#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SPEN	23013	hgsc.bcm.edu	37	1	16265370	16265370	+	Splice_Site	SNP	A	A	G			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr1:16265370A>G	ENST00000375759.3	+	14	11066	c.10862A>G	c.(10861-10863)cAg>cGg	p.Q3621R		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	3621	SPOC. {ECO:0000255|PROSITE- ProRule:PRU00249}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GGCTCCAATCAGGTCGGTTGT	0.587																																					p.Q3621R		Atlas-SNP	.											.	SPEN	374	.	0			c.A10862G						PASS	.						150.0	113.0	126.0					1																	16265370		2203	4300	6503	SO:0001630	splice_region_variant	23013	exon14			CCAATCAGGTCGG		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.10863+1A>G	chr1.hg19:g.16265370A>G		34.0	0.0	.		13.0	10.0	.	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	hg19	CCDS164.1	.	.	.	.	.	.	.	.	.	.	A	16.43	3.121904	0.56613	.	.	ENSG00000065526	ENST00000375759	T	0.11169	2.8	5.62	5.62	0.85841	Spen Paralogue and Orthologue SPOC, C-terminal-like (2);Spen paralogue/orthologue C-terminal, metazoa (1);Spen paralogue and orthologue SPOC, C-terminal (1);	.	.	.	.	T	0.22742	0.0549	M	0.65498	2.005	0.58432	D	0.999991	P	0.35628	0.513	P	0.45406	0.479	T	0.00717	-1.1596	9	0.48119	T	0.1	-17.7469	15.807	0.78520	1.0:0.0:0.0:0.0	.	3621	Q96T58	MINT_HUMAN	R	3621	ENSP00000364912:Q3621R	ENSP00000364912:Q3621R	Q	+	2	0	SPEN	16137957	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	8.904000	0.92590	2.128000	0.65567	0.533000	0.62120	CAG	.	.	.	none		0.587	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	Missense_Mutation
CDCA8	55143	hgsc.bcm.edu	37	1	38158699	38158699	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr1:38158699T>C	ENST00000373055.1	+	2	490	c.217T>C	c.(217-219)Tac>Cac	p.Y73H	C1orf109_ENST00000464085.1_5'Flank|CDCA8_ENST00000327331.2_Missense_Mutation_p.Y73H|C1orf109_ENST00000358011.4_5'Flank	NM_001256875.1|NM_018101.3	NP_001243804.1|NP_060571.1	Q53HL2	BOREA_HUMAN	cell division cycle associated 8	73	Required for centromere localization.|Required for interaction with INCENP and BIRC5.|Required for interaction with SENP3.|Required to form a minimal CPC core complex that localizes to the central spindle and midbody and properly executes the role of the CPC during cytokinesis.				chromosome organization (GO:0051276)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)	chromocenter (GO:0010369)|chromosome passenger complex (GO:0032133)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleus (GO:0005634)|protein complex (GO:0043234)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)|skin(1)|stomach(1)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CTGGCTTGACTACTTCGGTAA	0.567																																					p.Y73H		Atlas-SNP	.											.	CDCA8	25	.	0			c.T217C						PASS	.						48.0	49.0	49.0					1																	38158699		2203	4300	6503	SO:0001583	missense	55143	exon2			CTTGACTACTTCG	BG354581	CCDS424.1	1p34.3	2013-01-17			ENSG00000134690	ENSG00000134690			14629	protein-coding gene	gene with protein product	"""borealin"""	609977				12188893, 15260989	Standard	NM_001256875		Approved	FLJ12042, MESRGP, BOR, DasraB	uc001cbs.4	Q53HL2	OTTHUMG00000004320	ENST00000373055.1:c.217T>C	chr1.hg19:g.38158699T>C	ENSP00000362146:p.Tyr73His	144.0	0.0	.		129.0	56.0	.	NM_001256875	D3DPT4|Q53HN1|Q96AM3|Q9NVW5	Missense_Mutation	SNP	ENST00000373055.1	hg19	CCDS424.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.168750	0.78339	.	.	ENSG00000134690	ENST00000373055;ENST00000327331	T;T	0.48201	0.82;0.82	5.92	5.92	0.95590	Borealin-like, N-terminal (1);	0.442552	0.26658	N	0.023175	T	0.55016	0.1894	L	0.42245	1.32	0.42852	D	0.994089	P	0.45569	0.861	P	0.56042	0.79	T	0.53121	-0.8483	10	0.39692	T	0.17	-4.406	12.7362	0.57225	0.0:0.0:0.0:1.0	.	73	Q53HL2	BOREA_HUMAN	H	73	ENSP00000362146:Y73H;ENSP00000316121:Y73H	ENSP00000316121:Y73H	Y	+	1	0	CDCA8	37931286	0.997000	0.39634	0.999000	0.59377	0.989000	0.77384	2.888000	0.48594	2.265000	0.75225	0.533000	0.62120	TAC	.	.	.	none		0.567	CDCA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012473.1	NM_018101	
ARHGAP29	9411	hgsc.bcm.edu	37	1	94639617	94639617	+	Silent	SNP	G	G	T			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr1:94639617G>T	ENST00000260526.6	-	23	3776	c.3594C>A	c.(3592-3594)ccC>ccA	p.P1198P	ARHGAP29_ENST00000482481.1_5'Flank	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	1198					positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		CGAGACCGTGGGGATCGTGAT	0.527																																					p.P1198P		Atlas-SNP	.											.	ARHGAP29	132	.	0			c.C3594A						PASS	.						85.0	76.0	79.0					1																	94639617		2203	4300	6503	SO:0001819	synonymous_variant	9411	exon23			ACCGTGGGGATCG		CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.3594C>A	chr1.hg19:g.94639617G>T		77.0	0.0	.		105.0	40.0	.	NM_004815	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Silent	SNP	ENST00000260526.6	hg19	CCDS748.1																																																																																			.	.	.	none		0.527	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029376.2	NM_004815	
BNIPL	149428	hgsc.bcm.edu	37	1	151011013	151011013	+	Silent	SNP	T	T	C			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr1:151011013T>C	ENST00000368931.3	+	3	327	c.171T>C	c.(169-171)gaT>gaC	p.D57D	BNIPL_ENST00000295294.7_5'UTR	NM_138278.3	NP_612122.2	Q7Z465	BNIPL_HUMAN	BCL2/adenovirus E1B 19kD interacting protein like	57					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|regulation of growth rate (GO:0040009)	cytosol (GO:0005829)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			autonomic_ganglia(1)|endometrium(3)|large_intestine(1)|lung(4)|skin(1)	10	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CTTCTGAAGATCCTGAAGACC	0.473																																					p.D57D		Atlas-SNP	.											.	BNIPL	45	.	0			c.T171C						PASS	.						106.0	102.0	103.0					1																	151011013		1884	4122	6006	SO:0001819	synonymous_variant	149428	exon3			TGAAGATCCTGAA	AF193056	CCDS978.2, CCDS53362.1	1q21.2	2008-02-05			ENSG00000163141	ENSG00000163141			16976	protein-coding gene	gene with protein product		611275				12681488, 11741952	Standard	NM_138278		Approved	BNIPl-1, BNIPL-2, PP753	uc001ewl.2	Q7Z465	OTTHUMG00000035157	ENST00000368931.3:c.171T>C	chr1.hg19:g.151011013T>C		128.0	0.0	.		149.0	60.0	.	NM_138278	Q6DK43|Q8TCY7|Q8WYG2	Silent	SNP	ENST00000368931.3	hg19	CCDS978.2																																																																																			.	.	.	none		0.473	BNIPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085092.1	NM_138279	
CLK2	1196	hgsc.bcm.edu	37	1	155238100	155238100	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr1:155238100A>G	ENST00000368361.4	-	5	853	c.538T>C	c.(538-540)Tgt>Cgt	p.C180R	CLK2_ENST00000361168.5_Missense_Mutation_p.C179R|CLK2_ENST00000497188.1_5'UTR|CLK2_ENST00000536801.1_Missense_Mutation_p.C180R|CLK2_ENST00000355560.4_Missense_Mutation_p.C178R			P49760	CLK2_HUMAN	CDC-like kinase 2	180	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of gluconeogenesis (GO:0045721)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)|response to ionizing radiation (GO:0010212)|response to retinoic acid (GO:0032526)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	22	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TGGTCAACACATTGTACAACT	0.507								Other conserved DNA damage response genes																													p.C179R		Atlas-SNP	.											.	CLK2	55	.	0			c.T535C						PASS	.						72.0	69.0	70.0					1																	155238100		2203	4300	6503	SO:0001583	missense	1196	exon5			CAACACATTGTAC	L29218	CCDS1107.1, CCDS72939.1	1q21	2008-05-02			ENSG00000176444	ENSG00000176444		"""CDC-like kinases"""	2069	protein-coding gene	gene with protein product		602989				7990150, 9856501	Standard	XM_005244876		Approved	clk2	uc001fjw.3	P49760	OTTHUMG00000035873	ENST00000368361.4:c.538T>C	chr1.hg19:g.155238100A>G	ENSP00000357345:p.Cys180Arg	206.0	0.0	.		224.0	81.0	.	NM_003993	B1AVS9|B5MBX6|Q96CQ0	Missense_Mutation	SNP	ENST00000368361.4	hg19		.	.	.	.	.	.	.	.	.	.	.	17.70	3.453811	0.63290	.	.	ENSG00000176444	ENST00000361168;ENST00000368361;ENST00000355560;ENST00000536801	T;T;T;T	0.20881	2.04;2.04;2.04;2.04	5.41	5.41	0.78517	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.46521	0.1397	M	0.90309	3.105	0.80722	D	1	D;D	0.89917	1.0;0.993	D;D	0.83275	0.996;0.962	T	0.58086	-0.7698	10	0.87932	D	0	.	14.4034	0.67065	1.0:0.0:0.0:0.0	.	180;179	P49760;P49760-3	CLK2_HUMAN;.	R	179;180;178;180	ENSP00000354856:C179R;ENSP00000357345:C180R;ENSP00000347759:C178R;ENSP00000441023:C180R	ENSP00000347759:C178R	C	-	1	0	CLK2	153504724	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.326000	0.79133	2.271000	0.75665	0.459000	0.35465	TGT	.	.	.	none		0.507	CLK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000087391.1	NM_003993	
BIRC6	57448	hgsc.bcm.edu	37	2	32702603	32702603	+	Silent	SNP	C	C	A			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr2:32702603C>A	ENST00000421745.2	+	35	7154	c.7020C>A	c.(7018-7020)ctC>ctA	p.L2340L		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	2340					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TGTTTCTTCTCTCCATGGACT	0.423																																					p.L2340L	Pancreas(94;175 1509 16028 18060 45422)	Atlas-SNP	.											.	BIRC6	838	.	0			c.C7020A						PASS	.						146.0	121.0	129.0					2																	32702603		2203	4300	6503	SO:0001819	synonymous_variant	57448	exon35			TCTTCTCTCCATG	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.7020C>A	chr2.hg19:g.32702603C>A		121.0	0.0	.		149.0	56.0	.	NM_016252	Q9ULD1	Silent	SNP	ENST00000421745.2	hg19	CCDS33175.2																																																																																			.	.	.	none		0.423	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
TCF7L1	83439	hgsc.bcm.edu	37	2	85533645	85533645	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr2:85533645C>T	ENST00000282111.3	+	10	1495	c.1220C>T	c.(1219-1221)tCg>tTg	p.S407L		NM_031283.2	NP_112573.1	Q9HCS4	TF7L1_HUMAN	transcription factor 7-like 1 (T-cell specific, HMG-box)	407					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(4)|upper_aerodigestive_tract(1)	18						CAGCTTCACTCGCAGCTCTAC	0.602																																					p.S407L		Atlas-SNP	.											.	TCF7L1	44	.	0			c.C1220T						PASS	.						56.0	53.0	54.0					2																	85533645		2203	4300	6503	SO:0001583	missense	83439	exon10			TTCACTCGCAGCT	X62870	CCDS1971.1	2p11.2	2008-02-05			ENSG00000152284	ENSG00000152284			11640	protein-coding gene	gene with protein product		604652		TCF3		1741298, 11085512	Standard	NM_031283		Approved		uc002soy.3	Q9HCS4	OTTHUMG00000130026	ENST00000282111.3:c.1220C>T	chr2.hg19:g.85533645C>T	ENSP00000282111:p.Ser407Leu	183.0	0.0	.		157.0	64.0	.	NM_031283	Q53R97|Q6PD70|Q9NP00	Missense_Mutation	SNP	ENST00000282111.3	hg19	CCDS1971.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327451	0.81690	.	.	ENSG00000152284	ENST00000282111	D	0.97870	-4.58	4.74	3.87	0.44632	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.055635	0.85682	D	0.000000	D	0.95586	0.8565	N	0.03999	-0.3	0.43683	D	0.996123	D	0.76494	0.999	D	0.67382	0.951	D	0.95575	0.8641	10	0.66056	D	0.02	.	10.6733	0.45770	0.0:0.9072:0.0:0.0928	.	407	Q9HCS4	TF7L1_HUMAN	L	407	ENSP00000282111:S407L	ENSP00000282111:S407L	S	+	2	0	TCF7L1	85387156	0.900000	0.30661	0.960000	0.40013	0.866000	0.49608	2.024000	0.41049	1.228000	0.43614	-0.245000	0.11935	TCG	.	.	.	none		0.602	TCF7L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252301.2	NM_031283	
CUL3	8452	hgsc.bcm.edu	37	2	225378239	225378239	+	Splice_Site	SNP	A	A	G			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr2:225378239A>G	ENST00000264414.4	-	5	993		c.e5+1		CUL3_ENST00000409096.1_Splice_Site|CUL3_ENST00000409777.1_Splice_Site|CUL3_ENST00000344951.4_Splice_Site|CUL3_ENST00000432260.2_5'Flank	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3						cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TTCACGGATTACCTGAAAAAA	0.299																																					.		Atlas-SNP	.											.	CUL3	96	.	0			c.654+2T>C						PASS	.						45.0	48.0	47.0					2																	225378239		2202	4299	6501	SO:0001630	splice_region_variant	8452	exon6			CGGATTACCTGAA	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.654+1T>C	chr2.hg19:g.225378239A>G		179.0	0.0	.		120.0	71.0	.	NM_003590	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Splice_Site	SNP	ENST00000264414.4	hg19	CCDS2462.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.302813	0.81136	.	.	ENSG00000036257	ENST00000264414;ENST00000344951;ENST00000409096;ENST00000409777	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1491	0.81599	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CUL3	225086483	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	8.681000	0.91228	2.227000	0.72691	0.524000	0.50904	.	.	.	.	none		0.299	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2		Intron
RBM15B	29890	hgsc.bcm.edu	37	3	51430385	51430385	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr3:51430385C>G	ENST00000323686.4	+	1	1655	c.1555C>G	c.(1555-1557)Cgg>Ggg	p.R519G		NM_013286.4	NP_037418.3	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	519					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|large_intestine(5)|lung(3)	12				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TGGATACACCCGGCACCGCAA	0.612																																					p.R519G		Atlas-SNP	.											.	RBM15B	47	.	0			c.C1555G						PASS	.						48.0	54.0	52.0					3																	51430385		2203	4300	6503	SO:0001583	missense	29890	exon1			TACACCCGGCACC	AL831838	CCDS33764.1	3p21.1	2013-02-12			ENSG00000179837	ENSG00000259956		"""RNA binding motif (RRM) containing"""	24303	protein-coding gene	gene with protein product		612602				16129689	Standard	NM_013286		Approved	HUMAGCGB, OTT3	uc003dbd.3	Q8NDT2	OTTHUMG00000156896	ENST00000323686.4:c.1555C>G	chr3.hg19:g.51430385C>G	ENSP00000313890:p.Arg519Gly	63.0	0.0	.		34.0	25.0	.	NM_013286	A4QPG7|Q6QE19|Q9BV96	Missense_Mutation	SNP	ENST00000323686.4	hg19	CCDS33764.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.685730	0.29962	.	.	ENSG00000179837	ENST00000323686;ENST00000541145	T	0.16073	2.37	5.55	3.56	0.40772	.	.	.	.	.	T	0.24967	0.0606	L	0.46157	1.445	0.47862	D	0.999532	D	0.60575	0.988	P	0.54100	0.742	T	0.01762	-1.1279	9	0.28530	T	0.3	-18.1931	13.5402	0.61671	0.4569:0.5431:0.0:0.0	.	519	Q8NDT2	RB15B_HUMAN	G	519;192	ENSP00000313890:R519G	ENSP00000313890:R519G	R	+	1	2	RBM15B	51405425	0.998000	0.40836	0.948000	0.38648	0.889000	0.51656	3.085000	0.50151	1.314000	0.45095	0.655000	0.94253	CGG	.	.	.	none		0.612	RBM15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346489.1	NM_013286	
BAP1	8314	hgsc.bcm.edu	37	3	52437846	52437846	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr3:52437846C>A	ENST00000460680.1	-	13	1786	c.1315G>T	c.(1315-1317)Gtg>Ttg	p.V439L	BAP1_ENST00000296288.5_Missense_Mutation_p.V421L	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		GGCTGCAGCACTGACAGTTGC	0.567			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.V439L	GBM(101;493 1458 7992 21037 25532)	Atlas-SNP	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	371	.	0			c.G1315T						PASS	.						101.0	103.0	103.0					3																	52437846		2203	4300	6503	SO:0001583	missense	8314	exon13			GCAGCACTGACAG	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1315G>T	chr3.hg19:g.52437846C>A	ENSP00000417132:p.Val439Leu	40.0	0.0	.		27.0	15.0	.	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000460680.1	hg19	CCDS2853.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.198|3.198	-0.164260|-0.164260	0.06502|0.06502	.|.	.|.	ENSG00000163930|ENSG00000163930	ENST00000469613|ENST00000460680;ENST00000296288	.|T;T	.|0.56444	.|0.47;0.46	6.05|6.05	6.05|6.05	0.98169|0.98169	.|Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (1);	.|0.126603	.|0.53938	.|D	.|0.000045	T|T	0.37705|0.37705	0.1013|0.1013	N|N	0.19112|0.19112	0.55|0.55	0.35702|0.35702	D|D	0.81573|0.81573	.|B	.|0.12013	.|0.005	.|B	.|0.10450	.|0.005	T|T	0.38564|0.38564	-0.9655|-0.9655	5|10	.|0.27785	.|T	.|0.31	.|.	13.0153|13.0153	0.58753|0.58753	0.0:0.9266:0.0:0.0734|0.0:0.9266:0.0:0.0734	.|.	.|439	.|Q92560	.|BAP1_HUMAN	H|L	30|439;421	.|ENSP00000417132:V439L;ENSP00000296288:V421L	.|ENSP00000296288:V421L	Q|V	-|-	3|1	2|0	BAP1|BAP1	52412886|52412886	0.781000|0.781000	0.28676|0.28676	1.000000|1.000000	0.80357|0.80357	0.886000|0.886000	0.51366|0.51366	1.300000|1.300000	0.33436|0.33436	2.880000|2.880000	0.98712|0.98712	0.655000|0.655000	0.94253|0.94253	CAG|GTG	.	.	.	none		0.567	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
ROBO1	6091	hgsc.bcm.edu	37	3	78680444	78680444	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr3:78680444G>T	ENST00000464233.1	-	25	3606	c.3493C>A	c.(3493-3495)Cac>Aac	p.H1165N	ROBO1_ENST00000495273.1_Missense_Mutation_p.H1120N|ROBO1_ENST00000436010.2_Missense_Mutation_p.H1126N|ROBO1_ENST00000467549.1_Missense_Mutation_p.H1065N	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1165					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		CCTTTCTTGTGCCCCTGACTC	0.443																																					p.H1165N		Atlas-SNP	.											.	ROBO1	833	.	0			c.C3493A						PASS	.						139.0	138.0	138.0					3																	78680444		2034	4173	6207	SO:0001583	missense	6091	exon25			TCTTGTGCCCCTG	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.3493C>A	chr3.hg19:g.78680444G>T	ENSP00000420321:p.His1165Asn	70.0	0.0	.		36.0	24.0	.	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	hg19	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	G	17.34	3.366106	0.61513	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64	5.37	5.37	0.77165	.	0.092179	0.85682	D	0.000000	T	0.79511	0.4458	L	0.36672	1.1	0.58432	D	0.999992	B;B;B;B;B	0.33739	0.187;0.031;0.304;0.422;0.147	B;B;B;B;B	0.37422	0.152;0.032;0.139;0.078;0.249	T	0.75411	-0.3327	9	.	.	.	.	19.484	0.95022	0.0:0.0:1.0:0.0	.	1129;1165;1120;1065;1126	Q9Y6N7-3;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	N	1126;1120;1165;1120;1065;1169	ENSP00000406043:H1126N;ENSP00000420321:H1165N;ENSP00000420637:H1120N;ENSP00000417992:H1065N	.	H	-	1	0	ROBO1	78763134	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	9.420000	0.97426	2.669000	0.90835	0.650000	0.86243	CAC	.	.	.	none		0.443	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
FOXL2	668	hgsc.bcm.edu	37	3	138664642	138664642	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr3:138664642G>C	ENST00000330315.3	-	1	1340	c.923C>G	c.(922-924)gCc>gGc	p.A308G	RP11-548O1.3_ENST00000495287.1_lincRNA|C3orf72_ENST00000383165.3_5'Flank	NM_023067.3	NP_075555.1	P58012	FOXL2_HUMAN	forkhead box L2	308					apoptotic DNA fragmentation (GO:0006309)|cell differentiation (GO:0030154)|embryonic eye morphogenesis (GO:0048048)|extraocular skeletal muscle development (GO:0002074)|female somatic sex determination (GO:0019101)|granulosa cell differentiation (GO:0060014)|menstruation (GO:0042703)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	cysteine-type endopeptidase regulator activity involved in apoptotic process (GO:0043028)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin conjugating enzyme binding (GO:0031624)			large_intestine(1)|lung(1)|ovary(333)|skin(1)	336						gtgcggtggggcaggcggcgg	0.836			Mis		granulosa-cell tumour of the ovary		"""Blepharophimosis, ptosis and epicanthus inversus Types I, II; Premature ovarian failure type III"""																														p.A308G		Atlas-SNP	.		Dom	yes		3	3q23	668	forkhead box L2	yes	O	.	FOXL2	408	.	0			c.C923G						PASS	.						1.0	1.0	1.0					3																	138664642		130	327	457	SO:0001583	missense	668	exon1			GGTGGGGCAGGCG	AF301906	CCDS3105.1	3q23	2008-04-10			ENSG00000183770	ENSG00000183770		"""Forkhead boxes"""	1092	protein-coding gene	gene with protein product		605597		BPES		1941972	Standard	NM_023067		Approved	BPES1	uc003esw.3	P58012	OTTHUMG00000159889	ENST00000330315.3:c.923C>G	chr3.hg19:g.138664642G>C	ENSP00000333188:p.Ala308Gly	35.0	0.0	.		19.0	10.0	.	NM_023067	Q4ZGJ3	Missense_Mutation	SNP	ENST00000330315.3	hg19	CCDS3105.1	.	.	.	.	.	.	.	.	.	.	G	11.19	1.565020	0.27915	.	.	ENSG00000183770	ENST00000330315	D	0.94457	-3.43	3.31	-0.235	0.13071	.	0.588514	0.17202	U	0.183069	D	0.86079	0.5847	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.71632	-0.4534	10	0.22706	T	0.39	.	2.9753	0.05935	0.1129:0.1716:0.5406:0.1749	.	308	P58012	FOXL2_HUMAN	G	308	ENSP00000333188:A308G	ENSP00000333188:A308G	A	-	2	0	FOXL2	140147332	0.017000	0.18338	0.340000	0.25575	0.931000	0.56810	0.275000	0.18698	0.040000	0.15660	0.449000	0.29647	GCC	.	.	.	none		0.836	FOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357999.1		
UVSSA	57654	hgsc.bcm.edu	37	4	1379721	1379721	+	Nonsense_Mutation	SNP	C	C	A			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr4:1379721C>A	ENST00000389851.4	+	14	2549	c.2102C>A	c.(2101-2103)tCa>tAa	p.S701*	UVSSA_ENST00000511216.1_Nonsense_Mutation_p.S701*|UVSSA_ENST00000507531.1_Nonsense_Mutation_p.S701*|UVSSA_ENST00000511563.1_Nonsense_Mutation_p.S252*|UVSSA_ENST00000512728.1_Nonsense_Mutation_p.S252*	NM_020894.2	NP_065945.2	Q2YD98	UVSSA_HUMAN	UV-stimulated scaffold protein A	701					protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)	RNA polymerase II core binding (GO:0000993)										GAGAAGTTTTCAAACCAGTTT	0.572																																					p.S701X		Atlas-SNP	.											.	.	.	.	0			c.C2102A						PASS	.						150.0	122.0	131.0					4																	1379721		2203	4300	6503	SO:0001587	stop_gained	57654	exon14			AGTTTTCAAACCA	BC021930	CCDS33938.1	4p16.3	2012-04-27	2012-04-27	2012-04-27		ENSG00000163945			29304	protein-coding gene	gene with protein product		614632	"""KIAA1530"""	KIAA1530		10819331, 22466610, 22466611, 22466612	Standard	NM_020894		Approved		uc003gde.4	Q2YD98		ENST00000389851.4:c.2102C>A	chr4.hg19:g.1379721C>A	ENSP00000374501:p.Ser701*	111.0	0.0	.		91.0	32.0	.	NM_020894	A8K9E6|B2RU11|Q8WTX4|Q9P1Z8	Nonsense_Mutation	SNP	ENST00000389851.4	hg19	CCDS33938.1	.	.	.	.	.	.	.	.	.	.	C	40	8.268854	0.98735	.	.	ENSG00000163945	ENST00000511216;ENST00000389851;ENST00000507531;ENST00000511563;ENST00000512728	.	.	.	5.19	5.19	0.71726	.	0.111807	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	18.6999	0.91617	0.0:1.0:0.0:0.0	.	.	.	.	X	701;701;701;252;252	.	ENSP00000374501:S701X	S	+	2	0	KIAA1530	1369721	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.554000	0.73923	2.400000	0.81607	0.655000	0.94253	TCA	.	.	.	none		0.572	UVSSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359480.1	NM_020894	
RAP1GDS1	5910	hgsc.bcm.edu	37	4	99342409	99342409	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr4:99342409A>G	ENST00000408927.3	+	12	1417	c.1304A>G	c.(1303-1305)gAa>gGa	p.E435G	RAP1GDS1_ENST00000339360.5_Missense_Mutation_p.E436G|RAP1GDS1_ENST00000264572.7_Missense_Mutation_p.E344G|RAP1GDS1_ENST00000408900.3_Missense_Mutation_p.E386G|RAP1GDS1_ENST00000380158.4_Missense_Mutation_p.E387G|RAP1GDS1_ENST00000453712.2_Splice_Site_p.E435G	NM_001100426.1|NM_001100427.1|NM_021159.4	NP_001093896.1|NP_001093897.1|NP_066982.3	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1	435					myosin filament assembly (GO:0031034)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of Rho GTPase activity (GO:0032321)|vascular smooth muscle contraction (GO:0014829)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)	28				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)		CCTATAGCAGAAGCTGCTGAA	0.408			T	NUP98	T-ALL																																p.E436G		Atlas-SNP	.		Dom	yes		4	4q21-q25	5910	"""RAP1, GTP-GDP dissociation stimulator 1"""		L	.	RAP1GDS1	61	.	0			c.A1307G						PASS	.						111.0	105.0	107.0					4																	99342409		1919	4142	6061	SO:0001583	missense	5910	exon12			TAGCAGAAGCTGC		CCDS43253.1, CCDS43254.1, CCDS47105.1, CCDS47106.1, CCDS47107.1, CCDS47108.1	4q23-q25	2013-02-14			ENSG00000138698	ENSG00000138698		"""Armadillo repeat containing"""	9859	protein-coding gene	gene with protein product		179502				8262526, 17951244	Standard	NM_001100426		Approved	SmgGDS	uc003htw.4	P52306	OTTHUMG00000160987	ENST00000408927.3:c.1304A>G	chr4.hg19:g.99342409A>G	ENSP00000386153:p.Glu435Gly	84.0	0.0	.		74.0	34.0	.	NM_001100426	E9PH06|G5E9P9|Q499L7|Q4KMV2|Q4QQI8|Q9BUW9|Q9BUX6|Q9NYM2|Q9NZA8	Missense_Mutation	SNP	ENST00000408927.3	hg19	CCDS43253.1	.	.	.	.	.	.	.	.	.	.	A	33	5.194788	0.94960	.	.	ENSG00000138698	ENST00000380158;ENST00000264572;ENST00000408927;ENST00000453712;ENST00000408900;ENST00000339360	T;T;T;T;T;T	0.55052	2.85;2.85;2.85;0.54;2.85;2.85	5.79	5.79	0.91817	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.63153	0.2487	L	0.36672	1.1	0.80722	D	1	D;D;D;B;B;D	0.62365	0.991;0.989;0.981;0.073;0.342;0.983	P;D;D;B;B;P	0.72982	0.831;0.979;0.954;0.031;0.093;0.813	T	0.60281	-0.7294	10	0.33141	T	0.24	-18.4441	16.1415	0.81528	1.0:0.0:0.0:0.0	.	344;386;387;435;436;435	E9PH06;P52306-2;Q499L7;P52306;Q4QQI8;G5E9P9	.;.;.;GDS1_HUMAN;.;.	G	387;344;435;435;386;436	ENSP00000369503:E387G;ENSP00000264572:E344G;ENSP00000386153:E435G;ENSP00000407157:E435G;ENSP00000386223:E386G;ENSP00000340454:E436G	ENSP00000264572:E344G	E	+	2	0	RAP1GDS1	99561432	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.810000	0.91950	2.198000	0.70561	0.533000	0.62120	GAA	.	.	.	none		0.408	RAP1GDS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363273.2	NM_001100426	
KIAA1109	84162	hgsc.bcm.edu	37	4	123255556	123255556	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr4:123255556T>C	ENST00000264501.4	+	69	12077	c.11704T>C	c.(11704-11706)Tcc>Ccc	p.S3902P	KIAA1109_ENST00000388738.3_Missense_Mutation_p.S3902P			Q2LD37	K1109_HUMAN	KIAA1109	3902					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CAGGGGATCTTCCTTGCCAAG	0.388																																					p.S3902P		Atlas-SNP	.											.	KIAA1109	424	.	0			c.T11704C						PASS	.						123.0	120.0	121.0					4																	123255556		1956	4147	6103	SO:0001583	missense	84162	exon67			GGATCTTCCTTGC	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.11704T>C	chr4.hg19:g.123255556T>C	ENSP00000264501:p.Ser3902Pro	283.0	0.0	.		271.0	105.0	.	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	hg19	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.408409	0.83340	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000438707	T;T;T	0.35605	2.32;2.32;1.3	5.21	5.21	0.72293	.	0.131937	0.52532	D	0.000067	T	0.53578	0.1805	L	0.50333	1.59	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.78314	0.991;0.979	T	0.50550	-0.8815	10	0.39692	T	0.17	.	15.3741	0.74590	0.0:0.0:0.0:1.0	.	3901;3902	Q2LD37-4;Q2LD37	.;K1109_HUMAN	P	3902;3902;606	ENSP00000264501:S3902P;ENSP00000373390:S3902P;ENSP00000410874:S606P	ENSP00000264501:S3902P	S	+	1	0	KIAA1109	123475006	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.997000	0.88414	2.097000	0.63578	0.454000	0.30748	TCC	.	.	.	none		0.388	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
STOX2	56977	hgsc.bcm.edu	37	4	184930877	184930877	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr4:184930877C>G	ENST00000308497.4	+	3	2321	c.886C>G	c.(886-888)Ccc>Gcc	p.P296A	STOX2_ENST00000438269.1_Missense_Mutation_p.P296A	NM_020225.1	NP_064610.1	Q9P2F5	STOX2_HUMAN	storkhead box 2	296					embryo development (GO:0009790)|maternal placenta development (GO:0001893)					breast(1)|endometrium(7)|lung(6)	14		all_lung(41;1.89e-12)|Lung NSC(41;3.48e-12)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|all_hematologic(60;0.027)|Prostate(90;0.0283)		all cancers(43;2.85e-26)|Epithelial(43;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-10)|Colorectal(24;8.23e-06)|GBM - Glioblastoma multiforme(59;1.64e-05)|STAD - Stomach adenocarcinoma(60;3.6e-05)|COAD - Colon adenocarcinoma(29;4.37e-05)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.227)		TGAAGAGTGGCCCCTGCGAGA	0.478																																					p.P296A		Atlas-SNP	.											.	STOX2	142	.	0			c.C886G						PASS	.						23.0	24.0	24.0					4																	184930877		1915	4136	6051	SO:0001583	missense	56977	exon3			GAGTGGCCCCTGC	AB037813	CCDS47167.1	4q35.1	2014-09-11			ENSG00000173320	ENSG00000173320			25450	protein-coding gene	gene with protein product							Standard	XM_005263142		Approved	DKFZp762K222	uc003ivz.1	Q9P2F5	OTTHUMG00000160618	ENST00000308497.4:c.886C>G	chr4.hg19:g.184930877C>G	ENSP00000311257:p.Pro296Ala	99.0	0.0	.		96.0	32.0	.	NM_020225	A6H8U4|Q9NPS8	Missense_Mutation	SNP	ENST00000308497.4	hg19	CCDS47167.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.348435	0.82132	.	.	ENSG00000173320	ENST00000308497;ENST00000438269	T;D	0.86694	-1.23;-2.16	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.93884	0.8043	M	0.78456	2.415	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	D	0.93553	0.6888	10	0.87932	D	0	-25.0726	20.6634	0.99662	0.0:1.0:0.0:0.0	.	296	Q9P2F5	STOX2_HUMAN	A	296	ENSP00000311257:P296A;ENSP00000390127:P296A	ENSP00000311257:P296A	P	+	1	0	STOX2	185167871	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.818000	0.86416	2.894000	0.99253	0.655000	0.94253	CCC	.	.	.	none		0.478	STOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361433.3	NM_020225	
ZFR	51663	hgsc.bcm.edu	37	5	32364329	32364329	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr5:32364329C>A	ENST00000265069.8	-	18	2990	c.2888G>T	c.(2887-2889)aGc>aTc	p.S963I	ZFR_ENST00000510369.1_5'UTR	NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	963	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		ATCCCCAGGGCTCTGAGGGCT	0.348																																					p.S963I		Atlas-SNP	.											.	ZFR	98	.	0			c.G2888T						PASS	.						83.0	86.0	85.0					5																	32364329		2203	4300	6503	SO:0001583	missense	51663	exon18			CCAGGGCTCTGAG	AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.2888G>T	chr5.hg19:g.32364329C>A	ENSP00000265069:p.Ser963Ile	245.0	0.0	.		241.0	96.0	.	NM_016107	B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Missense_Mutation	SNP	ENST00000265069.8	hg19	CCDS34139.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.027756	0.75390	.	.	ENSG00000056097	ENST00000265069;ENST00000382126	T	0.44482	0.92	5.74	5.74	0.90152	DZF (2);	0.000000	0.85682	D	0.000000	T	0.69251	0.3090	M	0.81112	2.525	0.80722	D	1	D;D	0.69078	0.997;0.996	D;D	0.83275	0.996;0.99	T	0.72110	-0.4389	10	0.87932	D	0	.	19.9357	0.97140	0.0:1.0:0.0:0.0	.	942;963	B5MEH6;Q96KR1	.;ZFR_HUMAN	I	963;942	ENSP00000265069:S963I	ENSP00000265069:S963I	S	-	2	0	ZFR	32400086	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.382000	0.79729	2.715000	0.92844	0.655000	0.94253	AGC	.	.	.	none		0.348	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366586.1		
C9	735	hgsc.bcm.edu	37	5	39364500	39364500	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr5:39364500A>G	ENST00000263408.4	-	1	162	c.67T>C	c.(67-69)Tac>Cac	p.Y23H	C9_ENST00000509186.1_Intron	NM_001737.3	NP_001728.1	P02748	CO9_HUMAN	complement component 9	23					complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|hemolysis by symbiont of host erythrocytes (GO:0019836)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane attack complex (GO:0005579)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			CTGGTCGTGTACTGTGCTGTG	0.488																																					p.Y23H		Atlas-SNP	.											.	C9	116	.	0			c.T67C						PASS	.						108.0	97.0	100.0					5																	39364500		2203	4300	6503	SO:0001583	missense	735	exon1			TCGTGTACTGTGC		CCDS3929.1	5p14-p12	2014-09-17			ENSG00000113600	ENSG00000113600		"""Complement system"""	1358	protein-coding gene	gene with protein product		120940					Standard	NM_001737		Approved		uc003jlv.4	P02748	OTTHUMG00000094767	ENST00000263408.4:c.67T>C	chr5.hg19:g.39364500A>G	ENSP00000263408:p.Tyr23His	54.0	0.0	.		68.0	32.0	.	NM_001737		Missense_Mutation	SNP	ENST00000263408.4	hg19	CCDS3929.1	.	.	.	.	.	.	.	.	.	.	A	3.190	-0.165949	0.06461	.	.	ENSG00000113600	ENST00000263408	T	0.30182	1.54	4.45	-2.14	0.07123	.	1.608480	0.03288	N	0.187176	T	0.14657	0.0354	N	0.08118	0	0.09310	N	1	B	0.26120	0.142	B	0.28139	0.086	T	0.13683	-1.0500	10	0.15499	T	0.54	-0.1471	4.7136	0.12884	0.5465:0.0:0.2939:0.1596	.	23	P02748	CO9_HUMAN	H	23	ENSP00000263408:Y23H	ENSP00000263408:Y23H	Y	-	1	0	C9	39400257	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.222000	0.02965	-0.430000	0.07318	-0.366000	0.07423	TAC	.	.	.	none		0.488	C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211576.3		
FOXF2	2295	hgsc.bcm.edu	37	6	1390659	1390659	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr6:1390659C>G	ENST00000259806.1	+	1	591	c.477C>G	c.(475-477)atC>atG	p.I159M		NM_001452.1	NP_001443.1	Q12947	FOXF2_HUMAN	forkhead box F2	159					embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|establishment of planar polarity of embryonic epithelium (GO:0042249)|extracellular matrix organization (GO:0030198)|genitalia development (GO:0048806)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			large_intestine(2)|lung(5)|prostate(1)	8	Ovarian(93;0.0733)	all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.095)		AGTGCTTCATCAAGCTGCCTA	0.657																																					p.I159M		Atlas-SNP	.											.	FOXF2	28	.	0			c.C477G						PASS	.						47.0	55.0	53.0					6																	1390659		2203	4300	6503	SO:0001583	missense	2295	exon1			CTTCATCAAGCTG	U13220	CCDS4472.1	6p25.3	2008-04-10			ENSG00000137273	ENSG00000137273		"""Forkhead boxes"""	3810	protein-coding gene	gene with protein product		603250		FKHL6		9799607, 7957066	Standard	NM_001452		Approved	FREAC2	uc003mtm.3	Q12947	OTTHUMG00000016243	ENST00000259806.1:c.477C>G	chr6.hg19:g.1390659C>G	ENSP00000259806:p.Ile159Met	142.0	0.0	.		158.0	58.0	.	NM_001452	Q5TGJ1|Q9UQ85	Missense_Mutation	SNP	ENST00000259806.1	hg19	CCDS4472.1	.	.	.	.	.	.	.	.	.	.	C	18.76	3.692590	0.68271	.	.	ENSG00000137273	ENST00000259806	D	0.95690	-3.78	4.53	4.53	0.55603	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.000000	0.85682	D	0.000000	D	0.95560	0.8557	L	0.53617	1.68	0.58432	D	0.999998	D	0.71674	0.998	D	0.75020	0.985	D	0.95812	0.8842	10	0.72032	D	0.01	.	9.8127	0.40833	0.0:0.9032:0.0:0.0968	.	159	Q12947	FOXF2_HUMAN	M	159	ENSP00000259806:I159M	ENSP00000259806:I159M	I	+	3	3	FOXF2	1335658	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.881000	0.48538	2.106000	0.64143	0.536000	0.68110	ATC	.	.	.	none		0.657	FOXF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043558.1		
CFB	629	hgsc.bcm.edu	37	6	31916623	31916623	+	Silent	SNP	A	A	G			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr6:31916623A>G	ENST00000425368.2	+	8	1566	c.1053A>G	c.(1051-1053)tcA>tcG	p.S351S	CFB_ENST00000477310.1_Silent_p.S702S|CFB_ENST00000556679.1_Silent_p.S853S|CFB_ENST00000497841.1_3'UTR|CFB_ENST00000456570.1_Silent_p.S853S	NM_001710.5	NP_001701.2	P00751	CFAB_HUMAN	complement factor B	351	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement binding (GO:0001848)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|urinary_tract(1)	21						AGTTGAAGTCAGGGACTAACA	0.542																																					p.S351S		Atlas-SNP	.											.	CFB	33	.	0			c.A1053G						PASS	.						123.0	110.0	115.0					6																	31916623		1510	2708	4218	SO:0001819	synonymous_variant	629	exon8			GAAGTCAGGGACT	L15702	CCDS4729.1	6p21.33	2014-09-17	2006-02-10	2006-02-10	ENSG00000243649	ENSG00000243649	3.4.21.47	"""Complement system"""	1037	protein-coding gene	gene with protein product		138470	"""B-factor, properdin"""	BFD, BF			Standard	NM_001710		Approved	H2-Bf	uc011dor.2	P00751	OTTHUMG00000031198	ENST00000425368.2:c.1053A>G	chr6.hg19:g.31916623A>G		56.0	0.0	.		69.0	36.0	.	NM_001710	B0QZQ6|O15006|Q29944|Q53F89|Q5JP67|Q5ST50|Q96HX6|Q9BTF5|Q9BX92	Silent	SNP	ENST00000425368.2	hg19	CCDS4729.1																																																																																			.	.	.	none		0.542	CFB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076395.3	NM_001710	
TAF8	129685	hgsc.bcm.edu	37	6	42044861	42044862	+	Missense_Mutation	DNP	GA	GA	CT			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr6:42044861_42044862GA>CT	ENST00000372977.3	+	8	822_823	c.804_805GA>CT	c.(802-807)gaGAac>gaCTac	p.268_269EN>DY	TAF8_ENST00000456846.2_Missense_Mutation_p.268_269EN>DY|TAF8_ENST00000465926.1_Missense_Mutation_p.192_193EN>DY|TAF8_ENST00000494547.1_Missense_Mutation_p.R309T|TAF8_ENST00000372982.4_Missense_Mutation_p.R309T	NM_138572.2	NP_612639.2	Q7Z7C8	TAF8_HUMAN	TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa	268					cell differentiation (GO:0030154)|inner cell mass cell proliferation (GO:0001833)|maintenance of protein location in nucleus (GO:0051457)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fat cell differentiation (GO:0045598)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|transcription factor TFIID complex (GO:0005669)				endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	6	Colorectal(47;0.196)		STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00179)			CCGAGAAGGAGAACACCTCTGT	0.49																																					p.E268D|p.N269Y		Atlas-SNP	.											.	TAF8	25	.	0			c.G804C|c.A805T						PASS	.																																			SO:0001583	missense	129685	exon8			GAAGGAGAACACC|AAGGAGAACACCT	AK057383	CCDS43462.1	6p21.1	2008-10-23	2007-07-30	2007-07-30	ENSG00000137413	ENSG00000137413			17300	protein-coding gene	gene with protein product		609514	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 45/50kDa"", ""taube nuss homolog (mouse)"""	TBN			Standard	NM_138572		Approved	FLJ32821, TAF(II)43	uc003ors.3	Q7Z7C8	OTTHUMG00000014692	Exception_encountered	chr6.hg19:g.42044861_42044862delinsCT	ENSP00000362068:p.E268_N269delinsDY	146.0	0.0	.		146.0	51.0	.	NM_138572	Q5T0K1|Q8N4R9|Q96M52	Missense_Mutation	SNP	ENST00000372977.3	hg19	CCDS43462.1																																																																																			.	.	.	none		0.490	TAF8-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000357901.1	NM_138572	
UTRN	7402	hgsc.bcm.edu	37	6	144806574	144806574	+	Silent	SNP	C	C	T			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr6:144806574C>T	ENST00000367545.3	+	27	3741	c.3741C>T	c.(3739-3741)acC>acT	p.T1247T		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	1247					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TTGAAACTACCTGGTTAAACA	0.443																																					p.T1247T		Atlas-SNP	.											.	UTRN	327	.	0			c.C3741T						PASS	.						241.0	236.0	237.0					6																	144806574		2203	4300	6503	SO:0001819	synonymous_variant	7402	exon27			AACTACCTGGTTA	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.3741C>T	chr6.hg19:g.144806574C>T		131.0	0.0	.		160.0	63.0	.	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Silent	SNP	ENST00000367545.3	hg19	CCDS34547.1																																																																																			.	.	.	none		0.443	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
STXBP5	134957	hgsc.bcm.edu	37	6	147636834	147636834	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr6:147636834G>A	ENST00000321680.6	+	15	1586	c.1586G>A	c.(1585-1587)aGa>aAa	p.R529K	STXBP5_ENST00000367480.3_Missense_Mutation_p.R529K|STXBP5_ENST00000367481.3_Missense_Mutation_p.R529K|STXBP5_ENST00000179882.6_Missense_Mutation_p.R200K	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	529					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		ATTATTTATAGATTCAGCAAG	0.368																																					p.R529K		Atlas-SNP	.											.	STXBP5	163	.	0			c.G1586A						PASS	.						153.0	148.0	150.0					6																	147636834		2203	4300	6503	SO:0001583	missense	134957	exon15			TTTATAGATTCAG	AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.1586G>A	chr6.hg19:g.147636834G>A	ENSP00000321826:p.Arg529Lys	196.0	0.0	.		207.0	74.0	.	NM_139244	Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Missense_Mutation	SNP	ENST00000321680.6	hg19	CCDS47499.1	.	.	.	.	.	.	.	.	.	.	G	9.754	1.168167	0.21621	.	.	ENSG00000164506	ENST00000367481;ENST00000321680;ENST00000367480;ENST00000179882	T;T;T;T	0.65549	2.81;2.81;1.64;-0.16	5.78	4.91	0.64330	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (2);	0.048956	0.85682	N	0.000000	T	0.52108	0.1714	L	0.31804	0.96	0.58432	D	0.999999	D;D;D	0.61697	0.99;0.987;0.986	D;P;D	0.72982	0.979;0.787;0.965	T	0.54490	-0.8286	10	0.07644	T	0.81	.	14.5713	0.68213	0.07:0.0:0.93:0.0	.	529;529;200	Q5T5C0-2;Q5T5C0;B3KXX0	.;STXB5_HUMAN;.	K	529;529;529;200	ENSP00000356451:R529K;ENSP00000321826:R529K;ENSP00000356450:R529K;ENSP00000179882:R200K	ENSP00000179882:R200K	R	+	2	0	STXBP5	147678527	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.424000	0.73366	1.442000	0.47568	0.563000	0.77884	AGA	.	.	.	none		0.368	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1		
SDK1	221935	hgsc.bcm.edu	37	7	4051838	4051838	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr7:4051838C>A	ENST00000404826.2	+	16	2530	c.2391C>A	c.(2389-2391)caC>caA	p.H797Q	SDK1_ENST00000389531.3_Missense_Mutation_p.H797Q	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	797	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AAACAGAGCACAACGGGGTGT	0.542																																					p.H797Q		Atlas-SNP	.											.	SDK1	361	.	0			c.C2391A						PASS	.						112.0	114.0	113.0					7																	4051838		2203	4300	6503	SO:0001583	missense	221935	exon16			AGAGCACAACGGG	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.2391C>A	chr7.hg19:g.4051838C>A	ENSP00000385899:p.His797Gln	58.0	0.0	.		57.0	17.0	.	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	hg19	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	C	0.033	-1.323101	0.01320	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.56103	0.48;0.48	5.15	1.22	0.21188	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.075263	0.53938	D	0.000045	T	0.30792	0.0776	N	0.00765	-1.205	0.33596	D	0.601748	B;D	0.76494	0.034;0.999	B;P	0.60541	0.016;0.876	T	0.40251	-0.9573	10	0.21540	T	0.41	.	7.3399	0.26632	0.12:0.5964:0.0:0.2836	.	797;797	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	Q	797	ENSP00000385899:H797Q;ENSP00000374182:H797Q	ENSP00000374182:H797Q	H	+	3	2	SDK1	4018364	0.403000	0.25319	0.990000	0.47175	0.402000	0.30811	-0.398000	0.07259	0.344000	0.23847	0.563000	0.77884	CAC	.	.	.	none		0.542	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
ELMO1	9844	hgsc.bcm.edu	37	7	36895202	36895202	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr7:36895202A>G	ENST00000310758.4	-	22	2785	c.2138T>C	c.(2137-2139)aTt>aCt	p.I713T	ELMO1_ENST00000442504.1_Missense_Mutation_p.I713T|ELMO1_ENST00000396040.2_Missense_Mutation_p.I233T|ELMO1_ENST00000341056.3_Missense_Mutation_p.I415T|ELMO1_ENST00000448602.1_Missense_Mutation_p.I713T|ELMO1_ENST00000396045.3_Missense_Mutation_p.I233T	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	713					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						CTCCTTGGGAATCGGCGGAGG	0.562																																					p.I713T		Atlas-SNP	.											.	ELMO1	141	.	0			c.T2138C						PASS	.						122.0	123.0	123.0					7																	36895202		2203	4300	6503	SO:0001583	missense	9844	exon22			TTGGGAATCGGCG	AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.2138T>C	chr7.hg19:g.36895202A>G	ENSP00000312185:p.Ile713Thr	117.0	0.0	.		115.0	44.0	.	NM_014800	A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Missense_Mutation	SNP	ENST00000310758.4	hg19	CCDS5449.1	.	.	.	.	.	.	.	.	.	.	A	17.40	3.379922	0.61845	.	.	ENSG00000155849	ENST00000341056;ENST00000396045;ENST00000310758;ENST00000361912;ENST00000396040;ENST00000442504;ENST00000448602	T;T;T;T;T;T	0.51325	1.27;0.71;2.25;0.71;2.25;2.25	4.77	4.77	0.60923	.	0.061993	0.64402	D	0.000006	T	0.54647	0.1871	M	0.73962	2.25	0.80722	D	1	B	0.29627	0.252	B	0.36989	0.238	T	0.60969	-0.7157	10	0.72032	D	0.01	.	14.759	0.69590	1.0:0.0:0.0:0.0	.	713	Q92556	ELMO1_HUMAN	T	415;233;713;617;233;713;713	ENSP00000342142:I415T;ENSP00000379360:I233T;ENSP00000312185:I713T;ENSP00000379355:I233T;ENSP00000406952:I713T;ENSP00000394458:I713T	ENSP00000312185:I713T	I	-	2	0	ELMO1	36861727	1.000000	0.71417	0.981000	0.43875	0.875000	0.50365	9.139000	0.94554	2.132000	0.65825	0.528000	0.53228	ATT	.	.	.	none		0.562	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442	
IQUB	154865	hgsc.bcm.edu	37	7	123143385	123143385	+	Nonsense_Mutation	SNP	G	G	A			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr7:123143385G>A	ENST00000466202.1	-	4	1141	c.565C>T	c.(565-567)Caa>Taa	p.Q189*	IQUB_ENST00000324698.6_Nonsense_Mutation_p.Q189*|IQUB_ENST00000434450.1_Nonsense_Mutation_p.Q189*|IQUB_ENST00000488987.1_Intron	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	189	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)				breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						ACTCCATGTTGTACTAGAGTC	0.284																																					p.Q189X		Atlas-SNP	.											.	IQUB	117	.	0			c.C565T						PASS	.						102.0	109.0	107.0					7																	123143385		2203	4300	6503	SO:0001587	stop_gained	154865	exon4			CATGTTGTACTAG	AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.565C>T	chr7.hg19:g.123143385G>A	ENSP00000417769:p.Gln189*	102.0	0.0	.		132.0	49.0	.	NM_178827	A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Nonsense_Mutation	SNP	ENST00000466202.1	hg19	CCDS5787.1	.	.	.	.	.	.	.	.	.	.	G	12.53	1.965645	0.34659	.	.	ENSG00000164675	ENST00000466202;ENST00000324698;ENST00000434450	.	.	.	5.31	4.37	0.52481	.	0.486665	0.19520	N	0.112302	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	3.6964	0.08365	0.0835:0.1402:0.52:0.2564	.	.	.	.	X	189	.	ENSP00000324882:Q189X	Q	-	1	0	IQUB	122930621	0.004000	0.15560	0.899000	0.35326	0.132000	0.20833	0.148000	0.16224	2.637000	0.89404	0.655000	0.94253	CAA	.	.	.	none		0.284	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348529.1	NM_178827	
ZNF212	7988	hgsc.bcm.edu	37	7	148947628	148947629	+	Missense_Mutation	DNP	GA	GA	CC			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr7:148947628_148947629GA>CC	ENST00000335870.2	+	2	531_532	c.403_404GA>CC	c.(403-405)GAg>CCg	p.E135P		NM_012256.3	NP_036388.2	Q9UDV6	ZN212_HUMAN	zinc finger protein 212	135					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(4)|ovary(1)|prostate(1)	9	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)			CAGCAAGGGGGAGGCCCCCAAG	0.559																																					p.E135Q|p.E135A		Atlas-SNP	.											.	ZNF212	28	.	0			c.G403C|c.A404C						PASS	.																																			SO:0001583	missense	7988	exon2			AAGGGGGAGGCCC|AGGGGGAGGCCCC	U38864	CCDS5896.1	7q36.1	2013-01-08			ENSG00000170260	ENSG00000170260		"""Zinc fingers, C2H2-type"", ""-"""	13004	protein-coding gene	gene with protein product		602386				9169157	Standard	NM_012256		Approved	C2H2-150	uc003wfp.3	Q9UDV6	OTTHUMG00000158968	Exception_encountered	chr7.hg19:g.148947628_148947629delinsCC	ENSP00000338572:p.Glu135Pro	53.0	0.0	.		59.0|58.0	20.0|19.0	.	NM_012256	B2RCF4|Q13396|Q8N664	Missense_Mutation	SNP	ENST00000335870.2	hg19	CCDS5896.1																																																																																			.	.	.	none		0.559	ZNF212-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352710.1	NM_012256	
NOM1	64434	hgsc.bcm.edu	37	7	156759786	156759786	+	Splice_Site	SNP	G	G	C			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr7:156759786G>C	ENST00000275820.3	+	9	2313	c.2298G>C	c.(2296-2298)aaG>aaC	p.K766N		NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	766	MI. {ECO:0000255|PROSITE- ProRule:PRU00698}.					nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		CCATCTTAAAGGTTCGTGTAA	0.403																																					p.K766N		Atlas-SNP	.											.	NOM1	73	.	0			c.G2298C						PASS	.						107.0	99.0	101.0					7																	156759786		2203	4300	6503	SO:0001630	splice_region_variant	64434	exon9			CTTAAAGGTTCGT	AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.2298+1G>C	chr7.hg19:g.156759786G>C		65.0	0.0	.		64.0	17.0	.	NM_138400	Q96I08	Missense_Mutation	SNP	ENST00000275820.3	hg19	CCDS34787.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.757513	0.49468	.	.	ENSG00000146909	ENST00000275820	T	0.17213	2.29	4.73	4.73	0.59995	Initiation factor eIF-4 gamma, MA3 (1);	0.000000	0.85682	D	0.000000	T	0.51210	0.1661	M	0.89968	3.075	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.63537	-0.6615	10	0.72032	D	0.01	-36.156	18.0532	0.89356	0.0:0.0:1.0:0.0	.	766	Q5C9Z4	NOM1_HUMAN	N	766	ENSP00000275820:K766N	ENSP00000275820:K766N	K	+	3	2	NOM1	156452547	1.000000	0.71417	0.991000	0.47740	0.037000	0.13140	6.007000	0.70731	2.317000	0.78254	0.655000	0.94253	AAG	.	.	.	none		0.403	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327098.1	NM_138400	Missense_Mutation
GBA2	57704	hgsc.bcm.edu	37	9	35740323	35740323	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr9:35740323G>A	ENST00000378103.3	-	7	1689	c.1166C>T	c.(1165-1167)gCt>gTt	p.A389V	GBA2_ENST00000467252.1_5'UTR|GBA2_ENST00000378094.4_Missense_Mutation_p.A389V|GBA2_ENST00000378088.1_5'Flank|GBA2_ENST00000545786.1_Missense_Mutation_p.A395V	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	389					bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CACAGCTCCAGCAATGCCTAC	0.547																																					p.A389V		Atlas-SNP	.											.	GBA2	77	.	0			c.C1166T						PASS	.						54.0	50.0	51.0					9																	35740323		2203	4300	6503	SO:0001583	missense	57704	exon7			GCTCCAGCAATGC	AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.1166C>T	chr9.hg19:g.35740323G>A	ENSP00000367343:p.Ala389Val	54.0	0.0	.		55.0	16.0	.	NM_020944	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	ENST00000378103.3	hg19	CCDS6589.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.768382	0.90020	.	.	ENSG00000070610	ENST00000378103;ENST00000378094;ENST00000545786	.	.	.	5.6	4.66	0.58398	Beta-glucosidase, GBA2 type, N-terminal (1);	0.051116	0.85682	D	0.000000	T	0.79557	0.4466	M	0.89095	3.005	0.80722	D	1	D;D;P	0.67145	0.971;0.996;0.955	P;P;P	0.59357	0.651;0.856;0.763	T	0.83056	-0.0150	9	0.59425	D	0.04	-8.1199	15.9277	0.79632	0.0:0.135:0.865:0.0	.	395;389;389	F5H7P6;Q9HCG7-2;Q9HCG7	.;.;GBA2_HUMAN	V	389;389;395	.	ENSP00000367334:A389V	A	-	2	0	GBA2	35730323	1.000000	0.71417	0.987000	0.45799	0.979000	0.70002	6.041000	0.70988	2.798000	0.96311	0.650000	0.86243	GCT	.	.	.	none		0.547	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1	NM_020944	
NUP214	8021	hgsc.bcm.edu	37	9	134003841	134003841	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr9:134003841T>A	ENST00000359428.5	+	3	508	c.364T>A	c.(364-366)Ttt>Att	p.F122I	RNU6-881P_ENST00000516813.1_RNA|NUP214_ENST00000411637.2_Missense_Mutation_p.F122I|NUP214_ENST00000451030.1_Missense_Mutation_p.F122I			P35658	NU214_HUMAN	nucleoporin 214kDa	122	Seven-bladed beta propeller.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		CATTATTGCTTTTTTTGATGT	0.398			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.F122I	Pancreas(4;24 48 25510 30394 32571)	Atlas-SNP	.		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	.	NUP214	166	.	0			c.T364A						PASS	.						245.0	198.0	214.0					9																	134003841		2203	4300	6503	SO:0001583	missense	8021	exon3			ATTGCTTTTTTTG	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.364T>A	chr9.hg19:g.134003841T>A	ENSP00000352400:p.Phe122Ile	50.0	0.0	.		78.0	32.0	.	NM_005085	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	hg19	CCDS6940.1	.	.	.	.	.	.	.	.	.	.	T	34	5.324616	0.95708	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000531584	D;D;D;D	0.94046	-3.34;-3.34;-3.34;-3.34	5.94	5.94	0.96194	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.44097	D	0.000484	D	0.95364	0.8495	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.93373	0.6737	10	0.11485	T	0.65	-11.7116	15.5751	0.76373	0.0:0.0:0.0:1.0	.	122;122	P35658-4;P35658	.;NU214_HUMAN	I	122;122;122;122;32	ENSP00000352400:F122I;ENSP00000396576:F122I;ENSP00000405014:F122I;ENSP00000435874:F32I	ENSP00000352400:F122I	F	+	1	0	NUP214	132993662	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.343000	0.72986	2.276000	0.75962	0.455000	0.32223	TTT	.	.	.	none		0.398	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
GDF10	2662	hgsc.bcm.edu	37	10	48426591	48426591	+	Silent	SNP	C	C	A			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr10:48426591C>A	ENST00000224605.2	-	3	1681	c.1416G>T	c.(1414-1416)gtG>gtT	p.V472V		NM_004962.3	NP_004953.1	P55107	BMP3B_HUMAN	growth differentiation factor 10	472					fat cell differentiation (GO:0045444)|growth (GO:0040007)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(20)|skin(1)	31						CACAGGTGTCCACGGACATGT	0.577											OREG0020165	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V472V		Atlas-SNP	.											.	GDF10	79	.	0			c.G1416T						PASS	.						96.0	98.0	97.0					10																	48426591		2203	4300	6503	SO:0001819	synonymous_variant	2662	exon3			GGTGTCCACGGAC	L42113	CCDS73117.1	10q11.22	2014-04-10			ENSG00000107623	ENSG00000266524		"""Endogenous ligands"""	4215	protein-coding gene	gene with protein product		601361				8679252	Standard	NM_004962		Approved	BMP-3b	uc001jfb.3	P55107	OTTHUMG00000188319	ENST00000224605.2:c.1416G>T	chr10.hg19:g.48426591C>A		75.0	0.0	.	954	79.0	30.0	.	NM_004962	Q5VSQ8|Q9UCX6	Silent	SNP	ENST00000224605.2	hg19	CCDS7220.1																																																																																			.	.	.	none		0.577	GDF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047884.1	NM_004962	
OR5D16	390144	hgsc.bcm.edu	37	11	55606280	55606280	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr11:55606280G>C	ENST00000378396.1	+	1	53	c.53G>C	c.(52-54)gGc>gCc	p.G18A		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				ACTCTCTTGGGCTTCTCAGAT	0.418																																					p.G18A		Atlas-SNP	.											.	OR5D16	94	.	0			c.G53C						PASS	.						100.0	91.0	94.0					11																	55606280		2201	4296	6497	SO:0001583	missense	390144	exon1			TCTTGGGCTTCTC	AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.53G>C	chr11.hg19:g.55606280G>C	ENSP00000367649:p.Gly18Ala	120.0	0.0	.		159.0	49.0	.	NM_001005496	Q6IF65|Q96RB4	Missense_Mutation	SNP	ENST00000378396.1	hg19	CCDS31512.1	.	.	.	.	.	.	.	.	.	.	.	15.72	2.916894	0.52546	.	.	ENSG00000205029	ENST00000378396	T	0.00651	5.97	4.15	1.15	0.20763	.	.	.	.	.	T	0.02970	0.0088	M	0.86502	2.82	0.26922	N	0.966655	D	0.60160	0.987	D	0.66084	0.941	T	0.25813	-1.0121	9	0.87932	D	0	-12.1839	6.3729	0.21491	0.175:0.1508:0.6741:0.0	.	18	Q8NGK9	OR5DG_HUMAN	A	18	ENSP00000367649:G18A	ENSP00000367649:G18A	G	+	2	0	OR5D16	55362856	1.000000	0.71417	0.079000	0.20413	0.900000	0.52787	3.721000	0.54941	0.048000	0.15891	0.530000	0.56133	GGC	.	.	.	none		0.418	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334506.1	NM_001005496	
TMEM179B	374395	hgsc.bcm.edu	37	11	62556681	62556681	+	Splice_Site	SNP	A	A	T			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr11:62556681A>T	ENST00000333449.4	+	2	288	c.283A>T	c.(283-285)Aga>Tga	p.R95*	RP11-727F15.12_ENST00000601484.1_RNA|TMEM223_ENST00000525631.1_Intron|TMEM223_ENST00000527073.1_Intron|TMEM179B_ENST00000533861.1_Splice_Site_p.R95*	NM_199337.2	NP_955369.1	Q7Z7N9	T179B_HUMAN	transmembrane protein 179B	95						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|liver(1)|lung(1)	4						GGACTCCCACAGGTGACTGCC	0.587																																					p.R95X		Atlas-SNP	.											.	TMEM179B	13	.	0			c.A283T						PASS	.						82.0	69.0	73.0					11																	62556681		2201	4299	6500	SO:0001630	splice_region_variant	374395	exon2			TCCCACAGGTGAC	BC051355	CCDS8036.1	11q12.3	2007-11-26			ENSG00000185475	ENSG00000185475			33744	protein-coding gene	gene with protein product							Standard	NM_199337		Approved		uc001nvd.4	Q7Z7N9	OTTHUMG00000167611	ENST00000333449.4:c.284+1A>T	chr11.hg19:g.62556681A>T		64.0	0.0	.		72.0	28.0	.	NM_199337		Nonsense_Mutation	SNP	ENST00000333449.4	hg19	CCDS8036.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	32|32	5.192393|5.192393	0.94960|0.94960	.|.	.|.	ENSG00000185475|ENSG00000185475	ENST00000526546|ENST00000533861;ENST00000333449	.|.	.|.	.|.	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	.|0.097909	.|0.64402	.|D	.|0.000002	T|.	0.33556|.	0.0867|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.36817|.	-0.9732|.	3|.	.|0.02654	.|T	.|1	.|.	12.3273|12.3273	0.55018|0.55018	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	L|X	14|95	.|.	.|ENSP00000333697:R95X	Q|R	+|+	2|1	0|2	TMEM179B|TMEM179B	62313257|62313257	0.952000|0.952000	0.32445|0.32445	1.000000|1.000000	0.80357|0.80357	0.869000|0.869000	0.49853|0.49853	2.064000|2.064000	0.41432|0.41432	2.179000|2.179000	0.69175|0.69175	0.459000|0.459000	0.35465|0.35465	CAG|AGA	.	.	.	none		0.587	TMEM179B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395362.2	NM_199337	Nonsense_Mutation
LRP5	4041	hgsc.bcm.edu	37	11	68154171	68154171	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr11:68154171C>T	ENST00000294304.7	+	6	1509	c.1403C>T	c.(1402-1404)cCc>cTc	p.P468L		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	468	Beta-propeller 2.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GCACTGCACCCCGTGATGGGG	0.677																																					p.P468L		Atlas-SNP	.											.	LRP5	136	.	0			c.C1403T						PASS	.						24.0	24.0	24.0					11																	68154171		2193	4281	6474	SO:0001583	missense	4041	exon6			TGCACCCCGTGAT	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.1403C>T	chr11.hg19:g.68154171C>T	ENSP00000294304:p.Pro468Leu	81.0	0.0	.		90.0	35.0	.	NM_002335	Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	hg19	CCDS8181.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.727213	0.89390	.	.	ENSG00000162337	ENST00000294304	D	0.95518	-3.73	3.94	3.94	0.45596	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.48767	U	0.000167	D	0.98785	0.9591	H	0.99130	4.44	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99157	1.0860	10	0.66056	D	0.02	.	16.5321	0.84364	0.0:1.0:0.0:0.0	.	468	O75197	LRP5_HUMAN	L	468	ENSP00000294304:P468L	ENSP00000294304:P468L	P	+	2	0	LRP5	67910747	1.000000	0.71417	0.991000	0.47740	0.846000	0.48090	7.339000	0.79282	2.228000	0.72767	0.455000	0.32223	CCC	.	.	.	none		0.677	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335	
PPP6R3	55291	hgsc.bcm.edu	37	11	68377430	68377430	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr11:68377430C>A	ENST00000393800.2	+	23	2763	c.2509C>A	c.(2509-2511)Ccc>Acc	p.P837T	PPP6R3_ENST00000265637.4_Missense_Mutation_p.P791T|PPP6R3_ENST00000524845.1_Missense_Mutation_p.P808T|PPP6R3_ENST00000527403.2_Missense_Mutation_p.P802T|PPP6R3_ENST00000534534.1_Missense_Mutation_p.P605T|PPP6R3_ENST00000265636.5_Missense_Mutation_p.P757T|PPP6R3_ENST00000393799.2_Missense_Mutation_p.P843T|PPP6R3_ENST00000529710.1_Missense_Mutation_p.P757T|PPP6R3_ENST00000524904.1_Missense_Mutation_p.P831T|PPP6R3_ENST00000393801.3_Missense_Mutation_p.P843T	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	837					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						AGAGGAGTGTCCCGAGACTGC	0.602																																					p.P843T		Atlas-SNP	.											.	PPP6R3	159	.	0			c.C2527A						PASS	.						114.0	99.0	104.0					11																	68377430		2200	4294	6494	SO:0001583	missense	55291	exon24			GAGTGTCCCGAGA	AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.2509C>A	chr11.hg19:g.68377430C>A	ENSP00000377389:p.Pro837Thr	69.0	0.0	.		91.0	49.0	.	NM_001164160	Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Missense_Mutation	SNP	ENST00000393800.2	hg19	CCDS53672.1	.	.	.	.	.	.	.	.	.	.	C	5.098	0.203685	0.09704	.	.	ENSG00000110075	ENST00000393799;ENST00000393800;ENST00000534534;ENST00000524845;ENST00000265637;ENST00000524904;ENST00000393801;ENST00000265636;ENST00000529710;ENST00000527403;ENST00000534190	T;T;T;T;T;T;T;T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41	5.38	4.38	0.52667	.	0.726852	0.13772	N	0.363810	T	0.47838	0.1467	N	0.22421	0.69	0.19575	N	0.999961	B;B;B;B;B;B;B;B	0.06786	0.0;0.0;0.001;0.0;0.0;0.0;0.0;0.001	B;B;B;B;B;B;B;B	0.09377	0.001;0.0;0.004;0.001;0.001;0.0;0.001;0.004	T	0.16600	-1.0397	10	0.37606	T	0.19	.	4.8595	0.13575	0.2207:0.5836:0.1117:0.0839	.	520;605;757;808;831;837;843;757	B4DYU6;E9PQP7;Q5H9R7-3;Q5H9R7-6;Q5H9R7-2;Q5H9R7;Q5H9R7-5;Q5H9R7-4	.;.;.;.;.;PP6R3_HUMAN;.;.	T	843;837;605;808;791;831;843;757;757;802;544	ENSP00000377388:P843T;ENSP00000377389:P837T;ENSP00000434429:P605T;ENSP00000431415:P808T;ENSP00000265637:P791T;ENSP00000433058:P831T;ENSP00000377390:P843T;ENSP00000265636:P757T;ENSP00000437329:P757T;ENSP00000433565:P802T;ENSP00000436209:P544T	ENSP00000265636:P757T	P	+	1	0	PPP6R3	68134006	0.133000	0.22466	0.839000	0.33178	0.002000	0.02628	-0.056000	0.11787	2.512000	0.84698	0.561000	0.74099	CCC	.	.	.	none		0.602	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395275.1	NM_018312	
PIK3C2G	5288	hgsc.bcm.edu	37	12	18699304	18699304	+	Missense_Mutation	SNP	A	A	T	rs552965370		TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr12:18699304A>T	ENST00000266497.5	+	24	3443	c.3405A>T	c.(3403-3405)aaA>aaT	p.K1135N	PIK3C2G_ENST00000433979.1_Missense_Mutation_p.K1135N|PIK3C2G_ENST00000538779.1_Missense_Mutation_p.K1176N			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	1135	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				AAGACCTGAAATATGTGTATA	0.393																																					p.K1135N		Atlas-SNP	.											.	PIK3C2G	315	.	0			c.A3405T						PASS	.						121.0	109.0	113.0					12																	18699304		1971	4159	6130	SO:0001583	missense	5288	exon25			CCTGAAATATGTG	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.3405A>T	chr12.hg19:g.18699304A>T	ENSP00000266497:p.Lys1135Asn	129.0	0.0	.		125.0	56.0	.	NM_004570	A1L3U0	Missense_Mutation	SNP	ENST00000266497.5	hg19	CCDS44839.1	.	.	.	.	.	.	.	.	.	.	A	17.42	3.385183	0.61956	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	D;D;D	0.81821	-1.54;-1.54;-1.54	4.07	2.87	0.33458	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.155509	0.42682	D	0.000680	T	0.74084	0.3670	N	0.20304	0.555	0.44302	D	0.997173	P;P;P	0.52463	0.921;0.953;0.921	P;P;P	0.53401	0.535;0.725;0.535	T	0.71073	-0.4698	10	0.36615	T	0.2	-21.2283	9.6631	0.39967	0.9141:0.0:0.0859:0.0	.	1175;1176;1135	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	N	1135;1135;1176	ENSP00000404845:K1135N;ENSP00000266497:K1135N;ENSP00000445381:K1176N	ENSP00000266497:K1135N	K	+	3	2	PIK3C2G	18590571	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	2.472000	0.45136	0.862000	0.35528	0.533000	0.62120	AAA	.	.	.	none		0.393	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570	
DENND5B	160518	hgsc.bcm.edu	37	12	31633023	31633023	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr12:31633023A>G	ENST00000389082.5	-	3	668	c.404T>C	c.(403-405)cTt>cCt	p.L135P	DENND5B_ENST00000306833.6_Missense_Mutation_p.L170P|DENND5B_ENST00000536562.1_Missense_Mutation_p.L170P|DENND5B_ENST00000354285.4_Missense_Mutation_p.L157P|DENND5B_ENST00000545147.1_Intron	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	135					positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						CATCTGGTAAAGTGTCTGCAT	0.408																																					p.L135P		Atlas-SNP	.											.	DENND5B	114	.	0			c.T404C						PASS	.						90.0	87.0	88.0					12																	31633023		2068	4221	6289	SO:0001583	missense	160518	exon3			TGGTAAAGTGTCT	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.404T>C	chr12.hg19:g.31633023A>G	ENSP00000373734:p.Leu135Pro	101.0	0.0	.		103.0	44.0	.	NM_144973	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Missense_Mutation	SNP	ENST00000389082.5	hg19	CCDS44857.1	.	.	.	.	.	.	.	.	.	.	A	19.94	3.920322	0.73098	.	.	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562;ENST00000354285;ENST00000546299	T;T;T;T;T	0.11712	3.31;3.43;3.43;2.75;2.77	4.65	4.65	0.58169	.	0.000000	0.64402	D	0.000004	T	0.33000	0.0848	M	0.73962	2.25	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;1.0;0.999;1.0	T	0.10245	-1.0638	10	0.87932	D	0	-17.2544	14.2554	0.66048	1.0:0.0:0.0:0.0	.	170;57;157;135;170	Q6ZUT9-2;Q6ZUT9-3;Q6ZUT9-4;Q6ZUT9;G3V1S3	.;.;.;DEN5B_HUMAN;.	P	135;170;170;157;87	ENSP00000373734:L135P;ENSP00000306482:L170P;ENSP00000444889:L170P;ENSP00000346238:L157P;ENSP00000442938:L87P	ENSP00000306482:L170P	L	-	2	0	DENND5B	31524290	1.000000	0.71417	0.901000	0.35422	0.908000	0.53690	8.897000	0.92532	1.955000	0.56771	0.533000	0.62120	CTT	.	.	.	none		0.408	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973	
PDE1B	5153	hgsc.bcm.edu	37	12	54964116	54964116	+	Missense_Mutation	SNP	G	G	C	rs568969611		TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr12:54964116G>C	ENST00000243052.3	+	6	1005	c.569G>C	c.(568-570)cGg>cCg	p.R190P	PDE1B_ENST00000394277.3_3'UTR|PDE1B_ENST00000550620.1_Missense_Mutation_p.R170P|PDE1B_ENST00000538346.1_Missense_Mutation_p.R149P	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	190					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	TTGCTGACTCGGCATAACCTC	0.512																																					p.R190P		Atlas-SNP	.											.	PDE1B	76	.	0			c.G569C						PASS	.						184.0	153.0	163.0					12																	54964116		2203	4300	6503	SO:0001583	missense	5153	exon6			TGACTCGGCATAA	U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.569G>C	chr12.hg19:g.54964116G>C	ENSP00000243052:p.Arg190Pro	50.0	0.0	.		72.0	19.0	.	NM_000924	Q92825|Q96KP3	Missense_Mutation	SNP	ENST00000243052.3	hg19	CCDS8882.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.561493	0.86335	.	.	ENSG00000123360	ENST00000243052;ENST00000538346;ENST00000550620	T;T;T	0.71461	-0.57;-0.54;-0.55	3.84	3.84	0.44239	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.065176	0.56097	D	0.000021	T	0.82116	0.4967	M	0.80183	2.485	0.80722	D	1	D;P	0.54397	0.966;0.921	P;P	0.61533	0.89;0.841	D	0.85159	0.0991	10	0.87932	D	0	.	14.0587	0.64786	0.0:0.0:1.0:0.0	.	170;190	Q01064-2;Q01064	.;PDE1B_HUMAN	P	190;149;170	ENSP00000243052:R190P;ENSP00000442559:R149P;ENSP00000448519:R170P	ENSP00000243052:R190P	R	+	2	0	PDE1B	53250383	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.570000	0.82390	2.433000	0.82419	0.561000	0.74099	CGG	.	.	.	none		0.512	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406203.1		
DCTN2	10540	hgsc.bcm.edu	37	12	57925883	57925883	+	Missense_Mutation	SNP	T	T	G			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr12:57925883T>G	ENST00000548249.1	-	13	1301	c.1034A>C	c.(1033-1035)cAg>cCg	p.Q345P	DCTN2_ENST00000543672.1_Missense_Mutation_p.Q350P|DCTN2_ENST00000537439.1_Missense_Mutation_p.Q322P|DCTN2_ENST00000434715.3_Missense_Mutation_p.Q350P|DCTN2_ENST00000551400.1_5'Flank	NM_001261412.1|NM_001261413.1	NP_001248341.1|NP_001248342.1	Q13561	DCTN2_HUMAN	dynactin 2 (p50)	345					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|vesicle (GO:0031982)	motor activity (GO:0003774)|spectrin binding (GO:0030507)			endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|upper_aerodigestive_tract(2)	11						CTGACCAAACTGCATGGCTAC	0.473																																					p.Q347P		Atlas-SNP	.											.	DCTN2	51	.	0			c.A1040C						PASS	.						88.0	91.0	90.0					12																	57925883		1967	4139	6106	SO:0001583	missense	10540	exon13			CCAAACTGCATGG	U50733	CCDS44930.1, CCDS58245.1, CCDS73489.1	12q13.3	2008-05-14				ENSG00000175203			2712	protein-coding gene	gene with protein product		607376				8647893	Standard	NM_001261412		Approved	RBP50, DCTN-50	uc001som.2	Q13561	OTTHUMG00000170124	ENST00000548249.1:c.1034A>C	chr12.hg19:g.57925883T>G	ENSP00000447824:p.Gln345Pro	169.0	0.0	.		127.0	49.0	.	NM_001261412	B2RBK5|Q86YN2|Q9BW17	Missense_Mutation	SNP	ENST00000548249.1	hg19	CCDS58245.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.973025	0.74246	.	.	ENSG00000175203	ENST00000548249;ENST00000434715;ENST00000543672;ENST00000537439;ENST00000354743;ENST00000543105;ENST00000546758	.	.	.	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.60547	0.2277	M	0.69823	2.125	0.80722	D	1	P;P;P	0.39311	0.616;0.616;0.667	B;B;B	0.42138	0.377;0.326;0.301	T	0.62086	-0.6928	9	0.36615	T	0.2	-16.689	14.0463	0.64706	0.0:0.0:0.0:1.0	.	321;350;345	F8WAG8;F5H2S7;Q13561	.;.;DCTN2_HUMAN	P	345;350;350;322;321;258;212	.	ENSP00000346785:Q321P	Q	-	2	0	DCTN2	56212150	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.474000	0.66781	2.210000	0.71456	0.533000	0.62120	CAG	.	.	.	none		0.473	DCTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407393.2	NM_006400	
UBC	7316	hgsc.bcm.edu	37	12	125398244	125398244	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr12:125398244T>C	ENST00000538617.1	-	3	390	c.74A>G	c.(73-75)aAt>aGt	p.N25S	UBC_ENST00000536769.1_Missense_Mutation_p.N25S|UBC_ENST00000339647.5_Missense_Mutation_p.N25S|MIR5188_ENST00000583467.1_RNA|UBC_ENST00000536661.1_5'UTR|UBC_ENST00000546120.1_Missense_Mutation_p.N25S			P0CG48	UBC_HUMAN	ubiquitin C	405	Ubiquitin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		TGCCTTGACATTCTCGATGGT	0.507																																					p.N25S		Atlas-SNP	.											.	UBC	79	.	0			c.A74G						PASS	.						208.0	195.0	200.0					12																	125398244		2203	4300	6503	SO:0001583	missense	7316	exon2			TTGACATTCTCGA		CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000538617.1:c.74A>G	chr12.hg19:g.125398244T>C	ENSP00000443053:p.Asn25Ser	136.0	0.0	.		105.0	39.0	.	NM_021009	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Missense_Mutation	SNP	ENST00000538617.1	hg19		.	.	.	.	.	.	.	.	.	.	-	15.27	2.784882	0.49997	.	.	ENSG00000150991	ENST00000536769;ENST00000535460;ENST00000538617;ENST00000541046;ENST00000339647;ENST00000546120;ENST00000544656;ENST00000541272;ENST00000540351;ENST00000541645;ENST00000535131;ENST00000546271;ENST00000540700;ENST00000535859;ENST00000542416	T;T;T;T;T;T;T;T;T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74	4.34	4.34	0.51931	Ubiquitin supergroup (1);Ubiquitin (2);	0.256216	0.22998	U	0.053119	T	0.71626	0.3362	N	0.12920	0.275	0.45427	D	0.998403	B;B;B	0.30870	0.164;0.103;0.298	B;P;P	0.49561	0.438;0.48;0.615	T	0.74970	-0.3482	10	0.87932	D	0	.	11.7986	0.52114	0.0:0.0:0.0:1.0	.	114;25;25	Q66K58;F5H7K6;P0CG48	.;.;UBC_HUMAN	S	25	ENSP00000441543:N25S;ENSP00000443053:N25S;ENSP00000344818:N25S;ENSP00000438394:N25S;ENSP00000440205:N25S;ENSP00000442800:N25S;ENSP00000445337:N25S;ENSP00000439492:N25S;ENSP00000438289:N25S;ENSP00000441238:N25S;ENSP00000437452:N25S;ENSP00000441556:N25S	ENSP00000344818:N25S	N	-	2	0	UBC	123964197	1.000000	0.71417	0.997000	0.53966	0.954000	0.61252	7.223000	0.78033	1.730000	0.51580	0.528000	0.53228	AAT	.	.	.	none		0.507	UBC-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000400179.1	NM_021009	
POLE	5426	hgsc.bcm.edu	37	12	133252404	133252404	+	Silent	SNP	A	A	G			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr12:133252404A>G	ENST00000320574.5	-	11	1066	c.1023T>C	c.(1021-1023)gcT>gcC	p.A341A	POLE_ENST00000535270.1_Silent_p.A314A	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	341					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GGATCAGATGAGCCTGAACCC	0.488								DNA polymerases (catalytic subunits)																													p.A341A		Atlas-SNP	.											.	POLE	416	.	0			c.T1023C						PASS	.						90.0	88.0	88.0					12																	133252404		2203	4300	6503	SO:0001819	synonymous_variant	5426	exon11			CAGATGAGCCTGA		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.1023T>C	chr12.hg19:g.133252404A>G		87.0	0.0	.		80.0	23.0	.	NM_006231	Q13533|Q86VH9	Silent	SNP	ENST00000320574.5	hg19	CCDS9278.1																																																																																			.	.	.	none		0.488	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	
INTS6	26512	hgsc.bcm.edu	37	13	51952382	51952382	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr13:51952382A>G	ENST00000311234.4	-	12	2067	c.1595T>C	c.(1594-1596)cTg>cCg	p.L532P	INTS6_ENST00000490542.1_Missense_Mutation_p.L216P|INTS6_ENST00000497989.1_Missense_Mutation_p.L354P|INTS6_ENST00000398119.2_Missense_Mutation_p.L519P|INTS6_ENST00000463928.1_Intron|INTS6_ENST00000425000.1_Missense_Mutation_p.L100P	NM_012141.2	NP_036273.1	Q9UL03	INT6_HUMAN	integrator complex subunit 6	532					signal transduction (GO:0007165)|snRNA processing (GO:0016180)	actin cytoskeleton (GO:0015629)|integrator complex (GO:0032039)|nucleus (GO:0005634)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		TACCTTATTCAGCAAAGCAAC	0.363																																					p.L532P		Atlas-SNP	.											.	INTS6	72	.	0			c.T1595C						PASS	.						142.0	137.0	139.0					13																	51952382		2203	4300	6503	SO:0001583	missense	26512	exon12			TTATTCAGCAAAG	AF097645	CCDS9428.1, CCDS41890.1, CCDS45048.1	13q14.3	2010-08-20	2006-03-15	2006-03-15	ENSG00000102786	ENSG00000102786		"""DEAD-boxes"""	14879	protein-coding gene	gene with protein product		604331	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26"""	DDX26		10467397, 16239144	Standard	XM_005266340		Approved	DICE1, HDB, Notchl2, DBI-1, DDX26A, INT6	uc001vfk.3	Q9UL03	OTTHUMG00000016945	ENST00000311234.4:c.1595T>C	chr13.hg19:g.51952382A>G	ENSP00000310260:p.Leu532Pro	86.0	0.0	.		110.0	38.0	.	NM_012141	Q0P664|Q6PJP4|Q9UFK0|Q9Y5M9	Missense_Mutation	SNP	ENST00000311234.4	hg19	CCDS9428.1	.	.	.	.	.	.	.	.	.	.	A	11.33	1.605479	0.28623	.	.	ENSG00000102786	ENST00000311234;ENST00000398119;ENST00000497989;ENST00000425000;ENST00000490542	T;T;T;T;T	0.38077	1.16;1.16;1.16;1.16;1.16	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.29288	0.0729	L	0.31294	0.92	0.80722	D	1	B	0.24823	0.112	B	0.27715	0.082	T	0.06215	-1.0839	10	0.33141	T	0.24	-3.8626	14.2307	0.65890	1.0:0.0:0.0:0.0	.	532	Q9UL03	INT6_HUMAN	P	532;519;354;100;216	ENSP00000310260:L532P;ENSP00000381187:L519P;ENSP00000419871:L354P;ENSP00000406915:L100P;ENSP00000419984:L216P	ENSP00000310260:L532P	L	-	2	0	INTS6	50850383	1.000000	0.71417	1.000000	0.80357	0.234000	0.25298	9.264000	0.95635	1.956000	0.56807	0.460000	0.39030	CTG	.	.	.	none		0.363	INTS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045023.1	NM_012141	
SCFD1	23256	hgsc.bcm.edu	37	14	31164021	31164021	+	Missense_Mutation	SNP	A	A	T			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr14:31164021A>T	ENST00000458591.2	+	15	1512	c.1285A>T	c.(1285-1287)Atg>Ttg	p.M429L	SCFD1_ENST00000421551.3_Missense_Mutation_p.M370L|SCFD1_ENST00000554486.1_3'UTR|SCFD1_ENST00000541123.1_Missense_Mutation_p.M244L|SCFD1_ENST00000544052.2_Missense_Mutation_p.M362L|SCFD1_ENST00000396629.2_Missense_Mutation_p.M337L	NM_016106.3	NP_057190.2	Q8WVM8	SCFD1_HUMAN	sec1 family domain containing 1	429					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|response to hypoxia (GO:0001666)|response to toxic substance (GO:0009636)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle docking involved in exocytosis (GO:0006904)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi transport complex (GO:0017119)|Golgi-associated vesicle (GO:0005798)|plasma membrane (GO:0005886)	syntaxin binding (GO:0019905)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)	13	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		AGAAAAAATAATGAGCAAAAC	0.269																																					p.M429L		Atlas-SNP	.											.	SCFD1	43	.	0			c.A1285T						PASS	.						56.0	65.0	62.0					14																	31164021		2199	4289	6488	SO:0001583	missense	23256	exon15			AAAATAATGAGCA	AF110646	CCDS9639.1, CCDS45092.1, CCDS58308.1	14q12	2006-04-04	2004-01-15	2004-01-16	ENSG00000092108	ENSG00000092108			20726	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 163"""	C14orf163			Standard	NM_016106		Approved	RA410, KIAA0917, STXBP1L2, SLY1	uc001wqm.2	Q8WVM8	OTTHUMG00000029420	ENST00000458591.2:c.1285A>T	chr14.hg19:g.31164021A>T	ENSP00000390783:p.Met429Leu	339.0	0.0	.		347.0	129.0	.	NM_016106	A8K2Z5|B7Z4U7|B7Z594|O60754|O94990|Q7Z529|Q9BZI3|Q9UNL3|Q9Y6A8	Missense_Mutation	SNP	ENST00000458591.2	hg19	CCDS9639.1	.	.	.	.	.	.	.	.	.	.	A	13.86	2.363162	0.41902	.	.	ENSG00000092108	ENST00000458591;ENST00000544052;ENST00000421551;ENST00000541123;ENST00000396629	T;T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87;-0.87	5.95	4.79	0.61399	.	0.036511	0.85682	D	0.000000	T	0.64193	0.2576	L	0.35793	1.09	0.54753	D	0.999982	B;B;B;B	0.09022	0.0;0.002;0.002;0.002	B;B;B;B	0.13407	0.004;0.007;0.009;0.007	T	0.56595	-0.7953	10	0.22706	T	0.39	-10.3234	12.9787	0.58552	0.8647:0.1353:0.0:0.0	.	370;362;337;429	B7Z738;B7Z4U7;B7Z594;Q8WVM8	.;.;.;SCFD1_HUMAN	L	429;362;370;244;337	ENSP00000390783:M429L;ENSP00000443010:M362L;ENSP00000388078:M370L;ENSP00000443537:M244L;ENSP00000379870:M337L	ENSP00000309417:M437L	M	+	1	0	SCFD1	30233772	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.314000	0.78988	1.047000	0.40274	0.533000	0.62120	ATG	.	.	.	none		0.269	SCFD1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276612.3	NM_182835	
AKAP13	11214	hgsc.bcm.edu	37	15	86122543	86122543	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr15:86122543T>C	ENST00000394518.2	+	7	1339	c.1244T>C	c.(1243-1245)cTt>cCt	p.L415P	AKAP13_ENST00000361243.2_Missense_Mutation_p.L415P|RP11-815J21.2_ENST00000561409.1_RNA	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	415					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						ACGGAAGGCCTTTCGTCCTGT	0.507																																					p.L415P	Melanoma(94;603 1453 3280 32295 32951)	Atlas-SNP	.											.	AKAP13	394	.	0			c.T1244C						PASS	.						72.0	79.0	77.0					15																	86122543		2202	4299	6501	SO:0001583	missense	11214	exon7			AAGGCCTTTCGTC	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.1244T>C	chr15.hg19:g.86122543T>C	ENSP00000378026:p.Leu415Pro	152.0	0.0	.		140.0	42.0	.	NM_007200	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	hg19	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	T	11.76	1.734133	0.30684	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.15256	2.47;2.44	5.45	1.74	0.24563	.	.	.	.	.	T	0.13200	0.0320	N	0.24115	0.695	0.09310	N	0.999999	P;P	0.39883	0.567;0.693	B;B	0.43018	0.229;0.405	T	0.18053	-1.0349	9	0.66056	D	0.02	.	6.0258	0.19654	0.0:0.0831:0.3161:0.6008	.	415;415	Q12802;Q12802-2	AKP13_HUMAN;.	P	415;415;414;414	ENSP00000354718:L415P;ENSP00000378026:L415P	ENSP00000354718:L415P	L	+	2	0	AKAP13	83923547	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.266000	0.18534	0.093000	0.17368	-0.291000	0.09656	CTT	.	.	.	none		0.507	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
CNGB1	1258	hgsc.bcm.edu	37	16	57984325	57984325	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr16:57984325C>T	ENST00000251102.8	-	13	1054	c.994G>A	c.(994-996)Gct>Act	p.A332T	CNGB1_ENST00000564448.1_Missense_Mutation_p.A326T	NM_001297.4	NP_001288.3	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1	332					cation transport (GO:0006812)|cytosolic calcium ion homeostasis (GO:0051480)|detection of light stimulus involved in visual perception (GO:0050908)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|protein heterotetramerization (GO:0051290)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina homeostasis (GO:0001895)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of smell (GO:0007608)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|intracellular cyclic nucleotide activated cation channel complex (GO:0017071)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|transmembrane transporter complex (GO:1902495)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(7)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(11)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	54						TCTTCATAAGCTGGAACCACC	0.517																																					p.A332T	Colon(156;1293 1853 16336 28962 38659)	Atlas-SNP	.											.	CNGB1	105	.	0			c.G994A						PASS	.						122.0	124.0	123.0					16																	57984325		2000	4159	6159	SO:0001583	missense	1258	exon13			CATAAGCTGGAAC	AF042498	CCDS42169.1, CCDS45495.1, CCDS67042.1	16q13	2013-02-14			ENSG00000070729	ENSG00000070729		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2151	protein-coding gene	gene with protein product	"""glutamic acid-rich protein"""	600724		CNCG2, CNCG3L		8766832, 7590744, 16382102	Standard	NM_001297		Approved	RCNC2, RCNCb, GARP, GAR1, CNGB1B, RP45	uc002emt.2	Q14028	OTTHUMG00000154810	ENST00000251102.8:c.994G>A	chr16.hg19:g.57984325C>T	ENSP00000251102:p.Ala332Thr	74.0	0.0	.		88.0	37.0	.	NM_001297	H3BN09|O43636|Q13059|Q14029|Q9UMG2	Missense_Mutation	SNP	ENST00000251102.8	hg19	CCDS42169.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.948067	0.34377	.	.	ENSG00000070729	ENST00000251102	T	0.22134	1.97	4.16	0.746	0.18365	.	.	.	.	.	T	0.14313	0.0346	L	0.38175	1.15	0.09310	N	1	B	0.14438	0.01	B	0.10450	0.005	T	0.26326	-1.0106	9	0.48119	T	0.1	.	3.9774	0.09479	0.0:0.5783:0.1979:0.2237	.	332	Q14028	CNGB1_HUMAN	T	332	ENSP00000251102:A332T	ENSP00000251102:A332T	A	-	1	0	CNGB1	56541826	0.000000	0.05858	0.001000	0.08648	0.117000	0.20001	0.544000	0.23253	0.472000	0.27344	0.563000	0.77884	GCT	.	.	.	none		0.517	CNGB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337167.2	NM_001297	
NF1	4763	hgsc.bcm.edu	37	17	29527522	29527522	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr17:29527522G>C	ENST00000358273.4	+	9	1354	c.971G>C	c.(970-972)tGt>tCt	p.C324S	NF1_ENST00000431387.4_Missense_Mutation_p.C324S|NF1_ENST00000356175.3_Missense_Mutation_p.C324S	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	324			C -> R (in NF1; dbSNP:rs199474735). {ECO:0000269|PubMed:15060124}.		actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(6)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GCAATTGCCTGTGTCAAACTG	0.408			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.C324S		Atlas-SNP	.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	1586	.	14	Whole gene deletion(8)|Unknown(6)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(3)|lung(1)	c.G971C						PASS	.						124.0	105.0	112.0					17																	29527522		2203	4300	6503	SO:0001583	missense	4763	exon9	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	TTGCCTGTGTCAA		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.971G>C	chr17.hg19:g.29527522G>C	ENSP00000351015:p.Cys324Ser	86.0	0.0	.		98.0	35.0	.	NM_001128147	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	hg19	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	G	17.15	3.316574	0.60524	.	.	ENSG00000196712	ENST00000431387;ENST00000358273;ENST00000356175	T;T;T	0.64618	2.82;-0.11;-0.11	5.39	5.39	0.77823	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.60741	0.2292	L	0.51422	1.61	0.80722	D	1	B;B;B;B;B	0.17268	0.021;0.0;0.0;0.004;0.002	B;B;B;B;B	0.17098	0.017;0.003;0.004;0.003;0.003	T	0.57625	-0.7779	10	0.52906	T	0.07	.	19.1503	0.93485	0.0:0.0:1.0:0.0	.	324;324;324;324;324	E1P657;P21359-2;P21359;Q14931;P21359-3	.;.;NF1_HUMAN;.;.	S	324	ENSP00000412921:C324S;ENSP00000351015:C324S;ENSP00000348498:C324S	ENSP00000348498:C324S	C	+	2	0	NF1	26551648	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.082000	0.94059	2.542000	0.85734	0.591000	0.81541	TGT	.	.	.	none		0.408	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
ABCC3	8714	hgsc.bcm.edu	37	17	48738388	48738388	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr17:48738388T>A	ENST00000285238.8	+	8	991	c.911T>A	c.(910-912)cTg>cAg	p.L304Q	ABCC3_ENST00000427699.1_Missense_Mutation_p.L304Q	NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	304					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	AAGGCCCTGCTGGCCACCTTC	0.617																																					p.L304Q		Atlas-SNP	.											.	ABCC3	138	.	0			c.T911A						PASS	.						52.0	45.0	47.0					17																	48738388		2203	4300	6503	SO:0001583	missense	8714	exon8			CCCTGCTGGCCAC	Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.911T>A	chr17.hg19:g.48738388T>A	ENSP00000285238:p.Leu304Gln	43.0	0.0	.		65.0	27.0	.	NM_003786	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	ENST00000285238.8	hg19	CCDS32681.1	.	.	.	.	.	.	.	.	.	.	T	10.73	1.431575	0.25813	.	.	ENSG00000108846	ENST00000427699;ENST00000285238	D;D	0.95756	-2.58;-3.8	5.18	2.91	0.33838	ABC transporter, transmembrane domain, type 1 (1);	1.527580	0.04347	N	0.355032	D	0.95040	0.8394	M	0.74467	2.265	0.09310	N	1	P;P	0.43885	0.694;0.82	B;B	0.43575	0.388;0.424	D	0.83488	0.0068	10	0.36615	T	0.2	-0.3139	6.5554	0.22458	0.1376:0.076:0.0:0.7865	.	304;304	O15438;O15438-5	MRP3_HUMAN;.	Q	304	ENSP00000395160:L304Q;ENSP00000285238:L304Q	ENSP00000285238:L304Q	L	+	2	0	ABCC3	46093387	0.001000	0.12720	0.002000	0.10522	0.170000	0.22686	1.077000	0.30741	0.273000	0.22049	-0.669000	0.03829	CTG	.	.	.	none		0.617	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2	NM_020038	
SMURF2	64750	hgsc.bcm.edu	37	17	62542409	62542409	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr17:62542409T>C	ENST00000262435.9	-	18	2306	c.2119A>G	c.(2119-2121)Act>Gct	p.T707A		NM_022739.3	NP_073576.1	Q9HAU4	SMUF2_HUMAN	SMAD specific E3 ubiquitin protein ligase 2	707	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				BMP signaling pathway (GO:0030509)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|SMAD binding (GO:0046332)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(4)	22	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)			AGGTTGTTAGTGCAGGCATCA	0.443																																					p.T707A		Atlas-SNP	.											.	SMURF2	63	.	0			c.A2119G						PASS	.						138.0	117.0	124.0					17																	62542409		2203	4300	6503	SO:0001583	missense	64750	exon18			TGTTAGTGCAGGC	AF301463	CCDS32707.1	17q22-q23	2012-10-05			ENSG00000108854	ENSG00000108854			16809	protein-coding gene	gene with protein product		605532				11016919	Standard	XM_005257585		Approved		uc002jep.1	Q9HAU4	OTTHUMG00000179189	ENST00000262435.9:c.2119A>G	chr17.hg19:g.62542409T>C	ENSP00000262435:p.Thr707Ala	86.0	0.0	.		91.0	38.0	.	NM_022739	Q52LL1|Q9H260	Missense_Mutation	SNP	ENST00000262435.9	hg19	CCDS32707.1	.	.	.	.	.	.	.	.	.	.	T	2.270	-0.367160	0.05069	.	.	ENSG00000108854	ENST00000262435	T	0.57273	0.41	5.62	4.53	0.55603	HECT (4);	0.102243	0.64402	N	0.000003	T	0.45577	0.1349	L	0.52759	1.655	0.80722	D	1	B	0.02656	0.0	B	0.09377	0.004	T	0.30268	-0.9984	10	0.32370	T	0.25	.	11.3438	0.49548	0.0:0.0711:0.0:0.9289	.	707	Q9HAU4	SMUF2_HUMAN	A	707	ENSP00000262435:T707A	ENSP00000262435:T707A	T	-	1	0	SMURF2	59972871	1.000000	0.71417	0.998000	0.56505	0.217000	0.24651	4.099000	0.57755	0.955000	0.37878	0.402000	0.26972	ACT	.	.	.	none		0.443	SMURF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445227.1	NM_022739	
HGS	9146	hgsc.bcm.edu	37	17	79660684	79660684	+	Splice_Site	SNP	C	C	T			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr17:79660684C>T	ENST00000329138.4	+	10	877	c.742C>T	c.(742-744)Ctg>Ttg	p.L248L		NM_004712.4	NP_004703.1	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine kinase substrate	248	Interaction with SNX1. {ECO:0000250}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane invagination (GO:0010324)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of gene expression (GO:0010628)|protein localization to membrane (GO:0072657)|protein targeting to lysosome (GO:0006622)|regulation of protein catabolic process (GO:0042176)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|secretory granule (GO:0030141)	metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			TTGTCCTCAGCTGCCCCCCAA	0.701																																					p.L248L		Atlas-SNP	.											.	HGS	54	.	0			c.C742T						PASS	.						10.0	11.0	11.0					17																	79660684		2149	4193	6342	SO:0001630	splice_region_variant	9146	exon10			CCTCAGCTGCCCC	D84064	CCDS11784.1	17q25	2009-04-29				ENSG00000185359		"""Zinc fingers, FYVE domain containing"""	4897	protein-coding gene	gene with protein product		604375				9407053, 9630564	Standard	NM_004712		Approved	Hrs, ZFYVE8, Vps27	uc002kbg.3	O14964		ENST00000329138.4:c.742-1C>T	chr17.hg19:g.79660684C>T		117.0	0.0	.		115.0	5.0	.	NM_004712	Q9NR36	Silent	SNP	ENST00000329138.4	hg19	CCDS11784.1																																																																																			.	.	.	none		0.701	HGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440541.1	NM_004712	Silent
APCDD1	147495	hgsc.bcm.edu	37	18	10471923	10471923	+	Silent	SNP	G	G	C			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr18:10471923G>C	ENST00000355285.5	+	3	993	c.639G>C	c.(637-639)cgG>cgC	p.R213R	APCDD1_ENST00000578882.1_Intron	NM_153000.4	NP_694545.1			adenomatosis polyposis coli down-regulated 1											NS(1)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				READ - Rectum adenocarcinoma(15;0.08)		AGCTCATCCGGGTGGAGAAGC	0.577																																					p.R213R		Atlas-SNP	.											.	APCDD1	57	.	0			c.G639C						PASS	.						136.0	124.0	128.0					18																	10471923		2203	4300	6503	SO:0001819	synonymous_variant	147495	exon3			CATCCGGGTGGAG	AB056722	CCDS11849.1	18p11.21	2006-07-07			ENSG00000154856	ENSG00000154856			15718	protein-coding gene	gene with protein product		607479				12384519	Standard	NM_153000		Approved	B7323	uc002kom.4	Q8J025	OTTHUMG00000131635	ENST00000355285.5:c.639G>C	chr18.hg19:g.10471923G>C		91.0	0.0	.		110.0	39.0	.	NM_153000		Silent	SNP	ENST00000355285.5	hg19	CCDS11849.1																																																																																			.	.	.	none		0.577	APCDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254529.2	NM_153000	
KANK3	256949	hgsc.bcm.edu	37	19	8389663	8389663	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr19:8389663C>T	ENST00000593649.1	-	9	2199	c.2134G>A	c.(2134-2136)Gtg>Atg	p.V712M	KANK3_ENST00000330915.3_Missense_Mutation_p.V712M			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	712										breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						AGGGTTGCCACCATGTCCTGT	0.642																																					p.V712M		Atlas-SNP	.											.	KANK3	35	.	0			c.G2134A						PASS	.						51.0	41.0	45.0					19																	8389663		2203	4300	6503	SO:0001583	missense	256949	exon9			TTGCCACCATGTC	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.2134G>A	chr19.hg19:g.8389663C>T	ENSP00000470728:p.Val712Met	42.0	0.0	.		68.0	25.0	.	NM_198471	Q6NZI1|Q6ZQR3|Q8IUV2	Missense_Mutation	SNP	ENST00000593649.1	hg19		.	.	.	.	.	.	.	.	.	.	C	22.6	4.317784	0.81469	.	.	ENSG00000186994	ENST00000330915	T	0.71222	-0.55	4.67	4.67	0.58626	.	.	.	.	.	D	0.82618	0.5076	M	0.69463	2.115	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.84855	0.0816	9	0.87932	D	0	-25.0819	16.3	0.82806	0.0:1.0:0.0:0.0	.	712	Q6NY19-2	.	M	712	ENSP00000328923:V712M	ENSP00000328923:V712M	V	-	1	0	KANK3	8295663	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	7.513000	0.81739	2.416000	0.81992	0.561000	0.74099	GTG	.	.	.	none		0.642	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
TMED1	11018	hgsc.bcm.edu	37	19	10945667	10945667	+	Silent	SNP	T	T	C			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr19:10945667T>C	ENST00000214869.2	-	3	506	c.408A>G	c.(406-408)ggA>ggG	p.G136G	TMED1_ENST00000588289.1_5'UTR|C19orf38_ENST00000592854.1_5'Flank|TMED1_ENST00000591695.1_Intron	NM_006858.2	NP_006849.1	Q13445	TMED1_HUMAN	transmembrane emp24 protein transport domain containing 1	136					cell-cell signaling (GO:0007267)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|lung(2)|ovary(3)|prostate(1)|skin(1)	10						CCTCTGCCCATCCTTCGACCT	0.542																																					p.G136G		Atlas-SNP	.											.	TMED1	22	.	0			c.A408G						PASS	.						166.0	154.0	158.0					19																	10945667		2203	4300	6503	SO:0001819	synonymous_variant	11018	exon3			TGCCCATCCTTCG	U41804	CCDS12249.1	19p13.2	2008-02-05	2005-08-26			ENSG00000099203			17291	protein-coding gene	gene with protein product		605395	"""transmembrane emp24 domain containing 1"""			11466339, 8621446	Standard	NM_006858		Approved	ST2L, MGC1270, IL1RL1LG, Il1rl1l	uc002mpy.3	Q13445		ENST00000214869.2:c.408A>G	chr19.hg19:g.10945667T>C		69.0	0.0	.		88.0	37.0	.	NM_006858		Silent	SNP	ENST00000214869.2	hg19	CCDS12249.1																																																																																			.	.	.	none		0.542	TMED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452614.1	NM_006858	
USP29	57663	hgsc.bcm.edu	37	19	57642200	57642200	+	Silent	SNP	A	A	G	rs562830906		TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr19:57642200A>G	ENST00000254181.4	+	4	2611	c.2157A>G	c.(2155-2157)aaA>aaG	p.K719K	USP29_ENST00000598197.1_Silent_p.K719K	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	719	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ATGACTGTAAAGAAAACAGGA	0.423																																					p.K719K		Atlas-SNP	.											USP29,caecum,carcinoma,0,2	USP29	186	.	0			c.A2157G						PASS	.						73.0	71.0	72.0					19																	57642200		2203	4300	6503	SO:0001819	synonymous_variant	57663	exon4			CTGTAAAGAAAAC		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.2157A>G	chr19.hg19:g.57642200A>G		231.0	0.0	.		236.0	95.0	.	NM_020903		Silent	SNP	ENST00000254181.4	hg19	CCDS33124.1																																																																																			.	.	.	none		0.423	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1		
ZNF544	27300	hgsc.bcm.edu	37	19	58772847	58772847	+	Missense_Mutation	SNP	A	A	C			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr19:58772847A>C	ENST00000596652.1	+	6	1109	c.875A>C	c.(874-876)cAt>cCt	p.H292P	ZNF544_ENST00000599953.1_Missense_Mutation_p.H150P|ZNF544_ENST00000600044.1_Missense_Mutation_p.H264P|ZNF544_ENST00000599227.1_3'UTR|ZNF544_ENST00000596825.1_3'UTR|CTD-3138B18.4_ENST00000600029.1_Intron|ZNF544_ENST00000595981.1_Intron|ZNF544_ENST00000269829.4_Missense_Mutation_p.H292P|ZNF544_ENST00000415203.2_Missense_Mutation_p.H264P|ZNF544_ENST00000596929.1_Intron|CTD-3138B18.5_ENST00000597230.1_RNA|ZNF544_ENST00000600220.1_Missense_Mutation_p.H264P			Q6NX49	ZN544_HUMAN	zinc finger protein 544	292					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		AAGCCAGTGCATTTTGGGAAA	0.443																																					p.H292P		Atlas-SNP	.											.	ZNF544	57	.	0			c.A875C						PASS	.						71.0	70.0	71.0					19																	58772847		2203	4300	6503	SO:0001583	missense	27300	exon7			CAGTGCATTTTGG	AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.875A>C	chr19.hg19:g.58772847A>C	ENSP00000469635:p.His292Pro	137.0	0.0	.		122.0	51.0	.	NM_014480	A8K6J1|Q9UEX4	Missense_Mutation	SNP	ENST00000596652.1	hg19	CCDS12973.1	.	.	.	.	.	.	.	.	.	.	A	11.31	1.599650	0.28534	.	.	ENSG00000198131	ENST00000269829;ENST00000415203	T;T	0.29142	1.58;1.58	3.37	-3.78	0.04333	.	.	.	.	.	T	0.49626	0.1568	M	0.84585	2.705	0.09310	N	1	B;D;D	0.89917	0.001;1.0;0.963	B;D;P	0.68192	0.001;0.956;0.468	T	0.43180	-0.9407	9	0.62326	D	0.03	.	5.5574	0.17123	0.3664:0.4309:0.2027:0.0	.	264;264;292	B7ZAY1;B4DL50;Q6NX49	.;.;ZN544_HUMAN	P	292;264	ENSP00000269829:H292P;ENSP00000394341:H264P	ENSP00000269829:H292P	H	+	2	0	ZNF544	63464659	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.063000	0.11655	-0.641000	0.05487	0.533000	0.62120	CAT	.	.	.	none		0.443	ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466754.1	NM_014480	
PCSK2	5126	hgsc.bcm.edu	37	20	17462589	17462589	+	Silent	SNP	C	C	T			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr20:17462589C>T	ENST00000262545.2	+	12	2106	c.1791C>T	c.(1789-1791)gcC>gcT	p.A597A	PCSK2_ENST00000459871.1_3'UTR|PCSK2_ENST00000536609.1_Silent_p.A562A|PCSK2_ENST00000377899.1_Silent_p.A578A	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	597					cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CTCAGAGTGCCCCGTACATCG	0.622																																					p.A597A		Atlas-SNP	.											.	PCSK2	112	.	0			c.C1791T						PASS	.						32.0	29.0	30.0					20																	17462589		2203	4300	6503	SO:0001819	synonymous_variant	5126	exon12			GAGTGCCCCGTAC	AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.1791C>T	chr20.hg19:g.17462589C>T		122.0	0.0	.		105.0	46.0	.	NM_002594	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Silent	SNP	ENST00000262545.2	hg19	CCDS13125.1																																																																																			.	.	.	none		0.622	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078120.2	NM_002594	
MAGEA4	4103	hgsc.bcm.edu	37	X	151092151	151092151	+	Silent	SNP	G	G	A			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chrX:151092151G>A	ENST00000360243.2	+	3	282	c.15G>A	c.(13-15)caG>caA	p.Q5Q	MAGEA4_ENST00000370337.4_Silent_p.Q5Q|MAGEA4_ENST00000370340.3_Silent_p.Q5Q|MAGEA4_ENST00000276344.2_Silent_p.Q5Q|MAGEA4_ENST00000393921.1_Silent_p.Q5Q|MAGEA4_ENST00000393920.1_Silent_p.Q5Q|MAGEA4_ENST00000370335.1_Silent_p.Q5Q	NM_001011550.1	NP_001011550.1	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	5										breast(2)|central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)	27	Acute lymphoblastic leukemia(192;6.56e-05)					CTTCTGAGCAGAAGAGTCAGC	0.602																																					p.Q5Q		Atlas-SNP	.											.	MAGEA4	68	.	0			c.G15A						PASS	.						44.0	43.0	43.0					X																	151092151		2203	4300	6503	SO:0001819	synonymous_variant	4103	exon3			TGAGCAGAAGAGT		CCDS14702.1	Xq28	2009-03-13			ENSG00000147381	ENSG00000147381			6802	protein-coding gene	gene with protein product	"""melanoma-associated antigen 4"", ""cancer/testis antigen family 1, member 4"""	300175		MAGE4		8575766	Standard	XM_005274677		Approved	MAGE4A, MAGE4B, MAGE-41, MAGE-X2, MGC21336, CT1.4	uc004ffa.3	P43358	OTTHUMG00000024174	ENST00000360243.2:c.15G>A	chrX.hg19:g.151092151G>A		114.0	0.0	.		95.0	54.0	.	NM_001011548	Q14798	Silent	SNP	ENST00000360243.2	hg19	CCDS14702.1																																																																																			.	.	.	none		0.602	MAGEA4-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060898.1	NM_002362	
CLCN7	1186	hgsc.bcm.edu	37	16	1505758	1505760	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr16:1505758_1505760delAGA	ENST00000382745.4	-	11	1558_1560	c.953_955delTCT	c.(952-957)ttctgg>tgg	p.F318del	CLCN7_ENST00000262318.8_In_Frame_Del_p.F294del|CLCN7_ENST00000448525.1_In_Frame_Del_p.F294del	NM_001287.5	NP_001278.1	P51798	CLCN7_HUMAN	chloride channel, voltage-sensitive 7	318			F -> L (in OPTA2). {ECO:0000269|PubMed:19953639}.		chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|response to pH (GO:0009268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(3)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	24		Hepatocellular(780;0.0893)				AACTGGTTCCAGAAGGACGCACC	0.626																																					p.318_319del		Atlas-Indel,Pindel	.											.	CLCN7	53	.	0			c.954_956del						PASS	.																																			SO:0001651	inframe_deletion	1186	exon11			.	Z67743	CCDS32361.1, CCDS45378.1	16p13	2012-09-26	2012-02-23		ENSG00000103249	ENSG00000103249		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ion channels / Chloride channels : Voltage-sensitive"""	2025	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 63"""	602727	"""chloride channel 7"""			8543009	Standard	NM_001114331		Approved	CLC-7, OPTA2, CLC7, ClC-7, PPP1R63	uc002clv.3	P51798	OTTHUMG00000044467	ENST00000382745.4:c.953_955delTCT	chr16.hg19:g.1505758_1505760delAGA	ENSP00000372193:p.Phe318del	70.0	0.0	0		70.0	25.0	0.357143	NM_001287	A6NEJ7|A8K5T9|A8K7X1|B3KPN3|E9PDB9|Q9NYX5	In_Frame_Del	DEL	ENST00000382745.4	hg19	CCDS32361.1																																																																																			.	.	.	none		0.626	CLCN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103598.2	NM_001287	
NPR2	4882	hgsc.bcm.edu	37	9	35808792	35808794	+	In_Frame_Del	DEL	TTA	TTA	-			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	TTA	TTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr9:35808792_35808794delTTA	ENST00000342694.2	+	20	3183_3185	c.2928_2930delTTA	c.(2926-2931)cgttat>cgt	p.Y977del	SPAG8_ENST00000479751.1_5'Flank|SPAG8_ENST00000340291.2_Intron|AL133410.1_ENST00000582432.1_RNA	NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	977	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	AGATGCCCCGTTATTGTCTTTTT	0.498																																					p.976_977del		Atlas-Indel,Pindel	.											.	NPR2	162	.	0			c.2927_2929del						PASS	.																																			SO:0001651	inframe_deletion	4882	exon20			.	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.2928_2930delTTA	chr9.hg19:g.35808792_35808794delTTA	ENSP00000341083:p.Tyr977del	127.0	0.0	0		100.0	41.0	0.41	NM_003995	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	In_Frame_Del	DEL	ENST00000342694.2	hg19	CCDS6590.1																																																																																			.	.	.	none		0.498	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1		
GCSAM	257144	hgsc.bcm.edu	37	3	111849299	111849306	+	Frame_Shift_Del	DEL	TTCTCTGT	TTCTCTGT	-			TCGA-Y8-A8RZ-01A-11D-A36X-10	TCGA-Y8-A8RZ-10A-01D-A370-10	TTCTCTGT	TTCTCTGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63f0d3c3-071e-44c7-863d-72f0242c5b93	2a0d89df-334c-4d21-ad1d-0040556032a0	g.chr3:111849299_111849306delTTCTCTGT	ENST00000308910.4	-	2	268_275	c.84_91delACAGAGAA	c.(82-93)aaacagagaacafs	p.KQRT28fs	GCSAM_ENST00000484193.1_Frame_Shift_Del_p.KQRT30fs|RP11-757F18.5_ENST00000563632.1_RNA|C3orf52_ENST00000467942.2_3'UTR	NM_001190259.1|NM_001190260.1|NM_152785.4	NP_001177188.1|NP_001177189.1|NP_689998.1	Q8N6F7	GCSAM_HUMAN	germinal center-associated, signaling and motility	28					negative regulation of lymphocyte migration (GO:2000402)|regulation of B cell receptor signaling pathway (GO:0050855)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|myosin II binding (GO:0045159)|protein kinase binding (GO:0019901)										CACCTGGATGTTCTCTGTTTGGGGCTTT	0.49																																					p.31_33del		Pindel	.											.	.	.	.	0			c.91_98del						PASS	.																																			SO:0001589	frameshift_variant	257144	exon2			.	BC030506	CCDS2964.1, CCDS54621.1, CCDS54622.1	3q13.13	2012-09-03	2012-08-23	2012-08-23	ENSG00000174500	ENSG00000174500			20253	protein-coding gene	gene with protein product	"""human germinal center-associated lymphoma"""	607792	"""germinal center expressed transcript 2"""	GCET2			Standard	NM_152785		Approved	MGC40441, HGAL	uc021xcl.1	Q8N6F7	OTTHUMG00000159231	ENST00000308910.4:c.84_91delACAGAGAA	chr3.hg19:g.111849299_111849306delTTCTCTGT	ENSP00000309487:p.Lys28fs	61.0	0.0	.		47.0	10.0	0.213	NM_001190259	C9JD17|C9JUG6	Frame_Shift_Del	DEL	ENST00000308910.4	hg19	CCDS2964.1																																																																																			.	.	.	none		0.490	GCSAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353967.2	NM_152785	
