#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TEKT2	27285	hgsc.bcm.edu	37	1	36553152	36553152	+	Missense_Mutation	SNP	A	A	T			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr1:36553152A>T	ENST00000207457.3	+	8	1095	c.968A>T	c.(967-969)tAc>tTc	p.Y323F	ADPRHL2_ENST00000373178.4_5'Flank	NM_014466.2	NP_055281.2	Q9UIF3	TEKT2_HUMAN	tektin 2 (testicular)	323					cell projection organization (GO:0030030)|inner dynein arm assembly (GO:0036159)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|pancreas(1)|skin(2)	13		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GCCAGAACCTACCGGCCCAAC	0.617																																					p.Y323F		Atlas-SNP	.											.	TEKT2	32	.	0			c.A968T						PASS	.						41.0	48.0	45.0					1																	36553152		2203	4300	6503	SO:0001583	missense	27285	exon8			GAACCTACCGGCC	AB033823	CCDS401.1	1p34.3	2008-02-05			ENSG00000092850	ENSG00000092850			11725	protein-coding gene	gene with protein product		608953				12029069, 11751288	Standard	NM_014466		Approved	TEKTB1	uc001bzr.3	Q9UIF3	OTTHUMG00000007629	ENST00000207457.3:c.968A>T	chr1.hg19:g.36553152A>T	ENSP00000207457:p.Tyr323Phe	275.0	0.0	.		213.0	85.0	.	NM_014466	A6NIS6|O60638	Missense_Mutation	SNP	ENST00000207457.3	hg19	CCDS401.1	.	.	.	.	.	.	.	.	.	.	A	14.51	2.557648	0.45590	.	.	ENSG00000092850	ENST00000207457	T	0.02579	4.24	5.4	1.66	0.24008	.	0.609329	0.18043	N	0.153548	T	0.04182	0.0116	L	0.42245	1.32	0.30668	N	0.75363	P	0.52316	0.952	P	0.52386	0.697	T	0.22836	-1.0205	10	0.11485	T	0.65	.	5.9945	0.19487	0.7415:0.0:0.1373:0.1212	.	323	Q9UIF3	TEKT2_HUMAN	F	323	ENSP00000207457:Y323F	ENSP00000207457:Y323F	Y	+	2	0	TEKT2	36325739	0.898000	0.30612	0.999000	0.59377	0.992000	0.81027	1.330000	0.33781	0.329000	0.23460	0.460000	0.39030	TAC	.	.	.	none		0.617	TEKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020200.1	NM_014466	
RIMKLA	284716	hgsc.bcm.edu	37	1	42875853	42875853	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr1:42875853C>T	ENST00000431473.3	+	4	809	c.680C>T	c.(679-681)tCt>tTt	p.S227F		NM_173642.3	NP_775913.2	Q8IXN7	RIMKA_HUMAN	ribosomal modification protein rimK-like family member A	227	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|N-acetyl-L-aspartate-L-glutamate ligase activity (GO:0072590)			NS(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	13						AGCAACTGCTCTCTCGGTAAG	0.512																																					p.S227F		Atlas-SNP	.											.	RIMKLA	32	.	0			c.C680T						PASS	.						86.0	85.0	85.0					1																	42875853		2203	4300	6503	SO:0001583	missense	284716	exon4			ACTGCTCTCTCGG	BC039737	CCDS466.2	1p34.2	2011-09-21	2008-10-13	2008-10-13	ENSG00000177181	ENSG00000177181	6.3.2.N6		28725	protein-coding gene	gene with protein product	"""N-acetylaspartylglutamate synthetase II"""		"""family with sequence similarity 80, member A"""	FAM80A		20657015, 21454531	Standard	NM_173642		Approved	MGC47816, RP11-157D18.1, NAAGS-II	uc001chi.2	Q8IXN7	OTTHUMG00000007335	ENST00000431473.3:c.680C>T	chr1.hg19:g.42875853C>T	ENSP00000414330:p.Ser227Phe	83.0	0.0	.		63.0	19.0	.	NM_173642	Q5VUS5	Missense_Mutation	SNP	ENST00000431473.3	hg19	CCDS466.2	.	.	.	.	.	.	.	.	.	.	C	15.40	2.823247	0.50739	.	.	ENSG00000177181	ENST00000431473	.	.	.	5.74	4.82	0.62117	ATP-grasp fold (1);ATP-grasp fold, RimK-type (1);ATP-grasp fold, subdomain 2 (1);	0.171847	0.53938	N	0.000060	T	0.63873	0.2548	M	0.87900	2.915	0.44469	D	0.9974	B	0.13145	0.007	B	0.20577	0.03	T	0.61941	-0.6959	8	.	.	.	-5.9282	7.5817	0.27970	0.0:0.744:0.1669:0.0891	.	227	Q8IXN7	RIMKA_HUMAN	F	227	.	.	S	+	2	0	RIMKLA	42648440	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.316000	0.59178	1.402000	0.46780	0.650000	0.86243	TCT	.	.	.	none		0.512	RIMKLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019174.3	NM_173642	
MAST2	23139	hgsc.bcm.edu	37	1	46501468	46501468	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr1:46501468T>A	ENST00000361297.2	+	29	5410	c.5127T>A	c.(5125-5127)agT>agA	p.S1709R	MAST2_ENST00000372009.2_Missense_Mutation_p.S1519R	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					AGCCACCTAGTGCCCCCAGAC	0.582																																					p.S1709R		Atlas-SNP	.											.	MAST2	136	.	0			c.T5127A						PASS	.						58.0	66.0	63.0					1																	46501468		1967	4153	6120	SO:0001583	missense	23139	exon29			ACCTAGTGCCCCC	AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.5127T>A	chr1.hg19:g.46501468T>A	ENSP00000354671:p.Ser1709Arg	207.0	0.0	.		156.0	62.0	.	NM_015112		Missense_Mutation	SNP	ENST00000361297.2	hg19	CCDS41326.1	.	.	.	.	.	.	.	.	.	.	t	9.412	1.080872	0.20309	.	.	ENSG00000086015	ENST00000361297;ENST00000372009	T;T	0.66280	-0.11;-0.2	5.67	1.86	0.25419	.	2.019210	0.01799	N	0.032797	T	0.49406	0.1555	N	0.24115	0.695	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.11329	0.006;0.006	T	0.42327	-0.9458	10	0.59425	D	0.04	1.5002	4.9458	0.13989	0.0:0.1837:0.1615:0.6549	.	1519;1709	E7ERL6;Q6P0Q8	.;MAST2_HUMAN	R	1709;1519	ENSP00000354671:S1709R;ENSP00000361079:S1519R	ENSP00000354671:S1709R	S	+	3	2	MAST2	46274055	0.000000	0.05858	0.009000	0.14445	0.492000	0.33523	0.007000	0.13174	0.981000	0.38548	0.454000	0.30748	AGT	.	.	.	none		0.582	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	NM_015112	
L1TD1	54596	hgsc.bcm.edu	37	1	62675664	62675664	+	Missense_Mutation	SNP	G	G	T	rs200931139|rs532563709		TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr1:62675664G>T	ENST00000498273.1	+	4	1513	c.1218G>T	c.(1216-1218)gaG>gaT	p.E406D	Y_RNA_ENST00000363304.1_RNA	NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	406	Glu-rich.									breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						Tggaggaggaggaggaagagc	0.547																																					p.E406D		Atlas-SNP	.											.,1	L1TD1	114	.	0			c.G1218T						PASS	.						36.0	40.0	39.0					1																	62675664		2200	4298	6498	SO:0001583	missense	54596	exon5			GGAGGAGGAGGAA	BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.1218G>T	chr1.hg19:g.62675664G>T	ENSP00000419901:p.Glu406Asp	132.0	0.0	.		169.0	38.0	.	NM_001164835	Q8NDA1|Q9NUV8|Q9NV78	Missense_Mutation	SNP	ENST00000498273.1	hg19	CCDS619.1	.	.	.	.	.	.	.	.	.	.	G	7.766	0.706401	0.15239	.	.	ENSG00000240563	ENST00000498273	T	0.18810	2.19	3.4	-2.4	0.06583	.	.	.	.	.	T	0.07683	0.0193	N	0.12182	0.205	0.09310	N	1	B	0.15473	0.013	B	0.11329	0.006	T	0.38001	-0.9681	9	0.15952	T	0.53	.	0.3571	0.00358	0.2201:0.167:0.2729:0.34	.	406	Q5T7N2	LITD1_HUMAN	D	406	ENSP00000419901:E406D	ENSP00000419901:E406D	E	+	3	2	L1TD1	62448252	0.053000	0.20554	0.000000	0.03702	0.031000	0.12232	0.041000	0.13927	-0.479000	0.06813	0.448000	0.29417	GAG	.	.	.	alt		0.547	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024688.1	NM_019079	
APH1A	51107	hgsc.bcm.edu	37	1	150239509	150239509	+	Missense_Mutation	SNP	A	A	T			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr1:150239509A>T	ENST00000369109.3	-	5	763	c.575T>A	c.(574-576)cTg>cAg	p.L192Q	C1orf54_ENST00000369102.1_5'Flank|APH1A_ENST00000461320.1_5'UTR|APH1A_ENST00000360244.4_Missense_Mutation_p.L192Q|APH1A_ENST00000414276.2_Missense_Mutation_p.L122Q	NM_001077628.2	NP_001071096.1	Q96BI3	APH1A_HUMAN	APH1A gamma secretase subunit	192					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|metanephros development (GO:0001656)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			breast(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	9	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCCAACCACCAGGCCCAAAGC	0.537																																					p.L192Q		Atlas-SNP	.											.	APH1A	21	.	0			c.T575A						PASS	.						89.0	92.0	91.0					1																	150239509		1983	4183	6166	SO:0001583	missense	51107	exon5			ACCACCAGGCCCA	AF151835	CCDS41390.1, CCDS41391.1, CCDS58025.1	1q21.2	2013-05-01	2013-05-01		ENSG00000117362	ENSG00000117362			29509	protein-coding gene	gene with protein product		607629	"""anterior pharynx defective 1 homolog A (C. elegans)"""			10810093, 12110170	Standard	NM_001077628		Approved	APH-1A, CGI-78	uc001ety.2	Q96BI3	OTTHUMG00000012545	ENST00000369109.3:c.575T>A	chr1.hg19:g.150239509A>T	ENSP00000358105:p.Leu192Gln	188.0	0.0	.		189.0	67.0	.	NM_016022	B4DQK0|Q5TB22|Q5TB23|Q969R6|Q9BVG0|Q9Y386	Missense_Mutation	SNP	ENST00000369109.3	hg19	CCDS41390.1	.	.	.	.	.	.	.	.	.	.	A	14.46	2.542455	0.45280	.	.	ENSG00000117362	ENST00000369109;ENST00000360244;ENST00000414276;ENST00000236017	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.18	5.18	0.71444	.	0.292176	0.26658	N	0.023175	T	0.47229	0.1434	L	0.60455	1.87	0.33621	D	0.604855	P;D;D;P;P;P	0.71674	0.791;0.973;0.998;0.897;0.916;0.952	P;P;D;P;P;P	0.63488	0.5;0.761;0.915;0.648;0.761;0.761	T	0.52230	-0.8603	10	0.51188	T	0.08	-5.2965	13.2852	0.60239	1.0:0.0:0.0:0.0	.	76;135;122;192;192;192	B4DMX8;B4DUG7;B4DQK0;Q96BI3-2;Q5TB22;Q96BI3	.;.;.;.;.;APH1A_HUMAN	Q	192;192;122;135	ENSP00000358105:L192Q;ENSP00000353380:L192Q;ENSP00000397473:L122Q;ENSP00000236017:L135Q	ENSP00000236017:L135Q	L	-	2	0	APH1A	148506133	0.142000	0.22610	1.000000	0.80357	0.995000	0.86356	1.200000	0.32247	2.297000	0.77311	0.533000	0.62120	CTG	.	.	.	none		0.537	APH1A-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000035048.1	NM_016022	
TMEM79	84283	hgsc.bcm.edu	37	1	156261269	156261269	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr1:156261269G>C	ENST00000405535.2	+	4	1236	c.1065G>C	c.(1063-1065)tgG>tgC	p.W355C	TMEM79_ENST00000295694.5_Missense_Mutation_p.W355C|TMEM79_ENST00000357501.2_Missense_Mutation_p.E117Q|TMEM79_ENST00000495881.1_3'UTR|C1orf85_ENST00000482579.1_5'Flank	NM_032323.2	NP_115699.1	Q9BSE2	TMM79_HUMAN	transmembrane protein 79	355					cornification (GO:0070268)|cuticle development (GO:0042335)|epithelial cell maturation (GO:0002070)|establishment of skin barrier (GO:0061436)|hair follicle morphogenesis (GO:0031069)|positive regulation of epidermis development (GO:0045684)|regulated secretory pathway (GO:0045055)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|urinary_tract(1)	21	Hepatocellular(266;0.158)					TGCTGATGTGGAACCTCTACT	0.632																																					p.W355C		Atlas-SNP	.											.	TMEM79	43	.	0			c.G1065C						PASS	.						141.0	132.0	135.0					1																	156261269		2203	4300	6503	SO:0001583	missense	84283	exon4			GATGTGGAACCTC	BC005094	CCDS1138.1	1q22	2014-04-22			ENSG00000163472	ENSG00000163472			28196	protein-coding gene	gene with protein product	"""mattrin"""	615531					Standard	NM_032323		Approved	MGC13102, FLJ16057, FLJ32254, MATT	uc009wrw.3	Q9BSE2	OTTHUMG00000019788	ENST00000405535.2:c.1065G>C	chr1.hg19:g.156261269G>C	ENSP00000384748:p.Trp355Cys	70.0	0.0	.		50.0	19.0	.	NM_032323	B2RE22|D3DVB8	Missense_Mutation	SNP	ENST00000405535.2	hg19	CCDS1138.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.12|12.12	1.844054|1.844054	0.32606|0.32606	.|.	.|.	ENSG00000163472|ENSG00000163472	ENST00000357501;ENST00000456810|ENST00000295694;ENST00000405535	.|T;T	.|0.48201	.|0.82;0.82	5.7|5.7	4.78|4.78	0.61160|0.61160	.|.	.|0.368304	.|0.30374	.|N	.|0.009780	T|T	0.25717|0.25717	0.0626|0.0626	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	.|P	.|0.42941	.|0.794	.|B	.|0.43052	.|0.406	T|T	0.06058|0.06058	-1.0848|-1.0848	6|10	0.87932|0.41790	D|T	0|0.15	-3.2299|-3.2299	12.6166|12.6166	0.56580|0.56580	0.0:0.0:0.6985:0.3015|0.0:0.0:0.6985:0.3015	.|.	.|355	.|Q9BSE2	.|TMM79_HUMAN	Q|C	117|355	.|ENSP00000295694:W355C;ENSP00000384748:W355C	ENSP00000350100:E117Q|ENSP00000295694:W355C	E|W	+|+	1|3	0|0	TMEM79|TMEM79	154527893|154527893	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.325000|0.325000	0.28411|0.28411	4.330000|4.330000	0.59266|0.59266	1.390000|1.390000	0.46547|0.46547	-0.181000|-0.181000	0.13052|0.13052	GAA|TGG	.	.	.	none		0.632	TMEM79-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052101.1	NM_032323	
POU2F1	5451	hgsc.bcm.edu	37	1	167343522	167343522	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr1:167343522C>T	ENST00000541643.3	+	7	673	c.511C>T	c.(511-513)Cag>Tag	p.Q171*	POU2F1_ENST00000367866.2_Nonsense_Mutation_p.Q194*|POU2F1_ENST00000367865.1_3'UTR|POU2F1_ENST00000367862.5_Nonsense_Mutation_p.Q183*|POU2F1_ENST00000452019.1_Nonsense_Mutation_p.Q171*|POU2F1_ENST00000429375.2_Intron|POU2F1_ENST00000420254.3_Nonsense_Mutation_p.Q171*			P14859	PO2F1_HUMAN	POU class 2 homeobox 1	171					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						TCAGCCCATACAGATCGCACA	0.532																																					p.Q194X		Atlas-SNP	.											.	POU2F1	120	.	0			c.C580T						PASS	.						26.0	27.0	26.0					1																	167343522		2203	4300	6503	SO:0001587	stop_gained	5451	exon6			CCCATACAGATCG	BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.511C>T	chr1.hg19:g.167343522C>T	ENSP00000441285:p.Gln171*	201.0	0.0	.		199.0	82.0	.	NM_002697	B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Nonsense_Mutation	SNP	ENST00000541643.3	hg19		.	.	.	.	.	.	.	.	.	.	C	38	6.800924	0.97849	.	.	ENSG00000143190	ENST00000367866;ENST00000452019;ENST00000492850;ENST00000367865;ENST00000420254;ENST00000541643;ENST00000367862;ENST00000443275	.	.	.	5.77	5.77	0.91146	.	0.232564	0.28952	N	0.013612	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	20.0589	0.97667	0.0:1.0:0.0:0.0	.	.	.	.	X	194;171;48;169;171;171;183;79	.	ENSP00000356836:Q183X	Q	+	1	0	POU2F1	165610146	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	7.453000	0.80700	2.732000	0.93576	0.650000	0.86243	CAG	.	.	.	none		0.532	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_002697	
QSOX1	5768	hgsc.bcm.edu	37	1	180148011	180148011	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr1:180148011G>C	ENST00000367602.3	+	5	672	c.598G>C	c.(598-600)Ggt>Cgt	p.G200R	QSOX1_ENST00000367600.5_Missense_Mutation_p.G200R			O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1	200			G -> A (in dbSNP:rs17855475). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16806532, ECO:0000269|Ref.4}.		cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	flavin-linked sulfhydryl oxidase activity (GO:0016971)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						CTCCTACCTGGGTAGAGAGGT	0.507											OREG0014018	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G200R		Atlas-SNP	.											.	QSOX1	79	.	0			c.G598C						PASS	.						100.0	104.0	103.0					1																	180148011		2203	4300	6503	SO:0001583	missense	5768	exon5			TACCTGGGTAGAG	U97276	CCDS1337.1, CCDS30950.1	1q24	2008-02-05	2007-04-23	2007-04-23	ENSG00000116260	ENSG00000116260			9756	protein-coding gene	gene with protein product		603120	"""quiescin Q6"""	QSCN6		9878249, 8396966	Standard	NM_002826		Approved		uc001gnz.3	O00391	OTTHUMG00000035256	ENST00000367602.3:c.598G>C	chr1.hg19:g.180148011G>C	ENSP00000356574:p.Gly200Arg	74.0	0.0	.	1959	57.0	19.0	.	NM_002826	Q59G29|Q5T2X0|Q8TDL6|Q8WVP4	Missense_Mutation	SNP	ENST00000367602.3	hg19	CCDS1337.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.026464	0.93518	.	.	ENSG00000116260	ENST00000367602;ENST00000367600	T;T	0.08807	3.08;3.05	5.91	5.91	0.95273	.	0.144731	0.64402	D	0.000007	T	0.36744	0.0978	M	0.89287	3.02	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.15809	-1.0424	10	0.56958	D	0.05	-15.3101	17.2153	0.86941	0.0:0.0:1.0:0.0	.	200;200	O00391;O00391-2	QSOX1_HUMAN;.	R	200	ENSP00000356574:G200R;ENSP00000356572:G200R	ENSP00000356572:G200R	G	+	1	0	QSOX1	178414634	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.654000	0.83653	2.793000	0.96121	0.655000	0.94253	GGT	.	.	.	none		0.507	QSOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085289.1	NM_002826	
M1AP	130951	hgsc.bcm.edu	37	2	74802619	74802619	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr2:74802619C>T	ENST00000290536.5	-	7	1136	c.1020G>A	c.(1018-1020)tgG>tgA	p.W340*	M1AP_ENST00000358434.2_Nonsense_Mutation_p.W58*|M1AP_ENST00000464686.1_5'UTR|M1AP_ENST00000536235.1_Nonsense_Mutation_p.W340*|M1AP_ENST00000409585.1_Nonsense_Mutation_p.W340*	NM_001281296.1|NM_138804.3	NP_001268225.1|NP_620159.2	Q8TC57	M1AP_HUMAN	meiosis 1 associated protein	340					cell differentiation (GO:0030154)|chromatin assembly (GO:0031497)|female gamete generation (GO:0007292)|male meiosis chromosome separation (GO:0051308)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)											CCAGCTCATCCCAGTCCAGCT	0.478																																					p.W340X		Atlas-SNP	.											.	.	.	.	0			c.G1020A						PASS	.						126.0	117.0	120.0					2																	74802619		2203	4300	6503	SO:0001587	stop_gained	130951	exon7			CTCATCCCAGTCC		CCDS33229.1, CCDS62941.1	2p13.1	2013-02-05	2013-02-05	2013-01-16	ENSG00000159374	ENSG00000159374			25183	protein-coding gene	gene with protein product	"""meiosis 1 arresting protein"", ""spermatogenesis associated 37"""		"""chromosome 2 open reading frame 65"""	C2orf65		16881047, 23269666	Standard	NM_138804		Approved	D6Mm5e, SPATA37	uc002smy.3	Q8TC57	OTTHUMG00000152918	ENST00000290536.5:c.1020G>A	chr2.hg19:g.74802619C>T	ENSP00000290536:p.Trp340*	86.0	0.0	.		80.0	30.0	.	NM_138804	B7Z6E7|E9PGG8|Q6ZP30|Q96L07	Nonsense_Mutation	SNP	ENST00000290536.5	hg19	CCDS33229.1	.	.	.	.	.	.	.	.	.	.	C	36	5.900307	0.97081	.	.	ENSG00000159374	ENST00000290536;ENST00000409585;ENST00000536235;ENST00000358434	.	.	.	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.4491	13.5676	0.61828	0.0:1.0:0.0:0.0	.	.	.	.	X	340;340;340;58	.	ENSP00000290536:W340X	W	-	3	0	C2orf65	74656127	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.201000	0.72124	2.550000	0.86006	0.655000	0.94253	TGG	.	.	.	none		0.478	M1AP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328569.1	NM_138804	
ACVR2A	92	hgsc.bcm.edu	37	2	148677844	148677844	+	Silent	SNP	T	T	A			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr2:148677844T>A	ENST00000241416.7	+	8	1644	c.1008T>A	c.(1006-1008)gcT>gcA	p.A336A	ACVR2A_ENST00000404590.1_Silent_p.A336A|ACVR2A_ENST00000535787.1_Silent_p.A228A	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	336	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		ACCTGACAGCTTGCATTGCTG	0.348																																					p.A336A		Atlas-SNP	.											.	ACVR2A	125	.	0			c.T1008A						PASS	.						93.0	97.0	96.0					2																	148677844		2203	4300	6503	SO:0001819	synonymous_variant	92	exon8			GACAGCTTGCATT		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.1008T>A	chr2.hg19:g.148677844T>A		149.0	0.0	.		95.0	30.0	.	NM_001616	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Silent	SNP	ENST00000241416.7	hg19	CCDS33301.1																																																																																			.	.	.	none		0.348	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
CRYGD	1421	hgsc.bcm.edu	37	2	208988981	208988981	+	Missense_Mutation	SNP	G	G	A	rs200234608		TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr2:208988981G>A	ENST00000264376.4	-	2	134	c.107C>T	c.(106-108)gCg>gTg	p.A36V		NM_006891.3	NP_008822.2	P07320	CRGD_HUMAN	crystallin, gamma D	36	Beta/gamma crystallin 'Greek key' 1. {ECO:0000255|PROSITE-ProRule:PRU00028}.				cellular response to reactive oxygen species (GO:0034614)|lens development in camera-type eye (GO:0002088)|lens fiber cell differentiation (GO:0070306)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)			breast(1)|endometrium(1)|lung(3)	5				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.0858)|Lung(261;0.133)		GTCCACGCGCGCCGAGTTGCA	0.652																																					p.A36V		Atlas-SNP	.											CRYGD,NS,neuroblastoma,0,1	CRYGD	18	.	0			c.C107T						PASS	.						11.0	13.0	12.0					2																	208988981		2179	4274	6453	SO:0001583	missense	1421	exon2			ACGCGCGCCGAGT		CCDS2378.1	2q33.3	2013-02-14			ENSG00000118231	ENSG00000118231			2411	protein-coding gene	gene with protein product		123690		CRYG4			Standard	NM_006891		Approved		uc002vcn.4	P07320	OTTHUMG00000132944	ENST00000264376.4:c.107C>T	chr2.hg19:g.208988981G>A	ENSP00000264376:p.Ala36Val	146.0	0.0	.		125.0	5.0	.	NM_006891	Q17RF7|Q53R51|Q99681	Missense_Mutation	SNP	ENST00000264376.4	hg19	CCDS2378.1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.627591	0.28978	.	.	ENSG00000118231	ENST00000264376	T	0.72051	-0.62	4.35	3.19	0.36642	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.184420	0.36703	N	0.002444	T	0.29389	0.0732	N	0.00166	-1.94	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.34875	-0.9811	10	0.32370	T	0.25	.	8.1681	0.31239	0.9021:0.0:0.0979:0.0	.	36	P07320	CRGD_HUMAN	V	36	ENSP00000264376:A36V	ENSP00000264376:A36V	A	-	2	0	CRYGD	208697226	0.280000	0.24249	0.067000	0.19924	0.966000	0.64601	2.073000	0.41519	0.695000	0.31675	-0.573000	0.04149	GCG	.	G|0.998;A|0.002	0.002	weak		0.652	CRYGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256476.2	NM_006891	
CTDSP1	58190	hgsc.bcm.edu	37	2	219268024	219268024	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr2:219268024T>A	ENST00000273062.2	+	6	877	c.541T>A	c.(541-543)Tgc>Agc	p.C181S	CTDSP1_ENST00000443891.1_Missense_Mutation_p.C180S|MIR26B_ENST00000362251.2_RNA|CTDSP1_ENST00000488627.1_3'UTR	NM_021198.2|NM_182642.2	NP_067021.1|NP_872580.1	Q9GZU7	CTDS1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1	181	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.				negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|protein dephosphorylation (GO:0006470)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			NS(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	8		Renal(207;0.0915)		Epithelial(149;9.96e-07)|all cancers(144;0.00017)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCGAGAGTCCTGCGTCTTCCA	0.632																																					p.C181S		Atlas-SNP	.											.	CTDSP1	19	.	0			c.T541A						PASS	.						56.0	65.0	62.0					2																	219268024		2203	4300	6503	SO:0001583	missense	58190	exon6			GAGTCCTGCGTCT	AF229162	CCDS2416.1, CCDS56166.1	2q35	2010-06-21			ENSG00000144579	ENSG00000144579		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	21614	protein-coding gene	gene with protein product	"""nuclear LIM interactor-interacting factor"", ""small CTD phosphatase 1"""	605323				11950066, 12721286	Standard	NM_021198		Approved	NLIIF, SCP1	uc021vwv.1	Q9GZU7	OTTHUMG00000133109	ENST00000273062.2:c.541T>A	chr2.hg19:g.219268024T>A	ENSP00000273062:p.Cys181Ser	94.0	0.0	.		68.0	30.0	.	NM_021198	C9IYG0|Q7Z5Q3|Q7Z5Q4	Missense_Mutation	SNP	ENST00000273062.2	hg19	CCDS2416.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.013625	0.75161	.	.	ENSG00000144579	ENST00000443891;ENST00000273062	T;T	0.20463	2.07;2.07	4.64	3.45	0.39498	NLI interacting factor (3);Dullard phosphatase domain, eukaryotic (1);HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.56202	0.1969	H	0.96239	3.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.63829	-0.6548	10	0.87932	D	0	-31.262	9.6028	0.39615	0.1571:0.0:0.0:0.8429	.	181;180	Q9GZU7;C9IYG0	CTDS1_HUMAN;.	S	180;181	ENSP00000392248:C180S;ENSP00000273062:C181S	ENSP00000273062:C181S	C	+	1	0	CTDSP1	218976268	1.000000	0.71417	0.227000	0.23927	0.942000	0.58702	7.985000	0.88162	0.607000	0.29982	0.402000	0.26972	TGC	.	.	.	none		0.632	CTDSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256774.1	NM_182642, NM_021198	
NBEAL2	23218	hgsc.bcm.edu	37	3	47038846	47038846	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr3:47038846C>T	ENST00000450053.3	+	19	2926	c.2747C>T	c.(2746-2748)aCg>aTg	p.T916M	NBEAL2_ENST00000292309.5_Missense_Mutation_p.T916M|NBEAL2_ENST00000383740.2_5'UTR	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	916					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CCAGCTGAAACGCATGACCTC	0.577																																					p.T916M		Atlas-SNP	.											.	NBEAL2	267	.	0			c.C2747T						PASS	.						44.0	49.0	47.0					3																	47038846		2046	4200	6246	SO:0001583	missense	23218	exon19			CTGAAACGCATGA	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.2747C>T	chr3.hg19:g.47038846C>T	ENSP00000415034:p.Thr916Met	22.0	0.0	.		15.0	7.0	.	NM_015175	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	ENST00000450053.3	hg19	CCDS46817.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.77|12.77	2.036230|2.036230	0.35893|0.35893	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000416683|ENST00000292309;ENST00000450053	.|T;T	.|0.58358	.|0.34;0.35	5.41|5.41	4.54|4.54	0.55810|0.55810	.|.	.|0.371656	.|0.27700	.|N	.|0.018211	T|T	0.51787|0.51787	0.1695|0.1695	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	.|P	.|0.52577	.|0.954	.|P	.|0.45276	.|0.475	T|T	0.56763|0.56763	-0.7925|-0.7925	5|10	.|0.56958	.|D	.|0.05	.|.	12.9387|12.9387	0.58329|0.58329	0.0:0.9216:0.0:0.0784|0.0:0.9216:0.0:0.0784	.|.	.|916	.|Q6ZNJ1	.|NBEL2_HUMAN	C|M	388|916	.|ENSP00000292309:T916M;ENSP00000415034:T916M	.|ENSP00000292309:T916M	R|T	+|+	1|2	0|0	NBEAL2|NBEAL2	47013850|47013850	0.988000|0.988000	0.35896|0.35896	0.202000|0.202000	0.23494|0.23494	0.028000|0.028000	0.11728|0.11728	2.750000|2.750000	0.47500|0.47500	1.521000|1.521000	0.48983|0.48983	0.561000|0.561000	0.74099|0.74099	CGC|ACG	.	.	.	none		0.577	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064	
BOD1L1	259282	hgsc.bcm.edu	37	4	13616300	13616300	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr4:13616300T>C	ENST00000040738.5	-	4	829	c.694A>G	c.(694-696)Aga>Gga	p.R232G		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	232						nucleus (GO:0005634)	DNA binding (GO:0003677)										TTTGACGCTCTCTCACTGGTC	0.418																																					p.R232G		Atlas-SNP	.											.	.	.	.	0			c.A694G						PASS	.						143.0	117.0	126.0					4																	13616300		2203	4300	6503	SO:0001583	missense	259282	exon4			ACGCTCTCTCACT	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.694A>G	chr4.hg19:g.13616300T>C	ENSP00000040738:p.Arg232Gly	89.0	0.0	.		62.0	4.0	.	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	hg19	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	T	15.15	2.748965	0.49257	.	.	ENSG00000038219	ENST00000040738	T	0.12255	2.7	5.74	4.54	0.55810	.	0.000000	0.53938	D	0.000052	T	0.30603	0.0770	M	0.62723	1.935	0.35742	D	0.818752	D	0.76494	0.999	D	0.64144	0.922	T	0.32295	-0.9912	10	0.40728	T	0.16	-13.193	12.9123	0.58187	0.0:0.0:0.1359:0.8641	.	232	Q8NFC6	BOD1L_HUMAN	G	232	ENSP00000040738:R232G	ENSP00000040738:R232G	R	-	1	2	BOD1L	13225398	1.000000	0.71417	0.997000	0.53966	0.164000	0.22412	4.222000	0.58580	0.967000	0.38186	0.477000	0.44152	AGA	.	.	.	none		0.418	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
COL25A1	84570	hgsc.bcm.edu	37	4	109861784	109861784	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr4:109861784C>G	ENST00000399132.1	-	10	1113	c.583G>C	c.(583-585)Ggg>Cgg	p.G195R	COL25A1_ENST00000399126.1_Missense_Mutation_p.G195R|COL25A1_ENST00000399127.1_Missense_Mutation_p.G191R	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		CCTGGAGGCCCTGCCTGTCCT	0.562																																					p.G195R		Atlas-SNP	.											.	COL25A1	178	.	0			c.G583C						PASS	.						51.0	52.0	52.0					4																	109861784		1883	4103	5986	SO:0001583	missense	84570	exon9			GAGGCCCTGCCTG	AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.583G>C	chr4.hg19:g.109861784C>G	ENSP00000382083:p.Gly195Arg	63.0	0.0	.		42.0	17.0	.	NM_198721		Missense_Mutation	SNP	ENST00000399132.1	hg19	CCDS43258.1	.	.	.	.	.	.	.	.	.	.	C	18.34	3.603104	0.66445	.	.	ENSG00000188517	ENST00000399132;ENST00000333642;ENST00000401873;ENST00000399127;ENST00000399126	D;D;D	0.98807	-5.15;-5.15;-5.15	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	D	0.99582	0.9849	H	0.98951	4.38	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.97654	1.0156	9	.	.	.	-3.9504	19.3339	0.94307	0.0:1.0:0.0:0.0	.	195;195	Q9BXS0-2;Q9BXS0	.;COPA1_HUMAN	R	195;197;191;191;195	ENSP00000382083:G195R;ENSP00000382078:G191R;ENSP00000382077:G195R	.	G	-	1	0	COL25A1	110081233	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	7.172000	0.77604	2.557000	0.86248	0.555000	0.69702	GGG	.	.	.	none		0.562	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2	NM_032518	
TENM3	55714	hgsc.bcm.edu	37	4	183674665	183674665	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr4:183674665G>A	ENST00000511685.1	+	21	4048	c.3925G>A	c.(3925-3927)Gac>Aac	p.D1309N	TENM3_ENST00000406950.2_Missense_Mutation_p.D1309N|TENM3_ENST00000502950.1_3'UTR			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1309					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TAGGAAAGTTGACCAAAATGG	0.373																																					p.D1309N		Atlas-SNP	.											.	.	.	.	0			c.G3925A						PASS	.						113.0	112.0	112.0					4																	183674665		1915	4137	6052	SO:0001583	missense	55714	exon20			AAAGTTGACCAAA	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.3925G>A	chr4.hg19:g.183674665G>A	ENSP00000424226:p.Asp1309Asn	183.0	0.0	.		120.0	43.0	.	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	hg19	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.688166	0.68271	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.91996	-2.95;-2.95	5.65	5.65	0.86999	Six-bladed beta-propeller, TolB-like (1);	.	.	.	.	D	0.96166	0.8750	M	0.78801	2.425	0.80722	D	1	D	0.63880	0.993	D	0.74674	0.984	D	0.95850	0.8874	9	0.72032	D	0.01	.	19.9142	0.97043	0.0:0.0:1.0:0.0	.	1309	Q9P273	TEN3_HUMAN	N	1309	ENSP00000424226:D1309N;ENSP00000385276:D1309N	ENSP00000385276:D1309N	D	+	1	0	ODZ3	183911659	1.000000	0.71417	0.998000	0.56505	0.235000	0.25334	9.657000	0.98554	2.941000	0.99782	0.655000	0.94253	GAC	.	.	.	none		0.373	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
FRG1	2483	hgsc.bcm.edu	37	4	190878551	190878551	+	Splice_Site	SNP	A	A	G			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr4:190878551A>G	ENST00000226798.4	+	6	654		c.e6-1		FRG1_ENST00000514482.1_Splice_Site	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1						mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.?(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TGTTTCACTTAGGGGAAAATG	0.358																																					.		Atlas-SNP	.											FRG1,NS,malignant_melanoma,0,1	FRG1	76	.	1	Unknown(1)	NS(1)	c.433-2A>G						PASS	.						10.0	16.0	14.0					4																	190878551		2077	4234	6311	SO:0001630	splice_region_variant	2483	exon6			TCACTTAGGGGAA	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.433-1A>G	chr4.hg19:g.190878551A>G		91.0	1.0	.		92.0	6.0	.	NM_004477	A8K775	Splice_Site	SNP	ENST00000226798.4	hg19	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	N	13.17	2.156273	0.38021	.	.	ENSG00000109536	ENST00000226798;ENST00000524583;ENST00000531991	.	.	.	3.8	3.8	0.43715	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.8823	0.46946	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1	191115545	1.000000	0.71417	1.000000	0.80357	0.407000	0.30961	9.035000	0.93752	1.517000	0.48917	0.373000	0.22412	.	.	.	.	none		0.358	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	Intron
CHD1	1105	hgsc.bcm.edu	37	5	98235232	98235232	+	Missense_Mutation	SNP	A	A	T			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr5:98235232A>T	ENST00000284049.3	-	7	1186	c.1037T>A	c.(1036-1038)aTg>aAg	p.M346K		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	346	Chromo 1. {ECO:0000255|PROSITE- ProRule:PRU00053}.				chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	CAATTTTTTCATTCCTCTAAC	0.323																																					p.M346K		Atlas-SNP	.											.	CHD1	137	.	0			c.T1037A						PASS	.						112.0	124.0	120.0					5																	98235232		2203	4300	6503	SO:0001583	missense	1105	exon7			TTTTTCATTCCTC	AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.1037T>A	chr5.hg19:g.98235232A>T	ENSP00000284049:p.Met346Lys	59.0	0.0	.		46.0	15.0	.	NM_001270	Q17RZ3	Missense_Mutation	SNP	ENST00000284049.3	hg19	CCDS34204.1	.	.	.	.	.	.	.	.	.	.	A	27.3	4.814508	0.90790	.	.	ENSG00000153922	ENST00000284049	T	0.70631	-0.5	5.74	5.74	0.90152	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (2);	0.000000	0.40469	U	0.001094	T	0.74733	0.3755	L	0.42529	1.33	0.80722	D	1	D	0.54772	0.968	P	0.54060	0.741	T	0.77778	-0.2460	10	0.87932	D	0	.	16.0292	0.80564	1.0:0.0:0.0:0.0	.	346	O14646	CHD1_HUMAN	K	346	ENSP00000284049:M346K	ENSP00000284049:M346K	M	-	2	0	CHD1	98263132	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.962000	0.93254	2.187000	0.69744	0.533000	0.62120	ATG	.	.	.	none		0.323	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370295.1	NM_001270	
SHROOM1	134549	hgsc.bcm.edu	37	5	132160915	132160915	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr5:132160915G>T	ENST00000378679.3	-	4	1722	c.918C>A	c.(916-918)agC>agA	p.S306R	SHROOM1_ENST00000378676.1_Missense_Mutation_p.S306R|SHROOM1_ENST00000319854.3_Missense_Mutation_p.S306R|SHROOM1_ENST00000488072.1_5'Flank	NM_001172700.1	NP_001166171.1	Q2M3G4	SHRM1_HUMAN	shroom family member 1	306					actin filament bundle assembly (GO:0051017)|cell morphogenesis (GO:0000902)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|myosin II complex (GO:0016460)	actin filament binding (GO:0051015)			endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CGCCTGAAGCGCTCCGACTCC	0.617																																					p.S306R		Atlas-SNP	.											.	SHROOM1	35	.	0			c.C918A						PASS	.						37.0	41.0	40.0					5																	132160915		2203	4300	6503	SO:0001583	missense	134549	exon1			TGAAGCGCTCCGA	AF314142	CCDS4161.1, CCDS54902.1	5q31.1	2007-05-03			ENSG00000164403	ENSG00000164403			24084	protein-coding gene	gene with protein product		611179				11853319, 16615870	Standard	NM_133456		Approved	APXL2, KIAA1960	uc003kxy.2	Q2M3G4	OTTHUMG00000059835	ENST00000378679.3:c.918C>A	chr5.hg19:g.132160915G>T	ENSP00000367950:p.Ser306Arg	89.0	0.0	.		71.0	20.0	.	NM_133456	B7WP40|B7ZL01|Q8TDP0|Q8TF41	Missense_Mutation	SNP	ENST00000378679.3	hg19	CCDS54902.1	.	.	.	.	.	.	.	.	.	.	G	16.55	3.154073	0.57259	.	.	ENSG00000164403	ENST00000378679;ENST00000319854;ENST00000378676;ENST00000440118	T;T;T;T	0.23950	1.88;1.88;1.88;1.88	4.7	-1.49	0.08718	.	0.564112	0.19160	N	0.121214	T	0.32224	0.0822	L	0.32530	0.975	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.98	T	0.13818	-1.0495	10	0.59425	D	0.04	-17.2468	8.5248	0.33298	0.6377:0.0:0.3623:0.0	.	306;306	Q2M3G4-2;Q2M3G4	.;SHRM1_HUMAN	R	306	ENSP00000367950:S306R;ENSP00000324245:S306R;ENSP00000367947:S306R;ENSP00000388049:S306R	ENSP00000324245:S306R	S	-	3	2	SHROOM1	132188814	0.000000	0.05858	0.064000	0.19789	0.026000	0.11368	-0.578000	0.05841	-0.211000	0.10124	0.561000	0.74099	AGC	.	.	.	none		0.617	SHROOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133033.1	NM_133456	
TMEM173	340061	hgsc.bcm.edu	37	5	138856029	138856029	+	Missense_Mutation	SNP	A	A	C			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr5:138856029A>C	ENST00000330794.4	-	8	1290	c.957T>G	c.(955-957)gaT>gaG	p.D319E	TMEM173_ENST00000511850.1_5'Flank	NM_198282.2	NP_938023.1	Q86WV6	STING_HUMAN	transmembrane protein 173	319	c-di-GMP-binding domain (CBD).				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	cyclic-di-GMP binding (GO:0035438)|cyclic-GMP-AMP binding (GO:0061507)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|lung(6)|upper_aerodigestive_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AGCTGCTGTCATCTGCAGGTT	0.542																																					p.D319E		Atlas-SNP	.											.	TMEM173	19	.	0			c.T957G						PASS	.						49.0	48.0	48.0					5																	138856029		2203	4300	6503	SO:0001583	missense	340061	exon8			GCTGTCATCTGCA		CCDS4215.1	5q31.2	2009-11-06			ENSG00000184584	ENSG00000184584			27962	protein-coding gene	gene with protein product		612374				12477932	Standard	XM_005268445		Approved	FLJ38577, NET23	uc003lep.3	Q86WV6	OTTHUMG00000129239	ENST00000330794.4:c.957T>G	chr5.hg19:g.138856029A>C	ENSP00000331288:p.Asp319Glu	58.0	0.0	.		49.0	10.0	.	NM_198282	A8K3P6|B6EB35|D6RBX0|D6RE01|D6RID9	Missense_Mutation	SNP	ENST00000330794.4	hg19	CCDS4215.1	.	.	.	.	.	.	.	.	.	.	A	0.011	-1.696860	0.00725	.	.	ENSG00000184584	ENST00000330794	T	0.19938	2.11	5.19	-4.23	0.03789	.	0.353151	0.28135	N	0.016478	T	0.06872	0.0175	N	0.14661	0.345	0.19300	N	0.999972	B	0.06786	0.001	B	0.08055	0.003	T	0.35773	-0.9775	10	0.08179	T	0.78	-5.2849	4.5484	0.12092	0.4244:0.2109:0.2966:0.0681	.	319	Q86WV6	TM173_HUMAN	E	319	ENSP00000331288:D319E	ENSP00000331288:D319E	D	-	3	2	TMEM173	138836213	0.000000	0.05858	0.474000	0.27266	0.039000	0.13416	-0.774000	0.04684	-0.365000	0.08076	-0.648000	0.03929	GAT	.	.	.	none		0.542	TMEM173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251338.1	NM_198282	
FGFR4	2264	hgsc.bcm.edu	37	5	176523128	176523128	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr5:176523128T>C	ENST00000292408.4	+	14	2137	c.1892T>C	c.(1891-1893)tTt>tCt	p.F631S	FGFR4_ENST00000393637.1_Missense_Mutation_p.F591S|FGFR4_ENST00000292410.3_Missense_Mutation_p.F591S|FGFR4_ENST00000502906.1_Missense_Mutation_p.F631S|FGFR4_ENST00000393648.2_Missense_Mutation_p.F563S	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	631	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	ATTGCTGACTTTGGGCTGGCC	0.607										TSP Lung(9;0.080)																											p.F631S		Atlas-SNP	.											.	FGFR4	174	.	0			c.T1892C						PASS	.						60.0	58.0	59.0					5																	176523128		2203	4300	6503	SO:0001583	missense	2264	exon14			CTGACTTTGGGCT	AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.1892T>C	chr5.hg19:g.176523128T>C	ENSP00000292408:p.Phe631Ser	96.0	0.0	.		77.0	35.0	.	NM_002011	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Missense_Mutation	SNP	ENST00000292408.4	hg19	CCDS4410.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.367713	0.82463	.	.	ENSG00000160867	ENST00000292408;ENST00000393648;ENST00000502906;ENST00000292410;ENST00000393637;ENST00000377207	D;D;D;D;D	0.96830	-4.14;-4.14;-4.14;-4.14;-4.14	4.66	4.66	0.58398	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98915	0.9632	H	0.98701	4.305	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99084	1.0838	10	0.87932	D	0	.	13.7959	0.63171	0.0:0.0:0.0:1.0	.	563;591;631	B4DVP5;P22455-2;P22455	.;.;FGFR4_HUMAN	S	631;563;631;591;591;859	ENSP00000292408:F631S;ENSP00000377259:F563S;ENSP00000424960:F631S;ENSP00000292410:F591S;ENSP00000377254:F591S	ENSP00000292408:F631S	F	+	2	0	FGFR4	176455734	1.000000	0.71417	0.998000	0.56505	0.776000	0.43924	8.040000	0.89188	1.745000	0.51790	0.459000	0.35465	TTT	.	.	.	none		0.607	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253410.1		
GFPT2	9945	hgsc.bcm.edu	37	5	179743359	179743359	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr5:179743359A>G	ENST00000253778.8	-	13	1424	c.1255T>C	c.(1255-1257)Ttt>Ctt	p.F419L	GFPT2_ENST00000520165.1_5'Flank	NM_005110.2	NP_005101.1	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	419	SIS 1. {ECO:0000255|PROSITE- ProRule:PRU00797}.				carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glutamine metabolic process (GO:0006541)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	CTGATGAAAAAGCAAACGTCA	0.502																																					p.F419L		Atlas-SNP	.											.	GFPT2	74	.	0			c.T1255C						PASS	.						76.0	79.0	78.0					5																	179743359		2106	4233	6339	SO:0001583	missense	9945	exon13			TGAAAAAGCAAAC	AB016789	CCDS43411.1	5q	2008-07-18			ENSG00000131459	ENSG00000131459			4242	protein-coding gene	gene with protein product	"""glutamine: fructose-6-phosphate aminotransferase 2"""	603865				10198162	Standard	NM_005110		Approved	GFAT2	uc003mlw.1	O94808	OTTHUMG00000163442	ENST00000253778.8:c.1255T>C	chr5.hg19:g.179743359A>G	ENSP00000253778:p.Phe419Leu	151.0	0.0	.		122.0	38.0	.	NM_005110	Q53XM2|Q9BWS4	Missense_Mutation	SNP	ENST00000253778.8	hg19	CCDS43411.1	.	.	.	.	.	.	.	.	.	.	A	28.5	4.929944	0.92389	.	.	ENSG00000131459	ENST00000253778	T	0.61274	0.12	5.89	5.89	0.94794	Sugar isomerase (SIS) (2);	0.000000	0.85682	D	0.000000	T	0.48059	0.1479	N	0.11284	0.12	0.80722	D	1	P	0.41159	0.74	P	0.47645	0.553	T	0.47355	-0.9124	9	.	.	.	-22.0601	16.3123	0.82883	1.0:0.0:0.0:0.0	.	419	O94808	GFPT2_HUMAN	L	419	ENSP00000253778:F419L	.	F	-	1	0	GFPT2	179675965	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.157000	0.94714	2.254000	0.74563	0.459000	0.35465	TTT	.	.	.	none		0.502	GFPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373444.4	NM_005110	
ATXN1	6310	hgsc.bcm.edu	37	6	16327864	16327864	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr6:16327864G>C	ENST00000244769.4	-	8	1614	c.678C>G	c.(676-678)caC>caG	p.H226Q	ATXN1_ENST00000436367.1_Missense_Mutation_p.H226Q	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	226					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				CCCTGCTGAGGtgctgctgct	0.652																																					p.H226Q		Atlas-SNP	.											.,1	ATXN1	117	.	0			c.C678G						PASS	.						11.0	15.0	13.0					6																	16327864		2150	4194	6344	SO:0001583	missense	6310	exon7			GCTGAGGTGCTGC	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.678C>G	chr6.hg19:g.16327864G>C	ENSP00000244769:p.His226Gln	67.0	2.0	.		64.0	3.0	.	NM_001128164	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	hg19	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	G	1.926	-0.447046	0.04572	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.27256	1.68;1.68	4.74	0.503	0.16940	.	0.308295	0.34291	N	0.004091	T	0.05686	0.0149	L	0.39397	1.21	0.09310	N	0.999995	B	0.32245	0.361	B	0.28638	0.092	T	0.23976	-1.0173	10	0.48119	T	0.1	-16.8942	3.2876	0.06937	0.3032:0.0:0.385:0.3119	.	226	P54253	ATX1_HUMAN	Q	226	ENSP00000244769:H226Q;ENSP00000416360:H226Q	ENSP00000244769:H226Q	H	-	3	2	ATXN1	16435843	0.437000	0.25593	0.006000	0.13384	0.009000	0.06853	0.925000	0.28791	0.191000	0.20236	0.563000	0.77884	CAC	.	.	.	none		0.652	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
HIST1H2AH	85235	hgsc.bcm.edu	37	6	27115069	27115069	+	Silent	SNP	G	G	A	rs7756481	byFrequency	TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr6:27115069G>A	ENST00000377459.1	+	1	209	c.162G>A	c.(160-162)gcG>gcA	p.A54A	MIR3143_ENST00000584253.1_RNA|HIST1H2BK_ENST00000356950.1_5'Flank|HIST1H2BK_ENST00000396891.4_5'Flank	NM_080596.1	NP_542163.1	Q96KK5	H2A1H_HUMAN	histone cluster 1, H2ah	54						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|prostate(1)|skin(1)	12						ACCTGGCTGCGGTGCTGGAGT	0.657																																					p.A54A		Atlas-SNP	.											.	HIST1H2AH	26	.	0			c.G162A						PASS	.						52.0	53.0	53.0					6																	27115069		2203	4300	6503	SO:0001819	synonymous_variant	85235	exon1			GGCTGCGGTGCTG	AY131988	CCDS4622.1	6p22.1	2011-01-27	2006-10-11			ENSG00000274997		"""Histones / Replication-dependent"""	13671	protein-coding gene	gene with protein product		615013	"""histone 1, H2ah"""			12408966	Standard	NM_080596		Approved	H2AFALii, dJ86C11.1, H2A/S	uc003niz.4	Q96KK5		ENST00000377459.1:c.162G>A	chr6.hg19:g.27115069G>A		131.0	0.0	.		142.0	8.0	.	NM_080596		Silent	SNP	ENST00000377459.1	hg19	CCDS4622.1																																																																																			.	G|0.936;C|0.064	.	alt		0.657	HIST1H2AH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040136.1	NM_080596	
BEND3	57673	hgsc.bcm.edu	37	6	107390745	107390745	+	Silent	SNP	A	A	G			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr6:107390745A>G	ENST00000369042.1	-	4	1840	c.1650T>C	c.(1648-1650)ggT>ggC	p.G550G	BEND3_ENST00000429433.2_Silent_p.G550G			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	550	BEN 3. {ECO:0000255|PROSITE- ProRule:PRU00784}.									central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						GGCAGTCGGCACCGGGCACCT	0.647																																					p.G550G		Atlas-SNP	.											.	BEND3	70	.	0			c.T1650C						PASS	.						33.0	32.0	32.0					6																	107390745		2203	4300	6503	SO:0001819	synonymous_variant	57673	exon5			GTCGGCACCGGGC	AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.1650T>C	chr6.hg19:g.107390745A>G		40.0	0.0	.		34.0	12.0	.	NM_001080450	A2RRH2|Q9HCL9	Silent	SNP	ENST00000369042.1	hg19	CCDS34507.1																																																																																			.	.	.	none		0.647	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041686.1	NM_020913	
ZSCAN21	7589	hgsc.bcm.edu	37	7	99661446	99661446	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr7:99661446G>T	ENST00000292450.4	+	4	792	c.628G>T	c.(628-630)Gat>Tat	p.D210Y	ZSCAN21_ENST00000456748.2_Missense_Mutation_p.D210Y|ZSCAN21_ENST00000477297.1_Intron|ZSCAN21_ENST00000543588.1_Missense_Mutation_p.D210Y	NM_145914.2	NP_666019.1	Q9Y5A6	ZSC21_HUMAN	zinc finger and SCAN domain containing 21	210					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|skin(1)	21	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			GGAATCAGCAGATGAGCAGAA	0.433																																					p.D210Y		Atlas-SNP	.											.	ZSCAN21	29	.	0			c.G628T						PASS	.						89.0	91.0	90.0					7																	99661446		2203	4300	6503	SO:0001583	missense	7589	exon4			TCAGCAGATGAGC	AL136865	CCDS5681.1	7q11.1	2013-01-08	2006-10-06	2006-10-06	ENSG00000166529	ENSG00000166529		"""-"", ""Zinc fingers, C2H2-type"""	13104	protein-coding gene	gene with protein product		601261	"""zinc finger protein 38 (KOX 25)"", ""zinc finger protein 38"""	ZNF38		2288909, 2014798	Standard	NM_145914		Approved	DKFZp434L134, NY-REN-21, Zipro1	uc003uso.3	Q9Y5A6	OTTHUMG00000154583	ENST00000292450.4:c.628G>T	chr7.hg19:g.99661446G>T	ENSP00000292450:p.Asp210Tyr	103.0	0.0	.		176.0	113.0	.	NM_145914	A4D2A6|D6W5T9|Q9H0B5	Missense_Mutation	SNP	ENST00000292450.4	hg19	CCDS5681.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.593776	0.28445	.	.	ENSG00000166529	ENST00000543588;ENST00000292450;ENST00000456748;ENST00000379635	T;T;T	0.05925	4.04;3.37;4.04	4.79	2.91	0.33838	.	0.353172	0.20787	N	0.085686	T	0.11196	0.0273	L	0.29908	0.895	0.27965	N	0.936625	P;D	0.76494	0.454;0.999	B;D	0.68943	0.259;0.961	T	0.03630	-1.1018	10	0.66056	D	0.02	.	5.8826	0.18864	0.1063:0.2119:0.6818:0.0	.	210;210	Q9Y5A6;G3V1M0	ZSC21_HUMAN;.	Y	210;210;210;185	ENSP00000441212:D210Y;ENSP00000292450:D210Y;ENSP00000390960:D210Y	ENSP00000292450:D210Y	D	+	1	0	ZSCAN21	99499382	0.175000	0.23083	1.000000	0.80357	0.157000	0.22087	0.687000	0.25407	1.249000	0.43950	-0.140000	0.14226	GAT	.	.	.	none		0.433	ZSCAN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336166.1	NM_145914	
UPK3BL	100134938	hgsc.bcm.edu	37	7	102279605	102279605	+	Missense_Mutation	SNP	T	T	G			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr7:102279605T>G	ENST00000340457.8	-	4	576	c.527A>C	c.(526-528)gAa>gCa	p.E176A	POLR2J2_ENST00000591000.1_3'UTR|RP11-514P8.6_ENST00000519541.1_Missense_Mutation_p.E176A|POLR2J2_ENST00000476151.1_3'UTR	NM_001114403.2	NP_001107875.1	B0FP48	UPK3L_HUMAN	uroplakin 3B-like	176						integral component of membrane (GO:0016021)				kidney(2)|stomach(1)	3						CCACTTGGTTTCAGCCACGGG	0.622																																					p.E176A		Atlas-SNP	.											.	UPK3BL	6	.	0			c.A527C						PASS	.						107.0	69.0	81.0					7																	102279605		691	1582	2273	SO:0001583	missense	100134938	exon4			TTGGTTTCAGCCA	EU341824	CCDS47675.1	7q22.1	2014-02-12	2010-03-03		ENSG00000267368	ENSG00000267368			37278	protein-coding gene	gene with protein product	"""uroplakin-like protein"""						Standard	NM_001114403		Approved	UPLP		B0FP48	OTTHUMG00000165036	ENST00000340457.8:c.527A>C	chr7.hg19:g.102279605T>G	ENSP00000342938:p.Glu176Ala	452.0	0.0	.		625.0	41.0	.	NM_001114403		Missense_Mutation	SNP	ENST00000340457.8	hg19	CCDS47675.1	.	.	.	.	.	.	.	.	.	.	t	14.79	2.640591	0.47153	.	.	ENSG00000205236	ENST00000519541;ENST00000340457	T;T	0.65364	-0.15;-0.15	1.82	1.82	0.25136	.	.	.	.	.	T	0.68054	0.2959	M	0.80746	2.51	0.23802	N	0.996805	.	.	.	.	.	.	T	0.60454	-0.7260	7	0.66056	D	0.02	-21.9377	5.588	0.17285	0.0:0.0:0.0:1.0	.	.	.	.	A	176	ENSP00000429397:E176A;ENSP00000342938:E176A	ENSP00000342938:E176A	E	-	2	0	UPK3BL	102066841	0.999000	0.42202	0.716000	0.30569	0.031000	0.12232	1.725000	0.38074	0.830000	0.34757	0.156000	0.16432	GAA	.	.	.	none		0.622	UPK3BL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381510.1	NM_001114403	
BRAF	673	hgsc.bcm.edu	37	7	140507811	140507811	+	Silent	SNP	T	T	C			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr7:140507811T>C	ENST00000288602.6	-	5	720	c.660A>G	c.(658-660)gaA>gaG	p.E220E		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	220	RBD. {ECO:0000255|PROSITE- ProRule:PRU00262}.				activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	CATGCAATTCTTCTCCAGTAA	0.328		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												p.E220E	Colon(40;35 892 2973 5743 27438)	Atlas-SNP	.		Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	.	BRAF	36346	.	0			c.A660G						PASS	.						153.0	134.0	140.0					7																	140507811		2203	4300	6503	SO:0001819	synonymous_variant	673	exon5	Familial Cancer Database	CFC, CFCS	CAATTCTTCTCCA	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.660A>G	chr7.hg19:g.140507811T>C		80.0	0.0	.		126.0	29.0	.	NM_004333	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Silent	SNP	ENST00000288602.6	hg19	CCDS5863.1																																																																																			.	.	.	none		0.328	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333	
DUSP4	1846	hgsc.bcm.edu	37	8	29197704	29197704	+	Silent	SNP	G	G	A			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr8:29197704G>A	ENST00000240100.2	-	2	879	c.490C>T	c.(490-492)Ctg>Ttg	p.L164L	DUSP4_ENST00000240101.2_Silent_p.L73L	NM_001394.6	NP_001385.1	Q13115	DUS4_HUMAN	dual specificity phosphatase 4	164					endoderm formation (GO:0001706)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein dephosphorylation (GO:0006470)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			endometrium(1)|large_intestine(1)|lung(4)	6				KIRC - Kidney renal clear cell carcinoma(542;0.094)|Kidney(114;0.113)		ATGGCTGCCAGGGCCTTGGTT	0.582											OREG0018686	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L164L		Atlas-SNP	.											.	DUSP4	58	.	0			c.C490T						PASS	.						22.0	28.0	26.0					8																	29197704		2203	4300	6503	SO:0001819	synonymous_variant	1846	exon2			CTGCCAGGGCCTT	U21108	CCDS6072.1, CCDS6073.1	8p12-p11	2011-06-09			ENSG00000120875	ENSG00000120875		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3070	protein-coding gene	gene with protein product	"""VH1 homologous phosphatase 2"", ""MAP kinase phosphatase 2"""	602747				7535768, 9205128	Standard	NM_001394		Approved	HVH2, MKP-2, TYP	uc003xhm.3	Q13115	OTTHUMG00000133395	ENST00000240100.2:c.490C>T	chr8.hg19:g.29197704G>A		56.0	0.0	.	807	55.0	22.0	.	NM_001394	B2RBU5|D3DSU4|G5E930|Q13524	Silent	SNP	ENST00000240100.2	hg19	CCDS6072.1																																																																																			.	.	.	none		0.582	DUSP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257249.1	NM_001394	
VPS13B	157680	hgsc.bcm.edu	37	8	100836128	100836128	+	Silent	SNP	T	T	C			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr8:100836128T>C	ENST00000358544.2	+	51	9438	c.9327T>C	c.(9325-9327)acT>acC	p.T3109T	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Silent_p.T3084T	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3109					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AAGACAAGACTACAATAATCA	0.323																																					p.T3109T	Colon(161;2205 2542 7338 31318)	Atlas-SNP	.											.	VPS13B	811	.	0			c.T9327C						PASS	.						161.0	166.0	165.0					8																	100836128		2203	4297	6500	SO:0001819	synonymous_variant	157680	exon51			CAAGACTACAATA	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.9327T>C	chr8.hg19:g.100836128T>C		66.0	0.0	.		80.0	35.0	.	NM_017890	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	hg19	CCDS6280.1																																																																																			.	.	.	none		0.323	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
GPSM1	26086	hgsc.bcm.edu	37	9	139231429	139231429	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr9:139231429G>T	ENST00000440944.1	+	4	698	c.478G>T	c.(478-480)Ggc>Tgc	p.G160C	GPSM1_ENST00000392945.3_Missense_Mutation_p.G160C	NM_001145638.1	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1	160	Mediates association with membranes. {ECO:0000250}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GDP-dissociation inhibitor activity (GO:0005092)			biliary_tract(1)|endometrium(1)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		CCACGCCAAAGGCAAGCAACT	0.662																																					p.G160C		Atlas-SNP	.											.	GPSM1	50	.	0			c.G478T						PASS	.						61.0	50.0	54.0					9																	139231429		2163	4259	6422	SO:0001583	missense	26086	exon4			GCCAAAGGCAAGC	AI272212	CCDS6996.2, CCDS48055.1, CCDS48056.1	9q34.3	2013-01-10	2010-06-24		ENSG00000160360	ENSG00000160360		"""Tetratricopeptide (TTC) repeat domain containing"""	17858	protein-coding gene	gene with protein product	"""AGS3 homolog (C. elegans)"""	609491	"""G-protein signalling modulator 1 (AGS3-like, C. elegans)"""			11278352, 10969064	Standard	NM_001145639		Approved	AGS3, DKFZP727I051	uc004chd.2	Q86YR5	OTTHUMG00000020930	ENST00000440944.1:c.478G>T	chr9.hg19:g.139231429G>T	ENSP00000392828:p.Gly160Cys	142.0	0.0	.		107.0	49.0	.	NM_015597	A9Z1X4|B1B0W3|Q86SR5|Q969T1|Q9UFS8	Missense_Mutation	SNP	ENST00000440944.1	hg19	CCDS48055.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.802739	0.90623	.	.	ENSG00000160360	ENST00000392945;ENST00000440944;ENST00000354753	D;D;D	0.97016	-4.21;-4.21;-4.21	3.94	3.94	0.45596	Tetratricopeptide-like helical (1);	0.135266	0.48767	U	0.000165	D	0.98845	0.9610	H	0.98027	4.13	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99346	1.0913	10	0.87932	D	0	-36.4254	15.833	0.78773	0.0:0.0:1.0:0.0	.	160;160	Q86YR5;Q86YR5-3	GPSM1_HUMAN;.	C	160;160;137	ENSP00000376674:G160C;ENSP00000392828:G160C;ENSP00000346797:G137C	ENSP00000346797:G137C	G	+	1	0	GPSM1	138351250	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.573000	0.98181	2.122000	0.65172	0.563000	0.77884	GGC	.	.	.	none		0.662	GPSM1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015597	
ANKRD16	54522	hgsc.bcm.edu	37	10	5922267	5922267	+	Nonsense_Mutation	SNP	G	G	A			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr10:5922267G>A	ENST00000380094.5	-	6	1465	c.922C>T	c.(922-924)Cga>Tga	p.R308*	ANKRD16_ENST00000191063.8_Intron|ANKRD16_ENST00000380092.4_Nonsense_Mutation_p.R308*	NM_019046.2	NP_061919.1	Q6P6B7	ANR16_HUMAN	ankyrin repeat domain 16	308								p.R308*(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(3)|stomach(2)	12						GTACCTGATCGATTTTTTTCA	0.294																																					p.R308X		Atlas-SNP	.											ANKRD16,NS,carcinoma,0,2	ANKRD16	32	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C922T						PASS	.						77.0	75.0	76.0					10																	5922267		2203	4300	6503	SO:0001587	stop_gained	54522	exon6			CTGATCGATTTTT	AL137614	CCDS31136.1, CCDS31137.1	10p15.1	2013-01-10			ENSG00000134461	ENSG00000134461		"""Ankyrin repeat domain containing"""	23471	protein-coding gene	gene with protein product							Standard	NM_019046		Approved	DKFZP434N1511	uc010qat.2	Q6P6B7	OTTHUMG00000017610	ENST00000380094.5:c.922C>T	chr10.hg19:g.5922267G>A	ENSP00000369436:p.Arg308*	69.0	0.0	.		38.0	19.0	.	NM_001009941	A6NEF0|F8WEI4|Q9NT01	Nonsense_Mutation	SNP	ENST00000380094.5	hg19	CCDS31136.1	.	.	.	.	.	.	.	.	.	.	G	40	8.179958	0.98693	.	.	ENSG00000134461	ENST00000380094;ENST00000380092	.	.	.	4.41	4.41	0.53225	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	-5.1798	10.9767	0.47469	0.0:0.0:0.813:0.187	.	.	.	.	X	308	.	ENSP00000369434:R308X	R	-	1	2	ANKRD16	5962273	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	3.339000	0.52135	2.023000	0.59567	0.478000	0.44815	CGA	.	.	.	none		0.294	ANKRD16-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046611.2	XM_166138	
KNDC1	85442	hgsc.bcm.edu	37	10	135012281	135012281	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr10:135012281G>A	ENST00000304613.3	+	14	2290	c.2269G>A	c.(2269-2271)Ggc>Agc	p.G757S	KNDC1_ENST00000368572.2_Missense_Mutation_p.G757S|KNDC1_ENST00000368571.2_Missense_Mutation_p.G692S			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	757	Pro-rich.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CTCAGCCCAGGGCCGCCCCTG	0.736																																					p.G757S		Atlas-SNP	.											.	KNDC1	155	.	0			c.G2269A						PASS	.						5.0	8.0	7.0					10																	135012281		2096	4169	6265	SO:0001583	missense	85442	exon14			GCCCAGGGCCGCC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.2269G>A	chr10.hg19:g.135012281G>A	ENSP00000304437:p.Gly757Ser	91.0	0.0	.		74.0	20.0	.	NM_152643	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	hg19	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	G	16.33	3.092782	0.56075	.	.	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.20200	2.61;2.61;2.09	4.0	4.0	0.46444	.	0.312106	0.24429	U	0.038609	T	0.32912	0.0845	L	0.50333	1.59	0.09310	N	1	D;P;B	0.61697	0.99;0.944;0.421	P;P;B	0.58721	0.844;0.548;0.086	T	0.05354	-1.0890	10	0.41790	T	0.15	-6.823	11.9945	0.53194	0.0:0.0:1.0:0.0	.	757;692;757	Q76NI1-4;Q76NI1-2;Q76NI1	.;.;VKIND_HUMAN	S	757;757;692	ENSP00000304437:G757S;ENSP00000357561:G757S;ENSP00000357560:G692S	ENSP00000304437:G757S	G	+	1	0	KNDC1	134862271	0.033000	0.19621	0.010000	0.14722	0.175000	0.22909	0.981000	0.29526	1.954000	0.56735	0.306000	0.20318	GGC	.	.	.	none		0.736	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
GTF2H1	2965	hgsc.bcm.edu	37	11	18382179	18382179	+	Silent	SNP	T	T	C			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr11:18382179T>C	ENST00000265963.4	+	14	1645	c.1485T>C	c.(1483-1485)agT>agC	p.S495S	GTF2H1_ENST00000534641.1_Silent_p.S379S|GTF2H1_ENST00000453096.2_Silent_p.S495S|GTF2H1_ENST00000526630.2_Silent_p.S85S|GTF2H1_ENST00000530496.2_Silent_p.S183S	NM_005316.3	NP_005307.1	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1, 62kDa	495					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	20						AAATGAAAAGTAATTTGGAAC	0.343								Nucleotide excision repair (NER)																													p.S495S		Atlas-SNP	.											.	GTF2H1	35	.	0			c.T1485C						PASS	.						77.0	83.0	81.0					11																	18382179		2199	4293	6492	SO:0001819	synonymous_variant	2965	exon15			GAAAAGTAATTTG		CCDS7838.1	11p15.1-p14	2012-11-05	2002-08-29		ENSG00000110768	ENSG00000110768		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4655	protein-coding gene	gene with protein product		189972	"""general transcription factor IIH, polypeptide 1 (62kD subunit)"""			1529339, 8162052	Standard	NM_005316		Approved	BTF2, P62, TFIIH	uc001moh.2	P32780	OTTHUMG00000167690	ENST00000265963.4:c.1485T>C	chr11.hg19:g.18382179T>C		66.0	0.0	.		44.0	17.0	.	NM_001142307	B3KXE0|D3DQY2|Q6I9Y7|Q9H5K5|Q9NQD9	Silent	SNP	ENST00000265963.4	hg19	CCDS7838.1																																																																																			.	.	.	none		0.343	GTF2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395627.2	NM_005316	
DAGLA	747	hgsc.bcm.edu	37	11	61490356	61490356	+	Silent	SNP	C	C	T	rs374808753		TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr11:61490356C>T	ENST00000257215.5	+	4	449	c.333C>T	c.(331-333)taC>taT	p.Y111Y		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	111					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		AGTTCATCTACGCCATCGTGG	0.607																																					p.Y111Y		Atlas-SNP	.											.	DAGLA	109	.	0			c.C333T						PASS	.	C		1,4403	2.1+/-5.4	0,1,2201	248.0	163.0	192.0		333	-6.6	0.7	11		192	0,8598		0,0,4299	no	coding-synonymous	DAGLA	NM_006133.2		0,1,6500	TT,TC,CC		0.0,0.0227,0.0077		111/1043	61490356	1,13001	2202	4299	6501	SO:0001819	synonymous_variant	747	exon4			CATCTACGCCATC	AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.333C>T	chr11.hg19:g.61490356C>T		85.0	0.0	.		67.0	27.0	.	NM_006133	A7E233|Q6WQJ0	Silent	SNP	ENST00000257215.5	hg19	CCDS31578.1																																																																																			.	.	.	weak		0.607	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398516.1	NM_006133	
INPPL1	3636	hgsc.bcm.edu	37	11	71941503	71941503	+	Silent	SNP	C	C	A			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr11:71941503C>A	ENST00000298229.2	+	10	1392	c.1188C>A	c.(1186-1188)gtC>gtA	p.V396V	INPPL1_ENST00000538751.1_Silent_p.V154V|INPPL1_ENST00000541756.1_Silent_p.V154V	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	396					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						TCATCTTTGTCAGTGCCCGGG	0.582																																					p.V396V		Atlas-SNP	.											.	INPPL1	120	.	0			c.C1188A						PASS	.						78.0	77.0	77.0					11																	71941503		2200	4293	6493	SO:0001819	synonymous_variant	3636	exon10			CTTTGTCAGTGCC	Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.1188C>A	chr11.hg19:g.71941503C>A		92.0	0.0	.		87.0	39.0	.	NM_001567	B2RTX5|Q13577|Q13578	Silent	SNP	ENST00000298229.2	hg19	CCDS8213.1																																																																																			.	.	.	none		0.582	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396789.1	NM_001567	
FCHSD2	9873	hgsc.bcm.edu	37	11	72700036	72700036	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr11:72700036A>G	ENST00000409418.4	-	6	877	c.494T>C	c.(493-495)gTa>gCa	p.V165A	FCHSD2_ENST00000409314.1_Missense_Mutation_p.V165A|FCHSD2_ENST00000458644.2_Missense_Mutation_p.V5A|FCHSD2_ENST00000311172.7_Missense_Mutation_p.V109A|FCHSD2_ENST00000409853.1_Missense_Mutation_p.V109A	NM_014824.2	NP_055639.2	O94868	FCSD2_HUMAN	FCH and double SH3 domains 2	165										endometrium(2)|large_intestine(11)|lung(5)|ovary(2)|prostate(1)|skin(1)	22			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)			TTTCTCTCGTACTGCATGAGC	0.338																																					p.V165A		Atlas-SNP	.											.	FCHSD2	106	.	0			c.T494C						PASS	.						214.0	178.0	190.0					11																	72700036		2198	4290	6488	SO:0001583	missense	9873	exon6			TCTCGTACTGCAT	AB018312	CCDS8218.2	11q13.3	2008-02-05	2004-04-14	2004-04-16	ENSG00000137478	ENSG00000137478			29114	protein-coding gene	gene with protein product			"""SH3 multiple domains 3"""	SH3MD3		9872452, 15067381	Standard	NM_014824		Approved	KIAA0769	uc009ytl.3	O94868	OTTHUMG00000153082	ENST00000409418.4:c.494T>C	chr11.hg19:g.72700036A>G	ENSP00000386722:p.Val165Ala	94.0	0.0	.		78.0	31.0	.	NM_014824	B4DNI3|Q7L8J9|Q8WVM2|Q96FV7|Q9UF77	Missense_Mutation	SNP	ENST00000409418.4	hg19	CCDS8218.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.34|11.34	1.610376|1.610376	0.28712|0.28712	.|.	.|.	ENSG00000137478|ENSG00000137478	ENST00000311172;ENST00000409314;ENST00000409418;ENST00000458644;ENST00000409853|ENST00000543644	T;T;T;T;T|.	0.18502|.	3.13;3.13;3.13;2.21;3.13|.	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	0.124939|.	0.53938|.	D|.	0.000050|.	T|T	0.52041|0.52041	0.1710|0.1710	N|N	0.21324|0.21324	0.655|0.655	0.51233|0.51233	D|D	0.999913|0.999913	P;P;B|.	0.50066|.	0.931;0.792;0.075|.	B;B;B|.	0.41332|.	0.354;0.138;0.046|.	T|T	0.49273|0.49273	-0.8957|-0.8957	10|5	0.02654|.	T|.	1|.	-18.7119|-18.7119	14.7885|14.7885	0.69821|0.69821	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	5;165;109|.	E7ENZ2;O94868;O94868-3|.	.;FCSD2_HUMAN;.|.	A|H	109;165;165;5;109|8	ENSP00000308978:V109A;ENSP00000386987:V165A;ENSP00000386722:V165A;ENSP00000402972:V5A;ENSP00000386314:V109A|.	ENSP00000308978:V109A|.	V|Y	-|-	2|1	0|0	FCHSD2|FCHSD2	72377684|72377684	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.970000|0.970000	0.65996|0.65996	8.932000|8.932000	0.92897|0.92897	2.093000|2.093000	0.63338|0.63338	0.379000|0.379000	0.24179|0.24179	GTA|TAC	.	.	.	none		0.338	FCHSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329429.2	NM_014824	
RSF1	51773	hgsc.bcm.edu	37	11	77412208	77412208	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr11:77412208G>T	ENST00000308488.6	-	6	2368	c.2066C>A	c.(2065-2067)tCt>tAt	p.S689Y	RSF1_ENST00000360355.2_Missense_Mutation_p.S658Y|RSF1_ENST00000480887.1_Missense_Mutation_p.S437Y			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	689					CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			CTCTATGCCAGAGGTCTGGGC	0.413																																					p.S689Y		Atlas-SNP	.											.	RSF1	105	.	0			c.C2066A						PASS	.						98.0	100.0	99.0					11																	77412208		2199	4291	6490	SO:0001583	missense	51773	exon6			ATGCCAGAGGTCT	AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.2066C>A	chr11.hg19:g.77412208G>T	ENSP00000311513:p.Ser689Tyr	81.0	0.0	.		78.0	31.0	.	NM_016578	Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Missense_Mutation	SNP	ENST00000308488.6	hg19	CCDS8253.1	.	.	.	.	.	.	.	.	.	.	G	4.376	0.069294	0.08436	.	.	ENSG00000048649	ENST00000308488;ENST00000480887;ENST00000360355;ENST00000526324;ENST00000528095	D;D;D;D;T	0.86769	-2.14;-2.14;-2.13;-2.17;0.95	5.23	3.22	0.36961	.	0.380726	0.23067	N	0.052308	T	0.80221	0.4583	L	0.27053	0.805	0.09310	N	1	D	0.56521	0.976	P	0.44732	0.459	T	0.73569	-0.3941	10	0.72032	D	0.01	-3.2478	10.3956	0.44198	0.0:0.2723:0.5869:0.1407	.	689	Q96T23	RSF1_HUMAN	Y	689;437;658;490;688	ENSP00000311513:S689Y;ENSP00000434509:S437Y;ENSP00000353511:S658Y;ENSP00000432022:S490Y;ENSP00000436408:S688Y	ENSP00000311513:S689Y	S	-	2	0	RSF1	77089856	0.469000	0.25846	0.312000	0.25196	0.045000	0.14185	2.914000	0.48797	1.399000	0.46721	0.655000	0.94253	TCT	.	.	.	none		0.413	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318075.2	NM_016578	
ATM	472	hgsc.bcm.edu	37	11	108213973	108213973	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr11:108213973G>A	ENST00000452508.2	+	58	8482	c.8293G>A	c.(8293-8295)Ggt>Agt	p.G2765S	C11orf65_ENST00000526725.1_Intron|C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Missense_Mutation_p.G2765S			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2765	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		G -> S (may contribute to breast cancer). {ECO:0000269|PubMed:10534763}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TCAGCGAAGTGGTGTTCTTGA	0.398			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.G2765S		Atlas-SNP	.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM	1657	.	0			c.G8293A	GRCh37	CM994662	ATM	M		PASS	.						168.0	155.0	160.0					11																	108213973		2201	4298	6499	SO:0001583	missense	472	exon57	Familial Cancer Database	AT, Louis-Bar syndrome	CGAAGTGGTGTTC	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8293G>A	chr11.hg19:g.108213973G>A	ENSP00000388058:p.Gly2765Ser	104.0	0.0	.		136.0	8.0	.	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	hg19	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	G	36	5.764800	0.96906	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.81659	-1.52;-1.52	5.56	5.56	0.83823	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	D	0.93963	0.8067	H	0.97315	3.98	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95499	0.8576	10	0.87932	D	0	.	19.8788	0.96888	0.0:0.0:1.0:0.0	.	2765	Q13315	ATM_HUMAN	S	2765	ENSP00000278616:G2765S;ENSP00000388058:G2765S	ENSP00000278616:G2765S	G	+	1	0	ATM	107719183	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.391000	0.97249	2.779000	0.95612	0.561000	0.74099	GGT	.	.	.	none		0.398	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
DLAT	1737	hgsc.bcm.edu	37	11	111933142	111933142	+	Silent	SNP	T	T	A			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr11:111933142T>A	ENST00000280346.6	+	14	2486	c.1827T>A	c.(1825-1827)gcT>gcA	p.A609A	DLAT_ENST00000537636.1_Silent_p.A380A|DLAT_ENST00000393051.1_Silent_p.A504A	NM_001931.4	NP_001922.2	P10515	ODP2_HUMAN	dihydrolipoamide S-acetyltransferase	609	Catalytic. {ECO:0000250}.				cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial pyruvate dehydrogenase complex (GO:0005967)|mitochondrion (GO:0005739)	dihydrolipoyllysine-residue acetyltransferase activity (GO:0004742)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)	22		all_cancers(61;4.53e-11)|all_epithelial(67;2.76e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;4.87e-07)|BRCA - Breast invasive adenocarcinoma(274;6.83e-07)|all cancers(92;9.63e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0557)		TTGATGTGGCTAGCATGATGT	0.423																																					p.A609A		Atlas-SNP	.											.	DLAT	39	.	0			c.T1827A						PASS	.						154.0	159.0	157.0					11																	111933142		2201	4297	6498	SO:0001819	synonymous_variant	1737	exon14			TGTGGCTAGCATG	Y00978	CCDS8354.1	11q23.1	2008-02-05	2008-02-04		ENSG00000150768	ENSG00000150768	2.3.1.12		2896	protein-coding gene	gene with protein product	"""E2 component of pyruvate dehydrogenase complex"""	608770		DLTA		8102256	Standard	NM_001931		Approved	PDC-E2	uc001pmo.3	P10515	OTTHUMG00000133751	ENST00000280346.6:c.1827T>A	chr11.hg19:g.111933142T>A		56.0	0.0	.		50.0	11.0	.	NM_001931	Q16783|Q53EP3	Silent	SNP	ENST00000280346.6	hg19	CCDS8354.1																																																																																			.	.	.	none		0.423	DLAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258167.1	NM_001931	
TMPRSS13	84000	hgsc.bcm.edu	37	11	117789218	117789218	+	Silent	SNP	C	C	T			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr11:117789218C>T	ENST00000430170.2	-	2	444	c.357G>A	c.(355-357)gtG>gtA	p.V119V	TMPRSS13_ENST00000528626.1_Silent_p.V119V|TMPRSS13_ENST00000524993.1_Silent_p.V119V|TMPRSS13_ENST00000445164.2_Silent_p.V119V|TMPRSS13_ENST00000526090.1_Silent_p.V119V	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	119						blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		TAACAAGGTACACTCTGGTTG	0.617																																					p.V119V		Atlas-SNP	.											.	TMPRSS13	75	.	0			c.G357A						PASS	.						80.0	91.0	87.0					11																	117789218		2096	4215	6311	SO:0001819	synonymous_variant	84000	exon2			AAGGTACACTCTG	AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.357G>A	chr11.hg19:g.117789218C>T		112.0	0.0	.		89.0	40.0	.	NM_001206790	B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Silent	SNP	ENST00000430170.2	hg19	CCDS58185.1																																																																																			.	.	.	none		0.617	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1	NM_032046	
KIF21A	55605	hgsc.bcm.edu	37	12	39695383	39695383	+	Silent	SNP	G	G	C	rs576774677		TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr12:39695383G>C	ENST00000361418.5	-	37	4845	c.4830C>G	c.(4828-4830)gtC>gtG	p.V1610V	KIF21A_ENST00000544797.2_Silent_p.V1573V|KIF21A_ENST00000361961.3_Silent_p.V1597V|KIF21A_ENST00000541463.2_Silent_p.V1557V|KIF21A_ENST00000395670.3_Silent_p.V1611V			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	1610					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				CCATGTTCCAGACTTTCAAAA	0.478													G|||	1	0.000199681	0.0	0.0	5008	,	,		16506	0.0		0.0	False		,,,				2504	0.001				p.V1610V		Atlas-SNP	.											.	KIF21A	238	.	0			c.C4830G						PASS	.						153.0	158.0	156.0					12																	39695383		2203	4300	6503	SO:0001819	synonymous_variant	55605	exon37			GTTCCAGACTTTC	AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.4830C>G	chr12.hg19:g.39695383G>C		226.0	1.0	.		243.0	123.0	.	NM_001173464	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Silent	SNP	ENST00000361418.5	hg19	CCDS53776.1	.	.	.	.	.	.	.	.	.	.	G	8.051	0.766015	0.15983	.	.	ENSG00000139116	ENST00000552961	.	.	.	4.71	0.618	0.17624	.	.	.	.	.	T	0.51058	0.1652	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35025	-0.9805	4	.	.	.	.	5.3056	0.15801	0.2279:0.277:0.4952:0.0	.	.	.	.	C	911	.	.	S	-	2	0	KIF21A	37981650	0.996000	0.38824	0.987000	0.45799	0.989000	0.77384	0.321000	0.19558	-0.055000	0.13244	-0.145000	0.13849	TCT	.	.	.	none		0.478	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403581.1	NM_017641	
HDAC7	51564	hgsc.bcm.edu	37	12	48181543	48181543	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr12:48181543C>G	ENST00000427332.2	-	21	2444	c.2288G>C	c.(2287-2289)gGa>gCa	p.G763A	HDAC7_ENST00000354334.3_Missense_Mutation_p.G765A|HDAC7_ENST00000080059.7_Missense_Mutation_p.G802A|HDAC7_ENST00000552960.1_Missense_Mutation_p.G785A|HDAC7_ENST00000488927.1_5'Flank|HDAC7_ENST00000380610.4_Missense_Mutation_p.G819A			Q8WUI4	HDAC7_HUMAN	histone deacetylase 7	763	Histone deacetylase.				cell-cell junction assembly (GO:0007043)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25				GBM - Glioblastoma multiforme(48;0.137)		GTCCAGACCTCCAGCCCAGGC	0.617																																					p.G802A		Atlas-SNP	.											.	HDAC7	71	.	0			c.G2405C						PASS	.						30.0	32.0	31.0					12																	48181543		2201	4300	6501	SO:0001583	missense	51564	exon21			AGACCTCCAGCCC	AF239243	CCDS8756.2, CCDS41776.1	12q13.1	2008-02-25	2008-02-25	2008-02-25	ENSG00000061273	ENSG00000061273			14067	protein-coding gene	gene with protein product		606542	"""histone deacetylase 7A"""	HDAC7A		10922406, 10640276	Standard	NM_015401		Approved	DKFZP586J0917	uc010slo.2	Q8WUI4	OTTHUMG00000152968	ENST00000427332.2:c.2288G>C	chr12.hg19:g.48181543C>G	ENSP00000404394:p.Gly763Ala	151.0	0.0	.		134.0	68.0	.	NM_015401	B3KY08|B4DWI0|B4E0Q5|Q6P1W9|Q6W9G7|Q7Z4K2|Q7Z5I1|Q96K01|Q9BR73|Q9H7L0|Q9NW41|Q9NWA9|Q9NYK9|Q9UFU7	Missense_Mutation	SNP	ENST00000427332.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.8|26.8	4.771508|4.771508	0.90108|0.90108	.|.	.|.	ENSG00000061273|ENSG00000061273	ENST00000548080|ENST00000080059;ENST00000354334;ENST00000552960;ENST00000380610;ENST00000427332	.|T;T;T;T;T	.|0.68903	.|-0.36;-0.36;-0.36;-0.36;-0.36	4.97|4.97	4.97|4.97	0.65823|0.65823	.|Histone deacetylase domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.73552|0.73552	0.3601|0.3601	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	D|D	1|1	.|D;P;P;D	.|0.63046	.|0.971;0.918;0.955;0.992	.|P;P;P;P	.|0.62649	.|0.786;0.516;0.809;0.905	T|T	0.76575|0.76575	-0.2909|-0.2909	5|10	.|0.72032	.|D	.|0.01	.|.	17.2281|17.2281	0.86977|0.86977	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|763;802;785;765	.|Q8WUI4;Q8WUI4-5;Q8WUI4-6;Q8WUI4-7	.|HDAC7_HUMAN;.;.;.	Q|A	195|802;765;785;819;763	.|ENSP00000080059:G802A;ENSP00000351326:G765A;ENSP00000448532:G785A;ENSP00000369984:G819A;ENSP00000404394:G763A	.|ENSP00000080059:G802A	E|G	-|-	1|2	0|0	HDAC7|HDAC7	46467810|46467810	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.988000|0.988000	0.76386|0.76386	6.037000|6.037000	0.70956|0.70956	2.487000|2.487000	0.83934|0.83934	0.485000|0.485000	0.47835|0.47835	GAG|GGA	.	.	.	none		0.617	HDAC7-013	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000328804.2		
NAA16	79612	hgsc.bcm.edu	37	13	41936177	41936177	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr13:41936177C>T	ENST00000379406.3	+	13	1745	c.1421C>T	c.(1420-1422)tCt>tTt	p.S474F	NAA16_ENST00000379367.3_Missense_Mutation_p.S474F	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	474					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						GAAGGAACATCTGCCATGGAA	0.388																																					p.S474F		Atlas-SNP	.											.	NAA16	74	.	0			c.C1421T						PASS	.						101.0	99.0	100.0					13																	41936177		2203	4300	6503	SO:0001583	missense	79612	exon13			GAACATCTGCCAT	AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.1421C>T	chr13.hg19:g.41936177C>T	ENSP00000368716:p.Ser474Phe	65.0	0.0	.		63.0	22.0	.	NM_024561	B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Missense_Mutation	SNP	ENST00000379406.3	hg19	CCDS9379.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.028782	0.75504	.	.	ENSG00000172766	ENST00000379367;ENST00000379406	T;T	0.47869	0.83;0.83	5.26	5.26	0.73747	Tetratricopeptide-like helical (1);	0.076588	0.56097	D	0.000030	T	0.71384	0.3333	M	0.81497	2.545	0.58432	D	0.999999	D	0.69078	0.997	D	0.71414	0.973	T	0.74907	-0.3504	10	0.66056	D	0.02	-13.9844	19.2111	0.93755	0.0:1.0:0.0:0.0	.	474	Q6N069	NAA16_HUMAN	F	474	ENSP00000368674:S474F;ENSP00000368716:S474F	ENSP00000368674:S474F	S	+	2	0	NAA16	40834177	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.307000	0.78920	2.623000	0.88846	0.655000	0.94253	TCT	.	.	.	none		0.388	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044672.2	NM_018527	
DCT	1638	hgsc.bcm.edu	37	13	95121020	95121020	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr13:95121020G>A	ENST00000377028.5	-	2	988	c.575C>T	c.(574-576)tCt>tTt	p.S192F	DCT_ENST00000446125.1_Missense_Mutation_p.S192F|DCT_ENST00000490854.1_5'Flank	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	192					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		ATCTCTAACAGAATAATAATG	0.438																																					p.S192F		Atlas-SNP	.											.	DCT	186	.	0			c.C575T						PASS	.						102.0	107.0	105.0					13																	95121020		2203	4300	6503	SO:0001583	missense	1638	exon2			CTAACAGAATAAT	D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.575C>T	chr13.hg19:g.95121020G>A	ENSP00000366227:p.Ser192Phe	54.0	0.0	.		44.0	17.0	.	NM_001129889	Q09GT4	Missense_Mutation	SNP	ENST00000377028.5	hg19	CCDS9470.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782531	0.90282	.	.	ENSG00000080166	ENST00000377028;ENST00000446125	D;D	0.98792	-5.14;-5.14	5.69	5.69	0.88448	Tyrosinase (1);Uncharacterised domain, di-copper centre (2);	0.000000	0.85682	D	0.000000	D	0.99045	0.9673	M	0.71206	2.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99869	1.1094	10	0.62326	D	0.03	-23.5448	19.8199	0.96589	0.0:0.0:1.0:0.0	.	192;192	Q09GT4;P40126	.;TYRP2_HUMAN	F	192	ENSP00000366227:S192F;ENSP00000392762:S192F	ENSP00000366227:S192F	S	-	2	0	DCT	93919021	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.677000	0.91161	0.655000	0.94253	TCT	.	.	.	none		0.438	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045461.3		
COL4A2	1284	hgsc.bcm.edu	37	13	111082947	111082947	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr13:111082947G>A	ENST00000360467.5	+	10	947	c.641G>A	c.(640-642)gGg>gAg	p.G214E	COL4A2_ENST00000462309.1_3'UTR	NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	214	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GGAGCTCCAGGGAGACCAGTA	0.567																																					p.G214E		Atlas-SNP	.											.	COL4A2	178	.	0			c.G641A						PASS	.						90.0	94.0	93.0					13																	111082947		1911	4118	6029	SO:0001583	missense	1284	exon10			CTCCAGGGAGACC	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.641G>A	chr13.hg19:g.111082947G>A	ENSP00000353654:p.Gly214Glu	145.0	0.0	.		100.0	45.0	.	NM_001846	Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	ENST00000360467.5	hg19	CCDS41907.1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.336498	0.60963	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.99353	-5.77	5.28	4.44	0.53790	.	0.119241	0.37530	N	0.002060	D	0.99190	0.9719	H	0.97265	3.97	0.80722	D	1	P	0.36974	0.576	B	0.39706	0.307	D	0.98740	1.0716	10	0.87932	D	0	.	11.9483	0.52940	0.0805:0.0:0.9195:0.0	.	214	P08572	CO4A2_HUMAN	E	214	ENSP00000353654:G214E	ENSP00000257309:G214E	G	+	2	0	COL4A2	109880948	1.000000	0.71417	0.780000	0.31762	0.927000	0.56198	6.287000	0.72671	1.215000	0.43411	0.650000	0.86243	GGG	.	.	.	none		0.567	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2	NM_001846	
PELI2	57161	hgsc.bcm.edu	37	14	56746403	56746403	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr14:56746403T>C	ENST00000267460.4	+	3	503	c.217T>C	c.(217-219)Tgc>Cgc	p.C73R		NM_021255.2	NP_067078.1	Q9HAT8	PELI2_HUMAN	pellino E3 ubiquitin protein ligase family member 2	73	FHA; atypical.				innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein phosphorylation (GO:0001934)|protein ubiquitination (GO:0016567)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)	ligase activity (GO:0016874)			kidney(6)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	22						GGCTATCAGCTGCAAAGGTCA	0.363																																					p.C73R		Atlas-SNP	.											.	PELI2	55	.	0			c.T217C						PASS	.						116.0	113.0	114.0					14																	56746403		2203	4300	6503	SO:0001583	missense	57161	exon3			ATCAGCTGCAAAG	AF302502	CCDS9726.1	14q21	2012-02-23	2012-02-23		ENSG00000139946	ENSG00000139946		"""Pellino homologs"""	8828	protein-coding gene	gene with protein product		614798	"""pellino (Drosophila) homolog 2"", ""pellino homolog 2 (Drosophila)"""			11306823, 12860405	Standard	XM_006720211		Approved		uc001xch.3	Q9HAT8	OTTHUMG00000152336	ENST00000267460.4:c.217T>C	chr14.hg19:g.56746403T>C	ENSP00000267460:p.Cys73Arg	47.0	0.0	.		44.0	17.0	.	NM_021255	B2RDY5	Missense_Mutation	SNP	ENST00000267460.4	hg19	CCDS9726.1	.	.	.	.	.	.	.	.	.	.	T	10.43	1.348530	0.24426	.	.	ENSG00000139946	ENST00000267460	T	0.40225	1.04	4.84	3.66	0.41972	.	0.233454	0.51477	D	0.000086	T	0.24547	0.0595	N	0.11427	0.14	0.80722	D	1	B	0.22909	0.077	B	0.28139	0.086	T	0.05582	-1.0876	10	0.42905	T	0.14	-17.5883	9.3117	0.37910	0.2868:0.0:0.0:0.7132	.	73	Q9HAT8	PELI2_HUMAN	R	73	ENSP00000267460:C73R	ENSP00000267460:C73R	C	+	1	0	PELI2	55816156	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	0.741000	0.26202	0.937000	0.37394	0.455000	0.32223	TGC	.	.	.	none		0.363	PELI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276925.1		
NOXRED1	122945	hgsc.bcm.edu	37	14	77872299	77872299	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr14:77872299C>A	ENST00000380835.2	-	5	1028	c.862G>T	c.(862-864)Gat>Tat	p.D288Y		NM_001113475.2	NP_001106946.1	Q6NXP6	NXRD1_HUMAN	NADP-dependent oxidoreductase domain containing 1	288					proline biosynthetic process (GO:0006561)		pyrroline-5-carboxylate reductase activity (GO:0004735)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	9						CTGACAAAATCTGTTAATTGC	0.458																																					p.D288Y		Atlas-SNP	.											.	NOXRED1	23	.	0			c.G862T						PASS	.						99.0	90.0	92.0					14																	77872299		1568	3582	5150	SO:0001583	missense	122945	exon5			CAAAATCTGTTAA	AK057371	CCDS45142.1	14q24.3	2011-09-30	2011-09-30	2011-09-30	ENSG00000165555	ENSG00000165555			20487	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 148"""	C14orf148			Standard	NM_001113475		Approved	FLJ32809	uc001xtr.3	Q6NXP6	OTTHUMG00000171554	ENST00000380835.2:c.862G>T	chr14.hg19:g.77872299C>A	ENSP00000370215:p.Asp288Tyr	67.0	0.0	.		56.0	19.0	.	NM_001113475	B3KQ47|O95435	Missense_Mutation	SNP	ENST00000380835.2	hg19	CCDS45142.1	.	.	.	.	.	.	.	.	.	.	C	16.19	3.053689	0.55218	.	.	ENSG00000165555	ENST00000380835	T	0.58060	0.36	5.66	1.33	0.21861	.	0.389223	0.26446	N	0.024337	T	0.58779	0.2146	L	0.56769	1.78	0.30911	N	0.729061	D	0.61697	0.99	P	0.57009	0.811	T	0.62728	-0.6793	10	0.72032	D	0.01	-7.4072	9.5769	0.39463	0.1517:0.4074:0.4409:0.0	.	288	Q6NXP6	NXRD1_HUMAN	Y	288	ENSP00000370215:D288Y	ENSP00000370215:D288Y	D	-	1	0	C14orf148	76942052	0.233000	0.23772	0.081000	0.20488	0.896000	0.52359	0.741000	0.26202	0.267000	0.21916	0.460000	0.39030	GAT	.	.	.	none		0.458	NOXRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414103.1	NM_138791	
EIF2AK4	440275	hgsc.bcm.edu	37	15	40226434	40226434	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr15:40226434A>G	ENST00000263791.5	+	1	81	c.38A>G	c.(37-39)gAc>gGc	p.D13G	EIF2AK4_ENST00000560648.1_Missense_Mutation_p.D13G|EIF2AK4_ENST00000382727.2_Missense_Mutation_p.D13G|EIF2AK4_ENST00000559624.1_Missense_Mutation_p.D13G	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	13					cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		cgcggccgggACGAGCCTCCG	0.756																																					p.D13G		Atlas-SNP	.											.	EIF2AK4	107	.	0			c.A38G						PASS	.						12.0	16.0	14.0					15																	40226434		1850	4077	5927	SO:0001583	missense	440275	exon1			GCCGGGACGAGCC	AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.38A>G	chr15.hg19:g.40226434A>G	ENSP00000263791:p.Asp13Gly	101.0	0.0	.		79.0	16.0	.	NM_001013703	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Missense_Mutation	SNP	ENST00000263791.5	hg19	CCDS42016.1	.	.	.	.	.	.	.	.	.	.	A	16.20	3.055510	0.55325	.	.	ENSG00000128829	ENST00000263791;ENST00000382727	T;T	0.69306	-0.39;-0.38	4.33	0.326	0.15908	.	0.311332	0.29551	N	0.011825	T	0.34687	0.0906	N	0.03608	-0.345	0.20975	N	0.999813	B;B	0.16603	0.018;0.013	B;B	0.19391	0.011;0.025	T	0.16305	-1.0407	10	0.23302	T	0.38	-2.8305	4.9778	0.14149	0.4581:0.4284:0.1134:0.0	.	13;13	Q9P2K8;Q9P2K8-3	E2AK4_HUMAN;.	G	13	ENSP00000263791:D13G;ENSP00000372174:D13G	ENSP00000263791:D13G	D	+	2	0	EIF2AK4	38013726	1.000000	0.71417	0.777000	0.31699	0.957000	0.61999	0.557000	0.23454	0.188000	0.20168	0.374000	0.22700	GAC	.	.	.	none		0.756	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1		
FBN1	2200	hgsc.bcm.edu	37	15	48780565	48780565	+	Splice_Site	SNP	C	C	T			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr15:48780565C>T	ENST00000316623.5	-	26	3663	c.3208G>A	c.(3208-3210)Gac>Aac	p.D1070N		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1070	EGF-like 16; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		ATTAACTGACCTGTGCAGTTC	0.473																																					p.D1070N		Atlas-SNP	.											.	FBN1	310	.	0			c.G3208A						PASS	.						91.0	87.0	88.0					15																	48780565		2198	4296	6494	SO:0001630	splice_region_variant	2200	exon26			ACTGACCTGTGCA	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.3208+1G>A	chr15.hg19:g.48780565C>T		79.0	0.0	.		75.0	21.0	.	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	hg19	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	C	36	5.830889	0.97003	.	.	ENSG00000166147	ENST00000316623	D	0.99051	-5.37	6.17	6.17	0.99709	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99184	0.9717	M	0.69248	2.105	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.99659	1.0993	9	.	.	.	.	20.4745	0.99168	0.0:1.0:0.0:0.0	.	1070	P35555	FBN1_HUMAN	N	1070	ENSP00000325527:D1070N	.	D	-	1	0	FBN1	46567857	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GAC	.	.	.	none		0.473	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		Missense_Mutation
CEP152	22995	hgsc.bcm.edu	37	15	49031304	49031304	+	Silent	SNP	G	G	A			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr15:49031304G>A	ENST00000380950.2	-	27	4462	c.4275C>T	c.(4273-4275)aaC>aaT	p.N1425N	CEP152_ENST00000399334.3_Silent_p.N1369N	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	1425					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		GATGCTCTGAGTTCTCTAACA	0.443																																					p.N1425N		Atlas-SNP	.											.	CEP152	145	.	0			c.C4275T						PASS	.						172.0	159.0	163.0					15																	49031304		1905	4128	6033	SO:0001819	synonymous_variant	22995	exon27			CTCTGAGTTCTCT	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.4275C>T	chr15.hg19:g.49031304G>A		85.0	0.0	.		74.0	30.0	.	NM_001194998	E7ER66|Q17RV1|Q6NTA0	Silent	SNP	ENST00000380950.2	hg19	CCDS58361.1																																																																																			.	.	.	none		0.443	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985	
AGBL1	123624	hgsc.bcm.edu	37	15	86790909	86790909	+	Missense_Mutation	SNP	C	C	A	rs370819428		TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr15:86790909C>A	ENST00000441037.2	+	6	491	c.396C>A	c.(394-396)aaC>aaA	p.N132K	AGBL1_ENST00000421325.2_Missense_Mutation_p.N132K	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	132					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						CAGAGTCGAACGGCCGCAGAG	0.557																																					p.N132K		Atlas-SNP	.											.	AGBL1	151	.	0			c.C396A						PASS	.						20.0	22.0	21.0					15																	86790909		2113	4233	6346	SO:0001583	missense	123624	exon6			GTCGAACGGCCGC	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.396C>A	chr15.hg19:g.86790909C>A	ENSP00000413001:p.Asn132Lys	102.0	0.0	.		94.0	5.0	.	NM_152336	A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	ENST00000441037.2	hg19	CCDS58398.1	.	.	.	.	.	.	.	.	.	.	C	19.78	3.891754	0.72524	.	.	ENSG00000166748	ENST00000441037;ENST00000421325	T	0.41400	1.0	5.16	4.25	0.50352	Armadillo-like helical (1);Armadillo-type fold (1);	.	.	.	.	T	0.63129	0.2485	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.66492	-0.5910	9	0.72032	D	0.01	-11.8366	11.0423	0.47838	0.0:0.9138:0.0:0.0862	.	132	Q96MI9	CBPC4_HUMAN	K	161;132	ENSP00000397173:N132K	ENSP00000397173:N132K	N	+	3	2	AGBL1	84591913	1.000000	0.71417	0.988000	0.46212	0.915000	0.54546	1.427000	0.34881	1.170000	0.42753	0.561000	0.74099	AAC	.	.	.	alt		0.557	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336	
ZNF689	115509	hgsc.bcm.edu	37	16	30616527	30616527	+	Silent	SNP	G	G	T			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr16:30616527G>T	ENST00000287461.3	-	3	898	c.561C>A	c.(559-561)tcC>tcA	p.S187S	ZNF689_ENST00000566673.1_5'UTR|RP11-146F11.5_ENST00000563540.1_RNA	NM_138447.1	NP_612456.1	Q96CS4	ZN689_HUMAN	zinc finger protein 689	187					regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(1)	14			Colorectal(24;0.198)			GGGATGGATAGGAAAAGCGGC	0.587																																					p.S187S		Atlas-SNP	.											.	ZNF689	48	.	0			c.C561A						PASS	.						71.0	75.0	74.0					16																	30616527		2197	4300	6497	SO:0001819	synonymous_variant	115509	exon3			TGGATAGGAAAAG	BC014000	CCDS10686.1	16p11.2	2013-01-08			ENSG00000156853	ENSG00000156853		"""Zinc fingers, C2H2-type"", ""-"""	25173	protein-coding gene	gene with protein product							Standard	NM_138447		Approved	FLJ90415	uc031qvq.1	Q96CS4	OTTHUMG00000132415	ENST00000287461.3:c.561C>A	chr16.hg19:g.30616527G>T		125.0	0.0	.		79.0	26.0	.	NM_138447	Q658J5	Silent	SNP	ENST00000287461.3	hg19	CCDS10686.1																																																																																			.	.	.	none		0.587	ZNF689-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255552.1	NM_138447	
MYH1	4619	hgsc.bcm.edu	37	17	10404987	10404987	+	Missense_Mutation	SNP	A	A	T			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr17:10404987A>T	ENST00000226207.5	-	26	3366	c.3272T>A	c.(3271-3273)aTg>aAg	p.M1091K	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1091					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CAGACCGCTCATTTCAAACTC	0.378																																					p.M1091K		Atlas-SNP	.											.	MYH1	403	.	0			c.T3272A						PASS	.						102.0	96.0	98.0					17																	10404987		2203	4299	6502	SO:0001583	missense	4619	exon26			CCGCTCATTTCAA		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3272T>A	chr17.hg19:g.10404987A>T	ENSP00000226207:p.Met1091Lys	151.0	0.0	.		129.0	80.0	.	NM_005963	Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	hg19	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	A	16.68	3.189938	0.58017	.	.	ENSG00000109061	ENST00000226207	D	0.82893	-1.66	5.51	5.51	0.81932	Myosin tail (1);	0.122232	0.36519	U	0.002544	D	0.84306	0.5443	M	0.81239	2.535	0.58432	D	0.999997	B	0.09022	0.002	B	0.09377	0.004	T	0.82299	-0.0526	10	0.72032	D	0.01	.	15.9255	0.79611	1.0:0.0:0.0:0.0	.	1091	P12882	MYH1_HUMAN	K	1091	ENSP00000226207:M1091K	ENSP00000226207:M1091K	M	-	2	0	MYH1	10345712	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.129000	0.71657	2.221000	0.72209	0.528000	0.53228	ATG	.	.	.	none		0.378	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
PHF12	57649	hgsc.bcm.edu	37	17	27251300	27251300	+	Silent	SNP	C	C	T	rs200428291		TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr17:27251300C>T	ENST00000332830.4	-	4	1152	c.342G>A	c.(340-342)gaG>gaA	p.E114E	PHF12_ENST00000268756.3_Silent_p.E114E|RP11-20B24.5_ENST00000582631.1_RNA|PHF12_ENST00000577226.1_Silent_p.E114E|RP11-20B24.5_ENST00000580782.1_RNA|PHF12_ENST00000582655.1_5'UTR	NM_001033561.1	NP_001028733.1			PHD finger protein 12											breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			CATGACCCAGCTCCTTTTTCT	0.488																																					p.E114E		Atlas-SNP	.											.	PHF12	69	.	0			c.G342A						PASS	.						169.0	138.0	149.0					17																	27251300		2203	4300	6503	SO:0001819	synonymous_variant	57649	exon4			ACCCAGCTCCTTT	AB040956	CCDS11247.1, CCDS32598.1	17q11.2	2013-01-28			ENSG00000109118	ENSG00000109118		"""Zinc fingers, PHD-type"""	20816	protein-coding gene	gene with protein product						11390640	Standard	XM_005258015		Approved	PF1, KIAA1523	uc002hdg.1	Q96QT6	OTTHUMG00000132676	ENST00000332830.4:c.342G>A	chr17.hg19:g.27251300C>T		53.0	0.0	.		86.0	22.0	.	NM_020889		Silent	SNP	ENST00000332830.4	hg19	CCDS32598.1																																																																																			.	C|0.999;G|0.001	.	alt		0.488	PHF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255941.1	NM_020889	
NBR1	4077	hgsc.bcm.edu	37	17	41341718	41341718	+	Silent	SNP	T	T	C			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr17:41341718T>C	ENST00000422280.1	+	8	1053	c.594T>C	c.(592-594)ccT>ccC	p.P198P	NBR1_ENST00000341165.6_Silent_p.P198P|NBR1_ENST00000589872.1_Silent_p.P198P|NBR1_ENST00000542611.1_Silent_p.P177P|NBR1_ENST00000590996.1_Silent_p.P198P|NBR1_ENST00000389312.4_Silent_p.P198P	NM_031858.2	NP_114064.1	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	198					macroautophagy (GO:0016236)|negative regulation of osteoblast differentiation (GO:0045668)|protein oligomerization (GO:0051259)|regulation of bone mineralization (GO:0030500)|regulation of stress-activated MAPK cascade (GO:0032872)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	mitogen-activated protein kinase binding (GO:0051019)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	24		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		TCTCAATGCCTACTTCAGAAG	0.438																																					p.P198P		Atlas-SNP	.											.	NBR1	55	.	0			c.T594C						PASS	.						141.0	135.0	137.0					17																	41341718		1864	4098	5962	SO:0001819	synonymous_variant	4077	exon8			AATGCCTACTTCA	X76952	CCDS45694.1	17q21.31	2008-02-01	2005-02-15	2005-02-16		ENSG00000188554			6746	protein-coding gene	gene with protein product		166945	"""membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125)"""	M17S2		8069304	Standard	XM_006721903		Approved	CA125, KIAA0049, 1A1-3B	uc010whv.2	Q14596		ENST00000422280.1:c.594T>C	chr17.hg19:g.41341718T>C		114.0	0.0	.		123.0	23.0	.	NM_031862	Q13173|Q15026|Q5J7Q8|Q96GB6|Q9NRF7	Silent	SNP	ENST00000422280.1	hg19	CCDS45694.1																																																																																			.	.	.	none		0.438	NBR1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453461.1	NM_005899	
SLC4A1	6521	hgsc.bcm.edu	37	17	42335164	42335164	+	Missense_Mutation	SNP	G	G	A	rs373768879		TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr17:42335164G>A	ENST00000262418.6	-	12	1449	c.1294C>T	c.(1294-1296)Cgg>Tgg	p.R432W	AC003043.1_ENST00000597382.1_5'Flank|SLC4A1_ENST00000471005.1_5'Flank	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	432	Membrane (anion exchange).		R -> W (in ELO antigen).		anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		ATCTGGTTCCGGGTCTTTTCT	0.587																																					p.R432W		Atlas-SNP	.											.	SLC4A1	104	.	0			c.C1294T	GRCh37	CM983769	SLC4A1	M		PASS	.	G	TRP/ARG	0,4406		0,0,2203	76.0	70.0	72.0		1294	-11.1	0.0	17		72	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC4A1	NM_000342.3	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	432/912	42335164	1,13005	2203	4300	6503	SO:0001583	missense	6521	exon12			GGTTCCGGGTCTT		CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.1294C>T	chr17.hg19:g.42335164G>A	ENSP00000262418:p.Arg432Trp	82.0	0.0	.		105.0	66.0	.	NM_000342	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Missense_Mutation	SNP	ENST00000262418.6	hg19	CCDS11481.1	.	.	.	.	.	.	.	.	.	.	g	9.617	1.132909	0.21041	0.0	1.16E-4	ENSG00000004939	ENST00000262418	T	0.79554	-1.28	5.57	-11.1	0.00147	Bicarbonate transporter, C-terminal (1);	1.964930	0.02322	N	0.073075	T	0.78616	0.4311	L	0.48642	1.525	0.09310	N	1	D;P	0.57571	0.98;0.903	P;P	0.56088	0.571;0.791	T	0.80233	-0.1467	10	0.87932	D	0	.	5.1981	0.15249	0.1499:0.4325:0.2322:0.1855	.	432;432	E2RVJ0;P02730	.;B3AT_HUMAN	W	432	ENSP00000262418:R432W	ENSP00000262418:R432W	R	-	1	2	SLC4A1	39690690	0.000000	0.05858	0.000000	0.03702	0.267000	0.26476	-2.027000	0.01433	-3.368000	0.00177	-2.455000	0.00206	CGG	.	.	.	weak		0.587	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346194.1	NM_000342	
PSMG2	56984	hgsc.bcm.edu	37	18	12720515	12720515	+	Silent	SNP	C	C	T			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr18:12720515C>T	ENST00000317615.6	+	5	1096	c.414C>T	c.(412-414)ccC>ccT	p.P138P	PSMG2_ENST00000590217.1_Silent_p.P138P|PSMG2_ENST00000585331.2_Silent_p.P107P	NM_020232.4	NP_064617.2			proteasome (prosome, macropain) assembly chaperone 2											lung(1)|prostate(2)|skin(1)	4						CTAGTACTCCCTTCCGGTACC	0.348																																					p.P138P		Atlas-SNP	.											.	PSMG2	17	.	0			c.C414T						PASS	.						49.0	48.0	48.0					18																	12720515		2203	4299	6502	SO:0001819	synonymous_variant	56984	exon5			TACTCCCTTCCGG	AF276707	CCDS11862.1, CCDS67440.1	18p11.21	2012-01-25	2007-10-23	2007-10-23	ENSG00000128789	ENSG00000128789			24929	protein-coding gene	gene with protein product	"""hepatocellular carcinoma susceptibility protein"", ""CD40 ligand-activated specific transcript 3"""	609702	"""tumor necrosis factor superfamily, member 5-induced protein 1"""	TNFSF5IP1		11854909, 12147697, 17189198	Standard	NM_147163		Approved	HCCA3, MDS003, MGC15092, CLAST3, HsT1707, PAC2	uc002krk.3	Q969U7	OTTHUMG00000131703	ENST00000317615.6:c.414C>T	chr18.hg19:g.12720515C>T		118.0	0.0	.		94.0	4.0	.	NM_020232		Silent	SNP	ENST00000317615.6	hg19	CCDS11862.1																																																																																			.	.	.	none		0.348	PSMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254615.1	NM_020232	
DEFB116	245930	hgsc.bcm.edu	37	20	29891079	29891080	+	Missense_Mutation	DNP	TT	TT	CC			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr20:29891079_29891080TT>CC	ENST00000400549.1	-	2	243_244	c.244_245AA>GG	c.(244-246)AAg>GGg	p.K82G		NM_001037731.1	NP_001032820.1	Q30KQ4	DB116_HUMAN	defensin, beta 116	82					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				kidney(2)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	12	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			GTAATCCTCCTTCACATTTTTA	0.386																																					p.K82R|p.K82E		Atlas-SNP	.											.	DEFB116	18	.	0			c.A245G|c.A244G						PASS	.																																			SO:0001583	missense	245930	exon2			TCCTCCTTCACAT|CCTCCTTCACATT	DQ012020	CCDS42860.1	20q11.21	2008-07-17			ENSG00000215545	ENSG00000215545		"""Defensins, beta"""	18097	protein-coding gene	gene with protein product	"""defensin, beta 16"""					11854508, 16033865	Standard	NM_001037731		Approved	DEFB-16	uc010ztm.2	Q30KQ4	OTTHUMG00000159285	ENST00000400549.1:c.244_245delinsCC	chr20.hg19:g.29891079_29891080delinsCC	ENSP00000383396:p.Lys82Gly	124.0|121.0	0.0	.		76.0|77.0	28.0|29.0	.	NM_001037731		Missense_Mutation	SNP	ENST00000400549.1	hg19	CCDS42860.1																																																																																			.	.	.	none		0.386	DEFB116-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354403.1	NM_001037731	
CBFA2T2	9139	hgsc.bcm.edu	37	20	32199106	32199106	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr20:32199106G>C	ENST00000346541.3	+	4	949	c.412G>C	c.(412-414)Ggg>Cgg	p.G138R	CBFA2T2_ENST00000375279.2_Missense_Mutation_p.G138R|CBFA2T2_ENST00000492345.1_Missense_Mutation_p.G109R|CBFA2T2_ENST00000342704.6_Missense_Mutation_p.G129R|CBFA2T2_ENST00000397800.1_Missense_Mutation_p.G109R|CBFA2T2_ENST00000397798.2_Missense_Mutation_p.G109R|CBFA2T2_ENST00000359606.3_Missense_Mutation_p.G148R|CBFA2T2_ENST00000344201.3_Missense_Mutation_p.G109R	NM_005093.3	NP_005084.1	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 2	138	TAFH. {ECO:0000255|PROSITE- ProRule:PRU00440}.				epithelial cell differentiation (GO:0030855)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)	20						CCCTGAGATTGGGGAGAAGGT	0.507																																					p.G138R	Esophageal Squamous(174;142 1955 14837 21276 28041)	Atlas-SNP	.											.	CBFA2T2	93	.	0			c.G412C						PASS	.						107.0	103.0	104.0					20																	32199106		2203	4300	6503	SO:0001583	missense	9139	exon4			GAGATTGGGGAGA	AF052210	CCDS13221.1, CCDS46590.1	20q11	2007-01-29			ENSG00000078699	ENSG00000078699		"""Zinc fingers, MYND-type"""	1536	protein-coding gene	gene with protein product		603672				9790752	Standard	XM_006723886		Approved	MTGR1, ZMYND3	uc002wze.1	O43439	OTTHUMG00000032261	ENST00000346541.3:c.412G>C	chr20.hg19:g.32199106G>C	ENSP00000262653:p.Gly138Arg	83.0	0.0	.		80.0	32.0	.	NM_005093	B2RAE6|F8W6D7|Q5TGE4|Q5TGE5|Q5TGE6|Q5TGE7|Q8IWF3|Q96B06|Q96L00|Q9H436|Q9UJP8|Q9UJP9|Q9UP24	Missense_Mutation	SNP	ENST00000346541.3	hg19	CCDS13221.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.962319	0.92791	.	.	ENSG00000078699	ENST00000375279;ENST00000342704;ENST00000417366;ENST00000344201;ENST00000346541;ENST00000397800;ENST00000397798;ENST00000359606	T;T;T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83	5.69	5.69	0.88448	TAFH/NHR1 (3);	0.000000	0.85682	D	0.000000	T	0.71151	0.3306	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.73248	-0.4043	10	0.87932	D	0	-8.4321	19.812	0.96551	0.0:0.0:1.0:0.0	.	138;129	O43439;F8W6D7	MTG8R_HUMAN;.	R	138;129;129;109;138;109;109;148	ENSP00000364428:G138R;ENSP00000345810:G129R;ENSP00000408352:G129R;ENSP00000341865:G109R;ENSP00000262653:G138R;ENSP00000380902:G109R;ENSP00000380900:G109R;ENSP00000352622:G148R	ENSP00000345810:G129R	G	+	1	0	CBFA2T2	31662767	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.685000	0.91497	0.655000	0.94253	GGG	.	.	.	none		0.507	CBFA2T2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078708.2	NM_001032999	
AMER1	139285	hgsc.bcm.edu	37	X	63411064	63411064	+	Silent	SNP	C	C	G			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chrX:63411064C>G	ENST00000330258.3	-	2	2375	c.2103G>C	c.(2101-2103)ctG>ctC	p.L701L	AMER1_ENST00000403336.1_Silent_p.L701L|AMER1_ENST00000374869.3_Silent_p.L701L	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	701					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									AACGCTTCTCCAGAGGACGGA	0.537																																					p.L701L		Atlas-SNP	.											.	.	.	.	67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)	c.G2103C						PASS	.						52.0	46.0	48.0					X																	63411064		2203	4300	6503	SO:0001819	synonymous_variant	139285	exon2			CTTCTCCAGAGGA	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.2103G>C	chrX.hg19:g.63411064C>G		75.0	0.0	.		60.0	49.0	.	NM_152424	A2IB86|Q8N885	Silent	SNP	ENST00000330258.3	hg19	CCDS14377.2																																																																																			.	.	.	none		0.537	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
RPL36A	6173	hgsc.bcm.edu	37	X	100650416	100650416	+	Missense_Mutation	SNP	T	T	G			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chrX:100650416T>G	ENST00000553110.3	+	4	355	c.271T>G	c.(271-273)Ttt>Gtt	p.F91V	RPL36A_ENST00000471855.1_Missense_Mutation_p.F10V|RPL36A_ENST00000427805.2_Missense_Mutation_p.F127V|RPL36A-HNRNPH2_ENST00000409170.3_Missense_Mutation_p.I101M			P83881	RL36A_HUMAN	ribosomal protein L36a	91					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			liver(4)|lung(1)|prostate(1)	6						ATGCAAGCATTTTGAACTGGG	0.368																																					p.F127V		Atlas-SNP	.											.	.	.	.	0			c.T379G						PASS	.						38.0	43.0	41.0					X																	100650416		1376	2562	3938	SO:0001583	missense	0	exon4			AAGCATTTTGAAC	BC001781	CCDS14483.1, CCDS14483.2	Xq22.1	2011-04-06	2002-01-15	2002-01-18	ENSG00000241343	ENSG00000241343		"""L ribosomal proteins"""	10359	protein-coding gene	gene with protein product		300902	"""ribosomal protein L44"""	RPL44		3461443	Standard	NM_021029		Approved	L36A		P83881	OTTHUMG00000022027	ENST00000553110.3:c.271T>G	chrX.hg19:g.100650416T>G	ENSP00000446503:p.Phe91Val	118.0	0.0	.		115.0	87.0	.	NM_001199973	P09896|P10661|Q08ES5|Q5J9I6	Missense_Mutation	SNP	ENST00000553110.3	hg19		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	24.2|24.2|24.2	4.502877|4.502877|4.502877	0.85176|0.85176|0.85176	.|.|.	.|.|.	ENSG00000241343|ENSG00000241343|ENSG00000257529	ENST00000392994|ENST00000427805;ENST00000553110|ENST00000409170	.|T;T|.	.|0.51817|.	.|0.69;0.69|.	5.35|5.35|5.35	5.35|5.35|5.35	0.76521|0.76521|0.76521	.|Ribosomal protein, zinc-binding domain (1);|.	0.000000|0.000000|.	0.64402|0.64402|.	U|U|.	0.000006|0.000006|.	T|T|T	0.72930|0.72930|0.72930	0.3522|0.3522|0.3522	M|M|M	0.72894|0.72894|0.72894	2.215|2.215|2.215	0.41580|0.41580|0.41580	D|D|D	0.988736|0.988736|0.988736	.|D|.	.|0.62365|.	.|0.991|.	.|D|.	.|0.65684|.	.|0.937|.	T|T|T	0.73943|0.73943|0.73943	-0.3823|-0.3823|-0.3823	6|10|5	.|0.49607|.	.|T|.	.|0.09|.	.|.|.	14.3765|14.3765|14.3765	0.66881|0.66881|0.66881	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	.|91|.	.|P83881|.	.|RL36A_HUMAN|.	C|V|M	109|127;91|101	.|ENSP00000404375:F127V;ENSP00000446503:F91V|.	.|ENSP00000404375:F127V|.	F|F|I	+|+|+	2|1|3	0|0|3	RPL36A|RPL36A|RP1-164F3.9	100537072|100537072|100537072	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.997000|0.997000|0.997000	0.91878|0.91878|0.91878	7.651000|7.651000|7.651000	0.83577|0.83577|0.83577	1.773000|1.773000|1.773000	0.52216|0.52216|0.52216	0.486000|0.486000|0.486000	0.48141|0.48141|0.48141	TTT|TTT|ATT	.	.	.	none		0.368	RPL36A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_021029	
ENOX2	10495	hgsc.bcm.edu	37	X	129822852	129822852	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chrX:129822852A>G	ENST00000370927.1	-	3	346	c.325T>C	c.(325-327)Ttc>Ctc	p.F109L	ENOX2_ENST00000370935.1_Missense_Mutation_p.F80L|ENOX2_ENST00000492263.1_5'UTR|ENOX2_ENST00000394363.1_Missense_Mutation_p.F80L|ENOX2_ENST00000338144.3_Missense_Mutation_p.F109L			Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2	109	Pro-rich.				cell growth (GO:0016049)|oxidation-reduction process (GO:0055114)|regulation of growth (GO:0040008)|ultradian rhythm (GO:0007624)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|protein disulfide oxidoreductase activity (GO:0015035)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(3)	33						TTTGGAGGGAAGAGCGTGCAG	0.388																																					p.F109L	Ovarian(101;828 1506 2951 9500 35258)	Atlas-SNP	.											.	ENOX2	70	.	0			c.T325C						PASS	.						262.0	216.0	232.0					X																	129822852		2203	4300	6503	SO:0001583	missense	10495	exon6			GAGGGAAGAGCGT	AF207881	CCDS14626.1, CCDS14627.1	Xq25	2013-02-12	2007-03-23	2007-03-23	ENSG00000165675	ENSG00000165675		"""RNA binding motif (RRM) containing"""	2259	protein-coding gene	gene with protein product		300282	"""cytosolic ovarian carcinoma antigen 1"""	COVA1		8150545, 11888291	Standard	NM_006375		Approved	APK1, tNOX	uc004evw.3	Q16206	OTTHUMG00000022401	ENST00000370927.1:c.325T>C	chrX.hg19:g.129822852A>G	ENSP00000359965:p.Phe109Leu	49.0	0.0	.		53.0	38.0	.	NM_182314	A8K197|A8K1C2|Q5VTJ1|Q5VTJ2|Q8WUX0|Q9NTP6|Q9UH82	Missense_Mutation	SNP	ENST00000370927.1	hg19	CCDS14626.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.491368	0.84962	.	.	ENSG00000165675	ENST00000538435;ENST00000370935;ENST00000338144;ENST00000394363;ENST00000350369;ENST00000370927;ENST00000432489	T;T;T;T;T	0.73152	-0.72;-0.72;-0.72;-0.72;-0.72	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.81536	0.4843	M	0.73217	2.22	0.54753	D	0.999983	D	0.71674	0.998	D	0.79784	0.993	T	0.82112	-0.0618	9	.	.	.	-10.6533	11.7235	0.51696	1.0:0.0:0.0:0.0	.	109	Q16206	ENOX2_HUMAN	L	80;80;109;80;137;109;80	ENSP00000359973:F80L;ENSP00000337146:F109L;ENSP00000377890:F80L;ENSP00000359965:F109L;ENSP00000400304:F80L	.	F	-	1	0	ENOX2	129650533	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.761000	0.91691	1.897000	0.54924	0.417000	0.27973	TTC	.	.	.	none		0.388	ENOX2-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058277.1	NM_182314	
ACOT11	26027	hgsc.bcm.edu	37	1	55060319	55060319	+	Frame_Shift_Del	DEL	G	G	-			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr1:55060319delG	ENST00000371316.3	+	6	644	c.562delG	c.(562-564)gcafs	p.A188fs	ACOT11_ENST00000343744.2_Frame_Shift_Del_p.A188fs|ACOT11_ENST00000481208.1_3'UTR	NM_015547.3	NP_056362.1	Q8WXI4	ACO11_HUMAN	acyl-CoA thioesterase 11	188					fatty acid metabolic process (GO:0006631)|intracellular signal transduction (GO:0035556)|response to cold (GO:0009409)|response to temperature stimulus (GO:0009266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(3)|lung(5)|ovary(1)	17						CCTTGTCTATGCAGACACCAT	0.637																																					p.Y187X	Ovarian(148;1440 1861 22015 32453 51933)	Atlas-Indel,Pindel	.											.	ACOT11	105	.	0			c.561delT						PASS	.						56.0	52.0	53.0					1																	55060319		2203	4300	6503	SO:0001589	frameshift_variant	26027	exon6			.	AB014607	CCDS592.1, CCDS593.1	1p32.3	2011-09-13	2005-09-08	2005-09-08	ENSG00000162390	ENSG00000162390	3.1.2.-	"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	18156	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 14"""	606803	"""thioesterase, adipose associated"""	THEA		11696000, 16103133, 16940157	Standard	NM_015547		Approved	STARD14, BFIT, KIAA0707, BFIT1, THEM1	uc001cxl.2	Q8WXI4	OTTHUMG00000009891	ENST00000371316.3:c.562delG	chr1.hg19:g.55060319delG	ENSP00000360366:p.Ala188fs	175.0	0.0	0		166.0	59.0	0.355422	NM_147161	B1AQ22|D3DQ50|O75187|Q52LP1|Q53ER9|Q96DI1|Q9H883	Frame_Shift_Del	DEL	ENST00000371316.3	hg19	CCDS592.1																																																																																			.	.	.	none		0.637	ACOT11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027356.1	NM_015547	
TTYH3	80727	hgsc.bcm.edu	37	7	2686778	2686778	+	Frame_Shift_Del	DEL	C	C	-			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr7:2686778delC	ENST00000258796.7	+	3	501	c.296delC	c.(295-297)gccfs	p.A99fs	TTYH3_ENST00000403167.1_5'Flank|TTYH3_ENST00000407643.1_Frame_Shift_Del_p.A99fs	NM_025250.2	NP_079526.1	Q9C0H2	TTYH3_HUMAN	tweety family member 3	99					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|intracellular calcium activated chloride channel activity (GO:0005229)			kidney(1)|large_intestine(3)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	17		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)		CTCTCCAGCGCCGGCATCGCA	0.731																																					p.A99fs		Atlas-Indel,Pindel	.											.	TTYH3	36	.	0			c.295delG						PASS	.						13.0	16.0	15.0					7																	2686778		2173	4284	6457	SO:0001589	frameshift_variant	80727	exon3			.		CCDS34588.1	7p22	2013-09-02	2013-09-02		ENSG00000136295	ENSG00000136295			22222	protein-coding gene	gene with protein product		608919	"""tweety homolog 3 (Drosophila)"""				Standard	NM_025250		Approved	KIAA1691	uc003smp.3	Q9C0H2	OTTHUMG00000152050	ENST00000258796.7:c.296delC	chr7.hg19:g.2686778delC	ENSP00000258796:p.Ala99fs	54.0	0.0	0		74.0	40.0	0.540541	NM_025250	A4D201|B7WP98|Q6L749|Q6ZVG3|Q8TEG6	Frame_Shift_Del	DEL	ENST00000258796.7	hg19	CCDS34588.1																																																																																			.	.	.	none		0.731	TTYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325082.2	XM_166523	
ABCA12	26154	hgsc.bcm.edu	37	2	215820066	215820067	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr2:215820066_215820067delTC	ENST00000272895.7	-	43	6471_6472	c.6252_6253delGA	c.(6250-6255)tggatgfs	p.WM2084fs	AC072062.1_ENST00000607412.1_RNA|ABCA12_ENST00000389661.4_Frame_Shift_Del_p.WM1766fs	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2084					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AGCAAGTACATCCAGGAAAATG	0.436																																					p.2085_2085del	Ovarian(66;664 1488 5121 34295)	Atlas-Indel,Pindel	.											.	ABCA12	368	.	0			c.6253_6254del						PASS	.																																			SO:0001589	frameshift_variant	26154	exon43			.	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.6252_6253delGA	chr2.hg19:g.215820066_215820067delTC	ENSP00000272895:p.Trp2084fs	299.0	0.0	0		253.0	95.0	0.375494	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Frame_Shift_Del	DEL	ENST00000272895.7	hg19	CCDS33372.1																																																																																			.	.	.	none		0.436	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
NCOA2	10499	hgsc.bcm.edu	37	8	71068654	71068654	+	Frame_Shift_Del	DEL	G	G	-			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr8:71068654delG	ENST00000452400.2	-	11	2127	c.1946delC	c.(1945-1947)tctfs	p.S649fs	NCOA2_ENST00000524223.1_5'UTR	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	649					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			CATCTGATCAGATTTGGTGGT	0.567			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																p.S649fs		Atlas-Indel,Pindel	.		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	.	NCOA2	147	.	0			c.1947delT						PASS	.						93.0	92.0	92.0					8																	71068654		2000	4181	6181	SO:0001589	frameshift_variant	10499	exon11			.	X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.1946delC	chr8.hg19:g.71068654delG	ENSP00000399968:p.Ser649fs	75.0	0.0	0		54.0	27.0	0.5	NM_006540	Q14CD2	Frame_Shift_Del	DEL	ENST00000452400.2	hg19	CCDS47872.1																																																																																			.	.	.	none		0.567	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379696.1		
PGM1	5236	hgsc.bcm.edu	37	1	64125282	64125282	+	Frame_Shift_Del	DEL	T	T	-			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr1:64125282delT	ENST00000371084.3	+	11	1838	c.1625delT	c.(1624-1626)attfs	p.I542fs	PGM1_ENST00000540265.1_Frame_Shift_Del_p.I345fs|PGM1_ENST00000371083.4_Frame_Shift_Del_p.I560fs	NM_002633.2	NP_002624.2	P36871	PGM1_HUMAN	phosphoglucomutase 1	542					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	magnesium ion binding (GO:0000287)|phosphoglucomutase activity (GO:0004614)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20						CTTATTTCCATTGCTCTGAAA	0.532																																					p.I560fs		Atlas-Indel,Pindel	.											.	PGM1	75	.	0			c.1678delA						PASS	.						168.0	132.0	144.0					1																	64125282		2203	4300	6503	SO:0001589	frameshift_variant	5236	exon11			.	BC019920	CCDS625.1, CCDS53323.1, CCDS53324.1	1p22.1	2012-10-02			ENSG00000079739	ENSG00000079739	5.4.2.2		8905	protein-coding gene	gene with protein product		171900				4517931, 1530890	Standard	NM_002633		Approved		uc010ooz.2	P36871	OTTHUMG00000008968	ENST00000371084.3:c.1625delT	chr1.hg19:g.64125282delT	ENSP00000360125:p.Ile542fs	110.0	0.0	0		77.0	22.0	0.285714	NM_001172818	B2R5N9|B4DPV0|Q16105|Q16106|Q5BKZ9|Q6NW22|Q86U74|Q96J40|Q9NTY4	Frame_Shift_Del	DEL	ENST00000371084.3	hg19	CCDS625.1																																																																																			.	.	.	none		0.532	PGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024868.1	NM_002633	
ADAD1	132612	hgsc.bcm.edu	37	4	123333812	123333812	+	Frame_Shift_Del	DEL	T	T	-			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr4:123333812delT	ENST00000296513.2	+	10	1282	c.1097delT	c.(1096-1098)attfs	p.I366fs	ADAD1_ENST00000388725.2_Frame_Shift_Del_p.I348fs|ADAD1_ENST00000388724.2_Frame_Shift_Del_p.I355fs	NM_139243.3	NP_640336.1	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1 (testis-specific)	366	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				multicellular organismal development (GO:0007275)|RNA processing (GO:0006396)|spermatid development (GO:0007286)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	35						GAAGGCAAAATTTATCTGACT	0.393																																					p.I366fs		Atlas-Indel,Pindel	.											.	ADAD1	94	.	0			c.1096delA						PASS	.						187.0	176.0	180.0					4																	123333812		2203	4300	6503	SO:0001589	frameshift_variant	132612	exon10			.	AK057303	CCDS34058.1, CCDS54800.1, CCDS54801.1	4q27	2007-05-31			ENSG00000164113	ENSG00000164113			30713	protein-coding gene	gene with protein product		614130				7543294, 9541871	Standard	NM_139243		Approved	Tenr	uc003iep.3	Q96M93	OTTHUMG00000150128	ENST00000296513.2:c.1097delT	chr4.hg19:g.123333812delT	ENSP00000296513:p.Ile366fs	108.0	0.0	0		90.0	41.0	0.455556	NM_139243	A6NKN4|B7WPB0|D3DNX2|Q8IWG6|Q8NA06	Frame_Shift_Del	DEL	ENST00000296513.2	hg19	CCDS34058.1																																																																																			.	.	.	none		0.393	ADAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316452.1	NM_139243	
MYL12B	103910	hgsc.bcm.edu	37	18	3272961	3272961	+	Frame_Shift_Del	DEL	T	T	-			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr18:3272961delT	ENST00000581193.1	+	2	448	c.65delT	c.(64-66)gtgfs	p.V22fs	MYL12B_ENST00000584539.1_Frame_Shift_Del_p.V22fs|MYL12B_ENST00000237500.5_Frame_Shift_Del_p.V22fs|MYL12B_ENST00000400175.5_Frame_Shift_Del_p.V22fs	NM_001144945.1	NP_001138417.1	O14950	ML12B_HUMAN	myosin, light chain 12B, regulatory	22					axon guidance (GO:0007411)|muscle contraction (GO:0006936)|regulation of cell shape (GO:0008360)	apical part of cell (GO:0045177)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)|lung(2)	4						ACATCCAATGTGTTTGCCATG	0.428																																					p.V22fs		Atlas-Indel,Pindel	.											.	MYL12B	11	.	0			c.64delG						PASS	.						180.0	165.0	170.0					18																	3272961		2203	4300	6503	SO:0001589	frameshift_variant	103910	exon2			.	AY320408	CCDS11831.1	18p11.31	2013-01-10			ENSG00000118680	ENSG00000118680		"""Myosins / Light chain"", ""EF-hand domain containing"""	29827	protein-coding gene	gene with protein product	"""myosin regulatory light chain 2"""	609211				11942626	Standard	NM_033546		Approved	MRLC2	uc002klt.4	O14950	OTTHUMG00000131510	ENST00000581193.1:c.65delT	chr18.hg19:g.3272961delT	ENSP00000463559:p.Val22fs	201.0	0.0	0		157.0	58.0	0.369427	NM_033546	D3DUH6|Q13182|Q7Z5Z4	Frame_Shift_Del	DEL	ENST00000581193.1	hg19	CCDS11831.1																																																																																			.	.	.	none		0.428	MYL12B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258908.1	NM_033546	
COL6A5	256076	hgsc.bcm.edu	37	3	130120011	130120011	+	Frame_Shift_Del	DEL	G	G	-			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr3:130120011delG	ENST00000432398.2	+	11	4622	c.4128delG	c.(4126-4128)cagfs	p.Q1376fs	COL6A5_ENST00000265379.6_Frame_Shift_Del_p.Q1376fs	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1376	Nonhelical region.|VWFA 7. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						AACTATCACAGTACCTGGTGA	0.388																																					p.Q1376fs		Atlas-Indel,Pindel	.											.	COL6A5	205	.	0			c.4127delA						PASS	.						113.0	98.0	103.0					3																	130120011		692	1591	2283	SO:0001589	frameshift_variant	256076	exon11			.	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.4128delG	chr3.hg19:g.130120011delG	ENSP00000390895:p.Gln1376fs	206.0	0.0	0		137.0	49.0	0.357664	NM_153264	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Frame_Shift_Del	DEL	ENST00000432398.2	hg19																																																																																				.	.	.	none		0.388	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
ADAMTS6	11174	hgsc.bcm.edu	37	5	64510676	64510682	+	IGR	DEL	AACTTCA	AACTTCA	-			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	AACTTCA	AACTTCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr5:64510676_64510682delAACTTCA								ADAMTS6 (16084 upstream) : ADAMTS6 (82352 downstream)																							ATGTAAAGCCAACTTCATTATCTCCAC	0.464																																					p.839_841del		Atlas-Indel,Pindel	.											.	ADAMTS6	174	.	0			c.2515_2521del						PASS	.																																			SO:0001628	intergenic_variant	11174	exon20			.																													chr5.hg19:g.64510676_64510682delAACTTCA		121.0	0.0	0		77.0	17.0	0.220779	NM_197941		Frame_Shift_Del	DEL		hg19																																																																																				.	.	.	none	0	0.464								
ZBTB8B	728116	hgsc.bcm.edu	37	1	32936383	32936393	+	Frame_Shift_Del	DEL	TCATTCACTAT	TCATTCACTAT	-			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	TCATTCACTAT	TCATTCACTAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr1:32936383_32936393delTCATTCACTAT	ENST00000609129.1	+	2	236_246	c.158_168delTCATTCACTAT	c.(157-168)ctcattcactatfs	p.LIHY53fs	RP1-27O5.3_ENST00000480336.1_Frame_Shift_Del_p.LIHY53fs	NM_001145720.1	NP_001139192.1	Q8NAP8	ZBT8B_HUMAN	zinc finger and BTB domain containing 8B	53	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)	1						CGAGCCCTGCTCATTCACTATATCCAGGACA	0.502																																					p.53_56del		Atlas-Indel,Pindel	.											.	ZBTB8B	28	.	0			c.157_167del						PASS	.																																			SO:0001589	frameshift_variant	728116	exon2			.	AL442095	CCDS44104.1	1p35.1	2013-01-08			ENSG00000215897	ENSG00000273274		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	37057	protein-coding gene	gene with protein product							Standard	NM_001145720		Approved	RP1-27O5.1, DKFZp547H154, ZNF916B	uc001bvl.4	Q8NAP8	OTTHUMG00000167087	ENST00000609129.1:c.158_168delTCATTCACTAT	chr1.hg19:g.32936383_32936393delTCATTCACTAT	ENSP00000476499:p.Leu53fs	99.0	0.0	0		86.0	23.0	0.267442	NM_001145720	Q15DG5|Q5VXR5|Q69YT7	Frame_Shift_Del	DEL	ENST00000609129.1	hg19	CCDS44104.1																																																																																			.	.	.	none		0.502	ZBTB8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392986.2	NM_001145720	
PHF3	23469	hgsc.bcm.edu	37	6	64404652	64404653	+	Frame_Shift_Ins	INS	-	-	AGGT			TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr6:64404652_64404653insAGGT	ENST00000262043.3	+	6	3018_3019	c.2678_2679insAGGT	c.(2677-2682)ccaggtfs	p.-894fs	PHF3_ENST00000393387.1_Frame_Shift_Ins_p.-894fs			Q92576	PHF3_HUMAN	PHD finger protein 3						multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			GCTTCAAAACCAGGTAGTGAGA	0.292																																					p.P893fs	GBM(135;136 1820 29512 34071 46235)	Pindel	.											.	PHF3	191	.	0			c.2678_2679insAGGT						PASS	.																																			SO:0001589	frameshift_variant	23469	exon5			.	AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.2679_2682dupAGGT	chr6.hg19:g.64404653_64404656dupAGGT	ENSP00000262043:p.Gly894fs	266.0	0.0	.		199.0	34.0	0.171	NM_015153	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Frame_Shift_Ins	INS	ENST00000262043.3	hg19	CCDS4966.1																																																																																			.	.	.	none		0.292	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2		
GXYLT1	283464	hgsc.bcm.edu	37	12	42538257	42538295	+	In_Frame_Del	DEL	GCCCGCGACGCCGGCGCCTCTCACGGCGCCGCGTCCGCC	GCCCGCGACGCCGGCGCCTCTCACGGCGCCGCGTCCGCC	-	rs549907912|rs560905337	byFrequency	TCGA-Y8-A8RY-01A-11D-A36X-10	TCGA-Y8-A8RY-10A-01D-A370-10	GCCCGCGACGCCGGCGCCTCTCACGGCGCCGCGTCCGCC	GCCCGCGACGCCGGCGCCTCTCACGGCGCCGCGTCCGCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fbd6df33-90cf-4c79-bf0c-9f5bd762c16f	7a66b4e5-8f59-4d6e-b6dc-58884cf787ff	g.chr12:42538257_42538295delGCCCGCGACGCCGGCGCCTCTCACGGCGCCGCGTCCGCC	ENST00000398675.3	-	1	386_424	c.154_192delGGCGGACGCGGCGCCGTGAGAGGCGCCGGCGTCGCGGGC	c.(154-192)ggcggacgcggcgccgtgagaggcgccggcgtcgcgggcdel	p.GGRGAVRGAGVAG52del	GXYLT1_ENST00000280876.6_In_Frame_Del_p.GGRGAVRGAGVAG52del	NM_001099650.1|NM_173601.1	NP_001093120.1|NP_775872.1	Q4G148	GXLT1_HUMAN	glucoside xylosyltransferase 1	52					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|O-glycan processing (GO:0016266)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-xylosyltransferase activity (GO:0035252)			kidney(2)|large_intestine(4)|liver(3)|lung(8)	17						GCGCTGCGGGGCCCGCGACGCCGGCGCCTCTCACGGCGCCGCGTCCGCCGCCCGCGAGC	0.778														45	0.00898562	0.0272	0.0029	5008	,	,		10151	0.001		0.005	False		,,,				2504	0.001				p.52_65del		Pindel	.											.	GXYLT1	47	.	0			c.155_193del						PASS	.																																			SO:0001651	inframe_deletion	283464	exon1			.	BC015597	CCDS41771.1, CCDS41772.1	12q12	2013-10-11	2009-11-17	2009-11-17	ENSG00000151233	ENSG00000151233		"""Glycosyltransferase family 8 domain containing"""	27482	protein-coding gene	gene with protein product		613321	"""glycosyltransferase 8 domain containing 3"""	GLT8D3		19940119	Standard	NM_001099650		Approved	FLJ43151	uc001rms.4	Q4G148	OTTHUMG00000169379	ENST00000398675.3:c.154_192delGGCGGACGCGGCGCCGTGAGAGGCGCCGGCGTCGCGGGC	chr12.hg19:g.42538257_42538295delGCCCGCGACGCCGGCGCCTCTCACGGCGCCGCGTCCGCC	ENSP00000381666:p.Gly52_Gly64del	7.0	0.0	.		8.0	11.0	1.375	NM_001099650	B3KWJ2|Q8IXV1|Q96BH4	In_Frame_Del	DEL	ENST00000398675.3	hg19	CCDS41772.1																																																																																			.	.	.	none		0.778	GXYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403778.1	XM_290597	
