#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABHD10	55347	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	111710276	111710279	+	Frame_Shift_Del	DEL	CTGA	CTGA	-			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	CTGA	CTGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr3:111710276_111710279delCTGA	ENST00000273359.3	+	5	656_659	c.629_632delCTGA	c.(628-633)tctgaafs	p.SE210fs	ABHD10_ENST00000534857.1_Frame_Shift_Del_p.SE53fs|ABHD10_ENST00000494817.1_3'UTR	NM_018394.2	NP_060864.1	Q9NUJ1	ABHDA_HUMAN	abhydrolase domain containing 10	210					glucuronoside catabolic process (GO:0019391)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			large_intestine(2)|lung(7)|skin(1)	10						TCAAAATACTCTGAAGAAGGAGTT	0.368																																					p.210_211del		.											.	ABHD10	90	0			c.629_632del						.																																			SO:0001589	frameshift_variant	55347	exon5			AATACTCTGAAGA	AL713726	CCDS2963.1, CCDS63718.1	3q13.2	2012-03-26			ENSG00000144827	ENSG00000144827		"""Abhydrolase domain containing"""	25656	protein-coding gene	gene with protein product						22294686	Standard	NM_018394		Approved	FLJ11342	uc003dyk.5	Q9NUJ1	OTTHUMG00000159280	ENST00000273359.3:c.629_632delCTGA	3.37:g.111710276_111710279delCTGA	ENSP00000273359:p.Ser210fs	96.0	0.0		211.0	83.0	NM_018394	B7Z6A8|C9IZX5|D3DN63|Q8TCF9	Frame_Shift_Del	DEL	ENST00000273359.3	37	CCDS2963.1																																																																																			.		0.368	ABHD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354326.1	NM_018394	
ACTRT1	139741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	127185963	127185963	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chrX:127185963C>T	ENST00000371124.3	-	1	419	c.223G>A	c.(223-225)Gag>Aag	p.E75K		NM_138289.3	NP_612146.1	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	75						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	34						AGTCCACGCTCAATGGGGTAG	0.463																																					p.E75K		.											.	ACTRT1	133	0			c.G223A						.						165.0	153.0	157.0					X																	127185963		2203	4300	6503	SO:0001583	missense	139741	exon1			CACGCTCAATGGG	AF440739	CCDS14611.1	Xq25	2008-02-05	2005-11-22		ENSG00000123165	ENSG00000123165			24027	protein-coding gene	gene with protein product		300487				12243744	Standard	NM_138289		Approved	AIP1, KIAA0705, ARIP1, Arp-T1	uc004eum.3	Q8TDG2	OTTHUMG00000022359	ENST00000371124.3:c.223G>A	X.37:g.127185963C>T	ENSP00000360165:p.Glu75Lys	56.0	0.0		322.0	215.0	NM_138289	Q6X7C1|Q96L10	Missense_Mutation	SNP	ENST00000371124.3	37	CCDS14611.1	.	.	.	.	.	.	.	.	.	.	C	8.882	0.951787	0.18431	.	.	ENSG00000123165	ENST00000371124	D	0.97328	-4.34	3.76	1.98	0.26296	.	0.090484	0.45867	D	0.000339	D	0.95290	0.8472	L	0.48362	1.52	0.34742	D	0.73087	P	0.41366	0.747	P	0.48334	0.574	D	0.94629	0.7820	10	0.87932	D	0	.	6.4851	0.22085	0.0:0.7073:0.1816:0.111	.	75	Q8TDG2	ACTT1_HUMAN	K	75	ENSP00000360165:E75K	ENSP00000360165:E75K	E	-	1	0	ACTRT1	127013644	1.000000	0.71417	0.003000	0.11579	0.022000	0.10575	3.404000	0.52623	0.406000	0.25560	-1.268000	0.01426	GAG	.		0.463	ACTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058192.1	NM_138289	
ADAM11	4185	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	42855379	42855379	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr17:42855379T>A	ENST00000200557.6	+	24	2299	c.2130T>A	c.(2128-2130)agT>agA	p.S710R	ADAM11_ENST00000535346.1_Missense_Mutation_p.S510R	NM_002390.4	NP_002381.2	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11	710					integrin-mediated signaling pathway (GO:0007229)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Prostate(33;0.0959)				AAGACTGCAGTATCCATAACC	0.617																																					p.S710R		.											.	ADAM11	227	0			c.T2130A						.						106.0	107.0	107.0					17																	42855379		2203	4300	6503	SO:0001583	missense	4185	exon24			CTGCAGTATCCAT	D17390	CCDS11486.1	17q21.3	2014-08-12	2005-08-18		ENSG00000073670			"""ADAM metallopeptidase domain containing"""	189	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, cysteine-rich protein"""	155120	"""a disintegrin and metalloproteinase domain 11"""	MDC		8252040	Standard	XM_005257373		Approved		uc002ihh.3	O75078	OTTHUMG00000179038	ENST00000200557.6:c.2130T>A	17.37:g.42855379T>A	ENSP00000200557:p.Ser710Arg	40.0	0.0		62.0	29.0	NM_002390	Q14808|Q14809|Q14810	Missense_Mutation	SNP	ENST00000200557.6	37	CCDS11486.1	.	.	.	.	.	.	.	.	.	.	T	18.63	3.665086	0.67700	.	.	ENSG00000073670	ENST00000200557;ENST00000535346	T;T	0.41758	3.14;0.99	4.3	-5.76	0.02376	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.102842	0.64402	D	0.000003	T	0.50086	0.1595	L	0.48986	1.54	0.58432	D	0.999999	D;D	0.71674	0.991;0.998	D;D	0.68353	0.924;0.957	T	0.56408	-0.7984	10	0.52906	T	0.07	.	14.7285	0.69362	0.0:0.1995:0.0:0.8005	.	510;710	B4DKD2;O75078	.;ADA11_HUMAN	R	710;510	ENSP00000200557:S710R;ENSP00000443773:S510R	ENSP00000200557:S710R	S	+	3	2	ADAM11	40210905	0.000000	0.05858	0.931000	0.37212	0.987000	0.75469	-1.938000	0.01546	-1.060000	0.03189	-0.366000	0.07423	AGT	.		0.617	ADAM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444531.1	NM_002390	
ADAMTS8	11095	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	130297694	130297694	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr11:130297694C>T	ENST00000257359.6	-	1	1194	c.488G>A	c.(487-489)cGa>cAa	p.R163Q		NM_007037.4	NP_008968.4	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 8	163					negative regulation of cell proliferation (GO:0008285)|phosphate ion transmembrane transport (GO:0035435)	proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)|low-affinity phosphate transmembrane transporter activity (GO:0009673)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		CTCGGGTCCTCGCGGGAGGGG	0.716																																					p.R163Q		.											.	ADAMTS8	226	0			c.G488A						.						12.0	14.0	14.0					11																	130297694		1900	4071	5971	SO:0001583	missense	11095	exon1			GGTCCTCGCGGGA	AF060153	CCDS41732.1	11q25	2008-07-18	2005-08-19		ENSG00000134917	ENSG00000134917		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	224	protein-coding gene	gene with protein product		605175	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 8"""			10438512	Standard	NM_007037		Approved	METH2, FLJ41712, ADAM-TS8	uc001qgg.4	Q9UP79	OTTHUMG00000165656	ENST00000257359.6:c.488G>A	11.37:g.130297694C>T	ENSP00000257359:p.Arg163Gln	46.0	1.0		61.0	28.0	NM_007037	Q9NZS0	Missense_Mutation	SNP	ENST00000257359.6	37	CCDS41732.1	.	.	.	.	.	.	.	.	.	.	C	11.15	1.554423	0.27739	.	.	ENSG00000134917	ENST00000257359;ENST00000414575	T	0.59224	0.28	3.58	1.59	0.23543	.	.	.	.	.	T	0.28034	0.0691	N	0.08118	0	0.09310	N	1	B	0.21381	0.055	B	0.09377	0.004	T	0.19582	-1.0301	9	0.09590	T	0.72	.	4.2167	0.10539	0.0:0.6176:0.2403:0.1421	.	163	Q9UP79	ATS8_HUMAN	Q	163;192	ENSP00000257359:R163Q	ENSP00000257359:R163Q	R	-	2	0	ADAMTS8	129802904	0.948000	0.32251	0.001000	0.08648	0.780000	0.44128	0.746000	0.26275	0.190000	0.20209	0.455000	0.32223	CGA	.		0.716	ADAMTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385636.1	NM_007037	
ALDH18A1	5832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	97402774	97402774	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr10:97402774C>T	ENST00000371224.2	-	3	415	c.278G>A	c.(277-279)gGg>gAg	p.G93E	ALDH18A1_ENST00000483788.1_5'UTR|ALDH18A1_ENST00000371221.3_Missense_Mutation_p.G93E	NM_002860.3	NP_002851.2	P54886	P5CS_HUMAN	aldehyde dehydrogenase 18 family, member A1	93	Glutamate 5-kinase.				cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|glutamate metabolic process (GO:0006536)|L-proline biosynthetic process (GO:0055129)|ornithine biosynthetic process (GO:0006592)|proline biosynthetic process (GO:0006561)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glutamate 5-kinase activity (GO:0004349)|glutamate-5-semialdehyde dehydrogenase activity (GO:0004350)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(9)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)		TGCCAAGCGCCCCAGGGCCAG	0.507																																					p.G93E		.											.	ALDH18A1	117	0			c.G278A						.						74.0	57.0	63.0					10																	97402774		2203	4300	6503	SO:0001583	missense	5832	exon3			AAGCGCCCCAGGG	X94453	CCDS7443.1, CCDS31257.1	10q24.3-q24.6	2004-08-12	2004-08-12	2004-08-12	ENSG00000059573	ENSG00000059573		"""Aldehyde dehydrogenases"""	9722	protein-coding gene	gene with protein product		138250	"""pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase)"""	GSAS, PYCS		8921385	Standard	XM_006717933		Approved	P5CS	uc001kkz.3	P54886	OTTHUMG00000018815	ENST00000371224.2:c.278G>A	10.37:g.97402774C>T	ENSP00000360268:p.Gly93Glu	41.0	0.0		73.0	32.0	NM_001017423	B2R5Q4|B7Z350|B7Z5X8|B7ZLP1|D3DR44|O95952|Q3KQU2|Q5T566|Q5T567|Q9UM72	Missense_Mutation	SNP	ENST00000371224.2	37	CCDS7443.1	.	.	.	.	.	.	.	.	.	.	C	19.58	3.853867	0.71719	.	.	ENSG00000059573	ENST00000371224;ENST00000371221	T;T	0.70516	-0.49;-0.49	5.45	4.53	0.55603	Aspartate/glutamate/uridylate kinase (3);	0.049282	0.85682	D	0.000000	T	0.78181	0.4243	L	0.41027	1.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80600	-0.1310	10	0.87932	D	0	-17.4333	14.3078	0.66395	0.0:0.8501:0.1499:0.0	.	93;93	P54886;P54886-2	P5CS_HUMAN;.	E	93	ENSP00000360268:G93E;ENSP00000360265:G93E	ENSP00000360265:G93E	G	-	2	0	ALDH18A1	97392764	1.000000	0.71417	0.998000	0.56505	0.624000	0.37722	7.330000	0.79181	1.406000	0.46857	-0.176000	0.13171	GGG	.		0.507	ALDH18A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049552.1	NM_002860	
ALMS1	7840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	73717941	73717941	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr2:73717941G>C	ENST00000264448.6	+	10	8963	c.8852G>C	c.(8851-8853)gGt>gCt	p.G2951A	ALMS1_ENST00000409009.1_Missense_Mutation_p.G2909A|AC096546.1_ENST00000408160.1_RNA	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2951					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CTTCCTCAAGGTCAGGATTCT	0.418																																					p.G2951A		.											.	ALMS1	142	0			c.G8852C						.						164.0	152.0	156.0					2																	73717941		1883	4104	5987	SO:0001583	missense	7840	exon10			CTCAAGGTCAGGA	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.8852G>C	2.37:g.73717941G>C	ENSP00000264448:p.Gly2951Ala	62.0	0.0		86.0	33.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	37	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	g	3.883	-0.025554	0.07589	.	.	ENSG00000116127	ENST00000409009;ENST00000264448	T;T	0.05855	3.39;3.38	4.78	3.9	0.45041	.	0.496401	0.19006	N	0.125204	T	0.06462	0.0166	L	0.48642	1.525	0.38002	D	0.934273	P;P;P	0.46064	0.872;0.793;0.573	B;B;B	0.41510	0.359;0.164;0.164	T	0.43972	-0.9358	10	0.15499	T	0.54	.	9.0041	0.36100	0.098:0.0:0.902:0.0	.	2951;2909;2951	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	A	2909;2951	ENSP00000386627:G2909A;ENSP00000264448:G2951A	ENSP00000264448:G2951A	G	+	2	0	ALMS1	73571449	0.743000	0.28239	0.456000	0.27044	0.216000	0.24613	1.882000	0.39648	1.612000	0.50221	0.650000	0.86243	GGT	.		0.418	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
ANK1	286	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	41573290	41573290	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr8:41573290delG	ENST00000347528.4	-	14	1565	c.1482delC	c.(1480-1482)gccfs	p.A494fs	ANK1_ENST00000265709.8_Frame_Shift_Del_p.A527fs|ANK1_ENST00000379758.2_Frame_Shift_Del_p.A494fs|ANK1_ENST00000396945.1_Frame_Shift_Del_p.A494fs|ANK1_ENST00000289734.7_Frame_Shift_Del_p.A494fs|ANK1_ENST00000396942.1_Frame_Shift_Del_p.A494fs|ANK1_ENST00000352337.4_Frame_Shift_Del_p.A494fs	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	494	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GGTTGGGGTTGGCGTTATTTT	0.587																																					p.A527fs		.											.	ANK1	716	0			c.1581delC						.						121.0	107.0	112.0					8																	41573290		2203	4300	6503	SO:0001589	frameshift_variant	286	exon14			GGGGTTGGCGTTA	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.1482delC	8.37:g.41573290delG	ENSP00000339620:p.Ala494fs	69.0	0.0		145.0	68.0	NM_001142446	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Frame_Shift_Del	DEL	ENST00000347528.4	37	CCDS6119.1																																																																																			.		0.587	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
ARHGEF40	55701	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	21543017	21543017	+	Silent	SNP	C	C	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr14:21543017C>G	ENST00000298694.4	+	3	1255	c.1128C>G	c.(1126-1128)ggC>ggG	p.G376G	ARHGEF40_ENST00000298693.3_Silent_p.G376G			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	376	Gly-rich.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						GGAGAACAGGCAAAGGAAACA	0.632																																					p.G376G		.											.	ARHGEF40	228	0			c.C1128G						.						65.0	54.0	58.0					14																	21543017		2203	4300	6503	SO:0001819	synonymous_variant	55701	exon3			AACAGGCAAAGGA		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.1128C>G	14.37:g.21543017C>G		34.0	0.0		33.0	20.0	NM_018071	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Silent	SNP	ENST00000298694.4	37	CCDS32041.1																																																																																			.		0.632	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1		
ATAD5	79915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	29162318	29162318	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr17:29162318T>C	ENST00000321990.4	+	2	1597	c.1219T>C	c.(1219-1221)Ttt>Ctt	p.F407L	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	407					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				TATGAAAGCATTTAGGCAGCC	0.368																																					p.F407L		.											.	ATAD5	93	0			c.T1219C						.						66.0	71.0	69.0					17																	29162318		2201	4299	6500	SO:0001583	missense	79915	exon2			AAAGCATTTAGGC		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.1219T>C	17.37:g.29162318T>C	ENSP00000313171:p.Phe407Leu	103.0	0.0		152.0	55.0	NM_024857	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	T	14.51	2.556173	0.45487	.	.	ENSG00000176208	ENST00000321990	T	0.38401	1.14	5.91	5.91	0.95273	.	0.114300	0.64402	D	0.000004	T	0.60663	0.2286	M	0.70275	2.135	0.48511	D	0.999666	D;D	0.71674	0.998;0.997	D;D	0.80764	0.994;0.985	T	0.63721	-0.6573	10	0.72032	D	0.01	.	16.3436	0.83110	0.0:0.0:0.0:1.0	.	407;407	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	L	407	ENSP00000313171:F407L	ENSP00000313171:F407L	F	+	1	0	ATAD5	26186444	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.431000	0.73395	2.269000	0.75478	0.533000	0.62120	TTT	.		0.368	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857	
ATF7IP2	80063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	10574815	10574815	+	Silent	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr16:10574815A>G	ENST00000396560.2	+	11	1856	c.1629A>G	c.(1627-1629)gcA>gcG	p.A543A	ATF7IP2_ENST00000543967.1_Silent_p.A87A|ATF7IP2_ENST00000396559.1_Missense_Mutation_p.Q521R|ATF7IP2_ENST00000324570.5_Missense_Mutation_p.Q521R|ATF7IP2_ENST00000356427.2_Silent_p.A543A	NM_024997.3	NP_079273.2	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting protein 2	543			A -> T (in dbSNP:rs9931441).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				large_intestine(3)	3						CACAAAATGCAGTCCAGGTAC	0.413																																					p.Q521R		.											.	ATF7IP2	186	0			c.A1562G						.						95.0	96.0	96.0					16																	10574815		2197	4300	6497	SO:0001819	synonymous_variant	80063	exon11			AAATGCAGTCCAG	AK022730	CCDS10540.1, CCDS58422.1	16p13.2	2008-02-05			ENSG00000166669	ENSG00000166669			20397	protein-coding gene	gene with protein product		613645					Standard	NM_001256160		Approved	FLJ12668	uc002czu.3	Q5U623	OTTHUMG00000129749	ENST00000396560.2:c.1629A>G	16.37:g.10574815A>G		52.0	0.0		77.0	27.0	NM_001256160	B2RNR2|Q53EZ7|Q658U2|Q6IS97|Q8N9X8|Q9H9L6	Missense_Mutation	SNP	ENST00000396560.2	37	CCDS10540.1	.	.	.	.	.	.	.	.	.	.	A	4.595	0.110580	0.08780	.	.	ENSG00000166669	ENST00000396559;ENST00000324570	.	.	.	4.7	4.7	0.59300	.	.	.	.	.	T	0.47764	0.1463	.	.	.	0.09310	N	1	D	0.54207	0.965	P	0.50049	0.629	T	0.42361	-0.9456	7	0.87932	D	0	-1.4743	10.8381	0.46698	1.0:0.0:0.0:0.0	.	521	Q5U623-2	.	R	521	.	ENSP00000322811:Q521R	Q	+	2	0	ATF7IP2	10482316	0.976000	0.34144	0.076000	0.20297	0.011000	0.07611	1.677000	0.37576	1.882000	0.54519	0.460000	0.39030	CAG	.		0.413	ATF7IP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251961.1	NM_024997	
BRCC3	79184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	154299926	154299926	+	Splice_Site	SNP	G	G	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chrX:154299926G>A	ENST00000369462.1	+	1	148		c.e1+1		MTCP1_ENST00000369476.3_5'Flank|MTCP1_ENST00000482244.1_5'Flank|CMC4_ENST00000369484.3_5'Flank|BRCC3_ENST00000340647.4_Splice_Site|MTCP1_ENST00000362018.2_Intron|BRCC3_ENST00000369459.2_Splice_Site|BRCC3_ENST00000330045.7_Splice_Site|BRCC3_ENST00000399042.1_Missense_Mutation_p.V42M	NM_024332.3	NP_077308.1	P46736	BRCC3_HUMAN	BRCA1/BRCA2-containing complex, subunit 3						double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|positive regulation of DNA repair (GO:0045739)|protein K63-linked deubiquitination (GO:0070536)|regulation of catalytic activity (GO:0050790)|response to ionizing radiation (GO:0010212)|response to X-ray (GO:0010165)	BRCA1-A complex (GO:0070531)|BRISC complex (GO:0070552)|nuclear ubiquitin ligase complex (GO:0000152)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	enzyme regulator activity (GO:0030234)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|polyubiquitin binding (GO:0031593)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|pancreas(1)|skin(1)	22	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CATAGGGGAGGTGAGTAGGTC	0.612																																					.		.											.	BRCC3	706	0			c.123+1G>A						.						36.0	46.0	43.0					X																	154299926		2103	4201	6304	SO:0001630	splice_region_variant	79184	exon1			GGGGAGGTGAGTA	X64643	CCDS56610.1, CCDS56611.1, CCDS56612.1	Xq28	2013-05-29	2005-11-21	2005-11-21	ENSG00000185515	ENSG00000185515			24185	protein-coding gene	gene with protein product	"""Lys-63-specific deubiquitinase"""	300617	"""chromosome X open reading frame 53"""	CXorf53		1303175, 14636569	Standard	NM_024332		Approved	C6.1A, BRCC36	uc004fna.3	P46736	OTTHUMG00000022658	ENST00000369462.1:c.123+1G>A	X.37:g.154299926G>A		18.0	0.0		146.0	42.0	NM_001018055	A6QRF8|A6QRF9|A8MUX5|A8MWH0|A9Z1Y0|A9Z1Y5|B1B062|B4DQN7|Q16107|Q53YX5|Q9BTZ6	Splice_Site	SNP	ENST00000369462.1	37	CCDS56611.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.97|15.97	2.989290|2.989290	0.53934|0.53934	.|.	.|.	ENSG00000185515|ENSG00000185515	ENST00000340647;ENST00000330045;ENST00000369459;ENST00000369462;ENST00000411985|ENST00000399042;ENST00000457026	.|T	.|0.56275	.|0.47	4.09|4.09	4.09|4.09	0.47781|0.47781	.|.	.|1.413030	.|0.05247	.|N	.|0.513239	.|T	.|0.62816	.|0.2459	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.52155	.|-0.8613	.|7	.|0.54805	.|T	.|0.06	.|.	11.407|11.407	0.49904|0.49904	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	.|M	-1|42	.|ENSP00000381998:V42M	.|ENSP00000381998:V42M	.|V	+|+	.|1	.|0	BRCC3|BRCC3	153953120|153953120	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.640000|0.640000	0.38277|0.38277	8.004000|8.004000	0.88535|0.88535	1.968000|1.968000	0.57251|0.57251	0.600000|0.600000	0.82982|0.82982	.|GTG	.		0.612	BRCC3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058788.4	NM_024332	Intron
C10orf90	118611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	128193357	128193357	+	Missense_Mutation	SNP	C	C	A	rs199676174		TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr10:128193357C>A	ENST00000284694.7	-	3	532	c.412G>T	c.(412-414)Gca>Tca	p.A138S	C10orf90_ENST00000544758.1_Missense_Mutation_p.A235S|C10orf90_ENST00000392694.1_Missense_Mutation_p.A91S|C10orf90_ENST00000356858.3_Missense_Mutation_p.A91S|C10orf90_ENST00000368674.1_5'UTR|C10orf90_ENST00000454341.1_Missense_Mutation_p.A138S	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	138	Required for interaction with HDAC1. {ECO:0000250}.				mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		GTGATGGATGCAAACCCTCTG	0.677											OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A138S		.											.	C10orf90	92	0			c.G412T						.						28.0	34.0	32.0					10																	128193357		2191	4290	6481	SO:0001583	missense	118611	exon3			TGGATGCAAACCC	BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.412G>T	10.37:g.128193357C>A	ENSP00000284694:p.Ala138Ser	36.0	0.0	1563	55.0	21.0	NM_001004298	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Missense_Mutation	SNP	ENST00000284694.7	37	CCDS31310.1	.	.	.	.	.	.	.	.	.	.	C	13.36	2.214460	0.39102	.	.	ENSG00000154493	ENST00000356858;ENST00000284694;ENST00000454341;ENST00000544758;ENST00000432642;ENST00000368674;ENST00000392694	T;T;T;T;T	0.25579	2.17;2.15;2.16;2.17;1.79	4.97	1.66	0.24008	.	0.382729	0.22732	N	0.056306	T	0.26048	0.0635	L	0.38175	1.15	0.09310	N	1	P;B;B;B;B	0.36683	0.565;0.364;0.353;0.065;0.312	P;B;B;B;B	0.44990	0.466;0.121;0.181;0.041;0.332	T	0.16424	-1.0403	10	0.27082	T	0.32	-11.7681	13.1454	0.59459	0.5211:0.4789:0.0:0.0	.	235;235;91;138;138	F5GZL2;B4DMQ6;Q5T024;Q96M02;Q96M02-2	.;.;.;CJ090_HUMAN;.	S	91;138;138;235;138;91;91	ENSP00000284694:A138S;ENSP00000398786:A138S;ENSP00000444369:A235S;ENSP00000405995:A138S;ENSP00000376459:A91S	ENSP00000284694:A138S	A	-	1	0	C10orf90	128183347	0.323000	0.24643	0.013000	0.15412	0.620000	0.37586	0.007000	0.13174	0.609000	0.30018	0.561000	0.74099	GCA	C|1.000;G|0.000		0.677	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298	
C2CD4C	126567	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	408323	408323	+	Silent	SNP	C	C	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr19:408323C>A	ENST00000332235.6	-	2	212	c.39G>T	c.(37-39)cgG>cgT	p.R13R		NM_001136263.1	NP_001129735.1	Q8TF44	C2C4C_HUMAN	C2 calcium-dependent domain containing 4C	13										large_intestine(1)|pancreas(1)	2						CCCCAGACCCCCGAAGCCGCT	0.647																																					p.R13R		.											.	C2CD4C	46	0			c.G39T						.						23.0	28.0	26.0					19																	408323		692	1591	2283	SO:0001819	synonymous_variant	126567	exon2			AGACCCCCGAAGC	AB075837	CCDS45890.1	19p13.3	2009-09-28	2009-09-28	2009-09-28		ENSG00000183186			29417	protein-coding gene	gene with protein product	"""nuclear localized factor 3"""	610336	"""KIAA1957"", ""family with sequence similarity 148, member C"""	KIAA1957, FAM148C		11853319	Standard	NM_001136263		Approved	NLF3	uc002loo.3	Q8TF44		ENST00000332235.6:c.39G>T	19.37:g.408323C>A		100.0	1.0		128.0	58.0	NM_001136263	Q8N3H7	Silent	SNP	ENST00000332235.6	37	CCDS45890.1																																																																																			.		0.647	C2CD4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451789.2	XM_065166	
C2CD5	9847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	22606893	22606893	+	Silent	SNP	C	C	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr12:22606893C>G	ENST00000333957.4	-	24	3063	c.2808G>C	c.(2806-2808)ggG>ggC	p.G936G	C2CD5_ENST00000536386.1_Silent_p.G989G|C2CD5_ENST00000396028.2_Silent_p.G978G|C2CD5_ENST00000545552.1_Silent_p.G990G|C2CD5_ENST00000544930.1_Silent_p.G792G|C2CD5_ENST00000446597.1_Silent_p.G987G|C2CD5_ENST00000542676.1_Silent_p.G987G	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	936					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										CAACAGCATTCCCTCCTAATG	0.418																																					p.G936G		.											.	.	.	0			c.G2808C						.						155.0	140.0	145.0					12																	22606893		2203	4300	6503	SO:0001819	synonymous_variant	9847	exon24			AGCATTCCCTCCT	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.2808G>C	12.37:g.22606893C>G		91.0	0.0		220.0	83.0	NM_014802	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Silent	SNP	ENST00000333957.4	37	CCDS31758.1	.	.	.	.	.	.	.	.	.	.	C	8.314	0.822710	0.16678	.	.	ENSG00000111731	ENST00000539615	.	.	.	5.41	1.24	0.21308	.	0.000000	0.85682	D	0.000000	T	0.70640	0.3247	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72581	-0.4250	6	0.56958	D	0.05	-10.6763	13.3155	0.60405	0.0:0.3971:0.5369:0.066	.	.	.	.	A	237	.	ENSP00000437935:G237A	G	-	2	0	KIAA0528	22498160	0.980000	0.34600	1.000000	0.80357	0.971000	0.66376	0.123000	0.15708	0.242000	0.21303	0.561000	0.74099	GGA	.		0.418	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402257.1	NM_014802	
FOXL2NB	401089	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	138669225	138669225	+	Silent	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr3:138669225C>T	ENST00000383165.3	+	3	470	c.339C>T	c.(337-339)ctC>ctT	p.L113L		NM_001040061.2	NP_001035150.1	Q6ZUU3	FOXNB_HUMAN		113										large_intestine(1)|lung(3)	4						TAGAACCACTCAGCTCGTCCC	0.716																																					p.L113L		.											.	C3orf72	22	0			c.C339T						.						13.0	19.0	17.0					3																	138669225		1829	4081	5910	SO:0001819	synonymous_variant	401089	exon3			ACCACTCAGCTCG																												ENST00000383165.3:c.339C>T	3.37:g.138669225C>T		34.0	0.0		26.0	9.0	NM_001040061	A6NGX0	Silent	SNP	ENST00000383165.3	37	CCDS43155.1																																																																																			.		0.716	C3orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357986.1		
ZGRF1	55345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	113510881	113510881	+	Splice_Site	SNP	C	C	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr4:113510881C>G	ENST00000505019.1	-	11	3251	c.3126G>C	c.(3124-3126)gaG>gaC	p.E1042D	C4orf21_ENST00000309071.5_Missense_Mutation_p.E1042D	NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		1042						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		AACGACTACCCTCCAAGTTGA	0.338																																					p.E1042D		.											.	C4orf21	90	0			c.G3126C						.						100.0	102.0	101.0					4																	113510881		2203	4300	6503	SO:0001630	splice_region_variant	55345	exon11			ACTACCCTCCAAG																												ENST00000505019.1:c.3127+1G>C	4.37:g.113510881C>G		151.0	0.0		150.0	107.0	NM_018392	B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Missense_Mutation	SNP	ENST00000505019.1	37		.	.	.	.	.	.	.	.	.	.	C	4.785	0.145885	0.09134	.	.	ENSG00000138658	ENST00000505019;ENST00000309071	D;T	0.82433	-1.61;1.78	3.12	-6.25	0.02039	.	.	.	.	.	T	0.54822	0.1882	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.49041	-0.8980	9	0.12103	T	0.63	.	1.5577	0.02588	0.1413:0.1855:0.1416:0.5316	.	1042;1042	Q86YA3;G5EA02	CD021_HUMAN;.	D	1042	ENSP00000424737:E1042D;ENSP00000309095:E1042D	ENSP00000309095:E1042D	E	-	3	2	C4orf21	113730330	0.000000	0.05858	0.000000	0.03702	0.078000	0.17371	-1.438000	0.02416	-1.868000	0.01142	0.460000	0.39030	GAG	.		0.338	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000256413.1		Missense_Mutation
C6orf118	168090	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	165715292	165715292	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr6:165715292C>A	ENST00000230301.8	-	2	539	c.519G>T	c.(517-519)agG>agT	p.R173S	C6orf118_ENST00000543069.1_Missense_Mutation_p.R69S	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	173										breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		GTTCTTCCCTCCTGCGCCATC	0.617																																					p.R173S		.											.	C6orf118	90	0			c.G519T						.						37.0	43.0	41.0					6																	165715292		2203	4300	6503	SO:0001583	missense	168090	exon2			TTCCCTCCTGCGC		CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.519G>T	6.37:g.165715292C>A	ENSP00000230301:p.Arg173Ser	27.0	0.0		42.0	19.0	NM_144980	Q8TC11	Missense_Mutation	SNP	ENST00000230301.8	37	CCDS5288.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.530253	0.45073	.	.	ENSG00000112539	ENST00000230301;ENST00000543069	T;T	0.14391	2.51;2.51	4.47	1.51	0.23008	.	2.239880	0.01455	N	0.015640	T	0.06554	0.0168	L	0.50333	1.59	0.09310	N	1	P	0.52316	0.952	P	0.46659	0.523	T	0.15983	-1.0418	10	0.27082	T	0.32	-1.3071	5.227	0.15399	0.0:0.4852:0.3277:0.1871	.	173	Q5T5N4	CF118_HUMAN	S	173;69	ENSP00000230301:R173S;ENSP00000439288:R69S	ENSP00000230301:R173S	R	-	3	2	C6orf118	165635282	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	0.572000	0.23684	0.162000	0.19483	0.655000	0.94253	AGG	.		0.617	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043026.1	NM_144980	
C7orf61	402573	hgsc.bcm.edu;broad.mit.edu	37	7	100054424	100054425	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr7:100054424_100054425insG	ENST00000332375.3	-	3	816_817	c.571_572insC	c.(571-573)cgafs	p.R191fs		NM_001004323.1	NP_001004323.1	Q8IZ16	CG061_HUMAN	chromosome 7 open reading frame 61	191						nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|prostate(1)|skin(1)	4						CGGGTTGGGTCGGGGGGCAGCA	0.644																																					p.R191fs		.											.	.	.	0			c.572_573insC						.																																			SO:0001589	frameshift_variant	402573	exon3			TTGGGTCGGGGGG		CCDS47661.1	7q22.1	2013-10-11			ENSG00000185955	ENSG00000185955			22135	protein-coding gene	gene with protein product						12690205	Standard	NM_001004323		Approved	IMAGE:4839025	uc003uuz.1	Q8IZ16	OTTHUMG00000150234	ENST00000332375.3:c.572dupC	7.37:g.100054430_100054430dupG	ENSP00000327732:p.Arg191fs	29.0	0.0		96.0	19.0	NM_001004323		Frame_Shift_Ins	INS	ENST00000332375.3	37	CCDS47661.1																																																																																			.		0.644	C7orf61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316976.2	NM_001004323	
CADPS	8618	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	62739120	62739120	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr3:62739120C>G	ENST00000383710.4	-	3	1233	c.884G>C	c.(883-885)tGc>tCc	p.C295S	CADPS_ENST00000283269.9_Missense_Mutation_p.C295S|CADPS_ENST00000357948.3_Missense_Mutation_p.C295S|CADPS_ENST00000490353.2_Missense_Mutation_p.C295S	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	295					catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		CCTTACCTGGCAGGCATTGTA	0.448																																					p.C295S		.											.	CADPS	281	0			c.G884C						.						67.0	64.0	65.0					3																	62739120		2203	4300	6503	SO:0001583	missense	8618	exon3			ACCTGGCAGGCAT	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.884G>C	3.37:g.62739120C>G	ENSP00000373215:p.Cys295Ser	34.0	0.0		93.0	45.0	NM_003716	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	ENST00000383710.4	37	CCDS46858.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.913566	0.92178	.	.	ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269;ENST00000490353	D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.92251	0.7542	M	0.71581	2.175	0.80722	D	1	P;D;P	0.58970	0.837;0.984;0.651	P;D;B	0.71656	0.457;0.974;0.214	D	0.92186	0.5755	10	0.87932	D	0	.	20.2228	0.98330	0.0:1.0:0.0:0.0	.	295;295;295	Q9ULU8-2;Q9ULU8-3;Q9ULU8	.;.;CAPS1_HUMAN	S	295	ENSP00000373215:C295S;ENSP00000350632:C295S;ENSP00000283269:C295S;ENSP00000418736:C295S	ENSP00000283269:C295S	C	-	2	0	CADPS	62714160	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.818000	0.86416	2.789000	0.95967	0.655000	0.94253	TGC	.		0.448	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
CCDC14	64770	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	123650008	123650008	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr3:123650008T>C	ENST00000488653.2	-	12	1953	c.1863A>G	c.(1861-1863)atA>atG	p.I621M	CCDC14_ENST00000483247.1_Intron|CCDC14_ENST00000489746.1_Missense_Mutation_p.I421M|CCDC14_ENST00000310351.4_Missense_Mutation_p.I461M|CCDC14_ENST00000433542.2_Missense_Mutation_p.I580M|CCDC14_ENST00000485727.1_Missense_Mutation_p.I421M			Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	621					substantia nigra development (GO:0021762)	centrosome (GO:0005813)				NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)	21		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		TTATCCCCAATATCTGGTTTT	0.373																																					p.I580M		.											.	CCDC14	68	0			c.A1740G						.						80.0	79.0	79.0					3																	123650008		2203	4300	6503	SO:0001583	missense	64770	exon11			CCCCAATATCTGG	AL122079	CCDS3025.2	3q21.1	2014-03-20			ENSG00000175455	ENSG00000175455			25766	protein-coding gene	gene with protein product						12477932	Standard	NM_022757		Approved	FLJ12892, DKFZp434L1050	uc010hrt.3	Q49A88	OTTHUMG00000153005	ENST00000488653.2:c.1863A>G	3.37:g.123650008T>C	ENSP00000420180:p.Ile621Met	217.0	0.0		340.0	125.0	NM_022757	B7Z2T2|B8ZZ41|B8ZZ58|D3DN98|Q7Z3N3|Q86T30|Q8IWF8|Q8WUJ8|Q96K47|Q9H9A3|Q9UFH0	Missense_Mutation	SNP	ENST00000488653.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.94|16.94	3.260091|3.260091	0.59321|0.59321	.|.	.|.	ENSG00000175455|ENSG00000175455	ENST00000488653;ENST00000310351;ENST00000485727;ENST00000489746;ENST00000433542;ENST00000409697;ENST00000419247|ENST00000479903	T;T;T;T;T;T;T|.	0.62788|.	0.0;0.0;0.0;0.0;0.0;0.0;0.0|.	5.17|5.17	2.74|2.74	0.32292|0.32292	.|.	0.137208|.	0.49916|.	D|.	0.000129|.	T|T	0.46756|0.46756	0.1409|0.1409	L|L	0.59436|0.59436	1.845|1.845	0.30968|0.30968	N|N	0.722921|0.722921	D;D;D;D|.	0.63046|.	0.992;0.992;0.992;0.992|.	D;D;P;P|.	0.64321|.	0.924;0.924;0.862;0.895|.	T|T	0.50759|0.50759	-0.8790|-0.8790	10|5	0.48119|.	T|.	0.1|.	.|.	5.0782|5.0782	0.14642|0.14642	0.3723:0.0:0.1524:0.4753|0.3723:0.0:0.1524:0.4753	.|.	621;580;421;462|.	Q49A88;Q49A88-6;Q49A88-4;Q49A88-5|.	CCD14_HUMAN;.;.;.|.	M|C	621;461;421;421;580;602;262|203	ENSP00000420180:I621M;ENSP00000312031:I461M;ENSP00000418002:I421M;ENSP00000418403:I421M;ENSP00000395706:I580M;ENSP00000386866:I602M;ENSP00000400957:I262M|.	ENSP00000312031:I461M|.	I|Y	-|-	3|2	3|0	CCDC14|CCDC14	125132698|125132698	0.939000|0.939000	0.31865|0.31865	0.996000|0.996000	0.52242|0.52242	0.983000|0.983000	0.72400|0.72400	-0.081000|-0.081000	0.11321|0.11321	0.974000|0.974000	0.38366|0.38366	0.460000|0.460000	0.39030|0.39030	ATA|TAT	.		0.373	CCDC14-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_022757	
SOHLH2	54937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	36776092	36776092	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr13:36776092A>G	ENST00000379881.3	-	2	275	c.187T>C	c.(187-189)Tgc>Cgc	p.C63R	SOHLH2_ENST00000554962.1_Missense_Mutation_p.C140R|CCDC169-SOHLH2_ENST00000511166.1_Missense_Mutation_p.C140R|SOHLH2_ENST00000317764.6_Missense_Mutation_p.C63R	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	63					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		TTGAATATGCAATCATCCAAA	0.453																																					p.C140R		.											.	.	.	0			c.T418C						.						148.0	119.0	129.0					13																	36776092		2203	4300	6503	SO:0001583	missense	100526761	exon7			ATATGCAATCATC	AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.187T>C	13.37:g.36776092A>G	ENSP00000369210:p.Cys63Arg	56.0	0.0		130.0	49.0	NM_001198910	B4DX90|Q5EGC3|Q8TC74|Q96QX4	Missense_Mutation	SNP	ENST00000379881.3	37	CCDS9355.1	.	.	.	.	.	.	.	.	.	.	A	7.782	0.709683	0.15239	.	.	ENSG00000120669;ENSG00000120669;ENSG00000120669;ENSG00000250709	ENST00000379881;ENST00000554962;ENST00000317764;ENST00000511166	T;T;T;T	0.41758	1.59;1.59;0.99;1.59	5.54	-0.183	0.13284	.	0.588548	0.16395	N	0.216309	T	0.22003	0.0530	N	0.24115	0.695	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.11203	-1.0597	10	0.41790	T	0.15	-0.0896	2.4207	0.04447	0.4127:0.356:0.0859:0.1454	.	140;63	B4DX90;Q9NX45	.;SOLH2_HUMAN	R	63;140;63;140	ENSP00000369210:C63R;ENSP00000451542:C140R;ENSP00000326838:C63R;ENSP00000421868:C140R	ENSP00000421868:C140R	C	-	1	0	CCDC169-SOHLH2;SOHLH2	35674092	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.217000	0.17603	-0.253000	0.09514	-0.313000	0.08912	TGC	.		0.453	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044477.2	NM_017826	
CCDC65	85478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	49312509	49312509	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr12:49312509C>A	ENST00000320516.4	+	6	1037	c.849C>A	c.(847-849)agC>agA	p.S283R	RP11-302B13.5_ENST00000398092.4_Intron|CCDC65_ENST00000266984.5_Missense_Mutation_p.S283R	NM_033124.4	NP_149115.2	Q8IXS2	CCD65_HUMAN	coiled-coil domain containing 65	283										breast(1)|large_intestine(4)|lung(7)|ovary(1)|skin(2)	15						TGATACACAGCCGTGAGAGTG	0.458																																					p.S283R		.											.	CCDC65	92	0			c.C849A						.						103.0	93.0	96.0					12																	49312509		2203	4300	6503	SO:0001583	missense	85478	exon6			ACACAGCCGTGAG		CCDS8772.1	12q13.12	2014-07-18			ENSG00000139537	ENSG00000139537			29937	protein-coding gene	gene with protein product		611088				17089017, 21700706	Standard	NM_033124		Approved	NYD-SP28, FLJ35732, FAP250, CILD27	uc001rso.3	Q8IXS2		ENST00000320516.4:c.849C>A	12.37:g.49312509C>A	ENSP00000312706:p.Ser283Arg	93.0	0.0		104.0	45.0	NM_033124	A6NJG5|B2RBE2|Q8N7G4|Q8NA91|Q96JA0	Missense_Mutation	SNP	ENST00000320516.4	37	CCDS8772.1	.	.	.	.	.	.	.	.	.	.	C	16.42	3.117650	0.56505	.	.	ENSG00000139537	ENST00000266984;ENST00000552942;ENST00000320516	T;T;T	0.45668	1.49;0.89;1.5	4.72	2.9	0.33743	.	0.520042	0.21941	N	0.066862	T	0.44603	0.1301	L	0.52364	1.645	0.38630	D	0.951349	D	0.63880	0.993	P	0.57776	0.827	T	0.42050	-0.9474	10	0.17369	T	0.5	-3.3456	5.9072	0.19008	0.1545:0.6762:0.0:0.1694	.	283	Q8IXS2	CCD65_HUMAN	R	283;180;283	ENSP00000266984:S283R;ENSP00000446569:S180R;ENSP00000312706:S283R	ENSP00000266984:S283R	S	+	3	2	CCDC65	47598776	0.018000	0.18449	0.991000	0.47740	0.991000	0.79684	0.035000	0.13797	0.737000	0.32582	0.655000	0.94253	AGC	.		0.458	CCDC65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408922.1	NM_033124	
CHAT	1103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	50827803	50827803	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr10:50827803G>C	ENST00000337653.2	+	3	573	c.420G>C	c.(418-420)caG>caC	p.Q140H	CHAT_ENST00000395562.2_Missense_Mutation_p.Q58H|CHAT_ENST00000455728.2_Missense_Mutation_p.Q22H|CHAT_ENST00000351556.3_Missense_Mutation_p.Q22H|CHAT_ENST00000460699.1_3'UTR|CHAT_ENST00000339797.1_Missense_Mutation_p.Q22H|CHAT_ENST00000395559.2_Missense_Mutation_p.Q22H	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	140					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)			central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	CCCCGCTGCAGCAGACCCTGG	0.612																																					p.Q140H		.											.	CHAT	514	0			c.G420C						.						53.0	43.0	47.0					10																	50827803		2203	4300	6503	SO:0001583	missense	1103	exon3			GCTGCAGCAGACC	AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.420G>C	10.37:g.50827803G>C	ENSP00000337103:p.Gln140His	27.0	0.0		30.0	13.0	NM_020549	A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Missense_Mutation	SNP	ENST00000337653.2	37	CCDS7232.1	.	.	.	.	.	.	.	.	.	.	G	8.314	0.822684	0.16678	.	.	ENSG00000070748	ENST00000339797;ENST00000351556;ENST00000395559;ENST00000337653;ENST00000395562;ENST00000455728	T;T;T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47;-1.47;-1.47	5.09	3.08	0.35506	.	0.254877	0.38897	N	0.001523	T	0.73289	0.3568	L	0.60957	1.885	0.26170	N	0.979882	B;P	0.39920	0.091;0.695	B;B	0.36092	0.074;0.217	T	0.66783	-0.5836	10	0.72032	D	0.01	-5.7437	7.6624	0.28410	0.3642:0.0:0.6358:0.0	.	22;140	F8W8I2;P28329	.;CLAT_HUMAN	H	22;22;22;140;58;22	ENSP00000343486:Q22H;ENSP00000345878:Q22H;ENSP00000378926:Q22H;ENSP00000337103:Q140H;ENSP00000378929:Q58H;ENSP00000390521:Q22H	ENSP00000337103:Q140H	Q	+	3	2	CHAT	50497809	0.996000	0.38824	0.998000	0.56505	0.028000	0.11728	0.356000	0.20181	0.475000	0.27415	0.462000	0.41574	CAG	.		0.612	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047997.1	NM_020549	
CHD4	1108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	6710565	6710565	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr12:6710565G>A	ENST00000357008.2	-	6	852	c.689C>T	c.(688-690)gCa>gTa	p.A230V	CHD4_ENST00000309577.6_Missense_Mutation_p.A230V|CHD4_ENST00000544040.1_Missense_Mutation_p.A223V|CHD4_ENST00000544484.1_Missense_Mutation_p.A227V	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	230	Poly-Ala.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						CGCTGCTGCTGCCGCAGCTGC	0.577																																					p.A230V	Colon(32;586 792 4568 16848 45314)	.											.	CHD4	228	0			c.C689T						.						86.0	97.0	93.0					12																	6710565		2203	4300	6503	SO:0001583	missense	1108	exon6			GCTGCTGCCGCAG	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.689C>T	12.37:g.6710565G>A	ENSP00000349508:p.Ala230Val	53.0	0.0		74.0	25.0	NM_001273	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	G	11.76	1.735652	0.30774	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464;ENST00000545942	D;D;D;D;T	0.90504	-2.67;-2.68;-2.67;-2.68;0.81	5.87	5.87	0.94306	.	0.160296	0.47093	D	0.000249	D	0.88858	0.6551	L	0.37800	1.135	0.47621	D	0.999479	P;B;P	0.36535	0.557;0.193;0.557	B;B;B	0.41764	0.366;0.036;0.366	D	0.85496	0.1188	10	0.22109	T	0.4	-1.1386	20.2084	0.98285	0.0:0.0:1.0:0.0	.	230;230;223	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	V	227;223;230;230;204;230	ENSP00000440392:A227V;ENSP00000440542:A223V;ENSP00000312419:A230V;ENSP00000349508:A230V;ENSP00000437506:A230V	ENSP00000312419:A230V	A	-	2	0	CHD4	6580826	1.000000	0.71417	0.578000	0.28575	0.613000	0.37349	4.419000	0.59835	2.774000	0.95407	0.650000	0.86243	GCA	.		0.577	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
CHDC2	286464	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	36122659	36122659	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chrX:36122659T>C	ENST00000313548.4	+	8	1082	c.896T>C	c.(895-897)aTg>aCg	p.M299T		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	299						integral component of membrane (GO:0016021)											AGCAATAATATGCCCCCCATA	0.353																																					p.M299T		.											.	.	.	0			c.T896C						.						125.0	107.0	113.0					X																	36122659		2202	4300	6502	SO:0001583	missense	286464	exon8			ATAATATGCCCCC	AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.896T>C	X.37:g.36122659T>C	ENSP00000324767:p.Met299Thr	231.0	0.0		473.0	21.0	NM_173695		Missense_Mutation	SNP	ENST00000313548.4	37	CCDS14238.1	.	.	.	.	.	.	.	.	.	.	T	9.757	1.169143	0.21621	.	.	ENSG00000176034	ENST00000378660;ENST00000313548	.	.	.	5.53	0.0558	0.14316	.	1.589030	0.03720	N	0.251685	T	0.23492	0.0568	L	0.29908	0.895	0.09310	N	1	B	0.29341	0.242	B	0.26094	0.066	T	0.13255	-1.0516	9	0.34782	T	0.22	-0.148	1.2548	0.01989	0.1474:0.1735:0.1497:0.5294	.	299	Q8N9S7	CX059_HUMAN	T	299	.	ENSP00000324767:M299T	M	+	2	0	CXorf59	36032580	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	0.051000	0.14141	-0.034000	0.13713	0.486000	0.48141	ATG	.		0.353	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173695	
COL19A1	1310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	70852682	70852682	+	Silent	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr6:70852682C>T	ENST00000322773.4	+	23	1698	c.1596C>T	c.(1594-1596)tcC>tcT	p.S532S	COL19A1_ENST00000393344.1_Silent_p.S154S	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	532	Triple-helical region 3 (COL3).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						CTGCAGGCTCCATGGGACCCA	0.353																																					p.S532S		.											.	COL19A1	156	0			c.C1596T						.						105.0	110.0	108.0					6																	70852682		2203	4300	6503	SO:0001819	synonymous_variant	1310	exon23			AGGCTCCATGGGA		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.1596C>T	6.37:g.70852682C>T		54.0	0.0		77.0	29.0	NM_001858	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Silent	SNP	ENST00000322773.4	37	CCDS4970.1																																																																																			.		0.353	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1		
BMI1	648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	22618024	22618024	+	Silent	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr10:22618024A>G	ENST00000376663.3	+	9	1123	c.618A>G	c.(616-618)ctA>ctG	p.L206L	COMMD3-BMI1_ENST00000602390.1_Silent_p.L349L	NM_005180.8	NP_005171.4	P35226	BMI1_HUMAN	BMI1 proto-oncogene, polycomb ring finger	206	Interaction with E4F1.				chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|regulation of gene expression (GO:0010468)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|ubiquitin ligase complex (GO:0000151)	RING-like zinc finger domain binding (GO:0071535)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|urinary_tract(1)	12						ATTATACACTAATGGATATTG	0.264																																					p.L349L		.											.	.	.	0			c.A1047G						.						112.0	133.0	126.0					10																	22618024		2198	4284	6482	SO:0001819	synonymous_variant	0	exon13			TACACTAATGGAT	BC011652	CCDS7138.1	10p13	2014-06-26	2014-06-26	2006-04-26	ENSG00000168283	ENSG00000168283		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	1066	protein-coding gene	gene with protein product		164831	"""polycomb group ring finger 4"", ""B lymphoma Mo-MLV insertion region 1 homolog (mouse)"""	PCGF4		8268912	Standard	NM_005180		Approved	RNF51		P35226	OTTHUMG00000017807	ENST00000376663.3:c.618A>G	10.37:g.22618024A>G		115.0	0.0		172.0	56.0	NM_001204062	Q16030|Q5T8Z3|Q96F37	Silent	SNP	ENST00000376663.3	37	CCDS7138.1																																																																																			.		0.264	BMI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047176.1	NM_005180	
COPA	1314	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	160295377	160295377	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr1:160295377C>T	ENST00000241704.7	-	7	791	c.562G>A	c.(562-564)Gat>Aat	p.D188N	Y_RNA_ENST00000365208.1_RNA|COPA_ENST00000368069.3_Missense_Mutation_p.D188N	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	188					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CCAAATAGATCAACCCCAGTT	0.453																																					p.D188N		.											.	COPA	92	0			c.G562A						.						198.0	186.0	190.0					1																	160295377		2203	4300	6503	SO:0001583	missense	1314	exon7			ATAGATCAACCCC	U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.562G>A	1.37:g.160295377C>T	ENSP00000241704:p.Asp188Asn	95.0	1.0		287.0	176.0	NM_001098398	Q5T201|Q8IXZ9	Missense_Mutation	SNP	ENST00000241704.7	37	CCDS1202.1	.	.	.	.	.	.	.	.	.	.	C	35	5.541422	0.96474	.	.	ENSG00000122218	ENST00000368069;ENST00000241704	T;T	0.64618	-0.06;-0.11	5.1	5.1	0.69264	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.61912	0.2385	N	0.24115	0.695	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.70227	0.963;0.968	T	0.68191	-0.5474	10	0.87932	D	0	-18.0035	17.286	0.87141	0.0:1.0:0.0:0.0	.	188;188	P53621;P53621-2	COPA_HUMAN;.	N	188	ENSP00000357048:D188N;ENSP00000241704:D188N	ENSP00000241704:D188N	D	-	1	0	COPA	158562001	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.196000	0.77805	2.652000	0.90054	0.655000	0.94253	GAT	.		0.453	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080638.1	NM_004371	
COPS6	10980	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	99686935	99686935	+	Silent	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr7:99686935C>T	ENST00000303904.3	+	2	136	c.99C>T	c.(97-99)tgC>tgT	p.C33C	COPS6_ENST00000418625.1_Silent_p.C32C	NM_006833.4	NP_006824.2	Q7L5N1	CSN6_HUMAN	COP9 signalosome subunit 6	33					cullin deneddylation (GO:0010388)|viral process (GO:0016032)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|endometrium(3)|large_intestine(4)|lung(2)|prostate(1)|stomach(1)	12	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			TGATGGCCTGCGGAGTGACTG	0.632																																					p.C33C		.											.	COPS6	658	0			c.C99T						.						127.0	119.0	121.0					7																	99686935		2203	4300	6503	SO:0001819	synonymous_variant	10980	exon2			GGCCTGCGGAGTG	BC002520	CCDS5682.1	7q22.1	2013-03-14	2013-03-14		ENSG00000168090	ENSG00000168090			21749	protein-coding gene	gene with protein product	"""COP9 subunit 6 (MOV34 homolog, 34 kD)"""	614729	"""COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis)"""			12477932	Standard	NM_006833		Approved	MOV34-34KD, CSN6	uc003usu.3	Q7L5N1	OTTHUMG00000154632	ENST00000303904.3:c.99C>T	7.37:g.99686935C>T		34.0	0.0		157.0	50.0	NM_006833	A4D2A3|O15387	Silent	SNP	ENST00000303904.3	37	CCDS5682.1																																																																																			.		0.632	COPS6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000336412.3	NM_006833	
CST11	140880	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	23431159	23431159	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr20:23431159C>G	ENST00000377009.3	-	3	434	c.401G>C	c.(400-402)aGc>aCc	p.S134T	CST11_ENST00000377007.3_Missense_Mutation_p.S99T	NM_130794.1	NP_570612.1	Q9H112	CST11_HUMAN	cystatin 11	134					defense response to bacterium (GO:0042742)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			kidney(2)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	14	Colorectal(13;0.0431)|Lung NSC(19;0.235)					ACTGCTGCAGCTTTTGTTCAA	0.393																																					p.S134T		.											.	CST11	90	0			c.G401C						.						113.0	96.0	102.0					20																	23431159		2203	4300	6503	SO:0001583	missense	140880	exon3			CTGCAGCTTTTGT	AL096677	CCDS13154.1, CCDS13155.1	20p11.21	2012-08-14			ENSG00000125831	ENSG00000125831			15959	protein-coding gene	gene with protein product		609731		CST8L		20565543	Standard	NM_080830		Approved	dJ322G13.6, CTES2	uc002wtf.1	Q9H112	OTTHUMG00000032060	ENST00000377009.3:c.401G>C	20.37:g.23431159C>G	ENSP00000366208:p.Ser134Thr	91.0	0.0		148.0	64.0	NM_130794	Q0VAF2|Q0VAF3|Q8WXU5|Q8WXU6|Q9H113	Missense_Mutation	SNP	ENST00000377009.3	37	CCDS13155.1	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.682908	0.00745	.	.	ENSG00000125831	ENST00000377009;ENST00000377007	T;T	0.16196	2.71;2.36	3.86	1.59	0.23543	Proteinase inhibitor I25, cystatin (1);	0.621839	0.16746	N	0.201255	T	0.07007	0.0178	N	0.10685	0.025	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.31280	-0.9949	10	0.36615	T	0.2	-7.6746	3.4946	0.07650	0.0:0.2151:0.2044:0.5805	.	99;134	Q9H112-2;Q9H112	.;CST11_HUMAN	T	134;99	ENSP00000366208:S134T;ENSP00000366206:S99T	ENSP00000366206:S99T	S	-	2	0	CST11	23379159	0.530000	0.26330	0.290000	0.24890	0.002000	0.02628	0.301000	0.19174	0.021000	0.15133	-2.587000	0.00166	AGC	.		0.393	CST11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078314.1	NM_130794	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	41266132	41266133	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr3:41266132_41266133insC	ENST00000349496.5	+	3	409_410	c.129_130insC	c.(130-132)cctfs	p.P44fs	CTNNB1_ENST00000453024.1_Frame_Shift_Ins_p.P37fs|CTNNB1_ENST00000396185.3_Frame_Shift_Ins_p.P44fs|CTNNB1_ENST00000405570.1_Frame_Shift_Ins_p.P44fs|CTNNB1_ENST00000396183.3_Frame_Shift_Ins_p.P44fs	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	44					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.P44A(5)|p.?(4)|p.P44S(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.T40_L46del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.A43del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.P44del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CTACCACAGCTCCTTCTCTGAG	0.505		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.A43fs	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,+1	CTNNB1	24361	133	Deletion - In frame(99)|Complex - deletion inframe(18)|Substitution - Missense(9)|Unknown(7)	liver(90)|large_intestine(18)|stomach(7)|thyroid(4)|kidney(4)|adrenal_gland(3)|soft_tissue(2)|small_intestine(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)	c.129_130insC						.																																			SO:0001589	frameshift_variant	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CACAGCTCCTTCT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.131dupC	3.37:g.41266134_41266134dupC	ENSP00000344456:p.Pro44fs	102.0	0.0		229.0	29.0	NM_001098210	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Frame_Shift_Ins	INS	ENST00000349496.5	37	CCDS2694.1																																																																																			.		0.505	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CTNNB1	1499	hgsc.bcm.edu;ucsc.edu	37	3	41266135	41266135	+	Silent	SNP	T	T	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr3:41266135T>C	ENST00000349496.5	+	3	412	c.132T>C	c.(130-132)ccT>ccC	p.P44P	CTNNB1_ENST00000453024.1_Silent_p.P37P|CTNNB1_ENST00000396185.3_Silent_p.P44P|CTNNB1_ENST00000405570.1_Silent_p.P44P|CTNNB1_ENST00000396183.3_Silent_p.P44P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	44					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_S45insAP(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S45del(1)|p.H24_M131del(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.P44del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CCACAGCTCCTTCTCTGAGTG	0.502		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.P44P	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,+2	CTNNB1	24361	124	Deletion - In frame(98)|Complex - deletion inframe(18)|Unknown(7)|Insertion - In frame(1)	liver(88)|large_intestine(17)|stomach(7)|adrenal_gland(3)|soft_tissue(2)|small_intestine(2)|skin(2)|kidney(2)|haematopoietic_and_lymphoid_tissue(1)	c.T132C						.						85.0	75.0	78.0					3																	41266135		2203	4300	6503	SO:0001819	synonymous_variant	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	AGCTCCTTCTCTG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.132T>C	3.37:g.41266135T>C		105.0	0.0		231.0	72.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Silent	SNP	ENST00000349496.5	37	CCDS2694.1																																																																																			.		0.502	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CTNNB1	1499	hgsc.bcm.edu;ucsc.edu|hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	41266137	41266138	+	Missense_Mutation	DNP	CT	CT	TC	rs121913409		TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C|T	C|T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr3:41266137_41266138CT>TC	ENST00000349496.5	+	3	414_415	c.134_135CT>TC	c.(133-135)tCT>tTC	p.S45F	CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38F|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45F|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45F|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45F	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45F(384)|p.S45del(53)|p.A5_A80del(53)|p.S45C(19)|p.S45Y(17)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.S45_S47>C(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.S45fs*2(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.A21_A80del(1)|p.S45S(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ACAGCTCCTTCTCTGAGTGGTA	0.5	S45F(HCC15_LUNG)|S45F(LS180_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45F|p.S45S	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,+1|CTNNB1,NS,carcinoma,+2	CTNNB1	24361	602	Substitution - Missense(421)|Deletion - In frame(152)|Complex - deletion inframe(20)|Unknown(7)|Deletion - Frameshift(1)|Substitution - coding silent(1)	soft_tissue(233)|liver(141)|large_intestine(85)|kidney(74)|endometrium(16)|skin(11)|adrenal_gland(9)|stomach(7)|biliary_tract(5)|ovary(5)|lung(3)|central_nervous_system(2)|cervix(2)|small_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(1)|pituitary(1)|prostate(1)|bone(1)|pancreas(1)	c.C134T|c.T135C						.																																			SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CTCCTTCTCTGAG|TCCTTCTCTGAGT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	Exception_encountered	3.37:g.41266137_41266138delinsTC	ENSP00000344456:p.Ser45Phe	106.0|103.0	1.0|0.0		232.0|228.0	52.0|62.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation|Silent	SNP	ENST00000349496.5	37	CCDS2694.1																																																																																			.		0.500	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	41266138	41266138	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr3:41266138delT	ENST00000349496.5	+	3	415	c.135delT	c.(133-135)tctfs	p.S45fs	CTNNB1_ENST00000453024.1_Frame_Shift_Del_p.S38fs|CTNNB1_ENST00000396185.3_Frame_Shift_Del_p.S45fs|CTNNB1_ENST00000405570.1_Frame_Shift_Del_p.S45fs|CTNNB1_ENST00000396183.3_Frame_Shift_Del_p.S45fs	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45del(53)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.S45_S47>C(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.A21_A80del(1)|p.S45S(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CAGCTCCTTCTCTGAGTGGTA	0.502		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45fs	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,+2	CTNNB1	24361	181	Deletion - In frame(152)|Complex - deletion inframe(20)|Unknown(7)|Substitution - Missense(1)|Substitution - coding silent(1)	liver(91)|kidney(35)|large_intestine(28)|stomach(7)|adrenal_gland(5)|skin(4)|soft_tissue(2)|small_intestine(2)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|lung(1)|ovary(1)|prostate(1)|bone(1)|pancreas(1)	c.135delT						.						83.0	73.0	76.0					3																	41266138		2203	4300	6503	SO:0001589	frameshift_variant	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TCCTTCTCTGAGT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.135delT	3.37:g.41266138delT	ENSP00000344456:p.Ser45fs	106.0	0.0		232.0	31.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Frame_Shift_Del	DEL	ENST00000349496.5	37	CCDS2694.1																																																																																			.		0.502	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CYP11A1	1583	broad.mit.edu;bcgsc.ca	37	15	74637399	74637399	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr15:74637399C>T	ENST00000268053.6	-	3	765	c.611G>A	c.(610-612)cGc>cAc	p.R204H	CYP11A1_ENST00000541301.1_Intron|CYP11A1_ENST00000358632.4_Missense_Mutation_p.R46H|CYP11A1_ENST00000419019.2_Missense_Mutation_p.R46H	NM_000781.2	NP_000772.2	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A, polypeptide 1	204					biphenyl metabolic process (GO:0018879)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cerebellum development (GO:0021549)|cholesterol metabolic process (GO:0008203)|dibenzo-p-dioxin metabolic process (GO:0018894)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|granulosa cell differentiation (GO:0060014)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|maternal process involved in female pregnancy (GO:0060135)|mating behavior (GO:0007617)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|progesterone biosynthetic process (GO:0006701)|response to alkaloid (GO:0043279)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to gamma radiation (GO:0010332)|response to genistein (GO:0033595)|response to hydrogen peroxide (GO:0042542)|response to insecticide (GO:0017085)|response to L-ascorbic acid (GO:0033591)|response to salt stress (GO:0009651)|response to vitamin E (GO:0033197)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|testosterone biosynthetic process (GO:0061370)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	mitochondrial crista (GO:0030061)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|perikaryon (GO:0043204)	cholesterol binding (GO:0015485)|cholesterol monooxygenase (side-chain-cleaving) activity (GO:0008386)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.R204H(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Clomifene(DB00882)|Clotrimazole(DB00257)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Glutethimide(DB01437)|Ketoconazole(DB01026)|Omeprazole(DB00338)|Saquinavir(DB01232)|Terbinafine(DB00857)|Testosterone(DB00624)	AAAGGCAAAGCGGAACAGGTC	0.567																																					p.R204H	Esophageal Squamous(87;818 1337 4093 9268 37314)	.											.	CYP11A1	92	1	Substitution - Missense(1)	large_intestine(1)	c.G611A						.						87.0	80.0	82.0					15																	74637399		2197	4296	6493	SO:0001583	missense	1583	exon3			GCAAAGCGGAACA	AK056794	CCDS32291.1, CCDS45303.1	15q23-q24	2010-05-04	2003-01-14	2003-01-17	ENSG00000140459	ENSG00000140459	1.14.15.6	"""Cytochrome P450s"""	2590	protein-coding gene	gene with protein product	"""cholesterol monooxygenase (side-chain-cleaving)"""	118485	"""cytochrome P450, subfamily XIA (cholesterol side chain cleavage)"""	CYP11A			Standard	NM_000781		Approved	P450SCC	uc002axt.2	P05108	OTTHUMG00000150716	ENST00000268053.6:c.611G>A	15.37:g.74637399C>T	ENSP00000268053:p.Arg204His	38.0	0.0		90.0	6.0	NM_000781	A8K8D5|B3KPU8|G3XAD7|Q15081|Q16805|Q8N1A7	Missense_Mutation	SNP	ENST00000268053.6	37	CCDS32291.1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.995020	0.54041	.	.	ENSG00000140459	ENST00000268053;ENST00000358632;ENST00000419019;ENST00000450547	T;T;T	0.69306	-0.39;-0.39;-0.39	4.51	3.59	0.41128	.	0.238158	0.42682	N	0.000663	T	0.51822	0.1697	L	0.43646	1.37	0.80722	D	1	P;B;P	0.37466	0.596;0.205;0.596	B;B;B	0.29077	0.098;0.058;0.066	T	0.48468	-0.9033	10	0.33940	T	0.23	-16.8806	10.5091	0.44851	0.0:0.9076:0.0:0.0924	.	204;174;204	E7EPP8;B4DTE5;P05108	.;.;CP11A_HUMAN	H	204;46;46;116	ENSP00000268053:R204H;ENSP00000351455:R46H;ENSP00000405488:R46H	ENSP00000268053:R204H	R	-	2	0	CYP11A1	72424452	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.963000	0.49184	0.884000	0.36064	0.643000	0.83706	CGC	.		0.567	CYP11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319737.1		
CYP2A6	1548	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	41354534	41354534	+	Missense_Mutation	SNP	G	G	T	rs60563539		TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr19:41354534G>T	ENST00000301141.5	-	3	498	c.478C>A	c.(478-480)Ctc>Atc	p.L160I	CTC-490E21.12_ENST00000601627.1_Intron	NM_000762.5	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 6	160			L -> H (in allele CYP2A6*2; unable to catalyze 7-hydroxylation of coumarin; causes switching from coumarin 7- hydroxylation to 3-hydroxylation; dbSNP:rs1801272). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2322567, ECO:0000269|PubMed:2748347, ECO:0000269|Ref.6}.		coumarin catabolic process (GO:0046226)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)	coumarin 7-hydroxylase activity (GO:0008389)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)	37			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	GTGCCCCGGAGGGCGTCGATG	0.706																																					p.L160I		.											.	CYP2A6	92	0			c.C478A						.						35.0	39.0	37.0					19																	41354534		2203	4299	6502	SO:0001583	missense	1548	exon3			CCCGGAGGGCGTC	AF182275	CCDS12568.1	19q13.2	2013-11-11	2003-01-14		ENSG00000255974	ENSG00000255974		"""Cytochrome P450s"""	2610	protein-coding gene	gene with protein product		122720	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6"""	CYP2A3		7668294, 2748347	Standard	NM_000762		Approved	CPA6, CYP2A	uc002opl.4	P11509	OTTHUMG00000182713	ENST00000301141.5:c.478C>A	19.37:g.41354534G>T	ENSP00000301141:p.Leu160Ile	56.0	0.0		63.0	7.0	NM_000762	A7YAE5|B2R7F6|P00190|P10890|Q16803|Q4VAT9|Q4VAU0|Q4VAU1|Q9H1Z7|Q9UCU0|Q9UK48	Missense_Mutation	SNP	ENST00000301141.5	37	CCDS12568.1	.	.	.	.	.	.	.	.	.	.	-	7.661	0.684983	0.14973	.	.	ENSG00000255974	ENST00000301141	T	0.72282	-0.64	2.95	-5.91	0.02269	.	0.336308	0.29676	U	0.011482	T	0.46814	0.1412	L	0.28649	0.875	0.09310	N	1	B	0.02656	0.0	B	0.25506	0.061	T	0.25187	-1.0139	10	0.49607	T	0.09	.	0.9801	0.01434	0.4696:0.1142:0.2033:0.2128	rs60563539	160	P11509	CP2A6_HUMAN	I	160	ENSP00000301141:L160I	ENSP00000301141:L160I	L	-	1	0	CYP2A6	46046374	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.497000	0.00969	-2.055000	0.00899	-1.602000	0.00811	CTC	.		0.706	CYP2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463259.1	NM_000762	
DCAF4L2	138009	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	88885240	88885242	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	CAC	CAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr8:88885240_88885242delCAC	ENST00000319675.3	-	1	1054_1056	c.958_960delGTG	c.(958-960)gtgdel	p.V320del		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	320										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						CGTTCACATGCACGGGTAGGTAG	0.537																																					p.320_320del		.											.	DCAF4L2	91	0			c.958_960del						.																																			SO:0001651	inframe_deletion	138009	exon1			CACATGCACGGGT	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.958_960delGTG	8.37:g.88885240_88885242delCAC	ENSP00000316496:p.Val320del	111.0	0.0		205.0	26.0	NM_152418		In_Frame_Del	DEL	ENST00000319675.3	37	CCDS6245.1																																																																																			.		0.537	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418	
DCAF4L2	138009	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	88885245	88885246	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr8:88885245_88885246delGT	ENST00000319675.3	-	1	1050_1051	c.954_955delAC	c.(952-957)ctacccfs	p.P319fs		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	319										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						ACATGCACGGGTAGGTAGGCGG	0.535																																					p.318_319del		.											.	DCAF4L2	91	0			c.954_955del						.																																			SO:0001589	frameshift_variant	138009	exon1			GCACGGGTAGGTA	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.954_955delAC	8.37:g.88885245_88885246delGT	ENSP00000316496:p.Pro319fs	114.0	0.0		214.0	27.0	NM_152418		Frame_Shift_Del	DEL	ENST00000319675.3	37	CCDS6245.1																																																																																			.		0.535	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418	
DCAF6	55827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	168014320	168014320	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr1:168014320G>C	ENST00000312263.6	+	14	2086	c.1882G>C	c.(1882-1884)Gag>Cag	p.E628Q	DCAF6_ENST00000367840.3_Missense_Mutation_p.E705Q|DCAF6_ENST00000367843.3_Missense_Mutation_p.E648Q|DCAF6_ENST00000432587.2_Missense_Mutation_p.E674Q	NM_001017977.2	NP_001017977.1	Q58WW2	DCAF6_HUMAN	DDB1 and CUL4 associated factor 6	628					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	36						CACCAATCCTGAGCCTCAGTT	0.473																																					p.E705Q		.											.	DCAF6	516	0			c.G2113C						.						66.0	67.0	67.0					1																	168014320		2203	4300	6503	SO:0001583	missense	55827	exon16			AATCCTGAGCCTC	AL136738	CCDS1267.2, CCDS30933.1, CCDS55657.1, CCDS55658.1	1q23.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000143164	ENSG00000143164		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30002	protein-coding gene	gene with protein product		610494	"""IQ motif and WD repeats 1"""	IQWD1		12032826	Standard	NM_018442		Approved	PC326	uc001gex.3	Q58WW2	OTTHUMG00000034572	ENST00000312263.6:c.1882G>C	1.37:g.168014320G>C	ENSP00000311949:p.Glu628Gln	134.0	0.0		389.0	225.0	NM_001198956	A2A295|B4DNB8|Q7L8I0|Q8IXH3|Q8TB19	Missense_Mutation	SNP	ENST00000312263.6	37	CCDS30933.1	.	.	.	.	.	.	.	.	.	.	G	13.03	2.116445	0.37339	.	.	ENSG00000143164	ENST00000367843;ENST00000432587;ENST00000312263;ENST00000367840	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.31	4.38	0.52667	WD40 repeat-like-containing domain (1);	0.171751	0.51477	N	0.000084	T	0.31199	0.0789	L	0.50333	1.59	0.31299	N	0.6884669999999999	B;B;P;D	0.62365	0.321;0.385;0.568;0.991	B;B;B;P	0.59703	0.084;0.387;0.216;0.862	T	0.07751	-1.0756	9	0.33141	T	0.24	.	14.1999	0.65696	0.0:0.1495:0.8505:0.0	.	674;705;628;648	B4DNB8;Q58WW2-3;Q58WW2;Q58WW2-2	.;.;DCAF6_HUMAN;.	Q	648;674;628;705	ENSP00000356817:E648Q;ENSP00000396238:E674Q;ENSP00000311949:E628Q;ENSP00000356814:E705Q	ENSP00000311949:E628Q	E	+	1	0	DCAF6	166280944	0.995000	0.38212	0.099000	0.21106	0.794000	0.44872	3.386000	0.52492	1.207000	0.43291	0.467000	0.42956	GAG	.		0.473	DCAF6-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083661.2	NM_018442	
DNAH8	1769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	38810541	38810541	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr6:38810541G>A	ENST00000359357.3	+	33	4310	c.4056G>A	c.(4054-4056)atG>atA	p.M1352I	DNAH8_ENST00000449981.2_Missense_Mutation_p.M1569I|DNAH8_ENST00000441566.1_Missense_Mutation_p.M1352I			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1352					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TGGAAATGATGACCAATAAGG	0.383																																					p.M1569I		.											.	DNAH8	615	0			c.G4707A						.						120.0	113.0	115.0					6																	38810541		2203	4300	6503	SO:0001583	missense	1769	exon35			AATGATGACCAAT	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.4056G>A	6.37:g.38810541G>A	ENSP00000352312:p.Met1352Ile	84.0	0.0		319.0	67.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	G	29.7	5.029218	0.93518	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.60171	0.21;0.21;0.21	5.46	5.46	0.80206	Dynein heavy chain, domain-2 (1);	0.000000	0.85682	D	0.000000	T	0.67477	0.2897	M	0.81112	2.525	0.80722	D	1	P	0.50156	0.932	P	0.52758	0.708	T	0.70425	-0.4875	10	0.54805	T	0.06	.	19.6693	0.95905	0.0:0.0:1.0:0.0	.	1352	Q96JB1	DYH8_HUMAN	I	1557;1557;1352;1352	ENSP00000333363:M1557I;ENSP00000352312:M1352I;ENSP00000402294:M1352I	ENSP00000333363:M1557I	M	+	3	0	DNAH8	38918519	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.943000	0.87716	2.711000	0.92665	0.650000	0.86243	ATG	.		0.383	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
DRP2	1821	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	100513348	100513348	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chrX:100513348C>G	ENST00000395209.3	+	22	2968	c.2441C>G	c.(2440-2442)gCt>gGt	p.A814G	DRP2_ENST00000538510.1_Missense_Mutation_p.A814G|DRP2_ENST00000541709.1_Missense_Mutation_p.A736G|DRP2_ENST00000402866.1_Missense_Mutation_p.A814G	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	814					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						GAGGAGGCAGCTGAGGCACCC	0.597																																					p.A814G		.											.	DRP2	132	0			c.C2441G						.						29.0	28.0	29.0					X																	100513348		2199	4290	6489	SO:0001583	missense	1821	exon22			AGGCAGCTGAGGC	U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.2441C>G	X.37:g.100513348C>G	ENSP00000378635:p.Ala814Gly	51.0	0.0		222.0	132.0	NM_001939	A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Missense_Mutation	SNP	ENST00000395209.3	37	CCDS14480.2	.	.	.	.	.	.	.	.	.	.	C	0.089	-1.170240	0.01660	.	.	ENSG00000102385	ENST00000402866;ENST00000395209;ENST00000541709;ENST00000538510	T;T;T;T	0.05081	3.62;3.62;3.5;3.62	4.48	1.63	0.23807	.	0.505563	0.21254	N	0.077586	T	0.01765	0.0056	N	0.02665	-0.54	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.46527	-0.9185	10	0.02654	T	1	-0.35	4.3961	0.11363	0.0:0.4408:0.1631:0.3961	.	814	Q13474	DRP2_HUMAN	G	814;814;736;814	ENSP00000385038:A814G;ENSP00000378635:A814G;ENSP00000444752:A736G;ENSP00000441051:A814G	ENSP00000378635:A814G	A	+	2	0	DRP2	100400004	0.047000	0.20315	0.069000	0.20011	0.354000	0.29330	0.522000	0.22909	0.334000	0.23590	0.422000	0.28245	GCT	.		0.597	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057522.3	NM_001939	
EIF3E	3646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	109229595	109229595	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr8:109229595C>A	ENST00000220849.5	-	8	879	c.817G>T	c.(817-819)Gtt>Ttt	p.V273F	EIF3E_ENST00000519030.1_Missense_Mutation_p.V180F|EIF3E_ENST00000519517.1_5'UTR	NM_001568.2	NP_001559.1			eukaryotic translation initiation factor 3, subunit E										EIF3E/RSPO2(6)	NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			TCTTTTAGAACCTGCCGACGT	0.308																																					p.V273F	GBM(15;360 410 8460 34179 52246)	.											.	EIF3E	188	0			c.G817T						.						58.0	54.0	55.0					8																	109229595		2198	4298	6496	SO:0001583	missense	3646	exon8			TTAGAACCTGCCG	U94175	CCDS6308.1	8q22-q23	2010-03-10	2007-07-27	2007-07-27	ENSG00000104408	ENSG00000104408			3277	protein-coding gene	gene with protein product		602210	"""eukaryotic translation initiation factor 3, subunit 6 48kDa"""	INT6, EIF3S6		9403073, 9295280	Standard	NM_001568		Approved	eIF3-p48, eIF3e	uc003ymu.3	P60228	OTTHUMG00000164858	ENST00000220849.5:c.817G>T	8.37:g.109229595C>A	ENSP00000220849:p.Val273Phe	18.0	0.0		46.0	12.0	NM_001568		Missense_Mutation	SNP	ENST00000220849.5	37	CCDS6308.1	.	.	.	.	.	.	.	.	.	.	C	12.49	1.955073	0.34471	.	.	ENSG00000104408	ENST00000220849;ENST00000519030;ENST00000519627	T;T;T	0.42900	0.96;0.96;0.96	5.29	5.29	0.74685	.	0.060765	0.64402	D	0.000004	T	0.47544	0.1451	M	0.71581	2.175	0.80722	D	1	B;P	0.43973	0.087;0.823	B;B	0.41510	0.036;0.359	T	0.44832	-0.9302	10	0.27082	T	0.32	-16.7748	19.294	0.94115	0.0:1.0:0.0:0.0	.	273;273	B2R806;P60228	.;EIF3E_HUMAN	F	273;180;146	ENSP00000220849:V273F;ENSP00000428796:V180F;ENSP00000430839:V146F	ENSP00000220849:V273F	V	-	1	0	EIF3E	109298771	1.000000	0.71417	1.000000	0.80357	0.349000	0.29174	7.776000	0.85560	2.640000	0.89533	0.655000	0.94253	GTT	.		0.308	EIF3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380612.2	NM_001568	
EIF4E1B	253314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	176070173	176070173	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr5:176070173C>A	ENST00000318682.6	+	4	690	c.106C>A	c.(106-108)Cca>Aca	p.P36T	EIF4E1B_ENST00000504597.1_Missense_Mutation_p.P36T	NM_001099408.1	NP_001092878.1	A6NMX2	I4E1B_HUMAN	eukaryotic translation initiation factor 4E family member 1B	36					regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)	translation initiation factor activity (GO:0003743)			breast(1)|large_intestine(1)|lung(2)|pancreas(1)	5	all_cancers(89;0.00185)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGAAAAGTCTCCAAACTCTCC	0.602																																					p.P36T		.											.	.	.	0			c.C106A						.						47.0	57.0	54.0					5																	176070173		1961	4145	6106	SO:0001583	missense	253314	exon4			AAGTCTCCAAACT		CCDS47345.1	5q35.2	2008-06-12			ENSG00000175766	ENSG00000175766			33179	protein-coding gene	gene with protein product						16191198	Standard	NM_001099408		Approved	FLJ36951	uc010jkf.1	A6NMX2	OTTHUMG00000163227	ENST00000318682.6:c.106C>A	5.37:g.176070173C>A	ENSP00000323714:p.Pro36Thr	113.0	0.0		185.0	72.0	NM_001099408		Missense_Mutation	SNP	ENST00000318682.6	37	CCDS47345.1	.	.	.	.	.	.	.	.	.	.	C	8.682	0.905479	0.17760	.	.	ENSG00000175766	ENST00000318682;ENST00000510660;ENST00000504597	T;T	0.41400	1.0;1.0	4.14	-0.355	0.12587	Translation Initiation factor eIF- 4e-like  domain (1);	.	.	.	.	T	0.18923	0.0454	N	0.14661	0.345	0.09310	N	1	B	0.29432	0.244	B	0.26864	0.074	T	0.20075	-1.0286	9	0.19147	T	0.46	.	2.9823	0.05957	0.3898:0.3842:0.0:0.226	.	36	A6NMX2	I4E1B_HUMAN	T	36	ENSP00000323714:P36T;ENSP00000427633:P36T	ENSP00000323714:P36T	P	+	1	0	EIF4E1B	176002779	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.939000	0.03933	0.097000	0.17492	0.561000	0.74099	CCA	.		0.602	EIF4E1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372187.1	NM_001099408	
ERO1LB	56605	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	236416758	236416758	+	Silent	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr1:236416758A>G	ENST00000354619.5	-	3	471	c.270T>C	c.(268-270)tgT>tgC	p.C90C	ERO1LB_ENST00000327333.8_Silent_p.C90C	NM_019891.3	NP_063944.3	Q86YB8	ERO1B_HUMAN	ERO1-like beta (S. cerevisiae)	90					4-hydroxyproline metabolic process (GO:0019471)|cell redox homeostasis (GO:0045454)|extracellular matrix organization (GO:0030198)|glucose homeostasis (GO:0042593)|insulin processing (GO:0030070)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(3)|large_intestine(8)|lung(8)|skin(2)|urinary_tract(1)	23	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Flavin adenine dinucleotide(DB03147)	CTTTTATTGAACAGTGGCCAT	0.383																																					p.C90C		.											.	ERO1LB	90	0			c.T270C						.						60.0	55.0	57.0					1																	236416758		2203	4300	6503	SO:0001819	synonymous_variant	56605	exon3			TATTGAACAGTGG	AF252538	CCDS31064.1	1q42.2-q43	2008-02-05			ENSG00000086619	ENSG00000086619			14355	protein-coding gene	gene with protein product		615437				10818100	Standard	NM_019891		Approved	ERO1-L(beta)	uc001hxt.3	Q86YB8	OTTHUMG00000039955	ENST00000354619.5:c.270T>C	1.37:g.236416758A>G		131.0	2.0		360.0	82.0	NM_019891	B4DF57|Q5T1H4|Q8IZ11|Q9NR62	Silent	SNP	ENST00000354619.5	37	CCDS31064.1																																																																																			.		0.383	ERO1LB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096371.1	NM_019891	
F2	2147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	46747715	46747715	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr11:46747715A>G	ENST00000311907.5	+	7	922	c.866A>G	c.(865-867)aAc>aGc	p.N289S	F2_ENST00000530231.1_Missense_Mutation_p.N289S	NM_000506.3	NP_000497.1	P00734	THRB_HUMAN	coagulation factor II (thrombin)	289	Kringle 2. {ECO:0000255|PROSITE- ProRule:PRU00121}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell surface receptor signaling pathway (GO:0007166)|cellular protein metabolic process (GO:0044267)|cytosolic calcium ion homeostasis (GO:0051480)|fibrinolysis (GO:0042730)|leukocyte migration (GO:0050900)|multicellular organismal development (GO:0007275)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|negative regulation of proteolysis (GO:0045861)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900738)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of blood coagulation (GO:0030193)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|thrombospondin receptor activity (GO:0070053)			endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	27		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|ART-123(DB05777)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Dabigatran etexilate(DB06695)|Drotrecogin alfa(DB00055)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Suramin(DB04786)|Ximelagatran(DB04898)	TGCGACCTCAACTATTGTGGT	0.577																																					p.N289S	Esophageal Squamous(147;1147 1808 2148 38609 51144)	.											.	F2	93	0			c.A866G						.						52.0	61.0	58.0					11																	46747715		2201	4299	6500	SO:0001583	missense	2147	exon7			ACCTCAACTATTG	M33031	CCDS31476.1	11p11.2	2013-02-28			ENSG00000180210	ENSG00000180210	3.4.21.5	"""Endogenous ligands"""	3535	protein-coding gene	gene with protein product	"""prepro-coagulation factor II"""	176930					Standard	NM_000506		Approved		uc001ndf.4	P00734	OTTHUMG00000150344	ENST00000311907.5:c.866A>G	11.37:g.46747715A>G	ENSP00000308541:p.Asn289Ser	24.0	0.0		27.0	12.0	NM_000506	B2R7F7|B4E1A7|Q4QZ40|Q53H04|Q53H06|Q69EZ7|Q7Z7P3|Q9UCA1	Missense_Mutation	SNP	ENST00000311907.5	37	CCDS31476.1	.	.	.	.	.	.	.	.	.	.	A	12.88	2.069530	0.36470	.	.	ENSG00000180210	ENST00000311907;ENST00000530231;ENST00000442468	T;T;T	0.79940	-1.32;-1.32;-1.32	5.27	2.58	0.30949	Kringle (4);Kringle-like fold (1);	0.736545	0.14306	N	0.327987	T	0.68339	0.2990	N	0.20685	0.6	0.27658	N	0.947178	B	0.29862	0.259	B	0.34590	0.186	T	0.64892	-0.6300	10	0.87932	D	0	.	8.2886	0.31943	0.7341:0.1358:0.0:0.1302	.	289	P00734	THRB_HUMAN	S	289;289;279	ENSP00000308541:N289S;ENSP00000433907:N289S;ENSP00000387413:N279S	ENSP00000308541:N289S	N	+	2	0	F2	46704291	0.694000	0.27738	0.985000	0.45067	0.667000	0.39255	2.536000	0.45693	1.985000	0.57927	0.460000	0.39030	AAC	.		0.577	F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317706.1		
FAM188A	80013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	15858832	15858832	+	Splice_Site	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr10:15858832A>G	ENST00000277632.3	-	10	1103		c.e10+1		FAM188A_ENST00000477891.1_Splice_Site|FAM188A_ENST00000378036.1_Splice_Site	NM_024948.2	NP_079224.1	Q9H8M7	F188A_HUMAN	family with sequence similarity 188, member A						apoptotic process (GO:0006915)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(2)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	22						CTATAAGCATACCTTGGCAAA	0.353																																					.	Pancreas(159;946 1953 2111 4475 22008)	.											.	FAM188A	228	0			c.882+2T>C						.						65.0	66.0	66.0					10																	15858832		2203	4300	6503	SO:0001630	splice_region_variant	80013	exon11			AAGCATACCTTGG	AK023459	CCDS7110.1	10p13	2009-07-14	2009-07-14	2009-07-14	ENSG00000148481	ENSG00000148481			23578	protein-coding gene	gene with protein product	"""caspase recruitment domain containing pro-apoptotic protein"", ""CARD-containing protein"""	611649	"""chromosome 10 open reading frame 97"""	C10orf97		12054670, 17652099	Standard	XM_005252600		Approved	FLJ13397, CARP, my042, DERP5	uc001iod.1	Q9H8M7	OTTHUMG00000017734	ENST00000277632.3:c.882+1T>C	10.37:g.15858832A>G		87.0	0.0		162.0	57.0	NM_024948	Q5SZ68|Q5SZ69|Q5SZ70|Q6IA40|Q6P7P0|Q7Z2S1|Q8WUF1|Q9H3I4	Splice_Site	SNP	ENST00000277632.3	37	CCDS7110.1	.	.	.	.	.	.	.	.	.	.	A	17.69	3.452530	0.63290	.	.	ENSG00000148481	ENST00000277632;ENST00000418767;ENST00000436829	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4223	0.67193	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAM188A	15898838	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	6.467000	0.73547	2.100000	0.63781	0.533000	0.62120	.	.		0.353	FAM188A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046990.2	NM_024948	Intron
FANK1	92565	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	127684064	127684064	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr10:127684064G>C	ENST00000368693.1	+	4	499	c.395G>C	c.(394-396)gGa>gCa	p.G132A	FANK1_ENST00000368689.1_Missense_Mutation_p.G132A|FANK1_ENST00000368695.1_Missense_Mutation_p.G126A			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	132						cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				ATACTTCAAGGAGGGTGAGAG	0.428																																					p.G132A		.											.	FANK1	91	0			c.G395C						.						168.0	152.0	157.0					10																	127684064		2203	4300	6503	SO:0001583	missense	92565	exon4			TTCAAGGAGGGTG	BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.395G>C	10.37:g.127684064G>C	ENSP00000357682:p.Gly132Ala	254.0	0.0		521.0	210.0	NM_145235	Q6UXY9|Q6X7T6	Missense_Mutation	SNP	ENST00000368693.1	37	CCDS31309.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.21|11.21	1.570538|1.570538	0.28003|0.28003	.|.	.|.	ENSG00000203780|ENSG00000203780	ENST00000456942|ENST00000368695;ENST00000368693;ENST00000445510;ENST00000368691;ENST00000368689;ENST00000368692	.|T;T;T;T;T	.|0.61859	.|0.07;0.07;1.6;0.07;1.6	4.21|4.21	3.29|3.29	0.37713|0.37713	.|Ankyrin repeat-containing domain (4);	.|0.411523	.|0.21885	.|N	.|0.067666	T|T	0.36635|0.36635	0.0974|0.0974	N|N	0.00894|0.00894	-1.105|-1.105	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.67145	.|0.996;0.99;0.978	.|P;P;P	.|0.61940	.|0.896;0.861;0.622	T|T	0.41161|0.41161	-0.9524|-0.9524	5|10	.|0.02654	.|T	.|1	-16.2468|-16.2468	10.2657|10.2657	0.43453|0.43453	0.0:0.2005:0.7995:0.0|0.0:0.2005:0.7995:0.0	.|.	.|158;132;132	.|Q8TC84-3;Q8TC84-2;Q8TC84	.|.;.;FANK1_HUMAN	Q|A	27|126;132;132;132;132;158	.|ENSP00000357684:G126A;ENSP00000357682:G132A;ENSP00000415719:G132A;ENSP00000357680:G132A;ENSP00000357678:G132A	.|ENSP00000357678:G132A	E|G	+|+	1|2	0|0	FANK1|FANK1	127674054|127674054	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.993000|0.993000	0.82548|0.82548	2.833000|2.833000	0.48159|0.48159	1.099000|1.099000	0.41499|0.41499	0.557000|0.557000	0.71058|0.71058	GAG|GGA	.		0.428	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_145235	
FAT3	120114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	92616349	92616349	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr11:92616349A>G	ENST00000298047.6	+	23	12744	c.12727A>G	c.(12727-12729)Agt>Ggt	p.S4243G	FAT3_ENST00000533797.1_Missense_Mutation_p.S578G|FAT3_ENST00000409404.2_Missense_Mutation_p.S4243G|FAT3_ENST00000525166.1_Missense_Mutation_p.S4093G			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	4243					homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CTGCTTCCAGAGTGACTCCAG	0.667										TCGA Ovarian(4;0.039)																											p.S4243G		.											.	FAT3	73	0			c.A12727G						.						71.0	86.0	81.0					11																	92616349		2079	4190	6269	SO:0001583	missense	120114	exon23			TTCCAGAGTGACT	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.12727A>G	11.37:g.92616349A>G	ENSP00000298047:p.Ser4243Gly	23.0	0.0		26.0	17.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	A	11.26	1.586430	0.28268	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166;ENST00000533797	T;T;T;D	0.86297	-0.85;-0.95;-0.86;-2.1	5.85	3.56	0.40772	.	.	.	.	.	T	0.80003	0.4544	L	0.36672	1.1	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.70536	-0.4845	9	0.34782	T	0.22	.	10.1404	0.42732	0.8656:0.0:0.1344:0.0	.	4243;4243	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	G	4243;4243;4093;578	ENSP00000298047:S4243G;ENSP00000387040:S4243G;ENSP00000432586:S4093G;ENSP00000436399:S578G	ENSP00000298047:S4243G	S	+	1	0	FAT3	92255997	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.087000	0.50167	0.488000	0.27723	0.533000	0.62120	AGT	.		0.667	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
FCRL2	79368	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	157739786	157739786	+	Silent	SNP	G	G	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr1:157739786G>A	ENST00000361516.3	-	4	513	c.465C>T	c.(463-465)ggC>ggT	p.G155G	FCRL2_ENST00000392274.3_Silent_p.G155G|FCRL2_ENST00000368181.4_Intron|FCRL2_ENST00000469986.1_5'Flank	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	155	Ig-like C2-type 2.				cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			AGCTGCTCCAGCCTGACCCCA	0.542																																					p.G155G		.											.	FCRL2	92	0			c.C465T						.						56.0	62.0	60.0					1																	157739786		2203	4300	6503	SO:0001819	synonymous_variant	79368	exon4			GCTCCAGCCTGAC	AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.465C>T	1.37:g.157739786G>A		94.0	0.0		392.0	223.0	NM_030764	A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Silent	SNP	ENST00000361516.3	37	CCDS1168.1																																																																																			.		0.542	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051408.2	NM_030764	
FRG1	2483	broad.mit.edu;mdanderson.org	37	4	190874235	190874235	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr4:190874235C>G	ENST00000226798.4	+	4	494	c.272C>G	c.(271-273)cCt>cGt	p.P91R	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	91					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		GATGAGGGCCCTAGTCCTCCA	0.284																																					p.P91R		.											.	FRG1	90	0			c.C272G						.						11.0	11.0	11.0					4																	190874235		2004	4059	6063	SO:0001583	missense	2483	exon4			AGGGCCCTAGTCC	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.272C>G	4.37:g.190874235C>G	ENSP00000226798:p.Pro91Arg	910.0	1.0		1922.0	120.0	NM_004477	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	17.68	3.448522	0.63178	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	T;T	0.71817	1.97;-0.6	3.71	3.71	0.42584	Actin cross-linking (1);	0.000000	0.85682	D	0.000000	D	0.85729	0.5764	M	0.89904	3.07	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.89026	0.3438	10	0.87932	D	0	-24.9555	13.8593	0.63550	0.0:1.0:0.0:0.0	.	91	Q14331	FRG1_HUMAN	R	91;28	ENSP00000226798:P91R;ENSP00000435943:P28R	ENSP00000226798:P91R	P	+	2	0	FRG1	191111229	1.000000	0.71417	0.998000	0.56505	0.944000	0.59088	5.379000	0.66196	2.022000	0.59522	0.632000	0.83419	CCT	.		0.284	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
GAL3ST3	89792	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	11	65810799	65810799	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr11:65810799C>A	ENST00000312006.4	-	3	756	c.475G>T	c.(475-477)Gag>Tag	p.E159*	GAL3ST3_ENST00000527878.1_Nonsense_Mutation_p.E159*	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	159					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						AAGAGCGACTCGAACATGGCG	0.682																																					p.E159X		.											.	GAL3ST3	91	0			c.G475T						.						32.0	34.0	34.0					11																	65810799		2199	4293	6492	SO:0001587	stop_gained	89792	exon3			GCGACTCGAACAT	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.475G>T	11.37:g.65810799C>A	ENSP00000308591:p.Glu159*	43.0	0.0		34.0	9.0	NM_033036	Q14D05	Nonsense_Mutation	SNP	ENST00000312006.4	37	CCDS8128.1	.	.	.	.	.	.	.	.	.	.	C	35	5.586885	0.96578	.	.	ENSG00000175229	ENST00000312006;ENST00000527878	.	.	.	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-21.8951	15.4161	0.74970	0.0:1.0:0.0:0.0	.	.	.	.	X	159	.	ENSP00000308591:E159X	E	-	1	0	GAL3ST3	65567375	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.758000	0.85224	2.304000	0.77564	0.561000	0.74099	GAG	.		0.682	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
GNB5	10681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	52418147	52418147	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr15:52418147C>A	ENST00000261837.7	-	11	1072	c.1007G>T	c.(1006-1008)aGt>aTt	p.S336I	GNB5_ENST00000396335.4_Missense_Mutation_p.S224I|GNB5_ENST00000559348.1_5'UTR|CTD-2184D3.7_ENST00000557898.1_RNA|GNB5_ENST00000358784.7_Missense_Mutation_p.S294I	NM_016194.3	NP_057278.2	O14775	GBB5_HUMAN	guanine nucleotide binding protein (G protein), beta 5	336					GTP catabolic process (GO:0006184)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|G-protein gamma-subunit binding (GO:0031682)|GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			large_intestine(1)|lung(1)	2				all cancers(107;0.0163)		AATCTTACCACTGAGGGAGAA	0.478																																					p.S336I		.											.	GNB5	227	0			c.G1007T						.						66.0	58.0	61.0					15																	52418147		2195	4292	6487	SO:0001583	missense	10681	exon11			TTACCACTGAGGG	AF017656	CCDS10149.1, CCDS45261.1	15q21.1	2013-01-10			ENSG00000069966	ENSG00000069966		"""WD repeat domain containing"""	4401	protein-coding gene	gene with protein product		604447				9606987	Standard	NM_016194		Approved	GB5	uc031qrz.1	O14775	OTTHUMG00000131892	ENST00000261837.7:c.1007G>T	15.37:g.52418147C>A	ENSP00000261837:p.Ser336Ile	76.0	0.0		213.0	79.0	NM_016194	B2RBR5|Q9HAU9|Q9UFT3	Missense_Mutation	SNP	ENST00000261837.7	37	CCDS10149.1	.	.	.	.	.	.	.	.	.	.	C	34	5.386658	0.95967	.	.	ENSG00000069966	ENST00000261837;ENST00000396335;ENST00000544480;ENST00000358784	T	0.01406	4.93	6.08	6.08	0.98989	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.15262	0.0368	M	0.93462	3.42	0.80722	D	1	D;D	0.89917	1.0;0.961	D;D	0.85130	0.997;0.935	T	0.00548	-1.1677	10	0.87932	D	0	-31.5859	20.6634	0.99662	0.0:1.0:0.0:0.0	.	336;224	O14775;O14775-3	GBB5_HUMAN;.	I	336;294;134;224	ENSP00000261837:S336I	ENSP00000261837:S336I	S	-	2	0	GNB5	50205439	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.539000	0.82063	2.894000	0.99253	0.655000	0.94253	AGT	.		0.478	GNB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254842.1		
GPRIN2	9721	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	46999358	46999358	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr10:46999358G>A	ENST00000374317.1	+	3	751	c.478G>A	c.(478-480)Ggt>Agt	p.G160S	GPRIN2_ENST00000374314.4_Missense_Mutation_p.G160S	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	160										breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						GCAGCCAGGTGGTACTTCTGG	0.642																																					p.G160S		.											.	GPRIN2	90	0			c.G478A						.						38.0	36.0	36.0					10																	46999358		2203	4300	6503	SO:0001583	missense	9721	exon3			CCAGGTGGTACTT	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.478G>A	10.37:g.46999358G>A	ENSP00000363436:p.Gly160Ser	30.0	0.0		37.0	7.0	NM_014696	Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	CCDS31192.1	.	.	.	.	.	.	.	.	.	.	G	1.992	-0.431496	0.04669	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.03242	4.0;4.0	5.31	-5.35	0.02697	.	1.294500	0.05175	N	0.500245	T	0.02083	0.0065	N	0.04043	-0.29	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.47774	-0.9091	10	0.13853	T	0.58	0.6492	14.9079	0.70733	0.2569:0.0:0.7431:0.0	.	160	O60269	GRIN2_HUMAN	S	160	ENSP00000363436:G160S;ENSP00000363433:G160S	ENSP00000363433:G160S	G	+	1	0	GPRIN2	46419364	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.612000	0.00884	-0.809000	0.04381	-0.145000	0.13849	GGT	.		0.642	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
H2AFY	9555	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	134724771	134724771	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr5:134724771C>T	ENST00000511689.1	-	2	606	c.13G>A	c.(13-15)Ggt>Agt	p.G5S	H2AFY_ENST00000312469.4_Missense_Mutation_p.G5S|H2AFY_ENST00000510038.1_Missense_Mutation_p.G5S|H2AFY_ENST00000304332.4_Missense_Mutation_p.G5S|H2AFY_ENST00000423969.2_Missense_Mutation_p.G5S	NM_001040158.1|NM_138610.2	NP_001035248.1|NP_613258.2	O75367	H2AY_HUMAN	H2A histone family, member Y	5	Histone H2A.				chromatin modification (GO:0016568)|dosage compensation (GO:0007549)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of cell cycle G2/M phase transition (GO:1902750)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of histone phosphorylation (GO:0033128)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|nucleosome assembly (GO:0006334)	Barr body (GO:0001740)|condensed chromosome (GO:0000793)|extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleosome (GO:0000786)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|sex chromatin (GO:0001739)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|double-stranded methylated DNA binding (GO:0010385)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|rDNA binding (GO:0000182)|transcription regulatory region DNA binding (GO:0044212)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TTCTTCCCACCGCGGCTCGAC	0.622																																					p.G5S		.											.	H2AFY	90	0			c.G13A						.						83.0	69.0	74.0					5																	134724771		2203	4300	6503	SO:0001583	missense	9555	exon2			TCCCACCGCGGCT	AF054174	CCDS4183.1, CCDS4184.1, CCDS4185.1	5q31.1	2011-01-27			ENSG00000113648	ENSG00000113648		"""Histones / Replication-independent"""	4740	protein-coding gene	gene with protein product		610054				9653160, 9714746	Standard	NM_004893		Approved	macroH2A1.2	uc003lam.1	O75367	OTTHUMG00000129141	ENST00000511689.1:c.13G>A	5.37:g.134724771C>T	ENSP00000423563:p.Gly5Ser	24.0	0.0		52.0	21.0	NM_138610	O75377|Q503A8|Q7Z5E3|Q96D41|Q9H8P3|Q9UP96	Missense_Mutation	SNP	ENST00000511689.1	37	CCDS4185.1	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909180	0.72868	.	.	ENSG00000113648	ENST00000511689;ENST00000304332;ENST00000312469;ENST00000423969;ENST00000510038	T;T;T;D;T	0.84442	1.58;1.6;1.59;-1.85;1.58	5.11	5.11	0.69529	Histone-fold (1);Histone H2A (1);	0.052671	0.85682	N	0.000000	D	0.89643	0.6774	L	0.44542	1.39	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.987;0.999;0.999;0.997	D	0.88148	0.2849	10	0.36615	T	0.2	.	18.7267	0.91716	0.0:1.0:0.0:0.0	.	5;5;5;5	B4DJC3;O75367-3;O75367-2;O75367	.;.;.;H2AY_HUMAN	S	5	ENSP00000423563:G5S;ENSP00000302572:G5S;ENSP00000310169:G5S;ENSP00000415121:G5S;ENSP00000424971:G5S	ENSP00000302572:G5S	G	-	1	0	H2AFY	134752670	1.000000	0.71417	0.990000	0.47175	0.921000	0.55340	7.644000	0.83416	2.665000	0.90641	0.573000	0.79308	GGT	.		0.622	H2AFY-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251196.3	NM_004893	
HIVEP1	3096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	12162108	12162108	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr6:12162108G>T	ENST00000379388.2	+	8	7256	c.6924G>T	c.(6922-6924)gaG>gaT	p.E2308D	HIVEP1_ENST00000541134.1_Missense_Mutation_p.E173D	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	2308					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				ACTACCCTGAGTCAGAAGAAA	0.448																																					p.E2308D		.											.	HIVEP1	139	0			c.G6924T						.						87.0	86.0	87.0					6																	12162108		1922	4148	6070	SO:0001583	missense	3096	exon8			CCCTGAGTCAGAA	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.6924G>T	6.37:g.12162108G>T	ENSP00000368698:p.Glu2308Asp	85.0	0.0		346.0	81.0	NM_002114	B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	ENST00000379388.2	37	CCDS43426.1	.	.	.	.	.	.	.	.	.	.	G	11.77	1.738734	0.30774	.	.	ENSG00000095951	ENST00000379388;ENST00000442081;ENST00000541134;ENST00000542327	T;T	0.25250	3.17;1.81	5.76	-4.43	0.03568	.	0.643086	0.12906	N	0.429327	T	0.01870	0.0059	N	0.12569	0.235	0.23923	N	0.996456	B	0.06786	0.001	B	0.04013	0.001	T	0.39981	-0.9587	10	0.05959	T	0.93	-15.0873	1.0466	0.01571	0.2636:0.2011:0.3367:0.1987	.	2308	P15822	ZEP1_HUMAN	D	2308;235;173;290	ENSP00000368698:E2308D;ENSP00000445617:E173D	ENSP00000368698:E2308D	E	+	3	2	HIVEP1	12270094	0.000000	0.05858	0.004000	0.12327	0.817000	0.46193	-0.512000	0.06313	-0.394000	0.07727	-0.290000	0.09829	GAG	.		0.448	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114	
HIST1H4G	8369	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26246995	26246995	+	Missense_Mutation	SNP	C	C	T	rs140916075		TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr6:26246995C>T	ENST00000244537.4	-	1	264	c.211G>A	c.(211-213)Gtg>Atg	p.V71M		NM_003547.2	NP_003538.1	Q99525	H4G_HUMAN	histone cluster 1, H4g	71						nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				GTGTTGGTCACGGCGTACCAG	0.592																																					p.V71M		.											.	HIST1H4G	68	0			c.G211A						.	C	MET/VAL	0,4406		0,0,2203	78.0	67.0	71.0		211	2.3	0.7	6	dbSNP_134	71	1,8599		0,1,4299	no	missense	HIST1H4G	NM_003547.2	21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	71/99	26246995	1,13005	2203	4300	6503	SO:0001583	missense	8369	exon1			TGGTCACGGCGTA	Z80788	CCDS4599.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000124578	ENSG00000275663		"""Histones / Replication-dependent"""	4792	protein-coding gene	gene with protein product		602832	"""H4 histone family, member L"", ""histone 1, H4g"""	H4FL		9119399, 12408966	Standard	NM_003547		Approved	H4/l	uc003nhf.3	Q99525	OTTHUMG00000014444	ENST00000244537.4:c.211G>A	6.37:g.26246995C>T	ENSP00000244537:p.Val71Met	82.0	0.0		223.0	120.0	NM_003547		Missense_Mutation	SNP	ENST00000244537.4	37	CCDS4599.1	.	.	.	.	.	.	.	.	.	.	.	9.134	1.012034	0.19277	0.0	1.16E-4	ENSG00000124578	ENST00000244537	T	0.68903	-0.36	3.2	2.32	0.28847	Histone-fold (2);Histone core (1);	.	.	.	.	T	0.72637	0.3485	.	.	.	0.33596	D	0.601659	D	0.89917	1.0	D	0.85130	0.997	T	0.73792	-0.3871	8	0.87932	D	0	.	10.1053	0.42530	0.0:0.8946:0.0:0.1054	.	71	Q99525	H4G_HUMAN	M	71	ENSP00000244537:V71M	ENSP00000244537:V71M	V	-	1	0	HIST1H4G	26354974	1.000000	0.71417	0.697000	0.30258	0.011000	0.07611	6.913000	0.75759	0.663000	0.31027	-0.539000	0.04255	GTG	C|1.000;T|0.000		0.592	HIST1H4G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040107.1	NM_003547	
IGFBP4	3487	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	38600272	38600272	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr17:38600272C>A	ENST00000269593.4	+	1	560	c.285C>A	c.(283-285)caC>caA	p.H95Q	IGFBP4_ENST00000542955.1_Intron	NM_001552.2	NP_001543.2	P22692	IBP4_HUMAN	insulin-like growth factor binding protein 4	95	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|DNA metabolic process (GO:0006259)|inflammatory response (GO:0006954)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)	5		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			CACTGATGCACGGGCAAGGCG	0.672																																					p.H95Q	GBM(160;940 3581 26177)	.											.	IGFBP4	522	0			c.C285A						.						18.0	12.0	14.0					17																	38600272		2144	4202	6346	SO:0001583	missense	3487	exon1			GATGCACGGGCAA	M38177	CCDS11367.1	17q21.2	2014-09-16	2001-11-28		ENSG00000141753	ENSG00000141753			5473	protein-coding gene	gene with protein product	"""IGF-binding protein 4"""	146733	"""insulin-like growth factor-binding protein 4"""			1707125, 1704481	Standard	NM_001552		Approved	IBP4, BP-4, HT29-IGFBP, IGFBP-4	uc002hus.3	P22692	OTTHUMG00000133326	ENST00000269593.4:c.285C>A	17.37:g.38600272C>A	ENSP00000269593:p.His95Gln	17.0	0.0		22.0	8.0	NM_001552	A0N9W2|B4E351|Q5U012|Q9UCL6	Missense_Mutation	SNP	ENST00000269593.4	37	CCDS11367.1	.	.	.	.	.	.	.	.	.	.	C	18.82	3.705853	0.68615	.	.	ENSG00000141753	ENST00000269593	T	0.62639	0.01	5.16	-3.05	0.05396	Insulin-like growth factor-binding protein, IGFBP (2);Growth factor, receptor (1);	0.449529	0.24343	N	0.039353	T	0.45034	0.1322	N	0.12663	0.25	0.80722	D	1	D	0.71674	0.998	P	0.59703	0.862	T	0.51996	-0.8634	10	0.16420	T	0.52	-11.3722	2.9448	0.05842	0.1073:0.4315:0.2129:0.2483	.	95	P22692	IBP4_HUMAN	Q	95	ENSP00000269593:H95Q	ENSP00000269593:H95Q	H	+	3	2	IGFBP4	35853798	0.000000	0.05858	0.867000	0.34043	0.993000	0.82548	-1.859000	0.01657	-0.385000	0.07833	0.591000	0.81541	CAC	.		0.672	IGFBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257134.1	NM_001552	
IRAK3	11213	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	66641584	66641584	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr12:66641584C>A	ENST00000261233.4	+	12	1845	c.1424C>A	c.(1423-1425)cCa>cAa	p.P475Q	IRAK3_ENST00000457197.2_Missense_Mutation_p.P414Q	NM_007199.2	NP_009130.2			interleukin-1 receptor-associated kinase 3											breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(28;0.0203)		GAGAATGTACCAAGTATTCCA	0.413																																					p.P475Q		.											.	IRAK3	1379	0			c.C1424A						.						122.0	112.0	116.0					12																	66641584		2203	4300	6503	SO:0001583	missense	11213	exon12			ATGTACCAAGTAT	AF113136	CCDS8975.1, CCDS44937.1	12q13.13	2008-05-02			ENSG00000090376	ENSG00000090376			17020	protein-coding gene	gene with protein product		604459				10383454	Standard	NM_001142523		Approved	IRAK-M	uc001sth.3	Q9Y616	OTTHUMG00000169002	ENST00000261233.4:c.1424C>A	12.37:g.66641584C>A	ENSP00000261233:p.Pro475Gln	185.0	2.0		274.0	97.0	NM_007199		Missense_Mutation	SNP	ENST00000261233.4	37	CCDS8975.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.147196	0.57151	.	.	ENSG00000090376	ENST00000261233;ENST00000457197	T;T	0.73363	-0.7;-0.74	5.77	4.87	0.63330	.	0.156821	0.44483	D	0.000442	T	0.64994	0.2649	L	0.34521	1.04	0.31593	N	0.65361	P;P	0.49253	0.873;0.921	B;B	0.43301	0.415;0.352	T	0.69359	-0.5166	9	.	.	.	-9.9015	12.1478	0.54034	0.1711:0.8289:0.0:0.0	.	414;475	Q9Y616-2;Q9Y616	.;IRAK3_HUMAN	Q	475;414	ENSP00000261233:P475Q;ENSP00000409852:P414Q	.	P	+	2	0	IRAK3	64927851	0.997000	0.39634	0.953000	0.39169	0.521000	0.34408	3.854000	0.55949	1.417000	0.47077	0.561000	0.74099	CCA	.		0.413	IRAK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401908.1		
IRF2	3660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	185340688	185340688	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr4:185340688G>A	ENST00000393593.3	-	3	329	c.122C>T	c.(121-123)gCg>gTg	p.A41V	IRF2_ENST00000512020.1_5'UTR	NM_002199.3	NP_002190.2	P14316	IRF2_HUMAN	interferon regulatory factor 2	41					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A41V(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	22		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		ATGTCTAGCCGCATGCATCCA	0.423																																					p.A41V		.											.	IRF2	91	1	Substitution - Missense(1)	large_intestine(1)	c.C122T						.						108.0	109.0	109.0					4																	185340688		2203	4300	6503	SO:0001583	missense	3660	exon3			CTAGCCGCATGCA		CCDS3835.1	4q34.1-q35.1	2008-07-29				ENSG00000168310			6117	protein-coding gene	gene with protein product		147576				2475256	Standard	NM_002199		Approved		uc003iwf.4	P14316		ENST00000393593.3:c.122C>T	4.37:g.185340688G>A	ENSP00000377218:p.Ala41Val	33.0	0.0		61.0	12.0	NM_002199	D6RCK5|H0Y8S3|Q6IAS7|Q96B99	Missense_Mutation	SNP	ENST00000393593.3	37	CCDS3835.1	.	.	.	.	.	.	.	.	.	.	G	32	5.135806	0.94517	.	.	ENSG00000168310	ENST00000393593;ENST00000507523;ENST00000510814;ENST00000506230;ENST00000505316	D;D;D;D	0.98044	-4.68;-4.68;-4.68;-4.68	4.99	4.99	0.66335	Interferon regulatory factor, conserved site (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.000000	0.85682	D	0.000000	D	0.98855	0.9613	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99785	1.1029	10	0.87932	D	0	-9.6502	18.4742	0.90786	0.0:0.0:1.0:0.0	.	41	P14316	IRF2_HUMAN	V	41	ENSP00000377218:A41V;ENSP00000427204:A41V;ENSP00000424552:A41V;ENSP00000422860:A41V	ENSP00000377218:A41V	A	-	2	0	IRF2	185577682	1.000000	0.71417	0.957000	0.39632	0.942000	0.58702	9.645000	0.98471	2.581000	0.87130	0.655000	0.94253	GCG	.		0.423	IRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361393.1		
ITIH2	3698	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	7773850	7773850	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr10:7773850delT	ENST00000358415.4	+	13	1704	c.1538delT	c.(1537-1539)gtcfs	p.V513fs	ITIH2_ENST00000379587.4_Frame_Shift_Del_p.V502fs	NM_002216.2	NP_002207.2	P19823	ITIH2_HUMAN	inter-alpha-trypsin inhibitor heavy chain 2	513					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(2)|breast(1)|endometrium(8)|kidney(1)|large_intestine(17)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64						GTCACGGACGTCACTCAAAAC	0.433																																					p.V513fs		.											.	ITIH2	93	0			c.1538delT						.						172.0	165.0	167.0					10																	7773850		2203	4300	6503	SO:0001589	frameshift_variant	3698	exon13			CGGACGTCACTCA	X07173	CCDS31141.1	10p14	2011-10-26	2011-10-26		ENSG00000151655	ENSG00000151655			6167	protein-coding gene	gene with protein product		146640	"""inter-alpha (globulin) inhibitor, H2 polypeptide"""			1385302, 10100603	Standard	NM_002216		Approved	H2P	uc001ijs.3	P19823	OTTHUMG00000017633	ENST00000358415.4:c.1538delT	10.37:g.7773850delT	ENSP00000351190:p.Val513fs	53.0	0.0		81.0	39.0	NM_002216	Q14659|Q15484|Q5T986	Frame_Shift_Del	DEL	ENST00000358415.4	37	CCDS31141.1																																																																																			.		0.433	ITIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046678.2	NM_002216	
KCMF1	56888	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	85255054	85255054	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr2:85255054G>A	ENST00000409785.4	+	2	418	c.59G>A	c.(58-60)cGc>cAc	p.R20H		NM_020122.4	NP_064507.3	Q9P0J7	KCMF1_HUMAN	potassium channel modulatory factor 1	20							ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			ovary(3)	3						TTTCGAGGTCGCAGATATAAG	0.363																																					p.R20H		.											.	KCMF1	24	0			c.G59A						.						110.0	99.0	103.0					2																	85255054		1903	4150	6053	SO:0001583	missense	56888	exon2			GAGGTCGCAGATA	AF155652	CCDS46350.1	2p11.2	2010-11-23			ENSG00000176407	ENSG00000176407		"""Zinc fingers, ZZ-type"""	20589	protein-coding gene	gene with protein product		614719					Standard	NM_020122		Approved	DEBT91, PCMF, DKFZP434L1021, ZZZ1	uc002sox.4	Q9P0J7	OTTHUMG00000153004	ENST00000409785.4:c.59G>A	2.37:g.85255054G>A	ENSP00000386738:p.Arg20His	166.0	0.0		258.0	103.0	NM_020122	Q4ZG04|Q53SC7|Q9BWK2|Q9H8P5|Q9UFE8	Missense_Mutation	SNP	ENST00000409785.4	37	CCDS46350.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.469646	0.84533	.	.	ENSG00000176407	ENST00000409785	D	0.91295	-2.82	5.46	4.59	0.56863	Zinc finger, ZZ-type (4);	0.052611	0.85682	D	0.000000	D	0.92001	0.7466	L	0.47716	1.5	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.88933	0.3374	10	0.15499	T	0.54	-5.9955	12.0886	0.53713	0.0842:0.0:0.9158:0.0	.	20	Q9P0J7	KCMF1_HUMAN	H	20	ENSP00000386738:R20H	ENSP00000386738:R20H	R	+	2	0	KCMF1	85108565	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.869000	0.99810	1.309000	0.44985	0.591000	0.81541	CGC	.		0.363	KCMF1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328942.4	NM_020122	
KCTD8	386617	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	4	44449751	44449751	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr4:44449751T>A	ENST00000360029.3	-	1	1073	c.790A>T	c.(790-792)Aag>Tag	p.K264*	AC131951.1_ENST00000584757.1_RNA	NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	264					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						GACGTGTACTTCTCCGGCTGC	0.652										HNSCC(17;0.042)																											p.K264X		.											.	KCTD8	92	0			c.A790T						.						45.0	40.0	42.0					4																	44449751		2203	4300	6503	SO:0001587	stop_gained	386617	exon1			TGTACTTCTCCGG	AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.790A>T	4.37:g.44449751T>A	ENSP00000353129:p.Lys264*	53.0	0.0		55.0	16.0	NM_198353	A2RU39	Nonsense_Mutation	SNP	ENST00000360029.3	37	CCDS3467.1	.	.	.	.	.	.	.	.	.	.	T	39	7.791863	0.98492	.	.	ENSG00000183783	ENST00000360029	.	.	.	4.19	4.19	0.49359	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	.	12.5991	0.56487	0.0:0.0:0.0:1.0	.	.	.	.	X	264	.	ENSP00000353129:K264X	K	-	1	0	KCTD8	44144508	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.451000	0.44952	1.765000	0.52091	0.477000	0.44152	AAG	.		0.652	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
KDM1B	221656	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	18215297	18215297	+	Silent	SNP	C	C	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr6:18215297C>A	ENST00000297792.5	+	16	1650	c.1473C>A	c.(1471-1473)acC>acA	p.T491T	KDM1B_ENST00000397244.1_Silent_p.T492T|KDM1B_ENST00000546309.2_Silent_p.T14T|KDM1B_ENST00000388870.2_Silent_p.T724T			Q8NB78	KDM1B_HUMAN	lysine (K)-specific demethylase 1B	723					DNA methylation involved in gamete generation (GO:0043046)|histone H3-K4 demethylation (GO:0034720)|multicellular organismal development (GO:0007275)|regulation of DNA methylation (GO:0044030)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-monomethyl-K4 specific) (GO:0034649)|oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|large_intestine(6)|lung(8)|skin(3)|upper_aerodigestive_tract(1)	25						CCGTGAGGACCCTGGATGACA	0.582																																					p.T491T		.											.	KDM1B	91	0			c.C1473A						.						78.0	72.0	74.0					6																	18215297		2203	4300	6503	SO:0001819	synonymous_variant	221656	exon16			GAGGACCCTGGAT	AK125318	CCDS34343.1	6p22.3	2011-07-01	2009-09-29	2009-09-29	ENSG00000165097	ENSG00000165097		"""Chromatin-modifying enzymes / K-demethylases"""	21577	protein-coding gene	gene with protein product		613081	"""amine oxidase, flavin containing 1"", ""chromosome 6 open reading frame 193"", ""amine oxidase (flavin containing) domain 1"""	C6orf193, AOF1		19407342, 19727073	Standard	NM_153042		Approved	FLJ34109, FLJ33898, dJ298J15.2, bA204B7.3, FLJ43328, LSD2	uc003ncn.1	Q8NB78	OTTHUMG00000014316	ENST00000297792.5:c.1473C>A	6.37:g.18215297C>A		51.0	0.0		141.0	30.0	NM_153042	A2A2C5|A2A2C6|Q5TGV3|Q6AI15|Q6ZUU4|Q8N258|Q96EL7	Silent	SNP	ENST00000297792.5	37	CCDS34343.1	.	.	.	.	.	.	.	.	.	.	C	6.645	0.487486	0.12641	.	.	ENSG00000165097	ENST00000449850	.	.	.	5.99	5.12	0.69794	.	.	.	.	.	T	0.45736	0.1357	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50136	-0.8863	4	.	.	.	-11.1785	7.8068	0.29206	0.0:0.7137:0.135:0.1513	.	.	.	.	H	541	.	.	P	+	2	0	KDM1B	18323276	0.995000	0.38212	0.888000	0.34837	0.532000	0.34746	0.490000	0.22403	1.518000	0.48934	0.650000	0.86243	CCC	.		0.582	KDM1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277080.1	NM_153042	
KNDC1	85442	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	134981785	134981785	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr10:134981785C>A	ENST00000304613.3	+	3	350	c.329C>A	c.(328-330)cCc>cAc	p.P110H	KNDC1_ENST00000368572.2_Missense_Mutation_p.P110H|KNDC1_ENST00000368571.2_Missense_Mutation_p.P45H|KNDC1_ENST00000530127.1_3'UTR			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	110	KIND 1. {ECO:0000255|PROSITE- ProRule:PRU00709}.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		TTCGTTCCCCCCGAGTTCGAC	0.577																																					p.P110H		.											.	KNDC1	229	0			c.C329A						.						119.0	114.0	116.0					10																	134981785		2203	4300	6503	SO:0001583	missense	85442	exon3			TTCCCCCCGAGTT	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.329C>A	10.37:g.134981785C>A	ENSP00000304437:p.Pro110His	27.0	0.0		43.0	13.0	NM_152643	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	C	15.24	2.775382	0.49786	.	.	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	D;D;T	0.91945	-2.94;-2.94;-0.59	4.14	4.14	0.48551	KIND (2);	0.000000	0.64402	D	0.000008	D	0.95589	0.8566	M	0.78049	2.395	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.96124	0.9087	10	0.87932	D	0	-17.5516	14.3225	0.66496	0.0:1.0:0.0:0.0	.	45;110	Q76NI1-2;Q76NI1	.;VKIND_HUMAN	H	110;110;45	ENSP00000304437:P110H;ENSP00000357561:P110H;ENSP00000357560:P45H	ENSP00000304437:P110H	P	+	2	0	KNDC1	134831775	1.000000	0.71417	0.993000	0.49108	0.027000	0.11550	6.552000	0.73914	2.052000	0.61016	0.485000	0.47835	CCC	.		0.577	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
LAMC1	3915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	183093943	183093943	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr1:183093943A>G	ENST00000258341.4	+	14	2836	c.2579A>G	c.(2578-2580)tAt>tGt	p.Y860C		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	860	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						GCTGGCTTCTATTGTGACCGG	0.478																																					p.Y860C		.											.	LAMC1	252	0			c.A2579G						.						90.0	80.0	83.0					1																	183093943		2203	4300	6503	SO:0001583	missense	3915	exon14			GCTTCTATTGTGA	J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.2579A>G	1.37:g.183093943A>G	ENSP00000258341:p.Tyr860Cys	77.0	0.0		221.0	48.0	NM_002293	Q5VYE7	Missense_Mutation	SNP	ENST00000258341.4	37	CCDS1351.1	.	.	.	.	.	.	.	.	.	.	A	18.52	3.642132	0.67244	.	.	ENSG00000135862	ENST00000258341	T	0.61392	0.11	5.51	5.51	0.81932	EGF-like, laminin (4);	0.054008	0.85682	D	0.000000	T	0.76572	0.4006	M	0.80332	2.49	0.58432	D	0.999994	D	0.89917	1.0	D	0.71414	0.973	T	0.80082	-0.1531	10	0.66056	D	0.02	.	15.2812	0.73787	1.0:0.0:0.0:0.0	.	860	P11047	LAMC1_HUMAN	C	860	ENSP00000258341:Y860C	ENSP00000258341:Y860C	Y	+	2	0	LAMC1	181360566	1.000000	0.71417	0.980000	0.43619	0.978000	0.69477	4.890000	0.63178	2.091000	0.63221	0.528000	0.53228	TAT	.		0.478	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2	NM_002293	
LMNB1	4001	broad.mit.edu;ucsc.edu;mdanderson.org	37	5	126145938	126145938	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr5:126145938G>T	ENST00000261366.5	+	4	1070	c.709G>T	c.(709-711)Gag>Tag	p.E237*	LMNB1_ENST00000395354.1_Nonsense_Mutation_p.E237*|LMNB1_ENST00000460265.1_3'UTR	NM_001198557.1|NM_005573.3	NP_001185486.1|NP_005564.1	P20700	LMNB1_HUMAN	lamin B1	237	Linker 2.|Rod.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	lamin filament (GO:0005638)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.103)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.033)|OV - Ovarian serous cystadenocarcinoma(64;0.0398)|all cancers(49;0.0903)		GCGTCAAATTGAGTATGAGTA	0.483																																					p.E237X		.											.	LMNB1	226	0			c.G709T						.						139.0	131.0	134.0					5																	126145938		2203	4300	6503	SO:0001587	stop_gained	4001	exon4			CAAATTGAGTATG	L37737	CCDS4140.1	5q23.2	2013-01-16			ENSG00000113368	ENSG00000113368		"""Intermediate filaments type V, lamins"""	6637	protein-coding gene	gene with protein product		150340				7557986, 8838815	Standard	NM_005573		Approved		uc003kud.2	P20700	OTTHUMG00000128969	ENST00000261366.5:c.709G>T	5.37:g.126145938G>T	ENSP00000261366:p.Glu237*	69.0	1.0		102.0	37.0	NM_005573	B2R6J6|Q3SYN7|Q96EI6	Nonsense_Mutation	SNP	ENST00000261366.5	37	CCDS4140.1	.	.	.	.	.	.	.	.	.	.	G	39	7.474806	0.98306	.	.	ENSG00000113368	ENST00000261366;ENST00000395354	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	19.9659	0.97266	0.0:0.0:1.0:0.0	.	.	.	.	X	237	.	ENSP00000261366:E237X	E	+	1	0	LMNB1	126173837	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.813000	0.99286	2.802000	0.96397	0.650000	0.86243	GAG	.		0.483	LMNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250956.2	NM_005573	
LPA	4018	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	161006134	161006134	+	Silent	SNP	A	A	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr6:161006134A>C	ENST00000316300.5	-	26	4277	c.4233T>G	c.(4231-4233)tcT>tcG	p.S1411S	LPA_ENST00000447678.1_Silent_p.S1411S			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3919	Kringle 13. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TAGACGACCAAGACTGACATG	0.458																																					p.S1411S		.											.	LPA	74	0			c.T4233G						.						225.0	226.0	225.0					6																	161006134		2190	4295	6485	SO:0001819	synonymous_variant	4018	exon27			CGACCAAGACTGA	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.4233T>G	6.37:g.161006134A>C		91.0	0.0		216.0	66.0	NM_005577	Q5VTD7|Q9UD88	Silent	SNP	ENST00000316300.5	37	CCDS43523.1																																																																																			.		0.458	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577	
MACC1	346389	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	20199410	20199410	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr7:20199410A>T	ENST00000400331.5	-	5	882	c.574T>A	c.(574-576)Tgc>Agc	p.C192S	MACC1_ENST00000332878.4_Missense_Mutation_p.C192S|MACC1_ENST00000589011.1_Missense_Mutation_p.C192S	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	192					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						AAATCAAGGCAGGAGCGGGCC	0.483																																					p.C192S		.											.	MACC1	93	0			c.T574A						.						54.0	53.0	54.0					7																	20199410		2203	4300	6503	SO:0001583	missense	346389	exon5			CAAGGCAGGAGCG		CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.574T>A	7.37:g.20199410A>T	ENSP00000383185:p.Cys192Ser	93.0	0.0		175.0	41.0	NM_182762	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Missense_Mutation	SNP	ENST00000400331.5	37	CCDS5369.1	.	.	.	.	.	.	.	.	.	.	A	18.89	3.718563	0.68844	.	.	ENSG00000183742	ENST00000400331;ENST00000332878	T;T	0.29397	1.57;1.57	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.57242	0.2040	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.61691	-0.7011	10	0.87932	D	0	-9.7184	15.9795	0.80097	1.0:0.0:0.0:0.0	.	192	Q6ZN28	MACC1_HUMAN	S	192	ENSP00000383185:C192S;ENSP00000328410:C192S	ENSP00000328410:C192S	C	-	1	0	MACC1	20165935	1.000000	0.71417	0.998000	0.56505	0.713000	0.41058	9.339000	0.96797	2.168000	0.68352	0.477000	0.44152	TGC	.		0.483	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5	NM_182762	
MACROD1	28992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	63918758	63918758	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr11:63918758A>G	ENST00000255681.6	-	3	536	c.470T>C	c.(469-471)cTc>cCc	p.L157P	MACROD1_ENST00000538595.1_5'UTR	NM_014067.3	NP_054786.2	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1	157	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|large_intestine(3)|lung(6)|skin(1)	11						GTCGCTGCGGAGCAGGGAGAT	0.602																																					p.L157P		.											.	MACROD1	68	0			c.T470C						.						181.0	148.0	159.0					11																	63918758		2201	4297	6498	SO:0001583	missense	28992	exon3			CTGCGGAGCAGGG	AF202922	CCDS8056.1	11q13.1	2007-07-24	2007-06-11		ENSG00000133315	ENSG00000133315			29598	protein-coding gene	gene with protein product		610400				15691879	Standard	NM_014067		Approved	LRP16	uc001nyh.3	Q9BQ69	OTTHUMG00000167843	ENST00000255681.6:c.470T>C	11.37:g.63918758A>G	ENSP00000255681:p.Leu157Pro	63.0	0.0		116.0	44.0	NM_014067	Q9UH96	Missense_Mutation	SNP	ENST00000255681.6	37	CCDS8056.1	.	.	.	.	.	.	.	.	.	.	A	14.64	2.594495	0.46214	.	.	ENSG00000133315	ENST00000255681	T	0.23348	1.91	3.86	2.69	0.31865	Appr-1-p processing (2);	0.361143	0.27754	N	0.017981	T	0.28863	0.0716	L	0.58810	1.83	0.43874	D	0.996487	P	0.36990	0.577	B	0.42343	0.384	T	0.04537	-1.0944	10	0.72032	D	0.01	-5.7312	8.94	0.35725	0.8338:0.0:0.0:0.1662	.	157	Q9BQ69	MACD1_HUMAN	P	157	ENSP00000255681:L157P	ENSP00000255681:L157P	L	-	2	0	MACROD1	63675334	1.000000	0.71417	0.974000	0.42286	0.615000	0.37417	3.573000	0.53856	0.456000	0.26937	0.379000	0.24179	CTC	.		0.602	MACROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396570.1	NM_014067	
MAPK7	5598	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	19285441	19285441	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr17:19285441C>T	ENST00000308406.5	+	5	2211	c.1825C>T	c.(1825-1827)Cct>Tct	p.P609S	MAPK7_ENST00000571657.1_Intron|MAPK7_ENST00000395604.3_Missense_Mutation_p.P609S|MFAP4_ENST00000574313.2_5'Flank|MAPK7_ENST00000395602.4_Missense_Mutation_p.P609S|MAPK7_ENST00000299612.7_Missense_Mutation_p.P470S	NM_139033.2	NP_620602.2	Q13164	MK07_HUMAN	mitogen-activated protein kinase 7	609	May not be required for kinase activity; required to stimulate MEF2C activity. {ECO:0000250}.|Pro-rich.				cAMP-mediated signaling (GO:0019933)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to transforming growth factor beta stimulus (GO:0071560)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cAMP catabolic process (GO:0030821)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of response to cytokine stimulus (GO:0060761)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of angiogenesis (GO:0045765)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|mitogen-activated protein kinase binding (GO:0051019)			autonomic_ganglia(1)|central_nervous_system(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(9)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	30	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					TCCTCCTGGCCCTGTAGCCCA	0.726																																					p.P609S		.											.	MAPK7	1402	0			c.C1825T						.						19.0	18.0	18.0					17																	19285441		2199	4290	6489	SO:0001583	missense	5598	exon5			CCTGGCCCTGTAG	U25278	CCDS11206.1, CCDS11207.1	17p11.2	2011-06-09			ENSG00000166484	ENSG00000166484	2.7.11.24	"""Mitogen-activated protein kinase cascade / Kinases"""	6880	protein-coding gene	gene with protein product	"""BMK1 kinase"", ""extracellular-signal-regulated kinase 5"""	602521		PRKM7		10072598, 7759517	Standard	NM_139032		Approved	BMK1, ERK5	uc002gvp.3	Q13164	OTTHUMG00000059587	ENST00000308406.5:c.1825C>T	17.37:g.19285441C>T	ENSP00000311005:p.Pro609Ser	111.0	1.0		124.0	43.0	NM_002749	Q16634|Q59F50|Q6QLU7|Q7L4P4|Q969G1|Q96G51	Missense_Mutation	SNP	ENST00000308406.5	37	CCDS11206.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.490707	0.01018	.	.	ENSG00000166484	ENST00000308406;ENST00000299612;ENST00000395604;ENST00000395602	T;T;T;T	0.72725	-0.44;-0.68;-0.44;-0.44	4.63	2.62	0.31277	.	0.618817	0.15042	N	0.283799	T	0.42653	0.1212	N	0.08118	0	0.24741	N	0.993033	B	0.02656	0.0	B	0.01281	0.0	T	0.21518	-1.0243	10	0.13108	T	0.6	-2.9068	4.2814	0.10834	0.1798:0.6239:0.0:0.1964	.	609	Q13164	MK07_HUMAN	S	609;470;609;609	ENSP00000311005:P609S;ENSP00000299612:P470S;ENSP00000378968:P609S;ENSP00000378966:P609S	ENSP00000299612:P470S	P	+	1	0	MAPK7	19226034	0.020000	0.18652	0.952000	0.39060	0.027000	0.11550	0.816000	0.27267	0.389000	0.25086	-0.339000	0.08088	CCT	.		0.726	MAPK7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132506.1	NM_139033	
MFSD5	84975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53647509	53647509	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr12:53647509C>A	ENST00000329548.4	+	2	1081	c.890C>A	c.(889-891)tCc>tAc	p.S297Y	MFSD5_ENST00000534842.1_Missense_Mutation_p.S404Y	NM_032889.4	NP_116278.3	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing 5	297					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(3)|urinary_tract(1)	16						CTTGGCTCTTCCCTGTACCGT	0.562																																					p.S404Y		.											.	MFSD5	93	0			c.C1211A						.						94.0	80.0	85.0					12																	53647509		2203	4300	6503	SO:0001583	missense	84975	exon2			GCTCTTCCCTGTA	AK097576	CCDS8851.1, CCDS53796.1	12q13.13	2012-03-09			ENSG00000182544	ENSG00000182544			28156	protein-coding gene	gene with protein product							Standard	NM_032889		Approved	MGC11308	uc001sch.2	Q6N075	OTTHUMG00000170028	ENST00000329548.4:c.890C>A	12.37:g.53647509C>A	ENSP00000332624:p.Ser297Tyr	62.0	0.0		141.0	52.0	NM_001170790	G3V1N7|Q6NW04|Q8N7W8|Q8NCK0|Q96IA5	Missense_Mutation	SNP	ENST00000329548.4	37	CCDS8851.1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.863953	0.51482	.	.	ENSG00000182544	ENST00000551660;ENST00000534842;ENST00000328704;ENST00000329548	.	.	.	5.04	4.15	0.48705	Major facilitator superfamily domain, general substrate transporter (1);	0.442010	0.22915	N	0.054086	T	0.64461	0.2600	M	0.66439	2.03	0.48762	D	0.999702	D;D	0.64830	0.991;0.994	P;P	0.53102	0.703;0.718	T	0.62798	-0.6778	9	0.31617	T	0.26	-17.4767	12.2428	0.54553	0.0:0.9158:0.0:0.0842	.	297;404	Q6N075;G3V1N7	MFSD5_HUMAN;.	Y	404;404;404;297	.	ENSP00000331231:S404Y	S	+	2	0	MFSD5	51933776	1.000000	0.71417	0.997000	0.53966	0.844000	0.47949	2.985000	0.49362	1.130000	0.42092	0.561000	0.74099	TCC	.		0.562	MFSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406896.1	NM_032889	
MIR517A	574479	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	54216629	54216629	+	RNA	SNP	C	C	T	rs550303151		TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr19:54216629C>T	ENST00000385001.1	+	0	87				MIR519D_ENST00000385246.1_RNA|MIR524_ENST00000385242.1_RNA	NR_030201.1				microRNA 517a																		CAAAGGGAAGCGCTTTCTGTT	0.423													C|||	1	0.000199681	0.0	0.0	5008	,	,		18550	0.0		0.0	False		,,,				2504	0.001				.		.											.	.	.	0			.						.						134.0	123.0	126.0					19																	54216629		1568	3582	5150			574480	.			GGGAAGCGCTTTC			19q13.42	2011-09-12		2008-12-18	ENSG00000207734	ENSG00000207734		"""ncRNAs / Micro RNAs"""	32111	non-coding RNA	RNA, micro				MIRN517A			Standard	NR_030201		Approved	hsa-mir-517a	uc021vae.1				19.37:g.54216629C>T		142.0	0.0		229.0	79.0	.		RNA	SNP	ENST00000385001.1	37																																																																																				.		0.423	MIR517A-201	KNOWN	basic	miRNA	miRNA		NR_030201	
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	49449093	49449100	+	Frame_Shift_Del	DEL	CTTCTGGC	CTTCTGGC	-			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	CTTCTGGC	CTTCTGGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr12:49449093_49449100delCTTCTGGC	ENST00000301067.7	-	1	7_14	c.8_15delGCCAGAAG	c.(7-15)agccagaagfs	p.SQK3fs		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CACCAGCCAGCTTCTGGCTGTCCATCCC	0.49																																					p.3_5del		.											.	MLL2	612	0			c.8_15del						.																																			SO:0001589	frameshift_variant	8085	exon1			AGCCAGCTTCTGG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.8_15delGCCAGAAG	12.37:g.49449093_49449100delCTTCTGGC	ENSP00000301067:p.Ser3fs	93.0	0.0		90.0	26.0	NM_003482	O14687	Frame_Shift_Del	DEL	ENST00000301067.7	37	CCDS44873.1																																																																																			.		0.490	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	151884488	151884488	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr7:151884488C>A	ENST00000262189.6	-	33	5085	c.4867G>T	c.(4867-4869)Gaa>Taa	p.E1623*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.E1623*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1623					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTTTCTCCTTCCACAGTGGGA	0.433																																					p.E1623X		.											.	MLL3	1398	0			c.G4867T						.						180.0	181.0	181.0					7																	151884488		2203	4300	6503	SO:0001587	stop_gained	58508	exon33			CTCCTTCCACAGT	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.4867G>T	7.37:g.151884488C>A	ENSP00000262189:p.Glu1623*	94.0	0.0		212.0	112.0	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	47	13.290567	0.99732	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	.	.	.	5.47	5.47	0.80525	.	0.000000	0.44483	U	0.000447	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	19.6994	0.96047	0.0:1.0:0.0:0.0	.	.	.	.	X	1623	.	ENSP00000262189:E1623X	E	-	1	0	MLL3	151515421	1.000000	0.71417	0.999000	0.59377	0.954000	0.61252	7.776000	0.85560	2.718000	0.92993	0.579000	0.79373	GAA	.		0.433	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MUC16	94025	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	9057202	9057202	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr19:9057202C>A	ENST00000397910.4	-	3	30447	c.30244G>T	c.(30244-30246)Gaa>Taa	p.E10082*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10084	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GCCAGTATTTCAACTGAGGTG	0.478																																					p.E10082X		.											.	MUC16	566	0			c.G30244T						.						101.0	96.0	97.0					19																	9057202		1945	4155	6100	SO:0001587	stop_gained	94025	exon3			GTATTTCAACTGA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.30244G>T	19.37:g.9057202C>A	ENSP00000381008:p.Glu10082*	106.0	1.0		209.0	70.0	NM_024690	Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	60	47.046723	0.99987	.	.	ENSG00000181143	ENST00000397910	.	.	.	2.49	1.44	0.22558	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.1715	0.15112	0.0:0.8319:0.0:0.1681	.	.	.	.	X	10082	.	ENSP00000381008:E10082X	E	-	1	0	MUC16	8918202	0.000000	0.05858	0.002000	0.10522	0.114000	0.19823	-0.766000	0.04725	0.602000	0.29896	0.467000	0.42956	GAA	.		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC5B	727897	ucsc.edu;bcgsc.ca	37	11	1261426	1261426	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr11:1261426A>G	ENST00000529681.1	+	30	3849	c.3791A>G	c.(3790-3792)gAg>gGg	p.E1264G	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.E1267G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1264					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TGCACCTATGAGGACAGGACC	0.652																																					p.E1264G		.											.	.	.	0			c.A3791G						.						35.0	42.0	39.0					11																	1261426		2138	4247	6385	SO:0001583	missense	727897	exon30			CCTATGAGGACAG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.3791A>G	11.37:g.1261426A>G	ENSP00000436812:p.Glu1264Gly	37.0	1.0		36.0	5.0	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	a	14.31	2.498319	0.44455	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.18810	2.19;2.39	4.76	4.76	0.60689	.	.	.	.	.	T	0.34106	0.0886	L	0.46885	1.475	0.35675	D	0.813605	D;D	0.57257	0.979;0.979	P;P	0.57152	0.814;0.814	T	0.47761	-0.9092	9	0.87932	D	0	.	14.2562	0.66053	1.0:0.0:0.0:0.0	.	1957;1267	A7Y9J9;E9PBJ0	.;.	G	1264;1267;1265;1334	ENSP00000436812:E1264G;ENSP00000415793:E1267G	ENSP00000343037:E1265G	E	+	2	0	MUC5B	1218002	1.000000	0.71417	0.966000	0.40874	0.584000	0.36387	4.444000	0.60001	1.786000	0.52430	0.375000	0.23000	GAG	.		0.652	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC5B	727897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	1280240	1280240	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr11:1280240C>A	ENST00000529681.1	+	44	16720	c.16662C>A	c.(16660-16662)gaC>gaA	p.D5554E	MUC5B_ENST00000447027.1_Missense_Mutation_p.D5557E	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	5554	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACACCCAGGACCCAACGGTGC	0.652																																					p.D5554E		.											.	.	.	0			c.C16662A						.						42.0	50.0	48.0					11																	1280240		1953	4100	6053	SO:0001583	missense	727897	exon44			CCAGGACCCAACG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.16662C>A	11.37:g.1280240C>A	ENSP00000436812:p.Asp5554Glu	25.0	0.0		30.0	10.0	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	C	11.96	1.794947	0.31777	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000546052;ENST00000406844;ENST00000526859	T;T	0.15603	2.41;2.6	4.8	-4.99	0.03010	.	.	.	.	.	T	0.07143	0.0181	N	0.11560	0.145	0.09310	N	1	B;B	0.25563	0.049;0.129	B;B	0.26517	0.07;0.07	T	0.34378	-0.9831	9	0.87932	D	0	.	3.0599	0.06196	0.1821:0.2209:0.4387:0.1583	.	5891;5557	A7Y9J9;E9PBJ0	.;.	E	5554;5557;5498;453;5266;99	ENSP00000436812:D5554E;ENSP00000415793:D5557E	ENSP00000343037:D5498E	D	+	3	2	MUC5B	1236816	0.000000	0.05858	0.000000	0.03702	0.270000	0.26580	-2.809000	0.00756	-1.355000	0.02186	-0.254000	0.11334	GAC	.		0.652	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MYBL2	4605	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	42331511	42331511	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr20:42331511C>G	ENST00000217026.4	+	8	1460	c.1333C>G	c.(1333-1335)Cct>Gct	p.P445A	MYBL2_ENST00000396863.4_Missense_Mutation_p.P421A	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	445					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			CAAGAGCACACCTGTTAAGAC	0.592																																					p.P445A		.											.	MYBL2	415	0			c.C1333G						.						132.0	108.0	116.0					20																	42331511		2203	4300	6503	SO:0001583	missense	4605	exon8			AGCACACCTGTTA		CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.1333C>G	20.37:g.42331511C>G	ENSP00000217026:p.Pro445Ala	70.0	0.0		124.0	39.0	NM_002466	B2RBS5|B7Z8D9|F8W6N6|Q53F07	Missense_Mutation	SNP	ENST00000217026.4	37	CCDS13322.1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.326144	0.60743	.	.	ENSG00000101057	ENST00000396863;ENST00000217026	T;T	0.51325	0.71;0.75	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.51058	0.1652	L	0.32530	0.975	0.80722	D	1	D;P	0.56968	0.978;0.539	P;B	0.52793	0.709;0.124	T	0.54583	-0.8272	10	0.62326	D	0.03	-15.5247	17.4343	0.87547	0.0:1.0:0.0:0.0	.	421;445	F8W6N6;P10244	.;MYBB_HUMAN	A	421;445	ENSP00000380072:P421A;ENSP00000217026:P445A	ENSP00000217026:P445A	P	+	1	0	MYBL2	41764925	1.000000	0.71417	0.929000	0.37066	0.839000	0.47603	7.269000	0.78482	2.488000	0.83962	0.462000	0.41574	CCT	.		0.592	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080408.1	NM_002466	
MYT1L	23040	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	1796112	1796112	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr2:1796112T>C	ENST00000399161.2	-	24	4148	c.3401A>G	c.(3400-3402)aAc>aGc	p.N1134S	MYT1L_ENST00000428368.2_Missense_Mutation_p.N1132S|MYT1L_ENST00000407844.1_Missense_Mutation_p.N132S	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	1134					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CAGCTGGATGTTAGCCAGGCT	0.527																																					p.N1132S		.											.	MYT1L	95	0			c.A3395G						.						60.0	65.0	63.0					2																	1796112		2086	4226	6312	SO:0001583	missense	23040	exon24			TGGATGTTAGCCA	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.3401A>G	2.37:g.1796112T>C	ENSP00000382114:p.Asn1134Ser	60.0	1.0		214.0	81.0	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	37		.	.	.	.	.	.	.	.	.	.	T	23.7	4.444963	0.83993	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000407844;ENST00000399157;ENST00000428368	T;T;T	0.46451	0.87;1.6;0.87	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.59609	0.2206	L	0.61218	1.895	0.80722	D	1	P;D;D	0.63880	0.728;0.988;0.993	B;P;P	0.60789	0.322;0.76;0.879	T	0.62900	-0.6756	10	0.72032	D	0.01	-57.0633	15.9912	0.80206	0.0:0.0:0.0:1.0	.	132;1134;1132	Q9UL68-3;Q9UL68;Q9UL68-4	.;MYT1L_HUMAN;.	S	1134;1080;132;188;1132	ENSP00000382114:N1134S;ENSP00000382111:N188S;ENSP00000396103:N1132S	ENSP00000295067:N1080S	N	-	2	0	MYT1L	1775119	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	7.969000	0.87988	2.172000	0.68678	0.533000	0.62120	AAC	.		0.527	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
NAALAD2	10003	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	89924847	89924847	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr11:89924847A>G	ENST00000534061.1	+	19	2385	c.2155A>G	c.(2155-2157)Aag>Gag	p.K719E	NAALAD2_ENST00000321955.4_Missense_Mutation_p.K686E|NAALAD2_ENST00000375944.3_Silent_p.*306*	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	719					neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GAAAGAAGTAAAGAAACATAT	0.368																																					p.K719E		.											.	NAALAD2	92	0			c.A2155G						.						84.0	87.0	86.0					11																	89924847		2201	4298	6499	SO:0001583	missense	10003	exon19			GAAGTAAAGAAAC	AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.2155A>G	11.37:g.89924847A>G	ENSP00000432481:p.Lys719Glu	48.0	0.0		109.0	39.0	NM_005467	B3KQR4|Q4KKV4|Q4VAM9	Missense_Mutation	SNP	ENST00000534061.1	37	CCDS8288.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.461601	0.84317	.	.	ENSG00000077616	ENST00000534061;ENST00000321955	T;T	0.58506	0.33;0.33	5.08	5.08	0.68730	Transferrin receptor-like, dimerisation domain (3);	0.074850	0.53938	D	0.000043	T	0.66839	0.2830	M	0.62154	1.92	0.80722	D	1	P	0.51057	0.941	P	0.54100	0.742	T	0.67409	-0.5678	9	.	.	.	-11.4098	15.1983	0.73112	1.0:0.0:0.0:0.0	.	719	Q9Y3Q0	NALD2_HUMAN	E	719;686	ENSP00000432481:K719E;ENSP00000320083:K686E	.	K	+	1	0	NAALAD2	89564495	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.333000	0.90026	2.050000	0.60909	0.373000	0.22412	AAG	.		0.368	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389424.2	NM_005467	
NAPEPLD	222236	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	102743978	102743978	+	Silent	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr7:102743978C>T	ENST00000417955.1	-	5	1234	c.1080G>A	c.(1078-1080)aaG>aaA	p.K360K	NAPEPLD_ENST00000455523.2_Silent_p.K433K|NAPEPLD_ENST00000427257.1_Silent_p.K360K|NAPEPLD_ENST00000341533.4_Silent_p.K360K|NAPEPLD_ENST00000465647.1_Silent_p.K360K			Q6IQ20	NAPEP_HUMAN	N-acyl phosphatidylethanolamine phospholipase D	360					phospholipid catabolic process (GO:0009395)	extracellular vesicular exosome (GO:0070062)|photoreceptor outer segment membrane (GO:0042622)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						CTTCATTCAGCTTCACTGGAG	0.333																																					p.K360K		.											.	NAPEPLD	227	0			c.G1080A						.						48.0	45.0	46.0					7																	102743978		2203	4300	6503	SO:0001819	synonymous_variant	222236	exon5			ATTCAGCTTCACT	BC037350, AY357337	CCDS5729.1	7q22.1	2014-03-14			ENSG00000161048	ENSG00000161048	3.1.4.54		21683	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 18, N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D"""	612334				14634025, 15820312, 18067139	Standard	NM_198990		Approved	FMP30, C7orf18, NAPE-PLD	uc003vbd.2	Q6IQ20	OTTHUMG00000157204	ENST00000417955.1:c.1080G>A	7.37:g.102743978C>T		191.0	1.0		548.0	154.0	NM_001122838	Q5CZ87|Q769K1	Silent	SNP	ENST00000417955.1	37	CCDS5729.1																																																																																			.		0.333	NAPEPLD-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347904.1	NM_198990	
NCAPD3	23310	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	134073725	134073725	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr11:134073725A>G	ENST00000534548.2	-	11	1356	c.1292T>C	c.(1291-1293)cTc>cCc	p.L431P		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	431					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CTCCAAGGAGAGGGTGTTATC	0.448																																					p.L431P		.											.	NCAPD3	229	0			c.T1292C						.						95.0	99.0	97.0					11																	134073725		2201	4297	6498	SO:0001583	missense	23310	exon11			AAGGAGAGGGTGT	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.1292T>C	11.37:g.134073725A>G	ENSP00000433681:p.Leu431Pro	70.0	2.0		133.0	46.0	NM_015261	A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	37	CCDS31723.1	.	.	.	.	.	.	.	.	.	.	A	16.09	3.025634	0.54683	.	.	ENSG00000151503	ENST00000534548	T	0.09630	2.96	6.07	6.07	0.98685	Armadillo-type fold (1);	0.865479	0.10241	N	0.698415	T	0.24736	0.0600	M	0.63843	1.955	0.80722	D	1	D	0.58970	0.984	P	0.50617	0.646	T	0.00745	-1.1584	10	0.48119	T	0.1	-3.4631	16.6288	0.85011	1.0:0.0:0.0:0.0	.	431	P42695	CNDD3_HUMAN	P	431	ENSP00000433681:L431P	ENSP00000431612:L431P	L	-	2	0	NCAPD3	133578935	0.413000	0.25400	0.003000	0.11579	0.497000	0.33675	5.538000	0.67193	2.326000	0.78906	0.533000	0.62120	CTC	.		0.448	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	
NEDD4L	23327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	55996342	55996342	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr18:55996342G>C	ENST00000400345.3	+	10	1079	c.796G>C	c.(796-798)Ggc>Cgc	p.G266R	NEDD4L_ENST00000382850.4_Missense_Mutation_p.G266R|NEDD4L_ENST00000256832.7_Missense_Mutation_p.G145R|NEDD4L_ENST00000356462.6_Missense_Mutation_p.G266R|NEDD4L_ENST00000456986.1_Missense_Mutation_p.G145R|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000456173.2_Missense_Mutation_p.G145R|NEDD4L_ENST00000357895.5_Missense_Mutation_p.G258R|NEDD4L_ENST00000256830.9_Missense_Mutation_p.G266R|NEDD4L_ENST00000435432.2_Missense_Mutation_p.G145R|NEDD4L_ENST00000586263.1_Missense_Mutation_p.G258R|NEDD4L_ENST00000431212.2_Missense_Mutation_p.G145R	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	266					cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						GCCCTCGGAGGGCGGGGATGT	0.567																																					p.G266R		.											.	NEDD4L	658	0			c.G796C						.						26.0	31.0	29.0					18																	55996342		2024	4169	6193	SO:0001583	missense	23327	exon10			TCGGAGGGCGGGG	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.796G>C	18.37:g.55996342G>C	ENSP00000383199:p.Gly266Arg	57.0	0.0		63.0	28.0	NM_015277	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Missense_Mutation	SNP	ENST00000400345.3	37	CCDS45872.1	.	.	.	.	.	.	.	.	.	.	G	10.23	1.293134	0.23564	.	.	ENSG00000049759	ENST00000400345;ENST00000382850;ENST00000356462;ENST00000256830;ENST00000256832;ENST00000456986;ENST00000357895;ENST00000435432;ENST00000456173;ENST00000431212	T;T;T;T;T;T;T;T;T;T	0.32988	1.46;1.47;1.43;1.45;1.94;1.92;1.86;1.94;1.94;1.92	5.97	5.11	0.69529	.	0.441226	0.28365	N	0.015616	T	0.24314	0.0589	L	0.36672	1.1	0.36379	D	0.861814	B;B;B;B;B;B;B	0.27791	0.189;0.116;0.145;0.036;0.045;0.0;0.145	B;B;B;B;B;B;B	0.33254	0.16;0.06;0.063;0.047;0.063;0.001;0.063	T	0.20605	-1.0270	10	0.16420	T	0.52	.	9.5568	0.39343	0.1971:0.0:0.8029:0.0	.	266;258;258;145;266;266;266	Q96PU5-3;Q96PU5-6;Q96PU5-7;Q3LSM7;Q96PU5-2;Q96PU5;Q96PU5-5	.;.;.;.;.;NED4L_HUMAN;.	R	266;266;266;266;145;145;258;145;145;145	ENSP00000383199:G266R;ENSP00000372301:G266R;ENSP00000348847:G266R;ENSP00000256830:G266R;ENSP00000256832:G145R;ENSP00000411947:G145R;ENSP00000350569:G258R;ENSP00000393395:G145R;ENSP00000405440:G145R;ENSP00000389406:G145R	ENSP00000256830:G266R	G	+	1	0	NEDD4L	54147322	0.998000	0.40836	0.870000	0.34147	0.066000	0.16364	2.582000	0.46085	1.540000	0.49301	0.655000	0.94253	GGC	.		0.567	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1		
ASTE1	28990	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	130748574	130748574	+	5'Flank	SNP	G	G	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr3:130748574G>T	ENST00000264992.3	-	0	0				ASTE1_ENST00000514044.1_5'Flank|NEK11_ENST00000508196.1_Missense_Mutation_p.A8S|NEK11_ENST00000383366.4_Missense_Mutation_p.A8S|NEK11_ENST00000511262.1_Missense_Mutation_p.A8S|NEK11_ENST00000507910.1_Missense_Mutation_p.A8S|NEK11_ENST00000510769.1_Missense_Mutation_p.A8S|NEK11_ENST00000412440.2_5'UTR|NEK11_ENST00000429253.2_Missense_Mutation_p.A8S|NEK11_ENST00000510688.1_Missense_Mutation_p.A8S|NEK11_ENST00000356918.4_Missense_Mutation_p.A8S	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)						DNA repair (GO:0006281)		nuclease activity (GO:0004518)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						CCAAGAGGCAGCTAAGTGTGT	0.393																																					p.A8S		.											.	NEK11	848	0			c.G22T						.						119.0	111.0	114.0					3																	130748574		2203	4300	6503	SO:0001631	upstream_gene_variant	79858	exon3			GAGGCAGCTAAGT	AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644		3.37:g.130748574G>T	Exception_encountered	79.0	0.0		188.0	89.0	NM_024800	B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Missense_Mutation	SNP	ENST00000264992.3	37	CCDS3068.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.582576	0.46006	.	.	ENSG00000114670	ENST00000510769;ENST00000429253;ENST00000356918;ENST00000510688;ENST00000511262;ENST00000383366;ENST00000507910;ENST00000508196	T;T;T;T;T;T;T;T	0.70869	-0.52;-0.39;-0.51;-0.45;-0.5;-0.39;-0.51;-0.39	5.83	4.01	0.46588	.	0.255712	0.27388	N	0.019586	T	0.55970	0.1954	N	0.19112	0.55	0.80722	D	1	P;P;P;P;P	0.42692	0.649;0.787;0.775;0.666;0.775	B;B;B;B;B	0.41412	0.273;0.273;0.356;0.115;0.23	T	0.55774	-0.8088	10	0.49607	T	0.09	.	9.9423	0.41587	0.0723:0.1385:0.7893:0.0	.	8;8;8;8;8	Q8NG66-3;E9PHI8;Q8NG66-4;Q8NG66;Q8NG66-2	.;.;.;NEK11_HUMAN;.	S	8	ENSP00000421549:A8S;ENSP00000397180:A8S;ENSP00000349389:A8S;ENSP00000423458:A8S;ENSP00000425114:A8S;ENSP00000372857:A8S;ENSP00000426662:A8S;ENSP00000421851:A8S	ENSP00000349389:A8S	A	+	1	0	NEK11	132231264	0.567000	0.26626	0.839000	0.33178	0.510000	0.34073	0.511000	0.22739	0.798000	0.33994	0.650000	0.86243	GCT	.		0.393	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356659.1	NM_014065	
NID2	22795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	52509060	52509060	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr14:52509060G>T	ENST00000216286.5	-	7	1587	c.1588C>A	c.(1588-1590)Cac>Aac	p.H530N	NID2_ENST00000541773.1_Missense_Mutation_p.H477N	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	530	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					TTCACTCGGTGAGGTGCCCCT	0.512																																					p.H530N		.											.	NID2	158	0			c.C1588A						.						106.0	108.0	107.0					14																	52509060		2203	4300	6503	SO:0001583	missense	22795	exon7			CTCGGTGAGGTGC	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.1588C>A	14.37:g.52509060G>T	ENSP00000216286:p.His530Asn	23.0	0.0		68.0	34.0	NM_007361	A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	37	CCDS9706.1	.	.	.	.	.	.	.	.	.	.	G	15.49	2.848874	0.51164	.	.	ENSG00000087303	ENST00000216286;ENST00000541773;ENST00000395707	T;T	0.29655	1.56;1.56	6.16	5.25	0.73442	G2 nidogen/fibulin G2F (3);Green fluorescent protein-like (1);	0.189121	0.56097	N	0.000022	T	0.49762	0.1576	M	0.72479	2.2	0.43036	D	0.99461	P;D;P	0.53462	0.546;0.96;0.607	B;P;B	0.54965	0.376;0.765;0.395	T	0.56001	-0.8051	10	0.72032	D	0.01	.	16.3625	0.83273	0.0:0.0:0.867:0.133	.	477;532;530	Q14112-2;Q5CZI2;Q14112	.;.;NID2_HUMAN	N	530;477;532	ENSP00000216286:H530N;ENSP00000443730:H477N	ENSP00000216286:H530N	H	-	1	0	NID2	51578810	1.000000	0.71417	0.997000	0.53966	0.638000	0.38207	5.317000	0.65822	1.557000	0.49525	0.650000	0.86243	CAC	.		0.512	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
NPAS4	266743	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66191452	66191452	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr11:66191452C>T	ENST00000311034.2	+	7	1267	c.1091C>T	c.(1090-1092)aCc>aTc	p.T364I		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	364					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						CCACTCTTCACCGCAGCACTG	0.567																																					p.T364I		.											.	NPAS4	90	0			c.C1091T						.						142.0	148.0	146.0					11																	66191452		2200	4295	6495	SO:0001583	missense	266743	exon7			TCTTCACCGCAGC	AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.1091C>T	11.37:g.66191452C>T	ENSP00000311196:p.Thr364Ile	35.0	0.0		58.0	24.0	NM_178864	B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	ENST00000311034.2	37	CCDS8138.1	.	.	.	.	.	.	.	.	.	.	C	11.62	1.691579	0.30052	.	.	ENSG00000174576	ENST00000311034	T	0.48836	0.8	4.45	3.53	0.40419	.	0.393717	0.21716	N	0.070200	T	0.35998	0.0951	L	0.29908	0.895	0.46061	D	0.998845	B	0.15141	0.012	B	0.13407	0.009	T	0.21449	-1.0245	10	0.62326	D	0.03	-1.4082	11.4897	0.50373	0.1812:0.8188:0.0:0.0	.	364	Q8IUM7	NPAS4_HUMAN	I	364	ENSP00000311196:T364I	ENSP00000311196:T364I	T	+	2	0	NPAS4	65948028	0.404000	0.25328	0.607000	0.28956	0.844000	0.47949	1.186000	0.32078	1.080000	0.41073	0.563000	0.77884	ACC	.		0.567	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1	NM_178864	
NTNG1	22854	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	107937923	107937923	+	Silent	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr1:107937923C>T	ENST00000370068.1	+	4	1881	c.1035C>T	c.(1033-1035)ccC>ccT	p.P345P	NTNG1_ENST00000370066.1_Silent_p.P345P|NTNG1_ENST00000370061.3_Silent_p.P345P|NTNG1_ENST00000370072.3_Silent_p.P345P|NTNG1_ENST00000370071.2_Silent_p.P345P|NTNG1_ENST00000370074.4_Silent_p.P345P|NTNG1_ENST00000370067.1_Silent_p.P345P|NTNG1_ENST00000370073.2_Silent_p.P345P|NTNG1_ENST00000370065.1_Silent_p.P345P|NTNG1_ENST00000370070.2_Silent_p.P345P|NTNG1_ENST00000542803.1_Silent_p.P345P			Q9Y2I2	NTNG1_HUMAN	netrin G1	345	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		CCTATCTCCCCATCCCCAAAG	0.458																																					p.P345P		.											.	NTNG1	140	0			c.C1035T						.						156.0	155.0	155.0					1																	107937923		2203	4300	6503	SO:0001819	synonymous_variant	22854	exon4			TCTCCCCATCCCC	AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.1035C>T	1.37:g.107937923C>T		48.0	0.0		125.0	54.0	NM_014917	Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Silent	SNP	ENST00000370068.1	37	CCDS44180.1																																																																																			.		0.458	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000030340.1	NM_014917	
NUDT14	256281	hgsc.bcm.edu;bcgsc.ca	37	14	105643003	105643004	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr14:105643003_105643004insC	ENST00000392568.2	-	4	388_389	c.295_296insG	c.(295-297)gtgfs	p.V99fs	NUDT14_ENST00000550912.1_5'Flank|RP11-44N21.4_ENST00000548203.1_RNA	NM_177533.4	NP_803877.2	O95848	NUD14_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 14	99	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ADP-ribose diphosphatase activity (GO:0047631)|metal ion binding (GO:0046872)|UDP-sugar diphosphatase activity (GO:0008768)			cervix(2)|endometrium(1)|lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	14		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		CTCAACTGTCACCCCCGCTGAG	0.673										HNSCC(42;0.11)																											p.V99fs		.											.	NUDT14	91	0			c.296_297insG						.																																			SO:0001589	frameshift_variant	256281	exon4			ACTGTCACCCCCG	AB087802	CCDS10000.1	14q32.33	2013-02-15			ENSG00000183828	ENSG00000183828		"""Nudix motif containing"""	20141	protein-coding gene	gene with protein product		609219				12429023	Standard	NM_177533		Approved	UGPP	uc010tyn.3	O95848	OTTHUMG00000170372	ENST00000392568.2:c.296dupG	14.37:g.105643008_105643008dupC	ENSP00000376349:p.Val99fs	48.0	0.0		48.0	18.0	NM_177533	Q86SJ8	Frame_Shift_Ins	INS	ENST00000392568.2	37	CCDS10000.1																																																																																			.		0.673	NUDT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074544.4	NM_177533	
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	228529240	228529240	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr1:228529240C>T	ENST00000422127.1	+	74	18003	c.17959C>T	c.(17959-17961)Cgg>Tgg	p.R5987W	OBSCN_ENST00000366707.4_Missense_Mutation_p.R3621W|OBSCN_ENST00000570156.2_Missense_Mutation_p.R6944W|OBSCN_ENST00000284548.11_Missense_Mutation_p.R5987W|OBSCN_ENST00000366709.4_Missense_Mutation_p.R3106W	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5987	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCTGCAGGCACGGACAGCCAT	0.647																																					p.R6944W		.											.	OBSCN	403	0			c.C20830T						.						45.0	57.0	53.0					1																	228529240		2177	4267	6444	SO:0001583	missense	84033	exon85			CAGGCACGGACAG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.17959C>T	1.37:g.228529240C>T	ENSP00000409493:p.Arg5987Trp	33.0	0.0		84.0	25.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.1|21.1	4.093970|4.093970	0.76870|0.76870	.|.	.|.	ENSG00000154358|ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709|ENST00000441106	T;T;T;T|.	0.12465|.	2.68;2.68;2.68;2.68|.	5.48|5.48	4.57|4.57	0.56435|0.56435	Pleckstrin homology-type (1);Pleckstrin homology domain (2);|.	0.081715|.	0.50627|.	D|.	0.000112|.	T|T	0.70692|0.70692	0.3253|0.3253	M|M	0.76002|0.76002	2.32|2.32	0.48696|0.48696	D|D	0.999697|0.999697	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.75020|.	0.967;0.985|.	T|T	0.70824|0.70824	-0.4767|-0.4767	10|5	0.87932|.	D|.	0|.	.|.	9.9133|9.9133	0.41419|0.41419	0.1384:0.7894:0.0:0.0722|0.1384:0.7894:0.0:0.0722	.|.	5987;5987|.	Q5VST9;Q5VST9-3|.	OBSCN_HUMAN;.|.	W|M	5987;5987;3621;3106|603	ENSP00000284548:R5987W;ENSP00000409493:R5987W;ENSP00000355668:R3621W;ENSP00000355670:R3106W|.	ENSP00000284548:R5987W|.	R|T	+|+	1|2	2|0	OBSCN|OBSCN	226595863|226595863	0.998000|0.998000	0.40836|0.40836	0.200000|0.200000	0.23457|0.23457	0.471000|0.471000	0.32888|0.32888	3.764000|3.764000	0.55264|0.55264	1.326000|1.326000	0.45319|0.45319	0.563000|0.563000	0.77884|0.77884	CGG|ACG	.		0.647	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR10G7	390265	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	123909593	123909593	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr11:123909593C>A	ENST00000330487.5	-	1	124	c.116G>T	c.(115-117)gGg>gTg	p.G39V		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	39						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GAGGAGGTTCCCCAGCACAGT	0.572																																					p.G39V		.											.	OR10G7	70	0			c.G116T						.						55.0	52.0	53.0					11																	123909593		2200	4292	6492	SO:0001583	missense	390265	exon1			AGGTTCCCCAGCA	AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.116G>T	11.37:g.123909593C>A	ENSP00000329689:p.Gly39Val	174.0	1.0		553.0	245.0	NM_001004463	Q6IFE8	Missense_Mutation	SNP	ENST00000330487.5	37	CCDS31705.1	.	.	.	.	.	.	.	.	.	.	C	10.20	1.283476	0.23392	.	.	ENSG00000182634	ENST00000330487	T	0.04406	3.63	3.53	2.61	0.31194	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000129	T	0.14960	0.0361	H	0.94658	3.565	0.58432	D	0.999996	P	0.37061	0.58	B	0.40134	0.32	T	0.02639	-1.1130	10	0.87932	D	0	.	10.7313	0.46098	0.0:0.9035:0.0:0.0965	.	39	Q8NGN6	O10G7_HUMAN	V	39	ENSP00000329689:G39V	ENSP00000329689:G39V	G	-	2	0	OR10G7	123414803	0.024000	0.19004	0.887000	0.34795	0.238000	0.25445	1.310000	0.33551	0.832000	0.34804	0.557000	0.71058	GGG	.		0.572	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387271.1	NM_001004463	
OR2J3	442186	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	29080433	29080433	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr6:29080433A>T	ENST00000377169.1	+	1	766	c.766A>T	c.(766-768)Att>Ttt	p.I256F		NM_001005216.2	NP_001005216.2	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J, member 3	256						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24						TCTCTTTTTCATTCCGGCCAT	0.453																																					p.I256F		.											.	OR2J3	90	0			c.A766T						.						112.0	113.0	113.0					6																	29080433		1250	2565	3815	SO:0001583	missense	442186	exon1			TTTTTCATTCCGG		CCDS43433.1	6p22.2-p21.31	2012-08-09			ENSG00000204701	ENSG00000204701		"""GPCR / Class A : Olfactory receptors"""	8261	protein-coding gene	gene with protein product		615016					Standard	NM_001005216		Approved	OR6-6	uc011dll.2	O76001	OTTHUMG00000031092	ENST00000377169.1:c.766A>T	6.37:g.29080433A>T	ENSP00000366374:p.Ile256Phe	181.0	1.0		868.0	202.0	NM_001005216	B0UY52|B9EH11|Q5SUJ7|Q6IF25|Q96R15|Q9GZK5|Q9GZL4|Q9GZL5	Missense_Mutation	SNP	ENST00000377169.1	37	CCDS43433.1	.	.	.	.	.	.	.	.	.	.	A	9.367	1.069471	0.20147	.	.	ENSG00000204701	ENST00000377169	T	0.36157	1.27	2.78	0.349	0.16032	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.17450	0.0419	N	0.25890	0.77	0.23366	N	0.997822	P	0.36222	0.544	P	0.48524	0.58	T	0.30327	-0.9982	9	0.59425	D	0.04	.	6.4807	0.22061	0.5411:0.0:0.4589:0.0	.	256	O76001	OR2J3_HUMAN	F	256	ENSP00000366374:I256F	ENSP00000366374:I256F	I	+	1	0	OR2J3	29188412	0.000000	0.05858	0.997000	0.53966	0.222000	0.24845	-0.446000	0.06837	0.290000	0.22444	0.358000	0.22013	ATT	.		0.453	OR2J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076132.2		
OR2L13	284521	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248262994	248262994	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr1:248262994T>C	ENST00000358120.2	+	2	462	c.317T>C	c.(316-318)aTg>aCg	p.M106T	OR2L13_ENST00000366478.2_Missense_Mutation_p.M106T			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	106						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			TTCCTGACCATGGCGTGTTCT	0.517																																					p.M106T		.											.	OR2L13	70	0			c.T317C						.						253.0	230.0	238.0					1																	248262994		2203	4300	6503	SO:0001583	missense	284521	exon3			TGACCATGGCGTG	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.317T>C	1.37:g.248262994T>C	ENSP00000350836:p.Met106Thr	91.0	0.0		311.0	169.0	NM_175911	Q5VUR5	Missense_Mutation	SNP	ENST00000358120.2	37	CCDS1637.1	.	.	.	.	.	.	.	.	.	.	T	3.812	-0.039461	0.07497	.	.	ENSG00000196071	ENST00000366478;ENST00000358120	T;T	0.00342	8.03;8.03	3.74	3.74	0.42951	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000035	T	0.00178	0.0005	N	0.16066	0.365	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.43360	-0.9396	10	0.87932	D	0	.	7.5649	0.27872	0.0:0.0998:0.0:0.9002	.	106	Q8N349	OR2LD_HUMAN	T	106	ENSP00000355434:M106T;ENSP00000350836:M106T	ENSP00000350836:M106T	M	+	2	0	OR2L13	246329617	0.657000	0.27393	0.243000	0.24186	0.134000	0.20937	3.389000	0.52516	1.688000	0.51068	0.528000	0.53228	ATG	.		0.517	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097342.1	NM_175911	
OR2T4	127074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248525893	248525893	+	Silent	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr1:248525893A>G	ENST00000366475.1	+	1	1011	c.1011A>G	c.(1009-1011)ttA>ttG	p.L337L		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	337						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGAAAATGTTAACAGTGGAAC	0.393																																					p.L337L		.											.	OR2T4	68	0			c.A1011G						.						103.0	108.0	107.0					1																	248525893		2203	4300	6503	SO:0001819	synonymous_variant	127074	exon1			AATGTTAACAGTG	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.1011A>G	1.37:g.248525893A>G		257.0	0.0		689.0	225.0	NM_001004696	Q6IEZ8	Silent	SNP	ENST00000366475.1	37	CCDS31113.1																																																																																			.		0.393	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
OR2T27	403239	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	248813316	248813316	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr1:248813316G>T	ENST00000344889.3	-	1	869	c.870C>A	c.(868-870)taC>taA	p.Y290*		NM_001001824.1	NP_001001824.1	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T, member 27	290						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(2)|large_intestine(4)|lung(20)|skin(3)|stomach(1)	32	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCCTAAGGCTGTAAATGAGTG	0.478																																					p.Y290X		.											.	OR2T27	47	0			c.C870A						.						75.0	76.0	75.0					1																	248813316		2174	4269	6443	SO:0001587	stop_gained	403239	exon1			AAGGCTGTAAATG		CCDS31124.1	1q44	2012-08-09			ENSG00000187701	ENSG00000187701		"""GPCR / Class A : Olfactory receptors"""	31252	protein-coding gene	gene with protein product							Standard	NM_001001824		Approved		uc010pzo.2	Q8NH04	OTTHUMG00000040376	ENST00000344889.3:c.870C>A	1.37:g.248813316G>T	ENSP00000342008:p.Tyr290*	197.0	0.0		573.0	83.0	NM_001001824		Nonsense_Mutation	SNP	ENST00000344889.3	37	CCDS31124.1	.	.	.	.	.	.	.	.	.	.	.	6.679	0.493898	0.12702	.	.	ENSG00000187701	ENST00000344889	.	.	.	3.3	-0.96	0.10340	.	0.000000	0.36002	N	0.002857	.	.	.	.	.	.	0.52501	D	0.99995	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.6348	0.45558	0.3614:0.0:0.6386:0.0	.	.	.	.	X	290	.	ENSP00000342008:Y290X	Y	-	3	2	OR2T27	246879939	0.003000	0.15002	0.093000	0.20910	0.008000	0.06430	-0.342000	0.07801	-0.331000	0.08501	-1.478000	0.00992	TAC	.		0.478	OR2T27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097124.1	NM_001001824	
OR51L1	119682	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5020988	5020988	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr11:5020988G>A	ENST00000321543.1	+	1	776	c.776G>A	c.(775-777)gGg>gAg	p.G259E		NM_001004755.1	NP_001004755.1	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L, member 1	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(19)|skin(2)|stomach(1)	31		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		CCAGTTATTGGGGTGTCAATG	0.473																																					p.G259E		.											.	OR51L1	69	0			c.G776A						.						211.0	183.0	192.0					11																	5020988		2201	4298	6499	SO:0001583	missense	119682	exon1			TTATTGGGGTGTC	AB065799	CCDS31369.1	11p15.4	2012-08-09			ENSG00000176798	ENSG00000176798		"""GPCR / Class A : Olfactory receptors"""	14759	protein-coding gene	gene with protein product							Standard	NM_001004755		Approved		uc010qyu.2	Q8NGJ5	OTTHUMG00000066605	ENST00000321543.1:c.776G>A	11.37:g.5020988G>A	ENSP00000322156:p.Gly259Glu	162.0	0.0		361.0	162.0	NM_001004755	Q6IFE5	Missense_Mutation	SNP	ENST00000321543.1	37	CCDS31369.1	.	.	.	.	.	.	.	.	.	.	G	18.66	3.672481	0.67928	.	.	ENSG00000176798	ENST00000321543	T	0.00115	8.71	5.43	5.43	0.79202	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43260	D	0.000588	T	0.00580	0.0019	M	0.91872	3.25	0.26485	N	0.975031	D	0.89917	1.0	D	0.97110	1.0	T	0.33033	-0.9884	10	0.87932	D	0	.	11.6263	0.51147	0.0:0.0:0.8229:0.1771	.	259	Q8NGJ5	O51L1_HUMAN	E	259	ENSP00000322156:G259E	ENSP00000322156:G259E	G	+	2	0	OR51L1	4977564	0.003000	0.15002	1.000000	0.80357	0.981000	0.71138	0.388000	0.20735	2.822000	0.97130	0.650000	0.86243	GGG	.		0.473	OR51L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142812.1	NM_001004755	
OR52E2	119678	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	5079905	5079905	+	Missense_Mutation	SNP	T	T	A	rs547180704		TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr11:5079905T>A	ENST00000321522.2	-	1	952	c.953A>T	c.(952-954)gAg>gTg	p.E318V		NM_001005164.2	NP_001005164.2	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E, member 2	318						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|lung(13)|ovary(2)|skin(3)	20		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		TATTAGGTACTCTTCCTTTTC	0.338																																					p.E318V		.											.	OR52E2	71	0			c.A953T						.						58.0	59.0	59.0					11																	5079905		2201	4298	6499	SO:0001583	missense	119678	exon1			AGGTACTCTTCCT	AB065800	CCDS31371.1	11p15.4	2012-08-09			ENSG00000176787	ENSG00000176787		"""GPCR / Class A : Olfactory receptors"""	14769	protein-coding gene	gene with protein product							Standard	NM_001005164		Approved		uc010qyw.2	Q8NGJ4	OTTHUMG00000066608	ENST00000321522.2:c.953A>T	11.37:g.5079905T>A	ENSP00000322088:p.Glu318Val	66.0	0.0		121.0	34.0	NM_001005164		Missense_Mutation	SNP	ENST00000321522.2	37	CCDS31371.1	.	.	.	.	.	.	.	.	.	.	T	4.051	0.007160	0.07866	.	.	ENSG00000176787	ENST00000321522	T	0.00004	9.81	3.56	2.48	0.30137	.	.	.	.	.	T	0.00039	0.0001	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.01608	-1.1313	9	0.42905	T	0.14	.	4.199	0.10457	0.0:0.3364:0.0:0.6636	.	318	Q8NGJ4	O52E2_HUMAN	V	318	ENSP00000322088:E318V	ENSP00000322088:E318V	E	-	2	0	OR52E2	5036481	0.004000	0.15560	0.001000	0.08648	0.021000	0.10359	0.903000	0.28475	0.826000	0.34661	0.477000	0.44152	GAG	.		0.338	OR52E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142815.1	NM_001005164	
OR52H1	390067	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5566529	5566529	+	Silent	SNP	G	G	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr11:5566529G>T	ENST00000322653.4	-	1	250	c.225C>A	c.(223-225)gcC>gcA	p.A75A	HBG2_ENST00000380259.2_Intron	NM_001005289.1	NP_001005289.1	Q8NGJ2	O52H1_HUMAN	olfactory receptor, family 52, subfamily H, member 1	75						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;5.33e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGTCAGTCATGGCCAGCATGG	0.478																																					p.A75A		.											.	OR52H1	114	0			c.C225A						.						89.0	78.0	81.0					11																	5566529		2201	4297	6498	SO:0001819	synonymous_variant	390067	exon1			AGTCATGGCCAGC	AB065802	CCDS31386.1	11p15.4	2012-08-09			ENSG00000181616	ENSG00000181616		"""GPCR / Class A : Olfactory receptors"""	15218	protein-coding gene	gene with protein product							Standard	NM_001005289		Approved		uc010qzh.2	Q8NGJ2	OTTHUMG00000066909	ENST00000322653.4:c.225C>A	11.37:g.5566529G>T		93.0	0.0		212.0	80.0	NM_001005289	B9EH26|Q6IF79	Silent	SNP	ENST00000322653.4	37	CCDS31386.1																																																																																			.		0.478	OR52H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143400.1	NM_001005289	
PARP11	57097	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	3939168	3939168	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr12:3939168G>C	ENST00000228820.4	-	2	179	c.35C>G	c.(34-36)gCa>gGa	p.A12G	PARP11_ENST00000447133.3_5'UTR|PARP11_ENST00000397096.2_Missense_Mutation_p.A5G|PARP11_ENST00000427057.2_5'UTR	NM_020367.4	NP_065100.2	Q9NR21	PAR11_HUMAN	poly (ADP-ribose) polymerase family, member 11	5							NAD+ ADP-ribosyltransferase activity (GO:0003950)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	17			all cancers(3;1.58e-07)|OV - Ovarian serous cystadenocarcinoma(31;0.00287)|GBM - Glioblastoma multiforme(3;0.0141)|COAD - Colon adenocarcinoma(12;0.0264)			TAATTCTTCTGCTTTGTGAAA	0.368																																					p.A12G		.											.	PARP11	523	0			c.C35G						.						107.0	98.0	101.0					12																	3939168		2203	4300	6503	SO:0001583	missense	57097	exon2			TCTTCTGCTTTGT	AF263540	CCDS8523.2, CCDS66281.1	12p13.3	2014-01-28	2004-08-25	2004-08-26	ENSG00000111224	ENSG00000111224		"""Poly (ADP-ribose) polymerases"""	1186	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 6"""	C12orf6		15273990	Standard	NM_001286522		Approved		uc001qml.2	Q9NR21	OTTHUMG00000156442	ENST00000228820.4:c.35C>G	12.37:g.3939168G>C	ENSP00000228820:p.Ala12Gly	126.0	0.0		178.0	77.0	NM_020367	B4DRQ0|Q68DS1|Q8N5Y9	Missense_Mutation	SNP	ENST00000228820.4	37	CCDS8523.2	.	.	.	.	.	.	.	.	.	.	G	10.80	1.451925	0.26074	.	.	ENSG00000111224	ENST00000397096;ENST00000228820	T;T	0.31769	1.48;2.69	5.52	5.52	0.82312	.	0.796683	0.12037	N	0.505442	T	0.21022	0.0506	N	0.19112	0.55	0.80722	D	1	B;B	0.19817	0.039;0.023	B;B	0.18871	0.023;0.01	T	0.05616	-1.0874	10	0.32370	T	0.25	.	10.2001	0.43077	0.0872:0.0:0.9128:0.0	.	12;5	Q9NR21-4;Q9NR21	.;PAR11_HUMAN	G	5;12	ENSP00000380284:A5G;ENSP00000228820:A12G	ENSP00000228820:A12G	A	-	2	0	PARP11	3809429	0.161000	0.22892	0.998000	0.56505	0.425000	0.31504	2.197000	0.42696	2.873000	0.98535	0.563000	0.77884	GCA	.		0.368	PARP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344213.1		
PCDH10	57575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	134071720	134071720	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr4:134071720C>A	ENST00000264360.5	+	1	1251	c.425C>A	c.(424-426)cCc>cAc	p.P142H	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	142	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		ACTCGCTTCCCCTTGGAGAGC	0.612																																					p.P142H		.											.	PCDH10	92	0			c.C425A						.						57.0	60.0	59.0					4																	134071720		2203	4300	6503	SO:0001583	missense	57575	exon1			GCTTCCCCTTGGA	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.425C>A	4.37:g.134071720C>A	ENSP00000264360:p.Pro142His	32.0	0.0		51.0	22.0	NM_032961	Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	C	19.14	3.770027	0.69992	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.20200	2.09	4.78	4.78	0.61160	Cadherin (2);Cadherin-like (1);	0.000000	0.44902	D	0.000414	T	0.51686	0.1689	M	0.86028	2.79	0.80722	D	1	D;P	0.89917	1.0;0.559	D;P	0.91635	0.999;0.566	T	0.56129	-0.8030	10	0.45353	T	0.12	.	17.5675	0.87924	0.0:1.0:0.0:0.0	.	142;142	Q9P2E7;Q96SF0	PCD10_HUMAN;.	H	142	ENSP00000264360:P142H	ENSP00000264360:P142H	P	+	2	0	PCDH10	134291170	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	7.651000	0.83577	2.467000	0.83353	0.555000	0.69702	CCC	.		0.612	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
PCYOX1L	78991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	148745666	148745666	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr5:148745666C>G	ENST00000274569.4	+	4	694	c.632C>G	c.(631-633)gCt>gGt	p.A211G	PCYOX1L_ENST00000514349.1_Missense_Mutation_p.A121G	NM_024028.3	NP_076933.3	Q8NBM8	PCYXL_HUMAN	prenylcysteine oxidase 1 like	211					prenylcysteine catabolic process (GO:0030328)	extracellular region (GO:0005576)|membrane (GO:0016020)	prenylcysteine oxidase activity (GO:0001735)			breast(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCGTTTCTGCTGTCCTGCGG	0.612																																					p.A211G	Ovarian(62;1136 1477 27277 27495)	.											.	PCYOX1L	91	0			c.C632G						.						48.0	46.0	47.0					5																	148745666		2203	4300	6503	SO:0001583	missense	78991	exon4			TTTCTGCTGTCCT		CCDS4296.1	5q33.1	2008-02-05			ENSG00000145882	ENSG00000145882			28477	protein-coding gene	gene with protein product						12477932	Standard	NM_024028		Approved	MGC3265	uc003lqk.2	Q8NBM8	OTTHUMG00000130052	ENST00000274569.4:c.632C>G	5.37:g.148745666C>G	ENSP00000274569:p.Ala211Gly	31.0	0.0		73.0	28.0	NM_024028	Q7Z4S2|Q8NCY5|Q8NF69|Q9BTE8|Q9BWS3	Missense_Mutation	SNP	ENST00000274569.4	37	CCDS4296.1	.	.	.	.	.	.	.	.	.	.	C	18.98	3.737902	0.69304	.	.	ENSG00000145882	ENST00000274569;ENST00000514349	T;T	0.16743	3.01;2.32	5.18	5.18	0.71444	Prenylcysteine lyase (1);	0.059356	0.64402	D	0.000002	T	0.25827	0.0629	L	0.57536	1.79	0.80722	D	1	P;P	0.43857	0.62;0.819	P;P	0.44860	0.462;0.451	T	0.01045	-1.1470	10	0.33141	T	0.24	-16.972	19.0548	0.93059	0.0:1.0:0.0:0.0	.	121;211	E7EVZ5;Q8NBM8	.;PCYXL_HUMAN	G	211;121	ENSP00000274569:A211G;ENSP00000428512:A121G	ENSP00000274569:A211G	A	+	2	0	PCYOX1L	148725859	1.000000	0.71417	0.324000	0.25361	0.681000	0.39784	7.750000	0.85110	2.593000	0.87608	0.561000	0.74099	GCT	.		0.612	PCYOX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252331.2	NM_024028	
PIEZO2	63895	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	10696431	10696440	+	Frame_Shift_Del	DEL	CAGTGTCAGC	CAGTGTCAGC	-			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	CAGTGTCAGC	CAGTGTCAGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr18:10696431_10696440delCAGTGTCAGC	ENST00000503781.3	-	42	6585_6594	c.6586_6595delGCTGACACTG	c.(6586-6597)gctgacactgtgfs	p.ADTV2196fs	PIEZO2_ENST00000285141.4_Frame_Shift_Del_p.ADTV51fs|PIEZO2_ENST00000302079.6_Frame_Shift_Del_p.ADTV2196fs|PIEZO2_ENST00000580640.1_Frame_Shift_Del_p.ADTV2221fs|PIEZO2_ENST00000538948.1_Frame_Shift_Del_p.ADTV153fs	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2196					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)	p.T2198I(1)|p.T53I(1)									ATGAAGTCCACAGTGTCAGCCAGGAACATG	0.552																																					p.2196_2199del		.											.	.	.	2	Substitution - Missense(2)	lung(2)	c.6586_6595del						.																																			SO:0001589	frameshift_variant	63895	exon42			AGTCCACAGTGTC	AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.6586_6595delGCTGACACTG	18.37:g.10696431_10696440delCAGTGTCAGC	ENSP00000421377:p.Ala2196fs	68.0	0.0		96.0	19.0	NM_022068	B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Frame_Shift_Del	DEL	ENST00000503781.3	37																																																																																				.		0.552	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442385.4	NM_022068	
PLEKHG4B	153478	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	140645	140645	+	Missense_Mutation	SNP	C	C	T	rs369792305		TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr5:140645C>T	ENST00000283426.6	+	1	273	c.223C>T	c.(223-225)Cgg>Tgg	p.R75W	CTD-2231H16.1_ENST00000512035.1_lincRNA	NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	75							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		AGCTGCAGGGCGGACTCTTCC	0.662																																					p.R75W		.											.	PLEKHG4B	228	0			c.C223T						.		TRP/ARG	0,4338		0,0,2169	16.0	21.0	19.0		223	1.4	0.0	5		19	1,8549		0,1,4274	no	missense	PLEKHG4B	NM_052909.3	101	0,1,6443	TT,TC,CC		0.0117,0.0,0.0078	possibly-damaging	75/1272	140645	1,12887	2169	4275	6444	SO:0001583	missense	153478	exon1			GCAGGGCGGACTC	BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.223C>T	5.37:g.140645C>T	ENSP00000283426:p.Arg75Trp	100.0	0.0		153.0	67.0	NM_052909		Missense_Mutation	SNP	ENST00000283426.6	37	CCDS34124.1	.	.	.	.	.	.	.	.	.	.	.	12.80	2.047131	0.36085	0.0	1.17E-4	ENSG00000153404	ENST00000283426	T	0.25579	1.79	2.59	1.37	0.22104	.	.	.	.	.	T	0.12860	0.0312	N	0.19112	0.55	0.09310	N	1	P	0.50066	0.931	B	0.36766	0.232	T	0.14671	-1.0464	9	0.87932	D	0	.	5.4782	0.16708	0.6837:0.3163:0.0:0.0	.	75	Q96PX9	PKH4B_HUMAN	W	75	ENSP00000283426:R75W	ENSP00000283426:R75W	R	+	1	2	PLEKHG4B	193645	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	0.714000	0.25808	-0.022000	0.13986	0.298000	0.19748	CGG	.		0.662	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365359.1	NM_052909	
PLEKHG7	440107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	93148009	93148009	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr12:93148009C>G	ENST00000344636.3	+	6	643	c.459C>G	c.(457-459)taC>taG	p.Y153*		NM_001004330.2	NP_001004330.1	Q6ZR37	PKHG7_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 7	153	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)	17						TCATGATCTACTCCATCAAGG	0.468																																					p.Y153X		.											.	PLEKHG7	23	0			c.C459G						.						96.0	86.0	89.0					12																	93148009		2203	4300	6503	SO:0001587	stop_gained	440107	exon6			GATCTACTCCATC	AK128530	CCDS31873.1	12q22	2013-01-11				ENSG00000187510		"""Pleckstrin homology (PH) domain containing"""	33829	protein-coding gene	gene with protein product							Standard	NM_001004330		Approved	FLJ46688	uc001tcj.2	Q6ZR37		ENST00000344636.3:c.459C>G	12.37:g.93148009C>G	ENSP00000344961:p.Tyr153*	63.0	0.0		111.0	40.0	NM_001004330	B2RNR7	Nonsense_Mutation	SNP	ENST00000344636.3	37	CCDS31873.1	.	.	.	.	.	.	.	.	.	.	C	35	5.457813	0.96240	.	.	ENSG00000187510	ENST00000344636	.	.	.	5.4	1.6	0.23607	.	0.238813	0.44097	D	0.000499	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-17.2431	6.5086	0.22208	0.0:0.5426:0.1156:0.3418	.	.	.	.	X	153	.	ENSP00000344961:Y153X	Y	+	3	2	PLEKHG7	91672140	0.022000	0.18835	0.991000	0.47740	0.940000	0.58332	-0.046000	0.11983	0.029000	0.15352	-1.430000	0.01095	TAC	.		0.468	PLEKHG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407288.1	NM_001004330	
PLXNB3	5365	ucsc.edu;bcgsc.ca	37	X	153039047	153039047	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chrX:153039047A>G	ENST00000361971.5	+	19	3272	c.3158A>G	c.(3157-3159)gAg>gGg	p.E1053G	SRPK3_ENST00000489426.1_5'Flank|PLXNB3_ENST00000538776.1_Missense_Mutation_p.E706G|PLXNB3_ENST00000538282.1_Missense_Mutation_p.E663G|PLXNB3_ENST00000538966.1_Missense_Mutation_p.E1076G	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	1053	IPT/TIG 3.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GTGTGGCTGGAGGCTGACGCA	0.677																																					p.E1076G		.											.	PLXNB3	130	0			c.A3227G						.						18.0	18.0	18.0					X																	153039047		2160	4254	6414	SO:0001583	missense	5365	exon20			GGCTGGAGGCTGA	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.3158A>G	X.37:g.153039047A>G	ENSP00000355378:p.Glu1053Gly	33.0	1.0		102.0	24.0	NM_001163257	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	37	CCDS14729.1	.	.	.	.	.	.	.	.	.	.	A	14.81	2.646571	0.47258	.	.	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776;ENST00000538282	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	4.69	3.49	0.39957	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.267531	0.36703	N	0.002447	T	0.37156	0.0993	L	0.46947	1.48	0.41209	D	0.986425	B;B;B	0.32731	0.097;0.382;0.097	B;B;B	0.32677	0.15;0.149;0.15	T	0.08700	-1.0709	10	0.25106	T	0.35	.	8.5809	0.33628	0.8073:0.1927:0.0:0.0	.	706;1076;1053	B7Z3H9;F5H773;Q9ULL4	.;.;PLXB3_HUMAN	G	1076;1053;706;663	ENSP00000442736:E1076G;ENSP00000355378:E1053G;ENSP00000445569:E706G;ENSP00000441919:E663G	ENSP00000355378:E1053G	E	+	2	0	PLXNB3	152692241	0.882000	0.30256	0.831000	0.32960	0.165000	0.22458	0.957000	0.29215	0.472000	0.27344	0.356000	0.21956	GAG	.		0.677	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
PMEPA1	56937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	56227217	56227217	+	Silent	SNP	C	C	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr20:56227217C>A	ENST00000341744.3	-	4	1075	c.756G>T	c.(754-756)ccG>ccT	p.P252P	PMEPA1_ENST00000347215.4_Silent_p.P217P|PMEPA1_ENST00000265626.4_Silent_p.P202P|PMEPA1_ENST00000395816.3_Silent_p.P202P|PMEPA1_ENST00000395814.1_Silent_p.P202P	NM_020182.4	NP_064567.2	Q969W9	PMEPA_HUMAN	prostate transmembrane protein, androgen induced 1	252					androgen receptor signaling pathway (GO:0030521)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	R-SMAD binding (GO:0070412)|WW domain binding (GO:0050699)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)	16						GCAAGGAGGGCGGCCCACTGC	0.667																																					p.P252P		.											.	PMEPA1	227	0			c.G756T						.						19.0	20.0	20.0					20																	56227217		2197	4291	6488	SO:0001819	synonymous_variant	56937	exon4			GGAGGGCGGCCCA	AF224278	CCDS13462.1, CCDS13463.1, CCDS13464.1	20q13.31-q13.33	2008-04-03	2008-04-03	2008-04-03	ENSG00000124225	ENSG00000124225			14107	protein-coding gene	gene with protein product	"""solid tumor-associated 1"""	606564	"""transmembrane, prostate androgen induced RNA"""	TMEPAI		10873380	Standard	NM_020182		Approved	STAG1	uc002xyq.4	Q969W9	OTTHUMG00000032831	ENST00000341744.3:c.756G>T	20.37:g.56227217C>A		43.0	0.0		46.0	20.0	NM_020182	Q5TDR6|Q8NER4|Q96B72|Q9UJD3	Silent	SNP	ENST00000341744.3	37	CCDS13463.1																																																																																			.		0.667	PMEPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079858.2	NM_020182	
POTEC	388468	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	14542729	14542729	+	Silent	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr18:14542729A>G	ENST00000358970.5	-	1	416	c.417T>C	c.(415-417)gaT>gaC	p.D139D	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	139										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						GCTTGTCCAGATCTTCTCGAC	0.597																																					p.D139D		.											.	POTEC	3	0			c.T417C						.						65.0	73.0	71.0					18																	14542729		692	1584	2276	SO:0001819	synonymous_variant	388468	exon1			GTCCAGATCTTCT	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.417T>C	18.37:g.14542729A>G		327.0	0.0		906.0	360.0	NM_001137671		Silent	SNP	ENST00000358970.5	37	CCDS45835.1																																																																																			.		0.597	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269	
PRADC1	84279	broad.mit.edu;mdanderson.org	37	2	73456589	73456589	+	Splice_Site	SNP	C	C	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr2:73456589C>G	ENST00000258083.2	-	3	345	c.278G>C	c.(277-279)gGg>gCg	p.G93A	PRADC1_ENST00000480093.1_5'UTR	NM_032319.1	NP_115695.1	Q9BSG0	PADC1_HUMAN	protease-associated domain containing 1	93	PA.					extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|large_intestine(1)|lung(2)	4						CACTCCTTACCCCCTCTCCAC	0.522																																					p.G93A		.											.	PRADC1	90	0			c.G278C						.						100.0	101.0	101.0					2																	73456589		2203	4300	6503	SO:0001630	splice_region_variant	84279	exon3			CCTTACCCCCTCT	BC005069	CCDS1924.1	2p13.2	2012-10-31	2011-04-15	2011-04-15	ENSG00000135617	ENSG00000135617			16047	protein-coding gene	gene with protein product	"""protease-associated domain-containing glycoprotein 21 kDa"""		"""chromosome 2 open reading frame 7"""	C2orf7		15498570	Standard	NM_032319		Approved	MGC13004, PAP21, hPAP21	uc002siy.3	Q9BSG0	OTTHUMG00000129773	ENST00000258083.2:c.278+1G>C	2.37:g.73456589C>G		15.0	0.0		56.0	21.0	NM_032319	Q2Z1P2	Missense_Mutation	SNP	ENST00000258083.2	37	CCDS1924.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.606648	0.87157	.	.	ENSG00000135617	ENST00000258083	T	0.65916	-0.18	4.98	4.98	0.66077	Protease-associated domain, PA (1);	0.000000	0.85682	D	0.000000	D	0.83811	0.5335	M	0.92555	3.32	0.80722	D	1	D	0.71674	0.998	D	0.81914	0.995	D	0.87431	0.2388	9	.	.	.	-20.057	17.3441	0.87305	0.0:1.0:0.0:0.0	.	93	Q9BSG0	PADC1_HUMAN	A	93	ENSP00000258083:G93A	.	G	-	2	0	PRADC1	73310097	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	5.974000	0.70465	2.753000	0.94483	0.655000	0.94253	GGG	.		0.522	PRADC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251989.1	NM_032319	Missense_Mutation
PRKG1	5592	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	52834527	52834527	+	Intron	SNP	G	G	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr10:52834527G>T	ENST00000401604.2	+	2	460				PRKG1_ENST00000373980.4_Missense_Mutation_p.Q59H|PRKG1_ENST00000373985.1_Intron			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I						actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		CCACCCAGCAGGCGCAGAAGC	0.642																																					p.Q59H		.											.	PRKG1	523	0			c.G177T						.						233.0	157.0	183.0					10																	52834527		2203	4300	6503	SO:0001627	intron_variant	5592	exon1			CCAGCAGGCGCAG		CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.267-78397G>T	10.37:g.52834527G>T		113.0	1.0		166.0	70.0	NM_006258	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Missense_Mutation	SNP	ENST00000401604.2	37	CCDS44399.1	.	.	.	.	.	.	.	.	.	.	G	12.76	2.033139	0.35893	.	.	ENSG00000185532	ENST00000373980	T	0.68765	-0.35	5.47	4.57	0.56435	.	0.000000	0.64402	D	0.000005	T	0.48995	0.1531	N	0.16833	0.445	0.80722	D	1	P	0.39696	0.683	B	0.36418	0.224	T	0.52711	-0.8539	10	0.45353	T	0.12	-8.8809	12.3895	0.55350	0.0825:0.0:0.9175:0.0	.	59	Q13976-2	.	H	59	ENSP00000363092:Q59H	ENSP00000363092:Q59H	Q	+	3	2	PRKG1	52504533	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.091000	0.64505	1.442000	0.47568	-0.140000	0.14226	CAG	.		0.642	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
PRPF4B	8899	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	4053106	4053106	+	Splice_Site	SNP	T	T	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr6:4053106T>C	ENST00000337659.6	+	11	2565	c.2465T>C	c.(2464-2466)cTg>cCg	p.L822P	PRPF4B_ENST00000538861.1_Splice_Site_p.L808P	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	822	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				GACAATATCCTGGTAAGTCAA	0.373																																					p.L822P		.											.	PRPF4B	1308	0			c.T2465C						.						67.0	62.0	64.0					6																	4053106		2203	4300	6503	SO:0001630	splice_region_variant	8899	exon11			ATATCCTGGTAAG	U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.2466+1T>C	6.37:g.4053106T>C		44.0	1.0		181.0	46.0	NM_003913	A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Missense_Mutation	SNP	ENST00000337659.6	37	CCDS4488.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.245619	0.80024	.	.	ENSG00000112739	ENST00000337659;ENST00000538861	T;T	0.80909	-1.43;-1.43	4.6	4.6	0.57074	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.51477	D	0.000100	D	0.92747	0.7694	H	0.98466	4.24	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.95340	0.8437	10	0.87932	D	0	.	14.3009	0.66352	0.0:0.0:0.0:1.0	.	822	Q13523	PRP4B_HUMAN	P	822;808	ENSP00000337194:L822P;ENSP00000439331:L808P	ENSP00000337194:L822P	L	+	2	0	PRPF4B	3998105	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.655000	0.83696	1.811000	0.52892	0.455000	0.32223	CTG	.		0.373	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314018.2		Missense_Mutation
PRSS16	10279	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	27218524	27218524	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr6:27218524G>T	ENST00000230582.3	+	5	545	c.530G>T	c.(529-531)aGc>aTc	p.S177I	PRSS16_ENST00000421826.2_Intron	NM_005865.3	NP_005856.1	Q9NQE7	TSSP_HUMAN	protease, serine, 16 (thymus)	177					protein catabolic process (GO:0030163)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|lysosome (GO:0005764)	serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						TCCTCCTCCAGCCCCTGGATC	0.662																																					p.S177I	NSCLC(178;1118 2105 17078 23587 44429)	.											.	PRSS16	94	0			c.G530T						.						53.0	50.0	51.0					6																	27218524		2203	4300	6503	SO:0001583	missense	10279	exon5			CCTCCAGCCCCTG	AF052514	CCDS4623.1	6p21	2010-05-07			ENSG00000112812	ENSG00000112812		"""Serine peptidases / Serine peptidases"""	9480	protein-coding gene	gene with protein product		607169				10527559	Standard	NM_005865		Approved	TSSP	uc003nja.3	Q9NQE7	OTTHUMG00000016167	ENST00000230582.3:c.530G>T	6.37:g.27218524G>T	ENSP00000230582:p.Ser177Ile	42.0	1.0		179.0	45.0	NM_005865	O75416	Missense_Mutation	SNP	ENST00000230582.3	37	CCDS4623.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.4|20.4	3.991590|3.991590	0.74703|0.74703	.|.	.|.	ENSG00000112812|ENSG00000112812	ENST00000485993;ENST00000475106|ENST00000230582;ENST00000343467	.|T	.|0.24350	.|1.86	4.4|4.4	4.4|4.4	0.53042|0.53042	.|.	.|0.102270	.|0.85682	.|D	.|0.000000	T|T	0.34483|0.34483	0.0899|0.0899	M|M	0.71036|0.71036	2.16|2.16	0.35036|0.35036	D|D	0.759265|0.759265	.|D;D;P	.|0.71674	.|0.998;0.998;0.93	.|D;D;P	.|0.67382	.|0.951;0.951;0.718	T|T	0.27806|0.27806	-1.0063|-1.0063	5|10	.|0.72032	.|D	.|0.01	-18.6809|-18.6809	8.4643|8.4643	0.32947|0.32947	0.1053:0.0:0.8947:0.0|0.1053:0.0:0.8947:0.0	.|.	.|68;177;177	.|Q7Z5N6;C9JI59;Q9NQE7	.|.;.;TSSP_HUMAN	H|I	68|177	.|ENSP00000230582:S177I	.|ENSP00000230582:S177I	Q|S	+|+	3|2	2|0	PRSS16|PRSS16	27326503|27326503	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	2.038000|2.038000	0.41184|0.41184	2.456000|2.456000	0.83038|0.83038	0.563000|0.563000	0.77884|0.77884	CAG|AGC	.		0.662	PRSS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043418.2		
PTPRR	5801	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	71139795	71139795	+	Silent	SNP	G	G	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr12:71139795G>A	ENST00000283228.2	-	6	1262	c.810C>T	c.(808-810)caC>caT	p.H270H	PTPRR_ENST00000440835.2_Silent_p.H25H|PTPRR_ENST00000549308.1_Silent_p.H25H|PTPRR_ENST00000342084.4_Silent_p.H158H|PTPRR_ENST00000378778.1_Silent_p.H64H	NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	270					ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		TGGGCGATAGGTGGATCTCCT	0.438																																					p.H270H		.											.	PTPRR	652	0			c.C810T						.						198.0	168.0	178.0					12																	71139795		2203	4300	6503	SO:0001819	synonymous_variant	5801	exon6			CGATAGGTGGATC	D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502	ENST00000283228.2:c.810C>T	12.37:g.71139795G>A		302.0	0.0		697.0	276.0	NM_002849	B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Silent	SNP	ENST00000283228.2	37	CCDS8998.1																																																																																			.		0.438	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404485.1	NM_002849	
RABIF	5877	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	202858125	202858125	+	Silent	SNP	C	C	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr1:202858125C>G	ENST00000367262.3	-	1	138	c.102G>C	c.(100-102)ggG>ggC	p.G34G		NM_002871.4	NP_002862.2	P47224	MSS4_HUMAN	RAB interacting factor	34					membrane fusion (GO:0061025)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(2)|ovary(1)	4			BRCA - Breast invasive adenocarcinoma(75;0.166)			AGAGAGCGGTCCCTGGCTGCA	0.667																																					p.G34G		.											.	RABIF	227	0			c.G102C						.						26.0	24.0	25.0					1																	202858125		2196	4295	6491	SO:0001819	synonymous_variant	5877	exon1			AGCGGTCCCTGGC	S78873	CCDS1428.1	1q32.1	2008-05-14			ENSG00000183155	ENSG00000183155			9797	protein-coding gene	gene with protein product		603417		RASGRF3		9441742, 7619808	Standard	NM_002871		Approved	mss4	uc001gyl.3	P47224	OTTHUMG00000041400	ENST00000367262.3:c.102G>C	1.37:g.202858125C>G		89.0	1.0		109.0	54.0	NM_002871	B2R4P4|Q92992	Silent	SNP	ENST00000367262.3	37	CCDS1428.1																																																																																			.		0.667	RABIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099183.1		
RFC1	5981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	39322038	39322038	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr4:39322038G>C	ENST00000381897.1	-	9	1193	c.1060C>G	c.(1060-1062)Cct>Gct	p.P354A	RFC1_ENST00000418436.1_5'Flank|RFC1_ENST00000349703.2_Missense_Mutation_p.P354A	NM_001204747.1|NM_002913.4	NP_001191676.1|NP_002904.3	P35251	RFC1_HUMAN	replication factor C (activator 1) 1, 145kDa	354					DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription, DNA-templated (GO:0045893)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|telomere maintenance via telomerase (GO:0007004)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	cell junction (GO:0030054)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA clamp loader activity (GO:0003689)|double-stranded DNA binding (GO:0003690)|enzyme activator activity (GO:0008047)|sequence-specific DNA binding (GO:0043565)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						GTTTTCTTAGGAGTTTTTGTC	0.313																																					p.P354A	Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)	.											.	RFC1	230	0			c.C1060G						.						36.0	36.0	36.0					4																	39322038		2201	4300	6501	SO:0001583	missense	5981	exon9			TCTTAGGAGTTTT	L23320	CCDS3450.1, CCDS56329.1	4p14-p13	2010-04-21	2002-08-29		ENSG00000035928	ENSG00000035928		"""ATPases / AAA-type"""	9969	protein-coding gene	gene with protein product		102579	"""replication factor C (activator 1) 1 (145kD)"""			8114700	Standard	NM_002913		Approved	A1, PO-GA, RFC140, MHCBFB	uc003gty.2	P35251	OTTHUMG00000099363	ENST00000381897.1:c.1060C>G	4.37:g.39322038G>C	ENSP00000371321:p.Pro354Ala	166.0	0.0		267.0	108.0	NM_002913	A8K6E7|Q5XKF5|Q6PKU0|Q86V41|Q86V46	Missense_Mutation	SNP	ENST00000381897.1	37	CCDS56329.1	.	.	.	.	.	.	.	.	.	.	G	17.55	3.418820	0.62622	.	.	ENSG00000035928	ENST00000381897;ENST00000349703	T;T	0.54071	0.59;0.59	5.72	5.72	0.89469	.	0.274572	0.42294	D	0.000729	T	0.70378	0.3217	M	0.70275	2.135	0.80722	D	1	B;D	0.67145	0.326;0.996	B;D	0.63877	0.105;0.919	T	0.66736	-0.5848	10	0.33141	T	0.24	-10.5685	18.876	0.92337	0.0:0.0:1.0:0.0	.	354;354	P35251;P35251-2	RFC1_HUMAN;.	A	354	ENSP00000371321:P354A;ENSP00000261424:P354A	ENSP00000261424:P354A	P	-	1	0	RFC1	38998433	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.941000	0.63540	2.693000	0.91896	0.655000	0.94253	CCT	.		0.313	RFC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216808.1	NM_002913	
SACS	26278	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	23905027	23905027	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr13:23905027T>C	ENST00000382292.3	-	9	13261	c.12988A>G	c.(12988-12990)Agg>Ggg	p.R4330G	SACS_ENST00000382298.3_Missense_Mutation_p.R4330G|SACS_ENST00000402364.1_Missense_Mutation_p.R3580G			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	4330	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TACAACCGCCTAATAATCTTT	0.358																																					p.R4330G		.											.	SACS	298	0			c.A12988G						.						112.0	122.0	118.0					13																	23905027		2203	4299	6502	SO:0001583	missense	26278	exon10			ACCGCCTAATAAT	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.12988A>G	13.37:g.23905027T>C	ENSP00000371729:p.Arg4330Gly	139.0	0.0		271.0	14.0	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	T	18.55	3.648155	0.67358	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.86432	-2.12;-2.12;-2.12	5.83	4.62	0.57501	Heat shock protein DnaJ, N-terminal (4);	0.000000	0.85682	D	0.000000	D	0.94338	0.8180	M	0.91406	3.205	0.52501	D	0.999958	D	0.76494	0.999	D	0.78314	0.991	D	0.94762	0.7937	10	0.87932	D	0	.	12.9845	0.58583	0.0:0.0:0.1351:0.8649	.	4330	Q9NZJ4	SACS_HUMAN	G	4330;3580;4330	ENSP00000371729:R4330G;ENSP00000385844:R3580G;ENSP00000371735:R4330G	ENSP00000371729:R4330G	R	-	1	2	SACS	22803027	1.000000	0.71417	0.992000	0.48379	0.996000	0.88848	2.150000	0.42254	0.990000	0.38787	0.460000	0.39030	AGG	.		0.358	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
SCN10A	6336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38835301	38835301	+	Silent	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr3:38835301A>G	ENST00000449082.2	-	1	200	c.201T>C	c.(199-201)taT>taC	p.Y67Y		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	67					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GGAGCTCACCATAGAACTTGG	0.547																																					p.Y67Y		.											.	SCN10A	99	0			c.T201C						.						137.0	144.0	142.0					3																	38835301		2203	4300	6503	SO:0001819	synonymous_variant	6336	exon1			CTCACCATAGAAC	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.201T>C	3.37:g.38835301A>G		122.0	0.0		335.0	149.0	NM_006514	A6NDQ1	Silent	SNP	ENST00000449082.2	37	CCDS33736.1																																																																																			.		0.547	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
SDK2	54549	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	17	71382609	71382609	+	Silent	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr17:71382609C>T	ENST00000392650.3	-	31	4473	c.4473G>A	c.(4471-4473)tcG>tcA	p.S1491S	SDK2_ENST00000388726.3_Silent_p.S1491S	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1491	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						TCAGTGACTCCGACTCCTCGC	0.587																																					p.S1491S		.											.	SDK2	24	0			c.G4473A						.						60.0	49.0	53.0					17																	71382609		2194	4264	6458	SO:0001819	synonymous_variant	54549	exon31			TGACTCCGACTCC	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.4473G>A	17.37:g.71382609C>T		17.0	0.0		53.0	14.0	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Silent	SNP	ENST00000392650.3	37	CCDS45769.1																																																																																			.		0.587	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
SFPQ	6421	hgsc.bcm.edu;bcgsc.ca	37	1	35654866	35654867	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr1:35654866_35654867insT	ENST00000357214.5	-	5	1630_1631	c.1532_1533insA	c.(1531-1533)aacfs	p.N511fs		NM_005066.2	NP_005057.1	P23246	SFPQ_HUMAN	splicing factor proline/glutamine-rich	511					alternative mRNA splicing, via spliceosome (GO:0000380)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H3 deacetylation (GO:0070932)|mRNA processing (GO:0006397)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|histone deacetylase binding (GO:0042826)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)		SFPQ/TFE3(6)	NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				CATCTTTCATGTTTTTTTCAAC	0.406			T	TFE3	papillary renal cell																																p.N511fs		.		Dom	yes		1	1p34.3	6421	splicing factor proline/glutamine rich(polypyrimidine tract binding protein associated)		E	.	SFPQ	231	0			c.1533_1534insA						.																																			SO:0001589	frameshift_variant	6421	exon5			TTTCATGTTTTTT	X70944	CCDS388.1	1p34.3	2014-06-13	2010-05-04		ENSG00000116560	ENSG00000116560		"""RNA binding motif (RRM) containing"""	10774	protein-coding gene	gene with protein product	"""polypyrimidine tract binding protein associated"", ""protein phosphatase 1, regulatory subunit 140"""	605199	"""splicing factor proline/glutamine rich (polypyrimidine tract-binding protein-associated)"""			8449401	Standard	NM_005066		Approved	PSF, PPP1R140	uc001bys.3	P23246	OTTHUMG00000004157	ENST00000357214.5:c.1533dupA	1.37:g.35654873_35654873dupT	ENSP00000349748:p.Asn511fs	262.0	0.0		710.0	262.0	NM_005066	P30808|Q5SZ71	Frame_Shift_Ins	INS	ENST00000357214.5	37	CCDS388.1																																																																																			.		0.406	SFPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011984.4	NM_005066	
SH3YL1	26751	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	218860	218860	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr2:218860A>C	ENST00000405430.1	-	12	1356	c.980T>G	c.(979-981)cTt>cGt	p.L327R	SH3YL1_ENST00000403657.1_Missense_Mutation_p.L212R|SH3YL1_ENST00000403658.1_Missense_Mutation_p.L212R|SH3YL1_ENST00000415006.2_Missense_Mutation_p.L231R|SH3YL1_ENST00000468321.1_5'UTR|SH3YL1_ENST00000356150.5_Missense_Mutation_p.L327R|SH3YL1_ENST00000403712.2_Missense_Mutation_p.L308R			Q96HL8	SH3Y1_HUMAN	SH3 and SYLF domain containing 1	327	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				phosphatidylinositol biosynthetic process (GO:0006661)|regulation of ruffle assembly (GO:1900027)	ruffle membrane (GO:0032587)	phosphatase binding (GO:0019902)|phosphatidylinositol binding (GO:0035091)			large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	7	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.034)		all cancers(51;0.000647)|Epithelial(75;0.0043)|OV - Ovarian serous cystadenocarcinoma(76;0.00871)|GBM - Glioblastoma multiforme(21;0.148)		TTGACCTCGAAGTTTTCCTTC	0.353																																					p.L327R		.											.	SH3YL1	91	0			c.T980G						.						128.0	119.0	122.0					2																	218860		1854	4093	5947	SO:0001583	missense	26751	exon10			CCTCGAAGTTTTC		CCDS42646.1, CCDS42646.2, CCDS54332.1, CCDS62841.1	2p25.3	2013-10-18	2013-10-18		ENSG00000035115	ENSG00000035115			29546	protein-coding gene	gene with protein product			"""SH3 domain containing, Ysc84-like 1 (S. cerevisiae)"""			21624956	Standard	NM_001282687		Approved	Ray, DKFZP586F1318	uc002qvx.3	Q96HL8	OTTHUMG00000151359	ENST00000405430.1:c.980T>G	2.37:g.218860A>C	ENSP00000384269:p.Leu327Arg	48.0	0.0		152.0	75.0	NM_015677	A8K8E7|B7WNJ4|B7WPL6|Q8NEL2|Q9H5X4|Q9Y3V5	Missense_Mutation	SNP	ENST00000405430.1	37		.	.	.	.	.	.	.	.	.	.	A	21.5	4.157471	0.78114	.	.	ENSG00000035115	ENST00000415006;ENST00000403712;ENST00000403657;ENST00000405430;ENST00000356150;ENST00000403658;ENST00000451005	T;T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69;0.69	6.03	6.03	0.97812	Src homology-3 domain (5);	0.000000	0.64402	D	0.000001	T	0.67221	0.2870	M	0.71581	2.175	0.80722	D	1	D;D;D;D	0.76494	0.998;0.991;0.999;0.999	D;P;D;D	0.70716	0.97;0.891;0.969;0.948	T	0.70353	-0.4895	10	0.72032	D	0.01	-12.012	14.5176	0.67830	1.0:0.0:0.0:0.0	.	212;308;327;231	Q96HL8-4;Q96HL8-2;Q96HL8;Q96HL8-3	.;.;SH3Y1_HUMAN;.	R	231;308;212;327;327;212;240	ENSP00000404143:L231R;ENSP00000384276:L308R;ENSP00000385668:L212R;ENSP00000384269:L327R;ENSP00000348471:L327R;ENSP00000383928:L212R;ENSP00000416312:L240R	ENSP00000348471:L327R	L	-	2	0	SH3YL1	208860	1.000000	0.71417	0.948000	0.38648	0.965000	0.64279	5.939000	0.70179	2.302000	0.77476	0.533000	0.62120	CTT	.		0.353	SH3YL1-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322352.1	NM_015677	
SHKBP1	92799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	41089323	41089323	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr19:41089323T>A	ENST00000291842.5	+	11	1029	c.980T>A	c.(979-981)aTc>aAc	p.I327N	SHKBP1_ENST00000600733.1_Missense_Mutation_p.I302N	NM_138392.3	NP_612401.2	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	327					protein homooligomerization (GO:0051260)					breast(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(3)|urinary_tract(1)	29			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GTGCAGCCCATCACCAGTTAT	0.647																																					p.I327N		.											.	SHKBP1	92	0			c.T980A						.						32.0	28.0	30.0					19																	41089323		2203	4298	6501	SO:0001583	missense	92799	exon11			AGCCCATCACCAG	AF258553	CCDS12560.1	19q13.2	2013-01-10				ENSG00000160410		"""WD repeat domain containing"""	19214	protein-coding gene	gene with protein product						11152963	Standard	NM_138392		Approved	PP203, Sb1	uc002oob.3	Q8TBC3		ENST00000291842.5:c.980T>A	19.37:g.41089323T>A	ENSP00000291842:p.Ile327Asn	34.0	0.0		50.0	20.0	NM_138392	Q8N2I6|Q8WY93|Q96IB8	Missense_Mutation	SNP	ENST00000291842.5	37	CCDS12560.1	.	.	.	.	.	.	.	.	.	.	T	15.48	2.845362	0.51164	.	.	ENSG00000160410	ENST00000291842;ENST00000446701	T	0.09817	2.94	5.27	4.24	0.50183	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.32852	0.0843	M	0.81942	2.565	0.80722	D	1	D;D;D;B;D;B	0.89917	1.0;1.0;0.997;0.22;0.999;0.141	D;D;D;B;D;B	0.83275	0.996;0.991;0.994;0.062;0.996;0.028	T	0.04607	-1.0939	10	0.87932	D	0	-20.1167	10.6089	0.45410	0.1443:0.0:0.0:0.8557	.	205;164;250;164;327;327	B4DLI0;B4DUW2;B4DUV2;B3KVX8;B2R6W9;Q8TBC3	.;.;.;.;.;SHKB1_HUMAN	N	327;164	ENSP00000291842:I327N	ENSP00000291842:I327N	I	+	2	0	SHKBP1	45781163	1.000000	0.71417	0.998000	0.56505	0.289000	0.27227	7.495000	0.81514	0.832000	0.34804	-0.509000	0.04479	ATC	.		0.647	SHKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462613.2	NM_138392	
SLC1A7	6512	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	53555552	53555552	+	Silent	SNP	G	G	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr1:53555552G>C	ENST00000371494.4	-	9	1408	c.1281C>G	c.(1279-1281)ctC>ctG	p.L427L	SLC1A7_ENST00000488036.1_5'UTR	NM_006671.4	NP_006662.3	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter), member 7	427					dicarboxylic acid transport (GO:0006835)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.L427L(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Colorectal(1306;0.234)		CCATGGTGACGAGGCCGGCCT	0.627																																					p.L427L	NSCLC(128;80 1811 21245 38490 51715)	.											.	SLC1A7	155	1	Substitution - coding silent(1)	lung(1)	c.C1281G						.						81.0	72.0	75.0					1																	53555552		2203	4300	6503	SO:0001819	synonymous_variant	6512	exon9			GGTGACGAGGCCG	U76362	CCDS574.1, CCDS72796.1, CCDS72797.1, CCDS72798.1	1p32.3	2013-05-22			ENSG00000162383	ENSG00000162383		"""Solute carriers"""	10945	protein-coding gene	gene with protein product		604471				9108121	Standard	NM_001287597		Approved	EAAT5	uc001cuy.3	O00341	OTTHUMG00000008937	ENST00000371494.4:c.1281C>G	1.37:g.53555552G>C		90.0	0.0		173.0	76.0	NM_006671	Q5VVZ0|Q969Z8|Q9BW45	Silent	SNP	ENST00000371494.4	37	CCDS574.1																																																																																			.		0.627	SLC1A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024746.1	NM_006671	
SLC22A8	9376	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	62761284	62761284	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr11:62761284C>T	ENST00000336232.2	-	9	1418	c.1283G>A	c.(1282-1284)tGc>tAc	p.C428Y	SLC22A8_ENST00000430500.2_Missense_Mutation_p.C428Y|SLC22A8_ENST00000545207.1_Missense_Mutation_p.C337Y|SLC22A8_ENST00000535878.1_Missense_Mutation_p.C305Y|SLC22A8_ENST00000311438.8_Missense_Mutation_p.C428Y|SLC22A8_ENST00000542795.1_5'Flank	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8	428					glutathione transport (GO:0034635)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|quaternary ammonium group transmembrane transporter activity (GO:0015651)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)	GAGGAAGAGGCAGCTGAAGGA	0.562																																					p.C428Y		.											.	SLC22A8	93	0			c.G1283A						.						103.0	92.0	96.0					11																	62761284		2201	4298	6499	SO:0001583	missense	9376	exon9			AAGAGGCAGCTGA	AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452		"""Solute carriers"""	10972	protein-coding gene	gene with protein product		607581				10049739	Standard	NM_004254		Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.1283G>A	11.37:g.62761284C>T	ENSP00000337335:p.Cys428Tyr	89.0	0.0		145.0	68.0	NM_001184732	B4DPH7|F5GWA8|F5H5J1|O95820|Q59EW9|Q96TC1	Missense_Mutation	SNP	ENST00000336232.2	37	CCDS8042.1	.	.	.	.	.	.	.	.	.	.	C	19.73	3.881186	0.72294	.	.	ENSG00000149452	ENST00000336232;ENST00000540631;ENST00000545207;ENST00000535878;ENST00000311438;ENST00000430500	T;T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91;-0.91	5.89	5.89	0.94794	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.89315	0.6680	M	0.91768	3.24	0.42859	D	0.994103	D;D	0.89917	1.0;1.0	D;D	0.81914	0.994;0.995	D	0.91167	0.4965	10	0.87932	D	0	.	17.7556	0.88447	0.0:1.0:0.0:0.0	.	428;428	Q8TCC7-2;Q8TCC7	.;S22A8_HUMAN	Y	428;414;337;305;428;428	ENSP00000337335:C428Y;ENSP00000441658:C337Y;ENSP00000443368:C305Y;ENSP00000311463:C428Y;ENSP00000398548:C428Y	ENSP00000311463:C428Y	C	-	2	0	SLC22A8	62517860	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.683000	0.46943	2.793000	0.96121	0.655000	0.94253	TGC	.		0.562	SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396191.1	NM_004254	
SMEK1	55671	ucsc.edu;bcgsc.ca	37	14	91952073	91952073	+	Splice_Site	SNP	T	T	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr14:91952073T>C	ENST00000554943.1	-	3	315	c.200A>G	c.(199-201)gAc>gGc	p.D67G	SMEK1_ENST00000428424.2_Intron|SMEK1_ENST00000554684.1_Splice_Site_p.D67G|SMEK1_ENST00000337238.4_Splice_Site_p.D67G|SMEK1_ENST00000555462.1_Intron			Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1 (Dictyostelium)	67	WH1.				positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				NS(1)|endometrium(1)|kidney(1)|liver(1)|lung(1)|stomach(1)	6		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		AATCAGAGTGTCCTTTGGAGA	0.343																																					p.D67G		.											.	SMEK1	226	0			c.A200G						.						74.0	68.0	70.0					14																	91952073		2203	4299	6502	SO:0001630	splice_region_variant	55671	exon4			AGAGTGTCCTTTG	AK000714	CCDS9895.1, CCDS61532.1	14q32.12	2008-09-15	2006-10-12	2006-10-12		ENSG00000100796			20219	protein-coding gene	gene with protein product		610351	"""KIAA2010"""	KIAA2010		16085932, 18487071	Standard	XM_005267842		Approved	FLJ20707, MSTP033, FLFL1, smk-1, smk1	uc001xzm.3	Q6IN85		ENST00000554943.1:c.199-1A>G	14.37:g.91952073T>C		24.0	0.0		34.0	4.0	NM_032560	Q69YK6|Q86U23|Q86YI7|Q8IVG1|Q9H3F1|Q9H7U8|Q9NV01|Q9NWP1	Missense_Mutation	SNP	ENST00000554943.1	37		.	.	.	.	.	.	.	.	.	.	T	18.80	3.701398	0.68501	.	.	ENSG00000100796	ENST00000554684;ENST00000337238;ENST00000554943;ENST00000554390;ENST00000557018;ENST00000554511	T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93	5.5	5.5	0.81552	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.51770	0.1694	L	0.37697	1.125	0.80722	D	1	P;D	0.65815	0.745;0.995	B;D	0.63793	0.299;0.918	T	0.44360	-0.9333	10	0.30078	T	0.28	-17.0811	15.6207	0.76805	0.0:0.0:0.0:1.0	.	67;67	Q6IN85;Q6IN85-2	P4R3A_HUMAN;.	G	67	ENSP00000450864:D67G;ENSP00000337125:D67G;ENSP00000450883:D67G;ENSP00000452596:D67G;ENSP00000450432:D67G;ENSP00000451939:D67G	ENSP00000337125:D67G	D	-	2	0	SMEK1	91021826	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	8.040000	0.89188	2.092000	0.63282	0.533000	0.62120	GAC	.		0.343	SMEK1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000411665.1	NM_032560	Missense_Mutation
SNX13	23161	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	17908059	17908059	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr7:17908059C>G	ENST00000409389.1	-	9	980	c.808G>C	c.(808-810)Gat>Cat	p.D270H	SNX13_ENST00000428135.3_Missense_Mutation_p.D270H			Q9Y5W8	SNX13_HUMAN	sorting nexin 13	270	PXA. {ECO:0000255|PROSITE- ProRule:PRU00147, ECO:0000255|PROSITE- ProRule:PRU00553}.				intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					TTAATATAATCAGGATCACTG	0.269																																					p.D270H		.											.	SNX13	650	0			c.G808C						.						35.0	35.0	35.0					7																	17908059		1787	4033	5820	SO:0001583	missense	23161	exon9			TATAATCAGGATC	AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.808G>C	7.37:g.17908059C>G	ENSP00000386705:p.Asp270His	124.0	0.0		347.0	110.0	NM_015132	B2RCI9|O94821|Q8WVZ2|Q8WXH8	Missense_Mutation	SNP	ENST00000409389.1	37		.	.	.	.	.	.	.	.	.	.	C	21.5	4.165450	0.78339	.	.	ENSG00000071189	ENST00000409389;ENST00000428135;ENST00000242044	T;T	0.33865	1.39;1.65	5.22	4.34	0.51931	Phox-associated domain (2);PX-associated, sorting nexin 13 (1);	0.000000	0.85682	D	0.000000	T	0.62332	0.2419	M	0.83774	2.66	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;1.0;0.998	T	0.68258	-0.5456	10	0.72032	D	0.01	-6.7173	13.5344	0.61639	0.0:0.9233:0.0:0.0767	.	67;270;270;270	B3KN60;Q9Y5W8;B8ZZT9;Q9Y5W8-2	.;SNX13_HUMAN;.;.	H	270;270;318	ENSP00000386705:D270H;ENSP00000398789:D270H	ENSP00000242044:D318H	D	-	1	0	SNX13	17874584	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.229000	0.78088	1.187000	0.43000	0.650000	0.86243	GAT	.		0.269	SNX13-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000327608.1	NM_015132	
SORCS3	22986	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	106976778	106976778	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr10:106976778G>C	ENST00000369701.3	+	19	2859	c.2632G>C	c.(2632-2634)Ggc>Cgc	p.G878R	SORCS3_ENST00000369699.4_Missense_Mutation_p.G164R	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	878	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CATCGAGGACGGCATCAAGCA	0.522																																					p.G878R	NSCLC(116;1497 1690 7108 13108 14106)	.											.	SORCS3	99	0			c.G2632C						.						178.0	135.0	150.0					10																	106976778		2203	4300	6503	SO:0001583	missense	22986	exon19			GAGGACGGCATCA	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2632G>C	10.37:g.106976778G>C	ENSP00000358715:p.Gly878Arg	61.0	1.0		112.0	53.0	NM_014978	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474000	0.84640	.	.	ENSG00000156395	ENST00000369701;ENST00000369699	T;T	0.61742	0.08;0.08	5.87	4.97	0.65823	PKD domain (4);	0.000000	0.85682	D	0.000000	T	0.75148	0.3810	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76556	-0.2916	9	.	.	.	.	16.8359	0.85957	0.0:0.0:0.8704:0.1296	.	878	Q9UPU3	SORC3_HUMAN	R	878;164	ENSP00000358715:G878R;ENSP00000358713:G164R	.	G	+	1	0	SORCS3	106966768	1.000000	0.71417	0.929000	0.37066	0.905000	0.53344	9.420000	0.97426	1.615000	0.50252	0.655000	0.94253	GGC	.		0.522	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
SPATA3	130560	hgsc.bcm.edu;bcgsc.ca	37	2	231861082	231861082	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr2:231861082C>G	ENST00000452881.1	+	1	242	c.134C>G	c.(133-135)aCa>aGa	p.T45R	SPATA3_ENST00000433428.2_Missense_Mutation_p.T45R|SPATA3_ENST00000455816.1_Missense_Mutation_p.T45R|SPATA3_ENST00000424440.1_Missense_Mutation_p.T45R|AC105344.2_ENST00000414876.1_lincRNA			Q8NHX4	SPTA3_HUMAN	spermatogenesis associated 3	45			Missing.							endometrium(2)|lung(1)	3						CCTGAATCCACACCACAGCAG	0.592																																					p.T45R		.											.	.	.	0			c.C134G						.						145.0	157.0	153.0					2																	231861082		692	1591	2283	SO:0001583	missense	130560	exon1			AATCCACACCACA	AY032925	CCDS2481.1	2q37.1	2008-02-05			ENSG00000173699	ENSG00000173699			17884	protein-coding gene	gene with protein product							Standard	NM_139073		Approved	TSARG1	uc010zmd.2	Q8NHX4	OTTHUMG00000133221	ENST00000452881.1:c.134C>G	2.37:g.231861082C>G	ENSP00000388895:p.Thr45Arg	65.0	0.0		111.0	9.0	NM_139073	Q86WX5|Q8N9Y6	Missense_Mutation	SNP	ENST00000452881.1	37	CCDS2481.1	.	.	.	.	.	.	.	.	.	.	C	2.376	-0.343294	0.05243	.	.	ENSG00000173699	ENST00000424440;ENST00000452881;ENST00000433428;ENST00000455816;ENST00000440792	.	.	.	3.75	-3.3	0.05003	.	.	.	.	.	T	0.22003	0.0530	N	0.24115	0.695	0.09310	N	1	P	0.47677	0.899	P	0.45099	0.469	T	0.23619	-1.0183	8	0.16420	T	0.52	.	7.6178	0.28169	0.0:0.2599:0.5537:0.1864	.	36	Q8NHX4	SPTA3_HUMAN	R	45;45;45;45;11	.	ENSP00000399514:T45R	T	+	2	0	SPATA3	231569326	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.019000	0.03622	-0.732000	0.04856	-0.176000	0.13171	ACA	.		0.592	SPATA3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256956.2	NM_139073	
SPATA3	130560	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	231861109	231861109	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr2:231861109C>G	ENST00000452881.1	+	1	269	c.161C>G	c.(160-162)aCa>aGa	p.T54R	SPATA3_ENST00000433428.2_Missense_Mutation_p.T54R|SPATA3_ENST00000455816.1_Missense_Mutation_p.T54R|SPATA3_ENST00000424440.1_Missense_Mutation_p.T54R|AC105344.2_ENST00000414876.1_lincRNA			Q8NHX4	SPTA3_HUMAN	spermatogenesis associated 3	54										endometrium(2)|lung(1)	3						CCTGAATCCACACCACAGCAT	0.572																																					p.T54R		.											.	.	.	0			c.C161G						.						168.0	186.0	181.0					2																	231861109		692	1591	2283	SO:0001583	missense	130560	exon1			AATCCACACCACA	AY032925	CCDS2481.1	2q37.1	2008-02-05			ENSG00000173699	ENSG00000173699			17884	protein-coding gene	gene with protein product							Standard	NM_139073		Approved	TSARG1	uc010zmd.2	Q8NHX4	OTTHUMG00000133221	ENST00000452881.1:c.161C>G	2.37:g.231861109C>G	ENSP00000388895:p.Thr54Arg	70.0	0.0		114.0	39.0	NM_139073	Q86WX5|Q8N9Y6	Missense_Mutation	SNP	ENST00000452881.1	37	CCDS2481.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.33|10.33	1.319073|1.319073	0.23994|0.23994	.|.	.|.	ENSG00000173699|ENSG00000173699	ENST00000423134|ENST00000424440;ENST00000452881;ENST00000433428;ENST00000455816;ENST00000355662;ENST00000440792	.|.	.|.	.|.	3.91|3.91	-2.26|-2.26	0.06867|0.06867	.|.	.|1.309650	.|0.05271	.|N	.|0.517535	T|T	0.21509|0.21509	0.0518|0.0518	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|P	.|0.47677	.|0.899	.|B	.|0.42522	.|0.39	T|T	0.17745|0.17745	-1.0359|-1.0359	4|8	.|0.38643	.|T	.|0.18	-2.8179|-2.8179	3.6202|3.6202	0.08093|0.08093	0.1633:0.3364:0.4024:0.0979|0.1633:0.3364:0.4024:0.0979	.|.	.|45	.|Q8NHX4	.|SPTA3_HUMAN	Q|R	2|54;54;54;54;45;20	.|.	.|ENSP00000347884:T45R	H|T	+|+	3|2	2|0	SPATA3|SPATA3	231569353|231569353	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.031000|0.031000	0.12232|0.12232	-0.747000|-0.747000	0.04823|0.04823	-0.432000|-0.432000	0.07297|0.07297	0.655000|0.655000	0.94253|0.94253	CAC|ACA	.		0.572	SPATA3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256956.2	NM_139073	
SPATC1	375686	ucsc.edu;bcgsc.ca;mdanderson.org	37	8	145101782	145101782	+	Silent	SNP	C	C	T	rs140647326	byFrequency	TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr8:145101782C>T	ENST00000377470.3	+	5	1803	c.1701C>T	c.(1699-1701)ctC>ctT	p.L567L	CTD-3065J16.6_ENST00000561181.1_RNA|CTD-3065J16.6_ENST00000528912.1_RNA|SPATC1_ENST00000447830.2_3'UTR	NM_198572.2	NP_940974.2	Q76KD6	SPERI_HUMAN	spermatogenesis and centriole associated 1	567						centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCGGCATGCTCGCCGACGCGC	0.692																																					p.L567L		.											.	SPATC1	91	0			c.C1701T						.						60.0	58.0	59.0					8																	145101782		2203	4296	6499	SO:0001819	synonymous_variant	375686	exon5			CATGCTCGCCGAC	BC053547	CCDS6413.2, CCDS47937.1	8q24.3	2005-01-11			ENSG00000186583	ENSG00000186583			30510	protein-coding gene	gene with protein product		610874				15280373	Standard	NM_198572		Approved	MGC61633, SPATA15, SPERIOLIN	uc011lkw.2	Q76KD6	OTTHUMG00000156976	ENST00000377470.3:c.1701C>T	8.37:g.145101782C>T		31.0	0.0		45.0	20.0	NM_198572	B4DWW9|Q5U5I8|Q7Z6L7	Silent	SNP	ENST00000377470.3	37	CCDS6413.2																																																																																			C|0.999;A|0.001		0.692	SPATC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346926.1	NM_198572	
SPOCK1	6695	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	136314376	136314376	+	Silent	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr5:136314376A>G	ENST00000394945.1	-	11	1456	c.1287T>C	c.(1285-1287)gaT>gaC	p.D429D	SPOCK1_ENST00000282223.7_Silent_p.D429D|SPOCK1_ENST00000509978.1_5'Flank	NM_004598.3	NP_004589.1	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1	429					cell adhesion (GO:0007155)|central nervous system neuron differentiation (GO:0021953)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron projection development (GO:0010977)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|neuron migration (GO:0001764)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|postsynaptic density (GO:0014069)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasm (GO:0016528)	calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCTCTTTGTCATCATCCTCAT	0.483																																					p.D429D		.											.	SPOCK1	91	0			c.T1287C						.						293.0	230.0	251.0					5																	136314376		2203	4300	6503	SO:0001819	synonymous_variant	6695	exon11			TTTGTCATCATCC	AF231124	CCDS4191.1	5q31.2	2008-02-05	2005-11-04	2005-11-04	ENSG00000152377	ENSG00000152377			11251	protein-coding gene	gene with protein product		602264	"""sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican)"""	TIC1, SPOCK		9545645	Standard	NM_004598		Approved	testican-1	uc003lbp.3	Q08629	OTTHUMG00000129157	ENST00000394945.1:c.1287T>C	5.37:g.136314376A>G		123.0	0.0		303.0	130.0	NM_004598	B3KSW3|Q59EW0|Q8N630|Q9UCL8	Silent	SNP	ENST00000394945.1	37	CCDS4191.1																																																																																			.		0.483	SPOCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251222.1	NM_004598	
SRCAP	10847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu|broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30724538	30724539	+	Missense_Mutation	DNP	AA	AA	TG			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown|.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr16:30724538_30724539AA>TG	ENST00000262518.4	+	15	2525_2526	c.2140_2141AA>TG	c.(2140-2142)AAg>TGg	p.K714W	SRCAP_ENST00000395059.2_Missense_Mutation_p.K714W|SRCAP_ENST00000344771.4_Missense_Mutation_p.K714W|SNORA30_ENST00000384028.1_RNA	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	714	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GGGCTGGACCAAGCCCAATGCC	0.49																																					p.K714X|p.K714R		.											.	SRCAP	94	0			c.A2140T|c.A2141G						.																																			SO:0001583	missense	10847	exon15			TGGACCAAGCCCA|GGACCAAGCCCAA	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	Exception_encountered	16.37:g.30724538_30724539delinsTG	ENSP00000262518:p.Lys714Trp	51.0	0.0|1.0		123.0	47.0|48.0	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000262518.4	37	CCDS10689.2																																																																																			.		0.490	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
SSTR4	6754	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	23017142	23017142	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr20:23017142A>G	ENST00000255008.3	+	1	1086	c.1022A>G	c.(1021-1023)gAg>gGg	p.E341G	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	341					arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GGTGCTGAGGAGGAGCCCCTG	0.617																																					p.E341G	Esophageal Squamous(15;850 1104 16640)	.											.	SSTR4	522	0			c.A1022G						.						43.0	48.0	46.0					20																	23017142		2167	4272	6439	SO:0001583	missense	6754	exon1			CTGAGGAGGAGCC		CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.1022A>G	20.37:g.23017142A>G	ENSP00000255008:p.Glu341Gly	73.0	0.0		96.0	12.0	NM_001052	Q17RM1|Q17RM3|Q9UIY1	Missense_Mutation	SNP	ENST00000255008.3	37	CCDS42856.1	.	.	.	.	.	.	.	.	.	.	A	11.62	1.692244	0.30052	.	.	ENSG00000132671	ENST00000255008	T	0.66995	-0.24	3.65	3.65	0.41850	.	0.228573	0.20938	U	0.082978	T	0.66247	0.2770	L	0.48642	1.525	0.39894	D	0.973805	D	0.53885	0.963	P	0.53313	0.723	T	0.63484	-0.6627	10	0.25106	T	0.35	.	10.2785	0.43526	1.0:0.0:0.0:0.0	.	341	P31391	SSR4_HUMAN	G	341	ENSP00000255008:E341G	ENSP00000255008:E341G	E	+	2	0	SSTR4	22965142	0.998000	0.40836	0.901000	0.35422	0.231000	0.25187	3.983000	0.56916	1.510000	0.48803	0.533000	0.62120	GAG	.		0.617	SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078308.1		
STK39	27347	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	169018309	169018309	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr2:169018309C>A	ENST00000355999.4	-	5	1321	c.616G>T	c.(616-618)Gta>Tta	p.V206L		NM_013233.2	NP_037365.2	Q9UEW8	STK39_HUMAN	serine threonine kinase 39	206	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular hypotonic response (GO:0071476)|intracellular signal transduction (GO:0035556)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of rubidium ion transmembrane transporter activity (GO:2000687)|negative regulation of rubidium ion transport (GO:2000681)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of potassium ion transport (GO:0043268)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|response to stress (GO:0006950)|signal transduction by phosphorylation (GO:0023014)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)	13						GCTATTTGTACTGAACCATCC	0.303																																					p.V206L		.											.	STK39	546	0			c.G616T						.						81.0	74.0	76.0					2																	169018309		1796	4058	5854	SO:0001583	missense	27347	exon5			TTTGTACTGAACC	AF099989	CCDS42770.1	2q24.3	2010-06-25	2010-06-25		ENSG00000198648	ENSG00000198648			17717	protein-coding gene	gene with protein product	"""STE20/SPS1 homolog (yeast)"""	607648				10980603	Standard	NM_013233		Approved	DCHT, SPAK	uc002uea.3	Q9UEW8	OTTHUMG00000133745	ENST00000355999.4:c.616G>T	2.37:g.169018309C>A	ENSP00000348278:p.Val206Leu	195.0	0.0		348.0	126.0	NM_013233	O14774|Q53S90|Q53SL7|Q53SS1|Q9UER4|X5D9C8	Missense_Mutation	SNP	ENST00000355999.4	37	CCDS42770.1	.	.	.	.	.	.	.	.	.	.	C	32	5.174476	0.94807	.	.	ENSG00000198648	ENST00000355999	T	0.22743	1.94	6.17	6.17	0.99709	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.39682	0.1087	L	0.44542	1.39	0.80722	D	1	P	0.52842	0.956	P	0.59643	0.861	T	0.02064	-1.1220	10	0.87932	D	0	-10.3885	20.8794	0.99867	0.0:1.0:0.0:0.0	.	206	Q9UEW8	STK39_HUMAN	L	206	ENSP00000348278:V206L	ENSP00000348278:V206L	V	-	1	0	STK39	168726555	1.000000	0.71417	0.971000	0.41717	0.959000	0.62525	6.875000	0.75551	2.941000	0.99782	0.655000	0.94253	GTA	.		0.303	STK39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258112.2	NM_013233	
STON2	85439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	81862242	81862242	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr14:81862242C>G	ENST00000267540.2	-	2	569	c.369G>C	c.(367-369)gaG>gaC	p.E123D	STON2_ENST00000555447.1_Missense_Mutation_p.E123D	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	123					hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		CCTCACCTGTCTCAGCTGTTT	0.567																																					p.E123D		.											.	STON2	95	0			c.G369C						.						79.0	80.0	80.0					14																	81862242		2203	4300	6503	SO:0001583	missense	85439	exon4			ACCTGTCTCAGCT	AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.369G>C	14.37:g.81862242C>G	ENSP00000267540:p.Glu123Asp	51.0	0.0		118.0	50.0	NM_001256430	G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Missense_Mutation	SNP	ENST00000267540.2	37	CCDS9875.1	.	.	.	.	.	.	.	.	.	.	C	10.23	1.293747	0.23564	.	.	ENSG00000140022	ENST00000555447;ENST00000546306;ENST00000267540	T;T	0.54866	0.55;0.55	5.82	5.82	0.92795	Stonin-2, N-terminal (1);	1.323900	0.05364	N	0.534288	T	0.50411	0.1614	L	0.29908	0.895	0.09310	N	0.999995	B;B;B	0.23185	0.033;0.081;0.027	B;B;B	0.30943	0.113;0.122;0.069	T	0.41342	-0.9514	10	0.29301	T	0.29	-0.2313	15.6141	0.76750	0.0:1.0:0.0:0.0	.	123;123;123	Q8WXE9;Q17R23;G3V2T7	STON2_HUMAN;.;.	D	123;135;123	ENSP00000450857:E123D;ENSP00000267540:E123D	ENSP00000267540:E123D	E	-	3	2	STON2	80931995	0.154000	0.22792	0.047000	0.18901	0.717000	0.41224	3.968000	0.56809	2.751000	0.94390	0.655000	0.94253	GAG	.		0.567	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413317.1	NM_033104	
STXBP1	6812	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	130442485	130442485	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr9:130442485C>T	ENST00000373299.1	+	17	1626	c.1511C>T	c.(1510-1512)aCc>aTc	p.T504I	STXBP1_ENST00000481942.1_Intron|STXBP1_ENST00000373302.3_Missense_Mutation_p.T504I	NM_001032221.3	NP_001027392.1	P61764	STXB1_HUMAN	syntaxin binding protein 1	504					axon target recognition (GO:0007412)|energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long term synaptic depression (GO:0060292)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|protein stabilization (GO:0050821)|protein transport (GO:0015031)|regulation of insulin secretion (GO:0050796)|regulation of SNARE complex assembly (GO:0035542)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|regulation of synaptic vesicle priming (GO:0010807)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|SNARE binding (GO:0000149)|syntaxin binding (GO:0019905)|syntaxin-1 binding (GO:0017075)			breast(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|skin(2)	23						TATATCTCTACCCGTTCCTCT	0.502																																					p.T504I		.											.	STXBP1	91	0			c.C1511T						.						247.0	213.0	224.0					9																	130442485		2203	4300	6503	SO:0001583	missense	6812	exon17			TCTCTACCCGTTC	AF004563	CCDS6874.1, CCDS35146.1	9q34.1	2008-07-21			ENSG00000136854	ENSG00000136854			11444	protein-coding gene	gene with protein product	"""syntaxin-binding protein 1"""	602926				9545644	Standard	NM_001032221		Approved	hUNC18, MUNC18-1, UNC18, rbSec1	uc004brk.2	P61764	OTTHUMG00000020713	ENST00000373299.1:c.1511C>T	9.37:g.130442485C>T	ENSP00000362396:p.Thr504Ile	35.0	0.0		47.0	36.0	NM_001032221	B1AM97|Q28208|Q62759|Q64320|Q96TG8	Missense_Mutation	SNP	ENST00000373299.1	37	CCDS35146.1	.	.	.	.	.	.	.	.	.	.	C	13.03	2.114720	0.37339	.	.	ENSG00000136854	ENST00000535154;ENST00000373302;ENST00000541198;ENST00000373299	T;T	0.80653	-1.4;-1.4	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.75481	0.3855	L	0.38175	1.15	0.80722	D	1	B;B	0.31174	0.311;0.265	B;B	0.32342	0.144;0.089	T	0.74343	-0.3696	10	0.52906	T	0.07	-26.234	17.5557	0.87889	0.0:1.0:0.0:0.0	.	504;504	P61764;P61764-2	STXB1_HUMAN;.	I	458;504;336;504	ENSP00000362399:T504I;ENSP00000362396:T504I	ENSP00000362396:T504I	T	+	2	0	STXBP1	129482306	1.000000	0.71417	1.000000	0.80357	0.089000	0.18198	7.366000	0.79548	2.826000	0.97356	0.561000	0.74099	ACC	.		0.502	STXBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054229.1	NM_003165	
SYT12	91683	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	66807406	66807406	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr11:66807406delG	ENST00000393946.2	+	7	1515	c.353delG	c.(352-354)cggfs	p.R118fs	SYT12_ENST00000525457.1_Frame_Shift_Del_p.R118fs|SYT12_ENST00000527043.1_Frame_Shift_Del_p.R118fs|SYT12_ENST00000526281.1_3'UTR			Q8IV01	SYT12_HUMAN	synaptotagmin XII	118						cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|synapse (GO:0045202)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	20						CTGATGGGCCGGGAGTTGGAC	0.637																																					p.R118fs	Ovarian(65;2862 3307)	.											.	SYT12	91	0			c.353delG						.						67.0	71.0	70.0					11																	66807406		2200	4295	6495	SO:0001589	frameshift_variant	91683	exon4			TGGGCCGGGAGTT	AK024280	CCDS8154.1	11q13.2	2014-07-02			ENSG00000173227	ENSG00000173227		"""Synaptotagmins"""	18381	protein-coding gene	gene with protein product		606436				8987811	Standard	NM_177963		Approved	SRG1	uc001oju.3	Q8IV01	OTTHUMG00000167101	ENST00000393946.2:c.353delG	11.37:g.66807406delG	ENSP00000377520:p.Arg118fs	48.0	0.0		68.0	21.0	NM_001177880		Frame_Shift_Del	DEL	ENST00000393946.2	37	CCDS8154.1																																																																																			.		0.637	SYT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393129.1	NM_177963	
SYT12	91683	hgsc.bcm.edu;bcgsc.ca	37	11	66807409	66807409	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr11:66807409A>C	ENST00000393946.2	+	7	1518	c.356A>C	c.(355-357)gAg>gCg	p.E119A	SYT12_ENST00000525457.1_Missense_Mutation_p.E119A|SYT12_ENST00000527043.1_Missense_Mutation_p.E119A|SYT12_ENST00000526281.1_3'UTR			Q8IV01	SYT12_HUMAN	synaptotagmin XII	119						cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|synapse (GO:0045202)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	20						ATGGGCCGGGAGTTGGACCTG	0.627																																					p.E119A	Ovarian(65;2862 3307)	.											.	SYT12	91	0			c.A356C						.						67.0	71.0	69.0					11																	66807409		2200	4295	6495	SO:0001583	missense	91683	exon4			GCCGGGAGTTGGA	AK024280	CCDS8154.1	11q13.2	2014-07-02			ENSG00000173227	ENSG00000173227		"""Synaptotagmins"""	18381	protein-coding gene	gene with protein product		606436				8987811	Standard	NM_177963		Approved	SRG1	uc001oju.3	Q8IV01	OTTHUMG00000167101	ENST00000393946.2:c.356A>C	11.37:g.66807409A>C	ENSP00000377520:p.Glu119Ala	47.0	0.0		72.0	24.0	NM_001177880		Missense_Mutation	SNP	ENST00000393946.2	37	CCDS8154.1	.	.	.	.	.	.	.	.	.	.	A	15.29	2.789251	0.49997	.	.	ENSG00000173227	ENST00000393946;ENST00000525457;ENST00000527043	T;T;T	0.13307	2.6;2.6;2.6	5.1	3.98	0.46160	.	0.116529	0.64402	D	0.000019	T	0.08358	0.0208	N	0.19112	0.55	0.47778	D	0.999517	B	0.29037	0.231	B	0.29176	0.099	T	0.32025	-0.9922	10	0.21540	T	0.41	.	8.7614	0.34676	0.9107:0.0:0.0893:0.0	.	119	Q8IV01	SYT12_HUMAN	A	119	ENSP00000377520:E119A;ENSP00000431400:E119A;ENSP00000435316:E119A	ENSP00000377520:E119A	E	+	2	0	SYT12	66563985	1.000000	0.71417	0.997000	0.53966	0.894000	0.52154	6.154000	0.71826	0.974000	0.38366	0.379000	0.24179	GAG	.		0.627	SYT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393129.1	NM_177963	
TBC1D26	353149	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	15642108	15642108	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr17:15642108A>G	ENST00000437605.2	+	8	711	c.461A>G	c.(460-462)cAg>cGg	p.Q154R	ZNF286A_ENST00000413242.2_3'UTR|AC005324.6_ENST00000580194.1_RNA|AC005324.6_ENST00000434017.1_RNA|TBC1D26_ENST00000579428.1_Missense_Mutation_p.Q154R|AC005324.6_ENST00000433873.1_RNA	NM_178571.4	NP_848666	Q86UD7	TBC26_HUMAN	TBC1 domain family, member 26	154	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			endometrium(1)|large_intestine(1)|lung(4)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.078)		CACACCCTGCAGAAACACATG	0.532																																					p.Q154R		.											.	TBC1D26	90	0			c.A461G						.						111.0	102.0	105.0					17																	15642108		2136	4226	6362	SO:0001583	missense	353149	exon8			CCCTGCAGAAACA		CCDS42265.1	17p11.2	2008-11-04			ENSG00000214946	ENSG00000214946			28745	protein-coding gene	gene with protein product						11347906	Standard	NM_178571		Approved	MGC51025	uc010cov.3	Q86UD7	OTTHUMG00000059071	ENST00000437605.2:c.461A>G	17.37:g.15642108A>G	ENSP00000410111:p.Gln154Arg	189.0	0.0		215.0	111.0	NM_178571	A8K929|Q4G172	Missense_Mutation	SNP	ENST00000437605.2	37	CCDS42265.1	.	.	.	.	.	.	.	.	.	.	a	0.915	-0.717755	0.03182	.	.	ENSG00000214946	ENST00000437605	T	0.03717	3.83	1.44	-2.89	0.05665	Rab-GAP/TBC domain (4);	0.142512	0.46145	N	0.000318	T	0.00936	0.0031	N	0.01219	-0.95	0.09310	N	1	B;B	0.18741	0.03;0.012	B;B	0.26614	0.071;0.023	T	0.35375	-0.9791	10	0.02654	T	1	.	2.8292	0.05495	0.2353:0.2885:0.4763:0.0	.	154;154	Q86UD7;Q86UD7-2	TBC26_HUMAN;.	R	154	ENSP00000410111:Q154R	ENSP00000410111:Q154R	Q	+	2	0	TBC1D26	15582833	0.525000	0.26290	0.000000	0.03702	0.002000	0.02628	1.230000	0.32612	-1.068000	0.03156	-0.811000	0.03165	CAG	.		0.532	TBC1D26-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178571	
TG	7038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	133925494	133925494	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr8:133925494G>C	ENST00000220616.4	+	20	4402	c.4362G>C	c.(4360-4362)caG>caC	p.Q1454H	TG_ENST00000377869.1_Missense_Mutation_p.Q1454H	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1454					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		AGGCCAGTCAGGACGGACTGG	0.572																																					p.Q1454H		.											.	TG	145	0			c.G4362C						.						87.0	72.0	77.0					8																	133925494		2203	4300	6503	SO:0001583	missense	7038	exon20			CAGTCAGGACGGA	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4362G>C	8.37:g.133925494G>C	ENSP00000220616:p.Gln1454His	52.0	0.0		148.0	53.0	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	G	11.79	1.744127	0.30865	.	.	ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616	T;D	0.97480	-0.11;-4.4	5.45	2.71	0.32032	.	2.229260	0.01478	N	0.016568	D	0.96269	0.8783	M	0.68317	2.08	0.09310	N	1	P	0.45283	0.855	B	0.41510	0.359	D	0.86702	0.1930	10	0.87932	D	0	.	7.4202	0.27067	0.2669:0.0:0.7331:0.0	.	1454	P01266	THYG_HUMAN	H	1454;260;1454	ENSP00000367100:Q1454H;ENSP00000220616:Q1454H	ENSP00000220616:Q1454H	Q	+	3	2	TG	133994676	0.823000	0.29233	0.011000	0.14972	0.089000	0.18198	1.312000	0.33574	0.282000	0.22254	-0.145000	0.13849	CAG	.		0.572	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
TMEM131	23505	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	98373568	98373568	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr2:98373568C>G	ENST00000186436.5	-	41	5874	c.5646G>C	c.(5644-5646)gaG>gaC	p.E1882D		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	1882						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						TAATTTAATTCTCGTGAGGAA	0.473																																					p.E1882D		.											.	TMEM131	74	0			c.G5646C						.						42.0	42.0	42.0					2																	98373568		1897	4117	6014	SO:0001583	missense	23505	exon41			TTAATTCTCGTGA	AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.5646G>C	2.37:g.98373568C>G	ENSP00000186436:p.Glu1882Asp	46.0	1.0		105.0	37.0	NM_015348		Missense_Mutation	SNP	ENST00000186436.5	37	CCDS46368.1	.	.	.	.	.	.	.	.	.	.	C	12.10	1.835487	0.32421	.	.	ENSG00000075568	ENST00000186436	T	0.35048	1.33	5.62	4.73	0.59995	.	0.124327	0.53938	D	0.000049	T	0.18593	0.0446	N	0.14661	0.345	0.80722	D	1	B;B	0.24768	0.016;0.111	B;B	0.22753	0.007;0.041	T	0.09400	-1.0676	10	0.44086	T	0.13	-19.318	3.645	0.08181	0.1936:0.5847:0.0:0.2218	.	1882;262	Q92545;Q0P631	TM131_HUMAN;.	D	1882	ENSP00000186436:E1882D	ENSP00000186436:E1882D	E	-	3	2	TMEM131	97740000	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.717000	0.37991	1.586000	0.49944	0.637000	0.83480	GAG	.		0.473	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329285.2	XM_371542	
TMPO	7112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	98938128	98938128	+	Splice_Site	SNP	G	G	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr12:98938128G>C	ENST00000556029.1	+	5	1139		c.e5+1		TMPO_ENST00000343315.5_Intron|TMPO_ENST00000548223.1_Splice_Site|TMPO_ENST00000393053.2_Intron	NM_001032283.2	NP_001027454.1	P42167	LAP2B_HUMAN	thymopoietin							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)|lamin binding (GO:0005521)			breast(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						AAGGAAAAGGGTGATGCAAGG	0.378																																					.		.											.	TMPO	93	0			c.783+1G>C						.						87.0	90.0	89.0					12																	98938128		2203	4300	6503	SO:0001630	splice_region_variant	7112	exon5			AAAAGGGTGATGC		CCDS9064.1, CCDS31879.1, CCDS31880.1	12q22	2014-09-17			ENSG00000120802	ENSG00000120802			11875	protein-coding gene	gene with protein product	"""LEM domain containing 4"""	188380				7517549	Standard	NM_003276		Approved	TP, LAP2, LEMD4	uc001tfh.2	P42166	OTTHUMG00000170210	ENST00000556029.1:c.783+1G>C	12.37:g.98938128G>C		65.0	0.0		140.0	51.0	NM_001032283	A2T926|Q14861	Splice_Site	SNP	ENST00000556029.1	37	CCDS31879.1	.	.	.	.	.	.	.	.	.	.	G	17.21	3.332546	0.60853	.	.	ENSG00000120802	ENST00000556029	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9478	0.97189	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMPO	97462259	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.473000	0.73572	2.712000	0.92718	0.591000	0.81541	.	.		0.378	TMPO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407973.2	NM_003276	Intron
TNFRSF21	27242	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	47252058	47252058	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr6:47252058C>T	ENST00000296861.2	-	3	1252	c.859G>A	c.(859-861)Gac>Aac	p.D287N		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	287					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			TTGTTCACGTCTTCCTTCCCC	0.547																																					p.D287N		.											.	TNFRSF21	227	0			c.G859A						.						278.0	232.0	247.0					6																	47252058		2203	4300	6503	SO:0001583	missense	27242	exon3			TCACGTCTTCCTT	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.859G>A	6.37:g.47252058C>T	ENSP00000296861:p.Asp287Asn	191.0	1.0		418.0	170.0	NM_014452	B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	ENST00000296861.2	37	CCDS4921.1	.	.	.	.	.	.	.	.	.	.	C	12.40	1.927194	0.34002	.	.	ENSG00000146072	ENST00000296861	T	0.63744	-0.06	5.91	5.03	0.67393	.	0.569092	0.20506	N	0.090994	T	0.24005	0.0581	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.11567	-1.0582	10	0.59425	D	0.04	.	7.9554	0.30040	0.0:0.7287:0.1323:0.139	.	287	O75509	TNR21_HUMAN	N	287	ENSP00000296861:D287N	ENSP00000296861:D287N	D	-	1	0	TNFRSF21	47360017	0.002000	0.14202	0.844000	0.33320	0.660000	0.38997	0.265000	0.18515	1.472000	0.48140	0.655000	0.94253	GAC	.		0.547	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040814.1	NM_014452	
TNIP3	79931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	122085259	122085259	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr4:122085259T>C	ENST00000509841.1	-	4	331	c.253A>G	c.(253-255)Aca>Gca	p.T85A	TNIP3_ENST00000057513.3_Missense_Mutation_p.T8A|TNIP3_ENST00000454328.1_Missense_Mutation_p.T8A|TNIP3_ENST00000507879.1_Missense_Mutation_p.T78A	NM_001244764.1	NP_001231693.1			TNFAIP3 interacting protein 3											NS(1)|endometrium(4)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(2)	24						ATTCTAGATGTGCCCTGTACA	0.403																																					p.T85A		.											.	TNIP3	91	0			c.A253G						.						121.0	113.0	116.0					4																	122085259		2203	4300	6503	SO:0001583	missense	79931	exon4			TAGATGTGCCCTG	AJ320534	CCDS3718.1, CCDS58925.1, CCDS58926.1	4q27	2008-02-05			ENSG00000050730	ENSG00000050730			19315	protein-coding gene	gene with protein product		608019				11345586	Standard	NM_024873		Approved	LIND, FLJ21162, ABIN-3	uc021xrj.1	Q96KP6	OTTHUMG00000132969	ENST00000509841.1:c.253A>G	4.37:g.122085259T>C	ENSP00000426613:p.Thr85Ala	66.0	0.0		162.0	55.0	NM_001244764		Missense_Mutation	SNP	ENST00000509841.1	37	CCDS58926.1	.	.	.	.	.	.	.	.	.	.	T	16.08	3.020591	0.54576	.	.	ENSG00000050730	ENST00000057513;ENST00000454328;ENST00000507879;ENST00000509841	T;T;T;T	0.51071	0.94;0.94;0.73;0.72	5.44	-5.44	0.02624	.	0.337042	0.22233	N	0.062785	T	0.27594	0.0678	L	0.51422	1.61	0.09310	N	1	B;B;B	0.20052	0.041;0.041;0.041	B;B;B	0.17722	0.011;0.019;0.011	T	0.12785	-1.0534	10	0.25751	T	0.34	-0.8549	1.2525	0.01985	0.2434:0.1499:0.3748:0.2318	.	78;8;8	B4DVF5;A5HU65;Q96KP6	.;.;TNIP3_HUMAN	A	8;8;78;85	ENSP00000057513:T8A;ENSP00000411817:T8A;ENSP00000427106:T78A;ENSP00000426613:T85A	ENSP00000057513:T8A	T	-	1	0	TNIP3	122304709	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.027000	0.12371	-0.705000	0.05035	-0.321000	0.08615	ACA	.		0.403	TNIP3-003	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364000.4	NM_024873	
TNXB	7148	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32035476	32035476	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr6:32035476C>T	ENST00000375244.3	-	18	6707	c.6506G>A	c.(6505-6507)gGg>gAg	p.G2169E	TNXB_ENST00000375247.2_Missense_Mutation_p.G2169E			P22105	TENX_HUMAN	tenascin XB	2241	Fibronectin type-III 14. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CACGCGCCGCCCCTCGTGGAG	0.657																																					p.G2169E		.											.	TNXB	90	0			c.G6506A						.						41.0	48.0	46.0					6																	32035476		1991	4150	6141	SO:0001583	missense	7148	exon18			CGCCGCCCCTCGT	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.6506G>A	6.37:g.32035476C>T	ENSP00000364393:p.Gly2169Glu	74.0	1.0		157.0	73.0	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		.	.	.	.	.	.	.	.	.	.	C	11.58	1.682398	0.29872	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.57107	0.42;0.42	4.73	3.84	0.44239	.	0.125186	0.36409	N	0.002612	T	0.45955	0.1368	M	0.76574	2.34	0.09310	N	1	D	0.69078	0.997	D	0.64687	0.928	T	0.49808	-0.8900	10	0.02654	T	1	.	11.3624	0.49651	0.0:0.6454:0.3546:0.0	.	2169	P22105-3	.	E	2169	ENSP00000364393:G2169E;ENSP00000364396:G2169E	ENSP00000364393:G2169E	G	-	2	0	TNXB	32143454	0.001000	0.12720	0.014000	0.15608	0.610000	0.37248	1.173000	0.31920	0.930000	0.37217	0.563000	0.77884	GGG	.		0.657	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7578211	7578211	+	Missense_Mutation	SNP	C	C	T	rs587778720		TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr17:7578211C>T	ENST00000269305.4	-	6	827	c.638G>A	c.(637-639)cGa>cAa	p.R213Q	TP53_ENST00000445888.2_Missense_Mutation_p.R213Q|TP53_ENST00000413465.2_Missense_Mutation_p.R213Q|TP53_ENST00000455263.2_Missense_Mutation_p.R213Q|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.R213Q|TP53_ENST00000359597.4_Missense_Mutation_p.R213Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213L(38)|p.R213Q(29)|p.0?(8)|p.R213P(5)|p.?(5)|p.R120L(4)|p.R81L(4)|p.R120Q(2)|p.R81Q(2)|p.D208_V216delDRNTFRHSV(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.D208fs*1(1)|p.R213>L(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CACACTATGTCGAAAAGTGTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R213Q	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,-1	TP53	70225	110	Substitution - Missense(85)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Complex - compound substitution(1)	prostate(15)|large_intestine(14)|urinary_tract(9)|liver(9)|haematopoietic_and_lymphoid_tissue(8)|biliary_tract(6)|stomach(6)|oesophagus(6)|kidney(5)|lung(5)|central_nervous_system(4)|ovary(4)|pancreas(4)|bone(4)|upper_aerodigestive_tract(3)|soft_tissue(2)|eye(2)|vulva(1)|endometrium(1)|skin(1)|breast(1)	c.G638A	GRCh37	CM004906|CM022474	TP53	M		.						132.0	118.0	122.0					17																	7578211		2203	4300	6503	SO:0001583	missense	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CTATGTCGAAAAG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.638G>A	17.37:g.7578211C>T	ENSP00000269305:p.Arg213Gln	76.0	0.0		90.0	57.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	37	6.233765	0.97399	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	5.28	4.32	0.51571	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.057335	0.64402	N	0.000003	D	0.99871	0.9939	M	0.92507	3.315	0.50039	D	0.999845	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.993;0.996;1.0;0.995;0.994;0.999	D	0.96662	0.9490	10	0.87932	D	0	-7.5444	11.7807	0.52013	0.0:0.9141:0.0:0.0859	.	174;213;213;120;213;213;213	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Q	213;213;213;213;213;213;202;120;81;120;81	ENSP00000410739:R213Q;ENSP00000352610:R213Q;ENSP00000269305:R213Q;ENSP00000398846:R213Q;ENSP00000391127:R213Q;ENSP00000391478:R213Q;ENSP00000425104:R81Q;ENSP00000423862:R120Q	ENSP00000269305:R213Q	R	-	2	0	TP53	7518936	0.996000	0.38824	0.185000	0.23176	0.961000	0.63080	7.775000	0.85489	1.367000	0.46095	0.563000	0.77884	CGA	.		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TRRAP	8295	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	98506458	98506458	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr7:98506458A>G	ENST00000359863.4	+	14	1432	c.1223A>G	c.(1222-1224)gAt>gGt	p.D408G	TRRAP_ENST00000446306.3_Missense_Mutation_p.D408G|TRRAP_ENST00000355540.3_Missense_Mutation_p.D408G	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	408					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			AACATCGACGATGAGTCCCTG	0.632																																					p.D408G		.											.	TRRAP	923	0			c.A1223G						.						94.0	66.0	76.0					7																	98506458		2203	4300	6503	SO:0001583	missense	8295	exon14			TCGACGATGAGTC	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.1223A>G	7.37:g.98506458A>G	ENSP00000352925:p.Asp408Gly	45.0	0.0		132.0	38.0	NM_001244580	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	CCDS59066.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.94|18.94	3.729672|3.729672	0.69074|0.69074	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306|ENST00000456197	T;T|.	0.73575|.	3.18;-0.76|.	5.84|5.84	5.84|5.84	0.93424|0.93424	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77631|0.77631	0.4159|0.4159	M|M	0.80332|0.80332	2.49|2.49	0.80722|0.80722	D|D	1|1	D;D;D|.	0.67145|.	0.996;0.993;0.993|.	D;D;D|.	0.73708|.	0.981;0.956;0.956|.	T|T	0.78773|0.78773	-0.2073|-0.2073	10|5	0.72032|.	D|.	0.01|.	.|.	16.2302|16.2302	0.82332|0.82332	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	408;122;408|.	Q9Y4A5-2;Q59FH1;Q9Y4A5|.	.;.;TRRAP_HUMAN|.	G|V	408|123	ENSP00000352925:D408G;ENSP00000347733:D408G|.	ENSP00000347733:D408G|.	D|M	+|+	2|1	0|0	TRRAP|TRRAP	98344394|98344394	1.000000|1.000000	0.71417|0.71417	0.525000|0.525000	0.27900|0.27900	0.714000|0.714000	0.41099|0.41099	9.109000|9.109000	0.94291|0.94291	2.228000|2.228000	0.72767|0.72767	0.533000|0.533000	0.62120|0.62120	GAT|ATG	.		0.632	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
UBR4	23352	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	19511591	19511591	+	Splice_Site	SNP	A	A	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr1:19511591A>G	ENST00000375254.3	-	15	1966		c.e15+1		UBR4_ENST00000375226.2_Splice_Site|UBR4_ENST00000375267.2_Splice_Site|UBR4_ENST00000375217.2_Splice_Site	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		ACCTACTCTTACCAACTCAGG	0.493																																					.		.											.	UBR4	612	0			c.1938+2T>C						.						188.0	209.0	202.0					1																	19511591		2203	4300	6503	SO:0001630	splice_region_variant	23352	exon16			ACTCTTACCAACT	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.1938+1T>C	1.37:g.19511591A>G		63.0	1.0		97.0	45.0	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Splice_Site	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.702672	0.88924	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7279	0.69357	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	UBR4	19384178	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.369000	0.90118	2.158000	0.67659	0.482000	0.46254	.	.		0.493	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	Intron
USP47	55031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	11964527	11964527	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr11:11964527G>T	ENST00000399455.2	+	21	3139	c.3019G>T	c.(3019-3021)Gat>Tat	p.D1007Y	USP47_ENST00000339865.5_Missense_Mutation_p.D919Y|USP47_ENST00000539466.1_5'UTR|USP47_ENST00000527733.1_Missense_Mutation_p.D987Y	NM_001282659.1	NP_001269588.1	Q96K76	UBP47_HUMAN	ubiquitin specific peptidase 47	1007					base-excision repair (GO:0006284)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell growth (GO:0030307)|response to drug (GO:0042493)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-specific protease activity (GO:0004843)|WD40-repeat domain binding (GO:0071987)			breast(4)|endometrium(7)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46				Epithelial(150;0.000339)		AGAAACATGGGATACAGCAGA	0.413																																					p.D919Y		.											.	USP47	660	0			c.G2755T						.						156.0	147.0	150.0					11																	11964527		1933	4133	6066	SO:0001583	missense	55031	exon19			ACATGGGATACAG	AK027362	CCDS41619.1, CCDS60725.1	11p15.2	2008-02-05	2005-08-08		ENSG00000170242	ENSG00000170242		"""Ubiquitin-specific peptidases"""	20076	protein-coding gene	gene with protein product		614460	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"", ""ubiquitin specific protease 47"""			12838346	Standard	XM_005252997		Approved		uc001mjr.3	Q96K76	OTTHUMG00000165685	ENST00000399455.2:c.3019G>T	11.37:g.11964527G>T	ENSP00000382382:p.Asp1007Tyr	88.0	0.0		152.0	62.0	NM_017944	B3KXF5|E9PM46|Q658U0|Q86Y73|Q8TEP6|Q9BWI0|Q9NWN1	Missense_Mutation	SNP	ENST00000399455.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.45|17.45	3.393869|3.393869	0.62066|0.62066	.|.	.|.	ENSG00000170242|ENSG00000170242	ENST00000339865;ENST00000527733;ENST00000399455|ENST00000540365	T;T;T|.	0.05717|.	3.42;3.41;3.4|.	6.02|6.02	5.11|5.11	0.69529|0.69529	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.55721|0.55721	0.1938|0.1938	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	D;P;P|.	0.76494|.	0.999;0.799;0.873|.	D;P;P|.	0.80764|.	0.994;0.554;0.74|.	T|T	0.61681|0.61681	-0.7013|-0.7013	10|6	0.87932|0.87932	D|D	0|0	.|.	15.1392|15.1392	0.72599|0.72599	0.0684:0.0:0.9316:0.0|0.0684:0.0:0.9316:0.0	.|.	1007;987;919|.	Q96K76;E9PM46;Q96K76-2|.	UBP47_HUMAN;.;.|.	Y|V	919;987;1007|203	ENSP00000339957:D919Y;ENSP00000433146:D987Y;ENSP00000382382:D1007Y|.	ENSP00000339957:D919Y|ENSP00000445548:G203V	D|G	+|+	1|2	0|0	USP47|USP47	11921103|11921103	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.694000|0.694000	0.40290|0.40290	9.476000|9.476000	0.97823|0.97823	1.556000|1.556000	0.49512|0.49512	0.591000|0.591000	0.81541|0.81541	GAT|GGA	.		0.413	USP47-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000385853.2	NM_017944	
VAV2	7410	ucsc.edu;bcgsc.ca	37	9	136650970	136650970	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr9:136650970T>C	ENST00000371850.3	-	17	1491	c.1460A>G	c.(1459-1461)aAg>aGg	p.K487R	VAV2_ENST00000406606.3_Missense_Mutation_p.K477R|VAV2_ENST00000371851.1_Missense_Mutation_p.K477R	NM_001134398.1	NP_001127870.1	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor	487	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	35				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		GAAGCCCTGCTTTCCTTGAAG	0.537																																					p.K487R		.											.	VAV2	1273	0			c.A1460G						.						68.0	58.0	62.0					9																	136650970		2203	4300	6503	SO:0001583	missense	7410	exon17			CCCTGCTTTCCTT		CCDS6979.1, CCDS48053.1	9q34.1	2013-02-14	2007-07-25		ENSG00000160293	ENSG00000160293		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12658	protein-coding gene	gene with protein product		600428	"""vav 2 oncogene"""			7762982	Standard	NM_003371		Approved		uc004ces.3	P52735	OTTHUMG00000020882	ENST00000371850.3:c.1460A>G	9.37:g.136650970T>C	ENSP00000360916:p.Lys487Arg	45.0	0.0		49.0	4.0	NM_001134398	A2RUM4|A8MQ12|B6ZDF5|Q5SYV3|Q5SYV4|Q5SYV5|Q6N012|Q6PIJ9|Q6Q317	Missense_Mutation	SNP	ENST00000371850.3	37	CCDS48053.1	.	.	.	.	.	.	.	.	.	.	T	17.54	3.415441	0.62511	.	.	ENSG00000160293	ENST00000371850;ENST00000371851;ENST00000406606;ENST00000325440	D;D;D	0.87887	-2.31;-2.31;-2.31	5.22	5.22	0.72569	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.050035	0.85682	D	0.000000	D	0.90566	0.7043	L	0.50333	1.59	0.80722	D	1	B;D;B	0.89917	0.078;1.0;0.078	B;D;B	0.87578	0.064;0.998;0.064	D	0.88070	0.2800	10	0.19147	T	0.46	.	15.0862	0.72155	0.0:0.0:0.0:1.0	.	477;487;477	P52735-2;P52735;P52735-3	.;VAV2_HUMAN;.	R	487;477;477;477	ENSP00000360916:K487R;ENSP00000360917:K477R;ENSP00000385362:K477R	ENSP00000317258:K477R	K	-	2	0	VAV2	135640791	1.000000	0.71417	0.996000	0.52242	0.685000	0.39939	6.169000	0.71913	1.971000	0.57363	0.379000	0.24179	AAG	.		0.537	VAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054939.1		
VIM	7431	hgsc.bcm.edu;broad.mit.edu	37	10	17277290	17277291	+	Frame_Shift_Ins	INS	-	-	C	rs201530534		TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr10:17277290_17277291insC	ENST00000224237.5	+	6	1276_1277	c.1131_1132insC	c.(1132-1134)cgtfs	p.R378fs	RP11-124N14.3_ENST00000456355.1_RNA|VIM_ENST00000544301.1_Frame_Shift_Ins_p.R378fs			P08670	VIME_HUMAN	vimentin	378	Coil 2.|Rod.				apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)	p.A377A(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						AGGAAATGGCTCGTCACCTTCG	0.49																																					p.A377fs		.											.	VIM	291	1	Substitution - coding silent(1)	endometrium(1)	c.1131_1132insC						.																																			SO:0001589	frameshift_variant	7431	exon7			AATGGCTCGTCAC	M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.1132dupC	10.37:g.17277291_17277291dupC	ENSP00000224237:p.Arg378fs	63.0	0.0		126.0	9.0	NM_003380	B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	Frame_Shift_Ins	INS	ENST00000224237.5	37	CCDS7120.1																																																																																			.		0.490	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047015.1	NM_003380	
VPS33A	65082	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	122745969	122745969	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr12:122745969C>G	ENST00000267199.4	-	4	434	c.322G>C	c.(322-324)Gat>Cat	p.D108H	VPS33A_ENST00000542310.1_5'UTR|RP11-512M8.5_ENST00000535844.1_Missense_Mutation_p.D108H|VPS33A_ENST00000451053.2_Missense_Mutation_p.D108H	NM_022916.4	NP_075067.2	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33 homolog A (S. cerevisiae)	108					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of developmental pigmentation (GO:0048070)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)				NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	28	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		ATATGAAAATCTCTCGTTGGG	0.463																																					p.D108H		.											.	VPS33A	91	0			c.G322C						.						85.0	73.0	77.0					12																	122745969		2203	4300	6503	SO:0001583	missense	65082	exon4			GAAAATCTCTCGT	AK026048	CCDS9231.1	12q24.31	2008-06-23	2006-04-04		ENSG00000139719	ENSG00000139719			18179	protein-coding gene	gene with protein product		610034	"""vacuolar protein sorting 33A (yeast)"""			11250079	Standard	NM_022916		Approved		uc001ucd.3	Q96AX1	OTTHUMG00000168920	ENST00000267199.4:c.322G>C	12.37:g.122745969C>G	ENSP00000267199:p.Asp108His	61.0	0.0		127.0	43.0	NM_022916	Q547V4|Q9H5Q0	Missense_Mutation	SNP	ENST00000267199.4	37	CCDS9231.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.650784	0.87958	.	.	ENSG00000139719	ENST00000267199;ENST00000451053	T;T	0.76709	-1.04;-1.04	5.11	5.11	0.69529	.	0.153560	0.56097	D	0.000022	T	0.81635	0.4864	L	0.43152	1.355	0.80722	D	1	P;P	0.49783	0.928;0.858	P;P	0.54312	0.748;0.726	D	0.83545	0.0098	10	0.72032	D	0.01	-13.7253	18.8821	0.92360	0.0:1.0:0.0:0.0	.	108;108	F5H6Y0;Q96AX1	.;VP33A_HUMAN	H	108	ENSP00000267199:D108H;ENSP00000442951:D108H	ENSP00000446319:D108H	D	-	1	0	VPS33A	121311922	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	7.709000	0.84645	2.544000	0.85801	0.561000	0.74099	GAT	.		0.463	VPS33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401607.2		
WDR49	151790	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	167246878	167246878	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr3:167246878C>T	ENST00000308378.3	-	10	1617	c.1312G>A	c.(1312-1314)Gga>Aga	p.G438R	WDR49_ENST00000453925.2_Missense_Mutation_p.G502R|WDR49_ENST00000479765.1_Intron|WDR49_ENST00000476376.1_Missense_Mutation_p.G263R	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	438										breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						TCAAGATCTCCTGTGGTAAGG	0.348																																					p.G438R		.											.	WDR49	155	0			c.G1312A						.						87.0	84.0	85.0					3																	167246878		2203	4300	6503	SO:0001583	missense	151790	exon10			GATCTCCTGTGGT	AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.1312G>A	3.37:g.167246878C>T	ENSP00000311343:p.Gly438Arg	140.0	0.0		273.0	93.0	NM_178824	Q8N297	Missense_Mutation	SNP	ENST00000308378.3	37	CCDS3201.1	.	.	.	.	.	.	.	.	.	.	C	16.30	3.083773	0.55861	.	.	ENSG00000174776	ENST00000308378;ENST00000476376;ENST00000453925	T;T;T	0.47869	1.07;0.83;1.8	5.52	5.52	0.82312	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.109048	0.64402	D	0.000009	T	0.80132	0.4567	H	0.96576	3.845	0.43540	D	0.995836	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	D	0.86822	0.2005	10	0.87932	D	0	.	18.2233	0.89909	0.0:1.0:0.0:0.0	.	502;438	E7EQK3;Q8IV35	.;WDR49_HUMAN	R	438;263;502	ENSP00000311343:G438R;ENSP00000420508:G263R;ENSP00000410863:G502R	ENSP00000311343:G438R	G	-	1	0	WDR49	168729572	1.000000	0.71417	1.000000	0.80357	0.206000	0.24218	4.951000	0.63610	2.599000	0.87857	0.563000	0.77884	GGA	.		0.348	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350592.3	NM_178824	
XAB2	56949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	7687527	7687527	+	Silent	SNP	G	G	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr19:7687527G>A	ENST00000358368.4	-	11	1429	c.1392C>T	c.(1390-1392)gcC>gcT	p.A464A	XAB2_ENST00000534844.1_Silent_p.A461A	NM_020196.2	NP_064581.2	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	464					blastocyst development (GO:0001824)|DNA repair (GO:0006281)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	26						CGGCCCGGCGGGCAGGCAGCG	0.677								Direct reversal of damage;Nucleotide excision repair (NER)																													p.A464A		.											.	XAB2	272	0			c.C1392T						.						33.0	35.0	34.0					19																	7687527		2203	4299	6502	SO:0001819	synonymous_variant	56949	exon11			CCGGCGGGCAGGC	AB026111	CCDS32892.1	19p13.3	2013-08-21				ENSG00000076924			14089	protein-coding gene	gene with protein product	"""SYF1 homolog, RNA splicing factor (S. cerevisiae)"", ""SYF1 pre-mRNA-splicing factor"""	610850				10944529	Standard	NM_020196		Approved	HCNP, HCRN, SYF1, NTC90	uc002mgx.3	Q9HCS7		ENST00000358368.4:c.1392C>T	19.37:g.7687527G>A		16.0	0.0		17.0	8.0	NM_020196	Q8TET6|Q96HB0|Q96IW0|Q9NRG6|Q9ULP3	Silent	SNP	ENST00000358368.4	37	CCDS32892.1																																																																																			.		0.677	XAB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461021.1	NM_020196	
ZCCHC2	54877	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	60241883	60241883	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr18:60241883T>G	ENST00000269499.5	+	13	2987	c.2569T>G	c.(2569-2571)Ttc>Gtc	p.F857V	ZCCHC2_ENST00000586834.1_Missense_Mutation_p.F536V	NM_017742.4	NP_060212.4	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	857						cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25						CCCAGGTAGTTTCCCAGGCTC	0.498																																					p.F857V		.											.	ZCCHC2	432	0			c.T2569G						.						137.0	136.0	136.0					18																	60241883		2013	4183	6196	SO:0001583	missense	54877	exon13			GGTAGTTTCCCAG	AB051531	CCDS45880.1	18q21.33	2012-04-19			ENSG00000141664	ENSG00000141664		"""Zinc fingers, CCHC domain containing"""	22916	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 49"""	C18orf49		11214970	Standard	NM_017742		Approved	FLJ20281, KIAA1744, FLJ20222	uc002lip.4	Q9C0B9		ENST00000269499.5:c.2569T>G	18.37:g.60241883T>G	ENSP00000269499:p.Phe857Val	127.0	1.0		260.0	88.0	NM_017742	B2RPG6|Q8N3S1|Q9NXF6	Missense_Mutation	SNP	ENST00000269499.5	37	CCDS45880.1	.	.	.	.	.	.	.	.	.	.	T	17.92	3.506815	0.64410	.	.	ENSG00000141664	ENST00000269499	T	0.27890	1.64	5.39	5.39	0.77823	.	0.220250	0.40302	N	0.001122	T	0.44222	0.1283	L	0.32530	0.975	0.51767	D	0.99993	D	0.76494	0.999	D	0.78314	0.991	T	0.21793	-1.0235	10	0.33141	T	0.24	-17.1171	15.6987	0.77521	0.0:0.0:0.0:1.0	.	857	Q9C0B9	ZCHC2_HUMAN	V	857	ENSP00000269499:F857V	ENSP00000269499:F857V	F	+	1	0	ZCCHC2	58392863	1.000000	0.71417	0.980000	0.43619	0.971000	0.66376	5.376000	0.66178	2.161000	0.67846	0.533000	0.62120	TTC	.		0.498	ZCCHC2-005	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450083.1	NM_017742	
ZCCHC4	29063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	25353268	25353268	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr4:25353268G>T	ENST00000302874.4	+	8	992	c.968G>T	c.(967-969)cGa>cTa	p.R323L	AC108218.1_ENST00000580712.1_RNA|ZCCHC4_ENST00000505451.1_3'UTR	NM_024936.2	NP_079212.2	Q9H5U6	ZCHC4_HUMAN	zinc finger, CCHC domain containing 4	323							methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)	9		Breast(46;0.0503)				TTTGAATCCCGAATTTGTCAG	0.348																																					p.R323L		.											.	ZCCHC4	70	0			c.G968T						.						129.0	120.0	123.0					4																	25353268		1792	4064	5856	SO:0001583	missense	29063	exon8			AATCCCGAATTTG	AF161537	CCDS43218.1	4p15.31	2014-02-18			ENSG00000168228	ENSG00000168228		"""Zinc fingers, CCHC domain containing"""	22917	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 4"""	611792				11042152	Standard	NM_024936		Approved	HSPC052, FLJ23024, ZGRF4	uc003grl.4	Q9H5U6	OTTHUMG00000160563	ENST00000302874.4:c.968G>T	4.37:g.25353268G>T	ENSP00000303468:p.Arg323Leu	123.0	0.0		343.0	134.0	NM_024936	B2RXF6|B4DRD8|B7ZW20|Q5IW78|Q96AN7	Missense_Mutation	SNP	ENST00000302874.4	37	CCDS43218.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.956075	0.92726	.	.	ENSG00000168228	ENST00000302874	T	0.32515	1.45	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.48677	0.1513	M	0.77103	2.36	0.58432	D	0.999996	D	0.53745	0.962	P	0.50162	0.633	T	0.44697	-0.9311	10	0.44086	T	0.13	-16.3091	19.1733	0.93590	0.0:0.0:1.0:0.0	.	323	Q9H5U6	ZCHC4_HUMAN	L	323	ENSP00000303468:R323L	ENSP00000303468:R323L	R	+	2	0	ZCCHC4	24962366	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.011000	0.76359	2.815000	0.96918	0.650000	0.86243	CGA	.		0.348	ZCCHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361151.1		
ZFX	7543	hgsc.bcm.edu;bcgsc.ca	37	X	24227055	24227104	+	Frame_Shift_Del	DEL	GCAAGTGCCCTCTTGCACATAGATGAGTCTGCTGGCCTCGGCAGACTGGC	GCAAGTGCCCTCTTGCACATAGATGAGTCTGCTGGCCTCGGCAGACTGGC	-			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	GCAAGTGCCCTCTTGCACATAGATGAGTCTGCTGGCCTCGGCAGACTGGC	GCAAGTGCCCTCTTGCACATAGATGAGTCTGCTGGCCTCGGCAGACTGGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chrX:24227055_24227104delGCAAGTGCCCTCTTGCACATAGATGAGTCTGCTGGCCTCGGCAGACTGGC	ENST00000379177.1	+	10	1559_1608	c.1132_1181delGCAAGTGCCCTCTTGCACATAGATGAGTCTGCTGGCCTCGGCAGACTGGC	c.(1132-1182)gcaagtgccctcttgcacatagatgagtctgctggcctcggcagactggctfs	p.ASALLHIDESAGLGRLA378fs	ZFX_ENST00000304543.5_Frame_Shift_Del_p.ASALLHIDESAGLGRLA378fs|ZFX_ENST00000540034.1_Frame_Shift_Del_p.ASALLHIDESAGLGRLA417fs|ZFX_ENST00000338565.3_Frame_Shift_Del_p.ASALLHIDESAGLGRLA328fs|ZFX_ENST00000459724.1_3'UTR|ZFX_ENST00000379188.3_Frame_Shift_Del_p.ASALLHIDESAGLGRLA378fs|ZFX_ENST00000539115.1_Frame_Shift_Del_p.ASALLHIDESAGLGRLA149fs	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	378					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						GAATGGCACTGCAAGTGCCCTCTTGCACATAGATGAGTCTGCTGGCCTCGGCAGACTGGCTAAACAAAAA	0.424																																					p.378_394del	Esophageal Squamous(20;306 562 7346 32868 37983)	.											.	ZFX	132	0			c.1132_1181del						.																																			SO:0001589	frameshift_variant	7543	exon9			GGCACTGCAAGTG		CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.1132_1181delGCAAGTGCCCTCTTGCACATAGATGAGTCTGCTGGCCTCGGCAGACTGGC	X.37:g.24227055_24227104delGCAAGTGCCCTCTTGCACATAGATGAGTCTGCTGGCCTCGGCAGACTGGC	ENSP00000368475:p.Ala378fs	107.0	0.0		65.0	18.0	NM_003410	B9EG97|O43668|Q8WYJ8	Frame_Shift_Del	DEL	ENST00000379177.1	37	CCDS14211.1																																																																																			.		0.424	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056084.1	NM_003410	
ZNF208	7757	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	22156136	22156136	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr19:22156136G>T	ENST00000397126.4	-	4	1848	c.1700C>A	c.(1699-1701)aCc>aAc	p.T567N	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	567					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ATAACTAAGGGTTGAGGACCA	0.343																																					p.T567N		.											.	ZNF208	7	0			c.C1700A						.						24.0	24.0	24.0					19																	22156136		1924	4104	6028	SO:0001583	missense	7757	exon4			CTAAGGGTTGAGG	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1700C>A	19.37:g.22156136G>T	ENSP00000380315:p.Thr567Asn	22.0	0.0		56.0	20.0	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	G	0.206	-1.040222	0.02013	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.07800	3.16	2.82	-5.63	0.02474	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02848	0.0085	.	.	.	0.09310	N	1	B	0.23377	0.084	B	0.26614	0.071	T	0.35226	-0.9797	8	0.06891	T	0.86	.	2.7578	0.05298	0.1287:0.3034:0.3969:0.171	.	467	O43345	ZN208_HUMAN	N	567;467	ENSP00000380315:T567N	ENSP00000380315:T567N	T	-	2	0	ZNF208	21947976	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.956000	0.00675	-3.152000	0.00230	-2.155000	0.00331	ACC	.		0.343	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
ZNF2	7549	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	95847630	95847630	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr2:95847630G>T	ENST00000340539.5	+	5	1519	c.1057G>T	c.(1057-1059)Gac>Tac	p.D353Y	ZNF2_ENST00000425369.1_Missense_Mutation_p.D273Y|ZNF2_ENST00000453539.2_Missense_Mutation_p.D366Y|ZNF2_ENST00000295210.6_Missense_Mutation_p.D315Y|ZNF2_ENST00000398107.2_Missense_Mutation_p.D311Y	NM_021088.2	NP_066574	Q9BSG1	ZNF2_HUMAN	zinc finger protein 2	353					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	12		Ovarian(717;0.00768)		READ - Rectum adenocarcinoma(193;0.0222)		AGCTTTCTTTGACCGCTCATC	0.517																																					p.D353Y		.											.	ZNF2	90	0			c.G1057T						.						89.0	97.0	95.0					2																	95847630		2129	4277	6406	SO:0001583	missense	7549	exon5			TTCTTTGACCGCT	X60152	CCDS42712.1, CCDS42713.1, CCDS62957.1	2q11.1	2013-09-24	2005-02-07		ENSG00000163067	ENSG00000275111		"""Zinc fingers, C2H2-type"", ""-"""	12991	protein-coding gene	gene with protein product		194500	"""zinc finger protein 2 (A1-5)"""			8183940, 1945843	Standard	NM_021088		Approved	A1-5, ZNF661, Zfp661	uc002suf.3	Q9BSG1	OTTHUMG00000155150	ENST00000340539.5:c.1057G>T	2.37:g.95847630G>T	ENSP00000345392:p.Asp353Tyr	54.0	0.0		119.0	54.0	NM_021088	A8MWV7|B4DIR4|Q4ZFY6|Q96G44|Q9UMC5	Missense_Mutation	SNP	ENST00000340539.5	37	CCDS42712.1	.	.	.	.	.	.	.	.	.	.	G	4.727	0.135240	0.09032	.	.	ENSG00000163067	ENST00000398107;ENST00000340539;ENST00000425369;ENST00000295210;ENST00000453539	T;T;T;T;T	0.55052	0.54;2.48;3.3;0.54;2.48	5.18	5.18	0.71444	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.138238	0.33670	N	0.004673	T	0.50514	0.1620	N	0.05554	-0.025	0.42318	D	0.992242	D;P;D	0.89917	1.0;0.887;1.0	D;B;D	0.91635	0.969;0.261;0.999	T	0.44375	-0.9332	10	0.10636	T	0.68	-17.8972	16.2332	0.82358	0.0:0.0:1.0:0.0	.	315;311;352	B4DIR4;A8MWV7;Q9BSG1	.;.;ZNF2_HUMAN	Y	311;353;273;315;366	ENSP00000381178:D311Y;ENSP00000345392:D353Y;ENSP00000406017:D273Y;ENSP00000295210:D315Y;ENSP00000411051:D366Y	ENSP00000295210:D315Y	D	+	1	0	ZNF2	95211357	0.000000	0.05858	1.000000	0.80357	0.661000	0.39034	-0.622000	0.05553	2.697000	0.92050	0.563000	0.77884	GAC	.		0.517	ZNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338595.2	NM_021088	
ZNF28	7576	hgsc.bcm.edu;bcgsc.ca	37	19	53303182	53303182	+	Missense_Mutation	SNP	T	T	C	rs142391659		TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr19:53303182T>C	ENST00000457749.2	-	4	2035	c.1916A>G	c.(1915-1917)gAg>gGg	p.E639G	ZNF28_ENST00000360272.4_Missense_Mutation_p.E586G|ZNF28_ENST00000414252.2_Missense_Mutation_p.E586G|ZNF28_ENST00000438150.2_Missense_Mutation_p.E586G	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	639					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		CTTGCCACACTCATTACACTT	0.428																																					p.E639G		.											.	ZNF28	91	0			c.A1916G						.						193.0	181.0	185.0					19																	53303182		2203	4300	6503	SO:0001583	missense	7576	exon4			CCACACTCATTAC	X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.1916A>G	19.37:g.53303182T>C	ENSP00000397693:p.Glu639Gly	99.0	0.0		249.0	11.0	NM_006969	A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Missense_Mutation	SNP	ENST00000457749.2	37	CCDS33093.2	.	.	.	.	.	.	.	.	.	.	-	10.84	1.465403	0.26335	.	.	ENSG00000198538	ENST00000438150;ENST00000457749;ENST00000360272;ENST00000414252	T;T;T;T	0.35789	1.29;1.29;1.29;1.29	1.81	0.634	0.17718	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.40546	0.1121	L	0.47716	1.5	0.09310	N	1	D	0.60575	0.988	P	0.55615	0.78	T	0.22695	-1.0209	9	0.72032	D	0.01	.	5.8153	0.18490	0.2376:0.0:0.0:0.7624	.	639	P17035	ZNF28_HUMAN	G	586;639;586;586	ENSP00000412143:E586G;ENSP00000397693:E639G;ENSP00000353410:E586G;ENSP00000444965:E586G	ENSP00000353410:E586G	E	-	2	0	ZNF28	57994994	0.000000	0.05858	0.024000	0.17045	0.568000	0.35870	-0.093000	0.11111	-0.035000	0.13691	0.248000	0.18094	GAG	.		0.428	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336038.2	NM_006969	
ZNF436	80818	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	23689653	23689653	+	Silent	SNP	T	T	C			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr1:23689653T>C	ENST00000314011.4	-	4	358	c.222A>G	c.(220-222)caA>caG	p.Q74Q	ZNF436_ENST00000374608.3_Silent_p.Q74Q	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436	74	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		TAGTCCCAAATTGTACATCTT	0.393																																					p.Q74Q		.											.	ZNF436	153	0			c.A222G						.						123.0	124.0	124.0					1																	23689653		2203	4300	6503	SO:0001819	synonymous_variant	80818	exon4			CCCAAATTGTACA	AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232	ENST00000314011.4:c.222A>G	1.37:g.23689653T>C		120.0	0.0		279.0	121.0	NM_001077195	Q658I9	Silent	SNP	ENST00000314011.4	37	CCDS233.1																																																																																			.		0.393	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008908.1	NM_030634	
ZNF536	9745	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	30936253	30936254	+	Frame_Shift_Ins	INS	-	-	AAGT			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr19:30936253_30936254insAAGT	ENST00000355537.3	+	2	1931_1932	c.1784_1785insAAGT	c.(1783-1788)ccaagtfs	p.-597fs		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536						negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					AGAGACCTGCCAAGTAAGCTCG	0.52																																					p.P595fs		.											.	ZNF536	144	0			c.1784_1785insAAGT						.																																			SO:0001589	frameshift_variant	9745	exon2			ACCTGCCAAGTAA		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1785_1788dupAAGT	19.37:g.30936254_30936257dupAAGT	ENSP00000347730:p.Lys597fs	52.0	0.0		70.0	12.0	NM_014717	A2RU18	Frame_Shift_Ins	INS	ENST00000355537.3	37	CCDS32984.1																																																																																			.		0.520	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
ZNF608	57507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	123982848	123982848	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr5:123982848A>T	ENST00000306315.5	-	4	3664	c.3229T>A	c.(3229-3231)Tca>Aca	p.S1077T	ZNF608_ENST00000513985.1_5'Flank|ZNF608_ENST00000504926.1_Missense_Mutation_p.S650T	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	1077							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		TAATAAAGTGACTGAGCCAGG	0.483																																					p.S1077T		.											.	ZNF608	229	0			c.T3229A						.						72.0	68.0	69.0					5																	123982848		2203	4300	6503	SO:0001583	missense	57507	exon4			AAAGTGACTGAGC	AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.3229T>A	5.37:g.123982848A>T	ENSP00000307746:p.Ser1077Thr	148.0	0.0		291.0	111.0	NM_020747	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	ENST00000306315.5	37	CCDS34219.1	.	.	.	.	.	.	.	.	.	.	A	17.16	3.319352	0.60524	.	.	ENSG00000168916	ENST00000504926;ENST00000306315	T;T	0.51071	0.73;0.72	5.57	5.57	0.84162	.	0.064020	0.64402	D	0.000004	T	0.64461	0.2600	M	0.66939	2.045	0.49389	D	0.999785	D	0.76494	0.999	D	0.66602	0.945	T	0.61207	-0.7109	10	0.26408	T	0.33	-13.2497	16.0213	0.80499	1.0:0.0:0.0:0.0	.	1077	Q9ULD9	ZN608_HUMAN	T	650;1077	ENSP00000427657:S650T;ENSP00000307746:S1077T	ENSP00000307746:S1077T	S	-	1	0	ZNF608	124010747	1.000000	0.71417	0.998000	0.56505	0.962000	0.63368	5.253000	0.65452	2.239000	0.73571	0.523000	0.50628	TCA	.		0.483	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1	XM_114432	
ZNF679	168417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	63726562	63726562	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr7:63726562T>G	ENST00000421025.1	+	5	820	c.551T>G	c.(550-552)tTc>tGc	p.F184C	ZNF679_ENST00000255746.4_Missense_Mutation_p.F184C	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	184					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						AAGAAACATTTCAAATGTAAA	0.318																																					p.F184C		.											.	ZNF679	1	0			c.T551G						.						66.0	58.0	61.0					7																	63726562		692	1591	2283	SO:0001583	missense	168417	exon5			AACATTTCAAATG	BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.551T>G	7.37:g.63726562T>G	ENSP00000416809:p.Phe184Cys	196.0	0.0		428.0	230.0	NM_153363		Missense_Mutation	SNP	ENST00000421025.1	37	CCDS47592.1	.	.	.	.	.	.	.	.	.	.	T	10.27	1.304053	0.23736	.	.	ENSG00000197123	ENST00000421025;ENST00000255746	T;T	0.33654	1.4;1.4	1.12	-2.23	0.06930	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.41673	0.1169	M	0.71871	2.18	0.09310	N	0.999999	D	0.64830	0.994	P	0.52710	0.707	T	0.31138	-0.9954	9	0.56958	D	0.05	.	4.0757	0.09902	0.4393:0.0:0.0:0.5607	.	184	Q8IYX0	ZN679_HUMAN	C	184	ENSP00000416809:F184C;ENSP00000255746:F184C	ENSP00000255746:F184C	F	+	2	0	ZNF679	63363997	0.000000	0.05858	0.006000	0.13384	0.107000	0.19398	-0.540000	0.06106	-0.659000	0.05359	0.163000	0.16589	TTC	.		0.318	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344317.2	NM_153363	
ZNF700	90592	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	12059506	12059506	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr19:12059506A>T	ENST00000254321.5	+	4	810	c.667A>T	c.(667-669)Aaa>Taa	p.K223*	ZNF763_ENST00000590798.1_Intron|ZNF763_ENST00000591944.1_Intron|CTD-2006C1.12_ENST00000586394.1_RNA|ZNF763_ENST00000538752.1_Intron|ZNF700_ENST00000482090.1_Nonsense_Mutation_p.K205*	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	223					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						TGGAACTTATAAATGTAAATT	0.368																																					p.K226X		.											.	ZNF700	90	0			c.A676T						.						79.0	85.0	83.0					19																	12059506		2203	4300	6503	SO:0001587	stop_gained	90592	exon4			ACTTATAAATGTA	AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.667A>T	19.37:g.12059506A>T	ENSP00000254321:p.Lys223*	106.0	0.0		189.0	79.0	NM_001271848	B9EGU4	Nonsense_Mutation	SNP	ENST00000254321.5	37	CCDS32915.1	.	.	.	.	.	.	.	.	.	.	a	16.06	3.014522	0.54468	.	.	ENSG00000196757	ENST00000254321	.	.	.	0.732	-0.667	0.11395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	1.5805	0.02633	0.3076:0.0:0.3686:0.3237	.	.	.	.	X	223	.	ENSP00000254321:K223X	K	+	1	0	ZNF700	11920506	0.000000	0.05858	0.039000	0.18376	0.151000	0.21798	-4.230000	0.00270	-0.246000	0.09611	0.254000	0.18369	AAA	.		0.368	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344126.2	NM_144566	
ZNF845	91664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53856410	53856410	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10U-01A-11D-A12Z-10	TCGA-BC-A10U-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a85cabff-e8dc-440a-90f5-4fca51c33dd9	cc5b70cb-4799-4d23-86d6-30f9aec7989a	g.chr19:53856410G>A	ENST00000595091.1	+	5	2701	c.2482G>A	c.(2482-2484)Gag>Aag	p.E828K	ZNF845_ENST00000458035.1_Missense_Mutation_p.E828K			Q96IR2	ZN845_HUMAN	zinc finger protein 845	828					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						TCATAGTGGAGAGAAACCTTA	0.398																																					p.E828K		.											.	.	.	0			c.G2482A						.						46.0	44.0	44.0					19																	53856410		692	1591	2283	SO:0001583	missense	91664	exon4			AGTGGAGAGAAAC	BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.2482G>A	19.37:g.53856410G>A	ENSP00000470005:p.Glu828Lys	109.0	0.0		197.0	96.0	NM_138374		Missense_Mutation	SNP	ENST00000595091.1	37	CCDS46170.1	.	.	.	.	.	.	.	.	.	.	G	12.82	2.052672	0.36181	.	.	ENSG00000213799	ENST00000458035;ENST00000427984	T	0.24350	1.86	1.95	0.783	0.18572	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.35364	0.0929	L	0.56280	1.765	0.24756	N	0.992955	P	0.43633	0.813	P	0.53760	0.734	T	0.18304	-1.0341	9	0.46703	T	0.11	.	9.0555	0.36403	0.0:0.2296:0.7703:0.0	.	828	Q96IR2	ZN845_HUMAN	K	828;744	ENSP00000388311:E828K	ENSP00000412086:E744K	E	+	1	0	ZNF845	58548222	0.068000	0.21057	0.001000	0.08648	0.007000	0.05969	2.180000	0.42537	0.132000	0.18615	0.454000	0.30748	GAG	.		0.398	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908	
