58|Q6ZN82|Q6ZP71|Q8N9U7	Missense_Mutation	SNP	ENST00000426391.2	hg19		.	.	.	.	.	.	.	.	.	.	C	19.00	3.742051	0.69418	.	.	ENSG00000197608	ENST00000389534;ENST00000426391;ENST00000359973	T;T;T	0.08370	3.49;3.31;3.1	1.69	-1.02	0.10135	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09024	0.0223	N	0.08118	0	0.21740	N	0.999565	D;P;P	0.63046	0.992;0.525;0.911	D;B;P	0.67548	0.952;0.022;0.78	T	0.29549	-1.0008	9	0.59425	D	0.04	.	4.9331	0.13926	0.0:0.6374:0.2172:0.1454	.	902;478;786	Q6ZN19-3;Q6ZN19-2;Q6ZN19	.;.;ZN841_HUMAN	K	902;786;478	ENSP00000374185:E902K;ENSP00000415453:E786K;ENSP00000353060:E478K	ENSP00000353060:E478K	E	-	1	0	ZNF841	57260243	0.000000	0.05858	0.001000	0.08648	0.480000	0.33159	0.344000	0.19962	-0.398000	0.07679	0.313000	0.20887	GAG	.	.	.	none		0.363	ZNF841-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000462435.1	XM_209155	
LAMA5	3911	hgsc.bcm.edu	37	20	60904037	60904037	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr20:60904037G>A	ENST00000252999.3	-	34	4376	c.4310C>T	c.(4309-4311)cCa>cTa	p.P1437L		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	1437	Domain IV 1 (domain IV B).				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCAGCCACATGGACGGGCTCC	0.632																																					p.P1437L		Atlas-SNP	.											.	LAMA5	268	.	0			c.C4310T						PASS	.						56.0	58.0	57.0					20																	60904037		2203	4297	6500	SO:0001583	missense	3911	exon34			CCACATGGACGGG	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.4310C>T	chr20.hg19:g.60904037G>A	ENSP00000252999:p.Pro1437Leu	51.0	0.0	.		67.0	15.0	.	NM_005560	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	hg19	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	G	17.60	3.429028	0.62844	.	.	ENSG00000130702	ENST00000252999	T	0.21191	2.02	4.47	4.47	0.54385	.	0.000000	0.85682	D	0.000000	T	0.44540	0.1298	M	0.78049	2.395	0.80722	D	1	D	0.69078	0.997	D	0.64687	0.928	T	0.48681	-0.9014	10	0.72032	D	0.01	.	13.0337	0.58859	0.0:0.0:0.838:0.162	.	1437	O15230	LAMA5_HUMAN	L	1437	ENSP00000252999:P1437L	ENSP00000252999:P1437L	P	-	2	0	LAMA5	60337432	1.000000	0.71417	0.016000	0.15963	0.513000	0.34164	5.138000	0.64795	2.001000	0.58596	0.455000	0.32223	CCA	.	.	.	none		0.632	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
MICAL3	57553	hgsc.bcm.edu	37	22	18347671	18347671	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr22:18347671T>A	ENST00000441493.2	-	19	2951	c.2599A>T	c.(2599-2601)Acc>Tcc	p.T867S	MICAL3_ENST00000400561.2_Missense_Mutation_p.T867S|MICAL3_ENST00000585038.1_Missense_Mutation_p.T991S|MICAL3_ENST00000444520.1_Missense_Mutation_p.T867S|MICAL3_ENST00000383094.3_Missense_Mutation_p.T867S|MICAL3_ENST00000429452.1_Missense_Mutation_p.T991S|MICAL3_ENST00000414725.2_Missense_Mutation_p.T895S|MICAL3_ENST00000207726.7_Missense_Mutation_p.T895S	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	867					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		CTACCTGGGGTTCTCTCAGTG	0.602																																					p.T991S		Atlas-SNP	.											.	MICAL3	53	.	0			c.A2971T						PASS	.						92.0	89.0	90.0					22																	18347671		1568	3582	5150	SO:0001583	missense	57553	exon23			CTGGGGTTCTCTC	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.2599A>T	chr22.hg19:g.18347671T>A	ENSP00000416015:p.Thr867Ser	62.0	0.0	.		83.0	26.0	.	NM_001136004	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	hg19	CCDS46659.1	.	.	.	.	.	.	.	.	.	.	T	10.23	1.293575	0.23564	.	.	ENSG00000093100;ENSG00000093100;ENSG00000243156;ENSG00000243156;ENSG00000243156;ENSG00000243156;ENSG00000243156	ENST00000441493;ENST00000429452;ENST00000400561;ENST00000444520;ENST00000414725;ENST00000383094;ENST00000207726	T;T;T;T;T;T;T	0.66638	-0.02;-0.22;-0.11;-0.11;-0.1;-0.12;-0.1	5.72	4.68	0.58851	.	0.901642	0.09446	N	0.801150	T	0.41558	0.1164	N	0.11927	0.2	0.19945	N	0.999943	P;B;B;B;B	0.34546	0.456;0.0;0.0;0.0;0.0	B;B;B;B;B	0.31614	0.133;0.001;0.001;0.001;0.001	T	0.31558	-0.9939	10	0.02654	T	1	.	7.0794	0.25223	0.133:0.0762:0.0:0.7908	.	991;895;867;867;867	B2RXJ5;Q7RTP6-3;Q7RTP6-2;Q7RTP6-4;Q7RTP6	.;.;.;.;MICA3_HUMAN	S	867;991;867;867;895;867;895	ENSP00000416015:T867S;ENSP00000414846:T991S;ENSP00000383406:T867S;ENSP00000410315:T867S;ENSP00000391827:T895S;ENSP00000372574:T867S;ENSP00000207726:T895S	ENSP00000207726:T895S	T	-	1	0	XXbac-B461K10.4;MICAL3	16727671	0.999000	0.42202	0.926000	0.36857	0.664000	0.39144	1.693000	0.37742	0.970000	0.38263	0.533000	0.62120	ACC	.	.	.	none		0.602	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
MYO18B	84700	hgsc.bcm.edu	37	22	26351226	26351226	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr22:26351226C>T	ENST00000407587.2	+	39	6224	c.6055C>T	c.(6055-6057)Cgg>Tgg	p.R2019W	MYO18B_ENST00000536101.1_Missense_Mutation_p.R2018W|MYO18B_ENST00000335473.7_Missense_Mutation_p.R2018W			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2018	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GTCCCAGCAGCGGGAGAGCAG	0.662																																					p.R2018W		Atlas-SNP	.											.	MYO18B	322	.	0			c.C6052T						PASS	.						19.0	25.0	23.0					22																	26351226		1941	4143	6084	SO:0001583	missense	84700	exon39			CAGCAGCGGGAGA	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.6055C>T	chr22.hg19:g.26351226C>T	ENSP00000386096:p.Arg2019Trp	46.0	0.0	.		94.0	25.0	.	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	hg19		.	.	.	.	.	.	.	.	.	.	C	16.13	3.036701	0.54896	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.87729	-2.26;-2.26;-2.29	4.86	0.906	0.19314	.	0.256362	0.29355	N	0.012391	D	0.86560	0.5962	L	0.40543	1.245	0.34839	D	0.740504	D;D;D;D;D	0.71674	0.998;0.997;0.997;0.998;0.998	P;P;P;P;P	0.55713	0.782;0.61;0.61;0.721;0.782	D	0.89330	0.3646	10	0.87932	D	0	.	12.3547	0.55167	0.6837:0.3163:0.0:0.0	.	1531;2020;2018;2019;2018	Q8IUG5-2;B0QYF5;Q8IUG5;F5GXR6;F5GYU7	.;.;MY18B_HUMAN;.;.	W	2018;2018;2019	ENSP00000441229:R2018W;ENSP00000334563:R2018W;ENSP00000386096:R2019W	ENSP00000334563:R2018W	R	+	1	2	MYO18B	24681226	1.000000	0.71417	0.998000	0.56505	0.218000	0.24690	1.990000	0.40717	0.548000	0.28955	-0.293000	0.09583	CGG	.	.	.	none		0.662	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
FRRS1	391059	hgsc.bcm.edu	37	1	100214136	100214149	+	Frame_Shift_Del	DEL	CTGATCTCCTGGCC	CTGATCTCCTGGCC	-			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	CTGATCTCCTGGCC	CTGATCTCCTGGCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr1:100214136_100214149delCTGATCTCCTGGCC	ENST00000414213.1	-	3	777_790	c.176_189delGGCCAGGAGATCAG	c.(175-189)aggccaggagatcagfs	p.RPGDQ59fs	FRRS1_ENST00000287474.5_Frame_Shift_Del_p.RPGDQ59fs			Q6ZNA5	FRRS1_HUMAN	ferric-chelate reductase 1	59	Reelin. {ECO:0000255|PROSITE- ProRule:PRU00363}.					integral component of membrane (GO:0016021)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	26		all_epithelial(167;2.09e-06)|all_lung(203;0.000435)|Lung NSC(277;0.00201)		Epithelial(280;0.0718)|all cancers(265;0.126)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.206)		TACCTTCAATCTGATCTCCTGGCCTGAATGTCAT	0.374																																					p.59_64del		Atlas-Indel,Pindel	.											.	FRRS1	50	.	0			c.177_190del						PASS	.																																			SO:0001589	frameshift_variant	391059	exon3			.	AK131302	CCDS30780.1	1p21.3	2009-11-30	2006-02-22	2006-02-22	ENSG00000156869	ENSG00000156869			27622	protein-coding gene	gene with protein product		611578	"""stromal cell derived factor receptor 2 homolog (mouse)"""	SDFR2			Standard	NM_001013660		Approved	SDR2	uc001dsh.1	Q6ZNA5	OTTHUMG00000010768	ENST00000414213.1:c.176_189delGGCCAGGAGATCAG	chr1.hg19:g.100214136_100214149delCTGATCTCCTGGCC	ENSP00000393884:p.Arg59fs	95.0	0.0	0		131.0	19.0	0.145038	NM_001013660	A6NLN7	Frame_Shift_Del	DEL	ENST00000414213.1	hg19																																																																																				.	.	.	none		0.374	FRRS1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001013660	
TSHZ2	128553	hgsc.bcm.edu	37	20	51871518	51871519	+	Frame_Shift_Ins	INS	-	-	GATG			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr20:51871518_51871519insGATG	ENST00000371497.5	+	2	2408_2409	c.1521_1522insGATG	c.(1522-1524)gatfs	p.-509fs	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Frame_Shift_Ins_p.-506fs|TSHZ2_ENST00000603338.2_Frame_Shift_Ins_p.-506fs	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2						multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D508H(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			AAGACTTGGAAGATGGCTCAAA	0.455																																					p.E507fs		Atlas-Indel,Pindel	.											.	TSHZ2	209	.	1	Substitution - Missense(1)	lung(1)	c.1521_1522insGATG						PASS	.																																			SO:0001589	frameshift_variant	128553	exon2			.	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.1522_1525dupGATG	chr20.hg19:g.51871519_51871522dupGATG	ENSP00000360552:p.Gly509fs	64.0	0.0	0		58.0	11.0	0.189655	NM_173485	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Frame_Shift_Ins	INS	ENST00000371497.5	hg19	CCDS33490.1																																																																																			.	.	.	none		0.455	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
CPA1	1357	hgsc.bcm.edu	37	7	130021580	130021594	+	In_Frame_Del	DEL	ATGAGACCATGATCG	ATGAGACCATGATCG	-			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	ATGAGACCATGATCG	ATGAGACCATGATCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr7:130021580_130021594delATGAGACCATGATCG	ENST00000011292.3	+	3	407_421	c.257_271delATGAGACCATGATCG	c.(256-273)tatgagaccatgatcgag>tag	p.86_91YETMIE>*	CPA1_ENST00000484324.1_Start_Codon_Del	NM_001868.2	NP_001859.1	P15085	CBPA1_HUMAN	carboxypeptidase A1 (pancreatic)	86					proteolysis (GO:0006508)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(18;0.0435)					GGCATCAGCTATGAGACCATGATCGAGGACGTGCA	0.637											OREG0018314	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.86_90del		Atlas-INDEL	.											.	CPA1	73	.	0			c.256_270del						PASS	.																																			SO:0001651	inframe_deletion	1357	exon3			.		CCDS5820.1	7q32	2012-02-10			ENSG00000091704	ENSG00000091704	3.4.17.1		2296	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase A"""	114850		CPA			Standard	NM_001868		Approved		uc003vpx.3	P15085	OTTHUMG00000157826	ENST00000011292.3:c.257_271delATGAGACCATGATCG	chr7.hg19:g.130021580_130021594delATGAGACCATGATCG	ENSP00000011292:p.Tyr86_Glu91delins*	63.0	0.0	0	1576	76.0	14.0	0.184211	NM_001868	A4D1M1|Q53XU0|Q9BS67|Q9UCF2	In_Frame_Del	DEL	ENST00000011292.3	hg19	CCDS5820.1																																																																																			.	.	.	none		0.637	CPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349736.2	NM_001868	
FZD7	8324	hgsc.bcm.edu	37	2	202900385	202900386	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr2:202900385_202900386delCT	ENST00000286201.1	+	1	1076_1077	c.1015_1016delCT	c.(1015-1017)ctcfs	p.L339fs	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	339					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						CTGCACCATCCTCTTCATGGTG	0.629											OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.338_339del		Atlas-Indel,Pindel	.											.	FZD7	70	.	0			c.1014_1015del						PASS	.																																			SO:0001589	frameshift_variant	8324	exon1			.	AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.1015_1016delCT	chr2.hg19:g.202900387_202900388delCT	ENSP00000286201:p.Leu339fs	80.0	0.0	0	2133	82.0	12.0	0.146341	NM_003507	O94816|Q53S59|Q96B74	Frame_Shift_Del	DEL	ENST00000286201.1	hg19	CCDS2351.1																																																																																			.	.	.	none		0.629	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256314.1	NM_003507	
EP300	2033	hgsc.bcm.edu	37	22	41545134	41545134	+	Frame_Shift_Del	DEL	A	A	-	rs374281264	byFrequency	TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr22:41545134delA	ENST00000263253.7	+	13	3553	c.2334delA	c.(2332-2334)acafs	p.T778fs		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	778					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						TGAATGTAACAAATATCCCTT	0.453			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.T778fs		Atlas-Indel,Pindel	.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300	367	.	0			c.2333delC						PASS	.						143.0	123.0	129.0					22																	41545134		2203	4300	6503	SO:0001589	frameshift_variant	2033	exon13	Familial Cancer Database	Broad Thumb-Hallux syndrome	.	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.2334delA	chr22.hg19:g.41545134delA	ENSP00000263253:p.Thr778fs	121.0	0.0	0		193.0	58.0	0.300518	NM_001429	B1AKC2	Frame_Shift_Del	DEL	ENST00000263253.7	hg19	CCDS14010.1																																																																																			.	.	.	none		0.453	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
OR6C75	390323	hgsc.bcm.edu	37	12	55759766	55759767	+	Frame_Shift_Ins	INS	-	-	A			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr12:55759766_55759767insA	ENST00000343399.3	+	1	872_873	c.872_873insA	c.(871-876)agaaatfs	p.N292fs		NM_001005497.1	NP_001005497.1	A6NL08	O6C75_HUMAN	olfactory receptor, family 6, subfamily C, member 75	292						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)	25						TACACACTGAGAAATAAGCAAG	0.391																																					p.R291fs		Atlas-Indel,Pindel	.											.	OR6C75	67	.	0			c.872_873insA						PASS	.																																			SO:0001589	frameshift_variant	390323	exon1			.		CCDS31820.1	12q13.2	2013-09-23			ENSG00000187857	ENSG00000187857		"""GPCR / Class A : Olfactory receptors"""	31304	protein-coding gene	gene with protein product							Standard	NM_001005497		Approved		uc010spk.2	A6NL08	OTTHUMG00000169886	ENST00000343399.3:c.875dupA	chr12.hg19:g.55759769_55759769dupA	ENSP00000368987:p.Asn292fs	53.0	0.0	0		60.0	18.0	0.3	NM_001005497		Frame_Shift_Ins	INS	ENST00000343399.3	hg19	CCDS31820.1																																																																																			.	.	.	none		0.391	OR6C75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406418.1		
C16orf13	84326	hgsc.bcm.edu	37	16	684782	684782	+	Frame_Shift_Del	DEL	C	C	-			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr16:684782delC	ENST00000301686.8	-	5	515	c.504delG	c.(502-504)gggfs	p.G168fs	C16orf13_ENST00000397666.2_Frame_Shift_Del_p.A146fs|C16orf13_ENST00000338401.4_Frame_Shift_Del_p.G71fs|C16orf13_ENST00000397664.4_Frame_Shift_Del_p.G91fs|C16orf13_ENST00000397665.2_Frame_Shift_Del_p.A126fs	NM_032366.3	NP_115742.3	Q96S19	CP013_HUMAN	chromosome 16 open reading frame 13	168										large_intestine(1)	1		Hepatocellular(780;0.00335)				TGTCCCGAAGCCCCCATTCTG	0.677																																					p.L169fs		Atlas-Indel,Pindel	.											.	C16orf13	11	.	0			c.505delC						PASS	.						32.0	35.0	34.0					16																	684782		2192	4295	6487	SO:0001589	frameshift_variant	84326	exon5			.		CCDS32352.1, CCDS42090.1, CCDS42091.1, CCDS45367.1, CCDS45368.1, CCDS73798.1	16p13.3	2012-10-09			ENSG00000130731	ENSG00000130731			14141	protein-coding gene	gene with protein product							Standard	NM_001040160		Approved	MGC13114	uc002chw.1	Q96S19	OTTHUMG00000047855	ENST00000301686.8:c.504delG	chr16.hg19:g.684782delC	ENSP00000445926:p.Gly168fs	22.0	0.0	0		57.0	12.0	0.210526	NM_032366	A8MTR1|A8MWJ8|A8MZA1|B4DG95|B4DIJ3|D6REA6|F6TF62|F6VM53|Q96IW1|Q96MD6	Frame_Shift_Del	DEL	ENST00000301686.8	hg19	CCDS45368.1																																																																																			.	.	.	none		0.677	C16orf13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109081.2	NM_001040160	
KIAA1244	57221	hgsc.bcm.edu	37	6	138615192	138615194	+	In_Frame_Del	DEL	TGA	TGA	-			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	TGA	TGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr6:138615192_138615194delTGA	ENST00000251691.4	+	20	3597_3599	c.3431_3433delTGA	c.(3430-3435)ctgaag>cag	p.1144_1145LK>Q		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		CTTTACCAGCTGAAGAAAGCATC	0.424																																					p.1144_1144del		Atlas-Indel,Pindel	.											.	KIAA1244	236	.	0			c.3430_3432del						PASS	.																																			SO:0001651	inframe_deletion	57221	exon20			.	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.3431_3433delTGA	chr6.hg19:g.138615192_138615194delTGA	ENSP00000251691:p.Leu1144_Lys1145delinsGln	89.0	0.0	0		121.0	28.0	0.231405	NM_020340		In_Frame_Del	DEL	ENST00000251691.4	hg19	CCDS5189.2																																																																																			.	.	.	none		0.424	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
WDR81	124997	hgsc.bcm.edu	37	17	1629728	1629728	+	Frame_Shift_Del	DEL	T	T	-			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr17:1629728delT	ENST00000409644.1	+	1	1475	c.1475delT	c.(1474-1476)attfs	p.I492fs	WDR81_ENST00000446363.1_Intron|WDR81_ENST00000309182.5_Intron|RP11-961A15.1_ENST00000576540.1_RNA|WDR81_ENST00000437219.2_Intron|WDR81_ENST00000419248.1_Intron	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	492	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GATGAGTGCATTCCGGAGTTC	0.632																																					p.I492fs		Atlas-Indel,Pindel	.											.	WDR81	180	.	0			c.1474delA						PASS	.						25.0	27.0	26.0					17																	1629728		692	1585	2277	SO:0001589	frameshift_variant	124997	exon1			.	AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.1475delT	chr17.hg19:g.1629728delT	ENSP00000386609:p.Ile492fs	73.0	0.0	0		93.0	44.0	0.473118	NM_001163809	B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Frame_Shift_Del	DEL	ENST00000409644.1	hg19	CCDS54062.1																																																																																			.	.	.	none		0.632	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333118.2	NM_152348	
HLA-DOB	3112	hgsc.bcm.edu	37	6	32783066	32783067	+	Frame_Shift_Ins	INS	-	-	C			TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr6:32783066_32783067insC	ENST00000438763.2	-	2	211_212	c.115_116insG	c.(115-117)gctfs	p.A39fs	TAP2_ENST00000452392.2_Intron	NM_002120.3	NP_002111.1	P13765	DOB_HUMAN	major histocompatibility complex, class II, DO beta	39	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|negative regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002587)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|MHC class II protein complex (GO:0042613)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)			endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	9						GTAACAGTCAGCCTTTGCCTGA	0.46																																					p.A39fs		Atlas-Indel,Pindel	.											.	HLA-DOB	17	.	0			c.116_117insG						PASS	.																																			SO:0001589	frameshift_variant	3112	exon2			.		CCDS4754.1	6p21.3	2013-01-11			ENSG00000241106	ENSG00000241106		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4937	protein-coding gene	gene with protein product		600629					Standard	NM_002120		Approved			P13765	OTTHUMG00000031213	ENST00000438763.2:c.116dupG	chr6.hg19:g.32783068_32783068dupC	ENSP00000390020:p.Ala39fs	88.0	0.0	0		121.0	35.0	0.289256	NM_002120	B0V0Y0|Q29746|Q29825|Q6FHC2	Frame_Shift_Ins	INS	ENST00000438763.2	hg19	CCDS4754.1																																																																																			.	.	.	none		0.460	HLA-DOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076439.1	NM_002120	
RALGAPA2	57186	hgsc.bcm.edu	37	20	20392748	20392749	+	Frame_Shift_Ins	INS	-	-	GGTTCTGAATTATTGCTTCGAGATACAG	rs535510713		TCGA-Y8-A898-01A-11D-A34Z-10	TCGA-Y8-A898-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c71a07f-83ad-4612-a896-217d2fde9904	b87bb919-a7fb-44d5-a76a-872cb44c2dc0	g.chr20:20392748_20392749insGGTTCTGAATTATTGCTTCGAGATACAG	ENST00000202677.7	-	38	5546_5547	c.5539_5540insCTGTATCTCGAAGCAATAATTCAGAACC	c.(5539-5541)cacfs	p.H1847fs		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	1847					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						TACTTCGCGGTGGTTCTGAATT	0.49																																					p.H1847fs		Pindel	.											.	RALGAPA2	274	.	0			c.5540_5541insCTGTATCTCGAAGCAATAATTCAGAACC						PASS	.																																			SO:0001589	frameshift_variant	57186	exon38			.	AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.5512_5539dupCTGTATCTCGAAGCAATAATTCAGAACC	chr20.hg19:g.20392748_20392749insGGTTCTGAATTATTGCTTCGAGATACAG	ENSP00000202677:p.His1847fs	74.0	0.0	.		89.0	11.0	0.124	NM_020343	Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Frame_Shift_Ins	INS	ENST00000202677.7	hg19	CCDS46584.1																																																																																			.	.	.	none		0.490	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471941.1	NM_020343	
