#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TAS1R3	83756	hgsc.bcm.edu	37	1	1267161	1267161	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr1:1267161C>G	ENST00000339381.5	+	2	367	c.335C>G	c.(334-336)cCc>cGc	p.P112R		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	112					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		GCCATGAAGCCCAGCCTCATG	0.642																																					p.P112R		Atlas-SNP	.											.	TAS1R3	39	.	0			c.C335G						PASS	.						53.0	55.0	55.0					1																	1267161		2201	4297	6498	SO:0001583	missense	83756	exon2			TGAAGCCCAGCCT	AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.335C>G	chr1.hg19:g.1267161C>G	ENSP00000344411:p.Pro112Arg	82.0	0.0	.		65.0	9.0	.	NM_152228	Q5TA49|Q8NGW9	Missense_Mutation	SNP	ENST00000339381.5	hg19	CCDS30556.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.850317	0.51270	.	.	ENSG00000169962	ENST00000339381	D	0.85556	-2.0	5.0	5.0	0.66597	Extracellular ligand-binding receptor (1);	1.677870	0.04056	N	0.305492	D	0.94324	0.8176	M	0.84511	2.7	0.41984	D	0.990811	D	0.89917	1.0	D	0.78314	0.991	D	0.85678	0.1299	10	0.66056	D	0.02	.	16.4628	0.84069	0.0:1.0:0.0:0.0	.	112	Q7RTX0	TS1R3_HUMAN	R	112	ENSP00000344411:P112R	ENSP00000344411:P112R	P	+	2	0	TAS1R3	1257024	1.000000	0.71417	1.000000	0.80357	0.189000	0.23516	3.974000	0.56852	2.333000	0.79357	0.462000	0.41574	CCC	.	.	.	none		0.642	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008493.1		
KAZN	23254	hgsc.bcm.edu	37	1	15382699	15382699	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr1:15382699T>C	ENST00000376030.2	+	5	1133	c.839T>C	c.(838-840)cTc>cCc	p.L280P	KAZN_ENST00000422387.2_Missense_Mutation_p.L280P|KAZN_ENST00000400797.3_Missense_Mutation_p.L186P|KAZN_ENST00000503743.1_Missense_Mutation_p.L280P|KAZN_ENST00000400798.2_Missense_Mutation_p.L186P|KAZN_ENST00000361144.5_Missense_Mutation_p.L274P	NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein	280	Interaction with PPL.				keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						CAGGCGGACCTCCCGCTGACC	0.657																																					p.L280P		Atlas-SNP	.											.	KAZN	57	.	0			c.T839C						PASS	.						59.0	54.0	56.0					1																	15382699		2203	4300	6503	SO:0001583	missense	23254	exon5			CGGACCTCCCGCT	AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.839T>C	chr1.hg19:g.15382699T>C	ENSP00000365198:p.Leu280Pro	157.0	0.0	.		170.0	24.0	.	NM_015209	B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	Missense_Mutation	SNP	ENST00000376030.2	hg19	CCDS152.2	.	.	.	.	.	.	.	.	.	.	T	23.9	4.474863	0.84640	.	.	ENSG00000189337	ENST00000376030;ENST00000503743;ENST00000422387;ENST00000361144;ENST00000400798;ENST00000400797	T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78	5.8	5.8	0.92144	.	0.121142	0.56097	D	0.000022	T	0.55609	0.1931	L	0.27053	0.805	0.80722	D	1	P;P;D;P	0.89917	0.874;0.874;1.0;0.771	B;P;D;B	0.91635	0.347;0.447;0.999;0.241	T	0.52764	-0.8532	10	0.30078	T	0.28	-17.1885	15.3662	0.74523	0.0:0.0:0.0:1.0	.	280;186;274;280	Q674X7-2;Q674X7-4;Q674X7-3;Q674X7	.;.;.;KAZRN_HUMAN	P	280;280;280;274;186;186	ENSP00000365198:L280P;ENSP00000426015:L280P;ENSP00000391728:L280P;ENSP00000354727:L274P;ENSP00000383602:L186P;ENSP00000383601:L186P	ENSP00000354727:L274P	L	+	2	0	KAZN	15255286	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.404000	0.79996	2.223000	0.72356	0.454000	0.30748	CTC	.	.	.	none		0.657	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005690.2	NM_001017999	
TMEM51	55092	hgsc.bcm.edu	37	1	15545932	15545932	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr1:15545932C>G	ENST00000428417.1	+	3	901	c.455C>G	c.(454-456)cCg>cGg	p.P152R	TMEM51_ENST00000376008.2_Missense_Mutation_p.P152R|TMEM51_ENST00000400796.3_Missense_Mutation_p.P152R|TMEM51_ENST00000434578.2_3'UTR|TMEM51_ENST00000376014.3_Missense_Mutation_p.P152R	NM_001136217.1	NP_001129689.1	Q9NW97	TMM51_HUMAN	transmembrane protein 51	152						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(3)|large_intestine(2)|lung(5)|prostate(2)	14		Renal(390;0.00145)|Breast(348;0.00186)|Colorectal(325;0.00215)|all_lung(284;0.00459)|Lung NSC(340;0.0104)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;2.07e-06)|COAD - Colon adenocarcinoma(227;7.14e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000175)|KIRC - Kidney renal clear cell carcinoma(229;0.00141)|STAD - Stomach adenocarcinoma(313;0.00644)|READ - Rectum adenocarcinoma(331;0.0751)		GAGCAGAACCCGAGGTTGAGC	0.582																																					p.P152R		Atlas-SNP	.											.	TMEM51	28	.	0			c.C455G						PASS	.						97.0	92.0	94.0					1																	15545932		2203	4300	6503	SO:0001583	missense	55092	exon3			AGAACCCGAGGTT	AK098467	CCDS154.1	1p36.21	2008-02-05	2005-05-22	2005-05-22	ENSG00000171729	ENSG00000171729			25488	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 72"""	C1orf72		12477932	Standard	NM_018022		Approved	FLJ10199	uc001avx.3	Q9NW97	OTTHUMG00000002046	ENST00000428417.1:c.455C>G	chr1.hg19:g.15545932C>G	ENSP00000394899:p.Pro152Arg	286.0	0.0	.		324.0	39.0	.	NM_018022	A8K819	Missense_Mutation	SNP	ENST00000428417.1	hg19	CCDS154.1	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.621990	0.00820	.	.	ENSG00000171729	ENST00000428417;ENST00000376014;ENST00000451326;ENST00000434578;ENST00000400796;ENST00000376008;ENST00000303840	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	5.63	4.72	0.59763	.	0.297924	0.37906	N	0.001882	T	0.19967	0.0480	L	0.31294	0.92	0.09310	N	0.999999	B	0.10296	0.003	B	0.12837	0.008	T	0.21075	-1.0256	10	0.14252	T	0.57	-8.8165	9.3994	0.38424	0.393:0.4774:0.1296:0.0	.	152	Q9NW97	TMM51_HUMAN	R	152	ENSP00000394899:P152R;ENSP00000365182:P152R;ENSP00000383600:P152R;ENSP00000365176:P152R	ENSP00000303666:P152R	P	+	2	0	TMEM51	15418519	0.005000	0.15991	0.860000	0.33809	0.193000	0.23685	0.081000	0.14823	1.378000	0.46305	0.555000	0.69702	CCG	.	.	.	none		0.582	TMEM51-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005699.3	NM_018022	
PADI4	23569	hgsc.bcm.edu	37	1	17666248	17666248	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr1:17666248A>G	ENST00000375448.4	+	6	618	c.592A>G	c.(592-594)Aca>Gca	p.T198A	AC004824.2_ENST00000602074.1_Intron	NM_012387.2	NP_036519.2	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV	198					cellular protein modification process (GO:0006464)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|histone citrullination (GO:0036414)|histone H3-R26 citrullination (GO:0036413)|innate immune response (GO:0045087)|nucleosome assembly (GO:0006334)|protein citrullination (GO:0018101)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginine deiminase activity (GO:0016990)|calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(2)|urinary_tract(3)	26		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	CACAAACCATACACTGGTGCT	0.567																																					p.T198A		Atlas-SNP	.											.	PADI4	70	.	0			c.A592G						PASS	.						147.0	115.0	125.0					1																	17666248		2203	4300	6503	SO:0001583	missense	23569	exon6			AACCATACACTGG	AB017919	CCDS180.1	1p36.13	2014-06-06	2003-02-12		ENSG00000159339	ENSG00000159339	3.5.3.15	"""Peptidyl arginine deiminases"""	18368	protein-coding gene	gene with protein product		605347	"""peptidyl arginine deiminase, type V"""	PADI5		10488123	Standard	NM_012387		Approved	PAD, PDI5, PDI4	uc001baj.2	Q9UM07	OTTHUMG00000002371	ENST00000375448.4:c.592A>G	chr1.hg19:g.17666248A>G	ENSP00000364597:p.Thr198Ala	94.0	0.0	.		89.0	4.0	.	NM_012387	A8K392|B2RBW0|Q5VTZ8|Q70SX4	Missense_Mutation	SNP	ENST00000375448.4	hg19	CCDS180.1	.	.	.	.	.	.	.	.	.	.	a	4.235	0.042484	0.08196	.	.	ENSG00000159339	ENST00000375448	T	0.16597	2.33	4.87	0.129	0.14739	Protein-arginine deiminase (PAD), central domain (2);	0.414765	0.24806	N	0.035446	T	0.07007	0.0178	N	0.08118	0	0.09310	N	1	B;B	0.15141	0.012;0.005	B;B	0.19666	0.026;0.018	T	0.38908	-0.9639	10	0.20046	T	0.44	-3.9969	7.645	0.28315	0.4737:0.3836:0.1427:0.0	.	198;198	A8K392;Q9UM07	.;PADI4_HUMAN	A	198	ENSP00000364597:T198A	ENSP00000364597:T198A	T	+	1	0	PADI4	17538835	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.349000	0.07731	0.446000	0.26666	-0.619000	0.04042	ACA	.	.	.	none		0.567	PADI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006799.1	NM_012387	
KDF1	126695	hgsc.bcm.edu	37	1	27278714	27278714	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr1:27278714T>C	ENST00000320567.5	-	2	246	c.158A>G	c.(157-159)cAt>cGt	p.H53R		NM_152365.2	NP_689578.2	Q8NAX2	KDF1_HUMAN		53	Pro-rich.				developmental growth (GO:0048589)|establishment of skin barrier (GO:0061436)|keratinocyte development (GO:0003334)|limb epidermis development (GO:0060887)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|positive regulation of epidermal cell differentiation (GO:0045606)|regulation of epidermal cell division (GO:0010482)	cell cortex (GO:0005938)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)				NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.37e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.22e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		CTCTGGCCCATGGTGGCCAGG	0.632																																					p.H53R		Atlas-SNP	.											.	C1orf172	38	.	0			c.A158G						PASS	.						25.0	30.0	28.0					1																	27278714		2203	4300	6503	SO:0001583	missense	126695	exon2			GGCCCATGGTGGC																												ENST00000320567.5:c.158A>G	chr1.hg19:g.27278714T>C	ENSP00000319179:p.His53Arg	87.0	0.0	.		120.0	15.0	.	NM_152365	Q5QP32|Q8N0S7	Missense_Mutation	SNP	ENST00000320567.5	hg19	CCDS293.1	.	.	.	.	.	.	.	.	.	.	T	3.593	-0.083194	0.07141	.	.	ENSG00000175707	ENST00000320567;ENST00000374109	T	0.19938	2.11	4.78	3.63	0.41609	.	0.140335	0.46442	D	0.000294	T	0.05731	0.0150	N	0.02916	-0.46	0.26831	N	0.968583	B	0.02656	0.0	B	0.01281	0.0	T	0.41520	-0.9504	10	0.02654	T	1	.	3.7038	0.08392	0.0:0.2232:0.0:0.7768	.	53	Q8NAX2	CA172_HUMAN	R	53	ENSP00000319179:H53R	ENSP00000319179:H53R	H	-	2	0	C1orf172	27151301	0.445000	0.25657	1.000000	0.80357	0.998000	0.95712	4.006000	0.57083	2.005000	0.58758	0.528000	0.53228	CAT	.	.	.	none		0.632	C1orf172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012340.1		
NCDN	23154	hgsc.bcm.edu	37	1	36026513	36026513	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr1:36026513C>G	ENST00000373243.2	+	3	1144	c.761C>G	c.(760-762)cCc>cGc	p.P254R	NCDN_ENST00000356090.4_Missense_Mutation_p.P254R|NCDN_ENST00000373253.3_Missense_Mutation_p.P237R	NM_014284.2	NP_055099.1	Q9UBB6	NCDN_HUMAN	neurochondrin	254					bone resorption (GO:0045453)|neuron projection development (GO:0031175)|regulation of neuronal synaptic plasticity (GO:0048168)	cytosol (GO:0005829)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|pancreas(1)|skin(2)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				ACAACCGTGCCCCCTGAATGC	0.632																																					p.P254R		Atlas-SNP	.											.	NCDN	79	.	0			c.C761G						PASS	.						62.0	58.0	60.0					1																	36026513		2201	4299	6500	SO:0001583	missense	23154	exon3			CCGTGCCCCCTGA	AB011179	CCDS392.1, CCDS30672.1	1p34.3	2008-02-05			ENSG00000020129	ENSG00000020129			17597	protein-coding gene	gene with protein product		608458				15007648	Standard	NM_014284		Approved	NCDN-1, NCDN-2	uc001bza.3	Q9UBB6	OTTHUMG00000059204	ENST00000373243.2:c.761C>G	chr1.hg19:g.36026513C>G	ENSP00000362340:p.Pro254Arg	75.0	0.0	.		71.0	13.0	.	NM_014284	D3DPR9|Q9UBY2|Q9Y4A6|Q9Y4D9	Missense_Mutation	SNP	ENST00000373243.2	hg19	CCDS392.1	.	.	.	.	.	.	.	.	.	.	C	7.506	0.653673	0.14580	.	.	ENSG00000020129	ENST00000373253;ENST00000356090;ENST00000373243;ENST00000437806	T;T;T	0.68331	-0.32;-0.32;-0.32	4.76	4.76	0.60689	.	0.256266	0.37012	N	0.002286	T	0.56529	0.1991	N	0.22421	0.69	0.40225	D	0.977787	P	0.44139	0.827	P	0.45037	0.467	T	0.57676	-0.7770	10	0.33940	T	0.23	.	13.3806	0.60764	0.0:0.8286:0.1714:0.0	.	254	Q9UBB6	NCDN_HUMAN	R	237;254;254;237	ENSP00000362350:P237R;ENSP00000348394:P254R;ENSP00000362340:P254R	ENSP00000348394:P254R	P	+	2	0	NCDN	35799100	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	2.780000	0.47742	2.472000	0.83506	0.561000	0.74099	CCC	.	.	.	none		0.632	NCDN-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131298.1	NM_014284	
KDM4A	9682	hgsc.bcm.edu	37	1	44128602	44128602	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr1:44128602T>A	ENST00000372396.3	+	5	601	c.467T>A	c.(466-468)aTc>aAc	p.I156N	KDM4A_ENST00000463151.1_3'UTR	NM_014663.2	NP_055478.2	O75164	KDM4A_HUMAN	lysine (K)-specific demethylase 4A	156	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				cardiac muscle hypertrophy in response to stress (GO:0014898)|histone demethylation (GO:0016577)|histone H3-K36 demethylation (GO:0070544)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|methylated histone binding (GO:0035064)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(13)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	37						CTGAGAACAATCCTGGACTTG	0.488																																					p.I156N		Atlas-SNP	.											.	KDM4A	74	.	0			c.T467A						PASS	.						191.0	164.0	173.0					1																	44128602		2203	4300	6503	SO:0001583	missense	9682	exon5			GAACAATCCTGGA	AB014577	CCDS491.1	1p34.1	2013-01-23	2009-04-06	2009-04-06	ENSG00000066135	ENSG00000066135		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	22978	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 3A"", ""tudor domain containing 14A"""	609764	"""jumonji domain containing 2"", ""jumonji domain containing 2A"""	JMJD2, JMJD2A		9734811, 15138608	Standard	XM_005271354		Approved	KIAA0677, JHDM3A, TDRD14A	uc001cjx.3	O75164	OTTHUMG00000007560	ENST00000372396.3:c.467T>A	chr1.hg19:g.44128602T>A	ENSP00000361473:p.Ile156Asn	212.0	0.0	.		198.0	21.0	.	NM_014663	Q5VVB1	Missense_Mutation	SNP	ENST00000372396.3	hg19	CCDS491.1	.	.	.	.	.	.	.	.	.	.	T	29.7	5.027980	0.93518	.	.	ENSG00000066135	ENST00000372396	T	0.72051	-0.62	5.88	5.88	0.94601	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.000000	0.85682	D	0.000000	D	0.84982	0.5593	M	0.79693	2.465	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.965;0.997	D	0.86851	0.2023	10	0.72032	D	0.01	-1.527	16.2948	0.82765	0.0:0.0:0.0:1.0	.	156;156	B4DT38;O75164	.;KDM4A_HUMAN	N	156	ENSP00000361473:I156N	ENSP00000361473:I156N	I	+	2	0	KDM4A	43901189	1.000000	0.71417	0.993000	0.49108	0.994000	0.84299	8.027000	0.88791	2.253000	0.74438	0.455000	0.32223	ATC	.	.	.	none		0.488	KDM4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019960.1	NM_014663	
LCE4A	199834	hgsc.bcm.edu	37	1	152681679	152681680	+	Missense_Mutation	DNP	CC	CC	GT	rs6143428|rs11269814|rs200890315	byFrequency	TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr1:152681679_152681680CC>GT	ENST00000368777.1	+	2	384_385	c.128_129CC>GT	c.(127-129)tCC>tGT	p.S43C	LCE4A_ENST00000335535.3_Missense_Mutation_p.S43C			Q5TA78	LCE4A_HUMAN	late cornified envelope 4A	43	Cys-rich.				keratinization (GO:0031424)					endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.116)			TGCTGTGGCTCCAGCTCTGGGG	0.599																																					p.S43C|p.S43S		Atlas-SNP	.											LCE4A,rectum,carcinoma,0,1|LCE4A,rectum,carcinoma,+1,15	LCE4A	37	.	0			c.C128G|c.C129T						PASS	.																																			SO:0001583	missense	199834	exon1			GTGGCTCCAGCTC|TGGCTCCAGCTCT	BI670517	CCDS1022.1	1q22	2008-02-05	2004-10-11	2004-10-15	ENSG00000187170	ENSG00000187170		"""Late cornified envelopes"""	16613	protein-coding gene	gene with protein product		612618	"""small proline rich-like (epidermal differentiation complex) 4A"""	SPRL4A		11698679	Standard	NM_178356		Approved	LEP8	uc001fak.2	Q5TA78	OTTHUMG00000014394	Exception_encountered	chr1.hg19:g.152681679_152681680delinsGT	ENSP00000357766:p.Ser43Cys	219.0|215.0	0.0|1.0	.		195.0|192.0	13.0|9.0	.	NM_178356	Q14D97	Missense_Mutation|Silent	SNP	ENST00000368777.1	hg19	CCDS1022.1																																																																																			.	.	.	none|weak		0.599	LCE4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040048.1	NM_178356	
KIAA0040	9674	hgsc.bcm.edu	37	1	175129922	175129922	+	Missense_Mutation	SNP	A	A	C			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr1:175129922A>C	ENST00000423313.1	-	4	764	c.228T>G	c.(226-228)gaT>gaG	p.D76E	KIAA0040_ENST00000545251.2_Missense_Mutation_p.D76E|KIAA0040_ENST00000567124.1_5'Flank|KIAA0040_ENST00000444639.1_Missense_Mutation_p.D76E	NM_001162893.1|NM_001162895.1|NM_014656.2	NP_001156365.1|NP_001156367.1|NP_055471.2	Q15053	K0040_HUMAN	KIAA0040	0																	GGtcttcttcatccttcttct	0.498																																					p.D76E		Atlas-SNP	.											.	KIAA0040	2	.	0			c.T228G						PASS	.						123.0	102.0	108.0					1																	175129922		692	1591	2283	SO:0001583	missense	9674	exon3			TTCTTCATCCTTC	D25539		1q24-q25	2012-11-29			ENSG00000235750	ENSG00000235750			28950	protein-coding gene	gene with protein product							Standard	NM_014656		Approved		uc001gkn.3	Q15053	OTTHUMG00000034880	ENST00000423313.1:c.228T>G	chr1.hg19:g.175129922A>C	ENSP00000462172:p.Asp76Glu	75.0	0.0	.		62.0	4.0	.	NM_001162895	A8K9H6|Q2NKQ0	Missense_Mutation	SNP	ENST00000423313.1	hg19																																																																																				.	.	.	none		0.498	KIAA0040-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000084420.3	NM_014656	
KLF11	8462	hgsc.bcm.edu	37	2	10192452	10192453	+	Missense_Mutation	DNP	AA	AA	TT			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr2:10192452_10192453AA>TT	ENST00000305883.1	+	4	1519_1520	c.1357_1358AA>TT	c.(1357-1359)AAg>TTg	p.K453L	RP11-254F7.3_ENST00000607181.1_RNA|KLF11_ENST00000535335.1_Missense_Mutation_p.K436L|KLF11_ENST00000540845.1_Missense_Mutation_p.K436L	NM_003597.4	NP_003588.1	O14901	KLF11_HUMAN	Kruppel-like factor 11	453					apoptotic process (GO:0006915)|cellular response to peptide (GO:1901653)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		AGGGGAGAAGAAGTTTGTGTGC	0.569																																					p.K453X|p.K453M	Melanoma(56;431 1507 23687 50789)	Atlas-SNP	.											.	KLF11	45	.	0			c.A1357T|c.A1358T						PASS	.																																			SO:0001583	missense	8462	exon4			GAGAAGAAGTTTG|AGAAGAAGTTTGT	AF028008	CCDS1668.1, CCDS54333.1	2p25	2013-01-08	2004-11-29	2004-12-01	ENSG00000172059	ENSG00000172059		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11811	protein-coding gene	gene with protein product		603301	"""TGFB inducible early growth response 2"""	TIEG2		9748269, 11087666	Standard	NM_001177716		Approved	Tieg3, MODY7	uc002raf.1	O14901	OTTHUMG00000119004	Exception_encountered	chr2.hg19:g.10192452_10192453delinsTT	ENSP00000307023:p.Lys453Leu	157.0	0.0	.		141.0|137.0	22.0	.	NM_003597	B4DZE7|Q9EPF4	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000305883.1	hg19	CCDS1668.1																																																																																			.	.	.	none		0.569	KLF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000239202.3	NM_003597	
SMC6	79677	hgsc.bcm.edu	37	2	17888505	17888505	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr2:17888505C>G	ENST00000448223.2	-	18	2256	c.1987G>C	c.(1987-1989)Gat>Cat	p.D663H	SMC6_ENST00000351948.4_Missense_Mutation_p.D663H|SMC6_ENST00000402989.1_Missense_Mutation_p.D663H|SMC6_ENST00000381272.4_Missense_Mutation_p.D689H	NM_001142286.1	NP_001135758.1	Q96SB8	SMC6_HUMAN	structural maintenance of chromosomes 6	663					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			NS(1)|biliary_tract(1)|breast(6)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GAATCCACATCTCTGCTTAGG	0.363																																					p.D663H		Atlas-SNP	.											.	SMC6	102	.	0			c.G1987C						PASS	.						139.0	140.0	139.0					2																	17888505		2203	4300	6503	SO:0001583	missense	79677	exon18			CCACATCTCTGCT	AJ310551	CCDS1690.1	2p24.3	2008-02-05	2006-07-06	2006-07-06	ENSG00000163029	ENSG00000163029		"""Structural maintenance of chromosomes proteins"""	20466	protein-coding gene	gene with protein product		609387	"""SMC6 structural maintenance of chromosomes 6-like 1 (yeast)"""	SMC6L1		11230166	Standard	NM_024624		Approved	FLJ22116	uc002rcn.3	Q96SB8	OTTHUMG00000090675	ENST00000448223.2:c.1987G>C	chr2.hg19:g.17888505C>G	ENSP00000404092:p.Asp663His	158.0	0.0	.		117.0	19.0	.	NM_001142286	A8K8Q6|D6W518|Q05BV4|Q9H0X3|Q9H6M0	Missense_Mutation	SNP	ENST00000448223.2	hg19	CCDS1690.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.660667	0.88154	.	.	ENSG00000163029	ENST00000448223;ENST00000351948;ENST00000381272;ENST00000402989;ENST00000446852	T;T;T;T;T	0.29917	2.54;2.54;2.07;2.54;1.55	6.02	6.02	0.97574	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.57814	0.2079	M	0.68593	2.085	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.993;0.998	T	0.54397	-0.8300	10	0.59425	D	0.04	.	20.5373	0.99239	0.0:1.0:0.0:0.0	.	689;689;663	C9JMN1;Q96SB8-2;Q96SB8	.;.;SMC6_HUMAN	H	663;663;689;663;689	ENSP00000404092:D663H;ENSP00000323439:D663H;ENSP00000370672:D689H;ENSP00000384539:D663H;ENSP00000408644:D689H	ENSP00000323439:D663H	D	-	1	0	SMC6	17751986	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	6.427000	0.73378	2.857000	0.98124	0.650000	0.86243	GAT	.	.	.	none		0.363	SMC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207359.1	NM_024624	
NCL	4691	hgsc.bcm.edu	37	2	232325414	232325414	+	Missense_Mutation	SNP	T	T	A	rs540030591|rs139777351|rs371359723|rs199689485|rs527711138|rs368566589	byFrequency	TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr2:232325414T>A	ENST00000322723.4	-	4	1017	c.777A>T	c.(775-777)gaA>gaT	p.E259D	SNORD82_ENST00000365530.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin	259	Asp/Glu-rich (acidic).				angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		CCtcatcatcttcatcatcat	0.438																																					p.E259D		Atlas-SNP	.											.	NCL	80	.	0			c.A777T						PASS	.						229.0	194.0	206.0					2																	232325414		2203	4300	6503	SO:0001583	missense	4691	exon4			ATCATCTTCATCA		CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.777A>T	chr2.hg19:g.232325414T>A	ENSP00000318195:p.Glu259Asp	65.0	0.0	.		69.0	10.0	.	NM_005381	Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	Missense_Mutation	SNP	ENST00000322723.4	hg19	CCDS33397.1	.	.	.	.	.	.	.	.	.	.	T	0.028	-1.357543	0.01245	.	.	ENSG00000115053	ENST00000322723;ENST00000392033	T	0.23552	1.9	4.93	-9.86	0.00473	.	1.633390	0.02710	N	0.112777	T	0.06554	0.0168	N	0.03608	-0.345	0.19945	N	0.999949	B	0.02656	0.0	B	0.08055	0.003	T	0.26677	-1.0096	10	0.02654	T	1	0.5096	0.6058	0.00752	0.2352:0.1751:0.2128:0.3769	.	259	P19338	NUCL_HUMAN	D	259;151	ENSP00000318195:E259D	ENSP00000318195:E259D	E	-	3	2	NCL	232033658	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.197000	0.00276	-4.228000	0.00063	-3.370000	0.00041	GAA	.	.	.	weak		0.438	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332731.1	NM_005381	
KIF1A	547	hgsc.bcm.edu	37	2	241696843	241696843	+	Intron	SNP	C	C	A	rs537608637|rs10594016|rs533559120		TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr2:241696843C>A	ENST00000320389.7	-	25	2714				KIF1A_ENST00000498729.2_Missense_Mutation_p.E917D	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A						anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		cctcctcatcctcctcctcct	0.682													C|||	1	0.000199681	0.0	0.0014	5008	,	,		8551	0.0		0.0	False		,,,				2504	0.0				p.E917D		Atlas-SNP	.											.	KIF1A	152	.	0			c.G2751T						PASS	.																																			SO:0001627	intron_variant	547	exon27			CTCATCCTCCTCC	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2555+933G>T	chr2.hg19:g.241696843C>A		151.0	0.0	.		167.0	8.0	.	NM_001244008	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	hg19	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	C	8.327	0.825706	0.16749	.	.	ENSG00000130294	ENST00000498729;ENST00000373308;ENST00000404283	T;T	0.73047	-0.63;-0.71	4.04	3.16	0.36331	.	.	.	.	.	T	0.50429	0.1615	.	.	.	0.27599	N	0.949023	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.21690	-1.0238	8	0.08381	T	0.77	.	12.6857	0.56946	0.1669:0.833:0.0:0.0	.	917;917	F5H045;Q12756-2	.;.	D	917	ENSP00000438388:E917D;ENSP00000384231:E917D	ENSP00000362405:E917D	E	-	3	2	KIF1A	241345516	0.997000	0.39634	0.999000	0.59377	0.888000	0.51559	0.203000	0.17315	0.685000	0.31468	-0.372000	0.07161	GAG	.	.	.	none		0.682	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
ZNF619	285267	hgsc.bcm.edu	37	3	40528724	40528724	+	Silent	SNP	C	C	T			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr3:40528724C>T	ENST00000314686.5	+	6	1080	c.675C>T	c.(673-675)ttC>ttT	p.F225F	ZNF619_ENST00000520737.1_3'UTR|ZNF619_ENST00000521353.1_Silent_p.F281F|ZNF619_ENST00000522736.1_Silent_p.F232F|ZNF619_ENST00000429348.2_Silent_p.F241F|ZNF619_ENST00000432264.2_Silent_p.F241F|ZNF619_ENST00000447116.2_Silent_p.F281F|ZNF619_ENST00000456778.1_Silent_p.F197F			Q8N2I2	ZN619_HUMAN	zinc finger protein 619	225					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		GGAAAACCTTCAGATATAACT	0.438																																					p.F281F		Atlas-SNP	.											.	ZNF619	57	.	0			c.C843T						PASS	.						59.0	60.0	60.0					3																	40528724		2203	4300	6503	SO:0001819	synonymous_variant	285267	exon6			AACCTTCAGATAT	AK075245	CCDS46801.1, CCDS46802.1, CCDS46803.1	3p21.33	2013-01-08			ENSG00000177873	ENSG00000177873		"""Zinc fingers, C2H2-type"", ""-"""	26910	protein-coding gene	gene with protein product							Standard	NM_001145083		Approved	FLJ90764	uc011azb.2	Q8N2I2	OTTHUMG00000131391	ENST00000314686.5:c.675C>T	chr3.hg19:g.40528724C>T		129.0	0.0	.		128.0	19.0	.	NM_001145082	B4E271|C9JRN5|D4PHA2|E9PCD9	Silent	SNP	ENST00000314686.5	hg19																																																																																				.	.	.	none		0.438	ZNF619-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000254180.2	NM_173656	
TMIE	259236	hgsc.bcm.edu	37	3	46751076	46751076	+	Missense_Mutation	SNP	G	G	T	rs552239745|rs397817178|rs10578999|rs544504092|rs538183178|rs71619660|rs75020261	byFrequency	TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr3:46751076G>T	ENST00000326431.3	+	4	524	c.369G>T	c.(367-369)aaG>aaT	p.K123N		NM_147196.2	NP_671729.2	Q8NEW7	TMIE_HUMAN	transmembrane inner ear	123	Lys-rich.				inner ear morphogenesis (GO:0042472)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				endometrium(1)|lung(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000688)|KIRC - Kidney renal clear cell carcinoma(197;0.0177)|Kidney(197;0.0208)		CAGAGGATaagaagaagaaga	0.502																																					p.K123N		Atlas-SNP	.											.	TMIE	16	.	0			c.G369T						PASS	.						56.0	61.0	60.0					3																	46751076		1899	4121	6020	SO:0001583	missense	259236	exon4			GGATAAGAAGAAG	AY081842	CCDS43081.1	3p21	2010-01-06	2004-05-19		ENSG00000181585	ENSG00000181585			30800	protein-coding gene	gene with protein product		607237	"""deafness, autosomal recessive 6"""	DFNB6		12140191, 12145746	Standard	NM_147196		Approved		uc010hjk.1	Q8NEW7	OTTHUMG00000149909	ENST00000326431.3:c.369G>T	chr3.hg19:g.46751076G>T	ENSP00000324775:p.Lys123Asn	199.0	0.0	.		217.0	17.0	.	NM_147196	A0AV93|A8K0R0	Missense_Mutation	SNP	ENST00000326431.3	hg19	CCDS43081.1	.	.	.	.	.	.	.	.	.	.	G	4.335	0.061563	0.08339	.	.	ENSG00000181585	ENST00000326431	D	0.86230	-2.09	.	.	.	.	0.415784	0.26349	N	0.024899	T	0.76821	0.4041	L	0.40543	1.245	0.09310	N	1	B	0.25441	0.126	B	0.06405	0.002	T	0.64765	-0.6330	8	0.48119	T	0.1	-5.4402	.	.	.	.	123	Q8NEW7	TMIE_HUMAN	N	123	ENSP00000324775:K123N	ENSP00000324775:K123N	K	+	3	2	TMIE	46726080	0.976000	0.34144	0.425000	0.26659	0.475000	0.33008	1.894000	0.39768	0.121000	0.18284	0.123000	0.15791	AAG	.	.	.	weak		0.502	TMIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313853.1	NM_147196	
CELSR3	1951	hgsc.bcm.edu	37	3	48690465	48690465	+	Silent	SNP	A	A	T			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr3:48690465A>T	ENST00000164024.4	-	10	5884	c.5604T>A	c.(5602-5604)ctT>ctA	p.L1868L	CELSR3_ENST00000544264.1_Silent_p.L1868L	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1868	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GTGAGACCATAAGGACATGGT	0.597																																					p.L1868L		Atlas-SNP	.											.	CELSR3	237	.	0			c.T5604A						PASS	.						56.0	66.0	62.0					3																	48690465		2203	4300	6503	SO:0001819	synonymous_variant	1951	exon10			GACCATAAGGACA	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.5604T>A	chr3.hg19:g.48690465A>T		109.0	0.0	.		141.0	19.0	.	NM_001407	O75092	Silent	SNP	ENST00000164024.4	hg19	CCDS2775.1																																																																																			.	.	.	none		0.597	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
EPHA3	2042	hgsc.bcm.edu	37	3	89498468	89498468	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr3:89498468C>T	ENST00000336596.2	+	14	2665	c.2440C>T	c.(2440-2442)Ctc>Ttc	p.L814F	EPHA3_ENST00000494014.1_Missense_Mutation_p.L814F	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	814	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TGGGATTGTTCTCTGGGAGGT	0.453										TSP Lung(6;0.00050)																											p.L814F		Atlas-SNP	.											.	EPHA3	501	.	0			c.C2440T						PASS	.						260.0	238.0	246.0					3																	89498468		2203	4300	6503	SO:0001583	missense	2042	exon14			ATTGTTCTCTGGG	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2440C>T	chr3.hg19:g.89498468C>T	ENSP00000337451:p.Leu814Phe	166.0	0.0	.		170.0	26.0	.	NM_005233	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	hg19	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.544374	0.86022	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	T;T	0.69806	-0.43;-0.43	5.34	5.34	0.76211	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.82171	0.4979	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82186	-0.0582	9	.	.	.	.	19.0702	0.93130	0.0:1.0:0.0:0.0	.	814	P29320	EPHA3_HUMAN	F	814	ENSP00000337451:L814F;ENSP00000419190:L814F	.	L	+	1	0	EPHA3	89581158	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.839000	0.55835	2.507000	0.84556	0.655000	0.94253	CTC	.	.	.	none		0.453	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
OR5H14	403273	hgsc.bcm.edu	37	3	97868711	97868711	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr3:97868711G>A	ENST00000437310.1	+	1	542	c.482G>A	c.(481-483)gGa>gAa	p.G161E	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						ATCCATGAAGGATTTTTATTC	0.348																																					p.G161E		Atlas-SNP	.											OR5H14,NS,carcinoma,0,1	OR5H14	56	.	0			c.G482A						PASS	.						102.0	104.0	103.0					3																	97868711		2202	4300	6502	SO:0001583	missense	403273	exon1			ATGAAGGATTTTT		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.482G>A	chr3.hg19:g.97868711G>A	ENSP00000401706:p.Gly161Glu	216.0	0.0	.		248.0	31.0	.	NM_001005514	B9EH15	Missense_Mutation	SNP	ENST00000437310.1	hg19	CCDS33798.1	.	.	.	.	.	.	.	.	.	.	G	7.995	0.754074	0.15778	.	.	ENSG00000236032	ENST00000437310	T	0.37411	1.2	2.49	-1.46	0.08800	GPCR, rhodopsin-like superfamily (1);	0.899723	0.09201	N	0.834639	T	0.43743	0.1261	M	0.83118	2.625	0.09310	N	1	P	0.40731	0.728	P	0.45794	0.493	T	0.37641	-0.9697	10	0.37606	T	0.19	.	5.877	0.18834	0.0:0.4119:0.268:0.3201	.	161	A6NHG9	O5H14_HUMAN	E	161	ENSP00000401706:G161E	ENSP00000401706:G161E	G	+	2	0	OR5H14	99351401	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.034000	0.01424	-0.640000	0.05495	-1.112000	0.02068	GGA	.	.	.	none		0.348	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359112.1		
PDS5A	23244	hgsc.bcm.edu	37	4	39910143	39910143	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr4:39910143A>G	ENST00000303538.8	-	11	1644	c.1105T>C	c.(1105-1107)Tca>Cca	p.S369P	PDS5A_ENST00000503396.1_Missense_Mutation_p.S369P	NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						GGATCATGTGATCTAACCTTT	0.343																																					p.S369P		Atlas-SNP	.											.	PDS5A	114	.	0			c.T1105C						PASS	.						99.0	92.0	94.0					4																	39910143		1834	4086	5920	SO:0001583	missense	23244	exon11			CATGTGATCTAAC	AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.1105T>C	chr4.hg19:g.39910143A>G	ENSP00000303427:p.Ser369Pro	83.0	0.0	.		92.0	15.0	.	NM_001100399		Missense_Mutation	SNP	ENST00000303538.8	hg19	CCDS47045.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.384751	0.82792	.	.	ENSG00000121892	ENST00000303538;ENST00000503396	T;T	0.68765	-0.13;-0.35	4.93	4.93	0.64822	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.76630	0.4014	M	0.62723	1.935	0.80722	D	1	D;P	0.54047	0.964;0.938	P;P	0.60541	0.709;0.876	T	0.76833	-0.2813	9	.	.	.	-4.4602	14.5742	0.68235	1.0:0.0:0.0:0.0	.	369;369	Q29RF7-3;Q29RF7	.;PDS5A_HUMAN	P	369	ENSP00000303427:S369P;ENSP00000426749:S369P	.	S	-	1	0	PDS5A	39586538	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.315000	0.96313	1.853000	0.53794	0.455000	0.32223	TCA	.	.	.	none		0.343	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361287.1	NM_015200	
HNRNPDL	9987	hgsc.bcm.edu	37	4	83350434	83350434	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr4:83350434T>C	ENST00000295470.5	-	1	585	c.410A>G	c.(409-411)aAg>aGg	p.K137R	ENOPH1_ENST00000273920.3_5'Flank|HNRNPDL_ENST00000602300.1_Missense_Mutation_p.K18R|HNRNPDL_ENST00000502762.1_Missense_Mutation_p.K137R|ENOPH1_ENST00000509635.1_5'Flank|HNRNPDL_ENST00000514511.1_5'UTR|HNRNPDL_ENST00000349655.4_Missense_Mutation_p.K18R	NM_001207000.1|NM_031372.3	NP_001193929.1|NP_112740.1	O14979	HNRDL_HUMAN	heterogeneous nuclear ribonucleoprotein D-like	137					regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|single-stranded DNA binding (GO:0003697)										CGCGTTGATCTTGGATCCCTC	0.627																																					p.K137R		Atlas-SNP	.											.	HNRPDL	35	.	0			c.A410G						PASS	.						108.0	119.0	115.0					4																	83350434		2203	4300	6503	SO:0001583	missense	9987	exon1			TTGATCTTGGATC	D89092	CCDS3593.1, CCDS75153.1	4q21.22	2013-06-12		2013-06-12	ENSG00000152795	ENSG00000152795		"""RNA binding motif (RRM) containing"""	5037	protein-coding gene	gene with protein product		607137		HNRPDL		10072754, 9524220	Standard	NM_001207000		Approved	JKTBP, laAUF1	uc003hmr.3	O14979	OTTHUMG00000130299	ENST00000295470.5:c.410A>G	chr4.hg19:g.83350434T>C	ENSP00000295470:p.Lys137Arg	100.0	0.0	.		84.0	9.0	.	NM_031372	Q6SPF2|Q7KZ74|Q7KZ75|Q96IM0|Q96S43	Missense_Mutation	SNP	ENST00000295470.5	hg19	CCDS3593.1	.	.	.	.	.	.	.	.	.	.	t	16.13	3.036489	0.54896	.	.	ENSG00000152795	ENST00000295470;ENST00000502762;ENST00000349655	T;T;T	0.67345	-0.26;-0.26;-0.1	4.84	4.84	0.62591	Nucleotide-binding, alpha-beta plait (1);	0.064498	0.64402	D	0.000016	T	0.62804	0.2458	L	0.58101	1.795	0.43480	D	0.995701	B;B	0.21520	0.038;0.057	B;B	0.24155	0.051;0.034	T	0.59679	-0.7409	10	0.27785	T	0.31	.	14.2367	0.65932	0.0:0.0:0.0:1.0	.	18;137	O14979-3;O14979	.;HNRDL_HUMAN	R	137;137;18	ENSP00000295470:K137R;ENSP00000422040:K137R;ENSP00000338552:K18R	ENSP00000295470:K137R	K	-	2	0	HNRPDL	83569458	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	3.732000	0.55021	2.029000	0.59856	0.397000	0.26171	AAG	.	.	.	none		0.627	HNRNPDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252644.1	NM_005463	
SV2C	22987	hgsc.bcm.edu	37	5	75596667	75596667	+	Missense_Mutation	SNP	T	T	G			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr5:75596667T>G	ENST00000502798.2	+	11	2192	c.1750T>G	c.(1750-1752)Ttt>Gtt	p.F584V	RP11-466P24.6_ENST00000502589.1_RNA|SV2C_ENST00000322285.7_Missense_Mutation_p.F584V	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	584					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		CTGGATTTATTTTGTCAACTT	0.403																																					p.F584V		Atlas-SNP	.											.	SV2C	97	.	0			c.T1750G						PASS	.						215.0	197.0	203.0					5																	75596667		1886	4099	5985	SO:0001583	missense	22987	exon11			ATTTATTTTGTCA	AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.1750T>G	chr5.hg19:g.75596667T>G	ENSP00000423541:p.Phe584Val	131.0	0.0	.		125.0	18.0	.	NM_014979	Q496K1|Q9UPU8	Missense_Mutation	SNP	ENST00000502798.2	hg19	CCDS43331.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.539849	0.85917	.	.	ENSG00000122012	ENST00000502798;ENST00000322285	T;T	0.58506	0.48;0.33	5.68	5.68	0.88126	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.54598	0.1868	N	0.17082	0.46	0.80722	D	1	P	0.42871	0.792	P	0.50537	0.643	T	0.59568	-0.7430	10	0.54805	T	0.06	-18.9286	15.9159	0.79517	0.0:0.0:0.0:1.0	.	584	Q496J9	SV2C_HUMAN	V	584	ENSP00000423541:F584V;ENSP00000316983:F584V	ENSP00000316983:F584V	F	+	1	0	SV2C	75632423	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.163000	0.67991	0.482000	0.46254	TTT	.	.	.	none		0.403	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368700.4		
AFAP1L1	134265	hgsc.bcm.edu	37	5	148679111	148679111	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr5:148679111G>T	ENST00000296721.4	+	2	154	c.56G>T	c.(55-57)aGc>aTc	p.S19I	AFAP1L1_ENST00000515000.1_Missense_Mutation_p.S19I|AFAP1L1_ENST00000522492.1_3'UTR	NM_001146337.1|NM_152406.2	NP_001139809.1|NP_689619.1	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	19						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(10)|ovary(1)|pancreas(1)|skin(2)	26			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGCTGCTCAGCCTCCTGGAC	0.642																																					p.S19I		Atlas-SNP	.											.	AFAP1L1	86	.	0			c.G56T						PASS	.						67.0	64.0	65.0					5																	148679111		2203	4300	6503	SO:0001583	missense	134265	exon2			TGCTCAGCCTCCT	AK094067	CCDS34274.1, CCDS54932.1	5q33.1	2013-01-10			ENSG00000157510	ENSG00000157510		"""Pleckstrin homology (PH) domain containing"""	26714	protein-coding gene	gene with protein product		614410					Standard	NM_152406		Approved	FLJ36748	uc003lqh.3	Q8TED9	OTTHUMG00000163441	ENST00000296721.4:c.56G>T	chr5.hg19:g.148679111G>T	ENSP00000296721:p.Ser19Ile	73.0	0.0	.		88.0	5.0	.	NM_001146337	Q08AN4|Q08AN5|Q8IW82|Q8N8Z5|Q8N9Q4	Missense_Mutation	SNP	ENST00000296721.4	hg19	CCDS34274.1	.	.	.	.	.	.	.	.	.	.	G	15.16	2.749690	0.49257	.	.	ENSG00000157510	ENST00000296721;ENST00000515000	T;T	0.44482	0.92;0.92	4.65	4.65	0.58169	.	0.103899	0.64402	D	0.000002	T	0.44767	0.1309	L	0.47716	1.5	0.30230	N	0.796004	D;P;D	0.59357	0.958;0.93;0.985	P;B;P	0.52217	0.563;0.36;0.693	T	0.50110	-0.8866	10	0.66056	D	0.02	-24.6898	9.2249	0.37400	0.1331:0.0:0.8669:0.0	.	19;19;19	Q8TED9-2;Q8TED9;Q8TED9-3	.;AF1L1_HUMAN;.	I	19	ENSP00000296721:S19I;ENSP00000424427:S19I	ENSP00000296721:S19I	S	+	2	0	AFAP1L1	148659304	1.000000	0.71417	1.000000	0.80357	0.579000	0.36224	4.592000	0.61027	2.563000	0.86464	0.563000	0.77884	AGC	.	.	.	none		0.642	AFAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373443.1	NM_152406	
HIST1H1B	3009	hgsc.bcm.edu	37	6	27834701	27834701	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr6:27834701G>C	ENST00000331442.3	-	1	658	c.607C>G	c.(607-609)Ccc>Gcc	p.P203A		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	203					chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						GCGGCTTTGGGCTTTGCCGCC	0.557																																					p.P203A		Atlas-SNP	.											.	HIST1H1B	54	.	0			c.C607G						PASS	.						71.0	66.0	68.0					6																	27834701		2203	4300	6503	SO:0001583	missense	3009	exon1			CTTTGGGCTTTGC	AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.607C>G	chr6.hg19:g.27834701G>C	ENSP00000330074:p.Pro203Ala	139.0	0.0	.		138.0	8.0	.	NM_005322	Q14529|Q3MJ42	Missense_Mutation	SNP	ENST00000331442.3	hg19	CCDS4635.1	.	.	.	.	.	.	.	.	.	.	G	6.842	0.524661	0.13066	.	.	ENSG00000184357	ENST00000331442	T	0.16324	2.35	4.79	4.79	0.61399	.	0.398694	0.22302	N	0.061856	T	0.03305	0.0096	N	0.08118	0	0.53688	D	0.999977	B	0.20261	0.043	B	0.15870	0.014	T	0.34650	-0.9820	10	0.12103	T	0.63	-21.4378	14.0627	0.64810	0.0:0.0:1.0:0.0	.	203	P16401	H15_HUMAN	A	203	ENSP00000330074:P203A	ENSP00000330074:P203A	P	-	1	0	HIST1H1B	27942680	0.996000	0.38824	0.330000	0.25442	0.061000	0.15899	2.443000	0.44881	2.600000	0.87896	0.655000	0.94253	CCC	.	.	.	none		0.557	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043371.1	NM_005322	
GABBR1	2550	hgsc.bcm.edu	37	6	29581105	29581105	+	Missense_Mutation	SNP	C	C	T	rs548511243		TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr6:29581105C>T	ENST00000377034.4	-	12	1816	c.1481G>A	c.(1480-1482)cGc>cAc	p.R494H	GABBR1_ENST00000355973.3_Missense_Mutation_p.R377H|GABBR1_ENST00000377012.4_Missense_Mutation_p.R377H|GABBR1_ENST00000376977.3_Missense_Mutation_p.R494H|GABBR1_ENST00000377016.4_Missense_Mutation_p.R432H	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	494					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	GTCCTCCAGGCGCACACCAGA	0.552													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17554	0.0		0.0	False		,,,				2504	0.0				p.R494H		Atlas-SNP	.											.	GABBR1	95	.	0			c.G1481A						PASS	.						106.0	117.0	113.0					6																	29581105		1511	2708	4219	SO:0001583	missense	2550	exon12			TCCAGGCGCACAC	Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.1481G>A	chr6.hg19:g.29581105C>T	ENSP00000366233:p.Arg494His	200.0	0.0	.		160.0	22.0	.	NM_001470	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	ENST00000377034.4	hg19	CCDS4663.1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.325374	0.60743	.	.	ENSG00000204681	ENST00000355973;ENST00000376977;ENST00000377016;ENST00000377012;ENST00000377034	D;D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66;-1.66	5.84	5.84	0.93424	Extracellular ligand-binding receptor (1);	0.180709	0.49305	D	0.000155	T	0.67487	0.2898	N	0.25890	0.77	0.58432	D	0.999998	B;B;B;B	0.21147	0.052;0.008;0.005;0.009	B;B;B;B	0.13407	0.009;0.006;0.007;0.008	T	0.66304	-0.5957	10	0.62326	D	0.03	-27.9829	17.64	0.88133	0.0:1.0:0.0:0.0	.	494;432;494;377	Q9UBS5-5;Q9UBS5-3;Q9UBS5;Q5SUJ9	.;.;GABR1_HUMAN;.	H	377;494;432;377;494	ENSP00000348248:R377H;ENSP00000366176:R494H;ENSP00000366215:R432H;ENSP00000366211:R377H;ENSP00000366233:R494H	ENSP00000348248:R377H	R	-	2	0	GABBR1	29689084	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	7.421000	0.80204	2.769000	0.95229	0.655000	0.94253	CGC	.	.	.	none		0.552	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
B3GALT4	8705	hgsc.bcm.edu	37	6	33246172	33246172	+	Missense_Mutation	SNP	A	A	C			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr6:33246172A>C	ENST00000451237.1	+	1	1256	c.976A>C	c.(976-978)Aaa>Caa	p.K326Q		NM_003782.3	NP_003773.1	O96024	B3GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4	326					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ganglioside galactosyltransferase activity (GO:0047915)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|urinary_tract(2)	13						CTGCTATGGGAAATTCCTGCT	0.622																																					p.K326Q		Atlas-SNP	.											.	B3GALT4	30	.	0			c.A976C						PASS	.						89.0	99.0	96.0					6																	33246172		2203	4300	6503	SO:0001583	missense	8705	exon1			TATGGGAAATTCC	Y15061	CCDS34425.1	6p21.3	2013-02-19			ENSG00000235863	ENSG00000235863		"""Beta 3-glycosyltransferases"""	919	protein-coding gene	gene with protein product		603095				9582303	Standard	NM_003782		Approved	beta3Gal-T4, GalT4	uc003odr.3	O96024	OTTHUMG00000031100	ENST00000451237.1:c.976A>C	chr6.hg19:g.33246172A>C	ENSP00000390784:p.Lys326Gln	79.0	0.0	.		62.0	7.0	.	NM_003782		Missense_Mutation	SNP	ENST00000451237.1	hg19	CCDS34425.1	.	.	.	.	.	.	.	.	.	.	A	12.41	1.929873	0.34096	.	.	ENSG00000235863	ENST00000451237	T	0.50277	0.75	4.29	4.29	0.51040	.	0.350727	0.27424	N	0.019440	T	0.17577	0.0422	N	0.19112	0.55	0.37795	D	0.927492	B	0.27498	0.18	B	0.21360	0.034	T	0.10042	-1.0647	10	0.54805	T	0.06	.	11.4597	0.50202	1.0:0.0:0.0:0.0	.	326	O96024	B3GT4_HUMAN	Q	326	ENSP00000390784:K326Q	ENSP00000390784:K326Q	K	+	1	0	B3GALT4	33354150	0.862000	0.29867	1.000000	0.80357	0.987000	0.75469	3.092000	0.50207	1.815000	0.52974	0.523000	0.50628	AAA	.	.	.	none		0.622	B3GALT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076162.2		
DNAH8	1769	hgsc.bcm.edu	37	6	38843576	38843576	+	Silent	SNP	C	C	A			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr6:38843576C>A	ENST00000359357.3	+	51	7433	c.7179C>A	c.(7177-7179)acC>acA	p.T2393T	DNAH8_ENST00000441566.1_Silent_p.T2357T|DNAH8_ENST00000449981.2_Silent_p.T2610T			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2393					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CAAATCAAACCATGTATGAGT	0.353																																					p.T2610T		Atlas-SNP	.											.	DNAH8	1239	.	0			c.C7830A						PASS	.						89.0	89.0	89.0					6																	38843576		2203	4300	6503	SO:0001819	synonymous_variant	1769	exon53			TCAAACCATGTAT	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.7179C>A	chr6.hg19:g.38843576C>A		150.0	0.0	.		111.0	13.0	.	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	hg19																																																																																				.	.	.	none		0.353	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
PKHD1	5314	hgsc.bcm.edu	37	6	51924822	51924822	+	Silent	SNP	G	G	A			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr6:51924822G>A	ENST00000371117.3	-	15	1412	c.1137C>T	c.(1135-1137)ttC>ttT	p.F379F	PKHD1_ENST00000340994.4_Silent_p.F379F|AL590391.1_ENST00000408630.2_RNA	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	379					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GAGCCACAAAGAACCCACTGA	0.443																																					p.F379F		Atlas-SNP	.											.	PKHD1	927	.	0			c.C1137T						PASS	.						84.0	76.0	79.0					6																	51924822		2203	4300	6503	SO:0001819	synonymous_variant	5314	exon15			CACAAAGAACCCA	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.1137C>T	chr6.hg19:g.51924822G>A		88.0	0.0	.		75.0	12.0	.	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	ENST00000371117.3	hg19	CCDS4935.1																																																																																			.	.	.	none		0.443	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
UTRN	7402	hgsc.bcm.edu	37	6	144724303	144724303	+	Missense_Mutation	SNP	A	A	T			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr6:144724303A>T	ENST00000367545.3	+	2	124	c.124A>T	c.(124-126)Aat>Tat	p.N42Y		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	42	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		CAAATGGATAAATGCTCGATT	0.373																																					p.N42Y		Atlas-SNP	.											.	UTRN	327	.	0			c.A124T						PASS	.						79.0	76.0	77.0					6																	144724303		2202	4300	6502	SO:0001583	missense	7402	exon2			TGGATAAATGCTC	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.124A>T	chr6.hg19:g.144724303A>T	ENSP00000356515:p.Asn42Tyr	102.0	0.0	.		116.0	19.0	.	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	hg19	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	A	15.69	2.907745	0.52333	.	.	ENSG00000152818	ENST00000433557;ENST00000367529;ENST00000367545;ENST00000421035	D;D;D	0.98221	-4.8;-4.8;-4.8	5.48	5.48	0.80851	Actinin-type, actin-binding, conserved site (1);Calponin homology domain (5);	0.000000	0.53938	D	0.000052	D	0.99281	0.9749	H	0.96111	3.77	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.98886	1.0771	10	0.87932	D	0	.	14.8543	0.70323	1.0:0.0:0.0:0.0	.	42	P46939	UTRO_HUMAN	Y	42;42;42;47	ENSP00000390879:N42Y;ENSP00000356515:N42Y;ENSP00000396276:N47Y	ENSP00000356499:N42Y	N	+	1	0	UTRN	144765996	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.728000	0.74769	2.204000	0.70986	0.528000	0.53228	AAT	.	.	.	none		0.373	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
GRM1	2911	hgsc.bcm.edu	37	6	146678763	146678763	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr6:146678763T>C	ENST00000282753.1	+	5	1770	c.1535T>C	c.(1534-1536)aTc>aCc	p.I512T	GRM1_ENST00000507907.1_Missense_Mutation_p.I512T|GRM1_ENST00000361719.2_Missense_Mutation_p.I512T|GRM1_ENST00000355289.4_Missense_Mutation_p.I512T|GRM1_ENST00000492807.2_Missense_Mutation_p.I512T|GRM1_ENST00000392299.2_Missense_Mutation_p.I512T			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	512					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		GATTACAAAATCCAGATGAAC	0.443																																					p.I512T		Atlas-SNP	.											.	GRM1	419	.	0			c.T1535C						PASS	.						175.0	139.0	152.0					6																	146678763		2203	4300	6503	SO:0001583	missense	2911	exon6			ACAAAATCCAGAT	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.1535T>C	chr6.hg19:g.146678763T>C	ENSP00000282753:p.Ile512Thr	132.0	0.0	.		120.0	18.0	.	NM_000838	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	hg19	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	T	17.85	3.490489	0.64074	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.90788	-2.69;-2.72;-2.72;-2.69;-2.73;-2.72	5.48	5.48	0.80851	.	0.044050	0.85682	D	0.000000	D	0.87601	0.6218	M	0.62723	1.935	0.80722	D	1	P;P;P	0.40144	0.552;0.704;0.696	B;B;B	0.41666	0.133;0.272;0.363	D	0.89914	0.4054	10	0.87932	D	0	.	15.57	0.76326	0.0:0.0:0.0:1.0	.	512;512;512	F8W805;Q13255;Q13255-2	.;GRM1_HUMAN;.	T	512	ENSP00000354896:I512T;ENSP00000376119:I512T;ENSP00000424095:I512T;ENSP00000282753:I512T;ENSP00000347437:I512T;ENSP00000425599:I512T	ENSP00000282753:I512T	I	+	2	0	GRM1	146720456	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.671000	0.83941	2.081000	0.62600	0.533000	0.62120	ATC	.	.	.	none		0.443	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838	
ZKSCAN1	7586	hgsc.bcm.edu	37	7	99631136	99631136	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr7:99631136G>T	ENST00000324306.6	+	6	1242	c.1008G>T	c.(1006-1008)aaG>aaT	p.K336N	ZKSCAN1_ENST00000535170.1_Missense_Mutation_p.K123N|ZKSCAN1_ENST00000426572.1_Missense_Mutation_p.K300N	NM_003439.1	NP_003430.1	P17029	ZKSC1_HUMAN	zinc finger with KRAB and SCAN domains 1	336					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			CTATAGGAAAGGACAAAAAAA	0.483																																					p.K336N		Atlas-SNP	.											.	ZKSCAN1	59	.	0			c.G1008T						PASS	.						76.0	83.0	81.0					7																	99631136		2203	4300	6503	SO:0001583	missense	7586	exon6			AGGAAAGGACAAA	X52349	CCDS34698.1, CCDS69349.1, CCDS75640.1	7q22	2013-01-09	2004-11-16	2004-11-17	ENSG00000106261	ENSG00000106261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13101	protein-coding gene	gene with protein product		601260	"""zinc finger protein 36 (KOX 18)"""	ZNF139, ZNF36			Standard	NM_001287055		Approved	KOX18, PHZ-37, ZSCAN33	uc003usk.1	P17029	OTTHUMG00000156534	ENST00000324306.6:c.1008G>T	chr7.hg19:g.99631136G>T	ENSP00000323148:p.Lys336Asn	184.0	0.0	.		172.0	37.0	.	NM_003439	A4D294|P52745|Q2M1U1|Q8TBW5|Q8TEK7	Missense_Mutation	SNP	ENST00000324306.6	hg19	CCDS34698.1	.	.	.	.	.	.	.	.	.	.	G	9.281	1.048151	0.19827	.	.	ENSG00000106261	ENST00000324306;ENST00000426572;ENST00000535170	T;T;T	0.07444	3.27;3.24;3.19	5.18	2.25	0.28309	.	0.208078	0.34133	N	0.004225	T	0.04724	0.0128	N	0.24115	0.695	0.09310	N	0.999992	B	0.02656	0.0	B	0.01281	0.0	T	0.38779	-0.9645	10	0.23891	T	0.37	.	5.162	0.15066	0.1671:0.1743:0.6585:0.0	.	336	P17029	ZKSC1_HUMAN	N	336;300;123	ENSP00000323148:K336N;ENSP00000409172:K300N;ENSP00000443508:K123N	ENSP00000323148:K336N	K	+	3	2	ZKSCAN1	99469072	0.025000	0.19082	0.922000	0.36590	0.034000	0.12701	0.823000	0.27366	0.898000	0.36418	0.557000	0.71058	AAG	.	.	.	none		0.483	ZKSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344550.2	NM_003439	
ARMC10	83787	hgsc.bcm.edu	37	7	102738803	102738803	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr7:102738803C>T	ENST00000323716.3	+	7	1227	c.835C>T	c.(835-837)Cga>Tga	p.R279*	ARMC10_ENST00000541300.1_Nonsense_Mutation_p.R161*|ARMC10_ENST00000441711.2_Nonsense_Mutation_p.R244*|ARMC10_ENST00000425331.1_Nonsense_Mutation_p.R220*|ARMC10_ENST00000454559.1_Nonsense_Mutation_p.R185*|ARMC10_ENST00000428183.2_Nonsense_Mutation_p.R220*	NM_031905.4	NP_114111.2	Q8N2F6	ARM10_HUMAN	armadillo repeat containing 10	279					regulation of growth (GO:0040008)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.R279*(2)		NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	11						GATTCTTCTTCGAGTACTTAC	0.343																																					p.R279X		Atlas-SNP	.											ARMC10,NS,carcinoma,0,2	ARMC10	25	.	2	Substitution - Nonsense(2)	NS(1)|breast(1)	c.C835T						PASS	.						73.0	65.0	67.0					7																	102738803		2203	4300	6503	SO:0001587	stop_gained	83787	exon7			CTTCTTCGAGTAC	AY150853	CCDS5728.1, CCDS55145.1, CCDS55146.1, CCDS55147.1, CCDS55148.1, CCDS55149.1	7q22.1	2013-02-14			ENSG00000170632	ENSG00000170632		"""Armadillo repeat containing"""	21706	protein-coding gene	gene with protein product	"""specific Splicing Variant involved in Hepatocarcinogenesis"""	611864				12839973	Standard	NM_031905		Approved	MGC3195, SVH	uc003vaw.2	Q8N2F6	OTTHUMG00000157201	ENST00000323716.3:c.835C>T	chr7.hg19:g.102738803C>T	ENSP00000319412:p.Arg279*	521.0	0.0	.		475.0	23.0	.	NM_031905	A8K703|B4DWJ8|F5GX65|Q75K91|Q75MG6|Q75ML8|Q8IZC1|Q8IZC2|Q8IZC3|Q9BTM6	Nonsense_Mutation	SNP	ENST00000323716.3	hg19	CCDS5728.1	.	.	.	.	.	.	.	.	.	.	C	38	7.008041	0.97998	.	.	ENSG00000170632	ENST00000323716;ENST00000428183;ENST00000441711;ENST00000454559;ENST00000425331;ENST00000541300;ENST00000434153;ENST00000431642	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.7948	11.9574	0.52988	0.2764:0.7236:0.0:0.0	.	.	.	.	X	279;220;244;185;220;161;207;121	.	ENSP00000319412:R279X	R	+	1	2	ARMC10	102526039	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	0.632000	0.24583	2.709000	0.92574	0.591000	0.81541	CGA	.	.	.	none		0.343	ARMC10-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347882.1	NM_031905	
RBM33	155435	hgsc.bcm.edu	37	7	155473562	155473562	+	Missense_Mutation	SNP	T	T	A			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr7:155473562T>A	ENST00000401878.3	+	5	725	c.527T>A	c.(526-528)gTg>gAg	p.V176E	RBM33_ENST00000392759.3_Missense_Mutation_p.V176E|RBM33_ENST00000287912.3_Missense_Mutation_p.V176E	NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	176	Glu-rich.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		ACTGATGAAGTGTTAGACATC	0.433																																					p.V176E		Atlas-SNP	.											.	RBM33	157	.	0			c.T527A						PASS	.						97.0	95.0	96.0					7																	155473562		1960	4156	6116	SO:0001583	missense	155435	exon5			ATGAAGTGTTAGA	AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.527T>A	chr7.hg19:g.155473562T>A	ENSP00000384160:p.Val176Glu	160.0	0.0	.		154.0	17.0	.	NM_053043	A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	Missense_Mutation	SNP	ENST00000401878.3	hg19	CCDS5941.2	.	.	.	.	.	.	.	.	.	.	T	21.8	4.197992	0.79015	.	.	ENSG00000184863	ENST00000287912;ENST00000401878;ENST00000392759;ENST00000440108	T;T;T;T	0.33216	1.42;1.42;1.42;1.42	5.35	5.35	0.76521	.	.	.	.	.	T	0.50582	0.1624	L	0.52573	1.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.52697	-0.8541	9	0.87932	D	0	.	15.3587	0.74453	0.0:0.0:0.0:1.0	.	176;176	Q96EV2;Q96EV2-2	RBM33_HUMAN;.	E	176;176;176;67	ENSP00000287912:V176E;ENSP00000384160:V176E;ENSP00000376513:V176E;ENSP00000394987:V67E	ENSP00000287912:V176E	V	+	2	0	RBM33	155166323	1.000000	0.71417	0.998000	0.56505	0.951000	0.60555	5.466000	0.66731	2.029000	0.59856	0.460000	0.39030	GTG	.	.	.	none		0.433	RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317225.3	NM_001008408	
TEX15	56154	hgsc.bcm.edu	37	8	30700777	30700777	+	Silent	SNP	T	T	C			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr8:30700777T>C	ENST00000256246.2	-	1	5831	c.5757A>G	c.(5755-5757)agA>agG	p.R1919R		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1919					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		ATTTATTCACTCTGAGTAGCC	0.343																																					p.R1919R		Atlas-SNP	.											.	TEX15	350	.	0			c.A5757G						PASS	.						110.0	105.0	107.0					8																	30700777		2202	4299	6501	SO:0001819	synonymous_variant	56154	exon1			ATTCACTCTGAGT	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.5757A>G	chr8.hg19:g.30700777T>C		110.0	0.0	.		114.0	11.0	.	NM_031271		Silent	SNP	ENST00000256246.2	hg19	CCDS6080.1																																																																																			.	.	.	none		0.343	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
STMN2	11075	hgsc.bcm.edu	37	8	80567258	80567258	+	Silent	SNP	G	G	A			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr8:80567258G>A	ENST00000220876.7	+	4	823	c.441G>A	c.(439-441)gaG>gaA	p.E147E	STMN2_ENST00000518491.1_Silent_p.E136E|STMN2_ENST00000518111.1_Silent_p.E147E	NM_001199214.1|NM_007029.3	NP_001186143.1|NP_008960.2	Q93045	STMN2_HUMAN	stathmin 2	147	SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				cellular response to nerve growth factor stimulus (GO:1990090)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of neuron projection development (GO:0010977)|positive regulation of microtubule depolymerization (GO:0031117)|positive regulation of neuron projection development (GO:0010976)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	11	all_lung(9;8.34e-05)		Epithelial(68;0.0229)|all cancers(69;0.0874)			AAAACCGTGAGGCTAATCTAG	0.443																																					p.E147E		Atlas-SNP	.											.	STMN2	23	.	0			c.G441A						PASS	.						89.0	82.0	84.0					8																	80567258		1917	4125	6042	SO:0001819	synonymous_variant	11075	exon4			CCGTGAGGCTAAT		CCDS43748.1, CCDS56542.1	8q21.13	2014-04-01	2014-04-01	2001-07-13	ENSG00000104435	ENSG00000104435			10577	protein-coding gene	gene with protein product		600621	"""stathmin-like 2"""	SCGN10		8622778, 12140291	Standard	NM_007029		Approved	SCG10	uc022awk.1	Q93045	OTTHUMG00000164610	ENST00000220876.7:c.441G>A	chr8.hg19:g.80567258G>A		131.0	0.0	.		130.0	17.0	.	NM_007029	A8K9M2|G3V110|O14952|Q6PK68	Silent	SNP	ENST00000220876.7	hg19	CCDS43748.1																																																																																			.	.	.	none		0.443	STMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379261.2	NM_007029	
DOCK8	81704	hgsc.bcm.edu	37	9	441400	441400	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr9:441400G>T	ENST00000453981.1	+	41	5450	c.5338G>T	c.(5338-5340)Gac>Tac	p.D1780Y	DOCK8_ENST00000382329.1_Missense_Mutation_p.D1247Y|DOCK8_ENST00000469391.1_Missense_Mutation_p.D1680Y|DOCK8_ENST00000432829.2_Missense_Mutation_p.D1712Y			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1780	DHR-2.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		GAGAGCCTTCGACAGCATCGT	0.552																																					p.D1780Y		Atlas-SNP	.											.	DOCK8	401	.	0			c.G5338T						PASS	.						75.0	70.0	72.0					9																	441400		2203	4300	6503	SO:0001583	missense	81704	exon41			GCCTTCGACAGCA	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.5338G>T	chr9.hg19:g.441400G>T	ENSP00000408464:p.Asp1780Tyr	88.0	0.0	.		70.0	6.0	.	NM_203447	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	hg19	CCDS6440.2	.	.	.	.	.	.	.	.	.	.	G	13.41	2.228460	0.39399	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.17213	2.51;2.51;2.51;2.29	5.36	5.36	0.76844	.	0.046369	0.85682	D	0.000000	T	0.27629	0.0679	M	0.64997	1.995	0.80722	D	1	P;P;P	0.38642	0.641;0.641;0.641	B;B;B	0.42062	0.374;0.374;0.374	T	0.02320	-1.1177	10	0.72032	D	0.01	.	19.2822	0.94055	0.0:0.0:1.0:0.0	.	1680;1247;1780	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	Y	1780;1748;1712;1680;1247	ENSP00000408464:D1780Y;ENSP00000394888:D1712Y;ENSP00000419438:D1680Y;ENSP00000371766:D1247Y	ENSP00000287364:D1748Y	D	+	1	0	DOCK8	431400	1.000000	0.71417	0.974000	0.42286	0.031000	0.12232	5.138000	0.64795	2.763000	0.94921	0.655000	0.94253	GAC	.	.	.	none		0.552	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
TPD52L3	89882	hgsc.bcm.edu	37	9	6328657	6328657	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr9:6328657T>C	ENST00000344545.5	+	1	309	c.62T>C	c.(61-63)cTg>cCg	p.L21P	TPD52L3_ENST00000381428.1_Missense_Mutation_p.L21P|TPD52L3_ENST00000314556.3_Missense_Mutation_p.L21P	NM_033516.5	NP_277051	Q96J77	TPD55_HUMAN	tumor protein D52-like 3	21										large_intestine(1)|lung(9)|skin(1)	11		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0198)|Lung(218;0.1)		ACTTCTGAACTGGAGGATCTG	0.498																																					p.L21P		Atlas-SNP	.											.	TPD52L3	40	.	0			c.T62C						PASS	.						88.0	89.0	88.0					9																	6328657		2203	4300	6503	SO:0001583	missense	89882	exon1			CTGAACTGGAGGA	AY032877	CCDS34984.1, CCDS34985.1, CCDS34986.1	9p24.1	2008-02-05			ENSG00000170777	ENSG00000170777			23382	protein-coding gene	gene with protein product							Standard	NM_033516		Approved	NYD-SP25	uc003zjw.3	Q96J77	OTTHUMG00000019518	ENST00000344545.5:c.62T>C	chr9.hg19:g.6328657T>C	ENSP00000341677:p.Leu21Pro	118.0	0.0	.		115.0	18.0	.	NM_033516	Q5TCR3|Q5TCR4|Q5TCR5|Q8N4P5|Q8WWF7|Q96M09	Missense_Mutation	SNP	ENST00000344545.5	hg19	CCDS34986.1	.	.	.	.	.	.	.	.	.	.	T	5.474	0.272581	0.10349	.	.	ENSG00000170777	ENST00000344545;ENST00000381428;ENST00000314556	T;T;T	0.32515	1.47;1.46;1.45	4.74	0.688	0.18027	.	0.637913	0.15109	N	0.280044	T	0.09024	0.0223	N	0.01473	-0.845	0.09310	N	0.999999	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.26503	-1.0101	10	0.28530	T	0.3	-0.4477	3.543	0.07818	0.175:0.5355:0.0:0.2896	.	21;21;21	Q96J77-2;Q96J77;Q96J77-3	.;TPD55_HUMAN;.	P	21	ENSP00000341677:L21P;ENSP00000370836:L21P;ENSP00000318665:L21P	ENSP00000318665:L21P	L	+	2	0	TPD52L3	6318657	0.000000	0.05858	0.000000	0.03702	0.071000	0.16799	-0.248000	0.08854	0.033000	0.15463	-0.385000	0.06624	CTG	.	.	.	none		0.498	TPD52L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051658.1	NM_033516	
ZNF503	84858	hgsc.bcm.edu	37	10	77161118	77161118	+	Silent	SNP	G	G	T	rs540164655	byFrequency	TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr10:77161118G>T	ENST00000372524.4	-	1	546	c.60C>A	c.(58-60)ggC>ggA	p.G20G	ZNF503-AS2_ENST00000425916.3_RNA|RP11-399K21.11_ENST00000418818.2_lincRNA|ZNF503_ENST00000535216.1_Silent_p.G20G|ZNF503-AS2_ENST00000466942.2_RNA|ZNF503-AS2_ENST00000486015.1_RNA	NM_032772.4	NP_116161.2	Q96F45	ZN503_HUMAN	zinc finger protein 503	20	Gly-rich.				G1 to G0 transition involved in cell differentiation (GO:0070315)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|neural precursor cell proliferation (GO:0061351)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			lung(4)|ovary(1)|skin(1)	6	all_cancers(46;0.105)|all_epithelial(25;0.00449)|Prostate(51;0.0112)|Ovarian(15;0.088)					cgcctccgccgccgccgccgc	0.736													G|||	57	0.0113818	0.003	0.0202	5008	,	,		9151	0.0		0.0338	False		,,,				2504	0.0051				p.G20G		Atlas-SNP	.											.	ZNF503	25	.	0			c.C60A						PASS	.						1.0	2.0	2.0					10																	77161118		1017	2414	3431	SO:0001819	synonymous_variant	84858	exon1			TCCGCCGCCGCCG	AK127647	CCDS7350.1	10q22.3	2011-02-09			ENSG00000165655	ENSG00000165655		"""Zinc fingers, C2H2-type"""	23589	protein-coding gene	gene with protein product		613902				12477932	Standard	NM_032772		Approved	FLJ45745, MGC2555	uc001jxg.3	Q96F45	OTTHUMG00000018526	ENST00000372524.4:c.60C>A	chr10.hg19:g.77161118G>T		36.0	0.0	.		27.0	6.0	.	NM_032772	Q8NAC5|Q96E25|Q96IJ0	Silent	SNP	ENST00000372524.4	hg19	CCDS7350.1																																																																																			.	.	.	none		0.736	ZNF503-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048826.1	NM_032772	
ZNF503	84858	hgsc.bcm.edu	37	10	77161124	77161124	+	Silent	SNP	G	G	T	rs576950953	byFrequency	TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr10:77161124G>T	ENST00000372524.4	-	1	540	c.54C>A	c.(52-54)ggC>ggA	p.G18G	ZNF503-AS2_ENST00000425916.3_RNA|RP11-399K21.11_ENST00000418818.2_lincRNA|ZNF503_ENST00000535216.1_Silent_p.G18G|ZNF503-AS2_ENST00000466942.2_RNA|ZNF503-AS2_ENST00000486015.1_RNA	NM_032772.4	NP_116161.2	Q96F45	ZN503_HUMAN	zinc finger protein 503	18	Gly-rich.				G1 to G0 transition involved in cell differentiation (GO:0070315)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|neural precursor cell proliferation (GO:0061351)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			lung(4)|ovary(1)|skin(1)	6	all_cancers(46;0.105)|all_epithelial(25;0.00449)|Prostate(51;0.0112)|Ovarian(15;0.088)					cgccgccgccgccgccgcTGT	0.741													G|||	56	0.0111821	0.003	0.0202	5008	,	,		9831	0.0		0.0328	False		,,,				2504	0.0051				p.G18G		Atlas-SNP	.											.	ZNF503	25	.	0			c.C54A						PASS	.						1.0	2.0	2.0					10																	77161124		963	2340	3303	SO:0001819	synonymous_variant	84858	exon1			GCCGCCGCCGCCG	AK127647	CCDS7350.1	10q22.3	2011-02-09			ENSG00000165655	ENSG00000165655		"""Zinc fingers, C2H2-type"""	23589	protein-coding gene	gene with protein product		613902				12477932	Standard	NM_032772		Approved	FLJ45745, MGC2555	uc001jxg.3	Q96F45	OTTHUMG00000018526	ENST00000372524.4:c.54C>A	chr10.hg19:g.77161124G>T		34.0	0.0	.		24.0	6.0	.	NM_032772	Q8NAC5|Q96E25|Q96IJ0	Silent	SNP	ENST00000372524.4	hg19	CCDS7350.1																																																																																			.	.	.	none		0.741	ZNF503-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048826.1	NM_032772	
MUC5B	727897	hgsc.bcm.edu	37	11	1248326	1248326	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr11:1248326G>C	ENST00000529681.1	+	5	585	c.527G>C	c.(526-528)aGc>aCc	p.S176T	MUC5B_ENST00000447027.1_Missense_Mutation_p.S176T	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	176	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ATCAAGGTCAGCATCCGGCTG	0.667																																					p.S176T		Atlas-SNP	.											.	MUC5B	473	.	0			c.G527C						PASS	.						32.0	38.0	36.0					11																	1248326		2027	4156	6183	SO:0001583	missense	727897	exon5			AGGTCAGCATCCG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.527G>C	chr11.hg19:g.1248326G>C	ENSP00000436812:p.Ser176Thr	164.0	0.0	.		125.0	15.0	.	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	hg19	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	G	2.178	-0.388258	0.04932	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.58940	0.3;0.3	3.73	-4.11	0.03928	von Willebrand factor, type D domain (3);	.	.	.	.	T	0.33059	0.0850	N	0.16743	0.435	0.09310	N	1	B;B;B	0.21905	0.001;0.062;0.062	B;B;B	0.23716	0.003;0.048;0.048	T	0.30621	-0.9972	9	0.87932	D	0	.	1.502	0.02478	0.2543:0.2611:0.3281:0.1565	.	176;832;176	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	T	176;176;176;209	ENSP00000436812:S176T;ENSP00000415793:S176T	ENSP00000343037:S176T	S	+	2	0	MUC5B	1204902	0.000000	0.05858	0.001000	0.08648	0.059000	0.15707	-0.700000	0.05081	-0.380000	0.07894	0.455000	0.32223	AGC	.	.	.	none		0.667	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
UBQLN3	50613	hgsc.bcm.edu	37	11	5530266	5530266	+	Missense_Mutation	SNP	G	G	T			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr11:5530266G>T	ENST00000311659.4	-	2	670	c.523C>A	c.(523-525)Ccc>Acc	p.P175T	HBG2_ENST00000380259.2_Intron	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	175										NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGATGAAGGGGTCATCAATG	0.572																																					p.P175T	Ovarian(72;684 1260 12332 41642 52180)	Atlas-SNP	.											.	UBQLN3	107	.	0			c.C523A						PASS	.						70.0	68.0	68.0					11																	5530266		2201	4297	6498	SO:0001583	missense	50613	exon2			TGAAGGGGTCATC	AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.523C>A	chr11.hg19:g.5530266G>T	ENSP00000347997:p.Pro175Thr	120.0	0.0	.		120.0	16.0	.	NM_017481	Q9NRE0	Missense_Mutation	SNP	ENST00000311659.4	hg19	CCDS7758.1	.	.	.	.	.	.	.	.	.	.	G	17.80	3.477515	0.63849	.	.	ENSG00000175520	ENST00000311659;ENST00000445998	T;T	0.64618	0.34;-0.11	5.55	4.64	0.57946	.	0.298944	0.24215	N	0.040491	D	0.82935	0.5145	M	0.93638	3.44	0.58432	D	0.99999	D	0.58268	0.982	D	0.65010	0.931	D	0.87659	0.2533	10	0.87932	D	0	-9.5212	14.6678	0.68921	0.0:0.1462:0.8538:0.0	.	175	Q9H347	UBQL3_HUMAN	T	175	ENSP00000347997:P175T;ENSP00000412561:P175T	ENSP00000347997:P175T	P	-	1	0	UBQLN3	5486842	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	1.901000	0.39838	1.479000	0.48272	0.585000	0.79938	CCC	.	.	.	none		0.572	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143348.1	NM_017481	
ATXN2	6311	hgsc.bcm.edu	37	12	111991980	111991980	+	Missense_Mutation	SNP	A	A	T			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr12:111991980A>T	ENST00000377617.3	-	3	971	c.810T>A	c.(808-810)caT>caA	p.H270Q	ATXN2_ENST00000535949.1_Missense_Mutation_p.H5Q|ATXN2_ENST00000549455.1_Intron|ATXN2_ENST00000608853.1_Missense_Mutation_p.H110Q|ATXN2_ENST00000389153.4_Missense_Mutation_p.H5Q|ATXN2_ENST00000542287.2_Missense_Mutation_p.H5Q|ATXN2_ENST00000550104.1_Missense_Mutation_p.H270Q	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	270					cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						ATGTAAGTATATGAACCATCC	0.284																																					p.H270Q		Atlas-SNP	.											.	ATXN2	99	.	0			c.T810A						PASS	.						48.0	44.0	45.0					12																	111991980		2190	4281	6471	SO:0001583	missense	6311	exon3			AAGTATATGAACC	U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.810T>A	chr12.hg19:g.111991980A>T	ENSP00000366843:p.His270Gln	56.0	0.0	.		40.0	7.0	.	NM_002973	A6NLD4|Q6ZQZ7|Q99493	Missense_Mutation	SNP	ENST00000377617.3	hg19	CCDS31902.1	.	.	.	.	.	.	.	.	.	.	A	15.02	2.708827	0.48517	.	.	ENSG00000204842	ENST00000389153;ENST00000377617;ENST00000550104;ENST00000542287;ENST00000535949	T;T;T;T	0.40476	1.03;1.03;1.03;1.03	5.34	4.19	0.49359	Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.000000	0.85682	D	0.000000	T	0.61800	0.2376	M	0.81802	2.56	0.58432	D	0.999998	D;D;D;D	0.76494	0.997;0.999;0.997;0.999	D;D;D;D	0.83275	0.995;0.996;0.995;0.994	T	0.62353	-0.6872	10	0.59425	D	0.04	-12.6924	7.364	0.26762	0.7784:0.0:0.2216:0.0	.	5;270;5;5	B3KT59;Q99700;Q24JQ7;F8VQP2	.;ATX2_HUMAN;.;.	Q	5;270;270;5;5	ENSP00000373805:H5Q;ENSP00000366843:H270Q;ENSP00000446576:H270Q;ENSP00000445583:H5Q	ENSP00000366843:H270Q	H	-	3	2	ATXN2	110476363	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	2.844000	0.48246	0.877000	0.35895	0.260000	0.18958	CAT	.	.	.	none		0.284	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973	
SBNO1	55206	hgsc.bcm.edu	37	12	123829975	123829975	+	Missense_Mutation	SNP	G	G	A			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr12:123829975G>A	ENST00000602398.1	-	4	507	c.380C>T	c.(379-381)aCt>aTt	p.T127I	SBNO1_ENST00000602750.1_Missense_Mutation_p.T126I|SBNO1_ENST00000420886.2_Missense_Mutation_p.T127I|SBNO1_ENST00000267176.4_Missense_Mutation_p.T126I			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	127					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		TGTGCTTGCAGTAGTCTGGAT	0.423																																					p.T127I		Atlas-SNP	.											.	SBNO1	138	.	0			c.C380T						PASS	.						287.0	243.0	258.0					12																	123829975		2203	4300	6503	SO:0001583	missense	55206	exon3			CTTGCAGTAGTCT	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.380C>T	chr12.hg19:g.123829975G>A	ENSP00000473665:p.Thr127Ile	202.0	0.0	.		236.0	29.0	.	NM_001167856	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	ENST00000602398.1	hg19	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	G	14.65	2.599804	0.46318	.	.	ENSG00000139697	ENST00000420886;ENST00000267176;ENST00000442601	T;T	0.30981	1.52;1.51	5.74	4.83	0.62350	.	0.337294	0.31721	N	0.007176	T	0.16599	0.0399	N	0.08118	0	0.26828	N	0.968658	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.10222	-1.0639	10	0.38643	T	0.18	-21.286	12.2817	0.54767	0.0:0.3068:0.6932:0.0	.	127;126;125	A3KN83;A3KN83-2;A3KN83-3	SBNO1_HUMAN;.;.	I	127;126;126	ENSP00000387361:T127I;ENSP00000267176:T126I	ENSP00000267176:T126I	T	-	2	0	SBNO1	122395928	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	1.471000	0.35365	2.715000	0.92844	0.655000	0.94253	ACT	.	.	.	none		0.423	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183	
NBEA	26960	hgsc.bcm.edu	37	13	35738623	35738623	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr13:35738623C>A	ENST00000400445.3	+	24	4744	c.4210C>A	c.(4210-4212)Ctc>Atc	p.L1404I	NBEA_ENST00000379939.2_Missense_Mutation_p.L1404I|NBEA_ENST00000540320.1_Missense_Mutation_p.L1404I|NBEA_ENST00000310336.4_Missense_Mutation_p.L1404I	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1404					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TTTACCTTTGCTCTCTGCTGC	0.353																																					p.L1404I		Atlas-SNP	.											.	NBEA	340	.	0			c.C4210A						PASS	.						154.0	143.0	147.0					13																	35738623		1929	4159	6088	SO:0001583	missense	26960	exon24			CCTTTGCTCTCTG	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.4210C>A	chr13.hg19:g.35738623C>A	ENSP00000383295:p.Leu1404Ile	113.0	0.0	.		113.0	10.0	.	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	hg19	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.624892	0.66901	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518	T;T;T;T	0.71461	-0.56;-0.57;-0.57;-0.56	5.51	4.65	0.58169	.	0.000000	0.64402	D	0.000001	T	0.81418	0.4818	M	0.77616	2.38	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.79108	0.991;0.992	T	0.81686	-0.0820	10	0.56958	D	0.05	.	8.7366	0.34532	0.0:0.7864:0.0:0.2136	.	1404;1404	Q8NFP9;Q5T321	NBEA_HUMAN;.	I	1404;1404;1404;1404;66	ENSP00000440951:L1404I;ENSP00000383295:L1404I;ENSP00000369271:L1404I;ENSP00000308534:L1404I	ENSP00000308534:L1404I	L	+	1	0	NBEA	34636623	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.389000	0.44407	2.734000	0.93682	0.650000	0.86243	CTC	.	.	.	none		0.353	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
MYH6	4624	hgsc.bcm.edu	37	14	23866283	23866283	+	Missense_Mutation	SNP	A	A	G			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr14:23866283A>G	ENST00000356287.3	-	17	2086	c.2057T>C	c.(2056-2058)aTg>aCg	p.M686T	MYH6_ENST00000405093.3_Missense_Mutation_p.M686T			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	686	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GGGGTTGTCCATCACCCCTGT	0.612																																					p.M686T		Atlas-SNP	.											.	MYH6	274	.	0			c.T2057C						PASS	.						61.0	61.0	61.0					14																	23866283		2203	4300	6503	SO:0001583	missense	4624	exon18			TTGTCCATCACCC	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.2057T>C	chr14.hg19:g.23866283A>G	ENSP00000348634:p.Met686Thr	79.0	0.0	.		69.0	9.0	.	NM_002471	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	hg19	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	.	18.14	3.557260	0.65425	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	T;T	0.71817	-0.6;-0.6	4.14	4.14	0.48551	Myosin head, motor domain (2);	.	.	.	.	D	0.86653	0.5984	M	0.93462	3.42	0.58432	D	0.999993	B	0.25007	0.116	P	0.49683	0.619	D	0.88270	0.2929	9	0.87932	D	0	.	13.6054	0.62044	1.0:0.0:0.0:0.0	.	686	P13533	MYH6_HUMAN	T	686	ENSP00000386041:M686T;ENSP00000348634:M686T	ENSP00000348634:M686T	M	-	2	0	MYH6	22936123	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	8.603000	0.90871	1.872000	0.54250	0.528000	0.53228	ATG	.	.	.	none		0.612	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
ATG2B	55102	hgsc.bcm.edu	37	14	96788562	96788562	+	Missense_Mutation	SNP	C	C	G			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr14:96788562C>G	ENST00000359933.4	-	18	3659	c.2766G>C	c.(2764-2766)atG>atC	p.M922I	snoU13_ENST00000458931.1_RNA	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	922					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)		p.M922I(1)		breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		GAAATTCTGTCATTTCTACAG	0.348																																					p.M922I		Atlas-SNP	.											ATG2B,NS,carcinoma,0,1	ATG2B	169	.	1	Substitution - Missense(1)	cervix(1)	c.G2766C						PASS	.						118.0	113.0	114.0					14																	96788562		1840	4087	5927	SO:0001583	missense	55102	exon18			TTCTGTCATTTCT	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.2766G>C	chr14.hg19:g.96788562C>G	ENSP00000353010:p.Met922Ile	117.0	0.0	.		138.0	21.0	.	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	hg19	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	C	31	5.076068	0.94000	.	.	ENSG00000066739	ENST00000359933	T	0.48522	0.81	5.98	5.98	0.97165	.	0.000000	0.85682	U	0.000000	T	0.68284	0.2984	M	0.69823	2.125	0.80722	D	1	D	0.54964	0.969	D	0.63381	0.914	T	0.64993	-0.6276	10	0.45353	T	0.12	.	20.4434	0.99119	0.0:1.0:0.0:0.0	.	922	Q96BY7	ATG2B_HUMAN	I	922	ENSP00000353010:M922I	ENSP00000353010:M922I	M	-	3	0	ATG2B	95858315	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.601000	0.82783	2.838000	0.97847	0.655000	0.94253	ATG	.	.	.	none		0.348	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
ZNF469	84627	hgsc.bcm.edu	37	16	88501405	88501405	+	Silent	SNP	C	C	T			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr16:88501405C>T	ENST00000437464.1	+	2	7443	c.7443C>T	c.(7441-7443)gcC>gcT	p.A2481A	ZNF469_ENST00000565624.1_Silent_p.A2509A	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2481					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						GCCCAGCGGCCTTGCCTGCTC	0.682																																					p.A2481A		Atlas-SNP	.											.	ZNF469	121	.	0			c.C7443T						PASS	.						15.0	18.0	17.0					16																	88501405		690	1587	2277	SO:0001819	synonymous_variant	84627	exon2			AGCGGCCTTGCCT	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.7443C>T	chr16.hg19:g.88501405C>T		100.0	0.0	.		106.0	13.0	.	NM_001127464		Silent	SNP	ENST00000437464.1	hg19	CCDS45544.1																																																																																			.	.	.	none		0.682	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
ZNF469	84627	hgsc.bcm.edu	37	16	88501409	88501409	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr16:88501409C>A	ENST00000437464.1	+	2	7447	c.7447C>A	c.(7447-7449)Cct>Act	p.P2483T	ZNF469_ENST00000565624.1_Missense_Mutation_p.P2511T	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2483					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						AGCGGCCTTGCCTGCTCAGCA	0.692																																					p.P2483T		Atlas-SNP	.											.	ZNF469	121	.	0			c.C7447A						PASS	.						15.0	19.0	18.0					16																	88501409		690	1587	2277	SO:0001583	missense	84627	exon2			GCCTTGCCTGCTC	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.7447C>A	chr16.hg19:g.88501409C>A	ENSP00000402343:p.Pro2483Thr	108.0	0.0	.		106.0	13.0	.	NM_001127464		Missense_Mutation	SNP	ENST00000437464.1	hg19	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	C	10.48	1.360673	0.24598	.	.	ENSG00000225614	ENST00000437464	T	0.43294	0.95	3.4	0.838	0.18902	.	.	.	.	.	T	0.19886	0.0478	N	0.19112	0.55	0.09310	N	1	P	0.39480	0.675	B	0.30943	0.122	T	0.16958	-1.0385	9	0.72032	D	0.01	.	2.1652	0.03835	0.0:0.3445:0.3454:0.31	.	2483	Q96JG9	ZN469_HUMAN	T	2483	ENSP00000402343:P2483T	ENSP00000402343:P2483T	P	+	1	0	ZNF469	87028910	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.079000	0.14782	0.385000	0.24970	0.313000	0.20887	CCT	.	.	.	none		0.692	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
MED1	5469	hgsc.bcm.edu	37	17	37565772	37565772	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr17:37565772T>C	ENST00000300651.6	-	17	2925	c.2702A>G	c.(2701-2703)cAg>cGg	p.Q901R	MED1_ENST00000394287.3_Intron	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		ATTTAGTGCCTGAGATGCAAA	0.408										HNSCC(31;0.082)																											p.Q901R	Pancreas(21;279 768 2492 4877 24026)	Atlas-SNP	.											.	MED1	123	.	0			c.A2702G						PASS	.						134.0	134.0	134.0					17																	37565772		2203	4300	6503	SO:0001583	missense	5469	exon17			AGTGCCTGAGATG	L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.2702A>G	chr17.hg19:g.37565772T>C	ENSP00000300651:p.Gln901Arg	143.0	0.0	.		136.0	14.0	.	NM_004774	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000300651.6	hg19	CCDS11336.1	.	.	.	.	.	.	.	.	.	.	T	11.69	1.713193	0.30413	.	.	ENSG00000125686	ENST00000300651	T	0.36157	1.27	5.65	5.65	0.86999	.	.	.	.	.	T	0.23054	0.0557	N	0.14661	0.345	0.45806	D	0.99868	B	0.22346	0.068	B	0.15870	0.014	T	0.05053	-1.0909	9	0.49607	T	0.09	-6.8306	11.9583	0.52995	0.0:0.0:0.1446:0.8554	.	901	Q15648	MED1_HUMAN	R	901	ENSP00000300651:Q901R	ENSP00000300651:Q901R	Q	-	2	0	MED1	34819298	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.342000	0.52159	2.371000	0.80710	0.533000	0.62120	CAG	.	.	.	none		0.408	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256943.3	NM_004774	
KANSL1	284058	hgsc.bcm.edu	37	17	44248467	44248467	+	Missense_Mutation	SNP	C	C	A			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr17:44248467C>A	ENST00000262419.6	-	2	1513	c.1043G>T	c.(1042-1044)cGa>cTa	p.R348L	KANSL1_ENST00000432791.1_Missense_Mutation_p.R348L|KANSL1_ENST00000393476.3_5'UTR|KANSL1_ENST00000572904.1_Missense_Mutation_p.R348L|KANSL1_ENST00000574590.1_Missense_Mutation_p.R348L|KANSL1_ENST00000575318.1_Missense_Mutation_p.R348L|KANSL1_ENST00000576248.1_5'UTR	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	348					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											TTCAGCCTTTCGAGTCAGCAT	0.458																																					p.R348L		Atlas-SNP	.											.	.	.	.	0			c.G1043T						PASS	.						68.0	87.0	80.0					17																	44248467		2203	4300	6503	SO:0001583	missense	284058	exon2			GCCTTTCGAGTCA	BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.1043G>T	chr17.hg19:g.44248467C>A	ENSP00000262419:p.Arg348Leu	42.0	0.0	.		60.0	9.0	.	NM_001193466	A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Missense_Mutation	SNP	ENST00000262419.6	hg19	CCDS11503.1	.	.	.	.	.	.	.	.	.	.	C	17.62	3.434922	0.62955	.	.	ENSG00000120071	ENST00000262419;ENST00000432791	T;T	0.11495	2.77;2.77	5.94	5.94	0.96194	.	0.279693	0.33753	N	0.004596	T	0.22044	0.0531	L	0.27053	0.805	0.80722	D	1	P;D	0.57571	0.761;0.98	B;D	0.63877	0.151;0.919	T	0.00327	-1.1814	10	0.56958	D	0.05	-4.6431	18.9413	0.92607	0.0:1.0:0.0:0.0	.	348;348	C9JHY2;Q7Z3B3	.;K1267_HUMAN	L	348	ENSP00000262419:R348L;ENSP00000387393:R348L	ENSP00000262419:R348L	R	-	2	0	KIAA1267	41604244	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.359000	0.66074	2.826000	0.97356	0.561000	0.74099	CGA	.	.	.	none		0.458	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440274.1	NM_015443	
IMPACT	55364	hgsc.bcm.edu	37	18	22020542	22020542	+	Silent	SNP	G	G	C			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr18:22020542G>C	ENST00000284202.4	+	6	591	c.450G>C	c.(448-450)tcG>tcC	p.S150S	RP11-178F10.1_ENST00000579049.1_RNA	NM_018439.3	NP_060909	Q9P2X3	IMPCT_HUMAN	impact RWD domain protein	150					negative regulation of protein phosphorylation (GO:0001933)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(2)	16	all_cancers(21;0.00018)|all_epithelial(16;1.5e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)					CGGAAAGTTCGCTTAAAGCAT	0.363																																					p.S150S		Atlas-SNP	.											.	IMPACT	37	.	0			c.G450C						PASS	.						160.0	151.0	154.0					18																	22020542		2203	4300	6503	SO:0001819	synonymous_variant	55364	exon6			AAGTTCGCTTAAA	AB026264	CCDS11886.1	18q11.2-q12.1	2012-12-07	2012-12-07		ENSG00000154059	ENSG00000154059			20387	protein-coding gene	gene with protein product	"""RWD domain containing 5"""	615319	"""Impact homolog (mouse)"""			11116084	Standard	NM_018439		Approved	RWDD5	uc002kvh.4	Q9P2X3	OTTHUMG00000131943	ENST00000284202.4:c.450G>C	chr18.hg19:g.22020542G>C		133.0	0.0	.		130.0	16.0	.	NM_018439	A8MXG0|Q49AM0|Q9H2X4	Silent	SNP	ENST00000284202.4	hg19	CCDS11886.1																																																																																			.	.	.	none		0.363	IMPACT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254901.1	NM_018439	
DYM	54808	hgsc.bcm.edu	37	18	46889546	46889546	+	Missense_Mutation	SNP	G	G	C			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr18:46889546G>C	ENST00000269445.6	-	6	936	c.479C>G	c.(478-480)aCt>aGt	p.T160S	DYM_ENST00000442713.2_Intron|DYM_ENST00000578396.1_Missense_Mutation_p.T5S	NM_017653.3	NP_060123.3	Q7RTS9	DYM_HUMAN	dymeclin	160					bone development (GO:0060348)|Golgi organization (GO:0007030)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	enzyme binding (GO:0019899)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	18						TGGAATATCAGTGATCAACTG	0.363																																					p.T160S		Atlas-SNP	.											.	DYM	52	.	0			c.C479G						PASS	.						110.0	107.0	108.0					18																	46889546		2203	4300	6503	SO:0001583	missense	54808	exon6			ATATCAGTGATCA	AK000078	CCDS11937.1	18q21.1	2008-03-12			ENSG00000141627	ENSG00000141627			21317	protein-coding gene	gene with protein product		607461					Standard	NM_017653		Approved	FLJ20071, DMC, SMC	uc002ldi.1	Q7RTS9	OTTHUMG00000132659	ENST00000269445.6:c.479C>G	chr18.hg19:g.46889546G>C	ENSP00000269445:p.Thr160Ser	287.0	0.0	.		219.0	37.0	.	NM_017653	A8K5I8|B2RCF9|B4DKI7|Q3ZTS8|Q6P2P5|Q8N2M0|Q9BVE9|Q9NPU7	Missense_Mutation	SNP	ENST00000269445.6	hg19	CCDS11937.1	.	.	.	.	.	.	.	.	.	.	G	12.00	1.806018	0.31961	.	.	ENSG00000141627	ENST00000269445	D	0.82711	-1.64	5.52	4.53	0.55603	.	0.114501	0.64402	D	0.000019	T	0.67335	0.2882	N	0.17082	0.46	0.26816	N	0.968889	B	0.10296	0.003	B	0.08055	0.003	T	0.55042	-0.8202	10	0.45353	T	0.12	-16.7362	6.2807	0.21005	0.1559:0.0:0.8441:0.0	.	160	Q7RTS9	DYM_HUMAN	S	160	ENSP00000269445:T160S	ENSP00000269445:T160S	T	-	2	0	DYM	45143544	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.136000	0.50554	2.590000	0.87494	0.650000	0.86243	ACT	.	.	.	none		0.363	DYM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255912.3	NM_017653	
STAP2	55620	hgsc.bcm.edu	37	19	4332020	4332020	+	Splice_Site	SNP	T	T	G	rs74464159		TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr19:4332020T>G	ENST00000594605.1	-	4	476	c.353A>C	c.(352-354)gAg>gCg	p.E118A	STAP2_ENST00000600324.1_Splice_Site_p.E118A	NM_001013841.1	NP_001013863.1	Q9UGK3	STAP2_HUMAN	signal transducing adaptor family member 2	118	PH.					cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		TACTCTTACCTCCACCACCGT	0.463																																					p.E118A		Atlas-SNP	.											.	STAP2	38	.	0			c.A353C						PASS	.						118.0	99.0	106.0					19																	4332020		2203	4300	6503	SO:0001630	splice_region_variant	55620	exon4			CTTACCTCCACCA	AJ245719	CCDS12128.1, CCDS45926.1	19p13.3	2011-05-03	2007-08-09		ENSG00000178078	ENSG00000178078			30430	protein-coding gene	gene with protein product		607881				10980601, 11441184	Standard	XM_005259592		Approved	STAP-2, BKS	uc002mac.3	Q9UGK3		ENST00000594605.1:c.354+1A>C	chr19.hg19:g.4332020T>G		144.0	0.0	.		131.0	12.0	.	NM_001013841	A6NKK3|Q9NXI2	Missense_Mutation	SNP	ENST00000594605.1	hg19	CCDS45926.1	.	.	.	.	.	.	.	.	.	.	T	17.35	3.366418	0.61513	.	.	ENSG00000178078	ENST00000314714;ENST00000424810	.	.	.	4.06	4.06	0.47325	Pleckstrin homology domain (1);	0.235984	0.42053	D	0.000775	T	0.72961	0.3526	M	0.79475	2.455	0.35553	D	0.804074	D;D	0.76494	0.999;0.99	D;P	0.78314	0.991;0.768	T	0.81136	-0.1070	9	0.87932	D	0	-5.6986	9.6315	0.39782	0.0:0.0:0.0:1.0	.	118;118	Q9UGK3-2;Q9UGK3	.;STAP2_HUMAN	A	118	.	ENSP00000317912:E118A	E	-	2	0	STAP2	4283020	1.000000	0.71417	1.000000	0.80357	0.544000	0.35116	4.878000	0.63093	1.868000	0.54150	0.249000	0.18162	GAG	.	.	.	alt		0.463	STAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458114.2	NM_001013841	Missense_Mutation
TRIP10	9322	hgsc.bcm.edu	37	19	6744841	6744841	+	Missense_Mutation	SNP	T	T	C			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr19:6744841T>C	ENST00000313244.9	+	9	855	c.820T>C	c.(820-822)Tca>Cca	p.S274P	TRIP10_ENST00000596758.1_Missense_Mutation_p.S274P|TRIP10_ENST00000313285.8_Missense_Mutation_p.S274P|TRIP10_ENST00000600428.1_Missense_Mutation_p.S166P			Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10	274	F-BAR domain.				actin cytoskeleton organization (GO:0030036)|cell communication (GO:0007154)|endocytosis (GO:0006897)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	16						GCTGCACAAGTCAGGTTTTGC	0.632																																					p.S274P		Atlas-SNP	.											.	TRIP10	104	.	0			c.T820C						PASS	.						87.0	84.0	85.0					19																	6744841		2203	4300	6503	SO:0001583	missense	9322	exon9			CACAAGTCAGGTT	AB072596	CCDS12172.1, CCDS74271.1, CCDS74272.1	19p13.3	2008-02-05			ENSG00000125733	ENSG00000125733			12304	protein-coding gene	gene with protein product	"""Cdc42-interacting protein"""	604504	"""salt tolerator"""	STOT		7776974, 9210375, 11294612	Standard	XM_005259683		Approved	STP, HSTP, CIP4	uc002mfr.3	Q15642	OTTHUMG00000150255	ENST00000313244.9:c.820T>C	chr19.hg19:g.6744841T>C	ENSP00000320117:p.Ser274Pro	85.0	0.0	.		95.0	13.0	.	NM_004240	B2R8A6|B7WP22|D6W645|O15184|Q53G22|Q5TZN1|Q6FI24|Q8NFL1|Q8TCY1|Q8TDX3|Q96RJ1	Missense_Mutation	SNP	ENST00000313244.9	hg19		.	.	.	.	.	.	.	.	.	.	T	31	5.071840	0.93950	.	.	ENSG00000125733	ENST00000313285;ENST00000313244;ENST00000420690	T;T	0.45276	0.9;2.48	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.68183	0.2973	M	0.86502	2.82	0.80722	D	1	D;P;D	0.89917	1.0;0.939;0.998	D;P;D	0.85130	0.997;0.764;0.988	T	0.74636	-0.3599	10	0.87932	D	0	-11.9975	13.123	0.59338	0.0:0.0:0.0:1.0	.	274;274;274	G5E9U1;Q15642;Q15642-2	.;CIP4_HUMAN;.	P	274	ENSP00000320493:S274P;ENSP00000320117:S274P	ENSP00000320117:S274P	S	+	1	0	TRIP10	6695841	1.000000	0.71417	0.995000	0.50966	0.975000	0.68041	7.265000	0.78442	1.993000	0.58246	0.379000	0.24179	TCA	.	.	.	none		0.632	TRIP10-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000317129.2		
PRR12	57479	hgsc.bcm.edu	37	19	50119450	50119450	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr19:50119450C>T	ENST00000418929.2	+	9	5483	c.5471C>T	c.(5470-5472)tCc>tTc	p.S1824F		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	1003							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		GACTCGGAGTCCTCCCCTGGA	0.682																																					p.S1824F		Atlas-SNP	.											.	PRR12	157	.	0			c.C5471T						PASS	.						7.0	9.0	8.0					19																	50119450		1956	4080	6036	SO:0001583	missense	57479	exon9			CGGAGTCCTCCCC	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.5471C>T	chr19.hg19:g.50119450C>T	ENSP00000394510:p.Ser1824Phe	172.0	0.0	.		146.0	10.0	.	NM_020719	E9PB06|Q8N4J6	Missense_Mutation	SNP	ENST00000418929.2	hg19	CCDS46143.1	.	.	.	.	.	.	.	.	.	.	C	15.22	2.767465	0.49574	.	.	ENSG00000126464	ENST00000418929;ENST00000246798;ENST00000314734	T	0.47528	0.84	4.75	4.75	0.60458	.	0.000000	0.51477	D	0.000084	T	0.62527	0.2435	L	0.57536	1.79	0.58432	D	0.999999	D	0.76494	0.999	D	0.85130	0.997	T	0.55964	-0.8057	10	0.13470	T	0.59	-24.7453	16.648	0.85181	0.0:1.0:0.0:0.0	.	1824	Q9ULL5-3	.	F	1824;1004;1004	ENSP00000394510:S1824F	ENSP00000246798:S1004F	S	+	2	0	PRR12	54811262	1.000000	0.71417	0.972000	0.41901	0.580000	0.36256	5.691000	0.68249	2.471000	0.83476	0.491000	0.48974	TCC	.	.	.	none		0.682	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719	
NLRP11	204801	hgsc.bcm.edu	37	19	56297223	56297223	+	Missense_Mutation	SNP	C	C	T			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr19:56297223C>T	ENST00000589093.1	-	10	2963	c.2870G>A	c.(2869-2871)gGc>gAc	p.G957D	NLRP11_ENST00000592953.1_Missense_Mutation_p.G858D|NLRP11_ENST00000443188.1_Missense_Mutation_p.G957D|NLRP11_ENST00000360133.3_Missense_Mutation_p.G903D|NLRP11_ENST00000589824.2_Missense_Mutation_p.G903D			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	957							ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		TGTGTTCAGGCCAGTTAATGG	0.433																																					p.G957D		Atlas-SNP	.											.	NLRP11	139	.	0			c.G2870A						PASS	.						64.0	64.0	64.0					19																	56297223		2203	4300	6503	SO:0001583	missense	204801	exon12			TTCAGGCCAGTTA	AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.2870G>A	chr19.hg19:g.56297223C>T	ENSP00000466285:p.Gly957Asp	135.0	0.0	.		126.0	16.0	.	NM_145007	C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Missense_Mutation	SNP	ENST00000589093.1	hg19	CCDS12935.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.796267	0.00076	.	.	ENSG00000179873	ENST00000443188;ENST00000360133	T;T	0.51574	0.7;0.7	1.4	-2.74	0.05932	.	.	.	.	.	T	0.18923	0.0454	N	0.10874	0.06	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.23368	-1.0190	9	0.07990	T	0.79	.	3.0249	0.06087	0.0:0.3766:0.2572:0.3663	.	957;903	P59045;P59045-2	NAL11_HUMAN;.	D	957;903	ENSP00000409898:G957D;ENSP00000353251:G903D	ENSP00000353251:G903D	G	-	2	0	NLRP11	60989035	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.588000	0.02106	-0.970000	0.03569	-2.317000	0.00253	GGC	.	.	.	none		0.433	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1	NM_145007	
MYBL2	4605	hgsc.bcm.edu	37	20	42338684	42338684	+	Silent	SNP	C	C	T			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr20:42338684C>T	ENST00000217026.4	+	10	1714	c.1587C>T	c.(1585-1587)taC>taT	p.Y529Y	MYBL2_ENST00000396863.4_Silent_p.Y505Y	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	529					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			TGGAGAAGTACGGACCCCTGA	0.592																																					p.Y529Y		Atlas-SNP	.											.	MYBL2	82	.	0			c.C1587T						PASS	.						153.0	151.0	152.0					20																	42338684		2203	4300	6503	SO:0001819	synonymous_variant	4605	exon10			GAAGTACGGACCC		CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.1587C>T	chr20.hg19:g.42338684C>T		164.0	0.0	.		130.0	6.0	.	NM_002466	B2RBS5|B7Z8D9|F8W6N6|Q53F07	Silent	SNP	ENST00000217026.4	hg19	CCDS13322.1																																																																																			.	.	.	none		0.592	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080408.1	NM_002466	
PMEPA1	56937	hgsc.bcm.edu	37	20	56284608	56284608	+	Missense_Mutation	SNP	C	C	T	rs532526691		TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr20:56284608C>T	ENST00000341744.3	-	1	350	c.31G>A	c.(31-33)Gcc>Acc	p.A11T	PMEPA1_ENST00000265626.4_Intron|PMEPA1_ENST00000347215.4_Intron|PMEPA1_ENST00000472841.1_Intron|PMEPA1_ENST00000395816.3_Intron	NM_020182.4	NP_064567.2	Q969W9	PMEPA_HUMAN	prostate transmembrane protein, androgen induced 1	11					androgen receptor signaling pathway (GO:0030521)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	R-SMAD binding (GO:0070412)|WW domain binding (GO:0050699)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)	16						gcggcggcggcggTGCTGTTG	0.751													.|||	1	0.000199681	0.0	0.0	5008	,	,		3302	0.0		0.0	False		,,,				2504	0.001				p.A11T		Atlas-SNP	.											.	PMEPA1	29	.	0			c.G31A						PASS	.						21.0	18.0	19.0					20																	56284608		2097	4124	6221	SO:0001583	missense	56937	exon1			CGGCGGCGGTGCT	AF224278	CCDS13462.1, CCDS13463.1, CCDS13464.1	20q13.31-q13.33	2008-04-03	2008-04-03	2008-04-03	ENSG00000124225	ENSG00000124225			14107	protein-coding gene	gene with protein product	"""solid tumor-associated 1"""	606564	"""transmembrane, prostate androgen induced RNA"""	TMEPAI		10873380	Standard	NM_020182		Approved	STAG1	uc002xyq.4	Q969W9	OTTHUMG00000032831	ENST00000341744.3:c.31G>A	chr20.hg19:g.56284608C>T	ENSP00000345826:p.Ala11Thr	140.0	0.0	.		124.0	6.0	.	NM_020182	Q5TDR6|Q8NER4|Q96B72|Q9UJD3	Missense_Mutation	SNP	ENST00000341744.3	hg19	CCDS13463.1	.	.	.	.	.	.	.	.	.	.	C	15.12	2.739763	0.49045	.	.	ENSG00000124225	ENST00000341744;ENST00000395819	T;T	0.54279	0.84;0.58	2.87	2.87	0.33458	.	.	.	.	.	T	0.27900	0.0687	N	0.08118	0	0.80722	D	1	B	0.24576	0.106	B	0.11329	0.006	T	0.05971	-1.0853	9	0.14656	T	0.56	-6.3608	11.1595	0.48507	0.0:1.0:0.0:0.0	.	11	Q969W9	PMEPA_HUMAN	T	11	ENSP00000345826:A11T;ENSP00000379164:A11T	ENSP00000345826:A11T	A	-	1	0	PMEPA1	55718014	0.998000	0.40836	0.975000	0.42487	0.817000	0.46193	1.549000	0.36212	1.142000	0.42291	0.163000	0.16589	GCC	.	.	.	none		0.751	PMEPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079858.2	NM_020182	
SHROOM3	57619	hgsc.bcm.edu	37	4	77661777	77661777	+	Frame_Shift_Del	DEL	T	T	-			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr4:77661777delT	ENST00000296043.6	+	5	3404	c.2451delT	c.(2449-2451)actfs	p.T817fs		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	817					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CCGTCTCAACTTCCAGTACTT	0.537																																					p.T817fs		Atlas-Indel,Pindel	.											.	SHROOM3	134	.	0			c.2450delC						PASS	.						67.0	76.0	73.0					4																	77661777		2203	4300	6503	SO:0001589	frameshift_variant	57619	exon5			.	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2451delT	chr4.hg19:g.77661777delT	ENSP00000296043:p.Thr817fs	130.0	0.0	0		141.0	15.0	0.106383	NM_020859	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Frame_Shift_Del	DEL	ENST00000296043.6	hg19	CCDS3579.2																																																																																			.	.	.	none		0.537	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
TMF1	7110	hgsc.bcm.edu	37	3	69097304	69097307	+	Frame_Shift_Del	DEL	TTCT	TTCT	-			TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	TTCT	TTCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr3:69097304_69097307delTTCT	ENST00000398559.2	-	2	765_768	c.549_552delAGAA	c.(547-552)aaagaafs	p.KE183fs	CTD-2013N24.2_ENST00000596274.1_RNA|CTD-2013N24.2_ENST00000482368.2_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|CTD-2013N24.2_ENST00000596523.1_RNA|CTD-2013N24.2_ENST00000597950.1_RNA|CTD-2013N24.2_ENST00000595925.1_RNA|TMF1_ENST00000543976.1_Frame_Shift_Del_p.KE183fs|CTD-2013N24.2_ENST00000598783.1_RNA|CTD-2013N24.2_ENST00000596732.1_RNA|MIR3136_ENST00000583498.1_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	183					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		TCATATCCGATTCTTTATTAACAG	0.382																																					p.184_185del		Atlas-Indel,Pindel	.											.	TMF1	77	.	0			c.550_553del						PASS	.																																			SO:0001589	frameshift_variant	7110	exon2			.		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.549_552delAGAA	chr3.hg19:g.69097304_69097307delTTCT	ENSP00000381567:p.Lys183fs	188.0	0.0	0		165.0	19.0	0.115152	NM_007114	B7ZLJ2|Q17R87|Q59GK0	Frame_Shift_Del	DEL	ENST00000398559.2	hg19	CCDS43105.1																																																																																			.	.	.	none		0.382	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	NM_007114	
HIST1H1B	3009	hgsc.bcm.edu	37	6	27834657	27834701	+	In_Frame_Del	DEL	CTTTGCAGCTTTAGGTTTTGCTGCTTTGGGCTTAGCGGCTTTGGG	CTTTGCAGCTTTAGGTTTTGCTGCTTTGGGCTTAGCGGCTTTGGG	-	rs370043286|rs34144478|rs201436001|rs557184683|rs535793643|rs200074459|rs373472194	byFrequency	TCGA-Y8-A8S1-01A-11D-A36X-10	TCGA-Y8-A8S1-10A-01D-A370-10	CTTTGCAGCTTTAGGTTTTGCTGCTTTGGGCTTAGCGGCTTTGGG	CTTTGCAGCTTTAGGTTTTGCTGCTTTGGGCTTAGCGGCTTTGGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5c980b27-02f4-4e7d-bc5f-59809f2cbfd0	99aa2435-d52d-45ef-a896-64a90cac0ad3	g.chr6:27834657_27834701delCTTTGCAGCTTTAGGTTTTGCTGCTTTGGGCTTAGCGGCTTTGGG	ENST00000331442.3	-	1	658_702	c.607_651delCCCAAAGCCGCTAAGCCCAAAGCAGCAAAACCTAAAGCTGCAAAG	c.(607-651)cccaaagccgctaagcccaaagcagcaaaacctaaagctgcaaagdel	p.PKAAKPKAAKPKAAK203del		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	203					chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)	p.K212K(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						CCTTCTTGGCCTTTGCAGCTTTAGGTTTTGCTGCTTTGGGCTTAGCGGCTTTGGGCTTTGCCGCC	0.547																																					p.203_218del		Pindel	.											.	HIST1H1B	54	.	1	Substitution - coding silent(1)	large_intestine(1)	c.608_652del						PASS	.																																			SO:0001651	inframe_deletion	3009	exon1			.	AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.607_651delCCCAAAGCCGCTAAGCCCAAAGCAGCAAAACCTAAAGCTGCAAAG	chr6.hg19:g.27834657_27834701delCTTTGCAGCTTTAGGTTTTGCTGCTTTGGGCTTAGCGGCTTTGGG	ENSP00000330074:p.Pro203_Lys217del	128.0	0.0	.		130.0	11.0	0.085	NM_005322	Q14529|Q3MJ42	In_Frame_Del	DEL	ENST00000331442.3	hg19	CCDS4635.1																																																																																			.	.	.	none		0.547	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043371.1	NM_005322	
