#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACTR8	93973	broad.mit.edu;ucsc.edu	37	3	53911741	53911741	+	Nonsense_Mutation	SNP	A	A	C			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr3:53911741A>C	ENST00000335754.3	-	4	543	c.443T>G	c.(442-444)tTa>tGa	p.L148*	ACTR8_ENST00000482349.1_Nonsense_Mutation_p.L37*|ACTR8_ENST00000231909.7_5'Flank	NM_022899.4	NP_075050.3	Q9H981	ARP8_HUMAN	ARP8 actin-related protein 8 homolog (yeast)	148					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	ATP binding (GO:0005524)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)		ACAGTGATCTAAAATTGCAGG	0.393																																					p.L148X		.											.	ACTR8	91	0			c.T443G						.						98.0	93.0	95.0					3																	53911741		2203	4300	6503	SO:0001587	stop_gained	93973	exon4			TGATCTAAAATTG		CCDS2875.1	3p21.31	2011-07-06	2001-11-28		ENSG00000113812	ENSG00000113812		"""INO80 complex subunits"""	14672	protein-coding gene	gene with protein product	"""INO80 complex subunit N"""		"""ARP8 (actin-related protein 8, yeast) homolog"""			18163988, 16230350	Standard	NM_022899		Approved	INO80N	uc003dhd.3	Q9H981	OTTHUMG00000158279	ENST00000335754.3:c.443T>G	3.37:g.53911741A>C	ENSP00000336842:p.Leu148*	154.0	2.0		126.0	53.0	NM_022899	B3KSW7|Q8N566|Q9H663	Nonsense_Mutation	SNP	ENST00000335754.3	37	CCDS2875.1	.	.	.	.	.	.	.	.	.	.	A	40	7.942751	0.98574	.	.	ENSG00000113812	ENST00000335754;ENST00000482349;ENST00000498740	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	-4.564	14.6892	0.69072	1.0:0.0:0.0:0.0	.	.	.	.	X	148;37;37	.	ENSP00000336842:L148X	L	-	2	0	ACTR8	53886781	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.010000	0.76353	2.205000	0.71048	0.528000	0.53228	TTA	.		0.393	ACTR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350562.2	NM_022899	
ANKRD12	23253	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	9255937	9255939	+	In_Frame_Del	DEL	CTG	CTG	-	rs568282731		TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	CTG	CTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr18:9255937_9255939delCTG	ENST00000262126.4	+	9	2912_2914	c.2672_2674delCTG	c.(2671-2676)actgct>act	p.A893del	ANKRD12_ENST00000400020.3_In_Frame_Del_p.A870del|ANKRD12_ENST00000383440.2_In_Frame_Del_p.A870del	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	893						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						AGCAAAAATACTGCTGCTATTAA	0.345																																					p.891_892del		.											.	ANKRD12	92	0			c.2672_2674del						.																																			SO:0001651	inframe_deletion	23253	exon9			AAAATACTGCTGC	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2672_2674delCTG	18.37:g.9255940_9255942delCTG	ENSP00000262126:p.Ala893del	45.0	0.0		49.0	12.0	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	In_Frame_Del	DEL	ENST00000262126.4	37	CCDS11843.1																																																																																			.		0.345	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
ANO10	55129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	43618347	43618347	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr3:43618347C>T	ENST00000292246.3	-	6	1169	c.999G>A	c.(997-999)atG>atA	p.M333I	ANO10_ENST00000396091.3_Missense_Mutation_p.M267I|ANO10_ENST00000451430.2_Missense_Mutation_p.M222I|ANO10_ENST00000414522.2_Missense_Mutation_p.M333I|ANO10_ENST00000350459.4_Intron	NM_018075.3	NP_060545.3	Q9NW15	ANO10_HUMAN	anoctamin 10	333					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell death (GO:0008219)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)	p.M333I(1)		NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(3)|skin(3)	29						AGTAAATCATCATGACATACA	0.512																																					p.M333I		.											.	ANO10	92	1	Substitution - Missense(1)	lung(1)	c.G999A						.						108.0	83.0	91.0					3																	43618347		2203	4300	6503	SO:0001583	missense	55129	exon6			AATCATCATGACA	AL832508	CCDS2710.2, CCDS56247.1, CCDS56248.1, CCDS56249.1, CCDS56250.1	3p22.1-p21.33	2014-04-09	2008-08-28	2008-08-28	ENSG00000160746	ENSG00000160746		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25519	protein-coding gene	gene with protein product		613726	"""transmembrane protein 16K"""	TMEM16K		12477932, 24692353	Standard	NM_001204831		Approved	FLJ10375, MGC47890, SCAR10	uc003cmv.3	Q9NW15	OTTHUMG00000133044	ENST00000292246.3:c.999G>A	3.37:g.43618347C>T	ENSP00000292246:p.Met333Ile	288.0	0.0		202.0	92.0	NM_018075	A8K8K3|A8MV74|B3KTZ1|B3KY93|B4DJ83|B4DNK2|B7WP12|C9JHS1|Q8IXX9	Missense_Mutation	SNP	ENST00000292246.3	37	CCDS2710.2	.	.	.	.	.	.	.	.	.	.	C	32	5.131456	0.94473	.	.	ENSG00000160746	ENST00000292246;ENST00000396091;ENST00000414522;ENST00000451430	T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.75722	0.3888	M	0.69523	2.12	0.80722	D	1	D;D;D;D	0.76494	0.986;0.999;0.992;0.998	D;D;D;D	0.79108	0.939;0.992;0.966;0.983	T	0.69774	-0.5054	10	0.02654	T	1	.	19.7321	0.96186	0.0:1.0:0.0:0.0	.	222;333;267;333	Q9NW15-4;C9JHS1;Q9NW15-3;Q9NW15	.;.;.;ANO10_HUMAN	I	333;267;333;222	ENSP00000292246:M333I;ENSP00000379398:M267I;ENSP00000396990:M333I;ENSP00000394119:M222I	ENSP00000292246:M333I	M	-	3	0	ANO10	43593351	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.668000	0.90789	0.655000	0.94253	ATG	.		0.512	ANO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256649.2	NM_018075	
ARL9	132946	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	57389953	57389953	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr4:57389953A>G	ENST00000360096.2	+	4	597	c.283A>G	c.(283-285)Acc>Gcc	p.T95A		NM_206919.1	NP_996802.1	Q6T311	ARL9_HUMAN	ADP-ribosylation factor-like 9	159					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			lung(2)	2	Glioma(25;0.08)|all_neural(26;0.101)					CTTGTTTGGAACCTACCTGAC	0.468																																					p.T95A		.											.	ARL9	22	0			c.A283G						.						134.0	128.0	130.0					4																	57389953		2010	4180	6190	SO:0001583	missense	132946	exon4			TTTGGAACCTACC	AY439003	CCDS59474.1	4q12	2014-05-09				ENSG00000196503		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	23592	protein-coding gene	gene with protein product		612405					Standard	NM_206919		Approved		uc003hby.1	Q6T311		ENST00000360096.2:c.283A>G	4.37:g.57389953A>G	ENSP00000353210:p.Thr95Ala	201.0	0.0		91.0	80.0	NM_206919		Missense_Mutation	SNP	ENST00000360096.2	37	CCDS59474.1	.	.	.	.	.	.	.	.	.	.	A	17.54	3.414259	0.62511	.	.	ENSG00000196503	ENST00000360096	.	.	.	5.32	5.32	0.75619	.	0.092344	0.85682	D	0.000000	T	0.68430	0.3000	L	0.42008	1.315	0.48511	D	0.999666	D	0.89917	1.0	D	0.91635	0.999	T	0.75096	-0.3438	8	0.56958	D	0.05	-19.5799	13.5348	0.61641	1.0:0.0:0.0:0.0	.	159	Q6T311	ARL9_HUMAN	A	159	.	ENSP00000353210:T159A	T	+	1	0	ARL9	57084710	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.257000	0.78362	2.133000	0.65898	0.455000	0.32223	ACC	.		0.468	ARL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467724.1	NM_206919	
ARMC9	80210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	232087516	232087516	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr2:232087516A>G	ENST00000349938.4	+	6	774	c.580A>G	c.(580-582)Aag>Gag	p.K194E	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	194						extracellular vesicular exosome (GO:0070062)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		CAACACGCCAAAGCTTTTAAC	0.343																																					p.K194E		.											.	ARMC9	91	0			c.A580G						.						66.0	67.0	66.0					2																	232087516		2201	4298	6499	SO:0001583	missense	80210	exon6			ACGCCAAAGCTTT	BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.580A>G	2.37:g.232087516A>G	ENSP00000258417:p.Lys194Glu	131.0	0.0		125.0	56.0	NM_025139	Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Missense_Mutation	SNP	ENST00000349938.4	37	CCDS2484.1	.	.	.	.	.	.	.	.	.	.	A	16.70	3.196343	0.58126	.	.	ENSG00000135931	ENST00000349938;ENST00000359743	T	0.17213	2.29	5.59	5.59	0.84812	.	0.143260	0.64402	D	0.000007	T	0.12305	0.0299	N	0.22421	0.69	0.32951	D	0.519779	B	0.25351	0.124	B	0.21151	0.033	T	0.11867	-1.0570	10	0.32370	T	0.25	-20.9629	12.835	0.57767	0.8642:0.1358:0.0:0.0	.	194	Q7Z3E5	ARMC9_HUMAN	E	194	ENSP00000258417:K194E	ENSP00000258417:K194E	K	+	1	0	ARMC9	231795760	1.000000	0.71417	0.980000	0.43619	0.987000	0.75469	5.890000	0.69774	2.118000	0.64928	0.533000	0.62120	AAG	.		0.343	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256966.3	NM_025139	
B4GALNT4	338707	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	373809	373809	+	Missense_Mutation	SNP	C	C	T	rs144647644	byFrequency	TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr11:373809C>T	ENST00000329962.6	+	8	764	c.764C>T	c.(763-765)tCg>tTg	p.S255L		NM_178537.4	NP_848632.2	Q76KP1	B4GN4_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 4	255					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GACCGCGGCTCGGACCACGTG	0.657																																					p.S255L		.											.	B4GALNT4	91	0			c.C764T						.	C	LEU/SER	2,4388	4.2+/-10.8	0,2,2193	76.0	69.0	71.0		764	4.4	1.0	11	dbSNP_134	71	0,8582		0,0,4291	yes	missense	B4GALNT4	NM_178537.4	145	0,2,6484	TT,TC,CC		0.0,0.0456,0.0154	probably-damaging	255/1040	373809	2,12970	2195	4291	6486	SO:0001583	missense	338707	exon8			GCGGCTCGGACCA	AB089939	CCDS7694.1	11p15.5	2013-02-19			ENSG00000182272	ENSG00000182272	2.4.1.-	"""Beta 4-glycosyltransferases"""	26315	protein-coding gene	gene with protein product						15044014	Standard	NM_178537		Approved	FLJ25045, NGalNAc-T1	uc001lpb.3	Q76KP1	OTTHUMG00000119075	ENST00000329962.6:c.764C>T	11.37:g.373809C>T	ENSP00000328277:p.Ser255Leu	106.0	0.0		41.0	18.0	NM_178537	Q96LV2	Missense_Mutation	SNP	ENST00000329962.6	37	CCDS7694.1	.	.	.	.	.	.	.	.	.	.	c	31	5.094053	0.94149	4.56E-4	0.0	ENSG00000182272	ENST00000329962	T	0.22336	1.96	4.38	4.38	0.52667	PA14 (2);	0.379769	0.24152	N	0.041074	T	0.43787	0.1263	M	0.71581	2.175	0.51012	D	0.9999	D	0.71674	0.998	P	0.62885	0.908	T	0.42865	-0.9426	10	0.59425	D	0.04	-18.8564	16.4521	0.83994	0.0:1.0:0.0:0.0	.	255	Q76KP1	B4GN4_HUMAN	L	255	ENSP00000328277:S255L	ENSP00000328277:S255L	S	+	2	0	B4GALNT4	363809	0.903000	0.30736	0.993000	0.49108	0.912000	0.54170	6.940000	0.75917	2.429000	0.82318	0.462000	0.41574	TCG	C|1.000;T|0.000		0.657	B4GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239289.2	NM_178537	
BAX	581	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49464295	49464295	+	Intron	SNP	C	C	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr19:49464295C>T	ENST00000345358.7	+	5	526				BAX_ENST00000354470.3_Intron|CTD-2639E6.9_ENST00000599784.1_lincRNA|BAX_ENST00000293288.8_Missense_Mutation_p.P200S|BAX_ENST00000539787.1_Intron|BAX_ENST00000415969.2_Intron|BAX_ENST00000391871.3_Intron	NM_138761.3|NM_138764.4	NP_620116.1|NP_620119.2	Q07812	BAX_HUMAN	BCL2-associated X protein						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|apoptotic process involved in patterning of blood vessels (GO:1902262)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|B cell homeostatic proliferation (GO:0002358)|B cell negative selection (GO:0002352)|B cell receptor apoptotic signaling pathway (GO:1990117)|blood vessel remodeling (GO:0001974)|cellular response to organic substance (GO:0071310)|cellular response to UV (GO:0034644)|cerebral cortex development (GO:0021987)|development of secondary sexual characteristics (GO:0045136)|ectopic germ cell programmed cell death (GO:0035234)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells within a tissue (GO:0048873)|hypothalamus development (GO:0021854)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein binding (GO:0032091)|neuron apoptotic process (GO:0051402)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic DNA fragmentation (GO:1902512)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of developmental pigmentation (GO:0048087)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-embryonic camera-type eye morphogenesis (GO:0048597)|protein homooligomerization (GO:0051260)|protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:0001844)|protein oligomerization (GO:0051259)|regulation of cell cycle (GO:0051726)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of mitochondrial membrane permeability involved in programmed necrotic cell death (GO:1902445)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of nitrogen utilization (GO:0006808)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|release of cytochrome c from mitochondria (GO:0001836)|release of matrix enzymes from mitochondria (GO:0032976)|response to axon injury (GO:0048678)|response to gamma radiation (GO:0010332)|response to salt stress (GO:0009651)|response to toxic substance (GO:0009636)|retina development in camera-type eye (GO:0060041)|retinal cell apoptotic process (GO:1990009)|retinal cell programmed cell death (GO:0046666)|Sertoli cell proliferation (GO:0060011)|spermatid differentiation (GO:0048515)|T cell homeostatic proliferation (GO:0001777)|thymocyte apoptotic process (GO:0070242)|transformed cell apoptotic process (GO:0006927)|vagina development (GO:0060068)|viral process (GO:0016032)	BAX complex (GO:0097144)|Bcl-2 family protein complex (GO:0097136)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrial permeability transition pore complex (GO:0005757)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pore complex (GO:0046930)	BH3 domain binding (GO:0051434)|channel activity (GO:0015267)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(7)|skin(2)|urinary_tract(4)	17		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000159)|all cancers(93;0.00047)|GBM - Glioblastoma multiforme(486;0.018)|Epithelial(262;0.0279)		ACAGTGGTGCCCTCTCCCCAT	0.622																																					p.P200S		.											.	BAX	1271	0			c.C598T						.						80.0	59.0	66.0					19																	49464295		2197	4290	6487	SO:0001627	intron_variant	581	exon5			TGGTGCCCTCTCC		CCDS12742.1, CCDS12743.1, CCDS12744.1, CCDS12745.1, CCDS12745.2	19q13.3-q13.4	2014-03-07			ENSG00000087088	ENSG00000087088			959	protein-coding gene	gene with protein product		600040				8358790	Standard	NM_138761		Approved	BCL2L4	uc002plf.1	Q07812	OTTHUMG00000160476	ENST00000345358.7:c.474+124C>T	19.37:g.49464295C>T		22.0	0.0		28.0	14.0	NM_004324	A8K4W1|P55269|Q07814|Q07815|Q8WZ49|Q9NR76|Q9NYG7|Q9UCZ6|Q9UCZ7|Q9UQD6	Missense_Mutation	SNP	ENST00000345358.7	37	CCDS12742.1	.	.	.	.	.	.	.	.	.	.	C	11.49	1.652901	0.29336	.	.	ENSG00000087088	ENST00000293288	T	0.13089	2.62	2.67	-1.75	0.08031	.	0.148125	0.42548	U	0.000681	T	0.05456	0.0144	.	.	.	0.09310	N	0.999993	B	0.19706	0.038	B	0.19391	0.025	T	0.28522	-1.0041	8	.	.	.	.	0.9509	0.01376	0.2932:0.364:0.1967:0.1461	.	200	Q07812-2	.	S	200	ENSP00000293288:P200S	.	P	+	1	0	BAX	54156107	0.000000	0.05858	0.000000	0.03702	0.197000	0.23852	-0.728000	0.04925	-0.263000	0.09378	0.462000	0.41574	CCT	.		0.622	BAX-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360767.1	NM_138763	
BMP2	650	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	6759153	6759153	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr20:6759153G>T	ENST00000378827.4	+	3	1827	c.608G>T	c.(607-609)aGg>aTg	p.R203M		NM_001200.2	NP_001191.1	P12643	BMP2_HUMAN	bone morphogenetic protein 2	203					activation of MAPK activity (GO:0000187)|atrioventricular valve morphogenesis (GO:0003181)|BMP signaling pathway (GO:0030509)|BMP signaling pathway involved in heart induction (GO:0003130)|bone mineralization (GO:0030282)|bone mineralization involved in bone maturation (GO:0035630)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiocyte differentiation (GO:0035051)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation (GO:0002062)|corticotropin hormone secreting cell differentiation (GO:0060128)|embryo development (GO:0009790)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|inner ear development (GO:0048839)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesenchyme development (GO:0060485)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of calcium-independent cell-cell adhesion (GO:0051042)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell differentiation (GO:2000726)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of steroid biosynthetic process (GO:0010894)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|organ morphogenesis (GO:0009887)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|pericardium development (GO:0060039)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of odontogenesis (GO:0042482)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of Wnt signaling pathway by BMP signaling pathway (GO:0060804)|protein destabilization (GO:0031648)|protein phosphorylation (GO:0006468)|proteoglycan metabolic process (GO:0006029)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|telencephalon development (GO:0021537)|telencephalon regionalization (GO:0021978)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	BMP receptor binding (GO:0070700)|phosphatase activator activity (GO:0019211)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)|retinol dehydrogenase activity (GO:0004745)|SMAD binding (GO:0046332)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)	13						AATGCAAGCAGGTGGGAAAGT	0.493																																					p.R203M		.											.	BMP2	1044	0			c.G608T						.						55.0	57.0	56.0					20																	6759153		2203	4300	6503	SO:0001583	missense	650	exon3			CAAGCAGGTGGGA		CCDS13099.1	20p12	2014-01-30			ENSG00000125845	ENSG00000125845		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1069	protein-coding gene	gene with protein product		112261		BMP2A		2376592	Standard	NM_001200		Approved		uc002wmu.1	P12643	OTTHUMG00000031833	ENST00000378827.4:c.608G>T	20.37:g.6759153G>T	ENSP00000368104:p.Arg203Met	100.0	0.0		96.0	44.0	NM_001200		Missense_Mutation	SNP	ENST00000378827.4	37	CCDS13099.1	.	.	.	.	.	.	.	.	.	.	G	15.14	2.745024	0.49151	.	.	ENSG00000125845	ENST00000378827	T	0.65732	-0.17	5.7	-3.76	0.04359	Transforming growth factor-beta, N-terminal (1);	0.330970	0.35838	N	0.002949	T	0.69717	0.3142	M	0.82716	2.605	0.21878	N	0.999492	B	0.30793	0.295	P	0.44518	0.452	T	0.72033	-0.4412	10	0.72032	D	0.01	.	14.3182	0.66465	0.8386:0.0:0.1614:0.0	.	203	P12643	BMP2_HUMAN	M	203	ENSP00000368104:R203M	ENSP00000368104:R203M	R	+	2	0	BMP2	6707153	1.000000	0.71417	0.086000	0.20670	0.995000	0.86356	2.139000	0.42149	-0.453000	0.07076	0.650000	0.86243	AGG	.		0.493	BMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077918.3		
BPGM	669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	134346580	134346580	+	Silent	SNP	T	T	C			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr7:134346580T>C	ENST00000393132.2	+	3	810	c.321T>C	c.(319-321)caT>caC	p.H107H	BPGM_ENST00000344924.3_Silent_p.H107H|BPGM_ENST00000418040.1_Silent_p.H107H	NM_199186.2	NP_954655.1	P07738	PMGE_HUMAN	2,3-bisphosphoglycerate mutase	107					carbohydrate metabolic process (GO:0005975)|erythrocyte development (GO:0048821)|glycolytic process (GO:0006096)|respiratory gaseous exchange (GO:0007585)	extracellular vesicular exosome (GO:0070062)	bisphosphoglycerate 2-phosphatase activity (GO:0004083)|bisphosphoglycerate mutase activity (GO:0004082)|phosphoglycerate mutase activity (GO:0004619)			breast(1)|endometrium(1)|lung(2)|stomach(1)	5						CTTTGAATCATGGTGAAGAAC	0.512																																					p.H107H		.											.	BPGM	226	0			c.T321C						.						83.0	74.0	77.0					7																	134346580		2203	4300	6503	SO:0001819	synonymous_variant	669	exon3			GAATCATGGTGAA	BC017050	CCDS5833.1	7q33	2012-10-02			ENSG00000172331	ENSG00000172331	5.4.2.4		1093	protein-coding gene	gene with protein product		613896					Standard	NM_199186		Approved		uc003vrw.3	P07738	OTTHUMG00000155380	ENST00000393132.2:c.321T>C	7.37:g.134346580T>C		301.0	1.0		294.0	120.0	NM_199186	A4D1N9	Silent	SNP	ENST00000393132.2	37	CCDS5833.1																																																																																			.		0.512	BPGM-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339763.1	NM_001724	
ZNF436	80818	ucsc.edu;mdanderson.org	37	1	23698088	23698088	+	5'Flank	SNP	A	A	G			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr1:23698088A>G	ENST00000314011.4	-	0	0				C1orf213_ENST00000458053.1_3'UTR|Y_RNA_ENST00000364535.1_RNA|C1orf213_ENST00000437367.2_3'UTR|C1orf213_ENST00000454117.1_3'UTR|C1orf213_ENST00000335648.3_3'UTR	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		ccgtttggccagggtctccaa	0.458																																					.		.											.	C1orf213	68	0			.						.						83.0	67.0	72.0					1																	23698088		692	1591	2283	SO:0001631	upstream_gene_variant	148898	.			TTGGCCAGGGTCT	AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232		1.37:g.23698088A>G	Exception_encountered	101.0	0.0		90.0	24.0	.	Q658I9	RNA	SNP	ENST00000314011.4	37	CCDS233.1																																																																																			.		0.458	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008908.1	NM_030634	
CACNA1C	775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	2229596	2229596	+	Splice_Site	SNP	G	G	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr12:2229596G>T	ENST00000347598.4	+	3	477	c.477G>T	c.(475-477)ctG>ctT	p.L159L	CACNA1C_ENST00000399649.1_Splice_Site_p.L159L|CACNA1C_ENST00000399603.1_Splice_Site_p.L159L|CACNA1C_ENST00000327702.7_Splice_Site_p.L159L|CACNA1C_ENST00000402845.3_Splice_Site_p.L159L|CACNA1C_ENST00000399621.1_Splice_Site_p.L159L|CACNA1C_ENST00000480911.1_Splice_Site_p.L159L|CACNA1C_ENST00000406454.3_Splice_Site_p.L159L|CACNA1C_ENST00000335762.5_Splice_Site_p.L159L|CACNA1C_ENST00000399634.1_Splice_Site_p.L159L|CACNA1C_ENST00000399595.1_Splice_Site_p.L159L|CACNA1C_ENST00000399591.1_Splice_Site_p.L159L|CACNA1C_ENST00000399601.1_Splice_Site_p.L159L|CACNA1C_ENST00000344100.3_Splice_Site_p.L159L|CACNA1C_ENST00000399637.1_Splice_Site_p.L159L|CACNA1C_ENST00000399641.1_Splice_Site_p.L159L|CACNA1C_ENST00000399638.1_Splice_Site_p.L159L|CACNA1C_ENST00000399606.1_Splice_Site_p.L159L|CACNA1C_ENST00000399629.1_Splice_Site_p.L159L|CACNA1C_ENST00000399655.1_Splice_Site_p.L159L|CACNA1C_ENST00000399597.1_Splice_Site_p.L159L|CACNA1C_ENST00000399617.1_Splice_Site_p.L159L|CACNA1C_ENST00000399644.1_Splice_Site_p.L159L	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	159					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ATTCCAACCTGGTAAGTCCAC	0.423																																					p.L159L		.											.	CACNA1C	34	0			c.G477T						.						139.0	140.0	139.0					12																	2229596		2055	4222	6277	SO:0001630	splice_region_variant	775	exon3			CAACCTGGTAAGT	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.477+1G>T	12.37:g.2229596G>T		224.0	1.0		101.0	86.0	NM_001129831	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	ENST00000347598.4	37	CCDS44788.1																																																																																			.		0.423	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	Silent
CCDC71	64925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49200783	49200783	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr3:49200783G>C	ENST00000321895.6	-	2	965	c.859C>G	c.(859-861)Cga>Gga	p.R287G		NM_022903.3	NP_075054.3	Q8IV32	CCD71_HUMAN	coiled-coil domain containing 71	287										endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)	10				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GCCAGTGTTCGAGCTACCTTG	0.632																																					p.R287G		.											.	CCDC71	91	0			c.C859G						.						54.0	51.0	52.0					3																	49200783		2203	4300	6503	SO:0001583	missense	64925	exon2			GTGTTCGAGCTAC	AK022862	CCDS2790.1	3p21.31	2014-02-12			ENSG00000177352	ENSG00000177352			25760	protein-coding gene	gene with protein product						12477932	Standard	NM_022903		Approved	FLJ12800	uc003cwg.4	Q8IV32	OTTHUMG00000156815	ENST00000321895.6:c.859C>G	3.37:g.49200783G>C	ENSP00000319006:p.Arg287Gly	34.0	0.0		23.0	12.0	NM_022903	Q6IPE2|Q9H8H4|Q9H9F1	Missense_Mutation	SNP	ENST00000321895.6	37	CCDS2790.1	.	.	.	.	.	.	.	.	.	.	G	2.713	-0.268423	0.05716	.	.	ENSG00000177352	ENST00000321895	T	0.32515	1.45	4.06	2.16	0.27623	.	1.271780	0.05558	N	0.568761	T	0.20455	0.0492	N	0.17474	0.49	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.27054	-1.0085	10	0.72032	D	0.01	-17.4736	5.7061	0.17909	0.1107:0.4019:0.4874:0.0	.	287	Q8IV32	CCD71_HUMAN	G	287	ENSP00000319006:R287G	ENSP00000319006:R287G	R	-	1	2	CCDC71	49175787	0.663000	0.27448	0.002000	0.10522	0.168000	0.22595	0.722000	0.25925	0.617000	0.30160	0.491000	0.48974	CGA	.		0.632	CCDC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345980.1	NM_022903	
CCDC74B	91409	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	130898811	130898811	+	Silent	SNP	G	G	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr2:130898811G>T	ENST00000310463.6	-	4	740	c.603C>A	c.(601-603)ccC>ccA	p.P201P	CCDC74B_ENST00000392984.3_Silent_p.P303P|CCDC74B_ENST00000409943.3_Silent_p.P135P|CCDC74B_ENST00000409128.1_Silent_p.P177P|MED15P9_ENST00000427638.1_RNA	NM_207310.2	NP_997193.1	Q96LY2	CC74B_HUMAN	coiled-coil domain containing 74B	201								p.P201P(1)		endometrium(2)|large_intestine(1)|lung(3)	6	Colorectal(110;0.1)					CCGCCTTCTGGGGGACGTCAG	0.592																																					p.P201P		.											.	CCDC74B	90	1	Substitution - coding silent(1)	endometrium(1)	c.C603A						.						163.0	115.0	131.0					2																	130898811		2203	4276	6479	SO:0001819	synonymous_variant	91409	exon4			CTTCTGGGGGACG		CCDS2155.1, CCDS58726.1	2q21.1	2006-11-29		2006-02-16	ENSG00000152076	ENSG00000152076			25267	protein-coding gene	gene with protein product							Standard	NM_001258307		Approved	DKFZp434E2321	uc002tqn.2	Q96LY2	OTTHUMG00000131629	ENST00000310463.6:c.603C>A	2.37:g.130898811G>T		230.0	1.0		158.0	75.0	NM_207310	Q6NW18	Silent	SNP	ENST00000310463.6	37	CCDS2155.1																																																																																			.		0.592	CCDC74B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254522.3	NM_207310	
CELSR2	1952	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	109814047	109814047	+	Silent	SNP	G	G	A			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr1:109814047G>A	ENST00000271332.3	+	27	7777	c.7716G>A	c.(7714-7716)ctG>ctA	p.L2572L	CELSR2_ENST00000498157.1_3'UTR	NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2572					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		TCCTGCTGCTGAGCGCCACGT	0.632																																					p.L2572L	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2	526	0			c.G7716A						.						97.0	82.0	87.0					1																	109814047		2203	4300	6503	SO:0001819	synonymous_variant	1952	exon27			GCTGCTGAGCGCC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.7716G>A	1.37:g.109814047G>A		179.0	0.0		154.0	75.0	NM_001408	Q5T2Y7|Q92566	Silent	SNP	ENST00000271332.3	37	CCDS796.1																																																																																			.		0.632	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
CHD6	84181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	40045242	40045242	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr20:40045242C>T	ENST00000373233.3	-	33	6649	c.6472G>A	c.(6472-6474)Gcc>Acc	p.A2158T	CHD6_ENST00000480022.1_5'Flank	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2158					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TGGATCTGGGCCGCCAATGCT	0.547																																					p.A2158T		.											.	CHD6	238	0			c.G6472A						.						97.0	86.0	90.0					20																	40045242		2203	4300	6503	SO:0001583	missense	84181	exon33			TCTGGGCCGCCAA	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.6472G>A	20.37:g.40045242C>T	ENSP00000362330:p.Ala2158Thr	89.0	0.0		64.0	20.0	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	37	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	C	4.346	0.063610	0.08388	.	.	ENSG00000124177	ENST00000373233	D	0.85861	-2.04	5.46	2.27	0.28462	.	0.209320	0.34002	N	0.004356	T	0.63803	0.2542	N	0.12569	0.235	0.30644	N	0.75615	B	0.09022	0.002	B	0.04013	0.001	T	0.49560	-0.8927	10	0.10636	T	0.68	-8.2947	2.7837	0.05368	0.3849:0.3722:0.1255:0.1174	.	2158	Q8TD26	CHD6_HUMAN	T	2158	ENSP00000362330:A2158T	ENSP00000362330:A2158T	A	-	1	0	CHD6	39478656	0.031000	0.19500	0.931000	0.37212	0.070000	0.16714	0.244000	0.18124	0.694000	0.31654	0.655000	0.94253	GCC	.		0.547	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
COL11A1	1301	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	103480065	103480065	+	Splice_Site	SNP	A	A	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr1:103480065A>T	ENST00000370096.3	-	13	1885		c.e13+1		COL11A1_ENST00000512756.1_Splice_Site|COL11A1_ENST00000358392.2_Splice_Site|COL11A1_ENST00000353414.4_Splice_Site	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1						cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		ATCCTGTCTTACCCGAGCCTG	0.418																																					.		.											.	COL11A1	586	0			c.1455+2T>A						.						99.0	83.0	89.0					1																	103480065		2203	4300	6503	SO:0001630	splice_region_variant	1301	exon13			TGTCTTACCCGAG	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1572+1T>A	1.37:g.103480065A>T		181.0	1.0		151.0	65.0	NM_001190709	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Splice_Site	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.391427	0.83011	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7579	0.78051	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL11A1	103252653	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.466000	0.73543	2.117000	0.64856	0.533000	0.62120	.	.		0.418	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	Intron
CTNNB1	1499	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	41274853	41274853	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr3:41274853T>A	ENST00000349496.5	+	8	1383	c.1103T>A	c.(1102-1104)cTt>cAt	p.L368H	CTNNB1_ENST00000405570.1_Missense_Mutation_p.L368H|CTNNB1_ENST00000396183.3_Missense_Mutation_p.L368H|CTNNB1_ENST00000396185.3_Missense_Mutation_p.L368H|CTNNB1_ENST00000453024.1_Missense_Mutation_p.L361H	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	368					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GCTTTAGGACTTCACCTGACA	0.388		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.L368H	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1	24361	0			c.T1103A						.						102.0	91.0	95.0					3																	41274853		2203	4300	6503	SO:0001583	missense	1499	exon8	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TAGGACTTCACCT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1103T>A	3.37:g.41274853T>A	ENSP00000344456:p.Leu368His	200.0	1.0		191.0	92.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	15.65	2.896728	0.52121	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32;-0.32	5.72	5.72	0.89469	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.60287	0.2257	L	0.40543	1.245	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.12837	0.005;0.008	T	0.56007	-0.8050	10	0.45353	T	0.12	-7.6049	15.9983	0.80268	0.0:0.0:0.0:1.0	.	296;368	B4DSW9;P35222	.;CTNB1_HUMAN	H	368;368;368;361;368	ENSP00000385604:L368H;ENSP00000379486:L368H;ENSP00000344456:L368H;ENSP00000411226:L361H;ENSP00000379488:L368H	ENSP00000344456:L368H	L	+	2	0	CTNNB1	41249857	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.295000	0.72744	2.171000	0.68590	0.533000	0.62120	CTT	.		0.388	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
DCLK1	9201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	36700222	36700222	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr13:36700222G>A	ENST00000360631.3	-	2	264	c.53C>T	c.(52-54)gCg>gTg	p.A18V	DCLK1_ENST00000255448.4_Missense_Mutation_p.A18V|DCLK1_ENST00000379892.4_Missense_Mutation_p.A18V			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	18					axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		GTATCTCTGCGCCTTATCCCG	0.622																																					p.A18V		.											.	DCLK1	826	0			c.C53T						.						61.0	62.0	62.0					13																	36700222		2203	4300	6503	SO:0001583	missense	9201	exon2			CTCTGCGCCTTAT	AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.53C>T	13.37:g.36700222G>A	ENSP00000353846:p.Ala18Val	69.0	0.0		22.0	21.0	NM_004734	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	ENST00000360631.3	37		.	.	.	.	.	.	.	.	.	.	G	15.01	2.706275	0.48412	.	.	ENSG00000133083	ENST00000255448;ENST00000360631;ENST00000539451;ENST00000379892	T;T;T	0.67523	-0.27;-0.27;1.88	5.67	5.67	0.87782	.	0.110579	0.64402	D	0.000012	T	0.56848	0.2013	N	0.22421	0.69	0.50632	D	0.999889	B	0.22346	0.068	B	0.18263	0.021	T	0.51379	-0.8713	10	0.44086	T	0.13	.	19.7802	0.96413	0.0:0.0:1.0:0.0	.	18	O15075-2	.	V	18	ENSP00000255448:A18V;ENSP00000353846:A18V;ENSP00000369222:A18V	ENSP00000255448:A18V	A	-	2	0	DCLK1	35598222	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.096000	0.64535	2.675000	0.91044	0.655000	0.94253	GCG	.		0.622	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	
EMC7	56851	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	34393819	34393819	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr15:34393819G>C	ENST00000256545.4	-	1	330	c.222C>G	c.(220-222)caC>caG	p.H74Q	EMC7_ENST00000532113.1_5'UTR|PGBD4_ENST00000397766.2_5'Flank	NM_020154.2	NP_064539.1	Q9NPA0	EMC7_HUMAN	ER membrane protein complex subunit 7	74						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)										GGAAACCGACGTGCTCTTCTC	0.597																																					p.H74Q		.											.	.	.	0			c.C222G						.						109.0	102.0	105.0					15																	34393819		2201	4298	6499	SO:0001583	missense	56851	exon1			ACCGACGTGCTCT	AJ245874	CCDS10032.1	15q14	2012-05-30	2012-05-30	2012-05-30	ENSG00000134153	ENSG00000134153			24301	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 24"""	C15orf24		10873569, 22119785	Standard	NM_020154		Approved	C11orf3	uc001zhm.3	Q9NPA0	OTTHUMG00000129367	ENST00000256545.4:c.222C>G	15.37:g.34393819G>C	ENSP00000256545:p.His74Gln	145.0	0.0		89.0	15.0	NM_020154	B2RC00|Q96ED5	Missense_Mutation	SNP	ENST00000256545.4	37	CCDS10032.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.24|18.24	3.580800|3.580800	0.65992|0.65992	.|.	.|.	ENSG00000134153|ENSG00000134153	ENST00000256545|ENST00000527822	.|.	.|.	.|.	5.27|5.27	1.24|1.24	0.21308|0.21308	Carbohydrate-binding-like fold (1);Domain of unknown function DUF2012 (1);Carboxypeptidase, regulatory domain (1);|.	0.053340|.	0.85682|.	D|.	0.000000|.	T|T	0.41328|0.41328	0.1154|0.1154	L|L	0.28344|0.28344	0.845|0.845	0.41724|0.41724	D|D	0.989523|0.989523	B|.	0.24483|.	0.104|.	B|.	0.24006|.	0.05|.	T|T	0.11991|0.11991	-1.0565|-1.0565	9|5	0.30854|.	T|.	0.27|.	-9.7839|-9.7839	8.464|8.464	0.32944|0.32944	0.3222:0.0:0.6778:0.0|0.3222:0.0:0.6778:0.0	.|.	74|.	Q9NPA0|.	CO024_HUMAN|.	Q|G	74|64	.|.	ENSP00000256545:H74Q|.	H|R	-|-	3|1	2|0	C15orf24|C15orf24	32181111|32181111	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	0.402000|0.402000	0.20965|0.20965	0.367000|0.367000	0.24454|0.24454	0.585000|0.585000	0.79938|0.79938	CAC|CGT	.		0.597	EMC7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251519.1	NM_020154	
EPB41L3	23136	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	5428441	5428441	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr18:5428441C>G	ENST00000341928.2	-	9	1276	c.936G>C	c.(934-936)atG>atC	p.M312I	EPB41L3_ENST00000540638.2_Missense_Mutation_p.M312I|EPB41L3_ENST00000544123.1_Missense_Mutation_p.M312I|EPB41L3_ENST00000342933.3_Missense_Mutation_p.M312I|EPB41L3_ENST00000400111.3_Missense_Mutation_p.M312I|EPB41L3_ENST00000542652.2_5'UTR	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	312	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						AAACTCCTAACATAATTTCTA	0.388																																					p.M312I		.											.	EPB41L3	95	0			c.G936C						.						118.0	127.0	124.0					18																	5428441		2203	4300	6503	SO:0001583	missense	23136	exon9			TCCTAACATAATT	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.936G>C	18.37:g.5428441C>G	ENSP00000343158:p.Met312Ile	94.0	0.0		79.0	35.0	NM_012307	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	37	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	C	17.23	3.337402	0.60963	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000342933;ENST00000400111	D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1	5.31	5.31	0.75309	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.90967	0.7160	L	0.48362	1.52	0.80722	D	1	P;P;P;B;P	0.48911	0.692;0.681;0.917;0.022;0.726	P;B;D;B;P	0.63488	0.633;0.389;0.915;0.027;0.694	D	0.89652	0.3870	10	0.36615	T	0.2	.	18.973	0.92722	0.0:1.0:0.0:0.0	.	312;312;203;312;312	F5GX05;Q9Y2J2-3;A8K968;Q9Y2J2-2;Q9Y2J2	.;.;.;.;E41L3_HUMAN	I	312;203;312;203;312;312	ENSP00000343158:M312I;ENSP00000441174:M312I;ENSP00000341138:M312I;ENSP00000382981:M312I	ENSP00000343158:M312I	M	-	3	0	EPB41L3	5418441	1.000000	0.71417	0.997000	0.53966	0.827000	0.46813	6.029000	0.70895	2.455000	0.83008	0.655000	0.94253	ATG	.		0.388	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
EPHA6	285220	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	97194245	97194245	+	Silent	SNP	C	C	T	rs372907476		TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr3:97194245C>T	ENST00000514100.1	+	5	362	c.120C>T	c.(118-120)gcC>gcT	p.A40A	EPHA6_ENST00000502694.1_Silent_p.A40A|EPHA6_ENST00000442602.2_Silent_p.A14A|EPHA6_ENST00000389672.5_Silent_p.A648A	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	554	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						TAGCCACCGCCGCTGTTGGCG	0.418																																					p.A648A		.											.	EPHA6	1561	0			c.C1944T						.	C	,	1,3819		0,1,1909	78.0	81.0	80.0		1944,120	-12.1	0.0	3		80	0,8252		0,0,4126	no	coding-synonymous,coding-synonymous	EPHA6	NM_001080448.2,NM_173655.2	,	0,1,6035	TT,TC,CC		0.0,0.0262,0.0083	,	648/1131,40/335	97194245	1,12071	1910	4126	6036	SO:0001819	synonymous_variant	285220	exon8			CACCGCCGCTGTT	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.120C>T	3.37:g.97194245C>T		89.0	0.0		83.0	14.0	NM_001080448	D6RAL5	Silent	SNP	ENST00000514100.1	37																																																																																				.		0.418	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000359997.1	NM_001080448	
FAM205B	389715	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	34837695	34837695	+	RNA	SNP	C	C	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr9:34837695C>T	ENST00000455647.2	-	0	238							Q63HN1	F205B_HUMAN	family with sequence similarity 205, member B																		TTTTTGGTGACGCTTAAAAGA	0.408																																					.		.											.	.	.	0			.						.																																					389715	.			TGGTGACGCTTAA			9p13.3	2013-05-22	2011-08-15	2011-08-15	ENSG00000257198	ENSG00000257198			24504	other	unknown			"""chromosome 9 open reading frame 144"""	C9orf144			Standard	NR_024481		Approved	DKFZp434J193, C9orf144A	uc003zvp.4	Q63HN1	OTTHUMG00000019839		9.37:g.34837695C>T		172.0	1.0		135.0	76.0	.	Q6ZRJ7	RNA	SNP	ENST00000455647.2	37		.	.	.	.	.	.	.	.	.	.	C	12.20	1.865425	0.32977	.	.	ENSG00000215204	ENST00000399773	.	.	.	3.69	-0.737	0.11129	.	.	.	.	.	T	0.32763	0.0840	.	.	.	0.22066	N	0.999386	.	.	.	.	.	.	T	0.30621	-0.9972	5	0.35671	T	0.21	.	6.6589	0.23002	0.0:0.4675:0.0:0.5325	.	.	.	.	H	49	.	ENSP00000382673:R49H	R	-	2	0	C9orf144	34827695	0.959000	0.32827	0.475000	0.27278	0.052000	0.14988	0.754000	0.26390	-0.276000	0.09206	-1.069000	0.02264	CGT	.		0.408	FAM205B-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000052246.5	NR_024481	
FAT2	2196	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	150948080	150948080	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr5:150948080A>C	ENST00000261800.5	-	1	425	c.413T>G	c.(412-414)aTc>aGc	p.I138S		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	138	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTGGTCCAGGATGTGGACCAC	0.542																																					p.I138S		.											.	FAT2	96	0			c.T413G						.						118.0	110.0	113.0					5																	150948080		2203	4300	6503	SO:0001583	missense	2196	exon1			TCCAGGATGTGGA	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.413T>G	5.37:g.150948080A>C	ENSP00000261800:p.Ile138Ser	296.0	2.0		218.0	99.0	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.126926	0.77549	.	.	ENSG00000086570	ENST00000261800	T	0.65364	-0.15	5.45	5.45	0.79879	Cadherin (3);Cadherin-like (1);	0.171181	0.41194	D	0.000930	T	0.81592	0.4855	M	0.90650	3.135	0.54753	D	0.999984	D	0.76494	0.999	D	0.63488	0.915	D	0.85997	0.1492	10	0.87932	D	0	.	15.5309	0.75960	1.0:0.0:0.0:0.0	.	138	Q9NYQ8	FAT2_HUMAN	S	138	ENSP00000261800:I138S	ENSP00000261800:I138S	I	-	2	0	FAT2	150928273	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.262000	0.95591	2.065000	0.61736	0.454000	0.30748	ATC	.		0.542	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
FLNB	2317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	58107094	58107094	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr3:58107094C>G	ENST00000295956.4	+	20	3155	c.2990C>G	c.(2989-2991)aCa>aGa	p.T997R	FLNB_ENST00000490882.1_Missense_Mutation_p.T997R|FLNB_ENST00000493452.1_Missense_Mutation_p.T828R|FLNB_ENST00000419752.2_Missense_Mutation_p.T828R|FLNB_ENST00000357272.4_Missense_Mutation_p.T997R|FLNB_ENST00000348383.5_Missense_Mutation_p.T997R|FLNB_ENST00000429972.2_Missense_Mutation_p.T997R|FLNB_ENST00000358537.3_Missense_Mutation_p.T997R	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	997					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		ACACCTGTGACAGGCCGGGAG	0.627																																					p.T997R		.											.	FLNB	593	0			c.C2990G						.						121.0	103.0	109.0					3																	58107094		2203	4300	6503	SO:0001583	missense	2317	exon20			CTGTGACAGGCCG	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.2990C>G	3.37:g.58107094C>G	ENSP00000295956:p.Thr997Arg	153.0	0.0		103.0	52.0	NM_001457	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	ENST00000295956.4	37	CCDS2885.1	.	.	.	.	.	.	.	.	.	.	C	8.977	0.974338	0.18736	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	T;T;T;T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05	5.99	3.26	0.37387	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.728589	0.13697	N	0.369101	T	0.20577	0.0495	N	0.04203	-0.255	0.09310	N	1	B;B;B;B;B;B	0.21147	0.042;0.03;0.052;0.002;0.052;0.052	B;B;B;B;B;B	0.28784	0.056;0.034;0.094;0.02;0.094;0.094	T	0.29971	-0.9994	10	0.16420	T	0.52	.	8.1735	0.31268	0.0:0.666:0.0:0.334	.	997;997;828;828;997;997	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	R	997;997;997;997;997;997;828;828	ENSP00000295956:T997R;ENSP00000420213:T997R;ENSP00000351339:T997R;ENSP00000415599:T997R;ENSP00000232447:T997R;ENSP00000349819:T997R;ENSP00000418510:T828R;ENSP00000414532:T828R	ENSP00000295956:T997R	T	+	2	0	FLNB	58082134	0.000000	0.05858	0.001000	0.08648	0.879000	0.50718	0.205000	0.17356	0.877000	0.35895	0.655000	0.94253	ACA	.		0.627	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	
FLT4	2324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	180048543	180048543	+	Splice_Site	SNP	C	C	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr5:180048543C>T	ENST00000261937.6	-	13	2097	c.2019G>A	c.(2017-2019)caG>caA	p.Q673Q	FLT4_ENST00000393347.3_Splice_Site_p.Q673Q|FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000502649.1_Splice_Site_p.Q673Q	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	673					blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CAGCCTCACCCTGCACCGACA	0.672																																					p.Q673Q	Colon(97;1075 1466 27033 27547 35871)	.											.	FLT4	1490	0			c.G2019A						.						32.0	33.0	33.0					5																	180048543		2196	4292	6488	SO:0001630	splice_region_variant	2324	exon13			CTCACCCTGCACC	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2020+1G>A	5.37:g.180048543C>T		164.0	0.0		59.0	18.0	NM_182925	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Silent	SNP	ENST00000261937.6	37	CCDS4457.1																																																																																			.		0.672	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		Silent
FYN	2534	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	111982951	111982951	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr6:111982951T>G	ENST00000354650.3	-	14	2211	c.1605A>C	c.(1603-1605)gaA>gaC	p.E535D	FYN_ENST00000538466.1_Missense_Mutation_p.E532D|FYN_ENST00000368667.2_Missense_Mutation_p.E535D|FYN_ENST00000229471.4_Missense_Mutation_p.E480D|FYN_ENST00000368682.3_Missense_Mutation_p.E532D|FYN_ENST00000229470.5_Missense_Mutation_p.E483D|FYN_ENST00000356013.2_Missense_Mutation_p.E480D|FYN_ENST00000368678.4_Missense_Mutation_p.E532D	NM_002037.5	NP_002028.1	P06241	FYN_HUMAN	FYN proto-oncogene, Src family tyrosine kinase	535					activated T cell proliferation (GO:0050798)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular response to peptide hormone stimulus (GO:0071375)|dendrite morphogenesis (GO:0048813)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|feeding behavior (GO:0007631)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|leukocyte migration (GO:0050900)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein localization to nucleus (GO:1900182)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of defense response to virus by virus (GO:0050690)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|glycoprotein binding (GO:0001948)|growth factor receptor binding (GO:0070851)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(17)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	30		all_cancers(87;1.37e-05)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00125)|Colorectal(196;0.0211)		all cancers(137;0.0451)|OV - Ovarian serous cystadenocarcinoma(136;0.0476)|Epithelial(106;0.102)	Dasatinib(DB01254)	CTTACAGGTTTTCACCAGGTT	0.577																																					p.E535D		.											.	FYN	1000	0			c.A1605C						.						80.0	87.0	85.0					6																	111982951		2203	4300	6503	SO:0001583	missense	2534	exon14			CAGGTTTTCACCA	AK056699	CCDS5094.1, CCDS5095.1, CCDS5096.1	6q21	2014-06-25	2014-06-25		ENSG00000010810	ENSG00000010810		"""SH2 domain containing"""	4037	protein-coding gene	gene with protein product		137025	"""FYN oncogene related to SRC, FGR, YES"""			3526330	Standard	NM_002037		Approved	SYN, SLK, MGC45350	uc003pvh.3	P06241	OTTHUMG00000016305	ENST00000354650.3:c.1605A>C	6.37:g.111982951T>G	ENSP00000346671:p.Glu535Asp	72.0	1.0		33.0	32.0	NM_002037	B5BU57|E1P557|H0UI48|Q16248|Q5R3A6|Q5R3A7|Q8N5D7	Missense_Mutation	SNP	ENST00000354650.3	37	CCDS5094.1	.	.	.	.	.	.	.	.	.	.	T	0.470	-0.884955	0.02511	.	.	ENSG00000010810	ENST00000368682;ENST00000354650;ENST00000229471;ENST00000368667;ENST00000368678;ENST00000229470;ENST00000356013;ENST00000538466;ENST00000544792	T;T;T;T;T;T;T;T	0.74842	-0.87;-0.79;-0.88;-0.79;-0.87;-0.88;-0.88;-0.87	5.81	-2.22	0.06952	Protein kinase-like domain (1);	0.056291	0.64402	D	0.000003	T	0.21550	0.0519	N	0.05383	-0.06	0.36039	D	0.839958	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.27400	-1.0075	10	0.02654	T	1	.	8.7562	0.34648	0.0:0.4264:0.185:0.3886	.	535;480;532	P06241;P06241-3;E1P556	FYN_HUMAN;.;.	D	532;535;480;535;532;483;480;532;483	ENSP00000357671:E532D;ENSP00000346671:E535D;ENSP00000229471:E480D;ENSP00000357656:E535D;ENSP00000357667:E532D;ENSP00000229470:E483D;ENSP00000348295:E480D;ENSP00000440646:E532D	ENSP00000229470:E483D	E	-	3	2	FYN	112089644	0.999000	0.42202	0.927000	0.36925	0.829000	0.46940	0.439000	0.21575	-0.319000	0.08652	-0.379000	0.06801	GAA	.		0.577	FYN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043655.1		
HDAC9	9734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	18869095	18869095	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr7:18869095T>A	ENST00000432645.2	+	18	2381	c.2381T>A	c.(2380-2382)tTt>tAt	p.F794Y	HDAC9_ENST00000401921.1_Missense_Mutation_p.F753Y|HDAC9_ENST00000406451.4_Missense_Mutation_p.F794Y|HDAC9_ENST00000441542.2_Missense_Mutation_p.F797Y	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	794	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	GGGTTCTGCTTTTTTAATTCA	0.358																																					p.F797Y		.											.	HDAC9	227	0			c.T2390A						.						91.0	85.0	87.0					7																	18869095		1816	4085	5901	SO:0001583	missense	9734	exon18			TCTGCTTTTTTAA	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.2381T>A	7.37:g.18869095T>A	ENSP00000410337:p.Phe794Tyr	70.0	0.0		67.0	15.0	NM_178425	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	37	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	T	8.375	0.836301	0.16891	.	.	ENSG00000048052	ENST00000406451;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000341009	T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43	5.31	5.31	0.75309	Histone deacetylase domain (2);	0.000000	0.64402	D	0.000004	T	0.56124	0.1964	L	0.38649	1.16	0.80722	D	1	B;B;B;B;B;B	0.18166	0.002;0.025;0.021;0.021;0.026;0.021	B;B;B;B;B;B	0.25759	0.014;0.063;0.018;0.018;0.03;0.018	T	0.52139	-0.8615	10	0.27785	T	0.31	-48.3102	11.3354	0.49500	0.136:0.0:0.0:0.864	.	794;42;753;797;794;794	Q9UKV0-4;Q8N926;Q9UKV0-6;Q9UKV0-7;Q9UKV0;Q9UKV0-5	.;.;.;.;HDAC9_HUMAN;.	Y	794;753;794;797;706	ENSP00000384657:F794Y;ENSP00000383912:F753Y;ENSP00000410337:F794Y;ENSP00000408617:F797Y	ENSP00000339165:F706Y	F	+	2	0	HDAC9	18835620	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.525000	0.45598	2.129000	0.65627	0.528000	0.53228	TTT	.		0.358	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1		
GLI3	2737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	42004352	42004352	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr7:42004352G>T	ENST00000395925.3	-	15	4403	c.4319C>A	c.(4318-4320)tCt>tAt	p.S1440Y	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	1440					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GAACTGACCAGAGTAATTCTG	0.522									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.S1440Y		.											.	GLI3	1149	0			c.C4319A						.						64.0	66.0	65.0					7																	42004352		2203	4300	6503	SO:0001583	missense	2737	exon15	Familial Cancer Database	;	TGACCAGAGTAAT		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.4319C>A	7.37:g.42004352G>T	ENSP00000379258:p.Ser1440Tyr	222.0	0.0		196.0	88.0	NM_000168	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	G	19.30	3.801593	0.70682	.	.	ENSG00000106571	ENST00000395925	T	0.14766	2.48	5.62	5.62	0.85841	.	0.112923	0.64402	D	0.000007	T	0.34395	0.0896	L	0.52011	1.625	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.00619	-1.1641	10	0.41790	T	0.15	.	19.6632	0.95882	0.0:0.0:1.0:0.0	.	1440	P10071	GLI3_HUMAN	Y	1440	ENSP00000379258:S1440Y	ENSP00000379258:S1440Y	S	-	2	0	GLI3	41970877	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.442000	0.66575	2.625000	0.88918	0.655000	0.94253	TCT	.		0.522	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
HSP90AB1	3326	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	44219604	44219604	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr6:44219604delC	ENST00000371554.1	+	9	1659	c.1445delC	c.(1444-1446)tccfs	p.S482fs	SLC35B2_ENST00000495706.1_5'Flank|HSP90AB1_ENST00000371646.5_Frame_Shift_Del_p.S482fs|MIR4647_ENST00000583964.1_RNA|HSP90AB1_ENST00000353801.3_Frame_Shift_Del_p.S482fs			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	482					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			ACACAGAAGTCCATCTATTAC	0.502																																					p.S482fs		.											.	HSP90AB1	658	0			c.1445delC						.						126.0	124.0	125.0					6																	44219604		2203	4300	6503	SO:0001589	frameshift_variant	3326	exon9			AGAAGTCCATCTA	AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.1445delC	6.37:g.44219604delC	ENSP00000360609:p.Ser482fs	160.0	0.0		46.0	30.0	NM_007355	B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Frame_Shift_Del	DEL	ENST00000371554.1	37	CCDS4909.1																																																																																			.		0.502	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040730.1	NM_007355	
ITSN2	50618	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	24509193	24509193	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr2:24509193T>G	ENST00000355123.4	-	16	2194	c.1751A>C	c.(1750-1752)aAa>aCa	p.K584T	ITSN2_ENST00000361999.3_Missense_Mutation_p.K584T|ITSN2_ENST00000406921.3_Missense_Mutation_p.K584T	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	584					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCTAATGATTTTTTATGAAG	0.328																																					p.K584T		.											.	ITSN2	539	0			c.A1751C						.						79.0	81.0	80.0					2																	24509193		2202	4297	6499	SO:0001583	missense	50618	exon16			AATGATTTTTTAT	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.1751A>C	2.37:g.24509193T>G	ENSP00000347244:p.Lys584Thr	157.0	2.0		269.0	27.0	NM_147152	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	ENST00000355123.4	37	CCDS1710.2	.	.	.	.	.	.	.	.	.	.	T	17.50	3.405402	0.62288	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868;ENST00000445614;ENST00000406921;ENST00000412011	T;T;T;T;T	0.59502	0.26;0.26;0.26;0.71;0.78	5.33	5.33	0.75918	.	0.000000	0.36519	U	0.002552	T	0.71178	0.3309	L	0.56769	1.78	0.41861	D	0.990227	D;D;D;D	0.76494	0.999;0.999;0.999;0.998	D;D;D;D	0.80764	0.994;0.994;0.994;0.987	T	0.71062	-0.4701	10	0.39692	T	0.17	.	14.1859	0.65605	0.0:0.0:0.0:1.0	.	584;584;584;584	Q9NZM3-4;Q9NZM3-3;Q9NZM3-2;Q9NZM3	.;.;.;ITSN2_HUMAN	T	584;584;584;608;584;609	ENSP00000354561:K584T;ENSP00000347244:K584T;ENSP00000370250:K584T;ENSP00000384499:K584T;ENSP00000391224:K609T	ENSP00000347244:K584T	K	-	2	0	ITSN2	24362697	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.694000	0.37752	2.151000	0.67156	0.383000	0.25322	AAA	.		0.328	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	NM_006277	
ITGB6	3694	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	161055767	161055767	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr2:161055767C>T	ENST00000283249.2	-	2	301	c.64G>A	c.(64-66)Ggc>Agc	p.G22S	ITGB6_ENST00000485635.1_Intron|ITGB6_ENST00000409872.1_Missense_Mutation_p.G22S|ITGB6_ENST00000409967.2_Missense_Mutation_p.G22S|ITGB6_ENST00000428609.2_Intron	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	22					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						AGGGCACAGCCACCTAGGTTT	0.458																																					p.G22S		.											.	ITGB6	227	0			c.G64A						.						73.0	71.0	72.0					2																	161055767		2203	4300	6503	SO:0001583	missense	3694	exon2			CACAGCCACCTAG		CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.64G>A	2.37:g.161055767C>T	ENSP00000283249:p.Gly22Ser	587.0	1.0		474.0	92.0	NM_000888	B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Missense_Mutation	SNP	ENST00000283249.2	37	CCDS2212.1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.819480	0.50633	.	.	ENSG00000115221	ENST00000283249;ENST00000409967;ENST00000409872	D;D;D	0.84370	-1.84;-1.84;-1.84	5.68	4.7	0.59300	.	0.291814	0.35903	N	0.002902	T	0.49541	0.1563	N	0.00382	-1.575	0.32350	N	0.558545	B	0.02656	0.0	B	0.04013	0.001	T	0.57189	-0.7854	10	0.09843	T	0.71	.	3.7443	0.08542	0.0:0.6614:0.0:0.3386	.	22	P18564	ITB6_HUMAN	S	22	ENSP00000283249:G22S;ENSP00000386828:G22S;ENSP00000386367:G22S	ENSP00000283249:G22S	G	-	1	0	ITGB6	160764013	0.994000	0.37717	1.000000	0.80357	0.976000	0.68499	1.849000	0.39318	2.688000	0.91661	0.563000	0.77884	GGC	.		0.458	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255036.1	NM_000888	
KCNN1	3780	ucsc.edu;bcgsc.ca;mdanderson.org	37	19	18099244	18099244	+	Silent	SNP	C	C	T	rs377483438		TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr19:18099244C>T	ENST00000222249.9	+	7	1399	c.1080C>T	c.(1078-1080)ctC>ctT	p.L360L		NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	360					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	GTACCGCGCTCGTGGTGGCTG	0.622																																					p.L360L		.											.	KCNN1	22	0			c.C1080T						.	C		0,4406		0,0,2203	36.0	40.0	39.0		1080	-6.0	0.8	19		39	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	KCNN1	NM_002248.3		0,1,6501	TT,TC,CC		0.0116,0.0,0.0077		360/544	18099244	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	3780	exon7			CGCGCTCGTGGTG	U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.1080C>T	19.37:g.18099244C>T		137.0	1.0		59.0	23.0	NM_002248	Q5KR10|Q6DJU4	Silent	SNP	ENST00000222249.9	37																																																																																				.		0.622	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471896.2	NM_002248	
KDM3A	55818	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	86669229	86669229	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr2:86669229delT	ENST00000409556.1	+	3	424	c.59delT	c.(58-60)ctgfs	p.L20fs	KDM3A_ENST00000542128.1_Frame_Shift_Del_p.L20fs|KDM3A_ENST00000312912.5_Frame_Shift_Del_p.L20fs|KDM3A_ENST00000409064.1_Frame_Shift_Del_p.L20fs			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	20					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						TTTCTCAGTCTGTCCGCAGCC	0.632																																					p.L20fs	NSCLC(96;1150 1523 6936 46253 49736)	.											.	KDM3A	291	0			c.59delT						.						79.0	80.0	79.0					2																	86669229		2203	4300	6503	SO:0001589	frameshift_variant	55818	exon2			TCAGTCTGTCCGC	AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.59delT	2.37:g.86669229delT	ENSP00000386660:p.Leu20fs	160.0	0.0		92.0	58.0	NM_001146688	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Frame_Shift_Del	DEL	ENST00000409556.1	37	CCDS1990.1																																																																																			.		0.632	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252522.2	NM_018433	
KIR3DL2	3812	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55378066	55378066	+	Silent	SNP	G	G	A			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr19:55378066G>A	ENST00000326321.3	+	9	1281	c.1248G>A	c.(1246-1248)caG>caA	p.Q416Q	KIR3DL1_ENST00000402254.2_Silent_p.Q416Q|KIR3DL2_ENST00000270442.5_Silent_p.Q399Q|RNU6-222P_ENST00000362438.1_RNA	NM_006737.3	NP_006728.2	P43630	KI3L2_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2	416					cellular defense response (GO:0006968)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	23				GBM - Glioblastoma multiforme(193;0.0192)		GCCCTTCTCAGAGGCCCAAGA	0.527																																					p.Q416Q		.											.	KIR3DL2	92	0			c.G1248A						.						264.0	259.0	260.0					19																	55378066		2203	4300	6503	SO:0001819	synonymous_variant	3812	exon9			TTCTCAGAGGCCC	L41270	CCDS12906.1, CCDS58677.1	19q13.4	2014-05-22			ENSG00000240403	ENSG00000240403		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6339	protein-coding gene	gene with protein product		604947				7716543, 8662091	Standard	NM_006737		Approved	cl-5, nkat4, nkat4a, nkat4b, CD158K	uc002qho.4	P43630	OTTHUMG00000065935	ENST00000326321.3:c.1248G>A	19.37:g.55378066G>A		195.0	1.0		213.0	36.0	NM_006737	Q13238|Q14947|Q14948|Q92684|Q95366|Q95367|Q95368	Silent	SNP	ENST00000326321.3	37	CCDS12906.1																																																																																			.		0.527	KIR3DL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141241.1		
LCMT2	9836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	43622043	43622043	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr15:43622043G>C	ENST00000305641.5	-	1	760	c.645C>G	c.(643-645)ttC>ttG	p.F215L	LCMT2_ENST00000544735.1_Intron|ADAL_ENST00000422466.2_5'Flank|ADAL_ENST00000389651.4_5'Flank|LCMT2_ENST00000567039.1_Intron|ADAL_ENST00000428046.3_5'Flank	NM_014793.4	NP_055608.2	O60294	TYW4_HUMAN	leucine carboxyl methyltransferase 2	215					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(1)|urinary_tract(1)	20		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	CATAGACCACGAAAAGGGCAT	0.607																																					p.F215L		.											.	LCMT2	90	0			c.C645G						.						42.0	36.0	38.0					15																	43622043		2201	4299	6500	SO:0001583	missense	9836	exon1			GACCACGAAAAGG	AF265443	CCDS10094.1	15q15.3	2007-01-26			ENSG00000168806	ENSG00000168806			17558	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 4"""	611246				9628581, 17150819	Standard	NM_014793		Approved	KIAA0547, MGC9534, TYW4, PPM2	uc001zrg.3	O60294	OTTHUMG00000130705	ENST00000305641.5:c.645C>G	15.37:g.43622043G>C	ENSP00000307214:p.Phe215Leu	256.0	0.0		101.0	53.0	NM_014793	Q4JFT6|Q96B55|Q9NR10	Missense_Mutation	SNP	ENST00000305641.5	37	CCDS10094.1	.	.	.	.	.	.	.	.	.	.	G	17.03	3.283413	0.59867	.	.	ENSG00000168806	ENST00000305641	T	0.21734	1.99	5.39	3.5	0.40072	.	0.000000	0.85682	D	0.000000	T	0.15522	0.0374	L	0.46947	1.48	0.80722	D	1	P	0.48998	0.918	B	0.37480	0.251	T	0.03184	-1.1063	10	0.38643	T	0.18	-20.1703	8.3786	0.32457	0.1783:0.0:0.8217:0.0	.	215	O60294	LCMT2_HUMAN	L	215	ENSP00000307214:F215L	ENSP00000307214:F215L	F	-	3	2	LCMT2	41409335	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	0.579000	0.23788	0.817000	0.34445	0.655000	0.94253	TTC	.		0.607	LCMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253205.1	NM_014793	
NRROS	375387	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	196386948	196386948	+	Missense_Mutation	SNP	C	C	T	rs368543951		TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr3:196386948C>T	ENST00000328557.4	+	3	637	c.434C>T	c.(433-435)aCg>aTg	p.T145M		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	145					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											AACGCCCTGACGGAGGACATG	0.657																																					p.T145M		.											.	LRRC33	92	0			c.C434T						.	C	MET/THR	0,4406		0,0,2203	28.0	30.0	29.0		434	6.2	1.0	3		29	1,8599	1.2+/-3.3	0,1,4299	no	missense	LRRC33	NM_198565.1	81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	145/693	196386948	1,13005	2203	4300	6503	SO:0001583	missense	375387	exon3			CCCTGACGGAGGA	AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.434C>T	3.37:g.196386948C>T	ENSP00000328625:p.Thr145Met	97.0	1.0		43.0	7.0	NM_198565		Missense_Mutation	SNP	ENST00000328557.4	37	CCDS3319.1	.	.	.	.	.	.	.	.	.	.	C	17.50	3.405404	0.62288	0.0	1.16E-4	ENSG00000174004	ENST00000328557	T	0.01113	5.32	6.17	6.17	0.99709	.	0.292555	0.38381	N	0.001718	T	0.06690	0.0171	M	0.83118	2.625	0.80722	D	1	D	0.76494	0.999	D	0.63033	0.91	T	0.00115	-1.2038	10	0.87932	D	0	.	13.4429	0.61123	0.1239:0.7567:0.1194:0.0	.	145	Q86YC3	LRC33_HUMAN	M	145	ENSP00000328625:T145M	ENSP00000328625:T145M	T	+	2	0	LRRC33	197871345	0.768000	0.28519	0.990000	0.47175	0.909000	0.53808	1.506000	0.35747	2.941000	0.99782	0.655000	0.94253	ACG	.		0.657	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340676.1	NM_198565	
MYOF	26509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	95111015	95111015	+	Missense_Mutation	SNP	G	G	A	rs553662967		TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr10:95111015G>A	ENST00000359263.4	-	35	3859	c.3860C>T	c.(3859-3861)gCg>gTg	p.A1287V	MYOF_ENST00000371501.4_Missense_Mutation_p.A1287V|MYOF_ENST00000358334.5_Missense_Mutation_p.A1274V|MYOF_ENST00000371502.4_Missense_Mutation_p.A1287V	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	1287					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TAGATTTGGCGCCCTTTGAGG	0.498													G|||	1	0.000199681	0.0	0.0	5008	,	,		19560	0.0		0.0	False		,,,				2504	0.001				p.A1287V		.											.	MYOF	93	0			c.C3860T						.						59.0	59.0	59.0					10																	95111015		1939	4128	6067	SO:0001583	missense	26509	exon35			TTTGGCGCCCTTT	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.3860C>T	10.37:g.95111015G>A	ENSP00000352208:p.Ala1287Val	208.0	0.0		71.0	15.0	NM_013451	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	37	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	G	13.37	2.217516	0.39201	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	D;D;D;D	0.83419	-1.72;-1.71;-1.72;-1.7	6.17	3.07	0.35406	C2 calcium/lipid-binding domain, CaLB (1);	0.054833	0.64402	D	0.000001	T	0.73001	0.3531	L	0.42245	1.32	0.41689	D	0.98933	B;P	0.37500	0.358;0.597	B;B	0.28553	0.091;0.066	T	0.71686	-0.4518	10	0.40728	T	0.16	-18.6632	12.5276	0.56096	0.0:0.2381:0.6383:0.1235	.	1274;1287	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	V	1274;1287;1287;1287	ENSP00000351094:A1274V;ENSP00000352208:A1287V;ENSP00000360556:A1287V;ENSP00000360557:A1287V	ENSP00000351094:A1274V	A	-	2	0	MYOF	95101005	0.996000	0.38824	0.875000	0.34327	0.920000	0.55202	2.811000	0.47986	0.866000	0.35629	0.655000	0.94253	GCG	.		0.498	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451	
NLRP11	204801	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	56321586	56321586	+	Silent	SNP	G	G	A			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr19:56321586G>A	ENST00000589093.1	-	3	483	c.390C>T	c.(388-390)taC>taT	p.Y130Y	NLRP11_ENST00000360133.3_Silent_p.Y130Y|NLRP11_ENST00000589824.2_Silent_p.Y130Y|NLRP11_ENST00000443188.1_Silent_p.Y130Y|NLRP11_ENST00000592953.1_Silent_p.Y31Y			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	130							ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		ATTGAAGTATGTAGAACACAT	0.353																																					p.Y130Y		.											.	NLRP11	169	0			c.C390T						.						56.0	53.0	54.0					19																	56321586		2203	4300	6503	SO:0001819	synonymous_variant	204801	exon5			AAGTATGTAGAAC	AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.390C>T	19.37:g.56321586G>A		131.0	0.0		107.0	55.0	NM_145007	C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Silent	SNP	ENST00000589093.1	37	CCDS12935.1																																																																																			.		0.353	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1	NM_145007	
NUP133	55746	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	229586330	229586330	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr1:229586330C>T	ENST00000261396.3	-	23	3213	c.3122G>A	c.(3121-3123)aGa>aAa	p.R1041K	NUP133_ENST00000485119.1_5'UTR|NUP133_ENST00000537506.1_Missense_Mutation_p.R1025K	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	1041					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				ATTAGCTCTTCTATTTTCTTC	0.303																																					p.R1041K		.											.	NUP133	271	0			c.G3122A						.						64.0	67.0	66.0					1																	229586330		2200	4294	6494	SO:0001583	missense	55746	exon23			GCTCTTCTATTTT		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.3122G>A	1.37:g.229586330C>T	ENSP00000261396:p.Arg1041Lys	183.0	2.0		236.0	81.0	NM_018230	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Missense_Mutation	SNP	ENST00000261396.3	37	CCDS1579.1	.	.	.	.	.	.	.	.	.	.	C	7.612	0.674972	0.14841	.	.	ENSG00000069248	ENST00000366681;ENST00000261396;ENST00000366679;ENST00000537506	T;T;T	0.22539	1.95;1.95;1.95	6.06	4.1	0.47936	Nucleoporin, Nup133/Nup155-like, C-terminal (1);	0.181325	0.56097	N	0.000021	T	0.12178	0.0296	L	0.38838	1.175	0.43617	D	0.995995	B	0.09022	0.002	B	0.06405	0.002	T	0.08680	-1.0710	10	0.05833	T	0.94	-2.0152	6.199	0.20565	0.0:0.653:0.1379:0.2091	.	1041	Q8WUM0	NU133_HUMAN	K	970;1041;970;1025	ENSP00000261396:R1041K;ENSP00000355640:R970K;ENSP00000443496:R1025K	ENSP00000261396:R1041K	R	-	2	0	NUP133	227652953	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.059000	0.49947	1.568000	0.49683	0.650000	0.86243	AGA	.		0.303	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	
OMG	4974	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	29622317	29622317	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr17:29622317A>T	ENST00000247271.4	-	2	1294	c.1033T>A	c.(1033-1035)Tca>Aca	p.S345T	NF1_ENST00000358273.4_Intron|NF1_ENST00000356175.3_Intron	NM_002544.4	NP_002535.3	P23515	OMGP_HUMAN	oligodendrocyte myelin glycoprotein	345					cell adhesion (GO:0007155)|negative regulation of axonogenesis (GO:0050771)|neuron projection regeneration (GO:0031102)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|regulation of collateral sprouting of intact axon in response to injury (GO:0048683)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.0?(8)|p.?(3)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)|stomach(1)	13		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;1.81e-13)|Epithelial(4;4.04e-12)|OV - Ovarian serous cystadenocarcinoma(4;9.49e-12)|GBM - Glioblastoma multiforme(4;0.121)		GCTTCATGTGAATTGATAGTC	0.438																																					p.S345T		.											.	OMG	493	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	c.T1033A						.						367.0	329.0	342.0					17																	29622317		2203	4300	6503	SO:0001583	missense	4974	exon2			CATGTGAATTGAT		CCDS11265.1	17q11-q12	2008-07-18			ENSG00000126861	ENSG00000126861			8135	protein-coding gene	gene with protein product		164345				1899288, 2277079	Standard	NM_002544		Approved	OMGP	uc002hgj.3	P23515	OTTHUMG00000132870	ENST00000247271.4:c.1033T>A	17.37:g.29622317A>T	ENSP00000247271:p.Ser345Thr	170.0	0.0		136.0	42.0	NM_002544	E1P659	Missense_Mutation	SNP	ENST00000247271.4	37	CCDS11265.1	.	.	.	.	.	.	.	.	.	.	A	11.51	1.661015	0.29515	.	.	ENSG00000126861	ENST00000247271	T	0.71934	-0.61	5.41	3.16	0.36331	.	0.458819	0.18257	N	0.146767	T	0.48370	0.1496	N	0.19112	0.55	0.09310	N	0.999994	B	0.02656	0.0	B	0.01281	0.0	T	0.24440	-1.0160	10	0.22109	T	0.4	-0.0223	3.8006	0.08757	0.6622:0.1284:0.072:0.1374	.	345	P23515	OMGP_HUMAN	T	345	ENSP00000247271:S345T	ENSP00000247271:S345T	S	-	1	0	OMG	26646443	0.467000	0.25831	0.453000	0.27007	0.929000	0.56500	0.946000	0.29069	0.415000	0.25817	-0.438000	0.05819	TCA	.		0.438	OMG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256350.2	NM_002544	
OR9G1	390174	hgsc.bcm.edu;broad.mit.edu	37	11	56468748	56468748	+	Silent	SNP	T	T	C			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr11:56468748T>C	ENST00000312153.1	+	1	885	c.885T>C	c.(883-885)gaT>gaC	p.D295D		NM_001005213.1	NP_001005213.1	Q8NH87	OR9G1_HUMAN	olfactory receptor, family 9, subfamily G, member 1	295						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|lung(25)|stomach(2)|upper_aerodigestive_tract(1)	31						GGAATAAGGATGTGAAAGAGG	0.368																																					p.D295D		.											.	.	.	0			c.T885C						.						99.0	105.0	103.0					11																	56468748		2201	4296	6497	SO:0001819	synonymous_variant	504191	exon1			TAAGGATGTGAAA	AB065500	CCDS31536.1	11q11	2012-08-09			ENSG00000174914	ENSG00000174914		"""GPCR / Class A : Olfactory receptors"""	15319	protein-coding gene	gene with protein product				OR9G5			Standard	NM_001005213		Approved			Q8NH87	OTTHUMG00000167112	ENST00000312153.1:c.885T>C	11.37:g.56468748T>C		49.0	0.0		36.0	5.0	NM_001013358	Q6IEU9|Q8NGQ0	Silent	SNP	ENST00000312153.1	37	CCDS31536.1																																																																																			.		0.368	OR9G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393253.1	NM_001005213	
PCLO	27445	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	82585867	82585867	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr7:82585867T>C	ENST00000333891.9	-	5	4739	c.4402A>G	c.(4402-4404)Atc>Gtc	p.I1468V	PCLO_ENST00000423517.2_Missense_Mutation_p.I1468V	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CTCTCTTTGATCTCCTCTTCT	0.373																																					p.I1468V		.											.	PCLO	29	0			c.A4402G						.						103.0	94.0	97.0					7																	82585867		1811	4085	5896	SO:0001583	missense	27445	exon5			CTTTGATCTCCTC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.4402A>G	7.37:g.82585867T>C	ENSP00000334319:p.Ile1468Val	59.0	1.0		78.0	35.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	0.143	-1.099743	0.01843	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.15718	2.4;2.4	5.33	1.31	0.21738	.	.	.	.	.	T	0.09774	0.0240	N	0.22421	0.69	0.22457	N	0.999086	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.34601	-0.9822	9	0.87932	D	0	.	1.7394	0.02949	0.1818:0.1219:0.4142:0.282	.	1468;1468	Q9Y6V0-5;Q9Y6V0-6	.;.	V	1399;1468;1468	ENSP00000334319:I1468V;ENSP00000388393:I1468V	ENSP00000334319:I1468V	I	-	1	0	PCLO	82423803	0.104000	0.21937	0.001000	0.08648	0.022000	0.10575	0.454000	0.21827	-0.036000	0.13669	-1.675000	0.00742	ATC	.		0.373	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PDZRN3	23024	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	73433851	73433851	+	Silent	SNP	G	G	A	rs553747931		TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr3:73433851G>A	ENST00000263666.4	-	10	1980	c.1866C>T	c.(1864-1866)aaC>aaT	p.N622N	PDZRN3_ENST00000535920.1_Silent_p.N344N|PDZRN3_ENST00000479530.1_Silent_p.N339N|PDZRN3_ENST00000462146.2_Silent_p.N279N|PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000466780.1_Silent_p.N279N	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	622					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		TGAAAGACTCGTTGCTGAAGG	0.667													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18231	0.0		0.0	False		,,,				2504	0.0				p.N622N		.											.	PDZRN3	232	0			c.C1866T						.						77.0	78.0	78.0					3																	73433851		2203	4300	6503	SO:0001819	synonymous_variant	23024	exon10			AGACTCGTTGCTG	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.1866C>T	3.37:g.73433851G>A		111.0	1.0		55.0	26.0	NM_015009	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Silent	SNP	ENST00000263666.4	37	CCDS33789.1	.	.	.	.	.	.	.	.	.	.	G	6.175	0.400531	0.11696	.	.	ENSG00000121440	ENST00000494559	.	.	.	4.77	-3.32	0.04973	.	.	.	.	.	T	0.50854	0.1640	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47129	-0.9141	4	.	.	.	.	7.7794	0.29056	0.4812:0.0:0.4142:0.1047	.	.	.	.	M	219	.	.	T	-	2	0	PDZRN3	73516541	0.001000	0.12720	0.969000	0.41365	0.954000	0.61252	-2.013000	0.01450	-0.581000	0.05937	-0.140000	0.14226	ACG	.		0.667	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363	
PIN4	5303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	71401594	71401594	+	Silent	SNP	C	C	A	rs375360841		TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chrX:71401594C>A	ENST00000373669.2	+	1	66	c.34C>A	c.(34-36)Cgg>Agg	p.R12R	PIN4_ENST00000218432.5_Silent_p.R12R|PIN4_ENST00000423432.2_Silent_p.R12R	NM_006223.3	NP_006214.2	Q9Y237	PIN4_HUMAN	protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)	0	Necessary for association with the pre- rRNP complexes.|Necessary for nuclear localization and DNA-binding.				protein folding (GO:0006457)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|preribosome (GO:0030684)|spindle (GO:0005819)	bent DNA binding (GO:0003681)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			large_intestine(1)|lung(2)	3	Renal(35;0.156)					GGGGCTTGTACGGCAACTGGA	0.542																																					p.R12R		.											.	PIN4	130	0			c.C34A						.						64.0	59.0	61.0					X																	71401594		2203	4300	6503	SO:0001819	synonymous_variant	5303	exon1			CTTGTACGGCAAC	AB009690	CCDS14417.1, CCDS55447.1	Xq13.1	2008-02-05	2006-01-12		ENSG00000102309	ENSG00000102309			8992	protein-coding gene	gene with protein product		300252	"""protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)"""			16522211, 17875217	Standard	NM_006223		Approved	PAR14, PAR17, EPVH	uc004eam.3	Q9Y237	OTTHUMG00000021811	ENST00000373669.2:c.34C>A	X.37:g.71401594C>A		243.0	2.0		170.0	163.0	NM_001170747	A8E0G6|B3KXM0|F5H1P5|Q0D2H3|Q3MHV0|Q52M21|Q5HYW6|Q6IRW4	Silent	SNP	ENST00000373669.2	37	CCDS14417.1																																																																																			.		0.542	PIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057175.2	NM_006223	
PLCB4	5332	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	9365037	9365037	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr20:9365037A>G	ENST00000378493.1	+	11	1058	c.1043A>G	c.(1042-1044)cAg>cGg	p.Q348R	PLCB4_ENST00000378473.3_Missense_Mutation_p.Q348R|PLCB4_ENST00000278655.4_Missense_Mutation_p.Q348R|PLCB4_ENST00000334005.3_Missense_Mutation_p.Q348R|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000378501.2_Missense_Mutation_p.Q348R|PLCB4_ENST00000414679.2_Missense_Mutation_p.Q348R			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	348	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						ATGTACAGACAGGTTCTCCTG	0.443																																					p.Q348R		.											.	PLCB4	274	0			c.A1043G						.						83.0	80.0	81.0					20																	9365037		2203	4300	6503	SO:0001583	missense	5332	exon12			ACAGACAGGTTCT		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.1043A>G	20.37:g.9365037A>G	ENSP00000367754:p.Gln348Arg	177.0	2.0		153.0	75.0	NM_182797	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Missense_Mutation	SNP	ENST00000378493.1	37	CCDS13105.1	.	.	.	.	.	.	.	.	.	.	A	27.7	4.850716	0.91277	.	.	ENSG00000101333	ENST00000334005;ENST00000378473;ENST00000278655;ENST00000378493;ENST00000378501;ENST00000414679	T;T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08;-0.08	5.82	5.82	0.92795	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.152308	0.64402	D	0.000011	T	0.75803	0.3899	L	0.53561	1.675	0.80722	D	1	D;D;P;D	0.89917	0.999;0.986;0.925;1.0	D;D;D;D	0.80764	0.94;0.987;0.954;0.994	T	0.78033	-0.2362	10	0.87932	D	0	.	16.1822	0.81915	1.0:0.0:0.0:0.0	.	348;195;348;348	E2QRH8;Q15147-2;Q15147;Q15147-4	.;.;PLCB4_HUMAN;.	R	348;348;348;348;348;184	ENSP00000334105:Q348R;ENSP00000367734:Q348R;ENSP00000278655:Q348R;ENSP00000367754:Q348R;ENSP00000367762:Q348R;ENSP00000390616:Q184R	ENSP00000278655:Q348R	Q	+	2	0	PLCB4	9313037	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.962000	0.93254	2.225000	0.72522	0.460000	0.39030	CAG	.		0.443	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
PRCP	5547	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	82571056	82571056	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr11:82571056C>A	ENST00000313010.3	-	2	466	c.272G>T	c.(271-273)gGt>gTt	p.G91V	PRCP_ENST00000393399.2_Missense_Mutation_p.G112V|PRCP_ENST00000535099.1_Intron	NM_005040.2	NP_005031.1	P42785	PCP_HUMAN	prolylcarboxypeptidase (angiotensinase C)	91					angiogenesis involved in wound healing (GO:0060055)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|energy homeostasis (GO:0097009)|glucose homeostasis (GO:0042593)|negative regulation of systemic arterial blood pressure (GO:0003085)|plasma kallikrein-kinin cascade (GO:0002353)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)	basal part of cell (GO:0045178)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	17						CCCTTCATTACCAGTGTAGAA	0.333																																					p.G112V		.											.	PRCP	91	0			c.G335T						.						102.0	95.0	97.0					11																	82571056		2203	4297	6500	SO:0001583	missense	5547	exon3			TCATTACCAGTGT	BC001500, BI827978, L13977	CCDS8262.1, CCDS41695.1	11q14	2005-10-04				ENSG00000137509			9344	protein-coding gene	gene with protein product		176785				8344943	Standard	NM_199418		Approved	PCP, HUMPCP	uc001ozr.3	P42785		ENST00000313010.3:c.272G>T	11.37:g.82571056C>A	ENSP00000317362:p.Gly91Val	155.0	0.0		125.0	31.0	NM_199418	A8MU24|B2R7B7|B3KRK5|B5BU34	Missense_Mutation	SNP	ENST00000313010.3	37	CCDS8262.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.344058	0.82022	.	.	ENSG00000137509	ENST00000313010;ENST00000393399;ENST00000529671;ENST00000532809	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	5.71	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.68860	0.3047	H	0.96777	3.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80756	-0.1240	9	.	.	.	-17.7051	14.6012	0.68443	0.0:0.93:0.0:0.07	.	91;112	P42785;A8MU24	PCP_HUMAN;.	V	91;112;50;37	ENSP00000317362:G91V;ENSP00000377055:G112V;ENSP00000434771:G50V;ENSP00000437169:G37V	.	G	-	2	0	PRCP	82248704	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.486000	0.81215	1.423000	0.47198	0.491000	0.48974	GGT	.		0.333	PRCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391792.1	NM_005040	
PRICKLE1	144165	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	42853904	42853904	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr12:42853904C>T	ENST00000455697.1	-	8	2488	c.2203G>A	c.(2203-2205)Gcc>Acc	p.A735T	PRICKLE1_ENST00000548696.1_Missense_Mutation_p.A735T|PRICKLE1_ENST00000552240.1_Missense_Mutation_p.A735T|PRICKLE1_ENST00000445766.2_Missense_Mutation_p.A735T|RP11-328C8.4_ENST00000547824.1_RNA|PRICKLE1_ENST00000345127.3_Missense_Mutation_p.A735T	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	735					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		GTGGCATGGGCGTACTGTCCG	0.502																																					p.A735T		.											.	PRICKLE1	518	0			c.G2203A						.						124.0	123.0	123.0					12																	42853904		2203	4300	6503	SO:0001583	missense	144165	exon8			CATGGGCGTACTG	AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.2203G>A	12.37:g.42853904C>T	ENSP00000401060:p.Ala735Thr	92.0	0.0		78.0	27.0	NM_001144882	Q14C83|Q71QF8|Q96N00	Missense_Mutation	SNP	ENST00000455697.1	37	CCDS8742.1	.	.	.	.	.	.	.	.	.	.	C	9.836	1.189713	0.21954	.	.	ENSG00000139174	ENST00000455697;ENST00000445766;ENST00000548696;ENST00000345127;ENST00000552240	D;D;D;D;D	0.84800	-1.9;-1.9;-1.9;-1.9;-1.9	5.34	1.44	0.22558	.	0.454273	0.22030	N	0.065602	T	0.70815	0.3267	N	0.22421	0.69	0.09310	N	1	B	0.13594	0.008	B	0.04013	0.001	T	0.56697	-0.7936	10	0.37606	T	0.19	-1.1705	5.5579	0.17127	0.0:0.4873:0.2418:0.2709	.	735	Q96MT3	PRIC1_HUMAN	T	735	ENSP00000401060:A735T;ENSP00000398947:A735T;ENSP00000448359:A735T;ENSP00000345064:A735T;ENSP00000449819:A735T	ENSP00000345064:A735T	A	-	1	0	PRICKLE1	41140171	0.014000	0.17966	0.085000	0.20634	0.913000	0.54294	-0.037000	0.12164	0.062000	0.16340	-0.119000	0.15052	GCC	.		0.502	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404069.1		
PRKD1	5587	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	30066720	30066720	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr14:30066720G>T	ENST00000331968.5	-	16	2640	c.2411C>A	c.(2410-2412)cCc>cAc	p.P804H	PRKD1_ENST00000415220.2_Missense_Mutation_p.P812H	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	804	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		TTCCTTCCAGGGATTTGGTGG	0.308																																					p.P804H		.											.	PRKD1	1534	0			c.C2411A						.						123.0	120.0	121.0					14																	30066720		2203	4300	6503	SO:0001583	missense	5587	exon16			TTCCAGGGATTTG		CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.2411C>A	14.37:g.30066720G>T	ENSP00000333568:p.Pro804His	87.0	0.0		78.0	41.0	NM_002742	A6NL64|B2RAF6	Missense_Mutation	SNP	ENST00000331968.5	37	CCDS9637.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.484553	0.84854	.	.	ENSG00000184304	ENST00000331968;ENST00000415220	T;T	0.64991	-0.13;-0.13	5.44	5.44	0.79542	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75766	0.3894	L	0.49126	1.545	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.75388	-0.3335	10	0.52906	T	0.07	-13.8582	19.6286	0.95691	0.0:0.0:1.0:0.0	.	804	Q15139	KPCD1_HUMAN	H	804;812	ENSP00000333568:P804H;ENSP00000390535:P812H	ENSP00000333568:P804H	P	-	2	0	PRKD1	29136471	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.692000	0.91855	0.650000	0.86243	CCC	.		0.308	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742	
PTK2B	2185	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	27255270	27255270	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr8:27255270A>T	ENST00000397501.1	+	7	977	c.169A>T	c.(169-171)Aaa>Taa	p.K57*	PTK2B_ENST00000338238.4_Nonsense_Mutation_p.K57*|PTK2B_ENST00000544172.1_Nonsense_Mutation_p.K57*|PTK2B_ENST00000420218.2_Nonsense_Mutation_p.K57*|PTK2B_ENST00000346049.5_Nonsense_Mutation_p.K57*|PTK2B_ENST00000517339.1_Nonsense_Mutation_p.K57*	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	57	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	GAAAAACTTCAAACTGGTCAA	0.517																																					p.K57X		.											.	PTK2B	1378	0			c.A169T						.						149.0	137.0	141.0					8																	27255270		2203	4300	6503	SO:0001587	stop_gained	2185	exon7			AACTTCAAACTGG	U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.169A>T	8.37:g.27255270A>T	ENSP00000380638:p.Lys57*	286.0	0.0		236.0	97.0	NM_173174	D3DST0|Q13475|Q14290|Q16709|Q6PID4	Nonsense_Mutation	SNP	ENST00000397501.1	37	CCDS6057.1	.	.	.	.	.	.	.	.	.	.	A	44	10.540794	0.99424	.	.	ENSG00000120899	ENST00000397501;ENST00000539100;ENST00000338238;ENST00000544172;ENST00000522338;ENST00000521164;ENST00000346049;ENST00000420218;ENST00000522517;ENST00000412793;ENST00000517339	.	.	.	4.79	4.79	0.61399	.	0.060402	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.3454	0.55118	1.0:0.0:0.0:0.0	.	.	.	.	X	57;62;57;57;57;57;57;57;57;57;57	.	ENSP00000342242:K57X	K	+	1	0	PTK2B	27311187	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.890000	0.69774	2.018000	0.59344	0.533000	0.62120	AAA	.		0.517	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219916.1	NM_004103	
SIPA1L3	23094	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	38633281	38633281	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr19:38633281G>C	ENST00000222345.6	+	12	3973	c.3464G>C	c.(3463-3465)cGa>cCa	p.R1155P		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	1155					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CCTCCCTACCGACAGCCTTCT	0.572											OREG0025445	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R1155P		.											.	SIPA1L3	91	0			c.G3464C						.						208.0	202.0	204.0					19																	38633281		2203	4300	6503	SO:0001583	missense	23094	exon12			CCTACCGACAGCC	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.3464G>C	19.37:g.38633281G>C	ENSP00000222345:p.Arg1155Pro	110.0	2.0	879	102.0	43.0	NM_015073	Q2TV87	Missense_Mutation	SNP	ENST00000222345.6	37	CCDS33007.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035083	0.75617	.	.	ENSG00000105738	ENST00000222345	T	0.78816	-1.21	4.82	4.82	0.62117	.	0.649762	0.13409	N	0.390047	T	0.68742	0.3034	L	0.29908	0.895	0.47094	D	0.99931	B	0.13145	0.007	B	0.08055	0.003	T	0.60601	-0.7231	10	0.22109	T	0.4	-7.5852	16.8295	0.85940	0.0:0.0:1.0:0.0	.	1155	O60292	SI1L3_HUMAN	P	1155	ENSP00000222345:R1155P	ENSP00000222345:R1155P	R	+	2	0	SIPA1L3	43325121	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.022000	0.70839	2.506000	0.84524	0.563000	0.77884	CGA	.		0.572	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2	XM_032278	
SIGLEC14	100049587	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	52149062	52149062	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr19:52149062C>T	ENST00000360844.6	-	3	714	c.673G>A	c.(673-675)Gag>Aag	p.E225K	SIGLEC5_ENST00000534261.2_5'Flank|SIGLEC5_ENST00000429354.3_Intron|SIGLEC5_ENST00000599649.1_Intron|SIGLEC5_ENST00000222107.4_Intron	NM_001098612.1	NP_001092082.1	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14	225	Ig-like C2-type 1.				cell adhesion (GO:0007155)|innate immune response (GO:0045087)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.E225K(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)		ACAGTTCTCTCCGTGGTCACC	0.627																																					p.E225K		.											.	SIGLEC14	23	2	Substitution - Missense(2)	endometrium(2)	c.G673A						.						69.0	68.0	69.0					19																	52149062		2070	4205	6275	SO:0001583	missense	100049587	exon3			TTCTCTCCGTGGT	AY854038	CCDS42604.1	19q13.41	2013-01-29			ENSG00000254415	ENSG00000254415		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32926	protein-coding gene	gene with protein product						17012248	Standard	NM_001098612		Approved		uc002pxf.4	Q08ET2	OTTHUMG00000165511	ENST00000360844.6:c.673G>A	19.37:g.52149062C>T	ENSP00000354090:p.Glu225Lys	695.0	1.0		441.0	196.0	NM_001098612	Q6UXG0	Missense_Mutation	SNP	ENST00000360844.6	37	CCDS42604.1	.	.	.	.	.	.	.	.	.	.	C	17.37	3.371648	0.61624	.	.	ENSG00000254415	ENST00000360844	D	0.86865	-2.18	3.1	2.02	0.26589	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.145914	0.31335	N	0.007839	T	0.80602	0.4654	M	0.62723	1.935	0.20821	N	0.999847	P	0.42993	0.797	B	0.33846	0.171	T	0.72620	-0.4238	10	0.54805	T	0.06	.	8.0781	0.30729	0.0:0.7485:0.2515:0.0	.	225	Q08ET2	SIG14_HUMAN	K	225	ENSP00000354090:E225K	ENSP00000354090:E225K	E	-	1	0	SIGLEC14	56840874	0.002000	0.14202	0.334000	0.25495	0.939000	0.58152	0.012000	0.13287	0.617000	0.30160	0.514000	0.50259	GAG	.		0.627	SIGLEC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466899.2	NM_001098612	
SKAP2	8935	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	26765154	26765154	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr7:26765154T>C	ENST00000345317.2	-	9	1002	c.689A>G	c.(688-690)tAt>tGt	p.Y230C	SKAP2_ENST00000489977.1_5'UTR|SKAP2_ENST00000539623.1_Missense_Mutation_p.Y58C	NM_003930.3	NP_003921.2	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2	230					B cell activation (GO:0042113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(3)	17						TCTCTCATCATAATCCTCAGG	0.279																																					p.Y230C		.											.	SKAP2	91	0			c.A689G						.						112.0	110.0	110.0					7																	26765154		2203	4300	6503	SO:0001583	missense	8935	exon9			TCATCATAATCCT		CCDS5400.1	7p15.2	2013-01-10	2006-09-28	2006-09-28	ENSG00000005020	ENSG00000005020		"""Pleckstrin homology (PH) domain containing"""	15687	protein-coding gene	gene with protein product		605215	"""src family associated phosphoprotein 2"""	SCAP2		9837776, 9755858	Standard	NM_003930		Approved	RA70, SKAP-HOM, SKAP55R, SAPS	uc003syc.3	O75563	OTTHUMG00000023495	ENST00000345317.2:c.689A>G	7.37:g.26765154T>C	ENSP00000005587:p.Tyr230Cys	64.0	0.0		44.0	24.0	NM_003930	A4D173|Q53GP6|Q75MK6|Q75MZ4|Q9UBZ3|Q9UED8	Missense_Mutation	SNP	ENST00000345317.2	37	CCDS5400.1	.	.	.	.	.	.	.	.	.	.	T	9.568	1.120292	0.20877	.	.	ENSG00000005020	ENST00000345317;ENST00000539623;ENST00000535331	T;T	0.29917	2.07;1.55	5.86	3.4	0.38934	.	0.509488	0.22178	N	0.063543	T	0.14399	0.0348	N	0.08118	0	0.19775	N	0.99996	P;B	0.36495	0.556;0.31	B;B	0.35899	0.112;0.213	T	0.09796	-1.0658	10	0.49607	T	0.09	-15.7547	6.148	0.20296	0.1426:0.0772:0.0:0.7801	.	215;230	B7Z5N4;O75563	.;SKAP2_HUMAN	C	230;58;215	ENSP00000005587:Y230C;ENSP00000443593:Y58C	ENSP00000005587:Y230C	Y	-	2	0	SKAP2	26731679	0.997000	0.39634	0.079000	0.20413	0.990000	0.78478	5.239000	0.65371	0.434000	0.26340	0.533000	0.62120	TAT	.		0.279	SKAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214128.1		
SLC45A1	50651	bcgsc.ca;mdanderson.org	37	1	8384368	8384368	+	De_novo_Start_OutOfFrame	SNP	A	A	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr1:8384368A>T	ENST00000471889.1	+	0	364				SLC45A1_ENST00000377479.2_Silent_p.G27G|SLC45A1_ENST00000289877.8_5'Flank			Q9Y2W3	S45A1_HUMAN	solute carrier family 45, member 1						carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(2)	33	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		CCTCACAGGGACGCCCACCAG	0.617																																					.		.											.	SLC45A1	494	0			.						.						33.0	40.0	38.0					1																	8384368		2191	4281	6472			50651	.			ACAGGGACGCCCA	AF118274	CCDS30577.1	1p36.23	2014-01-28	2005-10-04	2005-10-04	ENSG00000162426	ENSG00000162426		"""Solute carriers"""	17939	protein-coding gene	gene with protein product	"""H+/sugar symporter"""	605763	"""deleted in neuroblastoma 5"""	DNB5		10729226	Standard	XM_005263467		Approved		uc001apb.3	Q9Y2W3	OTTHUMG00000000503	ENST00000471889.1:c.-22A>T	1.37:g.8384368A>T		61.0	0.0		32.0	9.0	.	Q5VY46|Q5VY49	Silent	SNP	ENST00000471889.1	37	CCDS30577.1																																																																																			.		0.617	SLC45A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001245.5		
SNTG2	54221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	1371215	1371215	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr2:1371215G>T	ENST00000308624.5	+	17	1718	c.1589G>T	c.(1588-1590)aGt>aTt	p.S530I	SNTG2_ENST00000407292.1_Missense_Mutation_p.S403I	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	530					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		GACAGTCAGAGTCTTGCCAGA	0.463																																					p.S530I		.											.	SNTG2	136	0			c.G1589T						.						55.0	52.0	53.0					2																	1371215		692	1591	2283	SO:0001583	missense	54221	exon17			GTCAGAGTCTTGC	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.1589G>T	2.37:g.1371215G>T	ENSP00000311837:p.Ser530Ile	157.0	0.0		235.0	53.0	NM_018968	Q05AH5	Missense_Mutation	SNP	ENST00000308624.5	37	CCDS46220.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.912658	0.52439	.	.	ENSG00000172554	ENST00000308624;ENST00000407292	T;T	0.71341	0.98;-0.56	4.91	4.91	0.64330	.	0.048636	0.85682	D	0.000000	T	0.81307	0.4795	M	0.69823	2.125	0.58432	D	0.999998	D;P	0.59767	0.986;0.933	P;P	0.58454	0.839;0.486	D	0.84132	0.0412	10	0.72032	D	0.01	.	17.7172	0.88341	0.0:0.0:1.0:0.0	.	403;530	Q9NY99-2;Q9NY99	.;SNTG2_HUMAN	I	530;403	ENSP00000311837:S530I;ENSP00000385020:S403I	ENSP00000311837:S530I	S	+	2	0	SNTG2	1350222	1.000000	0.71417	0.921000	0.36526	0.079000	0.17450	5.389000	0.66255	2.247000	0.74100	0.655000	0.94253	AGT	.		0.463	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968	
SNX13	23161	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	17890006	17890006	+	Silent	SNP	T	T	C			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr7:17890006T>C	ENST00000409389.1	-	11	1201	c.1029A>G	c.(1027-1029)gtA>gtG	p.V343V	SNX13_ENST00000428135.3_Silent_p.V343V			Q9Y5W8	SNX13_HUMAN	sorting nexin 13	343					intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					TTGAGTCACATACCTTCTTTA	0.289																																					p.V343V		.											.	SNX13	650	0			c.A1029G						.						80.0	70.0	73.0					7																	17890006		1838	4085	5923	SO:0001819	synonymous_variant	23161	exon11			GTCACATACCTTC	AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.1029A>G	7.37:g.17890006T>C		78.0	0.0		62.0	27.0	NM_015132	B2RCI9|O94821|Q8WVZ2|Q8WXH8	Silent	SNP	ENST00000409389.1	37																																																																																				.		0.289	SNX13-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000327608.1	NM_015132	
ST6GALNAC5	81849	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	77528719	77528719	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr1:77528719G>A	ENST00000477717.1	+	5	1074	c.839G>A	c.(838-840)tGt>tAt	p.C280Y		NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	280					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						CCTGATGAATGTACAATGTAC	0.413																																					p.C280Y		.											.	ST6GALNAC5	92	0			c.G839A						.						137.0	132.0	134.0					1																	77528719		2203	4300	6503	SO:0001583	missense	81849	exon5			ATGAATGTACAAT		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.839G>A	1.37:g.77528719G>A	ENSP00000417583:p.Cys280Tyr	176.0	0.0		142.0	70.0	NM_030965	B1AK82	Missense_Mutation	SNP	ENST00000477717.1	37	CCDS673.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.687610	0.88639	.	.	ENSG00000117069	ENST00000477717;ENST00000438953	T	0.30448	1.53	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.55800	0.1943	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.58747	-0.7582	10	0.87932	D	0	-37.385	20.3422	0.98769	0.0:0.0:1.0:0.0	.	280	Q9BVH7	SIA7E_HUMAN	Y	280;190	ENSP00000417583:C280Y	ENSP00000406658:C190Y	C	+	2	0	ST6GALNAC5	77301307	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.414000	0.97362	2.810000	0.96702	0.655000	0.94253	TGT	.		0.413	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965	
SPAG17	200162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	118535171	118535171	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr1:118535171G>A	ENST00000336338.5	-	36	5344	c.5279C>T	c.(5278-5280)cCc>cTc	p.P1760L		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1760						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TAGCACACTGGGGCTCTTGAG	0.478																																					p.P1760L		.											.	SPAG17	158	0			c.C5279T						.						110.0	105.0	107.0					1																	118535171		2203	4300	6503	SO:0001583	missense	200162	exon36			ACACTGGGGCTCT		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.5279C>T	1.37:g.118535171G>A	ENSP00000337804:p.Pro1760Leu	151.0	0.0		119.0	58.0	NM_206996	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	CCDS899.1	.	.	.	.	.	.	.	.	.	.	G	16.91	3.252587	0.59212	.	.	ENSG00000155761	ENST00000336338;ENST00000437255	T	0.74421	-0.84	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.84502	0.5486	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.85812	0.1380	10	0.87932	D	0	.	18.3968	0.90502	0.0:0.0:1.0:0.0	.	1760	Q6Q759	SPG17_HUMAN	L	1760;240	ENSP00000337804:P1760L	ENSP00000337804:P1760L	P	-	2	0	SPAG17	118336694	1.000000	0.71417	0.318000	0.25279	0.215000	0.24574	4.648000	0.61425	2.634000	0.89283	0.655000	0.94253	CCC	.		0.478	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
SVEP1	79987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	113173839	113173839	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr9:113173839T>C	ENST00000401783.2	-	37	6488	c.6152A>G	c.(6151-6153)tAc>tGc	p.Y2051C	SVEP1_ENST00000297826.5_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.Y2028C	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2051	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TGCTAGGCTGTAACCATCAGA	0.532																																					p.Y2051C		.											.	SVEP1	75	0			c.A6152G						.						48.0	49.0	49.0					9																	113173839		1966	4147	6113	SO:0001583	missense	79987	exon37			AGGCTGTAACCAT	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.6152A>G	9.37:g.113173839T>C	ENSP00000384917:p.Tyr2051Cys	80.0	0.0		64.0	43.0	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.320446	0.81469	.	.	ENSG00000165124	ENST00000401783;ENST00000374469	T;T	0.72394	-0.65;-0.65	5.98	5.98	0.97165	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.85982	0.5824	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88089	0.2812	10	0.87932	D	0	.	16.4728	0.84119	0.0:0.0:0.0:1.0	.	2051	Q4LDE5	SVEP1_HUMAN	C	2051;2028	ENSP00000384917:Y2051C;ENSP00000363593:Y2028C	ENSP00000363593:Y2028C	Y	-	2	0	SVEP1	112213660	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.840000	0.86819	2.296000	0.77279	0.482000	0.46254	TAC	.		0.532	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
TAF9B	51616	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	77392438	77392438	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chrX:77392438C>A	ENST00000341864.5	-	5	549	c.455G>T	c.(454-456)aGt>aTt	p.S152I		NM_015975.4	NP_057059.2	Q9HBM6	TAF9B_HUMAN	TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa	152					DNA-templated transcription, initiation (GO:0006352)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell growth (GO:0030307)|programmed cell death (GO:0012501)|protein stabilization (GO:0050821)|response to organic cyclic compound (GO:0014070)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	14						AGGTTTGCTACTAACAGCACC	0.403																																					p.S152I		.											.	TAF9B	40	0			c.G455T						.						159.0	127.0	138.0					X																	77392438		2203	4296	6499	SO:0001583	missense	51616	exon5			TTGCTACTAACAG	AF220509	CCDS35340.1	Xq13.1-q21.1	2010-08-16	2006-01-04	2006-01-04	ENSG00000187325	ENSG00000187325			17306	protein-coding gene	gene with protein product		300754	"""TAF9-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa"""	TAF9L		15899866	Standard	XM_005262142		Approved	TAFII31L, DN-7, DN7, TFIID-31	uc004eda.3	Q9HBM6	OTTHUMG00000021887	ENST00000341864.5:c.455G>T	X.37:g.77392438C>A	ENSP00000339917:p.Ser152Ile	107.0	0.0		83.0	5.0	NM_015975	B2RUZ9|Q9Y2S3	Missense_Mutation	SNP	ENST00000341864.5	37	CCDS35340.1	.	.	.	.	.	.	.	.	.	.	C	13.57	2.275270	0.40194	.	.	ENSG00000187325	ENST00000341864	T	0.32753	1.44	4.84	2.01	0.26516	.	0.222198	0.46442	D	0.000282	T	0.20495	0.0493	L	0.43923	1.385	0.41892	D	0.990373	B	0.22909	0.077	B	0.18871	0.023	T	0.07046	-1.0793	10	0.38643	T	0.18	-0.9529	3.7105	0.08418	0.0:0.4785:0.1828:0.3388	.	152	Q9HBM6	TAF9B_HUMAN	I	152	ENSP00000339917:S152I	ENSP00000339917:S152I	S	-	2	0	TAF9B	77279094	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	0.844000	0.27654	0.101000	0.17610	0.600000	0.82982	AGT	.		0.403	TAF9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057308.1	NM_015975	
TEK	7010	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	27157964	27157964	+	Missense_Mutation	SNP	C	C	A	rs369048700		TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr9:27157964C>A	ENST00000380036.4	+	2	630	c.188C>A	c.(187-189)gCc>gAc	p.A63D	TEK_ENST00000519097.1_Intron|TEK_ENST00000406359.4_Missense_Mutation_p.A63D	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	63	Ig-like C2-type 1.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	GACTTTGAAGCCTTAATGAAC	0.478																																					p.A63D		.											.	TEK	1584	0			c.C188A						.						113.0	106.0	109.0					9																	27157964		2203	4300	6503	SO:0001583	missense	7010	exon2			TTGAAGCCTTAAT	L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.188C>A	9.37:g.27157964C>A	ENSP00000369375:p.Ala63Asp	273.0	1.0		181.0	58.0	NM_000459	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	ENST00000380036.4	37	CCDS6519.1	.	.	.	.	.	.	.	.	.	.	C	13.89	2.371371	0.42003	.	.	ENSG00000120156	ENST00000380036;ENST00000346448;ENST00000406359	T;T	0.73789	-0.76;-0.78	5.93	5.93	0.95920	Tyrosine-protein kinase, receptor Tie-2, Ig-like domain 1, N-terminal (1);Immunoglobulin-like fold (1);	0.128568	0.34986	N	0.003539	T	0.53222	0.1783	N	0.08118	0	0.35548	D	0.803642	B;B;B;B	0.26975	0.026;0.165;0.014;0.065	B;B;B;B	0.23150	0.043;0.044;0.026;0.025	T	0.59359	-0.7469	10	0.20046	T	0.44	.	13.0159	0.58757	0.1269:0.7508:0.1223:0.0	.	96;63;63;63	Q59HG2;B5A953;B4DHD3;Q02763	.;.;.;TIE2_HUMAN	D	63	ENSP00000369375:A63D;ENSP00000383977:A63D	ENSP00000343716:A63D	A	+	2	0	TEK	27147964	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.853000	0.48317	2.798000	0.96311	0.655000	0.94253	GCC	.		0.478	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3		
THADA	63892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	43779386	43779386	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr2:43779386G>A	ENST00000405006.4	-	18	3118	c.2767C>T	c.(2767-2769)Cga>Tga	p.R923*	THADA_ENST00000402360.2_Nonsense_Mutation_p.R923*|THADA_ENST00000415080.2_Nonsense_Mutation_p.R633*|THADA_ENST00000330266.7_Nonsense_Mutation_p.R633*|THADA_ENST00000405975.2_Nonsense_Mutation_p.R923*	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	923								p.R923*(1)		breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				CAGTGGACTCGCCCATACATT	0.408																																					p.R923X		.											.	THADA	228	1	Substitution - Nonsense(1)	lung(1)	c.C2767T						.						55.0	56.0	56.0					2																	43779386		1940	4132	6072	SO:0001587	stop_gained	63892	exon18			GGACTCGCCCATA	AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.2767C>T	2.37:g.43779386G>A	ENSP00000385995:p.Arg923*	179.0	0.0		319.0	229.0	NM_001083953	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Nonsense_Mutation	SNP	ENST00000405006.4	37	CCDS46268.1	.	.	.	.	.	.	.	.	.	.	G	36	5.951656	0.97139	.	.	ENSG00000115970	ENST00000330266;ENST00000405975;ENST00000356975;ENST00000415080;ENST00000405006;ENST00000402360	.	.	.	5.56	3.72	0.42706	.	0.071578	0.56097	D	0.000032	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	8.8461	0.35170	0.0736:0.0:0.5989:0.3275	.	.	.	.	X	633;923;924;633;923;923	.	ENSP00000331105:R633X	R	-	1	2	THADA	43632890	1.000000	0.71417	0.995000	0.50966	0.983000	0.72400	2.171000	0.42453	0.780000	0.33566	0.591000	0.81541	CGA	.		0.408	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065	
THEMIS	387357	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	128134854	128134854	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr6:128134854T>C	ENST00000368248.2	-	4	1080	c.932A>G	c.(931-933)aAa>aGa	p.K311R	THEMIS_ENST00000368250.1_Missense_Mutation_p.K232R|THEMIS_ENST00000537166.1_Missense_Mutation_p.K276R|THEMIS_ENST00000543064.1_Missense_Mutation_p.K311R	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	311	CABIT 2.				negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						CTGGTACTTTTTGTGGATCAC	0.423																																					p.K311R		.											.	THEMIS	94	0			c.A932G						.						102.0	107.0	106.0					6																	128134854		2203	4300	6503	SO:0001583	missense	387357	exon4			TACTTTTTGTGGA	AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.932A>G	6.37:g.128134854T>C	ENSP00000357231:p.Lys311Arg	118.0	0.0		59.0	46.0	NM_001010923	A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Missense_Mutation	SNP	ENST00000368248.2	37	CCDS34534.1	.	.	.	.	.	.	.	.	.	.	T	7.622	0.677051	0.14841	.	.	ENSG00000172673	ENST00000368250;ENST00000543064;ENST00000368248;ENST00000537166;ENST00000434358	T;T;T;T;T	0.15603	2.41;2.41;2.41;2.41;2.41	5.59	5.59	0.84812	.	0.404730	0.29473	N	0.012044	T	0.14356	0.0347	M	0.70595	2.14	0.36782	D	0.884385	P;P	0.45531	0.86;0.698	B;P	0.45276	0.439;0.475	T	0.08848	-1.0702	10	0.18276	T	0.48	-6.8041	15.7742	0.78198	0.0:0.0:0.0:1.0	.	311;311	F5H1J9;Q8N1K5	.;THMS1_HUMAN	R	232;311;311;276;79	ENSP00000357233:K232R;ENSP00000439594:K311R;ENSP00000357231:K311R;ENSP00000439863:K276R;ENSP00000387740:K79R	ENSP00000357231:K311R	K	-	2	0	THEMIS	128176547	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	4.755000	0.62198	2.135000	0.66039	0.374000	0.22700	AAA	.		0.423	THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_001010923	
TICAM1	148022	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	4817368	4817368	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr19:4817368G>T	ENST00000248244.5	-	2	1251	c.1022C>A	c.(1021-1023)aCc>aAc	p.T341N		NM_182919.3	NP_891549.1	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1	341	Pro-rich.				apoptotic signaling pathway (GO:0097190)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of protein homodimerization activity (GO:0043496)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|ripoptosome (GO:0097342)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		TGGAGAGGTGGTATCTTCTAC	0.557																																					p.T341N		.											.	TICAM1	153	0			c.C1022A						.						55.0	58.0	57.0					19																	4817368		2203	4299	6502	SO:0001583	missense	148022	exon2			GAGGTGGTATCTT	AB086380	CCDS12136.1	19p13.3	2014-09-17				ENSG00000127666			18348	protein-coding gene	gene with protein product		607601				12539043, 12471095	Standard	NM_182919		Approved	TRIF, TICAM-1, MGC35334, PRVTIRB	uc002mbi.4	Q8IUC6		ENST00000248244.5:c.1022C>A	19.37:g.4817368G>T	ENSP00000248244:p.Thr341Asn	155.0	1.0		172.0	76.0	NM_182919	B3Y691|O75532|Q86XP8|Q96GA0	Missense_Mutation	SNP	ENST00000248244.5	37	CCDS12136.1	.	.	.	.	.	.	.	.	.	.	G	12.10	1.835438	0.32421	.	.	ENSG00000127666	ENST00000248244	T	0.42900	0.96	4.19	1.79	0.24919	.	1.658350	0.03947	N	0.287913	T	0.40119	0.1104	L	0.57536	1.79	0.09310	N	1	B	0.14438	0.01	B	0.09377	0.004	T	0.19582	-1.0301	10	0.39692	T	0.17	-7.0207	5.5523	0.17097	0.1021:0.0:0.6314:0.2665	.	341	Q8IUC6	TCAM1_HUMAN	N	341	ENSP00000248244:T341N	ENSP00000248244:T341N	T	-	2	0	TICAM1	4768368	0.000000	0.05858	0.000000	0.03702	0.349000	0.29174	-0.093000	0.11111	0.183000	0.20059	0.313000	0.20887	ACC	.		0.557	TICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450435.1	NM_014261	
TLE1	7088	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	84208091	84208091	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr9:84208091T>C	ENST00000376499.3	-	15	2494	c.1430A>G	c.(1429-1431)cAg>cGg	p.Q477R		NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	477					multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						GGTGTTGATCTGGCGAGCATG	0.622																																					p.Q477R	NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)	.											.	TLE1	92	0			c.A1430G						.						123.0	115.0	118.0					9																	84208091		2203	4300	6503	SO:0001583	missense	7088	exon15			TTGATCTGGCGAG		CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.1430A>G	9.37:g.84208091T>C	ENSP00000365682:p.Gln477Arg	233.0	1.0		135.0	46.0	NM_005077	A8K495|Q5T3G4|Q969V9	Missense_Mutation	SNP	ENST00000376499.3	37	CCDS6661.1	.	.	.	.	.	.	.	.	.	.	t	19.44	3.828484	0.71258	.	.	ENSG00000196781	ENST00000376499	T	0.11495	2.77	5.96	5.96	0.96718	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.28167	0.0695	L	0.52573	1.65	0.80722	D	1	B;B;D	0.53619	0.143;0.008;0.961	P;B;D	0.65773	0.508;0.149;0.938	T	0.00353	-1.1795	10	0.87932	D	0	-16.5744	16.4484	0.83959	0.0:0.0:0.0:1.0	.	462;503;477	B4DEF9;Q59EF7;Q04724	.;.;TLE1_HUMAN	R	477	ENSP00000365682:Q477R	ENSP00000365682:Q477R	Q	-	2	0	TLE1	83397911	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.040000	0.89188	2.285000	0.76669	0.533000	0.62120	CAG	.		0.622	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055407.1	NM_005077	
TLE1	7088	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	84208095	84208095	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr9:84208095G>T	ENST00000376499.3	-	15	2490	c.1426C>A	c.(1426-1428)Cgc>Agc	p.R476S		NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	476					multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						TTGATCTGGCGAGCATGCCGG	0.612																																					p.R476S	NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)	.											.	TLE1	92	0			c.C1426A						.						117.0	111.0	113.0					9																	84208095		2203	4300	6503	SO:0001583	missense	7088	exon15			TCTGGCGAGCATG		CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.1426C>A	9.37:g.84208095G>T	ENSP00000365682:p.Arg476Ser	237.0	0.0		136.0	50.0	NM_005077	A8K495|Q5T3G4|Q969V9	Missense_Mutation	SNP	ENST00000376499.3	37	CCDS6661.1	.	.	.	.	.	.	.	.	.	.	g	35	5.563760	0.96527	.	.	ENSG00000196781	ENST00000376499	T	0.11495	2.77	5.96	5.96	0.96718	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.43433	0.1247	M	0.88570	2.965	0.80722	D	1	D;D;P	0.67145	0.968;0.996;0.782	P;D;B	0.76575	0.581;0.988;0.233	T	0.44590	-0.9318	10	0.87932	D	0	-23.6887	20.422	0.99049	0.0:0.0:1.0:0.0	.	461;502;476	B4DEF9;Q59EF7;Q04724	.;.;TLE1_HUMAN	S	476	ENSP00000365682:R476S	ENSP00000365682:R476S	R	-	1	0	TLE1	83397915	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.872000	0.87187	2.832000	0.97577	0.655000	0.94253	CGC	.		0.612	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055407.1	NM_005077	
MUSTN1	389125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52867655	52867655	+	Silent	SNP	G	G	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr3:52867655G>T	ENST00000446157.2	-	2	390	c.120C>A	c.(118-120)acC>acA	p.T40T	TMEM110-MUSTN1_ENST00000504329.1_Silent_p.T330T|ITIH4_ENST00000406595.1_5'Flank|RP5-966M1.6_ENST00000468472.1_Silent_p.T40T|MUSTN1_ENST00000486659.1_Silent_p.T45T|ITIH4_ENST00000485816.1_5'Flank|ITIH4_ENST00000346281.5_5'Flank|ITIH4_ENST00000434759.3_5'Flank|ITIH4_ENST00000266041.4_5'Flank|RP5-966M1.6_ENST00000513520.1_5'UTR	NM_205853.3	NP_995325	Q8IVN3	MSTN1_HUMAN	musculoskeletal, embryonic nuclear protein 1	40						nucleus (GO:0005634)				endometrium(1)|large_intestine(1)|lung(2)|prostate(2)|upper_aerodigestive_tract(1)	7				BRCA - Breast invasive adenocarcinoma(193;6.56e-05)|Kidney(197;0.000586)|KIRC - Kidney renal clear cell carcinoma(197;0.000755)|OV - Ovarian serous cystadenocarcinoma(275;0.0471)		TGACCTGGTAGGTCTTGGACT	0.592																																					p.T330T		.											.	.	.	0			c.C990A						.						143.0	152.0	149.0					3																	52867655		1988	4167	6155	SO:0001819	synonymous_variant	100526772	exon9			CTGGTAGGTCTTG		CCDS46846.1	3p21.31	2004-03-10				ENSG00000272573			22144	protein-coding gene	gene with protein product							Standard	NM_205853		Approved	Mustang		Q8IVN3		ENST00000446157.2:c.120C>A	3.37:g.52867655G>T		96.0	0.0		99.0	43.0	NM_001198974		Silent	SNP	ENST00000446157.2	37	CCDS46846.1	.	.	.	.	.	.	.	.	.	.	G	11.77	1.738391	0.30774	.	.	ENSG00000243696	ENST00000513520	.	.	.	5.21	1.1	0.20463	.	.	.	.	.	T	0.51024	0.1650	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.36456	-0.9747	4	.	.	.	-6.2345	4.9396	0.13958	0.0716:0.1143:0.3616:0.4526	.	.	.	.	I	3	.	.	L	-	1	2	MUSTN1	52842695	0.416000	0.25424	1.000000	0.80357	0.976000	0.68499	-0.425000	0.07017	0.206000	0.20587	0.455000	0.32223	CTA	.		0.592	MUSTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352933.2	XM_371644	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7577111	7577111	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr17:7577111G>C	ENST00000269305.4	-	8	1016	c.827C>G	c.(826-828)gCc>gGc	p.A276G	TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.A276G|TP53_ENST00000445888.2_Missense_Mutation_p.A276G|TP53_ENST00000420246.2_Missense_Mutation_p.A276G|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.A276G	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	276	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		A -> D (in sporadic cancers; somatic mutation).|A -> G (in sporadic cancers; somatic mutation).|A -> P (in sporadic cancers; somatic mutation).|A -> S (in sporadic cancers; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.A276V(7)|p.A276D(6)|p.A276G(4)|p.?(2)|p.A276fs*69(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.A276fs*68(1)|p.L265_K305del41(1)|p.A276_C277delAC(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.A276fs*70(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCCAGGACAGGCACAAACACG	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.A276G	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,0	TP53	70225	42	Substitution - Missense(17)|Whole gene deletion(8)|Deletion - In frame(7)|Deletion - Frameshift(5)|Unknown(2)|Complex - frameshift(2)|Insertion - Frameshift(1)	upper_aerodigestive_tract(6)|central_nervous_system(6)|breast(5)|haematopoietic_and_lymphoid_tissue(4)|lung(4)|bone(4)|stomach(3)|urinary_tract(2)|oesophagus(2)|skin(2)|prostate(2)|ovary(1)|pancreas(1)	c.C827G						.						72.0	62.0	65.0					17																	7577111		2203	4300	6503	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GGACAGGCACAAA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.827C>G	17.37:g.7577111G>C	ENSP00000269305:p.Ala276Gly	128.0	0.0		46.0	41.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.046851	0.93740	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99859	-7.24;-7.24;-7.24;-7.24;-7.24;-7.24	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99866	0.9937	M	0.89715	3.055	0.80722	D	1	D;D;D;P	0.63880	0.993;0.988;0.988;0.909	D;D;D;P	0.68483	0.93;0.936;0.958;0.89	D	0.96378	0.9279	10	0.87932	D	0	-17.5913	15.662	0.77193	0.0:0.0:1.0:0.0	.	276;276;276;276	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	G	276;276;276;276;276;265;144	ENSP00000352610:A276G;ENSP00000269305:A276G;ENSP00000398846:A276G;ENSP00000391127:A276G;ENSP00000391478:A276G;ENSP00000425104:A144G	ENSP00000269305:A276G	A	-	2	0	TP53	7517836	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.573000	0.98181	2.556000	0.86216	0.462000	0.41574	GCC	.		0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TRPM1	4308	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	31294718	31294718	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr15:31294718T>A	ENST00000256552.6	-	28	4332	c.4185A>T	c.(4183-4185)aaA>aaT	p.K1395N	TRPM1_ENST00000397795.2_Missense_Mutation_p.K1373N|TRPM1_ENST00000542188.1_Missense_Mutation_p.K1412N|RP11-348B17.1_ENST00000561299.1_RNA	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		TAGTTTCTTCTTTTTTAGAGT	0.358																																					p.K1412N		.											.	TRPM1	94	0			c.A4236T						.						167.0	155.0	159.0					15																	31294718		1847	4091	5938	SO:0001583	missense	4308	exon27			TTCTTCTTTTTTA	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.4185A>T	15.37:g.31294718T>A	ENSP00000256552:p.Lys1395Asn	50.0	0.0		43.0	18.0	NM_001252020		Missense_Mutation	SNP	ENST00000256552.6	37	CCDS58346.1	.	.	.	.	.	.	.	.	.	.	T	3.670	-0.067798	0.07228	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	T;T;T	0.51817	0.71;0.69;0.71	5.05	-2.17	0.07059	.	1.825870	0.02729	N	0.114868	T	0.21631	0.0521	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.14727	-1.0462	10	0.48119	T	0.1	-4.0268	0.8112	0.01093	0.3583:0.1736:0.2959:0.1721	.	1367;1373	Q7Z4N2-3;Q7Z4N2	.;TRPM1_HUMAN	N	1373;1412;1395;1373	ENSP00000380897:K1373N;ENSP00000437849:K1412N;ENSP00000256552:K1395N	ENSP00000256552:K1395N	K	-	3	2	TRPM1	29082010	0.000000	0.05858	0.000000	0.03702	0.353000	0.29299	-0.760000	0.04756	-0.051000	0.13334	0.528000	0.53228	AAA	.		0.358	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420	
TTC16	158248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	130493535	130493535	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr9:130493535G>C	ENST00000373289.3	+	14	2553	c.2473G>C	c.(2473-2475)Ggc>Cgc	p.G825R	TTC16_ENST00000489226.1_3'UTR|TOR2A_ENST00000472723.1_5'Flank	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	825										central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						CCAAGGCCAGGGCCAGAGGTC	0.607																																					p.G825R		.											.	TTC16	90	0			c.G2473C						.						44.0	49.0	47.0					9																	130493535		2202	4300	6502	SO:0001583	missense	158248	exon14			GGCCAGGGCCAGA	AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.2473G>C	9.37:g.130493535G>C	ENSP00000362386:p.Gly825Arg	297.0	0.0		186.0	51.0	NM_144965	B4DYG4|B5ME24|Q5JU66|Q96M72	Missense_Mutation	SNP	ENST00000373289.3	37	CCDS6875.1	.	.	.	.	.	.	.	.	.	.	G	10.84	1.465281	0.26335	.	.	ENSG00000167094	ENST00000373289	T	0.19105	2.17	4.52	-4.92	0.03075	.	1.353330	0.04720	N	0.419182	T	0.15132	0.0365	L	0.40543	1.245	0.09310	N	1	B;B	0.29432	0.244;0.244	B;B	0.29176	0.099;0.099	T	0.32877	-0.9890	10	0.51188	T	0.08	-1.1371	4.1494	0.10230	0.3232:0.0:0.3783:0.2984	.	812;825	B4DZ42;Q8NEE8	.;TTC16_HUMAN	R	825	ENSP00000362386:G825R	ENSP00000362386:G825R	G	+	1	0	TTC16	129533356	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-1.678000	0.01942	-0.796000	0.04456	-0.672000	0.03802	GGC	.		0.607	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054224.1	NM_144965	
TTN	7273	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179494983	179494983	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr2:179494983G>T	ENST00000591111.1	-	189	39567	c.39343C>A	c.(39343-39345)Cac>Aac	p.H13115N	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.H5816N|TTN_ENST00000460472.2_Missense_Mutation_p.H5691N|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.H14756N|TTN_ENST00000342992.6_Missense_Mutation_p.H12188N|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.H5883N|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13115					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.H12188N(2)|p.H5883N(1)|p.H5691N(1)|p.H5816N(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTCGGAGGTGGGCACTAGAT	0.388																																					p.H14756N		.											.	TTN	636	5	Substitution - Missense(5)	lung(5)	c.C44266A						.						92.0	94.0	93.0					2																	179494983		1850	4087	5937	SO:0001583	missense	7273	exon239			GGAGGTGGGCACT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.39343C>A	2.37:g.179494983G>T	ENSP00000465570:p.His13115Asn	137.0	1.0		106.0	52.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	14.73	2.622476	0.46840	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.34667	1.35;1.35;1.35;1.35	6.04	6.04	0.98038	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.17408	0.0418	N	0.02181	-0.65	0.46927	D	0.99925	P;P;P;P	0.44734	0.842;0.842;0.842;0.828	B;B;B;B	0.33750	0.169;0.169;0.169;0.169	T	0.30765	-0.9967	9	0.87932	D	0	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	5691;5816;5883;13115	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	12188;5691;5883;5816;5691	ENSP00000343764:H12188N;ENSP00000434586:H5691N;ENSP00000340554:H5883N;ENSP00000352154:H5816N	ENSP00000340554:H5883N	H	-	1	0	TTN	179203228	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	5.339000	0.65953	2.873000	0.98535	0.563000	0.77884	CAC	.		0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TYK2	7297	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10475628	10475628	+	Missense_Mutation	SNP	G	G	A	rs550060811		TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr19:10475628G>A	ENST00000525621.1	-	8	1589	c.1108C>T	c.(1108-1110)Cgg>Tgg	p.R370W	TYK2_ENST00000529370.1_Missense_Mutation_p.R370W|TYK2_ENST00000264818.6_Missense_Mutation_p.R370W|TYK2_ENST00000524462.1_Missense_Mutation_p.R185W	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	370	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			AGTGGCTCCCGCGGCCTGTCT	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		18461	0.0		0.0	False		,,,				2504	0.001				p.R370W		.											.	TYK2	1009	0			c.C1108T						.						48.0	50.0	49.0					19																	10475628		2203	4300	6503	SO:0001583	missense	7297	exon8			GCTCCCGCGGCCT		CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.1108C>T	19.37:g.10475628G>A	ENSP00000431885:p.Arg370Trp	95.0	0.0		68.0	14.0	NM_003331	Q6QB10|Q96CH0	Missense_Mutation	SNP	ENST00000525621.1	37	CCDS12236.1	.	.	.	.	.	.	.	.	.	.	G	14.56	2.572705	0.45798	.	.	ENSG00000105397	ENST00000524462;ENST00000525621;ENST00000264818;ENST00000543792;ENST00000529370	T;T;T;T	0.10668	2.85;2.85;2.85;2.85	4.22	-1.01	0.10169	FERM domain (1);	1.740170	0.03671	N	0.243955	T	0.09113	0.0225	N	0.08118	0	0.09310	N	1	D;D	0.65815	0.995;0.989	P;P	0.48677	0.517;0.586	T	0.32877	-0.9890	10	0.66056	D	0.02	-2.09	8.252	0.31732	0.0:0.1173:0.3931:0.4895	.	370;370	E9PPF2;P29597	.;TYK2_HUMAN	W	185;370;370;117;370	ENSP00000433203:R185W;ENSP00000431885:R370W;ENSP00000264818:R370W;ENSP00000432728:R370W	ENSP00000264818:R370W	R	-	1	2	TYK2	10336628	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.215000	0.17562	-0.156000	0.11079	-0.514000	0.04452	CGG	.		0.617	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389443.1		
UBN1	29855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	4924702	4924702	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr16:4924702C>A	ENST00000396658.4	+	14	2994	c.2291C>A	c.(2290-2292)tCc>tAc	p.S764Y	UBN1_ENST00000262376.6_Missense_Mutation_p.S764Y|UBN1_ENST00000545171.1_Missense_Mutation_p.S764Y|UBN1_ENST00000590769.1_Missense_Mutation_p.S764Y	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	764					chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						AAAGAGCTGTCCTGCCAGGCT	0.557																																					p.S764Y		.											.	UBN1	92	0			c.C2291A						.						59.0	65.0	63.0					16																	4924702		2197	4300	6497	SO:0001583	missense	29855	exon15			AGCTGTCCTGCCA	AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.2291C>A	16.37:g.4924702C>A	ENSP00000379894:p.Ser764Tyr	49.0	0.0		24.0	4.0	NM_001079514	B7Z6D3|D3DUE8|Q13079|Q9P1P7	Missense_Mutation	SNP	ENST00000396658.4	37	CCDS10525.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.252105	0.59212	.	.	ENSG00000118900	ENST00000262376;ENST00000545171;ENST00000396658	T;T;T	0.29655	1.56;1.56;1.56	5.14	4.18	0.49190	.	0.523236	0.19361	N	0.116159	T	0.38480	0.1042	L	0.32530	0.975	0.32514	N	0.537184	P;P	0.47545	0.763;0.897	P;P	0.54590	0.549;0.756	T	0.52472	-0.8571	10	0.72032	D	0.01	-1.4924	14.246	0.65988	0.0:0.8515:0.1485:0.0	.	764;764	Q9NPG3-2;Q9NPG3	.;UBN1_HUMAN	Y	764	ENSP00000262376:S764Y;ENSP00000442379:S764Y;ENSP00000379894:S764Y	ENSP00000262376:S764Y	S	+	2	0	UBN1	4864703	0.984000	0.35163	0.968000	0.41197	0.938000	0.57974	3.617000	0.54181	1.400000	0.46741	0.462000	0.41574	TCC	.		0.557	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251719.1	NM_016936	
VCAN	1462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	82835447	82835447	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr5:82835447A>C	ENST00000265077.3	+	8	7190	c.6625A>C	c.(6625-6627)Act>Cct	p.T2209P	VCAN_ENST00000512590.2_Intron|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000343200.5_Missense_Mutation_p.T1222P|VCAN_ENST00000502527.2_Intron|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000342785.4_Intron|VCAN-AS1_ENST00000512090.1_RNA	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2209	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TTTCTTAGCTACTGCATTAGT	0.378																																					p.T2209P		.											.	VCAN	238	0			c.A6625C						.						92.0	89.0	90.0					5																	82835447		2203	4300	6503	SO:0001583	missense	1462	exon8			TTAGCTACTGCAT	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.6625A>C	5.37:g.82835447A>C	ENSP00000265077:p.Thr2209Pro	123.0	0.0		109.0	58.0	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	A	8.926	0.962297	0.18583	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000513960	T;T;T	0.34472	1.36;1.36;3.02	5.93	-5.58	0.02512	.	0.761271	0.12327	N	0.478717	T	0.22475	0.0542	L	0.60455	1.87	0.09310	N	0.999999	B;B	0.29188	0.236;0.016	B;B	0.22386	0.039;0.003	T	0.29427	-1.0012	10	0.66056	D	0.02	.	0.5685	0.00691	0.3764:0.2353:0.1566:0.2317	.	1222;2209	P13611-2;P13611	.;CSPG2_HUMAN	P	2209;1222;1222	ENSP00000265077:T2209P;ENSP00000340062:T1222P;ENSP00000426251:T1222P	ENSP00000265077:T2209P	T	+	1	0	VCAN	82871203	0.000000	0.05858	0.015000	0.15790	0.026000	0.11368	-0.428000	0.06991	-0.514000	0.06488	-0.256000	0.11100	ACT	.		0.378	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
WDR1	9948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	10077080	10077080	+	Silent	SNP	G	G	A			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr4:10077080G>A	ENST00000499869.2	-	15	1936	c.1743C>T	c.(1741-1743)agC>agT	p.S581S	WDR1_ENST00000382452.2_Silent_p.S581S|WDR1_ENST00000515743.1_5'UTR|WDR1_ENST00000382451.2_Silent_p.S441S|RP11-448G15.3_ENST00000561486.1_RNA|WDR1_ENST00000502702.1_Silent_p.S441S			O75083	WDR1_HUMAN	WD repeat domain 1	581					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sensory perception of sound (GO:0007605)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|lung(5)|ovary(2)|pancreas(1)|urinary_tract(1)	12				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		GCCAGGCCAGGCTGCTGACAT	0.557																																					p.S581S		.											.	WDR1	48	0			c.C1743T						.						47.0	53.0	51.0					4																	10077080		2123	4233	6356	SO:0001819	synonymous_variant	9948	exon15			GGCCAGGCTGCTG	AF020260	CCDS54739.1, CCDS54740.1	4p16.1	2013-01-09			ENSG00000071127	ENSG00000071127		"""WD repeat domain containing"""	12754	protein-coding gene	gene with protein product		604734				10036186	Standard	NM_017491		Approved		uc021xlv.1	O75083	OTTHUMG00000160253	ENST00000499869.2:c.1743C>T	4.37:g.10077080G>A		387.0	1.0		200.0	68.0	NM_017491	A8K6E9|A8MPU4|O75313|Q8N6E5|Q9UG05|Q9UG78|Q9UQE0	Silent	SNP	ENST00000499869.2	37	CCDS54740.1																																																																																			.		0.557	WDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359877.1		
ZDHHC12	84885	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	131483968	131483968	+	Silent	SNP	C	C	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr9:131483968C>T	ENST00000372663.4	-	4	456	c.444G>A	c.(442-444)ctG>ctA	p.L148L	ZDHHC12_ENST00000467312.1_5'UTR|ZDHHC12_ENST00000372667.5_Silent_p.L162L|RP11-545E17.3_ENST00000443631.1_RNA|ZDHHC12_ENST00000372672.2_Silent_p.L148L	NM_032799.4	NP_116188	Q96GR4	ZDH12_HUMAN	zinc finger, DHHC-type containing 12	148					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(1)|ovary(2)|upper_aerodigestive_tract(1)	4						CCACCAGCTGCAGCGCCAGGT	0.647																																					p.L148L		.											.	ZDHHC12	90	0			c.G444A						.						157.0	143.0	148.0					9																	131483968		2203	4300	6503	SO:0001819	synonymous_variant	84885	exon4			CAGCTGCAGCGCC	AK027430	CCDS6909.1	9q34.11	2008-02-05			ENSG00000160446	ENSG00000160446		"""Zinc fingers, DHHC-type"""	19159	protein-coding gene	gene with protein product							Standard	NM_032799		Approved	ZNF400, FLJ14524	uc004bvy.3	Q96GR4	OTTHUMG00000020756	ENST00000372663.4:c.444G>A	9.37:g.131483968C>T		618.0	0.0		267.0	31.0	NM_032799	A6NH95|B2RE03|Q5T265|Q5T267|Q5T268|Q86VT5|Q96T09	Silent	SNP	ENST00000372663.4	37	CCDS6909.1																																																																																			.		0.647	ZDHHC12-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054484.1	NM_032799	
ZDHHC5	25921	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57466587	57466587	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr11:57466587G>T	ENST00000287169.3	+	11	3041	c.1679G>T	c.(1678-1680)cGt>cTt	p.R560L	ZDHHC5_ENST00000527985.1_Missense_Mutation_p.R507L	NM_015457.2	NP_056272.2	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC-type containing 5	560					protein palmitoylation (GO:0018345)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(3)|lung(5)|skin(1)	18						CTCCCGGGCCGTGAGGAAGAA	0.587																																					p.R560L		.											.	ZDHHC5	226	0			c.G1679T						.						67.0	73.0	71.0					11																	57466587		2201	4296	6497	SO:0001583	missense	25921	exon11			CGGGCCGTGAGGA	AB051535	CCDS7965.1	11q13.1	2008-05-02			ENSG00000156599	ENSG00000156599		"""Zinc fingers, DHHC-type"""	18472	protein-coding gene	gene with protein product		614586				11214970	Standard	NM_015457		Approved	KIAA1748, ZNF375	uc001nkx.1	Q9C0B5	OTTHUMG00000167198	ENST00000287169.3:c.1679G>T	11.37:g.57466587G>T	ENSP00000287169:p.Arg560Leu	92.0	0.0		63.0	15.0	NM_015457	Q2TGF0|Q6ZMF0|Q8TAK8|Q9H923|Q9UFI7	Missense_Mutation	SNP	ENST00000287169.3	37	CCDS7965.1	.	.	.	.	.	.	.	.	.	.	G	12.10	1.835843	0.32421	.	.	ENSG00000156599	ENST00000527985;ENST00000287169	T;T	0.59638	0.25;1.25	5.3	3.38	0.38709	.	0.340347	0.27951	N	0.017181	T	0.43144	0.1234	L	0.29908	0.895	0.40417	D	0.979806	B	0.18968	0.032	B	0.17722	0.019	T	0.37056	-0.9722	10	0.66056	D	0.02	-1.4425	8.4462	0.32843	0.2373:0.0:0.7627:0.0	.	560	Q9C0B5	ZDHC5_HUMAN	L	507;560	ENSP00000432202:R507L;ENSP00000287169:R560L	ENSP00000287169:R560L	R	+	2	0	ZDHHC5	57223163	0.000000	0.05858	0.938000	0.37757	0.933000	0.57130	0.386000	0.20702	0.773000	0.33404	0.655000	0.94253	CGT	.		0.587	ZDHHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393694.1	NM_015457	
ZFP62	643836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	180276821	180276821	+	Silent	SNP	T	T	C			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr5:180276821T>C	ENST00000502412.1	-	2	1731	c.1674A>G	c.(1672-1674)gaA>gaG	p.E558E	ZFP62_ENST00000506377.1_Intron|ZFP62_ENST00000512132.1_Silent_p.E525E|ZFP62_ENST00000359141.6_Silent_p.E498E	NM_001172638.1	NP_001166109.1	Q8NB50	ZFP62_HUMAN	ZFP62 zinc finger protein	558					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|endometrium(2)|pancreas(1)	4	all_cancers(89;4.01e-05)|all_epithelial(37;4.69e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00469)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGTAAGGTCGTTCCCCAGTGT	0.423																																					p.E558E		.											.	.	.	0			c.A1674G						.						116.0	99.0	104.0					5																	180276821		692	1591	2283	SO:0001819	synonymous_variant	643836	exon2			AGGTCGTTCCCCA	AK002206	CCDS47357.1, CCDS47357.2, CCDS54955.1	5q35.3	2013-01-08	2012-11-27			ENSG00000196670		"""Zinc fingers, C2H2-type"""	23241	protein-coding gene	gene with protein product		610281	"""zinc finger protein 62 homolog (mouse)"", ""zinc finger protein 62"""			8808410	Standard	NM_152283		Approved	FLJ34231, ZET, ZNF755	uc011dhf.2	Q8NB50		ENST00000502412.1:c.1674A>G	5.37:g.180276821T>C		66.0	0.0		66.0	19.0	NM_001172638	B4DIP6|B4E0N3|B5MDX6|B7ZVZ2|B9EIP6|E9PFT8|J3QTA9	Silent	SNP	ENST00000502412.1	37	CCDS54955.1																																																																																			.		0.423	ZFP62-002	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368386.2	NM_152283	
ZNF469	84627	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	88502790	88502790	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr16:88502790C>T	ENST00000437464.1	+	2	8828	c.8828C>T	c.(8827-8829)gCa>gTa	p.A2943V	ZNF469_ENST00000565624.1_Missense_Mutation_p.A2971V	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2943					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						GAAGCTGGTGCAGAGAAGCTG	0.682																																					p.A2943V		.											.	.	.	0			c.C8828T						.						4.0	6.0	5.0					16																	88502790		651	1530	2181	SO:0001583	missense	84627	exon2			CTGGTGCAGAGAA	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.8828C>T	16.37:g.88502790C>T	ENSP00000402343:p.Ala2943Val	92.0	1.0		41.0	15.0	NM_001127464		Missense_Mutation	SNP	ENST00000437464.1	37	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	C	13.25	2.181211	0.38511	.	.	ENSG00000225614	ENST00000437464	T	0.05580	3.42	4.37	0.463	0.16700	.	.	.	.	.	T	0.03053	0.0090	N	0.14661	0.345	0.09310	N	1	B	0.22080	0.064	B	0.15052	0.012	T	0.48234	-0.9053	9	0.15499	T	0.54	.	4.2482	0.10682	0.2532:0.4664:0.0:0.2804	.	2943	Q96JG9	ZN469_HUMAN	V	2943	ENSP00000402343:A2943V	ENSP00000402343:A2943V	A	+	2	0	ZNF469	87030291	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	0.086000	0.14935	0.171000	0.19730	0.462000	0.41574	GCA	.		0.682	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
ZNF687	57592	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	151258940	151258940	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr1:151258940C>T	ENST00000368879.2	+	2	271	c.173C>T	c.(172-174)tCt>tTt	p.S58F		NM_020832.1	NP_065883.1	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	58					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	32	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GCAGCAGCCTCTGCTGGGGAT	0.567																																					p.S58F		.											.	ZNF687	92	0			c.C173T						.						51.0	56.0	55.0					1																	151258940		2203	4300	6503	SO:0001583	missense	57592	exon2			CAGCCTCTGCTGG		CCDS992.1	1q21.2	2008-05-02			ENSG00000143373	ENSG00000143373			29277	protein-coding gene	gene with protein product		610568				10718198	Standard	NM_020832		Approved	KIAA1441	uc001exq.3	Q8N1G0	OTTHUMG00000012347	ENST00000368879.2:c.173C>T	1.37:g.151258940C>T	ENSP00000357874:p.Ser58Phe	86.0	1.0		74.0	37.0	NM_020832	D3DV17|Q68DQ8|Q9H937|Q9P2A7	Missense_Mutation	SNP	ENST00000368879.2	37		.	.	.	.	.	.	.	.	.	.	C	0.066	-1.212632	0.01555	.	.	ENSG00000143373	ENST00000443959;ENST00000336715;ENST00000324048;ENST00000368879	T;T;T	0.00986	5.47;5.47;5.8	4.1	3.16	0.36331	.	0.490245	0.15027	N	0.284679	T	0.00412	0.0013	L	0.29908	0.895	0.09310	N	1	P;B;B	0.36249	0.545;0.022;0.32	B;B;B	0.34931	0.192;0.016;0.192	T	0.49995	-0.8879	10	0.49607	T	0.09	.	12.6197	0.56595	0.0:0.8312:0.1688:0.0	.	58;58;58	Q8N1G0-2;Q8N1G0;F8WCX2	.;ZN687_HUMAN;.	F	67;58;58;58	ENSP00000336620:S58F;ENSP00000319829:S58F;ENSP00000357874:S58F	ENSP00000319829:S58F	S	+	2	0	ZNF687	149525564	0.014000	0.17966	0.004000	0.12327	0.070000	0.16714	3.347000	0.52200	0.923000	0.37045	0.313000	0.20887	TCT	.		0.567	ZNF687-201	KNOWN	basic	protein_coding	protein_coding		NM_020832	
ZNF710	374655	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	90611162	90611162	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr15:90611162C>T	ENST00000268154.4	+	2	1044	c.793C>T	c.(793-795)Cgc>Tgc	p.R265C		NM_198526.2	NP_940928.2	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	265					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(1)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	19	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			GACCGTGGAACGCCACAAGAA	0.652																																					p.R265C		.											.	ZNF710	90	0			c.C793T						.						43.0	51.0	48.0					15																	90611162		2199	4295	6494	SO:0001583	missense	374655	exon2			GTGGAACGCCACA	AK094712	CCDS10358.1	15q26.1	2013-01-08			ENSG00000140548	ENSG00000140548		"""Zinc fingers, C2H2-type"""	25352	protein-coding gene	gene with protein product							Standard	XM_005254905		Approved	DKFZp547K1113, FLJ37393, FLJ00306	uc002bov.2	Q8N1W2	OTTHUMG00000149812	ENST00000268154.4:c.793C>T	15.37:g.90611162C>T	ENSP00000268154:p.Arg265Cys	196.0	0.0		94.0	51.0	NM_198526	A0AVS3|Q6ZMK9|Q8NDU0	Missense_Mutation	SNP	ENST00000268154.4	37	CCDS10358.1	.	.	.	.	.	.	.	.	.	.	C	17.47	3.398143	0.62177	.	.	ENSG00000140548	ENST00000268154	T	0.10005	2.92	4.96	4.96	0.65561	.	0.465853	0.18202	N	0.148465	T	0.07818	0.0196	N	0.22421	0.69	0.53005	D	0.999967	D	0.56968	0.978	B	0.34452	0.183	T	0.24154	-1.0168	10	0.87932	D	0	-65.6362	16.951	0.86245	0.0:1.0:0.0:0.0	.	265	Q8N1W2	ZN710_HUMAN	C	265	ENSP00000268154:R265C	ENSP00000268154:R265C	R	+	1	0	ZNF710	88412166	0.994000	0.37717	1.000000	0.80357	0.867000	0.49689	1.469000	0.35343	2.574000	0.86865	0.561000	0.74099	CGC	.		0.652	ZNF710-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313423.1	NM_198526	
ZNF76	7629	hgsc.bcm.edu;broad.mit.edu	37	6	35262247	35262247	+	Silent	SNP	C	C	T			TCGA-BC-A5W4-01A-11D-A28X-10	TCGA-BC-A5W4-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b8ed2260-c9ac-4a92-ae6a-8c6d3ec81274	6f170e0b-fdc4-4cc0-a824-cdd9c60aff16	g.chr6:35262247C>T	ENST00000373953.3	+	13	1775	c.1509C>T	c.(1507-1509)acC>acT	p.T503T	ZNF76_ENST00000339411.5_Silent_p.T448T|ZNF76_ENST00000440666.2_Silent_p.T477T	NM_003427.3	NP_003418.2	P36508	ZNF76_HUMAN	zinc finger protein 76	503					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						CAATCATTACCTCTGGGGCTG	0.507											OREG0017373	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T503T	Esophageal Squamous(52;92 1039 20612 23956 34676)	.											.	ZNF76	90	0			c.C1509T						.						207.0	159.0	175.0					6																	35262247		2203	4300	6503	SO:0001819	synonymous_variant	7629	exon13			CATTACCTCTGGG	M91592	CCDS4801.1, CCDS75435.1	6p21.31	2013-01-08	2011-02-25		ENSG00000065029	ENSG00000065029		"""Zinc fingers, C2H2-type"""	13149	protein-coding gene	gene with protein product		194549	"""zinc finger protein 76 (expressed in testis)"""	D6S229E		1427894	Standard	XM_005249364		Approved	Zfp523, ZNF523	uc003oki.1	P36508	OTTHUMG00000014564	ENST00000373953.3:c.1509C>T	6.37:g.35262247C>T		332.0	0.0	854	104.0	5.0	NM_003427	Q9BQB2	Silent	SNP	ENST00000373953.3	37	CCDS4801.1	.	.	.	.	.	.	.	.	.	.	C	8.492	0.862300	0.17178	.	.	ENSG00000065029	ENST00000498555	.	.	.	5.62	1.85	0.25348	.	.	.	.	.	T	0.29783	0.0744	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.12837	-1.0532	4	.	.	.	.	4.0448	0.09768	0.155:0.5064:0.0:0.3386	.	.	.	.	L	36	.	.	P	+	2	0	ZNF76	35370225	0.704000	0.27836	0.998000	0.56505	0.980000	0.70556	-0.274000	0.08537	0.051000	0.15978	0.650000	0.86243	CCT	.		0.507	ZNF76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040279.2	NM_003427	
