#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADCY3	109	broad.mit.edu;ucsc.edu	37	2	25057765	25057765	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr2:25057765C>T	ENST00000260600.5	-	9	2554	c.1703G>A	c.(1702-1704)cGc>cAc	p.R568H	ADCY3_ENST00000405392.1_Missense_Mutation_p.R201H|ADCY3_ENST00000450524.1_5'Flank	NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	568					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GTCCTGCAGGCGCAGCCTCCG	0.647																																					p.R568H		.											.	ADCY3	94	0			c.G1703A						.						30.0	30.0	30.0					2																	25057765		2202	4300	6502	SO:0001583	missense	109	exon9			TGCAGGCGCAGCC	AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.1703G>A	2.37:g.25057765C>T	ENSP00000260600:p.Arg568His	72.0	1.0		40.0	7.0	NM_004036	B3KT86|Q53T54|Q9UDB1	Missense_Mutation	SNP	ENST00000260600.5	37	CCDS1715.1	.	.	.	.	.	.	.	.	.	.	C	17.45	3.393792	0.62066	.	.	ENSG00000138031	ENST00000260600;ENST00000405392;ENST00000415879	T;T	0.46063	0.88;0.88	5.05	4.15	0.48705	.	0.062472	0.64402	N	0.000003	T	0.25457	0.0619	N	0.24115	0.695	0.38209	D	0.94041	B;B;B	0.12013	0.001;0.001;0.005	B;B;B	0.08055	0.001;0.001;0.003	T	0.09292	-1.0681	10	0.08837	T	0.75	.	11.3117	0.49368	0.0:0.9062:0.0:0.0938	.	568;568;201	B7ZLX9;O60266;B3KT86	.;ADCY3_HUMAN;.	H	568;201;543	ENSP00000260600:R568H;ENSP00000384484:R201H	ENSP00000260600:R568H	R	-	2	0	ADCY3	24911269	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.258000	0.65479	1.060000	0.40578	0.563000	0.77884	CGC	.		0.647	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211574.2		
ADAM23	8745	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	207437884	207437884	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr2:207437884G>C	ENST00000264377.3	+	18	2030	c.1702G>C	c.(1702-1704)Gat>Cat	p.D568H	ADAM23_ENST00000374416.1_Missense_Mutation_p.D568H|ADAM23_ENST00000374415.3_Missense_Mutation_p.D568H	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	568	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.|May bind the integrin receptor.				cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		GAACGAGTGTGATATTACTGA	0.378																																					p.D568H	Melanoma(194;1127 2130 19620 24042 27855)	.											.	ADAM23	228	0			c.G1702C						.						272.0	241.0	251.0					2																	207437884		2203	4300	6503	SO:0001583	missense	8745	exon18			GAGTGTGATATTA	AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.1702G>C	2.37:g.207437884G>C	ENSP00000264377:p.Asp568His	165.0	1.0		102.0	12.0	NM_003812	A2RU59	Missense_Mutation	SNP	ENST00000264377.3	37	CCDS2369.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.560591	0.86335	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	T;T;T	0.15256	2.44;2.44;2.44	5.81	5.81	0.92471	Blood coagulation inhibitor, Disintegrin (5);	0.000000	0.64402	D	0.000007	T	0.62417	0.2426	H	0.98446	4.235	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.77739	-0.2475	10	0.87932	D	0	.	18.9069	0.92466	0.0:0.0:1.0:0.0	.	568	O75077	ADA23_HUMAN	H	568;568;462;568	ENSP00000264377:D568H;ENSP00000363537:D568H;ENSP00000363536:D568H	ENSP00000264377:D568H	D	+	1	0	ADAM23	207146129	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.216000	0.89764	2.755000	0.94549	0.650000	0.86243	GAT	.		0.378	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	NM_003812	
AEBP1	165	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	44151907	44151907	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr7:44151907C>T	ENST00000223357.3	+	17	2509	c.2204C>T	c.(2203-2205)tCg>tTg	p.S735L	MIR4649_ENST00000582839.1_RNA|AEBP1_ENST00000450684.2_Missense_Mutation_p.S310L	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	735	Interaction with PTEN. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						CGCTACCTTTCGCCAGATGCC	0.622																																					p.S735L		.											.	AEBP1	90	0			c.C2204T						.																																			SO:0001583	missense	165	exon17			ACCTTTCGCCAGA	D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.2204C>T	7.37:g.44151907C>T	ENSP00000223357:p.Ser735Leu	86.0	1.0		52.0	19.0	NM_001129	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	ENST00000223357.3	37	CCDS5476.1	.	.	.	.	.	.	.	.	.	.	C	12.35	1.911816	0.33721	.	.	ENSG00000106624	ENST00000223357;ENST00000450684	T;T	0.03496	3.91;3.91	4.97	4.97	0.65823	Peptidase M14, carboxypeptidase A (2);	0.337424	0.31989	N	0.006746	T	0.06188	0.0160	L	0.33668	1.02	0.19575	N	0.999966	P;D	0.53619	0.905;0.961	B;P	0.47206	0.145;0.541	T	0.26087	-1.0113	10	0.44086	T	0.13	-48.286	17.3708	0.87377	0.0:1.0:0.0:0.0	.	310;735	Q8IUX7-2;Q8IUX7	.;AEBP1_HUMAN	L	735;310	ENSP00000223357:S735L;ENSP00000398878:S310L	ENSP00000223357:S735L	S	+	2	0	AEBP1	44118432	0.000000	0.05858	0.999000	0.59377	0.464000	0.32679	0.777000	0.26718	2.457000	0.83068	0.462000	0.41574	TCG	.		0.622	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2	NM_001129	
ALDH1L1	10840	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	125844550	125844550	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr3:125844550A>G	ENST00000393434.2	-	15	2058	c.1709T>C	c.(1708-1710)aTc>aCc	p.I570T	ALDH1L1_ENST00000472186.1_Missense_Mutation_p.I570T|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.I469T|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.I580T|ALDH1L1_ENST00000393431.2_3'UTR	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	570	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	CCAGGGGATGATGATGCCACA	0.587																																					p.I580T		.											.	ALDH1L1	156	0			c.T1739C						.						97.0	77.0	83.0					3																	125844550		2203	4300	6503	SO:0001583	missense	10840	exon15			GGGATGATGATGC	AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.1709T>C	3.37:g.125844550A>G	ENSP00000377083:p.Ile570Thr	153.0	1.0		131.0	19.0	NM_001270364	B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	ENST00000393434.2	37	CCDS3034.1	.	.	.	.	.	.	.	.	.	.	A	16.67	3.187325	0.57909	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434	T;T;T;T	0.14640	2.49;2.49;2.49;2.49	4.5	4.5	0.54988	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.348186	0.28841	N	0.013971	T	0.43344	0.1243	H	0.99894	4.905	0.80722	D	1	P;B	0.45768	0.866;0.096	B;B	0.43658	0.41;0.426	T	0.68239	-0.5461	10	0.87932	D	0	.	11.7788	0.52001	1.0:0.0:0.0:0.0	.	469;570	E9PBX3;O75891	.;AL1L1_HUMAN	T	580;570;469;570	ENSP00000273450:I580T;ENSP00000420293:I570T;ENSP00000395881:I469T;ENSP00000377083:I570T	ENSP00000273450:I580T	I	-	2	0	ALDH1L1	127327240	1.000000	0.71417	0.917000	0.36280	0.647000	0.38526	8.421000	0.90259	1.881000	0.54492	0.482000	0.46254	ATC	.		0.587	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354391.1	NM_012190	
ALG3	10195	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	183963596	183963596	+	Silent	SNP	T	T	C			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr3:183963596T>C	ENST00000397676.3	-	2	231	c.201A>G	c.(199-201)acA>acG	p.T67T	ALG3_ENST00000418734.2_Intron|EIF2B5_ENST00000444495.1_Intron|ALG3_ENST00000445626.2_Silent_p.T19T|ALG3_ENST00000455059.1_Silent_p.T27T|ALG3_ENST00000463495.1_5'Flank	NM_005787.5	NP_005778.1	Q92685	ALG3_HUMAN	ALG3, alpha-1,3- mannosyltransferase	67					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)|dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity (GO:0052925)			kidney(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AGTCAATCTCTGTGTCTGGAA	0.507																																					p.T67T		.											.	.	.	0			c.A201G						.						70.0	68.0	69.0					3																	183963596		2011	4192	6203	SO:0001819	synonymous_variant	10195	exon2			AATCTCTGTGTCT	BC002839	CCDS46967.1, CCDS46968.1	3q27.3	2013-02-26	2013-02-26		ENSG00000214160	ENSG00000214160	2.4.1.258	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	23056	protein-coding gene	gene with protein product	"""carbohydrate deficient glycoprotein syndrome type IV"", ""dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase"", ""dol-P-Man dependent alpha-1,3- mannosyltransferase"""	608750	"""asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)"""			1058125	Standard	NM_005787		Approved	NOT56L, Not56, CDGS4, D16Ertd36e	uc003fne.2	Q92685	OTTHUMG00000156823	ENST00000397676.3:c.201A>G	3.37:g.183963596T>C		76.0	1.0		73.0	32.0	NM_005787	A8JZZ6|Q9BT71	Silent	SNP	ENST00000397676.3	37	CCDS46968.1																																																																																			.		0.507	ALG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346033.1	NM_005787	
ALKBH7	84266	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	6374593	6374593	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr19:6374593A>C	ENST00000245812.3	+	3	884	c.496A>C	c.(496-498)Atc>Ctc	p.I166L	ALKBH7_ENST00000596657.1_Missense_Mutation_p.I24L|ALKBH7_ENST00000599849.1_Missense_Mutation_p.I105L	NM_032306.3	NP_115682.1	Q9BT30	ALKB7_HUMAN	alkB, alkylation repair homolog 7 (E. coli)	166					cellular response to DNA damage stimulus (GO:0006974)|fatty acid metabolic process (GO:0006631)|regulation of lipid storage (GO:0010883)|regulation of mitochondrial membrane permeability involved in programmed necrotic cell death (GO:1902445)	mitochondrial matrix (GO:0005759)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						CTCCCTCTACATCCTTAGGTA	0.647																																					p.I166L		.											.	ALKBH7	90	0			c.A496C						.						43.0	51.0	48.0					19																	6374593		2203	4300	6503	SO:0001583	missense	84266	exon3			CTCTACATCCTTA	AY427650	CCDS12163.1	19p13.3	2008-02-05	2006-02-09	2006-02-09		ENSG00000125652		"""Alkylation repair homologs"""	21306	protein-coding gene	gene with protein product		613305	"""spermatogenesis associated 11"""	SPATA11		12477932	Standard	NM_032306		Approved	MGC10974	uc002meo.2	Q9BT30		ENST00000245812.3:c.496A>C	19.37:g.6374593A>C	ENSP00000245812:p.Ile166Leu	69.0	2.0		29.0	15.0	NM_032306	B2R4U9|Q53FF3	Missense_Mutation	SNP	ENST00000245812.3	37	CCDS12163.1	.	.	.	.	.	.	.	.	.	.	A	34	5.323153	0.95708	.	.	ENSG00000125652	ENST00000245812	T	0.12672	2.66	5.26	5.26	0.73747	.	0.058302	0.64402	D	0.000003	T	0.34077	0.0885	M	0.77486	2.375	0.50171	D	0.999859	D	0.67145	0.996	D	0.66847	0.947	T	0.09465	-1.0673	10	0.21540	T	0.41	-19.3469	13.0009	0.58673	1.0:0.0:0.0:0.0	.	166	Q9BT30	ALKB7_HUMAN	L	166	ENSP00000245812:I166L	ENSP00000245812:I166L	I	+	1	0	ALKBH7	6325593	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.332000	0.72934	2.128000	0.65567	0.454000	0.30748	ATC	.		0.647	ALKBH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453036.1	NM_032306	
ANTXR1	84168	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	69379336	69379336	+	Silent	SNP	C	C	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr2:69379336C>T	ENST00000303714.4	+	13	1309	c.987C>T	c.(985-987)atC>atT	p.I329I	ANTXR1_ENST00000409349.3_Silent_p.I329I	NM_032208.2	NP_115584.1	Q9H6X2	ANTR1_HUMAN	anthrax toxin receptor 1	329					actin cytoskeleton reorganization (GO:0031532)|reproductive process (GO:0022414)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|lamellipodium membrane (GO:0031258)	actin filament binding (GO:0051015)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|transmembrane signaling receptor activity (GO:0004888)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						CCCTGCTGATCCTGTTCCTGC	0.612									Familial Infantile Hemangioma																												p.I329I		.											.	ANTXR1	94	0			c.C987T						.						225.0	161.0	183.0					2																	69379336		2203	4300	6503	SO:0001819	synonymous_variant	84168	exon13	Familial Cancer Database	Infantile Capillary Hemangioma, HCI, Hereditary Capillary Hemangioma	GCTGATCCTGTTC	AF421380	CCDS1892.1, CCDS46313.1, CCDS46314.1	2p13.1	2006-04-12			ENSG00000169604	ENSG00000169604			21014	protein-coding gene	gene with protein product	"""anthrax toxin receptor"", ""tumor endothelial marker 8 precursor"""	606410				10947988, 11559528	Standard	NM_032208		Approved	TEM8, FLJ21776, FLJ10601, ATR	uc002sfg.3	Q9H6X2	OTTHUMG00000129575	ENST00000303714.4:c.987C>T	2.37:g.69379336C>T		64.0	1.0		35.0	19.0	NM_032208	A8K7U8|J7K7G4|J7KF88|Q4ZFV6|Q53QD8|Q96P02|Q9NVP3	Silent	SNP	ENST00000303714.4	37	CCDS1892.1																																																																																			.		0.612	ANTXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251770.2	NM_032208	
AMMECR1L	83607	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	128628831	128628831	+	Silent	SNP	C	C	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr2:128628831C>T	ENST00000272647.5	-	4	770	c.510G>A	c.(508-510)acG>acA	p.T170T	AMMECR1L_ENST00000393001.1_Silent_p.T170T	NM_001199140.1	NP_001186069.1	Q6DCA0	AMERL_HUMAN	AMMECR1-like	170	AMMECR1. {ECO:0000255|PROSITE- ProRule:PRU00467}.									central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	9	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.07)		ACCTGGTTAACGTGTATTCCC	0.458																																					p.T170T		.											.	AMMECR1L	90	0			c.G510A						.						74.0	72.0	73.0					2																	128628831		2203	4300	6503	SO:0001819	synonymous_variant	83607	exon4			GGTTAACGTGTAT		CCDS2152.1	2q21	2012-11-15	2012-11-15		ENSG00000144233	ENSG00000144233			28658	protein-coding gene	gene with protein product			"""AMME chromosomal region gene 1-like"""				Standard	NM_001199140		Approved	MGC4268	uc002tpl.3	Q6DCA0	OTTHUMG00000131535	ENST00000272647.5:c.510G>A	2.37:g.128628831C>T		74.0	0.0		44.0	10.0	NM_031445	B4E276	Silent	SNP	ENST00000272647.5	37	CCDS2152.1																																																																																			.		0.458	AMMECR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254392.1	NM_031445	
ARHGEF18	23370	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	7535139	7535139	+	Silent	SNP	C	C	G			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr19:7535139C>G	ENST00000359920.6	+	19	3730	c.3477C>G	c.(3475-3477)ctC>ctG	p.L1159L	ARHGEF18_ENST00000319670.9_Silent_p.L1001L	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	1159					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				CCACACCACTCAGCGCCAAGG	0.672																																					p.L1159L		.											.	ARHGEF18	228	0			c.C3477G						.						28.0	34.0	32.0					19																	7535139		2199	4295	6494	SO:0001819	synonymous_variant	23370	exon19			ACCACTCAGCGCC	AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.3477C>G	19.37:g.7535139C>G		115.0	1.0		51.0	27.0	NM_001130955	A8MV62|B5ME81|O60274|Q6DD92	Silent	SNP	ENST00000359920.6	37	CCDS45946.1																																																																																			.		0.672	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436340.1	NM_015318	
ART3	419	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	77025763	77025763	+	Silent	SNP	A	A	G			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr4:77025763A>G	ENST00000355810.4	+	10	1103	c.984A>G	c.(982-984)ccA>ccG	p.P328P	ART3_ENST00000349321.3_Intron|ART3_ENST00000341029.5_Intron	NM_001130016.2	NP_001123488.1	Q13508	NAR3_HUMAN	ADP-ribosyltransferase 3	328					protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|stomach(1)	16			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TGAAAATTCCAGAACCTTTTC	0.423																																					p.P328P		.											.	ART3	92	0			c.A984G						.						190.0	162.0	170.0					4																	77025763		692	1591	2283	SO:0001819	synonymous_variant	419	exon10			AATTCCAGAACCT	X95827	CCDS3575.1, CCDS47079.1, CCDS47080.1	4q21.1	2008-05-15			ENSG00000156219	ENSG00000156219			725	protein-coding gene	gene with protein product		603086				9119374	Standard	NM_001130017		Approved		uc003hjo.3	Q13508	OTTHUMG00000130110	ENST00000355810.4:c.984A>G	4.37:g.77025763A>G		97.0	1.0		47.0	36.0	NM_001130016	Q53XW3|Q6FHT7|Q8WVJ7|Q93069|Q96HL1	Silent	SNP	ENST00000355810.4	37	CCDS47079.1																																																																																			.		0.423	ART3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252416.2	NM_001179	
ATP13A2	23400	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	17331296	17331296	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr1:17331296G>A	ENST00000326735.8	-	5	401	c.368C>T	c.(367-369)tCc>tTc	p.S123F	ATP13A2_ENST00000341676.5_Missense_Mutation_p.S123F|RP1-37C10.3_ENST00000446261.1_RNA|ATP13A2_ENST00000452699.1_Missense_Mutation_p.S123F			Q9NQ11	AT132_HUMAN	ATPase type 13A2	123					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.S123F(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		CTCTGCCTGGGACTGTGGGGA	0.662																																					p.S123F		.											.	ATP13A2	93	1	Substitution - Missense(1)	lung(1)	c.C368T						.						54.0	59.0	57.0					1																	17331296		2203	4300	6503	SO:0001583	missense	23400	exon5			GCCTGGGACTGTG	AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.368C>T	1.37:g.17331296G>A	ENSP00000327214:p.Ser123Phe	125.0	0.0		59.0	6.0	NM_001141973	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Missense_Mutation	SNP	ENST00000326735.8	37	CCDS175.1	.	.	.	.	.	.	.	.	.	.	G	4.583	0.108308	0.08780	.	.	ENSG00000159363	ENST00000326735;ENST00000341676;ENST00000452699;ENST00000511957	T;T;T;T	0.64260	1.9;1.9;1.9;-0.09	4.21	-3.27	0.05048	.	2.347610	0.01220	N	0.008094	T	0.41073	0.1143	N	0.08118	0	0.09310	N	1	B;B;B	0.20368	0.018;0.023;0.044	B;B;B	0.32928	0.063;0.004;0.155	T	0.25847	-1.0120	10	0.46703	T	0.11	-0.523	0.8787	0.01230	0.3168:0.1134:0.3486:0.2212	.	123;123;123	Q5JXY1;Q6S9Z9;Q9NQ11	.;.;AT132_HUMAN	F	123;123;123;27	ENSP00000327214:S123F;ENSP00000341115:S123F;ENSP00000413307:S123F;ENSP00000427241:S27F	ENSP00000327214:S123F	S	-	2	0	ATP13A2	17203883	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-0.072000	0.11486	-0.497000	0.06641	-0.657000	0.03884	TCC	.		0.662	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006617.1	NM_022089	
ATP1A2	477	ucsc.edu;bcgsc.ca	37	1	160106381	160106381	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr1:160106381G>T	ENST00000361216.3	+	19	2674	c.2585G>T	c.(2584-2586)gGc>gTc	p.G862V	ATP1A2_ENST00000392233.3_Missense_Mutation_p.G862V	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	862					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			GCACTGGGTGGCTTCTTCACC	0.597																																					p.G862V		.											.	ATP1A2	518	0			c.G2585T						.						117.0	102.0	107.0					1																	160106381		2203	4300	6503	SO:0001583	missense	477	exon19			TGGGTGGCTTCTT	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.2585G>T	1.37:g.160106381G>T	ENSP00000354490:p.Gly862Val	105.0	2.0		87.0	32.0	NM_000702	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	ENST00000361216.3	37	CCDS1196.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.589038	0.86851	.	.	ENSG00000018625	ENST00000361216;ENST00000392233;ENST00000435866	D;D	0.88201	-2.35;-2.35	4.71	4.71	0.59529	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.94420	0.8205	M	0.89478	3.035	0.80722	D	1	D	0.65815	0.995	D	0.70935	0.971	D	0.95040	0.8177	10	0.87932	D	0	.	15.5314	0.75964	0.0:0.0:1.0:0.0	.	862	P50993	AT1A2_HUMAN	V	862;862;565	ENSP00000354490:G862V;ENSP00000376066:G862V	ENSP00000354490:G862V	G	+	2	0	ATP1A2	158373005	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.586000	0.82596	2.590000	0.87494	0.561000	0.74099	GGC	.		0.597	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	NM_000702	
ATP2B2	491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	10417206	10417206	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr3:10417206T>C	ENST00000352432.4	-	10	1393	c.1324A>G	c.(1324-1326)Aag>Gag	p.K442E	ATP2B2_ENST00000397077.1_Missense_Mutation_p.K397E|ATP2B2_ENST00000383800.4_Missense_Mutation_p.K397E|ATP2B2_ENST00000360273.2_Missense_Mutation_p.K442E|ATP2B2_ENST00000343816.4_Missense_Mutation_p.K428E			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	442					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						ATGAAGAACTTGACAAAGTAC	0.587																																					p.K442E	Ovarian(125;1619 1709 15675 19819 38835)	.											.	ATP2B2	95	0			c.A1324G						.						96.0	89.0	91.0					3																	10417206		2203	4300	6503	SO:0001583	missense	491	exon11			AGAACTTGACAAA	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.1324A>G	3.37:g.10417206T>C	ENSP00000324172:p.Lys442Glu	135.0	0.0		126.0	13.0	NM_001001331	O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	37	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.760115	0.89932	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42;-2.42;-2.42	4.48	4.48	0.54585	ATPase, P-type, ATPase-associated domain (1);	0.096864	0.64402	D	0.000001	D	0.82416	0.5032	N	0.20483	0.58	0.80722	D	1	P;B;B	0.48089	0.905;0.099;0.233	B;B;B	0.43508	0.422;0.042;0.245	D	0.83890	0.0284	10	0.45353	T	0.12	-28.7124	13.9721	0.64247	0.0:0.0:0.0:1.0	.	377;409;442	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	E	442;397;397;442;428;377;298;442	ENSP00000324172:K442E;ENSP00000373311:K397E;ENSP00000380267:K397E;ENSP00000353414:K442E;ENSP00000344677:K428E;ENSP00000414854:K298E	ENSP00000342954:K442E	K	-	1	0	ATP2B2	10392206	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.868000	0.87116	1.884000	0.54569	0.459000	0.35465	AAG	.		0.587	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683	
BAI3	577	ucsc.edu;bcgsc.ca	37	6	69349266	69349266	+	Missense_Mutation	SNP	G	G	T	rs146475807		TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr6:69349266G>T	ENST00000370598.1	+	3	1520	c.699G>T	c.(697-699)gaG>gaT	p.E233D		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	233					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TGACCCAGGAGCTGCAAACCA	0.547																																					p.E233D		.											.	BAI3	1148	0			c.G699T						.						27.0	27.0	27.0					6																	69349266		2203	4298	6501	SO:0001583	missense	577	exon3			CCAGGAGCTGCAA	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.699G>T	6.37:g.69349266G>T	ENSP00000359630:p.Glu233Asp	61.0	2.0		23.0	15.0	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	G	4.394	0.072667	0.08436	.	.	ENSG00000135298	ENST00000370598	T	0.20598	2.06	5.23	4.35	0.52113	.	0.074904	0.53938	D	0.000055	T	0.02418	0.0074	N	0.08118	0	0.80722	D	1	B	0.32918	0.39	B	0.26864	0.074	T	0.23404	-1.0189	10	0.02654	T	1	.	9.98	0.41809	0.2181:0.0:0.7819:0.0	.	233	O60242	BAI3_HUMAN	D	233	ENSP00000359630:E233D	ENSP00000359630:E233D	E	+	3	2	BAI3	69405987	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.308000	0.43690	1.306000	0.44926	0.563000	0.77884	GAG	G|1.000;A|0.000		0.547	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
SPECC1	92521	broad.mit.edu;ucsc.edu;mdanderson.org	37	17	20224663	20224663	+	IGR	SNP	G	G	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr17:20224663G>A	ENST00000395530.2	+	0	8133				AC004702.2_ENST00000580225.1_lincRNA|U6_ENST00000517027.1_RNA|CCDC144CP_ENST00000340196.4_RNA	NM_001033555.2	NP_001028727.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1						cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		GCGGGGAGGGGCTGAGGGGTC	0.632																																					.		.											.	.	.	0			.						.																																			SO:0001628	intergenic_variant	348254	.			GGAGGGGCTGAGG	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808		17.37:g.20224663G>A		105.0	0.0		48.0	16.0	.	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	RNA	SNP	ENST00000395530.2	37	CCDS42281.1	.	.	.	.	.	.	.	.	.	.	.	0.010	-1.785611	0.00628	.	.	ENSG00000154898	ENST00000340196;ENST00000425519	.	.	.	0.565	-1.13	0.09775	.	.	.	.	.	T	0.18509	0.0444	.	.	.	0.23056	N	0.998368	.	.	.	.	.	.	T	0.18587	-1.0332	3	0.54805	T	0.06	.	.	.	.	.	.	.	.	T	12	.	ENSP00000343605:A12T	A	+	1	0	CCDC144C	20165255	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-3.765000	0.00372	-3.872000	0.00096	-3.908000	0.00016	GCT	.		0.632	SPECC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132368.3	NM_152904	
CCNJL	79616	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	159686508	159686508	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr5:159686508T>G	ENST00000393977.3	-	5	980	c.695A>C	c.(694-696)tAt>tCt	p.Y232S	CCNJL_ENST00000377503.2_5'UTR|CCNJL_ENST00000257536.7_Missense_Mutation_p.Y184S|CCNJL_ENST00000519673.1_Missense_Mutation_p.Y184S|CCNJL_ENST00000541762.1_Missense_Mutation_p.Y183S	NM_024565.5	NP_078841.3	Q8IV13	CCNJL_HUMAN	cyclin J-like	232						nucleus (GO:0005634)				endometrium(2)|kidney(5)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTAATGGGCATACTCCTTGAG	0.637																																					p.Y232S		.											.	CCNJL	90	0			c.A695C						.						68.0	73.0	71.0					5																	159686508		2068	4189	6257	SO:0001583	missense	79616	exon5			TGGGCATACTCCT	BC013353	CCDS4350.2	5q33.3	2008-10-31			ENSG00000135083	ENSG00000135083			25876	protein-coding gene	gene with protein product						12477932	Standard	XM_005265982		Approved	FLJ14166	uc003lyb.1	Q8IV13	OTTHUMG00000130325	ENST00000393977.3:c.695A>C	5.37:g.159686508T>G	ENSP00000377547:p.Tyr232Ser	48.0	0.0		31.0	7.0	NM_024565	Q6ZN43|Q9H7W8	Missense_Mutation	SNP	ENST00000393977.3	37	CCDS4350.2	.	.	.	.	.	.	.	.	.	.	T	20.5	4.001583	0.74818	.	.	ENSG00000135083	ENST00000393977;ENST00000257536;ENST00000519673;ENST00000541762	T;T;T;T	0.21734	1.99;1.99;1.99;1.99	5.41	4.22	0.49857	Cyclin, C-terminal (1);Cyclin-like (3);	0.064020	0.64402	D	0.000004	T	0.41880	0.1178	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.995;0.999;1.0	T	0.25012	-1.0144	10	0.87932	D	0	-11.5958	11.3202	0.49417	0.1365:0.0:0.0:0.8635	.	184;184;232	E7EN43;B4DZA8;Q8IV13	.;.;CCNJL_HUMAN	S	232;184;184;183	ENSP00000377547:Y232S;ENSP00000257536:Y184S;ENSP00000427960:Y184S;ENSP00000446367:Y183S	ENSP00000257536:Y184S	Y	-	2	0	CCNJL	159619086	1.000000	0.71417	0.473000	0.27253	0.946000	0.59487	5.018000	0.64054	0.842000	0.35045	0.533000	0.62120	TAT	.		0.637	CCNJL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252674.1	NM_024565	
CILP2	148113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	19655201	19655201	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr19:19655201C>A	ENST00000291495.5	+	8	1932	c.1847C>A	c.(1846-1848)aCc>aAc	p.T616N	CILP2_ENST00000586018.1_Missense_Mutation_p.T622N	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	616						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						CGAGACCTCACCTCGGCGGCG	0.692																																					p.T616N		.											.	CILP2	91	0			c.C1847A						.						46.0	55.0	52.0					19																	19655201		2200	4298	6498	SO:0001583	missense	148113	exon8			ACCTCACCTCGGC	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.1847C>A	19.37:g.19655201C>A	ENSP00000291495:p.Thr616Asn	71.0	0.0		41.0	17.0	NM_153221	Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	ENST00000291495.5	37	CCDS12405.1	.	.	.	.	.	.	.	.	.	.	C	12.32	1.902375	0.33628	.	.	ENSG00000160161	ENST00000291495	T	0.44881	0.91	4.37	3.32	0.38043	.	0.539436	0.19585	N	0.110752	T	0.29256	0.0728	N	0.19112	0.55	0.26737	N	0.970478	B;B	0.24092	0.097;0.097	B;B	0.26094	0.051;0.066	T	0.26883	-1.0090	10	0.66056	D	0.02	-13.3451	11.028	0.47757	0.0:0.6349:0.3651:0.0	.	616;616	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	N	616	ENSP00000291495:T616N	ENSP00000291495:T616N	T	+	2	0	CILP2	19516201	0.355000	0.24921	0.014000	0.15608	0.785000	0.44390	3.087000	0.50167	0.819000	0.34492	0.485000	0.47835	ACC	.		0.692	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221	
COL5A2	1290	broad.mit.edu;bcgsc.ca	37	2	190044308	190044308	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr2:190044308G>T	ENST00000374866.3	-	1	297	c.23C>A	c.(22-24)gCa>gAa	p.A8E		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	8					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			GAGAGGTCTTGCTTCCGCCCA	0.418																																					p.A8E		.											.	COL5A2	92	0			c.C23A						.						62.0	56.0	58.0					2																	190044308		2203	4300	6503	SO:0001583	missense	1290	exon1			GGTCTTGCTTCCG	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.23C>A	2.37:g.190044308G>T	ENSP00000364000:p.Ala8Glu	83.0	0.0		64.0	5.0	NM_000393	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	G	13.02	2.110907	0.37242	.	.	ENSG00000204262	ENST00000374866	D	0.89939	-2.59	4.83	4.83	0.62350	.	0.393327	0.18308	N	0.145205	T	0.72542	0.3473	N	0.08118	0	0.23716	N	0.997039	B	0.33694	0.421	B	0.22386	0.039	T	0.61869	-0.6974	9	.	.	.	.	8.7539	0.34635	0.0808:0.2708:0.6484:0.0	.	8	P05997	CO5A2_HUMAN	E	8	ENSP00000364000:A8E	.	A	-	2	0	COL5A2	189752553	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.144000	0.42197	2.501000	0.84356	0.591000	0.81541	GCA	.		0.418	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393	
CPAMD8	27151	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17040002	17040002	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr19:17040002T>A	ENST00000443236.1	-	24	3066	c.3035A>T	c.(3034-3036)cAg>cTg	p.Q1012L		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	965						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CAGTGGCCGCTGCACATACTG	0.587																																					p.Q1012L		.											.	CPAMD8	141	0			c.A3035T						.						48.0	55.0	53.0					19																	17040002		2096	4227	6323	SO:0001583	missense	27151	exon24			GGCCGCTGCACAT	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3035A>T	19.37:g.17040002T>A	ENSP00000402505:p.Gln1012Leu	37.0	0.0		30.0	5.0	NM_015692	Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	37	CCDS42519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.98|15.98	2.992975|2.992975	0.54041|0.54041	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000291440|ENST00000443236	.|.	.|.	.|.	3.4|3.4	2.32|2.32	0.28847|0.28847	.|.	0.196250|.	0.33364|.	U|.	0.004989|.	T|T	0.59487|0.59487	0.2197|0.2197	L|L	0.57536|0.57536	1.79|1.79	0.80722|0.80722	D|D	1|1	P|.	0.44195|.	0.828|.	B|.	0.33750|.	0.169|.	T|T	0.52343|0.52343	-0.8588|-0.8588	9|5	0.28530|.	T|.	0.3|.	.|.	9.3067|9.3067	0.37878|0.37878	0.0:0.0:0.1819:0.8181|0.0:0.0:0.1819:0.8181	.|.	965|.	Q8IZJ3|.	CPMD8_HUMAN|.	L|C	1012|1023	.|.	ENSP00000291440:Q1012L|.	Q|S	-|-	2|1	0|0	CPAMD8|CPAMD8	16901002|16901002	1.000000|1.000000	0.71417|0.71417	0.509000|0.509000	0.27700|0.27700	0.897000|0.897000	0.52465|0.52465	3.063000|3.063000	0.49978|0.49978	0.213000|0.213000	0.20722|0.20722	0.533000|0.533000	0.62120|0.62120	CAG|AGC	.		0.587	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692	
CSMD1	64478	hgsc.bcm.edu;broad.mit.edu	37	8	3165845	3165845	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr8:3165845G>T	ENST00000520002.1	-	25	4370	c.3815C>A	c.(3814-3816)cCt>cAt	p.P1272H	CSMD1_ENST00000537824.1_Missense_Mutation_p.P1271H|CSMD1_ENST00000602723.1_Missense_Mutation_p.P1272H|CSMD1_ENST00000400186.3_Missense_Mutation_p.P1272H|CSMD1_ENST00000542608.1_Missense_Mutation_p.P1271H|CSMD1_ENST00000602557.1_Missense_Mutation_p.P1272H|CSMD1_ENST00000539096.1_Missense_Mutation_p.P1271H			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1272	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TATGCACGAAGGTAGTGGTTT	0.502																																					p.P1271H		.											.	CSMD1	86	0			c.C3812A						.						118.0	112.0	114.0					8																	3165845		2095	4225	6320	SO:0001583	missense	64478	exon24			CACGAAGGTAGTG			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.3815C>A	8.37:g.3165845G>T	ENSP00000430733:p.Pro1272His	71.0	0.0		22.0	4.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	G	16.01	3.000811	0.54254	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11	5.22	4.31	0.51392	Complement control module (2);Sushi/SCR/CCP (3);	0.068318	0.64402	N	0.000014	D	0.93171	0.7825	H	0.99555	4.625	0.80722	D	1	D;D;D	0.89917	0.992;1.0;1.0	P;D;D	0.81914	0.873;0.995;0.985	D	0.95834	0.8860	10	0.87932	D	0	.	15.1701	0.72865	0.0:0.0:0.8586:0.1414	.	1272;1272;1272	E5RIG2;Q96PZ7;Q96PZ7-4	.;CSMD1_HUMAN;.	H	1272;1272;1134;1271;1271;1271	ENSP00000383047:P1272H;ENSP00000430733:P1272H;ENSP00000441462:P1271H;ENSP00000446243:P1271H;ENSP00000441675:P1271H	ENSP00000320445:P1134H	P	-	2	0	CSMD1	3153252	1.000000	0.71417	0.851000	0.33527	0.204000	0.24138	7.663000	0.83820	2.414000	0.81942	0.561000	0.74099	CCT	.		0.502	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CTNNB1	1499	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	41274909	41274909	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr3:41274909A>T	ENST00000349496.5	+	8	1439	c.1159A>T	c.(1159-1161)Aat>Tat	p.N387Y	CTNNB1_ENST00000396183.3_Missense_Mutation_p.N387Y|CTNNB1_ENST00000396185.3_Missense_Mutation_p.N387Y|CTNNB1_ENST00000453024.1_Missense_Mutation_p.N380Y|CTNNB1_ENST00000405570.1_Missense_Mutation_p.N387Y	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	387					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GACTCTCAGGAATCTTTCAGA	0.393		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.N387Y	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1	24361	0			c.A1159T						.						102.0	93.0	96.0					3																	41274909		2203	4300	6503	SO:0001583	missense	1499	exon8	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CTCAGGAATCTTT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1159A>T	3.37:g.41274909A>T	ENSP00000344456:p.Asn387Tyr	173.0	1.0		170.0	64.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.523001	0.85600	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	D;D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68;-1.68	5.72	5.72	0.89469	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.92430	0.7597	M	0.89478	3.035	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.93767	0.7071	10	0.87932	D	0	-10.1444	15.9983	0.80268	1.0:0.0:0.0:0.0	.	315;387	B4DSW9;P35222	.;CTNB1_HUMAN	Y	387;387;387;380;387	ENSP00000385604:N387Y;ENSP00000379486:N387Y;ENSP00000344456:N387Y;ENSP00000411226:N380Y;ENSP00000379488:N387Y	ENSP00000344456:N387Y	N	+	1	0	CTNNB1	41249913	1.000000	0.71417	0.987000	0.45799	0.998000	0.95712	9.339000	0.96797	2.171000	0.68590	0.533000	0.62120	AAT	.		0.393	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CTSD	1509	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	1778644	1778644	+	Missense_Mutation	SNP	C	C	T	rs371522391		TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr11:1778644C>T	ENST00000236671.2	-	5	746	c.614G>A	c.(613-615)cGc>cAc	p.R205H	AC068580.6_ENST00000449248.1_RNA|RP11-295K3.1_ENST00000427721.1_Missense_Mutation_p.A76T	NM_001909.4	NP_001900.1	P07339	CATD_HUMAN	cathepsin D	205					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|autophagic vacuole assembly (GO:0000045)|cell death (GO:0008219)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(1)|large_intestine(4)|lung(8)	13		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GACGGAGATGCGGGGGTAGGC	0.587																																					p.R205H		.											.	CTSD	90	0			c.G614A						.	C	HIS/ARG	1,4403	2.1+/-5.4	0,1,2201	194.0	126.0	149.0		614	-2.9	1.0	11		149	0,8598		0,0,4299	no	missense	CTSD	NM_001909.4	29	0,1,6500	TT,TC,CC		0.0,0.0227,0.0077	benign	205/413	1778644	1,13001	2202	4299	6501	SO:0001583	missense	1509	exon5			GAGATGCGGGGGT	M11233	CCDS7725.1	11p15.5	2009-06-26	2006-12-05		ENSG00000117984	ENSG00000117984	3.4.23.5	"""Cathepsins"""	2529	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 10"""	116840	"""cathepsin D (lysosomal aspartyl protease)"""	CPSD		3927292	Standard	NM_001909		Approved	CLN10	uc001luc.2	P07339	OTTHUMG00000044760	ENST00000236671.2:c.614G>A	11.37:g.1778644C>T	ENSP00000236671:p.Arg205His	61.0	0.0		68.0	34.0	NM_001909	Q6IB57	Missense_Mutation	SNP	ENST00000236671.2	37	CCDS7725.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	14.78|14.78	2.637977|2.637977	0.47153|0.47153	2.27E-4|2.27E-4	0.0|0.0	ENSG00000250644|ENSG00000117984	ENST00000427721|ENST00000236671;ENST00000438213;ENST00000367196	.|T;T;T	.|0.58358	.|0.34;0.34;0.38	4.11|4.11	-2.92|-2.92	0.05615|0.05615	.|Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	.|0.778438	.|0.12176	.|N	.|0.492528	T|T	0.38026|0.38026	0.1025|0.1025	L|L	0.56280|0.56280	1.765|1.765	0.26796|0.26796	N|N	0.969301|0.969301	.|B	.|0.23249	.|0.082	.|B	.|0.13407	.|0.009	T|T	0.28073|0.28073	-1.0055|-1.0055	5|10	.|0.39692	.|T	.|0.17	.|.	3.7053|3.7053	0.08398|0.08398	0.3688:0.2628:0.0:0.3683|0.3688:0.2628:0.0:0.3683	.|.	.|205	.|P07339	.|CATD_HUMAN	T|H	76|205;190;170	.|ENSP00000236671:R205H;ENSP00000415036:R190H;ENSP00000356164:R170H	.|ENSP00000236671:R205H	A|R	-|-	1|2	0|0	RP11-295K3.1|CTSD	1735220|1735220	0.010000|0.010000	0.17322|0.17322	0.960000|0.960000	0.40013|0.40013	0.752000|0.752000	0.42762|0.42762	-0.155000|-0.155000	0.10115|0.10115	-0.137000|-0.137000	0.11455|0.11455	0.472000|0.472000	0.43445|0.43445	GCA|CGC	.		0.587	CTSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104272.5	NM_001909	
CYLD	1540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	50815217	50815217	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr16:50815217G>A	ENST00000427738.3	+	9	1784	c.1579G>A	c.(1579-1581)Gcc>Acc	p.A527T	CYLD_ENST00000568704.2_Intron|RP11-327F22.4_ENST00000564510.1_RNA|RP11-327F22.4_ENST00000575917.1_RNA|CYLD_ENST00000311559.9_Missense_Mutation_p.A527T|CYLD_ENST00000564326.1_Missense_Mutation_p.A524T|CYLD_ENST00000540145.1_Missense_Mutation_p.A527T|CYLD_ENST00000566206.1_Missense_Mutation_p.A524T|CYLD_ENST00000569418.1_Missense_Mutation_p.A524T|CYLD_ENST00000398568.2_Missense_Mutation_p.A524T			Q9NQC7	CYLD_HUMAN	cylindromatosis (turban tumor syndrome)	527	CAP-Gly 3. {ECO:0000255|PROSITE- ProRule:PRU00045}.|Interaction with IKBKG/NEMO.|Interaction with TRIP.				cell cycle (GO:0007049)|innate immune response (GO:0045087)|necroptotic process (GO:0070266)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein K63-linked deubiquitination (GO:0070536)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of mitotic cell cycle (GO:0007346)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|microtubule (GO:0005874)|nucleus (GO:0005634)	Lys63-specific deubiquitinase activity (GO:0061578)|proline-rich region binding (GO:0070064)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(9)|lung(17)|pancreas(1)|skin(22)|upper_aerodigestive_tract(1)	62		all_cancers(37;0.0156)				TTTCACCTGTGCCCTGAAGAA	0.483			"""Mis, N, F, S"""		cylindroma	cylindroma			Multiple Trichoepithelioma, Familial;Familial Cylindromatosis																												p.A527T		.	yes	Rec	yes	Familial cylindromatosis	16	16q12-q13	1540	familial cylindromatosis gene		E	.	CYLD	2444	0			c.G1579A						.						102.0	98.0	100.0					16																	50815217		1932	4141	6073	SO:0001583	missense	1540	exon11	Familial Cancer Database	;FADC, Turban Tumor syndrome, Epithelioma Adenoides Cysticum of Brooke, Hereditary Multiple Benign Cystic Epithelioma, Dermal Eccrine Cylindromatosis, Brooke-Spiegler s.	ACCTGTGCCCTGA	AB020656	CCDS42164.1, CCDS45482.1	16q12-q13	2014-09-17							2584	protein-coding gene	gene with protein product	"""ubiquitin specific peptidase like 2"""	605018		CYLD1		7493027	Standard	NM_015247		Approved	KIAA0849, USPL2	uc002egq.1	Q9NQC7		ENST00000427738.3:c.1579G>A	16.37:g.50815217G>A	ENSP00000392025:p.Ala527Thr	105.0	0.0		55.0	17.0	NM_015247	O94934|Q7L3N6|Q96EH0|Q9NZX9	Missense_Mutation	SNP	ENST00000427738.3	37	CCDS45482.1	.	.	.	.	.	.	.	.	.	.	G	16.62	3.174382	0.57692	.	.	ENSG00000083799	ENST00000540145;ENST00000311559;ENST00000427738;ENST00000398568	T;T;T	0.74526	-0.85;-0.85;-0.85	6.02	6.02	0.97574	Cytoskeleton-associated protein, Gly-rich domain (4);	0.046658	0.85682	D	0.000000	T	0.76169	0.3950	L	0.28014	0.82	0.58432	D	0.999997	D;D;P;P	0.59767	0.98;0.986;0.867;0.891	P;P;B;B	0.58721	0.818;0.844;0.288;0.412	T	0.69323	-0.5175	10	0.16896	T	0.51	-5.9624	20.5407	0.99260	0.0:0.0:1.0:0.0	.	524;527;524;527	A8KAB0;F5H2R7;Q9NQC7-2;Q9NQC7	.;.;.;CYLD_HUMAN	T	527;527;524;524	ENSP00000445447:A527T;ENSP00000308928:A527T;ENSP00000381574:A524T	ENSP00000308928:A527T	A	+	1	0	CYLD	49372718	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.934000	0.75880	2.865000	0.98341	0.655000	0.94253	GCC	.		0.483	CYLD-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422998.2		
DDX19B	11269	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	70366883	70366883	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr16:70366883A>C	ENST00000288071.6	+	11	1444	c.1199A>C	c.(1198-1200)gAa>gCa	p.E400A	DDX19B_ENST00000568625.1_Missense_Mutation_p.E291A|DDX19B_ENST00000563206.1_Missense_Mutation_p.E405A|DDX19B_ENST00000451014.3_Missense_Mutation_p.E374A|DDX19B_ENST00000393657.2_Missense_Mutation_p.E291A|DDX19B_ENST00000563392.1_Missense_Mutation_p.E291A|DDX19B_ENST00000355992.3_Missense_Mutation_p.E369A|RP11-529K1.2_ENST00000562077.1_RNA|RP11-529K1.3_ENST00000567706.1_Intron	NM_007242.5	NP_009173.1	Q9UMR2	DD19B_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B	400	C-terminal lobe.|Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|prostate(1)	9		Ovarian(137;0.0694)				ATTGATGTTGAACAAGTGTCT	0.527																																					p.E400A	Esophageal Squamous(26;382 757 1343 9728 15939)	.											.	DDX19B	226	0			c.A1199C						.						73.0	63.0	66.0					16																	70366883		2198	4297	6495	SO:0001583	missense	11269	exon11			ATGTTGAACAAGT	AJ237946	CCDS10888.1, CCDS32475.1, CCDS42187.1, CCDS58478.1	16q22.3	2012-02-23	2012-02-23	2005-07-13	ENSG00000157349	ENSG00000157349		"""DEAD-boxes"""	2742	protein-coding gene	gene with protein product		605812	"""DEAD (Asp-Glu-Ala-As) box polypeptide 19"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 19 (Dbp5, yeast, homolog)"""	DDX19		10428971	Standard	NM_007242		Approved	DBP5	uc002eyo.4	Q9UMR2	OTTHUMG00000137577	ENST00000288071.6:c.1199A>C	16.37:g.70366883A>C	ENSP00000288071:p.Glu400Ala	495.0	1.0		256.0	36.0	NM_007242	B3KNE9|B4DXS6|E7EMK4|Q6FIB7|Q6IAE0|Q96KE7|Q9H0U0	Missense_Mutation	SNP	ENST00000288071.6	37	CCDS10888.1	.	.	.	.	.	.	.	.	.	.	A	12.38	1.921483	0.33908	.	.	ENSG00000157349	ENST00000451014;ENST00000355992;ENST00000393657;ENST00000288071	T;T;T;T	0.04706	3.57;3.57;3.57;3.57	5.09	5.09	0.68999	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.09069	0.0224	N	0.13272	0.32	0.80722	D	1	B;D;B	0.76494	0.022;0.999;0.062	B;D;B	0.73708	0.085;0.981;0.12	T	0.48980	-0.8986	10	0.31617	T	0.26	-10.1974	12.8787	0.58003	1.0:0.0:0.0:0.0	.	374;369;400	E7EMK4;Q9UMR2-2;Q9UMR2	.;.;DD19B_HUMAN	A	374;369;291;400	ENSP00000392639:E374A;ENSP00000348271:E369A;ENSP00000377267:E291A;ENSP00000288071:E400A	ENSP00000288071:E400A	E	+	2	0	DDX19B	68924384	1.000000	0.71417	0.626000	0.29213	0.610000	0.37248	8.444000	0.90323	2.149000	0.67028	0.533000	0.62120	GAA	.		0.527	DDX19B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268965.3	NM_007242	
DHTKD1	55526	ucsc.edu;bcgsc.ca	37	10	12131085	12131085	+	Missense_Mutation	SNP	T	T	G	rs553049198		TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr10:12131085T>G	ENST00000263035.4	+	5	880	c.818T>G	c.(817-819)tTt>tGt	p.F273C	DHTKD1_ENST00000465617.1_Intron	NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	273					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			GACCTGTACTTTGGGGCGCAC	0.572																																					p.F273C		.											.	DHTKD1	515	0			c.T818G						.						134.0	111.0	119.0					10																	12131085		2203	4300	6503	SO:0001583	missense	55526	exon5			TGTACTTTGGGGC	BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.818T>G	10.37:g.12131085T>G	ENSP00000263035:p.Phe273Cys	114.0	2.0		53.0	19.0	NM_018706	Q68CU5|Q9BUM8|Q9HCE2	Missense_Mutation	SNP	ENST00000263035.4	37	CCDS7087.1	.	.	.	.	.	.	.	.	.	.	T	14.96	2.692310	0.48202	.	.	ENSG00000181192	ENST00000263035;ENST00000437298	D;T	0.95756	-3.8;2.22	5.43	5.43	0.79202	Dehydrogenase, E1 component (1);	0.044874	0.85682	D	0.000000	D	0.95341	0.8488	L	0.39514	1.22	0.58432	D	0.999992	P	0.50617	0.937	P	0.54856	0.762	D	0.95948	0.8952	10	0.87932	D	0	-8.9798	15.4667	0.75406	0.0:0.0:0.0:1.0	.	273	Q96HY7	DHTK1_HUMAN	C	273;208	ENSP00000263035:F273C;ENSP00000388163:F208C	ENSP00000263035:F273C	F	+	2	0	DHTKD1	12171091	1.000000	0.71417	0.875000	0.34327	0.249000	0.25844	5.038000	0.64177	2.056000	0.61249	0.460000	0.39030	TTT	.		0.572	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046777.1	NM_018706	
DSCAM	1826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	42080424	42080424	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr21:42080424T>A	ENST00000400454.1	-	2	794	c.317A>T	c.(316-318)aAt>aTt	p.N106I		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	106	Ig-like C2-type 1.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CCCTGAAGGATTTTCAGCTGT	0.463																																					p.N106I	Melanoma(134;970 1778 1785 21664 32388)	.											.	DSCAM	101	0			c.A317T						.						114.0	109.0	111.0					21																	42080424		1885	4110	5995	SO:0001583	missense	1826	exon2			GAAGGATTTTCAG	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.317A>T	21.37:g.42080424T>A	ENSP00000383303:p.Asn106Ile	69.0	0.0		46.0	15.0	NM_001271534	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.272051	0.80469	.	.	ENSG00000171587	ENST00000400454	T	0.56941	0.43	5.22	5.22	0.72569	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.78149	0.4238	M	0.91818	3.245	0.53688	D	0.999977	D	0.76494	0.999	D	0.87578	0.998	D	0.83855	0.0265	10	0.87932	D	0	.	15.1068	0.72326	0.0:0.0:0.0:1.0	.	106	O60469	DSCAM_HUMAN	I	106	ENSP00000383303:N106I	ENSP00000383303:N106I	N	-	2	0	DSCAM	41002294	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.603000	0.82811	1.980000	0.57719	0.477000	0.44152	AAT	.		0.463	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
EEA1	8411	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	93205205	93205205	+	Silent	SNP	T	T	C			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr12:93205205T>C	ENST00000322349.8	-	17	2313	c.2049A>G	c.(2047-2049)ttA>ttG	p.L683L		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	683	Gln/Glu/Lys-rich.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						TAATCTTATTTAACTCCTTTA	0.313																																					p.L683L		.											.	EEA1	229	0			c.A2049G						.						51.0	51.0	51.0					12																	93205205		2201	4298	6499	SO:0001819	synonymous_variant	8411	exon17			CTTATTTAACTCC	L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.2049A>G	12.37:g.93205205T>C		48.0	0.0		43.0	11.0	NM_003566	Q14221	Silent	SNP	ENST00000322349.8	37	CCDS31874.1																																																																																			.		0.313	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407304.1	NM_003566	
EYS	346007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	65612320	65612320	+	Silent	SNP	A	A	G			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr6:65612320A>G	ENST00000370621.3	-	17	3241	c.2715T>C	c.(2713-2715)tgT>tgC	p.C905C	EYS_ENST00000370616.2_Silent_p.C905C|EYS_ENST00000503581.1_Silent_p.C905C			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	905	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						CCATATCTTCACAGTCACCAT	0.343																																					p.C905C		.											.	EYS	660	0			c.T2715C						.						153.0	127.0	135.0					6																	65612320		692	1591	2283	SO:0001819	synonymous_variant	346007	exon17			ATCTTCACAGTCA		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2715T>C	6.37:g.65612320A>G		203.0	0.0		121.0	26.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Silent	SNP	ENST00000370621.3	37																																																																																				.		0.343	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
BRINP3	339479	ucsc.edu;bcgsc.ca	37	1	190423871	190423871	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr1:190423871A>T	ENST00000367462.3	-	2	381	c.150T>A	c.(148-150)gaT>gaA	p.D50E	BRINP3_ENST00000534846.1_Missense_Mutation_p.I12K	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	50					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											AGGGTCCCTTATCAGAGAGGA	0.493																																					p.D50E		.											.	FAM5C	228	0			c.T150A						.						79.0	79.0	79.0					1																	190423871		2203	4300	6503	SO:0001583	missense	339479	exon2			TCCCTTATCAGAG	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.150T>A	1.37:g.190423871A>T	ENSP00000356432:p.Asp50Glu	156.0	2.0		119.0	22.0	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	CCDS1373.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.41|14.41	2.528145|2.528145	0.44969|0.44969	.|.	.|.	ENSG00000162670|ENSG00000162670	ENST00000367462;ENST00000445957|ENST00000534846	T;T|T	0.58506|0.16743	2.13;0.33|2.32	5.42|5.42	3.13|3.13	0.36017|0.36017	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.17492|0.17492	0.0420|0.0420	L|L	0.61218|0.61218	1.895|1.895	0.34177|0.34177	D|D	0.670441|0.670441	D|B	0.58970|0.19817	0.984|0.039	D|B	0.67548|0.18871	0.952|0.023	T|T	0.11743|0.11743	-1.0575|-1.0575	10|9	0.87932|0.87932	D|D	0|0	.|.	6.1183|6.1183	0.20139|0.20139	0.7286:0.0:0.2714:0.0|0.7286:0.0:0.2714:0.0	.|.	50|12	Q76B58|B7Z260	FAM5C_HUMAN|.	E|K	50|12	ENSP00000356432:D50E;ENSP00000393441:D50E|ENSP00000438022:I12K	ENSP00000356432:D50E|ENSP00000438022:I12K	D|I	-|-	3|2	2|0	FAM5C|FAM5C	188690494|188690494	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.289000|1.289000	0.33307|0.33307	0.897000|0.897000	0.36392|0.36392	0.533000|0.533000	0.62120|0.62120	GAT|ATA	.		0.493	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
FAM78A	286336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	134136583	134136583	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr9:134136583C>T	ENST00000372271.3	-	2	845	c.478G>A	c.(478-480)Gac>Aac	p.D160N	FAM78A_ENST00000372269.3_Missense_Mutation_p.D157N|FAM78A_ENST00000247295.4_5'UTR	NM_033387.3	NP_203745.2	Q5JUQ0	FA78A_HUMAN	family with sequence similarity 78, member A	160										NS(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.15e-05)|Epithelial(140;0.000267)		TAAAAGTTGTCATTCATGCTG	0.582																																					p.D160N		.											.	FAM78A	91	0			c.G478A						.						127.0	117.0	120.0					9																	134136583		2203	4300	6503	SO:0001583	missense	286336	exon2			AGTTGTCATTCAT	AK095423	CCDS6941.2	9q34	2008-02-05	2005-07-18	2005-07-18	ENSG00000126882	ENSG00000126882			25465	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 59"""	C9orf59		11214971	Standard	NM_033387		Approved	FLJ00024	uc004cak.3	Q5JUQ0	OTTHUMG00000020821	ENST00000372271.3:c.478G>A	9.37:g.134136583C>T	ENSP00000361345:p.Asp160Asn	57.0	0.0		30.0	7.0	NM_033387	Q86VQ9|Q9H7P4	Missense_Mutation	SNP	ENST00000372271.3	37	CCDS6941.2	.	.	.	.	.	.	.	.	.	.	C	27.4	4.828590	0.90955	.	.	ENSG00000126882	ENST00000372269;ENST00000372271;ENST00000464831	.	.	.	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.79233	0.4411	M	0.75777	2.31	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.82364	-0.0494	9	0.87932	D	0	-41.4748	17.1064	0.86664	0.0:1.0:0.0:0.0	.	160;157	Q5JUQ0;Q5JUQ2	FA78A_HUMAN;.	N	157;160;129	.	ENSP00000361343:D157N	D	-	1	0	FAM78A	133126404	1.000000	0.71417	1.000000	0.80357	0.717000	0.41224	7.776000	0.85560	2.337000	0.79520	0.462000	0.41574	GAC	.		0.582	FAM78A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054720.1	NM_033387	
FASN	2194	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	80051623	80051623	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr17:80051623C>T	ENST00000306749.2	-	4	523	c.305G>A	c.(304-306)gGa>gAa	p.G102E		NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	102	Beta-ketoacyl synthase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	AGTGTGTGTTCCTCGGAGTGA	0.677																																					p.G102E	Colon(59;314 1043 11189 28578 32273)	.											.	FASN	90	0			c.G305A						.						55.0	51.0	53.0					17																	80051623		2200	4295	6495	SO:0001583	missense	2194	exon4			TGTGTTCCTCGGA	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.305G>A	17.37:g.80051623C>T	ENSP00000304592:p.Gly102Glu	45.0	0.0		68.0	40.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.518479	0.85495	.	.	ENSG00000169710	ENST00000306749	T	0.38077	1.16	4.38	4.38	0.52667	Beta-ketoacyl synthase, N-terminal (1);Thiolase-like, subgroup (1);Thiolase-like (1);	0.066543	0.64402	D	0.000014	T	0.63885	0.2549	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.71873	-0.4461	10	0.87932	D	0	-42.0902	16.5418	0.84386	0.0:1.0:0.0:0.0	.	102	P49327	FAS_HUMAN	E	102	ENSP00000304592:G102E	ENSP00000304592:G102E	G	-	2	0	FASN	77644912	1.000000	0.71417	0.381000	0.26106	0.805000	0.45488	5.836000	0.69375	2.006000	0.58801	0.561000	0.74099	GGA	.		0.677	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
FGFR3	2261	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	1807577	1807577	+	Silent	SNP	C	C	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr4:1807577C>T	ENST00000260795.2	+	12	1848	c.1746C>T	c.(1744-1746)tgC>tgT	p.C582C	FGFR3_ENST00000340107.4_Silent_p.C584C|FGFR3_ENST00000440486.2_Silent_p.C582C|FGFR3_ENST00000412135.2_Silent_p.C470C|FGFR3_ENST00000352904.1_Silent_p.C470C|FGFR3_ENST00000481110.2_Silent_p.C583C			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	582	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	TCGACACCTGCAAGCCGCCCG	0.682		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																												p.C584C		.		Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	.	FGFR3	9542	0			c.C1752T						.						43.0	53.0	50.0					4																	1807577		2203	4298	6501	SO:0001819	synonymous_variant	2261	exon13	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	CACCTGCAAGCCG	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.1746C>T	4.37:g.1807577C>T		76.0	0.0		54.0	16.0	NM_001163213	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Silent	SNP	ENST00000260795.2	37	CCDS3353.1																																																																																			.		0.682	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142	
FHDC1	85462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	153896514	153896514	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr4:153896514G>T	ENST00000511601.1	+	12	2259	c.2071G>T	c.(2071-2073)Gag>Tag	p.E691*	FHDC1_ENST00000260008.3_Nonsense_Mutation_p.E691*			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	691									ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					CCAGGGCATGGAGGAGACCTC	0.617																																					p.E691X		.											.	FHDC1	136	0			c.G2071T						.						44.0	46.0	46.0					4																	153896514		2203	4300	6503	SO:0001587	stop_gained	85462	exon11			GGCATGGAGGAGA	AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.2071G>T	4.37:g.153896514G>T	ENSP00000427567:p.Glu691*	71.0	0.0		29.0	12.0	NM_033393		Nonsense_Mutation	SNP	ENST00000511601.1	37	CCDS34081.1	.	.	.	.	.	.	.	.	.	.	G	37	6.463344	0.97585	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	.	.	.	5.19	1.17	0.20885	.	0.740846	0.13614	N	0.374944	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	17.3028	0.87187	0.0:0.4784:0.5216:0.0	.	.	.	.	X	691	.	ENSP00000260008:E691X	E	+	1	0	FHDC1	154115964	0.162000	0.22906	0.003000	0.11579	0.007000	0.05969	1.423000	0.34837	-0.035000	0.13691	0.563000	0.77884	GAG	.		0.617	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364981.2	NM_033393	
FOS	2353	broad.mit.edu;mdanderson.org	37	14	75747795	75747795	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr14:75747795G>A	ENST00000303562.4	+	4	1020	c.811G>A	c.(811-813)Gac>Aac	p.D271N	FOS_ENST00000555347.1_Missense_Mutation_p.D123N|FOS_ENST00000555686.1_Missense_Mutation_p.D157N|FOS_ENST00000535987.1_Missense_Mutation_p.D235N	NM_005252.3	NP_005243.1	P01100	FOS_HUMAN	FBJ murine osteosarcoma viral oncogene homolog	271					aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hormone stimulus (GO:0032870)|cellular response to reactive oxygen species (GO:0034614)|conditioned taste aversion (GO:0001661)|DNA methylation (GO:0006306)|Fc-epsilon receptor signaling pathway (GO:0038095)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nervous system development (GO:0007399)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to cold (GO:0009409)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gravity (GO:0009629)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|skeletal muscle cell differentiation (GO:0035914)|sleep (GO:0030431)|SMAD protein signal transduction (GO:0060395)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	double-stranded DNA binding (GO:0003690)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_lung(585;0.0138)|all_epithelial(191;0.0263)|all_neural(303;0.112)		BRCA - Breast invasive adenocarcinoma(234;0.0117)	Nadroparin(DB08813)|Pseudoephedrine(DB00852)	GCCCTTTGATGACTTCCTGTT	0.587																																					p.D271N		.											.	FOS	847	0			c.G811A						.						66.0	62.0	63.0					14																	75747795		2203	4300	6503	SO:0001583	missense	2353	exon4			TTTGATGACTTCC	K00650	CCDS9841.1	14q24.3	2013-01-10	2009-07-23			ENSG00000170345		"""basic leucine zipper proteins"""	3796	protein-coding gene	gene with protein product		164810	"""v-fos FBJ murine osteosarcoma viral oncogene homolog"""			16123044, 16055710, 15926923	Standard	NM_005252		Approved	c-fos, AP-1	uc001xrn.3	P01100		ENST00000303562.4:c.811G>A	14.37:g.75747795G>A	ENSP00000306245:p.Asp271Asn	20.0	1.0		13.0	6.0	NM_005252	A8K4E2|B4DQ65|P18849	Missense_Mutation	SNP	ENST00000303562.4	37	CCDS9841.1	.	.	.	.	.	.	.	.	.	.	G	15.72	2.917421	0.52546	.	.	ENSG00000170345	ENST00000303562;ENST00000535987;ENST00000555686;ENST00000555672;ENST00000555347	T;T;T	0.65732	0.42;0.76;-0.17	5.22	5.22	0.72569	.	0.294527	0.37348	N	0.002128	T	0.74650	0.3744	M	0.71036	2.16	0.42075	D	0.991227	D;D	0.59767	0.971;0.986	P;P	0.55749	0.783;0.722	T	0.77332	-0.2627	10	0.56958	D	0.05	-9.3342	18.7653	0.91869	0.0:0.0:1.0:0.0	.	235;271	B4DQ65;P01100	.;FOS_HUMAN	N	271;235;157;121;123	ENSP00000306245:D271N;ENSP00000442268:D235N;ENSP00000452590:D157N	ENSP00000306245:D271N	D	+	1	0	FOS	74817548	1.000000	0.71417	1.000000	0.80357	0.545000	0.35147	4.591000	0.61019	2.609000	0.88269	0.563000	0.77884	GAC	.		0.587	FOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415044.1	NM_005252	
GLRA4	441509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	102978843	102978843	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chrX:102978843A>C	ENST00000372617.4	-	5	938	c.518T>G	c.(517-519)cTg>cGg	p.L173R	GLRA4_ENST00000469567.1_5'Flank	NM_001024452.2	NP_001019623.2	Q5JXX5	GLRA4_HUMAN	glycine receptor, alpha 4	173						cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			cervix(1)|endometrium(2)|large_intestine(2)|lung(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						GAGGTCCATCAGGCAGGACAA	0.527																																					p.L173R		.											.	GLRA4	108	0			c.T518G						.						117.0	110.0	112.0					X																	102978843		2034	4174	6208	SO:0001583	missense	441509	exon5			TCCATCAGGCAGG	Z93848	CCDS43980.2	Xq22.2	2012-01-16			ENSG00000188828	ENSG00000188828		"""Ligand-gated ion channels / Glycine receptors"""	31715	protein-coding gene	gene with protein product							Standard	NM_001024452		Approved		uc011mse.2	Q5JXX5	OTTHUMG00000022110	ENST00000372617.4:c.518T>G	X.37:g.102978843A>C	ENSP00000361700:p.Leu173Arg	280.0	1.0		102.0	69.0	NM_001024452		Missense_Mutation	SNP	ENST00000372617.4	37	CCDS43980.2	.	.	.	.	.	.	.	.	.	.	G	14.46	2.541146	0.45280	.	.	ENSG00000188828	ENST00000372617	T	0.78364	-1.17	5.46	5.46	0.80206	Neurotransmitter-gated ion-channel ligand-binding (3);Neurotransmitter-gated ion-channel, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.61060	0.2317	N	0.10874	0.06	0.32898	D	0.512749	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.64162	-0.6472	10	0.59425	D	0.04	.	11.2816	0.49197	0.0905:0.0:0.9095:0.0	.	173;132	Q5JXX5;B9WSA6	GLRA4_HUMAN;.	R	173	ENSP00000361700:L173R	ENSP00000361700:L173R	L	-	2	0	GLRA4	102865499	1.000000	0.71417	0.888000	0.34837	0.570000	0.35934	6.795000	0.75140	1.085000	0.41206	-0.170000	0.13304	CTG	.		0.527	GLRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057742.2	NM_001024452	
GPR158	57512	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	25464385	25464385	+	Silent	SNP	C	C	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr10:25464385C>A	ENST00000376351.3	+	1	395	c.36C>A	c.(34-36)ctC>ctA	p.L12L	GPR158-AS1_ENST00000449643.1_RNA	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	12					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						TCCTCTGCCTCCTGCTTGCTC	0.622																																					p.L12L		.											.	GPR158	141	0			c.C36A						.						35.0	41.0	39.0					10																	25464385		2202	4291	6493	SO:0001819	synonymous_variant	57512	exon1			CTGCCTCCTGCTT	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.36C>A	10.37:g.25464385C>A		61.0	1.0		57.0	19.0	NM_020752	Q6QR81|Q9ULT3	Silent	SNP	ENST00000376351.3	37	CCDS31166.1																																																																																			.		0.622	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110	
GRIN3A	116443	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	104499796	104499796	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr9:104499796C>G	ENST00000361820.3	-	1	1066	c.466G>C	c.(466-468)Gca>Cca	p.A156P		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	156					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	CCCAGGCCTGCCTCGATGGCC	0.587																																					p.A156P		.											.	GRIN3A	96	0			c.G466C						.						102.0	96.0	98.0					9																	104499796		2203	4300	6503	SO:0001583	missense	116443	exon1			GGCCTGCCTCGAT		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.466G>C	9.37:g.104499796C>G	ENSP00000355155:p.Ala156Pro	108.0	0.0		54.0	19.0	NM_133445	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.765044	0.69878	.	.	ENSG00000198785	ENST00000361820	D	0.86562	-2.14	4.98	4.98	0.66077	.	0.206037	0.42548	N	0.000699	D	0.88190	0.6370	L	0.48642	1.525	0.52099	D	0.999943	D	0.60575	0.988	P	0.51657	0.676	D	0.87667	0.2538	10	0.38643	T	0.18	.	18.2597	0.90031	0.0:1.0:0.0:0.0	.	156	Q8TCU5	NMD3A_HUMAN	P	156	ENSP00000355155:A156P	ENSP00000355155:A156P	A	-	1	0	GRIN3A	103539617	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.853000	0.48317	2.304000	0.77564	0.655000	0.94253	GCA	.		0.587	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		
GRXCR1	389207	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	42895456	42895456	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr4:42895456C>A	ENST00000399770.2	+	1	173	c.173C>A	c.(172-174)tCc>tAc	p.S58Y	RN7SKP82_ENST00000516786.1_RNA	NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	58					auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						CTAGGTGATTCCGATGGACAG	0.502																																					p.S58Y		.											.	GRXCR1	23	0			c.C173A						.						177.0	182.0	181.0					4																	42895456		2023	4198	6221	SO:0001583	missense	389207	exon1			GTGATTCCGATGG		CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	ENST00000399770.2:c.173C>A	4.37:g.42895456C>A	ENSP00000382670:p.Ser58Tyr	134.0	1.0		91.0	58.0	NM_001080476		Missense_Mutation	SNP	ENST00000399770.2	37	CCDS43225.1	.	.	.	.	.	.	.	.	.	.	C	9.142	1.014208	0.19277	.	.	ENSG00000215203	ENST00000399770	T	0.34472	1.36	5.87	4.99	0.66335	.	1.381860	0.05653	U	0.585562	T	0.23451	0.0567	N	0.14661	0.345	0.30549	N	0.765609	B	0.28512	0.214	B	0.25140	0.058	T	0.06807	-1.0806	10	0.19147	T	0.46	-3.4656	9.0168	0.36175	0.0:0.6545:0.2572:0.0883	.	58	A8MXD5	GRCR1_HUMAN	Y	58	ENSP00000382670:S58Y	ENSP00000382670:S58Y	S	+	2	0	GRXCR1	42590213	0.001000	0.12720	0.994000	0.49952	0.227000	0.25037	1.250000	0.32850	2.785000	0.95823	0.650000	0.86243	TCC	.		0.502	GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360576.1	NM_001080476	
HGS	9146	hgsc.bcm.edu;broad.mit.edu	37	17	79660939	79660939	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr17:79660939delC	ENST00000329138.4	+	11	1015	c.880delC	c.(880-882)cccfs	p.P294fs		NM_004712.4	NP_004703.1	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine kinase substrate	294	Interaction with SNX1. {ECO:0000250}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane invagination (GO:0010324)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of gene expression (GO:0010628)|protein localization to membrane (GO:0072657)|protein targeting to lysosome (GO:0006622)|regulation of protein catabolic process (GO:0042176)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|secretory granule (GO:0030141)	metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			CAAGGCGGAGCCCATGCCCTC	0.662																																					p.P294fs		.											.	HGS	91	0			c.880delC						.						38.0	42.0	41.0					17																	79660939		2202	4300	6502	SO:0001589	frameshift_variant	9146	exon11			GCGGAGCCCATGC	D84064	CCDS11784.1	17q25	2009-04-29				ENSG00000185359		"""Zinc fingers, FYVE domain containing"""	4897	protein-coding gene	gene with protein product		604375				9407053, 9630564	Standard	NM_004712		Approved	Hrs, ZFYVE8, Vps27	uc002kbg.3	O14964		ENST00000329138.4:c.880delC	17.37:g.79660939delC	ENSP00000331201:p.Pro294fs	28.0	0.0		54.0	15.0	NM_004712	Q9NR36	Frame_Shift_Del	DEL	ENST00000329138.4	37	CCDS11784.1																																																																																			.		0.662	HGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440541.1	NM_004712	
HNRNPUL1	11100	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	41785002	41785002	+	Silent	SNP	G	G	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr19:41785002G>A	ENST00000392006.3	+	6	980	c.807G>A	c.(805-807)gtG>gtA	p.V269V	HNRNPUL1_ENST00000593587.1_Silent_p.V169V|HNRNPUL1_ENST00000594207.1_3'UTR|HNRNPUL1_ENST00000595018.1_Silent_p.V169V|HNRNPUL1_ENST00000352456.3_Silent_p.V169V|HNRNPUL1_ENST00000378215.4_Intron|HNRNPUL1_ENST00000263367.3_Silent_p.V180V|HNRNPUL1_ENST00000602130.1_Silent_p.V269V	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	269	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.|Necessary for interaction with TP53.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						AAATCTCCGTGAAGCACCTTC	0.552																																					p.V269V		.											.	HNRNPUL1	69	0			c.G807A						.						112.0	109.0	110.0					19																	41785002		2203	4300	6503	SO:0001819	synonymous_variant	11100	exon6			CTCCGTGAAGCAC	AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.807G>A	19.37:g.41785002G>A		64.0	1.0		39.0	14.0	NM_007040	B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Silent	SNP	ENST00000392006.3	37	CCDS12576.1																																																																																			.		0.552	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1	NM_144732, NM_007040	
IL5RA	3568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	3137002	3137002	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr3:3137002G>T	ENST00000446632.2	-	8	1410	c.836C>A	c.(835-837)aCa>aAa	p.T279K	IL5RA_ENST00000383846.1_Missense_Mutation_p.T279K|IL5RA_ENST00000456302.1_Missense_Mutation_p.T279K|IL5RA_ENST00000418488.2_Intron|IL5RA_ENST00000311981.8_Missense_Mutation_p.T279K|IL5RA_ENST00000445864.2_Intron|IL5RA_ENST00000430514.2_Missense_Mutation_p.T279K|IL5RA_ENST00000438560.1_Missense_Mutation_p.T279K|IL5RA_ENST00000256452.3_Missense_Mutation_p.T279K	NM_175726.3	NP_783853.1	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha	279	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell proliferation (GO:0008283)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-5-mediated signaling pathway (GO:0038043)|regulation of interleukin-5 production (GO:0032674)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-5 receptor activity (GO:0004914)			cervix(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	24				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		TCCATTCCTTGTATTGTGTAT	0.328																																					p.T279K	GBM(169;430 2801 24955 28528)	.											.	IL5RA	91	0			c.C836A						.						72.0	72.0	72.0					3																	3137002		2203	4300	6503	SO:0001583	missense	3568	exon8			TTCCTTGTATTGT	M96652	CCDS2559.1, CCDS2560.1, CCDS46739.1, CCDS58813.1	3p26-p24	2008-01-11			ENSG00000091181	ENSG00000091181		"""Interleukins and interleukin receptors"", ""CD molecules"""	6017	protein-coding gene	gene with protein product		147851		IL5R		1732409	Standard	NM_175727		Approved	CDw125, CD125	uc010hbs.3	Q01344	OTTHUMG00000090245	ENST00000446632.2:c.836C>A	3.37:g.3137002G>T	ENSP00000412209:p.Thr279Lys	161.0	0.0		116.0	51.0	NM_001243099	B3IU77|B4E2G0|Q14633|Q15469|Q6ISX9	Missense_Mutation	SNP	ENST00000446632.2	37	CCDS2559.1	.	.	.	.	.	.	.	.	.	.	G	4.694	0.129079	0.08981	.	.	ENSG00000091181	ENST00000446632;ENST00000438560;ENST00000256452;ENST00000383846;ENST00000311981;ENST00000430514;ENST00000456302	D;D;D;D;D;D;D	0.85484	-1.99;-1.99;-1.99;-1.99;-1.99;-1.99;-1.99	5.0	0.227	0.15359	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.788201	0.11359	N	0.572071	T	0.77870	0.4195	L	0.56396	1.775	0.09310	N	1	B;P;P;B	0.49090	0.418;0.919;0.763;0.177	B;B;B;B	0.43052	0.068;0.406;0.293;0.049	T	0.66118	-0.6003	10	0.06236	T	0.91	-1.3347	6.7952	0.23721	0.5903:0.0:0.4097:0.0	.	279;279;279;279	B4E2G0;Q01344-3;Q01344-2;Q01344	.;.;.;IL5RA_HUMAN	K	279	ENSP00000412209:T279K;ENSP00000390753:T279K;ENSP00000256452:T279K;ENSP00000373358:T279K;ENSP00000309196:T279K;ENSP00000400400:T279K;ENSP00000392059:T279K	ENSP00000256452:T279K	T	-	2	0	IL5RA	3112002	0.004000	0.15560	0.001000	0.08648	0.027000	0.11550	0.569000	0.23638	0.098000	0.17522	-0.345000	0.07892	ACA	.		0.328	IL5RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337537.2		
IL9R	3581	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	155233210	155233210	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chrX:155233210G>T	ENST00000244174.5	+	3	418	c.239G>T	c.(238-240)tGg>tTg	p.W80L	IL9R_ENST00000540897.1_Missense_Mutation_p.W117L|IL9R_ENST00000369423.2_Missense_Mutation_p.W127L|IL9R_ENST00000424344.3_Missense_Mutation_p.W59L	NM_002186.2	NP_002177.2	Q01113	IL9R_HUMAN	interleukin 9 receptor	80					cell proliferation (GO:0008283)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	interleukin-9 receptor activity (GO:0004919)			NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(12)|upper_aerodigestive_tract(1)	23	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TCCAGCCCCTGGCTCCTCTTC	0.597																																					p.W127L		.											.	IL9R	40	0			c.G380T						.						70.0	74.0	73.0					X																	155233210		2203	4296	6499	SO:0001583	missense	3581	exon4			GCCCCTGGCTCCT	M84747	CCDS14771.4, CCDS59180.1	Xq28 and Yq12	2008-02-05			ENSG00000124334	ENSG00000124334		"""Pseudoautosomal regions / PAR2"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6030	protein-coding gene	gene with protein product		300007				1376929, 8666384	Standard	NM_002186		Approved	CD129	uc004fnv.1	Q01113	OTTHUMG00000022720	ENST00000244174.5:c.239G>T	X.37:g.155233210G>T	ENSP00000244174:p.Trp80Leu	150.0	1.0		76.0	37.0	NM_176786	B9ZVT0|Q14634|Q8WWU1|Q96TF0	Missense_Mutation	SNP	ENST00000244174.5	37	CCDS14771.4	.	.	.	.	.	.	.	.	.	.	.	12.34	1.907523	0.33721	.	.	ENSG00000124334	ENST00000244174;ENST00000424344;ENST00000455739;ENST00000369423;ENST00000540897	T;T;T;T	0.32272	1.46;1.46;1.46;1.46	1.29	1.29	0.21616	.	0.299193	0.28119	N	0.016536	T	0.17959	0.0431	.	.	.	0.09310	N	1	P;B;P	0.41848	0.763;0.201;0.718	B;B;B	0.42282	0.382;0.053;0.146	T	0.09818	-1.0657	9	0.19147	T	0.46	-10.2691	5.5447	0.17057	0.0:0.0:1.0:0.0	.	59;80;127	F5H3Z0;Q01113;B9ZVT0	.;IL9R_HUMAN;.	L	80;59;59;127;117	ENSP00000244174:W80L;ENSP00000388918:W59L;ENSP00000358431:W127L;ENSP00000438112:W117L	ENSP00000244174:W80L	W	+	2	0	IL9R	154886404	0.988000	0.35896	0.972000	0.41901	0.620000	0.37586	1.213000	0.32407	0.932000	0.37266	0.287000	0.19450	TGG	G|1.000;A|0.000		0.597	IL9R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058981.1	NM_002186	
IQCE	23288	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	2625881	2625881	+	Silent	SNP	G	G	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr7:2625881G>A	ENST00000402050.2	+	12	1048	c.864G>A	c.(862-864)aaG>aaA	p.K288K	IQCE_ENST00000438376.2_Silent_p.K272K|IQCE_ENST00000404984.1_Silent_p.K237K|IQCE_ENST00000325979.7_Silent_p.K223K	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	288						mitochondrion (GO:0005739)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		AAAGGCAGAAGAAGATGGGCA	0.577																																					p.K288K		.											.	IQCE	226	0			c.G864A						.						53.0	61.0	58.0					7																	2625881		1979	4150	6129	SO:0001819	synonymous_variant	23288	exon12			GCAGAAGAAGATG	AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.864G>A	7.37:g.2625881G>A		61.0	1.0		45.0	9.0	NM_152558	Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Silent	SNP	ENST00000402050.2	37	CCDS43542.1																																																																																			.		0.577	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325063.2	NM_152558	
KAT6B	23522	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	76789864	76789864	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr10:76789864G>A	ENST00000287239.4	+	18	5771	c.5282G>A	c.(5281-5283)aGc>aAc	p.S1761N	KAT6B_ENST00000372724.1_Missense_Mutation_p.S1469N|KAT6B_ENST00000372711.1_Missense_Mutation_p.S1578N|KAT6B_ENST00000372725.1_Missense_Mutation_p.S1469N|KAT6B_ENST00000372714.1_Missense_Mutation_p.S1469N	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1761	Interaction with RUNX1 and RUNX2.|Ser-rich.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										AGGCCTCCGAGCAGCAGCCAG	0.607																																					p.S1761N		.											.	.	.	0			c.G5282A						.						41.0	37.0	39.0					10																	76789864		2203	4300	6503	SO:0001583	missense	23522	exon18			CTCCGAGCAGCAG	AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.5282G>A	10.37:g.76789864G>A	ENSP00000287239:p.Ser1761Asn	57.0	1.0		31.0	12.0	NM_012330	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	ENST00000287239.4	37	CCDS7345.1	.	.	.	.	.	.	.	.	.	.	G	15.97	2.990872	0.54041	.	.	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	T;T;T;T;T	0.80909	-1.37;-1.37;-1.41;-1.37;-1.43	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000013	D	0.85323	0.5670	L	0.29908	0.895	0.58432	D	0.999999	D;D;D	0.71674	0.992;0.998;0.991	D;D;D	0.80764	0.961;0.994;0.989	D	0.86915	0.2063	10	0.87932	D	0	-11.1859	19.4767	0.94992	0.0:0.0:1.0:0.0	.	1578;1469;1761	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	N	1469;1469;1761;1469;1578	ENSP00000361810:S1469N;ENSP00000361809:S1469N;ENSP00000287239:S1761N;ENSP00000361799:S1469N;ENSP00000361796:S1578N	ENSP00000287239:S1761N	S	+	2	0	KAT6B	76459870	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	9.476000	0.97823	2.592000	0.87571	0.563000	0.77884	AGC	.		0.607	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
KCNA5	3741	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	5154790	5154790	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr12:5154790G>A	ENST00000252321.3	+	1	1706	c.1477G>A	c.(1477-1479)Ggc>Agc	p.G493S		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	493					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	CACTGTTGGGGGCAAGATCGT	0.607																																					p.G493S		.											.	KCNA5	715	0			c.G1477A						.						120.0	110.0	113.0					12																	5154790		2203	4300	6503	SO:0001583	missense	3741	exon1			GTTGGGGGCAAGA	M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.1477G>A	12.37:g.5154790G>A	ENSP00000252321:p.Gly493Ser	112.0	2.0		67.0	28.0	NM_002234	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	ENST00000252321.3	37	CCDS8536.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.544712	0.86022	.	.	ENSG00000130037	ENST00000252321	D	0.98135	-4.74	4.87	4.87	0.63330	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99357	0.9774	H	0.99156	4.45	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98241	1.0488	10	0.87932	D	0	.	17.2051	0.86915	0.0:0.0:1.0:0.0	.	493	P22460	KCNA5_HUMAN	S	493	ENSP00000252321:G493S	ENSP00000252321:G493S	G	+	1	0	KCNA5	5025051	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.587000	0.98229	2.536000	0.85505	0.561000	0.74099	GGC	.		0.607	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2	NM_002234	
KRTAP4-8	728224	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39254310	39254310	+	Silent	SNP	C	C	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr17:39254310C>T	ENST00000333822.4	-	1	83	c.27G>A	c.(25-27)gtG>gtA	p.V9V		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	9					aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						GGTCAGAGCACACGGAGCCAC	0.567																																					p.V9V		.											.	.	.	0			c.G27A						.						31.0	32.0	32.0					17																	39254310		692	1591	2283	SO:0001819	synonymous_variant	728224	exon1			AGAGCACACGGAG	AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.27G>A	17.37:g.39254310C>T		192.0	1.0		165.0	26.0	NM_031960	A8MSH3	Silent	SNP	ENST00000333822.4	37	CCDS45674.1																																																																																			.		0.567	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257684.1	NM_031960	
LAMA1	284217	ucsc.edu;bcgsc.ca	37	18	6958596	6958596	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr18:6958596C>T	ENST00000389658.3	-	55	7937	c.7844G>A	c.(7843-7845)aGc>aAc	p.S2615N	RP11-781P6.1_ENST00000584722.1_RNA	NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2615	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				TATCGTCCTGCTTTCTACTAA	0.423																																					p.S2615N		.											.	LAMA1	149	0			c.G7844A						.						127.0	100.0	109.0					18																	6958596		2203	4300	6503	SO:0001583	missense	284217	exon55			GTCCTGCTTTCTA	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.7844G>A	18.37:g.6958596C>T	ENSP00000374309:p.Ser2615Asn	206.0	2.0		125.0	24.0	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	C	6.566	0.472653	0.12461	.	.	ENSG00000101680	ENST00000389658;ENST00000344342	T	0.79749	-1.3	5.48	1.11	0.20524	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	1.121610	0.06584	N	0.750821	T	0.71484	0.3345	L	0.54323	1.7	0.09310	N	1	B	0.13145	0.007	B	0.13407	0.009	T	0.52388	-0.8582	10	0.28530	T	0.3	.	0.6113	0.00762	0.2085:0.2841:0.2648:0.2426	.	2615	P25391	LAMA1_HUMAN	N	2615;68	ENSP00000374309:S2615N	ENSP00000341000:S68N	S	-	2	0	LAMA1	6948596	0.229000	0.23729	0.268000	0.24571	0.551000	0.35334	0.188000	0.17018	0.337000	0.23665	0.655000	0.94253	AGC	.		0.423	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
LAMA1	284217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	7002349	7002349	+	Silent	SNP	A	A	G			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr18:7002349A>G	ENST00000389658.3	-	30	4389	c.4296T>C	c.(4294-4296)gaT>gaC	p.D1432D		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1432	Laminin EGF-like 15. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				AAGTACACACATCACAATGGT	0.507																																					p.D1432D		.											.	LAMA1	149	0			c.T4296C						.						227.0	183.0	198.0					18																	7002349		2203	4300	6503	SO:0001819	synonymous_variant	284217	exon30			ACACACATCACAA	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.4296T>C	18.37:g.7002349A>G		52.0	0.0		37.0	9.0	NM_005559		Silent	SNP	ENST00000389658.3	37	CCDS32787.1																																																																																			.		0.507	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
MAP4K5	11183	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	50911780	50911780	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr14:50911780C>A	ENST00000013125.4	-	18	1636	c.1318G>T	c.(1318-1320)Gtg>Ttg	p.V440L		NM_006575.4|NM_198794.2	NP_006566.2|NP_942089.1	Q9Y4K4	M4K5_HUMAN	mitogen-activated protein kinase kinase kinase kinase 5	440					activation of JUN kinase activity (GO:0007257)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	all_epithelial(31;0.000415)|Breast(41;0.0102)					GTCTCTGCCACAGGCCCACAA	0.423																																					p.V440L		.											.	MAP4K5	546	0			c.G1318T						.						100.0	94.0	96.0					14																	50911780		1856	4092	5948	SO:0001583	missense	11183	exon18			CTGCCACAGGCCC	U77129		14q11.2-q21	2011-06-09				ENSG00000012983		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6867	protein-coding gene	gene with protein product	"""germinal center kinase-related"""	604923				9038372, 8274451	Standard	NM_198794		Approved	KHS1, GCKR, KHS	uc001wyb.3	Q9Y4K4		ENST00000013125.4:c.1318G>T	14.37:g.50911780C>A	ENSP00000013125:p.Val440Leu	122.0	0.0		73.0	16.0	NM_006575	Q8IYF6	Missense_Mutation	SNP	ENST00000013125.4	37		.	.	.	.	.	.	.	.	.	.	C	7.563	0.665175	0.14710	.	.	ENSG00000012983	ENST00000013125	T	0.13538	2.58	5.39	0.0837	0.14434	Protein kinase-like domain (1);	1.242570	0.05155	N	0.496721	T	0.05502	0.0145	N	0.08118	0	0.09310	N	1	B;B;B	0.14438	0.01;0.008;0.01	B;B;B	0.10450	0.004;0.005;0.002	T	0.35724	-0.9777	10	0.08381	T	0.77	.	1.8258	0.03120	0.1142:0.3798:0.2568:0.2492	.	114;440;440	B3KWC4;B2R928;Q9Y4K4	.;.;M4K5_HUMAN	L	440	ENSP00000013125:V440L	ENSP00000013125:V440L	V	-	1	0	MAP4K5	49981530	0.506000	0.26139	0.469000	0.27204	0.924000	0.55760	0.366000	0.20365	-0.003000	0.14444	-0.152000	0.13540	GTG	.		0.423	MAP4K5-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000410880.1	NM_006575	
MGAM	8972	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	141755415	141755415	+	Silent	SNP	C	C	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr7:141755415C>T	ENST00000549489.2	+	28	3467	c.3372C>T	c.(3370-3372)acC>acT	p.T1124T	MGAM_ENST00000475668.2_Silent_p.T1124T	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1124	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GCATCTCCACCCGCCTTCCCT	0.493																																					p.T1124T		.											.	MGAM	70	0			c.C3372T						.						138.0	127.0	130.0					7																	141755415		1923	4134	6057	SO:0001819	synonymous_variant	8972	exon28			CTCCACCCGCCTT	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.3372C>T	7.37:g.141755415C>T		93.0	1.0		72.0	14.0	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000549489.2	37	CCDS47727.1																																																																																			.		0.493	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
MTMR7	9108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	17163407	17163407	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr8:17163407T>G	ENST00000180173.5	-	11	1245	c.1211A>C	c.(1210-1212)gAg>gCg	p.E404A	MTMR7_ENST00000398099.3_5'UTR|MTMR7_ENST00000521857.1_Missense_Mutation_p.E404A	NM_004686.4	NP_004677.3	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7	404	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				inositol phosphate dephosphorylation (GO:0046855)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(8)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	32				Colorectal(111;0.112)		CCAAACACACTCAATGAACTG	0.363																																					p.E404A		.											.	MTMR7	91	0			c.A1211C						.						102.0	101.0	101.0					8																	17163407		2203	4300	6503	SO:0001583	missense	9108	exon11			ACACACTCAATGA	AF073482	CCDS34851.1	8p22	2011-06-09			ENSG00000003987	ENSG00000003987		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7454	protein-coding gene	gene with protein product		603562				9736772, 12890864	Standard	NM_004686		Approved		uc003wxm.3	Q9Y216	OTTHUMG00000163771	ENST00000180173.5:c.1211A>C	8.37:g.17163407T>G	ENSP00000180173:p.Glu404Ala	142.0	0.0		33.0	14.0	NM_004686	A1L4K9|B4DG87|Q68DX4	Missense_Mutation	SNP	ENST00000180173.5	37	CCDS34851.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.506771	0.85282	.	.	ENSG00000003987	ENST00000180173;ENST00000521857	D;D	0.93426	-3.22;-3.22	4.87	4.87	0.63330	Myotubularin phosphatase domain (1);	0.000000	0.85682	D	0.000000	D	0.97340	0.9130	M	0.92122	3.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.98342	1.0539	10	0.87932	D	0	.	14.9478	0.71047	0.0:0.0:0.0:1.0	.	404;404	Q9Y216-2;Q9Y216	.;MTMR7_HUMAN	A	404	ENSP00000180173:E404A;ENSP00000429733:E404A	ENSP00000180173:E404A	E	-	2	0	MTMR7	17207778	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.868000	0.87116	2.180000	0.69256	0.460000	0.39030	GAG	.		0.363	MTMR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375311.1	NM_004686	
MYO9B	4650	ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17283665	17283665	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr19:17283665A>G	ENST00000594824.1	+	13	2180	c.2033A>G	c.(2032-2034)gAc>gGc	p.D678G	MYO9B_ENST00000397274.2_Missense_Mutation_p.D678G|MYO9B_ENST00000595618.1_Missense_Mutation_p.D678G			Q13459	MYO9B_HUMAN	myosin IXB	678	Myosin motor.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						ATCGGCATGGACCCCGTGGCC	0.682																																					p.D678G		.											.	MYO9B	67	0			c.A2033G						.						48.0	56.0	53.0					19																	17283665		2113	4216	6329	SO:0001583	missense	4650	exon13			GCATGGACCCCGT		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.2033A>G	19.37:g.17283665A>G	ENSP00000471367:p.Asp678Gly	44.0	2.0		16.0	7.0	NM_001130065	O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	ENST00000594824.1	37		.	.	.	.	.	.	.	.	.	.	A	24.5	4.537911	0.85917	.	.	ENSG00000099331	ENST00000397274	D	0.87491	-2.26	4.51	4.51	0.55191	Myosin head, motor domain (2);	0.101834	0.42548	D	0.000699	D	0.91637	0.7357	M	0.70275	2.135	0.50171	D	0.999858	P;P;D	0.59357	0.868;0.868;0.985	P;P;D	0.64237	0.84;0.84;0.923	D	0.92441	0.5962	10	0.72032	D	0.01	.	12.9614	0.58460	1.0:0.0:0.0:0.0	.	678;678;684	Q13459;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.	G	678	ENSP00000380444:D678G	ENSP00000380444:D678G	D	+	2	0	MYO9B	17144665	1.000000	0.71417	0.998000	0.56505	0.699000	0.40488	7.359000	0.79477	1.801000	0.52704	0.533000	0.62120	GAC	.		0.682	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
NEB	4703	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	152476269	152476269	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr2:152476269T>C	ENST00000172853.10	-	69	9986	c.9839A>G	c.(9838-9840)tAc>tGc	p.Y3280C	NEB_ENST00000409198.1_Missense_Mutation_p.Y3280C|NEB_ENST00000604864.1_Missense_Mutation_p.Y3523C|NEB_ENST00000427231.2_Missense_Mutation_p.Y3523C|NEB_ENST00000397345.3_Missense_Mutation_p.Y3523C|NEB_ENST00000603639.1_Missense_Mutation_p.Y3523C			P20929	NEBU_HUMAN	nebulin	3280					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGCTTCTTTGTATTTGTACTG	0.443																																					p.Y3523C		.											.	NEB	145	0			c.A10568G						.						52.0	51.0	52.0					2																	152476269		1937	4133	6070	SO:0001583	missense	4703	exon73			TCTTTGTATTTGT	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.9839A>G	2.37:g.152476269T>C	ENSP00000172853:p.Tyr3280Cys	132.0	1.0		76.0	28.0	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	T	25.7	4.664117	0.88251	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	D;D;D;D	0.99958	-9.03;-9.03;-9.03;-9.03	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.99959	0.9983	M	0.93283	3.4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95786	0.8821	10	0.87932	D	0	.	16.215	0.82206	0.0:0.0:0.0:1.0	.	3280	P20929	NEBU_HUMAN	C	3280;3523;3523;3280	ENSP00000386259:Y3280C;ENSP00000380505:Y3523C;ENSP00000416578:Y3523C;ENSP00000172853:Y3280C	ENSP00000172853:Y3280C	Y	-	2	0	NEB	152184515	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.948000	0.87774	2.288000	0.76882	0.533000	0.62120	TAC	.		0.443	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
NRXN2	9379	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64434901	64434901	+	Missense_Mutation	SNP	C	C	A	rs143130600		TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr11:64434901C>A	ENST00000377551.1	-	8	1830	c.1619G>T	c.(1618-1620)gGt>gTt	p.G540V	NRXN2_ENST00000409571.1_Missense_Mutation_p.G533V|NRXN2_ENST00000377559.3_Missense_Mutation_p.G509V|NRXN2_ENST00000265459.6_Missense_Mutation_p.G540V			Q9P2S2	NRX2A_HUMAN	neurexin 2	540	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						GCCAGCTCCACCCCCAGCCCG	0.657																																					p.G540V		.											.	NRXN2	232	0			c.G1619T						.						49.0	52.0	51.0					11																	64434901		2201	4297	6498	SO:0001583	missense	9379	exon9			GCTCCACCCCCAG		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.1619G>T	11.37:g.64434901C>A	ENSP00000366774:p.Gly540Val	81.0	0.0		49.0	11.0	NM_015080	A7E2C1|Q9Y2D6	Missense_Mutation	SNP	ENST00000377551.1	37	CCDS8077.1	.	.	.	.	.	.	.	.	.	.	C	4.594	0.110325	0.08780	.	.	ENSG00000110076	ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571	T;T;T;T	0.62788	0.0;0.12;0.0;0.12	4.3	-1.63	0.08345	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	1.182110	0.06903	N	0.806307	T	0.38081	0.1027	N	0.03608	-0.345	0.09310	N	0.999998	B;B;B	0.28605	0.217;0.008;0.0	B;B;B	0.31946	0.138;0.065;0.002	T	0.37267	-0.9713	10	0.52906	T	0.07	.	7.6893	0.28559	0.1966:0.5605:0.2429:0.0	.	509;540;286	Q9P2S2-2;Q9P2S2;E7EV67	.;NRX2A_HUMAN;.	V	540;509;540;509;533	ENSP00000366774:G540V;ENSP00000366782:G509V;ENSP00000265459:G540V;ENSP00000386416:G533V	ENSP00000265459:G540V	G	-	2	0	NRXN2	64191477	0.000000	0.05858	0.042000	0.18584	0.282000	0.26991	0.093000	0.15086	-0.128000	0.11641	-0.502000	0.04539	GGT	C|1.000;T|0.000		0.657	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080	
NLRX1	79671	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	119052990	119052990	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr11:119052990G>A	ENST00000409109.1	+	9	3129	c.2542G>A	c.(2542-2544)Ggt>Agt	p.G848S	NLRX1_ENST00000409991.1_Missense_Mutation_p.G848S|NLRX1_ENST00000409265.4_Missense_Mutation_p.G848S|NLRX1_ENST00000525863.1_Missense_Mutation_p.G848S|NLRX1_ENST00000292199.2_Missense_Mutation_p.G848S	NM_001282144.1	NP_001269073.1	Q86UT6	NLRX1_HUMAN	NLR family member X1	848	Required for the repression of MAVS- induced interferon signaling.				innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|viral process (GO:0016032)	mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)			cervix(1)|endometrium(2)|kidney(2)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	22	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CAACGGTGCTGGTGACACAGC	0.682																																					p.G848S		.											.	NLRX1	92	0			c.G2542A						.						60.0	63.0	62.0					11																	119052990		2200	4295	6495	SO:0001583	missense	79671	exon9			GGTGCTGGTGACA	AB094095	CCDS8416.1	11q23.3	2007-02-07			ENSG00000160703	ENSG00000160703		"""Nucleotide-binding domain and leucine rich repeat containing"""	29890	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat containing X1"", ""NOD-like receptor X1"", ""NLR family, X1"""	611947				12766759	Standard	XM_005271669		Approved	NOD9, CLR11.3	uc001pvw.3	Q86UT6	OTTHUMG00000154476	ENST00000409109.1:c.2542G>A	11.37:g.119052990G>A	ENSP00000387334:p.Gly848Ser	56.0	0.0		25.0	7.0	NM_024618	A8K6Q1|B3KPK2|B3KTA2|Q7RTR3|Q96D51|Q9H724	Missense_Mutation	SNP	ENST00000409109.1	37	CCDS8416.1	.	.	.	.	.	.	.	.	.	.	G	14.71	2.617421	0.46736	.	.	ENSG00000160703	ENST00000409991;ENST00000292199;ENST00000409265;ENST00000409109;ENST00000525863	T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63	4.52	2.58	0.30949	.	0.216054	0.37012	N	0.002285	T	0.46908	0.1417	L	0.55743	1.74	0.21416	N	0.999691	D;B	0.55800	0.973;0.386	P;B	0.53593	0.73;0.079	T	0.26780	-1.0093	10	0.33940	T	0.23	.	3.9576	0.09396	0.312:0.188:0.5:0.0	.	848;848	Q86UT6-2;Q86UT6	.;NLRX1_HUMAN	S	848	ENSP00000386851:G848S;ENSP00000292199:G848S;ENSP00000386858:G848S;ENSP00000387334:G848S;ENSP00000433442:G848S	ENSP00000292199:G848S	G	+	1	0	NLRX1	118558200	1.000000	0.71417	0.631000	0.29282	0.912000	0.54170	2.704000	0.47118	1.131000	0.42111	0.407000	0.27541	GGT	.		0.682	NLRX1-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335403.1	NM_170722	
OBSCN	84033	ucsc.edu;bcgsc.ca	37	1	228451857	228451857	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr1:228451857G>T	ENST00000422127.1	+	16	4670	c.4626G>T	c.(4624-4626)agG>agT	p.R1542S	OBSCN_ENST00000359599.6_Missense_Mutation_p.R198S|OBSCN_ENST00000284548.11_Missense_Mutation_p.R1542S|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000570156.2_Missense_Mutation_p.R1726S|OBSCN_ENST00000366709.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1542	Ig-like 16.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CAGCGAGCAGGGAGGTGCAGG	0.637																																					p.R1726S		.											.	OBSCN	403	0			c.G5178T						.						53.0	56.0	55.0					1																	228451857		2115	4228	6343	SO:0001583	missense	84033	exon18			GAGCAGGGAGGTG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.4626G>T	1.37:g.228451857G>T	ENSP00000409493:p.Arg1542Ser	210.0	2.0		157.0	57.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	.	0.214	-1.034312	0.02029	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599	T;T;T	0.66638	-0.22;-0.22;-0.22	4.82	-9.64	0.00541	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.744272	0.12367	N	0.475174	T	0.29850	0.0746	N	0.04508	-0.205	0.42774	D	0.993848	B;B	0.15141	0.009;0.012	B;B	0.20577	0.03;0.003	T	0.39014	-0.9634	10	0.09843	T	0.71	.	5.4923	0.16783	0.1629:0.3709:0.3804:0.0857	.	1542;1542	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	S	1542;1542;198	ENSP00000284548:R1542S;ENSP00000409493:R1542S;ENSP00000352613:R198S	ENSP00000284548:R1542S	R	+	3	2	OBSCN	226518480	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.765000	0.01799	-3.385000	0.00174	-2.756000	0.00123	AGG	.		0.637	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR2M7	391196	ucsc.edu;bcgsc.ca	37	1	248487600	248487600	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr1:248487600A>G	ENST00000317965.2	-	1	299	c.271T>C	c.(271-273)Tcc>Ccc	p.S91P		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATAGAAATGGACTTGCTGCCA	0.483																																					p.S91P		.											.	OR2M7	70	0			c.T271C						.						226.0	228.0	227.0					1																	248487600		2203	4300	6503	SO:0001583	missense	391196	exon1			AAATGGACTTGCT	BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.271T>C	1.37:g.248487600A>G	ENSP00000324557:p.Ser91Pro	206.0	2.0		163.0	76.0	NM_001004691	B2RNL0|Q6IEX6	Missense_Mutation	SNP	ENST00000317965.2	37	CCDS31111.1	.	.	.	.	.	.	.	.	.	.	A	12.82	2.053316	0.36181	.	.	ENSG00000177186	ENST00000317965	T	0.00603	6.28	1.54	-1.69	0.08186	GPCR, rhodopsin-like superfamily (1);	0.911703	0.08892	U	0.878473	T	0.01061	0.0035	M	0.64997	1.995	0.09310	N	1	P	0.40398	0.716	P	0.49192	0.602	T	0.42899	-0.9424	10	0.72032	D	0.01	.	3.4631	0.07540	0.2395:0.1649:0.0:0.5955	.	91	Q8NG81	OR2M7_HUMAN	P	91	ENSP00000324557:S91P	ENSP00000324557:S91P	S	-	1	0	OR2M7	246554223	0.000000	0.05858	0.001000	0.08648	0.020000	0.10135	-0.106000	0.10890	-0.136000	0.11475	0.155000	0.16302	TCC	.		0.483	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097357.1	NM_001004691	
OR52N4	390072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5776243	5776243	+	Silent	SNP	C	C	G			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr11:5776243C>G	ENST00000317254.3	+	1	321	c.273C>G	c.(271-273)ctC>ctG	p.L91L	TRIM5_ENST00000380027.1_Intron	NM_001005175.2	NP_001005175.3	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N, member 4 (gene/pseudogene)	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		GGTTTCATCTCAAGGACATTG	0.468																																					p.L91L		.											.	OR52N4	2	0			c.C273G						.						145.0	148.0	147.0					11																	5776243		2201	4297	6498	SO:0001819	synonymous_variant	390072	exon1			TCATCTCAAGGAC	AB065813	CCDS44528.1	11p15.4	2013-10-10	2013-10-10		ENSG00000181074	ENSG00000181074		"""GPCR / Class A : Olfactory receptors"""	15230	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily N, member 4"""				Standard	NM_001005175		Approved		uc001mbu.3	Q8NGI2	OTTHUMG00000066887	ENST00000317254.3:c.273C>G	11.37:g.5776243C>G		123.0	0.0		74.0	12.0	NM_001005175	B2RNP8|Q6IF77	Silent	SNP	ENST00000317254.3	37	CCDS44528.1																																																																																			.		0.468	OR52N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143350.1	NM_001005175	
OR7D2	162998	broad.mit.edu;mdanderson.org	37	19	9296842	9296842	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr19:9296842C>A	ENST00000344248.2	+	1	564	c.385C>A	c.(385-387)Cct>Act	p.P129T		NM_175883.2	NP_787079.1	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D, member 2	129					regulation of transcription, DNA-templated (GO:0006355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	20						TGTCTGCCACCCTCTGCACTA	0.507																																					p.P129T		.											.	OR7D2	71	0			c.C385A						.						165.0	155.0	158.0					19																	9296842		2203	4300	6503	SO:0001583	missense	162998	exon1			TGCCACCCTCTGC	AK095468	CCDS32900.1	19p13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8378	protein-coding gene	gene with protein product							Standard	NM_175883		Approved	OR19-4, HTPCRH03, FLJ38149	uc002mkz.1	Q96RA2		ENST00000344248.2:c.385C>A	19.37:g.9296842C>A	ENSP00000345563:p.Pro129Thr	75.0	0.0		18.0	3.0	NM_175883	Q6IFJ7|Q8N133	Missense_Mutation	SNP	ENST00000344248.2	37	CCDS32900.1	.	.	.	.	.	.	.	.	.	.	C	13.64	2.298751	0.40694	.	.	ENSG00000188000	ENST00000344248	T	0.01887	4.58	2.21	2.21	0.28008	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39615	U	0.001304	T	0.12475	0.0303	H	0.99881	4.885	0.38097	D	0.937133	P	0.39847	0.691	B	0.37833	0.259	T	0.43458	-0.9390	10	0.87932	D	0	.	11.9872	0.53155	0.0:1.0:0.0:0.0	.	129	Q96RA2	OR7D2_HUMAN	T	129	ENSP00000345563:P129T	ENSP00000345563:P129T	P	+	1	0	OR7D2	9157842	0.997000	0.39634	1.000000	0.80357	0.534000	0.34807	6.450000	0.73477	1.583000	0.49898	0.511000	0.50034	CCT	.		0.507	OR7D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449002.1		
P2RY1	5028	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	152553754	152553754	+	Silent	SNP	A	A	G			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr3:152553754A>G	ENST00000305097.3	+	1	1019	c.183A>G	c.(181-183)gtA>gtG	p.V61V		NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	61					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			ACATCTTGGTATTCATCATCG	0.562																																					p.V61V		.											.	P2RY1	500	0			c.A183G						.						106.0	91.0	96.0					3																	152553754		2203	4300	6503	SO:0001819	synonymous_variant	5028	exon1			CTTGGTATTCATC	U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.183A>G	3.37:g.152553754A>G		209.0	1.0		159.0	17.0	NM_002563		Silent	SNP	ENST00000305097.3	37	CCDS3169.1																																																																																			.		0.562	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356943.1	NM_002563	
PABPC5	140886	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	90690699	90690699	+	Silent	SNP	T	T	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chrX:90690699T>A	ENST00000312600.3	+	2	337	c.123T>A	c.(121-123)gcT>gcA	p.A41A	PABPC5_ENST00000373105.1_Intron|PABPC5-AS1_ENST00000456187.1_RNA	NM_080832.2	NP_543022.1	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	41	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.					mitochondrion (GO:0005739)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(1)|pancreas(1)	42						TCAGGCCTGCTGGCCCTCTGC	0.572																																					p.A41A		.											.	PABPC5	110	0			c.T123A						.						53.0	41.0	45.0					X																	90690699		2203	4300	6503	SO:0001819	synonymous_variant	140886	exon2			GCCTGCTGGCCCT	AJ278963	CCDS14460.1	Xq21.3	2013-02-12	2001-11-28		ENSG00000174740	ENSG00000174740		"""RNA binding motif (RRM) containing"""	13629	protein-coding gene	gene with protein product		300407	"""poly(A)-binding protein, cytoplasmic 5"""			11374897	Standard	NM_080832		Approved	PABP5	uc004efg.3	Q96DU9	OTTHUMG00000021959	ENST00000312600.3:c.123T>A	X.37:g.90690699T>A		53.0	0.0		16.0	10.0	NM_080832	A8K240|Q5JQF4|Q6P529|Q9UFE5	Silent	SNP	ENST00000312600.3	37	CCDS14460.1																																																																																			.		0.572	PABPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057429.1	NM_080832	
PAX6	5080	ucsc.edu;bcgsc.ca	37	11	31815289	31815289	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr11:31815289C>A	ENST00000379132.3	-	9	1107	c.827G>T	c.(826-828)aGa>aTa	p.R276I	PAX6_ENST00000379107.2_Missense_Mutation_p.R290I|PAX6_ENST00000419022.1_Missense_Mutation_p.R290I|PAX6_ENST00000379111.2_Missense_Mutation_p.R276I|PAX6_ENST00000379123.5_Missense_Mutation_p.R276I|PAX6_ENST00000379129.2_Missense_Mutation_p.R290I|PAX6_ENST00000241001.8_Missense_Mutation_p.R276I|PAX6_ENST00000379115.4_Missense_Mutation_p.R290I			P26367	PAX6_HUMAN	paired box 6	276					astrocyte differentiation (GO:0048708)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|cerebral cortex regionalization (GO:0021796)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|cornea development in camera-type eye (GO:0061303)|dorsal/ventral axis specification (GO:0009950)|embryonic camera-type eye morphogenesis (GO:0048596)|eye development (GO:0001654)|eye photoreceptor cell development (GO:0042462)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain-midbrain boundary formation (GO:0021905)|glucose homeostasis (GO:0042593)|hindbrain development (GO:0030902)|iris morphogenesis (GO:0061072)|keratinocyte differentiation (GO:0030216)|lacrimal gland development (GO:0032808)|lens development in camera-type eye (GO:0002088)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|neuron migration (GO:0001764)|oligodendrocyte cell fate specification (GO:0021778)|organ morphogenesis (GO:0009887)|pancreatic A cell development (GO:0003322)|pituitary gland development (GO:0021983)|positive regulation of cell fate specification (GO:0042660)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of gene expression (GO:0010628)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to organelle (GO:0033365)|protein ubiquitination (GO:0016567)|regulation of cell migration (GO:0030334)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in somatic motor neuron fate commitment (GO:0021918)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|salivary gland morphogenesis (GO:0007435)|signal transduction involved in regulation of gene expression (GO:0023019)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell differentiation (GO:0003309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)	35	Lung SC(675;0.225)					GCTGGCCTGTCTTCTCTGATT	0.458									Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation																												p.R290I		.											.	PAX6	1086	0			c.G869T						.						289.0	293.0	291.0					11																	31815289		2202	4299	6501	SO:0001583	missense	5080	exon11	Familial Cancer Database	WAGR syndrome	GCCTGTCTTCTCT	AY707088	CCDS31451.1, CCDS31452.1	11p13	2014-09-17	2007-07-12		ENSG00000007372	ENSG00000007372		"""Paired boxes"", ""Homeoboxes / PRD class"""	8620	protein-coding gene	gene with protein product	"""aniridia, keratitis"""	607108	"""paired box gene 6 (aniridia, keratitis)"""	AN2		1302030	Standard	NM_001127612		Approved	D11S812E, AN, WAGR	uc021qfm.1	P26367	OTTHUMG00000041447	ENST00000379132.3:c.827G>T	11.37:g.31815289C>A	ENSP00000368427:p.Arg276Ile	160.0	2.0		134.0	53.0	NM_001604	Q6N006|Q99413	Missense_Mutation	SNP	ENST00000379132.3	37	CCDS31451.1	.	.	.	.	.	.	.	.	.	.	C	35	5.485031	0.96323	.	.	ENSG00000007372	ENST00000419022;ENST00000379132;ENST00000379129;ENST00000531633;ENST00000379107;ENST00000464174;ENST00000241001;ENST00000379115;ENST00000379111;ENST00000379123;ENST00000494377;ENST00000470027;ENST00000379109;ENST00000533333;ENST00000530373;ENST00000531910	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.94723	-3.5;-3.5;-3.5;-3.03;-3.5;-3.1;-3.5;-3.5;-3.5;-3.5;-2.97;-2.97;-3.5;-3.24;-2.99;-2.96	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	D	0.96731	0.8933	L	0.60067	1.865	0.80722	D	1	D;D	0.76494	0.983;0.999	P;D	0.72982	0.824;0.979	D	0.96464	0.9343	10	0.62326	D	0.03	.	20.3674	0.98886	0.0:1.0:0.0:0.0	.	290;276	F1T0F8;P26367	.;PAX6_HUMAN	I	290;276;290;105;290;75;276;290;276;276;140;140;276;231;75;140	ENSP00000404100:R290I;ENSP00000368427:R276I;ENSP00000368424:R290I;ENSP00000451885:R105I;ENSP00000368401:R290I;ENSP00000431961:R75I;ENSP00000241001:R276I;ENSP00000368410:R290I;ENSP00000368406:R276I;ENSP00000368418:R276I;ENSP00000451901:R140I;ENSP00000450775:R140I;ENSP00000368403:R276I;ENSP00000451372:R231I;ENSP00000452202:R75I;ENSP00000452558:R140I	ENSP00000241001:R276I	R	-	2	0	PAX6	31771865	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.449000	0.80643	2.805000	0.96524	0.643000	0.83706	AGA	.		0.458	PAX6-008	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000099293.4	NM_001604	
PKP1	5317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	201294914	201294914	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr1:201294914T>C	ENST00000352845.3	+	13	2117	c.2117T>C	c.(2116-2118)cTt>cCt	p.L706P	PKP1_ENST00000367324.3_Missense_Mutation_p.L685P|PKP1_ENST00000263946.3_Missense_Mutation_p.L706P			Q13835	PKP1_HUMAN	plakophilin 1	706					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						GCTGCCCGGCTTCTCCTGTCT	0.562																																					p.L706P		.											.	PKP1	92	0			c.T2117C						.						67.0	62.0	64.0					1																	201294914		2203	4300	6503	SO:0001583	missense	5317	exon13			CCCGGCTTCTCCT	X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.2117T>C	1.37:g.201294914T>C	ENSP00000295597:p.Leu706Pro	139.0	0.0		116.0	25.0	NM_000299	O00645|Q14CA0|Q15152	Missense_Mutation	SNP	ENST00000352845.3	37	CCDS30966.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.110130	0.77210	.	.	ENSG00000081277	ENST00000367324;ENST00000263946;ENST00000352845	T;T;T	0.50277	0.75;0.75;0.75	5.29	5.29	0.74685	Armadillo-like helical (1);Armadillo-type fold (1);	0.149594	0.44483	D	0.000451	T	0.63295	0.2499	L	0.53249	1.67	0.80722	D	1	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.76575	0.968;0.988;0.982	T	0.61840	-0.6980	10	0.37606	T	0.19	-2.7201	15.2179	0.73285	0.0:0.0:0.0:1.0	.	293;685;706	Q14BN3;Q13835-2;Q13835	.;.;PKP1_HUMAN	P	685;706;706	ENSP00000356293:L685P;ENSP00000263946:L706P;ENSP00000295597:L706P	ENSP00000263946:L706P	L	+	2	0	PKP1	199561537	0.999000	0.42202	0.985000	0.45067	0.926000	0.56050	5.471000	0.66762	1.992000	0.58205	0.533000	0.62120	CTT	.		0.562	PKP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000086897.1	NM_000299	
PLAA	9373	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	26905887	26905887	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr9:26905887C>G	ENST00000397292.3	-	14	2427	c.2010G>C	c.(2008-2010)caG>caC	p.Q670H		NM_001031689.2	NP_001026859.1	Q9Y263	PLAP_HUMAN	phospholipase A2-activating protein	670	PUL. {ECO:0000255|PROSITE- ProRule:PRU00729}.				inflammatory response (GO:0006954)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	phospholipase A2 activator activity (GO:0016005)			breast(1)|endometrium(7)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	17		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)		TTTGTCCTGCCTGGCCAACAA	0.443																																					p.Q670H	Melanoma(175;2670 2735 14091 35526)	.											.	PLAA	514	0			c.G2010C						.						83.0	79.0	80.0					9																	26905887		2203	4300	6503	SO:0001583	missense	9373	exon14			TCCTGCCTGGCCA	AF083395	CCDS35000.1	9p21	2013-01-10			ENSG00000137055	ENSG00000137055		"""WD repeat domain containing"""	9043	protein-coding gene	gene with protein product	"""DOA1 homolog (S. cerevisiae)"""	603873				9931468, 10644453	Standard	NM_001031689		Approved	PLAP, PLA2P, FLJ11281, FLJ12699, DOA1	uc003zqd.3	Q9Y263	OTTHUMG00000019708	ENST00000397292.3:c.2010G>C	9.37:g.26905887C>G	ENSP00000380460:p.Gln670His	198.0	0.0		93.0	22.0	NM_001031689	Q53EU5|Q5VY33|Q9NUL8|Q9NVE9|Q9UF53|Q9Y5L1	Missense_Mutation	SNP	ENST00000397292.3	37	CCDS35000.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.48|10.48	1.362073|1.362073	0.24684|0.24684	.|.	.|.	ENSG00000137055|ENSG00000137055	ENST00000517642|ENST00000397292	.|T	.|0.49432	.|0.78	6.07|6.07	6.07|6.07	0.98685|0.98685	.|PUL (2);	.|0.402261	.|0.31495	.|N	.|0.007554	T|T	0.34745|0.34745	0.0908|0.0908	L|L	0.40543|0.40543	1.245|1.245	0.80722|0.80722	D|D	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.06405	.|0.002	T|T	0.36407|0.36407	-0.9749|-0.9749	5|10	.|0.48119	.|T	.|0.1	-3.1398|-3.1398	4.1806|4.1806	0.10374|0.10374	0.1536:0.5945:0.1479:0.104|0.1536:0.5945:0.1479:0.104	.|.	.|670	.|Q9Y263	.|PLAP_HUMAN	R|H	288|670	.|ENSP00000380460:Q670H	.|ENSP00000380460:Q670H	G|Q	-|-	1|3	0|2	PLAA|PLAA	26895887|26895887	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	0.868000|0.868000	0.27982|0.27982	2.885000|2.885000	0.99019|0.99019	0.655000|0.655000	0.94253|0.94253	GGC|CAG	.		0.443	PLAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051958.2	NM_001031689	
PORCN	64840	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	48375573	48375573	+	Silent	SNP	C	C	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chrX:48375573C>T	ENST00000326194.6	+	13	1219	c.1176C>T	c.(1174-1176)ggC>ggT	p.G392G	PORCN_ENST00000359882.4_Silent_p.G386G|PORCN_ENST00000367574.4_Silent_p.G310G|PORCN_ENST00000361988.3_Silent_p.G381G|PORCN_ENST00000537758.1_Silent_p.G392G|PORCN_ENST00000355961.4_Silent_p.G387G|PORCN_ENST00000355092.3_Silent_p.G386G	NM_203475.1	NP_982301.1	Q9H237	PORCN_HUMAN	porcupine homolog (Drosophila)	392					glycoprotein metabolic process (GO:0009100)|Wnt signaling pathway (GO:0016055)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups (GO:0016746)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCCCACAGGGCCTGGGGGTGC	0.597																																					p.G392G		.											.	PORCN	133	0			c.C1176T						.						88.0	60.0	70.0					X																	48375573		2164	4194	6358	SO:0001819	synonymous_variant	64840	exon13			ACAGGGCCTGGGG	AF317058	CCDS14296.1, CCDS14297.1, CCDS14298.1, CCDS14299.1	Xp11.23	2014-02-05			ENSG00000102312	ENSG00000102312			17652	protein-coding gene	gene with protein product		300651	"""dermal hypoplasia, focal"""	DHOF		10866835, 12034504, 17546030	Standard	NM_203474		Approved	MG61, PORC, PPN, por	uc004djv.1	Q9H237	OTTHUMG00000024116	ENST00000326194.6:c.1176C>T	X.37:g.48375573C>T		50.0	1.0		10.0	8.0	NM_203475	B2RBN8|B7ZAR3|Q14829|Q9H234|Q9H235|Q9H236|Q9UJU7	Silent	SNP	ENST00000326194.6	37	CCDS14299.1																																																																																			.		0.597	PORCN-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356990.1	NM_022825	
POU2F1	5451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	167384897	167384897	+	Silent	SNP	T	T	C			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr1:167384897T>C	ENST00000541643.3	+	17	2244	c.2082T>C	c.(2080-2082)tcT>tcC	p.S694S	POU2F1_ENST00000367865.1_3'UTR|POU2F1_ENST00000420254.3_Intron|POU2F1_ENST00000367866.2_Silent_p.S717S|POU2F1_ENST00000429375.2_Silent_p.S654S|POU2F1_ENST00000367862.5_Silent_p.S706S			P14859	PO2F1_HUMAN	POU class 2 homeobox 1	694					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						GCTTGGTCTCTGCCGCCGCAG	0.592																																					p.S717S		.											.	POU2F1	579	0			c.T2151C						.						146.0	134.0	138.0					1																	167384897		2203	4300	6503	SO:0001819	synonymous_variant	5451	exon16			GGTCTCTGCCGCC	BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.2082T>C	1.37:g.167384897T>C		133.0	0.0		80.0	21.0	NM_002697	B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Silent	SNP	ENST00000541643.3	37																																																																																				.		0.592	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_002697	
PRMT1	3276	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	50180570	50180570	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr19:50180570G>A	ENST00000391851.4	+	1	162	c.33G>A	c.(31-33)atG>atA	p.M11I	PRMT1_ENST00000532489.1_Intron|PRMT1_ENST00000454376.2_Missense_Mutation_p.M11I	NM_198318.4	NP_938074.2	Q99873	ANM1_HUMAN	protein arginine methyltransferase 1	0					cell surface receptor signaling pathway (GO:0007166)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|negative regulation of megakaryocyte differentiation (GO:0045653)|neuron projection development (GO:0031175)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|protein methylation (GO:0006479)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|identical protein binding (GO:0042802)|methyltransferase activity (GO:0008168)|N-methyltransferase activity (GO:0008170)|poly(A) RNA binding (GO:0044822)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(2)	12		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00103)|GBM - Glioblastoma multiforme(134;0.012)		ACTGCATCATGGAGGTGAGCG	0.677																																					p.M11I		.											.	PRMT1	91	0			c.G33A						.						31.0	45.0	41.0					19																	50180570		1974	4185	6159	SO:0001583	missense	3276	exon1			CATCATGGAGGTG	D66904	CCDS42592.1, CCDS46145.1, CCDS74425.1	19q13	2014-06-12	2006-02-16	2006-02-16	ENSG00000126457	ENSG00000126457	2.1.1.125	"""Protein arginine methyltransferases"""	5187	protein-coding gene	gene with protein product		602950	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 2"", ""HMT1 hnRNP methyltransferase-like 2 (S. cerevisiae)"""	HRMT1L2		9545638	Standard	NM_001207042		Approved	HCP1, ANM1	uc010enf.2	Q99873	OTTHUMG00000167568	ENST00000391851.4:c.33G>A	19.37:g.50180570G>A	ENSP00000375724:p.Met11Ile	31.0	0.0		18.0	4.0	NM_001207042	B4E3C3|G5E9B6|Q15529|Q2VP93|Q6LEU5|Q8WUW5|Q99872|Q99874|Q9NZ04|Q9NZ05|Q9NZ06	Missense_Mutation	SNP	ENST00000391851.4	37	CCDS42592.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.93|17.93	3.509147|3.509147	0.64410|0.64410	.|.	.|.	ENSG00000126457|ENSG00000126457	ENST00000391851;ENST00000454376|ENST00000524771	T;T|.	0.25250|.	1.81;1.83|.	4.79|4.79	4.79|4.79	0.61399|0.61399	.|.	.|.	.|.	.|.	.|.	T|.	0.48732|.	0.1516|.	.|.	.|.	.|.	0.29010|0.29010	N|N	0.886951|0.886951	B;P|.	0.36249|.	0.003;0.545|.	B;B|.	0.26416|.	0.003;0.069|.	T|.	0.43814|.	-0.9368|.	8|.	0.37606|.	T|.	0.19|.	0.2964|0.2964	13.1992|13.1992	0.59758|0.59758	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1;11|.	Q99873;G5E9B6|.	ANM1_HUMAN;.|.	I|X	11|7	ENSP00000375724:M11I;ENSP00000406162:M11I|.	ENSP00000375724:M11I|.	M|W	+|+	3|2	0|0	PRMT1|PRMT1	54872382|54872382	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.870000|0.870000	0.49936|0.49936	5.026000|5.026000	0.64103|0.64103	2.473000|2.473000	0.83533|0.83533	0.655000|0.655000	0.94253|0.94253	ATG|TGG	.		0.677	PRMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395065.1	NM_001536	
PRPF8	10594	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	1576479	1576479	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr17:1576479G>A	ENST00000572621.1	-	23	3935	c.3670C>T	c.(3670-3672)Cgc>Tgc	p.R1224C	PRPF8_ENST00000304992.6_Missense_Mutation_p.R1224C			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1224	Reverse transcriptase homology domain.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		TGAGCTGTGCGCTCCTTAGTA	0.537																																					p.R1224C		.											.	PRPF8	525	0			c.C3670T						.						125.0	100.0	108.0					17																	1576479		2203	4300	6503	SO:0001583	missense	10594	exon24			CTGTGCGCTCCTT	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.3670C>T	17.37:g.1576479G>A	ENSP00000460348:p.Arg1224Cys	63.0	1.0		21.0	15.0	NM_006445	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	37	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	G	19.43	3.825815	0.71143	.	.	ENSG00000174231	ENST00000304992	T	0.46451	0.87	6.06	5.04	0.67666	Pre-mRNA-processing-splicing factor 8, U5-snRNA-binding (1);	0.047131	0.85682	D	0.000000	T	0.66752	0.2821	M	0.85462	2.755	0.80722	D	1	D	0.76494	0.999	D	0.65140	0.932	T	0.68435	-0.5409	10	0.45353	T	0.12	-6.6737	17.345	0.87308	0.0:0.0:0.8504:0.1496	.	1224	Q6P2Q9	PRP8_HUMAN	C	1224	ENSP00000304350:R1224C	ENSP00000304350:R1224C	R	-	1	0	PRPF8	1523229	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	2.954000	0.49113	2.879000	0.98667	0.650000	0.86243	CGC	.		0.537	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
PRSS41	360226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2854526	2854526	+	RNA	SNP	T	T	C	rs371957092	byFrequency	TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr16:2854526T>C	ENST00000399677.1	+	0	717							Q7RTY9	PRS41_HUMAN	protease, serine, 41							anchored component of membrane (GO:0031225)|intracellular organelle (GO:0043229)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)										GTGCTGAGGATGGCAGTGTAG	0.517													T|||	4	0.000798722	0.003	0.0	5008	,	,		19506	0.0		0.0	False		,,,				2504	0.0				p.D239D		.											.	.	.	0			c.T717C						.	T		2,1382		0,2,690	223.0	187.0	198.0		717	-8.5	0.0	16		198	0,3182		0,0,1591	no	coding-synonymous	PRSS41	NM_001135086.1		0,2,2281	CC,CT,TT		0.0,0.1445,0.0438		239/319	2854526	2,4564	692	1591	2283			360226	exon4			TGAGGATGGCAGT			16p13.3	2014-04-01			ENSG00000215148	ENSG00000215148		"""Serine peptidases / Serine peptidases"""	30715	other	unknown	"""testis serine protease 1"""					12838346	Standard	NM_001135086		Approved	TESSP1	uc010uwi.2	Q7RTY9	OTTHUMG00000128932		16.37:g.2854526T>C		75.0	0.0		53.0	10.0	NM_001135086		Silent	SNP	ENST00000399677.1	37																																																																																				.		0.517	PRSS41-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000436450.1	NM_183379	
PTOV1	53635	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50361895	50361895	+	Silent	SNP	C	C	A	rs376020024		TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr19:50361895C>A	ENST00000601675.1	+	10	1130	c.1026C>A	c.(1024-1026)atC>atA	p.I342I	PTOV1_ENST00000221557.9_Silent_p.I310I|AC018766.5_ENST00000593654.1_RNA|PTOV1_ENST00000391842.1_Silent_p.I342I|AC018766.5_ENST00000599259.1_RNA|PTOV1_ENST00000598325.1_3'UTR|AC018766.5_ENST00000601893.1_RNA|AC018766.4_ENST00000596624.1_RNA|PTOV1_ENST00000601638.1_Silent_p.I310I|PTOV1_ENST00000599732.1_Silent_p.I342I|PTOV1_ENST00000600603.1_Silent_p.I310I			Q86YD1	PTOV1_HUMAN	prostate tumor overexpressed 1	342	Interaction with FLOT1.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(5)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)	16		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.0132)		TGTGCCGGATCATGGACAATG	0.662																																					p.I342I		.											.	PTOV1	226	0			c.C1026A						.	C		2,4404		0,2,2201	42.0	28.0	33.0		1026	2.4	0.9	19		33	0,8600		0,0,4300	no	coding-synonymous	PTOV1	NM_017432.3		0,2,6501	AA,AC,CC		0.0,0.0454,0.0154		342/417	50361895	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	53635	exon10			CCGGATCATGGAC	AF238381	CCDS12782.1	19q13.33	2014-08-28	2008-09-12		ENSG00000104960	ENSG00000104960			9632	protein-coding gene	gene with protein product		610195				12598323, 15713644	Standard	XM_005258998		Approved		uc002pqf.1	Q86YD1	OTTHUMG00000183162	ENST00000601675.1:c.1026C>A	19.37:g.50361895C>A		81.0	0.0		52.0	25.0	NM_017432	Q6UXX7|Q96BU3|Q9HBN4|Q9NYL1	Silent	SNP	ENST00000601675.1	37	CCDS12782.1																																																																																			.		0.662	PTOV1-007	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465347.1	NM_017432	
PTPRA	5786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	2988018	2988018	+	Silent	SNP	G	G	A	rs142755718		TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr20:2988018G>A	ENST00000216877.6	+	10	1231	c.831G>A	c.(829-831)ccG>ccA	p.P277P	PTPRA_ENST00000356147.3_Silent_p.P277P|PTPRA_ENST00000399903.2_Silent_p.P286P|PTPRA_ENST00000380393.3_Silent_p.P286P|PTPRA_ENST00000318266.5_Silent_p.P277P|PTPRA_ENST00000358719.4_Silent_p.P142P|PTPRA_ENST00000425918.2_Silent_p.P297P	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	286	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						ACCTGACACCGGTTGAAGGGG	0.438													G|||	1	0.000199681	0.0	0.0	5008	,	,		18700	0.0		0.001	False		,,,				2504	0.0				p.P286P		.											.	PTPRA	227	0			c.G858A						.	G	,,	1,4405	2.1+/-5.4	0,1,2202	202.0	181.0	188.0		858,831,831	-6.7	0.9	20	dbSNP_134	188	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	PTPRA	NM_002836.3,NM_080840.2,NM_080841.2	,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,	286/803,277/794,277/794	2988018	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5786	exon15			GACACCGGTTGAA		CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.831G>A	20.37:g.2988018G>A		106.0	0.0		106.0	14.0	NM_002836	A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Silent	SNP	ENST00000216877.6	37	CCDS13039.1																																																																																			G|1.000;A|0.000		0.438	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077682.3		
PTPRC	5788	ucsc.edu;bcgsc.ca	37	1	198721765	198721765	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr1:198721765T>A	ENST00000367376.2	+	31	3538	c.3367T>A	c.(3367-3369)Tgg>Agg	p.W1123R	PTPRC_ENST00000442510.2_Missense_Mutation_p.W1125R|PTPRC_ENST00000594404.1_Missense_Mutation_p.W962R|PTPRC_ENST00000348564.6_Missense_Mutation_p.W964R|PTPRC_ENST00000352140.3_Missense_Mutation_p.W1075R	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	1123	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						ATATACAAACTGGAGTGTGGA	0.398																																					p.W1125R		.											.	PTPRC	295	0			c.T3373A						.						77.0	79.0	78.0					1																	198721765		2203	4300	6503	SO:0001583	missense	5788	exon31			ACAAACTGGAGTG	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.3367T>A	1.37:g.198721765T>A	ENSP00000356346:p.Trp1123Arg	158.0	2.0		111.0	27.0	NM_002838	A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	ENST00000367376.2	37		.	.	.	.	.	.	.	.	.	.	T	15.60	2.882544	0.51908	.	.	ENSG00000081237	ENST00000367376;ENST00000352140;ENST00000442510;ENST00000348564	D	0.96491	-4.03	6.16	6.16	0.99307	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.47093	D	0.000253	D	0.99086	0.9686	H	0.99404	4.55	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98922	1.0784	10	0.87932	D	0	.	15.3771	0.74615	0.0:0.0:0.0:1.0	.	964;1075;1123	B1ALS3;E9PC28;P08575	.;.;PTPRC_HUMAN	R	1125;1075;1123;962	ENSP00000193532:W1075R	ENSP00000306782:W962R	W	+	1	0	PTPRC	196988388	1.000000	0.71417	0.873000	0.34254	0.049000	0.14656	6.338000	0.72963	2.367000	0.80283	0.528000	0.53228	TGG	.		0.398	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
PXK	54899	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	58395296	58395296	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr3:58395296A>G	ENST00000356151.2	+	15	1455	c.1346A>G	c.(1345-1347)cAc>cGc	p.H449R	PXK_ENST00000536660.1_Missense_Mutation_p.H312R|PXK_ENST00000484288.1_Missense_Mutation_p.H449R|PXK_ENST00000383715.4_Missense_Mutation_p.H432R|PXK_ENST00000463280.1_Missense_Mutation_p.H416R|PXK_ENST00000383716.3_Missense_Mutation_p.H416R|PXK_ENST00000302779.5_Missense_Mutation_p.H432R|PXK_ENST00000479241.1_Missense_Mutation_p.H432R	NM_017771.3	NP_060241.2			PX domain containing serine/threonine kinase											cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000249)|KIRC - Kidney renal clear cell carcinoma(10;0.00346)|Kidney(10;0.00368)|OV - Ovarian serous cystadenocarcinoma(275;0.22)		GCTCAGTCCCACCATGGATCT	0.418																																					p.H449R		.											.	PXK	334	0			c.A1346G						.						62.0	62.0	62.0					3																	58395296		2203	4300	6503	SO:0001583	missense	54899	exon15			AGTCCCACCATGG	AY274811	CCDS2889.1, CCDS74952.1, CCDS74954.1, CCDS74955.1	3p21.2	2008-02-05			ENSG00000168297	ENSG00000168297			23326	protein-coding gene	gene with protein product		611450					Standard	XM_005265255		Approved	FLJ20335	uc003djz.1	Q7Z7A4	OTTHUMG00000159149	ENST00000356151.2:c.1346A>G	3.37:g.58395296A>G	ENSP00000348472:p.His449Arg	253.0	1.0		196.0	92.0	NM_017771		Missense_Mutation	SNP	ENST00000356151.2	37	CCDS2889.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.52|19.52	3.843105|3.843105	0.71488|0.71488	.|.	.|.	ENSG00000168297|ENSG00000168297	ENST00000356151;ENST00000302779;ENST00000383716;ENST00000463280;ENST00000383715;ENST00000484288;ENST00000479241;ENST00000536660;ENST00000536750|ENST00000479134;ENST00000495557	T;T;T;T;T;T;T;T|.	0.32023|.	3.11;3.11;3.11;1.5;1.48;1.5;1.47;3.11|.	5.75|5.75	5.75|5.75	0.90469|0.90469	Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71476|0.71476	0.3344|0.3344	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.71674|.	0.997;0.996;0.994;0.998;0.996;0.996|.	D;D;D;D;D;P|.	0.70016|.	0.933;0.918;0.917;0.967;0.918;0.89|.	T|T	0.70498|0.70498	-0.4855|-0.4855	10|5	0.23302|.	T|.	0.38|.	-14.7244|-14.7244	14.9154|14.9154	0.70792|0.70792	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	416;416;416;449;432;449|.	E9PD56;Q7Z7A4-6;B4DID9;Q7Z7A4;Q7Z7A4-4;Q7Z7A4-2|.	.;.;.;PXK_HUMAN;.;.|.	R|A	449;432;416;416;432;449;432;312;312|204;21	ENSP00000348472:H449R;ENSP00000305045:H432R;ENSP00000373222:H416R;ENSP00000417903:H416R;ENSP00000373221:H432R;ENSP00000417915:H449R;ENSP00000419049:H432R;ENSP00000438356:H312R|.	ENSP00000305045:H432R|.	H|T	+|+	2|1	0|0	PXK|PXK	58370336|58370336	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.787000|0.787000	0.44495|0.44495	6.908000|6.908000	0.75730|0.75730	2.315000|2.315000	0.78130|0.78130	0.519000|0.519000	0.50382|0.50382	CAC|ACC	.		0.418	PXK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353499.1	NM_017771	
RAB9B	51209	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	103080318	103080318	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chrX:103080318C>T	ENST00000243298.2	-	3	681	c.397G>A	c.(397-399)Gtg>Atg	p.V133M		NM_016370.2	NP_057454.1	Q9NP90	RAB9B_HUMAN	RAB9B, member RAS oncogene family	133					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(1)|lung(11)	14						TCAGTAGTCACTTGCCTATCC	0.433																																					p.V133M		.											.	RAB9B	659	0			c.G397A						.						230.0	220.0	223.0					X																	103080318		2203	4300	6503	SO:0001583	missense	51209	exon3			TAGTCACTTGCCT	AB036693	CCDS14515.1	Xq22.1-q22.3	2010-04-19			ENSG00000123570	ENSG00000123570		"""RAB, member RAS oncogene"""	14090	protein-coding gene	gene with protein product		300285				11043518	Standard	NM_016370		Approved	RAB9L	uc004ell.2	Q9NP90	OTTHUMG00000022112	ENST00000243298.2:c.397G>A	X.37:g.103080318C>T	ENSP00000243298:p.Val133Met	91.0	0.0		24.0	17.0	NM_016370	B2R8M0|Q52LX2	Missense_Mutation	SNP	ENST00000243298.2	37	CCDS14515.1	.	.	.	.	.	.	.	.	.	.	C	16.53	3.148687	0.57151	.	.	ENSG00000123570	ENST00000243298	D	0.83914	-1.78	5.51	5.51	0.81932	Small GTP-binding protein domain (1);	0.056566	0.64402	D	0.000001	D	0.91744	0.7389	M	0.91818	3.245	0.58432	D	0.999999	D	0.89917	1.0	D	0.77004	0.989	D	0.92703	0.6176	10	0.87932	D	0	0.0455	9.3971	0.38408	0.0:0.9014:0.0:0.0986	.	133	Q9NP90	RAB9B_HUMAN	M	133	ENSP00000243298:V133M	ENSP00000243298:V133M	V	-	1	0	RAB9B	102966974	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.088000	0.71371	2.311000	0.77944	0.600000	0.82982	GTG	.		0.433	RAB9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057746.1		
RBM42	79171	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36120133	36120133	+	Silent	SNP	G	G	T	rs371589146		TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr19:36120133G>T	ENST00000262633.4	+	1	183	c.78G>T	c.(76-78)ccG>ccT	p.P26P	RBM42_ENST00000592202.1_Silent_p.P26P|RBM42_ENST00000588161.1_Silent_p.P26P|RBM42_ENST00000589871.1_Silent_p.P26P|RBM42_ENST00000586618.1_Silent_p.P26P|RBM42_ENST00000360475.4_Silent_p.P26P|RBM42_ENST00000589559.1_Silent_p.P26P	NM_024321.3	NP_077297.2	Q9BTD8	RBM42_HUMAN	RNA binding motif protein 42	26						cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|large_intestine(7)|lung(9)|prostate(1)	21	all_lung(56;1.58e-07)|Lung NSC(56;2.43e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CTGGCATCCCGGGCAAAAGCG	0.687																																					p.P26P		.											.	RBM42	90	0			c.G78T						.						11.0	12.0	11.0					19																	36120133		1960	3804	5764	SO:0001819	synonymous_variant	79171	exon1			CATCCCGGGCAAA	BC004204	CCDS12468.1	19q13.12	2013-02-12				ENSG00000126254		"""RNA binding motif (RRM) containing"""	28117	protein-coding gene	gene with protein product		613232				12477932	Standard	NM_024321		Approved	MGC10433	uc002oan.3	Q9BTD8		ENST00000262633.4:c.78G>T	19.37:g.36120133G>T		35.0	0.0		27.0	11.0	NM_024321	O00320|Q8N5R7|Q9BU66	Silent	SNP	ENST00000262633.4	37	CCDS12468.1																																																																																			.		0.687	RBM42-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459057.2	NM_024321	
RET	5979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	43600449	43600449	+	Silent	SNP	G	G	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr10:43600449G>A	ENST00000355710.3	+	4	907	c.675G>A	c.(673-675)acG>acA	p.T225T	RET_ENST00000340058.5_Silent_p.T225T	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	225	Cadherin. {ECO:0000255|PROSITE- ProRule:PRU00043}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	AGGTGAGCACGCGCTGGGCCC	0.731		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												p.T225T	Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	.	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	.	RET	4507	0			c.G675A						.						22.0	21.0	22.0					10																	43600449		2192	4283	6475	SO:0001819	synonymous_variant	5979	exon4	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	GAGCACGCGCTGG	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.675G>A	10.37:g.43600449G>A		59.0	0.0		40.0	13.0	NM_020975	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Silent	SNP	ENST00000355710.3	37	CCDS7200.1																																																																																			.		0.731	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047694.2	NM_020975	
RBP3	5949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	48389747	48389747	+	Silent	SNP	C	C	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr10:48389747C>T	ENST00000224600.4	-	1	1244	c.1131G>A	c.(1129-1131)caG>caA	p.Q377Q	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	377	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	CAGACGCAGCCTGCAGGCCGG	0.652																																					p.Q377Q		.											.	RBP3	153	0			c.G1131A						.						33.0	36.0	35.0					10																	48389747		2202	4300	6502	SO:0001819	synonymous_variant	5949	exon1			CGCAGCCTGCAGG	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.1131G>A	10.37:g.48389747C>T		57.0	0.0		41.0	15.0	NM_002900	Q0QD34|Q5VSR0|Q8IXN0	Silent	SNP	ENST00000224600.4	37	CCDS7218.1																																																																																			.		0.652	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	NM_002900	
RFX3	5991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	3247979	3247979	+	Intron	SNP	T	T	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr9:3247979T>A	ENST00000382004.3	-	16	2280				RFX3_ENST00000302303.1_Missense_Mutation_p.E674V|RFX3_ENST00000358730.2_Missense_Mutation_p.E674V	NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)						cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		GAAGTGTAATTCTGGCTTATT	0.453																																					p.E674V		.											.	RFX3	93	0			c.A2021T						.						95.0	100.0	98.0					9																	3247979		2203	4300	6503	SO:0001627	intron_variant	5991	exon16			TGTAATTCTGGCT	AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.1968+52A>T	9.37:g.3247979T>A		66.0	0.0		32.0	12.0	NM_002919	A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Missense_Mutation	SNP	ENST00000382004.3	37	CCDS6449.1	.	.	.	.	.	.	.	.	.	.	T	10.92	1.486314	0.26686	.	.	ENSG00000080298	ENST00000358730;ENST00000302303	T;T	0.59906	0.23;0.23	4.08	2.92	0.33932	.	.	.	.	.	T	0.43344	0.1243	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27297	-1.0078	8	0.32370	T	0.25	.	9.4539	0.38743	0.0:0.0:0.1935:0.8065	.	674	P48380-2	.	V	674	ENSP00000351574:E674V;ENSP00000303847:E674V	ENSP00000303847:E674V	E	-	2	0	RFX3	3237979	0.960000	0.32886	0.003000	0.11579	0.040000	0.13550	2.298000	0.43602	0.688000	0.31529	0.402000	0.26972	GAA	.		0.453	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051545.1	NM_002919	
RTKN2	219790	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	63957724	63957724	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr10:63957724C>A	ENST00000373789.3	-	12	1869	c.1773G>T	c.(1771-1773)agG>agT	p.R591S	RTKN2_ENST00000395265.1_Intron|RTKN2_ENST00000315289.2_Intron	NM_145307.2	NP_660350.2	Q8IZC4	RTKN2_HUMAN	rhotekin 2	591					hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(12;0.0297)|all_hematologic(501;0.215)					TGGATTTCTGCCTTGGAGCTG	0.413																																					p.R591S		.											.	RTKN2	68	0			c.G1773T						.						67.0	65.0	66.0					10																	63957724		2203	4300	6503	SO:0001583	missense	219790	exon12			TTTCTGCCTTGGA	BC025765	CCDS7263.1, CCDS73140.1	10q21.3	2013-01-10	2007-12-14	2007-12-14	ENSG00000182010	ENSG00000182010		"""Pleckstrin homology (PH) domain containing"""	19364	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family K member 1"""	PLEKHK1		15504364	Standard	NM_001282941		Approved	Em:AC024597.2, bA531F24.1, FLJ39352	uc001jlw.3	Q8IZC4	OTTHUMG00000018299	ENST00000373789.3:c.1773G>T	10.37:g.63957724C>A	ENSP00000362894:p.Arg591Ser	173.0	2.0		104.0	37.0	NM_145307	Q3ZCR1|Q68DZ6|Q8N8K1|Q8TAV2	Missense_Mutation	SNP	ENST00000373789.3	37	CCDS7263.1	.	.	.	.	.	.	.	.	.	.	C	15.91	2.971630	0.53614	.	.	ENSG00000182010	ENST00000373789	T	0.37584	1.19	5.61	4.51	0.55191	.	0.000000	0.85682	D	0.000000	T	0.55497	0.1924	L	0.61218	1.895	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.57665	-0.7772	10	0.87932	D	0	-7.06	13.1439	0.59450	0.0:0.8789:0.0:0.1211	.	591	Q8IZC4	RTKN2_HUMAN	S	591	ENSP00000362894:R591S	ENSP00000362894:R591S	R	-	3	2	RTKN2	63627730	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.959000	0.29240	2.657000	0.90304	0.655000	0.94253	AGG	.		0.413	RTKN2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091618.1	NM_145307	
RXRG	6258	ucsc.edu;bcgsc.ca	37	1	165398166	165398166	+	Silent	SNP	T	T	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr1:165398166T>A	ENST00000359842.5	-	2	389	c.87A>T	c.(85-87)ccA>ccT	p.P29P		NM_001256570.1|NM_006917.4	NP_001243499.1|NP_008848.1	P48443	RXRG_HUMAN	retinoid X receptor, gamma	29	Modulating. {ECO:0000250}.				gene expression (GO:0010467)|heart development (GO:0007507)|neuron differentiation (GO:0030182)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|skeletal muscle tissue development (GO:0007519)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	9-cis retinoic acid receptor activity (GO:0004886)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(6)|lung(22)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	38	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tretinoin(DB00755)	AGGCTGCTGATGGGCTCATGG	0.597																																					p.P29P		.											.	RXRG	186	0			c.A87T						.						60.0	53.0	55.0					1																	165398166		2203	4300	6503	SO:0001819	synonymous_variant	6258	exon2			TGCTGATGGGCTC	U38480	CCDS1248.1, CCDS72970.1	1q22-q23	2013-01-16			ENSG00000143171	ENSG00000143171		"""Nuclear hormone receptors"""	10479	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 3"""	180247				8034312	Standard	NR_033824		Approved	NR2B3	uc001gda.3	P48443	OTTHUMG00000034626	ENST00000359842.5:c.87A>T	1.37:g.165398166T>A		76.0	2.0		72.0	31.0	NM_006917	A6NIP1|Q6IBU7	Silent	SNP	ENST00000359842.5	37	CCDS1248.1																																																																																			.		0.597	RXRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083794.2	NM_006917	
SERPINA6	866	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	94772500	94772500	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr14:94772500C>A	ENST00000341584.3	-	4	1086	c.940G>T	c.(940-942)Gat>Tat	p.D314Y		NM_001756.3	NP_001747	P08185	CBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6	314					glucocorticoid metabolic process (GO:0008211)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)|steroid binding (GO:0005496)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	26		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)	TCCAGCACATCTCCGAGGTCA	0.527																																					p.D314Y		.											.	SERPINA6	653	0			c.G940T						.						129.0	109.0	116.0					14																	94772500		2203	4300	6503	SO:0001583	missense	866	exon4			GCACATCTCCGAG	J02943	CCDS9924.1	14q32.13	2014-02-18	2005-08-18		ENSG00000170099	ENSG00000170099		"""Serine (or cysteine) peptidase inhibitors"""	1540	protein-coding gene	gene with protein product	"""corticosteroid binding globulin"", ""transcortin"""	122500	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6"""	CBG		3299377, 7912884, 24172014	Standard	NM_001756		Approved		uc001ycv.3	P08185	OTTHUMG00000171346	ENST00000341584.3:c.940G>T	14.37:g.94772500C>A	ENSP00000342850:p.Asp314Tyr	118.0	1.0		78.0	30.0	NM_001756	A8K456|Q7Z2Q9	Missense_Mutation	SNP	ENST00000341584.3	37	CCDS9924.1	.	.	.	.	.	.	.	.	.	.	C	14.56	2.571389	0.45798	.	.	ENSG00000170099	ENST00000341584	D	0.88896	-2.44	4.83	0.99	0.19807	Serpin domain (3);	1.532730	0.03655	N	0.241710	D	0.93294	0.7863	M	0.89163	3.01	0.09310	N	1	D	0.53462	0.96	P	0.51324	0.666	T	0.79519	-0.1770	10	0.66056	D	0.02	.	9.7715	0.40591	0.0:0.6173:0.0:0.3827	.	314	P08185	CBG_HUMAN	Y	314	ENSP00000342850:D314Y	ENSP00000342850:D314Y	D	-	1	0	SERPINA6	93842253	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.084000	0.14891	0.348000	0.23949	-0.145000	0.13849	GAT	.		0.527	SERPINA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413065.1	NM_001756	
SH3BP2	6452	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	2829348	2829348	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr4:2829348A>G	ENST00000356331.5	+	7	794	c.533A>G	c.(532-534)gAt>gGt	p.D178G	SH3BP2_ENST00000503393.2_Missense_Mutation_p.D235G|SH3BP2_ENST00000452765.2_Missense_Mutation_p.D178G|SH3BP2_ENST00000515183.1_3'UTR|SH3BP2_ENST00000442312.2_Missense_Mutation_p.D206G|SH3BP2_ENST00000511747.1_Missense_Mutation_p.D178G|SH3BP2_ENST00000435136.2_Missense_Mutation_p.D178G	NM_003023.4	NP_003014.3	P78314	3BP2_HUMAN	SH3-domain binding protein 2	178					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)		SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	20				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)		GAGCACGACGATGAGGATGAC	0.652									Cherubism																												p.D235G		.											.	SH3BP2	514	0			c.A704G						.						52.0	37.0	42.0					4																	2829348		2201	4298	6499	SO:0001583	missense	6452	exon7	Familial Cancer Database	Familial Benign Giant-cell Tumor of the Jaw, Familial Multilocular Cystic Disease	ACGACGATGAGGA	BC022996	CCDS33944.1, CCDS54715.1, CCDS54716.1	4p16.3	2013-02-14				ENSG00000087266		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	10825	protein-coding gene	gene with protein product		602104	"""Cherubism"""			9299232, 11381256	Standard	NM_003023		Approved	RES4-23, CRBM	uc003gfj.4	P78314		ENST00000356331.5:c.533A>G	4.37:g.2829348A>G	ENSP00000348685:p.Asp178Gly	127.0	0.0		67.0	30.0	NM_001145856	A6NNC2|B2R5R6|B4DT04|D3DVR0|D6R919|O00500|O15373|P78315	Missense_Mutation	SNP	ENST00000356331.5	37	CCDS33944.1	.	.	.	.	.	.	.	.	.	.	a	14.47	2.544300	0.45280	.	.	ENSG00000087266	ENST00000452765;ENST00000508385;ENST00000512014;ENST00000442312;ENST00000435136;ENST00000511747;ENST00000503393;ENST00000356331	D;T;T;D;D;D;D;D	0.95171	-3.63;1.87;1.82;-3.63;-3.63;-3.63;-3.63;-3.63	4.8	4.8	0.61643	.	0.106622	0.64402	D	0.000010	D	0.95956	0.8683	M	0.64997	1.995	0.80722	D	1	D;D;D;D;D	0.71674	0.993;0.997;0.998;0.997;0.997	P;D;D;D;D	0.81914	0.853;0.989;0.995;0.989;0.989	D	0.95349	0.8445	10	0.46703	T	0.11	-21.8009	10.749	0.46198	1.0:0.0:0.0:0.0	.	206;153;153;235;178	B4DT04;Q6ZVU3;Q6ZTK4;D6R919;P78314	.;.;.;.;3BP2_HUMAN	G	178;178;178;206;178;178;235;178	ENSP00000409746:D178G;ENSP00000424917:D178G;ENSP00000424105:D178G;ENSP00000388152:D206G;ENSP00000403231:D178G;ENSP00000424846:D178G;ENSP00000422168:D235G;ENSP00000348685:D178G	ENSP00000348685:D178G	D	+	2	0	SH3BP2	2799146	0.994000	0.37717	0.046000	0.18839	0.083000	0.17756	4.982000	0.63825	1.806000	0.52798	0.392000	0.25879	GAT	.		0.652	SH3BP2-007	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000362406.2	NM_003023	
SHROOM4	57477	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	50350826	50350826	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chrX:50350826G>T	ENST00000289292.7	-	6	3599	c.3316C>A	c.(3316-3318)Cct>Act	p.P1106T	SHROOM4_ENST00000376020.2_Missense_Mutation_p.P1106T|SHROOM4_ENST00000460112.3_Missense_Mutation_p.P990T			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1106	Poly-Pro.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					CAGTTGGGAGGAGGAGGGCGA	0.587																																					p.P1106T		.											.	SHROOM4	131	0			c.C3316A						.						39.0	34.0	35.0					X																	50350826		2203	4300	6503	SO:0001583	missense	57477	exon6			TGGGAGGAGGAGG	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3316C>A	X.37:g.50350826G>T	ENSP00000289292:p.Pro1106Thr	92.0	0.0		30.0	17.0	NM_020717	A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	ENST00000289292.7	37	CCDS35277.1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.958479	0.53400	.	.	ENSG00000158352	ENST00000289292;ENST00000376020;ENST00000460112	T;T;T	0.25250	2.24;2.24;1.81	5.74	5.74	0.90152	.	0.193727	0.44483	D	0.000447	T	0.34919	0.0914	L	0.34521	1.04	0.49213	D	0.999763	D	0.58268	0.982	P	0.55112	0.769	T	0.07009	-1.0795	10	0.87932	D	0	.	16.1551	0.81657	0.0:0.0:1.0:0.0	.	1106	Q9ULL8	SHRM4_HUMAN	T	1106;1106;990	ENSP00000289292:P1106T;ENSP00000365188:P1106T;ENSP00000421450:P990T	ENSP00000289292:P1106T	P	-	1	0	SHROOM4	50367566	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.125000	0.77193	2.418000	0.82041	0.513000	0.50165	CCT	.		0.587	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
SIK1	150094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	44841639	44841639	+	Silent	SNP	C	C	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr21:44841639C>T	ENST00000270162.6	-	5	510	c.378G>A	c.(376-378)gcG>gcA	p.A126A		NM_173354.3	NP_775490.2	P57059	SIK1_HUMAN	salt-inducible kinase 1	126	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle cell differentiation (GO:0055007)|cell cycle (GO:0007049)|entrainment of circadian clock by photoperiod (GO:0043153)|intracellular signal transduction (GO:0035556)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of triglyceride biosynthetic process (GO:0010868)|positive regulation of anoikis (GO:2000210)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell differentiation (GO:0045595)|regulation of mitotic cell cycle (GO:0007346)|regulation of myotube differentiation (GO:0010830)|regulation of sodium ion transport (GO:0002028)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|cAMP response element binding protein binding (GO:0008140)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|testis(2)|urinary_tract(1)	21					Dabrafenib(DB08912)	ACTTCTTCCGCGCCTCGTTCT	0.572																																					p.A126A		.											.	SIK1	346	0			c.G378A						.						67.0	61.0	63.0					21																	44841639		2203	4300	6503	SO:0001819	synonymous_variant	150094	exon5			CTTCCGCGCCTCG	BC038504	CCDS33575.1	21q22.3	2008-12-23	2008-12-23	2008-12-23	ENSG00000142178	ENSG00000142178			11142	protein-coding gene	gene with protein product	"""myocardial SNF1-like kinase"""	605705	"""SNF1-like kinase"""	SNF1LK		7893599	Standard	NM_173354		Approved	msk	uc002zdf.2	P57059	OTTHUMG00000086874	ENST00000270162.6:c.378G>A	21.37:g.44841639C>T		111.0	0.0		78.0	24.0	NM_173354	A6NC84|Q5R2V5|Q6ZNL8|Q86YJ2	Silent	SNP	ENST00000270162.6	37	CCDS33575.1																																																																																			.		0.572	SIK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195654.1	NM_173354	
SLC5A5	6528	ucsc.edu;bcgsc.ca	37	19	18004537	18004537	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr19:18004537C>T	ENST00000222248.3	+	15	2130	c.1783C>T	c.(1783-1785)Ccc>Tcc	p.P595S		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	595					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						TGAAGAACTCCCCACTGGAAA	0.582																																					p.P595S	Melanoma(65;1008 1708 7910 46650)	.											.	SLC5A5	93	0			c.C1783T						.						35.0	31.0	32.0					19																	18004537		2203	4300	6503	SO:0001583	missense	6528	exon15			GAACTCCCCACTG		CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.1783C>T	19.37:g.18004537C>T	ENSP00000222248:p.Pro595Ser	137.0	2.0		96.0	35.0	NM_000453	O43702|Q2M335|Q9NYB6	Missense_Mutation	SNP	ENST00000222248.3	37	CCDS12368.1	.	.	.	.	.	.	.	.	.	.	C	8.335	0.827479	0.16749	.	.	ENSG00000105641	ENST00000222248	D	0.88818	-2.43	3.62	2.51	0.30379	.	3.165620	0.01238	N	0.008559	D	0.85243	0.5652	L	0.51422	1.61	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.64689	-0.6348	10	0.09338	T	0.73	.	8.0271	0.30444	0.2433:0.7567:0.0:0.0	.	595	Q92911	SC5A5_HUMAN	S	595	ENSP00000222248:P595S	ENSP00000222248:P595S	P	+	1	0	SLC5A5	17865537	0.001000	0.12720	0.002000	0.10522	0.151000	0.21798	0.962000	0.29280	0.813000	0.34350	0.485000	0.47835	CCC	.		0.582	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1		
SNF8	11267	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	47014463	47014463	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr17:47014463T>A	ENST00000502492.1	-	4	650	c.268A>T	c.(268-270)Atg>Ttg	p.M90L	SNF8_ENST00000290330.3_Missense_Mutation_p.M90L|AC091133.1_ENST00000435491.1_RNA|SNF8_ENST00000514089.1_Intron			Q96H20	SNF8_HUMAN	SNF8, ESCRT-II complex subunit	90					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|lung(1)	3						ACGCCCAGCATCTCAGACCAA	0.438																																					p.M90L		.											.	SNF8	90	0			c.A268T						.						160.0	158.0	159.0					17																	47014463		2203	4300	6503	SO:0001583	missense	11267	exon4			CCAGCATCTCAGA	AF156102	CCDS11541.1	17q21.32	2013-06-05	2013-06-05		ENSG00000159210	ENSG00000159210			17028	protein-coding gene	gene with protein product		610904	"""SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)"""			10419521, 15329733	Standard	NM_007241		Approved	EAP30, VPS22, Dot3	uc002ioj.3	Q96H20	OTTHUMG00000160569	ENST00000502492.1:c.268A>T	17.37:g.47014463T>A	ENSP00000421380:p.Met90Leu	135.0	2.0		124.0	32.0	NM_007241	Q8IXY3|Q9UN50	Missense_Mutation	SNP	ENST00000502492.1	37	CCDS11541.1	.	.	.	.	.	.	.	.	.	.	T	13.57	2.276967	0.40294	.	.	ENSG00000159210	ENST00000502492;ENST00000290330;ENST00000510558	.	.	.	5.53	5.53	0.82687	.	0.036551	0.85682	D	0.000000	T	0.41373	0.1156	N	0.11427	0.14	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.34378	-0.9831	9	0.87932	D	0	-32.1566	15.4918	0.75611	0.0:0.0:0.0:1.0	.	90;90	Q96H20-2;Q96H20	.;SNF8_HUMAN	L	90	.	ENSP00000290330:M90L	M	-	1	0	SNF8	44369462	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.771000	0.85420	2.315000	0.78130	0.533000	0.62120	ATG	.		0.438	SNF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000361172.1	NM_007241	
SORBS1	10580	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	97101323	97101323	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr10:97101323C>T	ENST00000361941.3	-	25	2568	c.2542G>A	c.(2542-2544)Gag>Aag	p.E848K	SORBS1_ENST00000353505.5_Missense_Mutation_p.E699K|SORBS1_ENST00000371249.2_Missense_Mutation_p.E630K|SORBS1_ENST00000306402.6_Missense_Mutation_p.E595K|SORBS1_ENST00000371247.2_Missense_Mutation_p.E848K|SORBS1_ENST00000371245.3_Missense_Mutation_p.E699K|SORBS1_ENST00000371241.1_Missense_Mutation_p.E498K|SORBS1_ENST00000347291.4_Missense_Mutation_p.E660K|SORBS1_ENST00000354106.3_Missense_Mutation_p.E818K|SORBS1_ENST00000607232.1_Missense_Mutation_p.E1108K|SORBS1_ENST00000393949.1_Missense_Mutation_p.E818K|SORBS1_ENST00000371246.2_Missense_Mutation_p.E870K|SORBS1_ENST00000371239.1_Missense_Mutation_p.E625K|SORBS1_ENST00000474353.2_5'Flank|SORBS1_ENST00000371227.4_Missense_Mutation_p.E802K|SORBS1_ENST00000277982.5_Missense_Mutation_p.E870K	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		TGCGGTACCTCGATGTAGGTG	0.438																																					p.E870K		.											.	SORBS1	155	0			c.G2608A						.						74.0	75.0	75.0					10																	97101323		2203	4300	6503	SO:0001583	missense	10580	exon25			GTACCTCGATGTA	AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.2542G>A	10.37:g.97101323C>T	ENSP00000355136:p.Glu848Lys	86.0	1.0		61.0	25.0	NM_001034955		Missense_Mutation	SNP	ENST00000361941.3	37	CCDS31255.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.048189	0.93740	.	.	ENSG00000095637	ENST00000371245;ENST00000306402;ENST00000371249;ENST00000371247;ENST00000371227;ENST00000371246;ENST00000393949;ENST00000353505;ENST00000347291;ENST00000361941;ENST00000277982;ENST00000371241;ENST00000354106;ENST00000371239	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.14893	2.47;2.47;2.47;2.47;2.47;2.47;2.47;2.47;2.47;2.47;2.47;2.47;2.47;2.47	6.07	6.07	0.98685	Src homology-3 domain (3);Variant SH3 (1);	0.000000	0.42821	D	0.000650	T	0.38746	0.1052	L	0.43152	1.355	0.80722	D	1	P;D;D;D;D;D;D;P;D;D;D;P	0.89917	0.673;1.0;0.989;1.0;0.963;1.0;1.0;0.75;1.0;1.0;1.0;0.942	P;D;P;D;P;D;D;P;D;D;D;P	0.91635	0.593;0.998;0.885;0.999;0.772;0.996;0.999;0.55;0.997;0.998;0.998;0.808	T	0.02371	-1.1169	10	0.87932	D	0	-19.5423	20.6439	0.99570	0.0:1.0:0.0:0.0	.	563;802;630;595;498;625;699;848;870;660;818;342	B4DTX5;Q9BX66-11;Q9BX66-10;Q9BX66-9;Q9BX66-4;Q9BX66-8;Q9BX66-3;Q9BX66;Q9BX66-2;Q9BX66-6;Q9BX66-5;Q6MZY5	.;.;.;.;.;.;.;SRBS1_HUMAN;.;.;.;.	K	699;595;630;848;802;870;818;699;660;848;870;498;818;625	ENSP00000360291:E699K;ENSP00000302556:E595K;ENSP00000360295:E630K;ENSP00000360293:E848K;ENSP00000360271:E802K;ENSP00000360292:E870K;ENSP00000377521:E818K;ENSP00000343998:E699K;ENSP00000277985:E660K;ENSP00000355136:E848K;ENSP00000277982:E870K;ENSP00000360285:E498K;ENSP00000277984:E818K;ENSP00000360283:E625K	ENSP00000277982:E870K	E	-	1	0	SORBS1	97091313	1.000000	0.71417	0.986000	0.45419	0.610000	0.37248	7.818000	0.86416	2.884000	0.98904	0.655000	0.94253	GAG	.		0.438	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049517.1		
SPECC1	92521	ucsc.edu;bcgsc.ca	37	17	20107972	20107972	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr17:20107972G>T	ENST00000261503.5	+	4	661	c.610G>T	c.(610-612)Ggg>Tgg	p.G204W	SPECC1_ENST00000395529.3_Missense_Mutation_p.G204W|AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000395527.4_Missense_Mutation_p.G204W|SPECC1_ENST00000536879.1_Intron|SPECC1_ENST00000472876.1_Intron|SPECC1_ENST00000395522.2_Missense_Mutation_p.G123W|SPECC1_ENST00000395525.3_Missense_Mutation_p.G123W|SPECC1_ENST00000395530.2_Missense_Mutation_p.G123W|SPECC1_ENST00000584527.1_5'Flank	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	204					cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		GAACGCTGAGGGGACTGATGC	0.443																																					p.G204W		.											.	SPECC1	639	0			c.G610T						.						146.0	163.0	158.0					17																	20107972		2203	4300	6503	SO:0001583	missense	92521	exon4			GCTGAGGGGACTG	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.610G>T	17.37:g.20107972G>T	ENSP00000261503:p.Gly204Trp	204.0	2.0		81.0	60.0	NM_001033553	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	ENST00000261503.5	37	CCDS32590.1	.	.	.	.	.	.	.	.	.	.	G	11.89	1.772721	0.31411	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000395529;ENST00000395522;ENST00000395527;ENST00000395525	T;T;T;T	0.65178	-0.14;2.85;2.86;2.86	4.82	4.82	0.62117	.	0.740963	0.13639	N	0.373114	T	0.76948	0.4059	L	0.61218	1.895	0.80722	D	1	D;D;D;D	0.71674	0.998;0.998;0.998;0.97	D;D;D;P	0.69307	0.963;0.963;0.963;0.825	T	0.77127	-0.2702	10	0.72032	D	0.01	-3.0921	16.1904	0.81986	0.0:0.0:1.0:0.0	.	123;123;204;204	Q5M775-4;Q5M775-3;Q5M775-2;Q5M775	.;.;.;CYTSB_HUMAN	W	204;204;204;123;123;123	ENSP00000261503:G204W;ENSP00000378900:G204W;ENSP00000378893:G123W;ENSP00000378896:G123W	ENSP00000261503:G204W	G	+	1	0	SPECC1	20048564	0.563000	0.26594	0.298000	0.25002	0.016000	0.09150	3.440000	0.52886	2.606000	0.88127	0.655000	0.94253	GGG	.		0.443	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904	
STIP1	10963	broad.mit.edu;bcgsc.ca	37	11	63964989	63964989	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr11:63964989A>G	ENST00000305218.4	+	7	971	c.824A>G	c.(823-825)tAc>tGc	p.Y275C	STIP1_ENST00000538945.1_Missense_Mutation_p.Y251C|STIP1_ENST00000358794.5_Missense_Mutation_p.Y322C	NM_006819.2	NP_006810.1	P31948	STIP1_HUMAN	stress-induced phosphoprotein 1	275					response to stress (GO:0006950)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(1)|skin(1)	27						AAGGGCGACTACAATAAGTGC	0.493																																					p.Y275C		.											.	STIP1	93	0			c.A824G						.						73.0	73.0	73.0					11																	63964989		2201	4297	6498	SO:0001583	missense	10963	exon7			GCGACTACAATAA	BC039299	CCDS8058.1, CCDS60827.1, CCDS60828.1	11q13	2014-01-13	2014-01-13		ENSG00000168439	ENSG00000168439		"""Tetratricopeptide (TTC) repeat domain containing"""	11387	protein-coding gene	gene with protein product	"""Hsp70/Hsp90-organizing protein"""	605063	"""stress-induced-phosphoprotein 1"""			1569099	Standard	NM_006819		Approved	HOP, STI1	uc001nyk.1	P31948	OTTHUMG00000167789	ENST00000305218.4:c.824A>G	11.37:g.63964989A>G	ENSP00000305958:p.Tyr275Cys	104.0	2.0		66.0	13.0	NM_006819	B4DM70|F5H0T1|G3XAD8|Q3ZCU9|Q5TZU9	Missense_Mutation	SNP	ENST00000305218.4	37	CCDS8058.1	.	.	.	.	.	.	.	.	.	.	A	18.66	3.672569	0.67928	.	.	ENSG00000168439	ENST00000358794;ENST00000305218;ENST00000538945	T;T;T	0.64085	-0.08;-0.08;-0.08	5.73	5.73	0.89815	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.055265	0.64402	D	0.000001	T	0.81380	0.4810	M	0.86864	2.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.983;0.992	D	0.83441	0.0043	10	0.49607	T	0.09	-12.1991	15.316	0.74078	1.0:0.0:0.0:0.0	.	251;275	F5H0T1;P31948	.;STIP1_HUMAN	C	322;275;251	ENSP00000351646:Y322C;ENSP00000305958:Y275C;ENSP00000445957:Y251C	ENSP00000305958:Y275C	Y	+	2	0	STIP1	63721565	1.000000	0.71417	0.976000	0.42696	0.759000	0.43091	6.271000	0.72569	2.324000	0.78689	0.533000	0.62120	TAC	.		0.493	STIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396289.2	NM_006819	
SVEP1	79987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	113312149	113312149	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr9:113312149G>C	ENST00000401783.2	-	2	1103	c.767C>G	c.(766-768)gCt>gGt	p.A256G	SVEP1_ENST00000374469.1_Missense_Mutation_p.A233G|SVEP1_ENST00000374461.1_Missense_Mutation_p.A233G|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000302728.8_Missense_Mutation_p.A256G	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	256	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TGCCCGGCGAGCTAAAGCCTC	0.473																																					p.A256G		.											.	SVEP1	75	0			c.C767G						.						66.0	62.0	63.0					9																	113312149		1920	4123	6043	SO:0001583	missense	79987	exon2			CGGCGAGCTAAAG	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.767C>G	9.37:g.113312149G>C	ENSP00000384917:p.Ala256Gly	171.0	0.0		83.0	16.0	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	G	33	5.224356	0.95139	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17	5.38	5.38	0.77491	von Willebrand factor, type A (2);	0.000000	0.85682	D	0.000000	D	0.88440	0.6437	M	0.75447	2.3	0.50467	D	0.999879	P;P;D	0.89917	0.892;0.928;1.0	P;P;D	0.83275	0.579;0.809;0.996	D	0.89042	0.3449	10	0.72032	D	0.01	.	19.497	0.95077	0.0:0.0:1.0:0.0	.	256;256;256	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	G	256;233;256;233	ENSP00000384917:A256G;ENSP00000363593:A233G;ENSP00000304118:A256G;ENSP00000363585:A233G	ENSP00000304118:A256G	A	-	2	0	SVEP1	112351970	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.420000	0.97426	2.677000	0.91161	0.563000	0.77884	GCT	.		0.473	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
SYNDIG1	79953	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	24565510	24565510	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr20:24565510A>G	ENST00000376862.3	+	3	1132	c.499A>G	c.(499-501)Aca>Gca	p.T167A		NM_024893.1	NP_079169.1	Q9H7V2	SYNG1_HUMAN	synapse differentiation inducing 1	167					intracellular protein transport (GO:0006886)|positive regulation of synapse assembly (GO:0051965)|response to biotic stimulus (GO:0009607)|synaptic vesicle clustering (GO:0097091)	cell body (GO:0044297)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	glutamate receptor binding (GO:0035254)|protein homodimerization activity (GO:0042803)	p.T167A(1)		breast(2)|endometrium(1)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	24						CTCAAGCGACACAGAGAGTGA	0.562																																					p.T167A		.											.	SYNDIG1	91	1	Substitution - Missense(1)	lung(1)	c.A499G						.						140.0	132.0	135.0					20																	24565510		2203	4300	6503	SO:0001583	missense	79953	exon3			AGCGACACAGAGA	AK024282	CCDS13164.1	20p11.21	2011-06-30	2011-06-30	2011-06-30	ENSG00000101463	ENSG00000101463			15885	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 5"", ""synapse differentiation induced gene 1"""	614311	"""chromosome 20 open reading frame 39"", ""transmembrane protein 90B"""	C20orf39, TMEM90B		20152115	Standard	NM_024893		Approved	FLJ14220, IFITMD5, SynDIG1	uc002wtw.1	Q9H7V2	OTTHUMG00000032104	ENST00000376862.3:c.499A>G	20.37:g.24565510A>G	ENSP00000366058:p.Thr167Ala	60.0	1.0		64.0	29.0	NM_024893	Q6IA30|Q9H514	Missense_Mutation	SNP	ENST00000376862.3	37	CCDS13164.1	.	.	.	.	.	.	.	.	.	.	A	13.58	2.278997	0.40294	.	.	ENSG00000101463	ENST00000376862	D	0.90620	-2.7	5.1	5.1	0.69264	.	0.078921	0.52532	D	0.000063	D	0.88746	0.6520	L	0.47716	1.5	0.41539	D	0.988501	P	0.47762	0.9	P	0.45538	0.484	D	0.89491	0.3757	10	0.56958	D	0.05	-16.4836	12.8475	0.57837	1.0:0.0:0.0:0.0	.	167	Q9H7V2	SYNG1_HUMAN	A	167	ENSP00000366058:T167A	ENSP00000366058:T167A	T	+	1	0	SYNDIG1	24513510	0.992000	0.36948	0.997000	0.53966	0.670000	0.39368	3.706000	0.54830	1.930000	0.55929	0.459000	0.35465	ACA	.		0.562	SYNDIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078376.1	NM_024893	
SYNE2	23224	ucsc.edu;bcgsc.ca	37	14	64518505	64518505	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr14:64518505A>T	ENST00000344113.4	+	48	8086	c.7874A>T	c.(7873-7875)tAt>tTt	p.Y2625F	SYNE2_ENST00000358025.3_Missense_Mutation_p.Y2625F|SYNE2_ENST00000554584.1_Missense_Mutation_p.Y2658F|SYNE2_ENST00000357395.3_De_novo_Start_OutOfFrame	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2625					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GTAGTGGAATATGATGAATTT	0.403																																					p.Y2625F		.											.	SYNE2	164	0			c.A7874T						.						105.0	100.0	102.0					14																	64518505		1917	4140	6057	SO:0001583	missense	23224	exon48			TGGAATATGATGA	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.7874A>T	14.37:g.64518505A>T	ENSP00000341781:p.Tyr2625Phe	331.0	2.0		225.0	87.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	A	1.247	-0.619766	0.03636	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.55052	0.91;0.91;0.54	5.81	-1.29	0.09288	.	2.020300	0.01861	N	0.036625	T	0.24967	0.0606	N	0.08118	0	0.09310	N	0.999999	B;B	0.31174	0.207;0.311	B;B	0.24701	0.025;0.055	T	0.07654	-1.0761	10	0.10377	T	0.69	.	1.8156	0.03099	0.3338:0.3235:0.2261:0.1167	.	2625;2625	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	F	2625;2625;2658;2658	ENSP00000350719:Y2625F;ENSP00000341781:Y2625F;ENSP00000452570:Y2658F	ENSP00000261678:Y2658F	Y	+	2	0	SYNE2	63588258	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.096000	0.15147	-0.108000	0.12066	0.533000	0.62120	TAT	.		0.403	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
TBC1D10B	26000	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30370140	30370140	+	Splice_Site	SNP	T	T	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr16:30370140T>A	ENST00000409939.3	-	8	1723		c.e8-2		RP11-347C12.10_ENST00000563252.1_lincRNA	NM_015527.3	NP_056342.3	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B						positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(1)|lung(2)|urinary_tract(1)	6			Colorectal(24;0.193)			TCTTAACGCCTGCAGGGGTGG	0.592																																					.		.											.	.	.	0			c.1643-2A>T						.						40.0	41.0	41.0					16																	30370140		2197	4299	6496	SO:0001630	splice_region_variant	26000	exon9			AACGCCTGCAGGG	BC063112	CCDS10676.2	16p11.2	2013-07-09			ENSG00000169221	ENSG00000169221			24510	protein-coding gene	gene with protein product		613620				20404108	Standard	NM_015527		Approved	DKFZP434P1750, Rab27A-GAPbeta, FLJ13130, EPI64B	uc002dxt.3	Q4KMP7	OTTHUMG00000132396	ENST00000409939.3:c.1643-2A>T	16.37:g.30370140T>A		83.0	1.0		56.0	16.0	NM_015527	B9A6L0|Q6IN54|Q6P530|Q71RG7|Q86VC5|Q9H8Z2|Q9NUN6|Q9UFP2	Splice_Site	SNP	ENST00000409939.3	37	CCDS10676.2	.	.	.	.	.	.	.	.	.	.	T	12.20	1.865547	0.32977	.	.	ENSG00000169221	ENST00000409939	.	.	.	4.62	4.62	0.57501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4111	0.60944	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TBC1D10B	30277641	1.000000	0.71417	0.816000	0.32577	0.318000	0.28184	7.652000	0.83633	2.082000	0.62665	0.459000	0.35465	.	.		0.592	TBC1D10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255527.3	NM_015527	Intron
TAF1C	9013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	84214736	84214736	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr16:84214736C>A	ENST00000567759.1	-	11	1481	c.1299G>T	c.(1297-1299)caG>caT	p.Q433H	TAF1C_ENST00000341690.6_Missense_Mutation_p.Q340H|TAF1C_ENST00000378541.4_Missense_Mutation_p.Q433H|TAF1C_ENST00000541676.1_Missense_Mutation_p.Q340H|TAF1C_ENST00000566732.1_Missense_Mutation_p.Q407H|TAF1C_ENST00000570117.1_Missense_Mutation_p.Q101H	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	433					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						GTTCCCCTTTCTGGCACGAAG	0.612																																					p.Q433H		.											.	TAF1C	91	0			c.G1299T						.						84.0	87.0	86.0					16																	84214736		2200	4300	6500	SO:0001583	missense	9013	exon11			CCCTTTCTGGCAC	L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.1299G>T	16.37:g.84214736C>A	ENSP00000455265:p.Gln433His	114.0	0.0		54.0	28.0	NM_005679	B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Missense_Mutation	SNP	ENST00000567759.1	37	CCDS32496.1	.	.	.	.	.	.	.	.	.	.	C	9.568	1.120224	0.20877	.	.	ENSG00000103168	ENST00000378541;ENST00000541676;ENST00000341690	T;T;T	0.62498	0.02;0.02;0.02	4.56	3.61	0.41365	.	0.115077	0.38436	N	0.001681	T	0.74313	0.3700	M	0.70595	2.14	0.31335	N	0.684381	D;D;D	0.76494	0.997;0.999;0.997	D;D;D	0.85130	0.995;0.997;0.995	T	0.75476	-0.3304	10	0.59425	D	0.04	-29.1612	8.6093	0.33793	0.0:0.8957:0.0:0.1043	.	407;433;340	Q15572-6;Q15572;Q15572-2	.;TAF1C_HUMAN;.	H	433;340;340	ENSP00000367802:Q433H;ENSP00000437900:Q340H;ENSP00000345305:Q340H	ENSP00000345305:Q340H	Q	-	3	2	TAF1C	82772237	1.000000	0.71417	1.000000	0.80357	0.099000	0.18886	1.118000	0.31246	1.141000	0.42275	-0.137000	0.14449	CAG	.		0.612	TAF1C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433045.2	NM_139353	
TEK	7010	broad.mit.edu;ucsc.edu	37	9	27212818	27212818	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr9:27212818T>C	ENST00000380036.4	+	17	3242	c.2800T>C	c.(2800-2802)Tcc>Ccc	p.S934P	TEK_ENST00000519097.1_Missense_Mutation_p.S786P|TEK_ENST00000406359.4_Missense_Mutation_p.S891P	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	934	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	TAGCACCGCGTCCACACTGTC	0.587																																					p.S934P		.											.	TEK	1584	0			c.T2800C						.						93.0	74.0	81.0					9																	27212818		2203	4300	6503	SO:0001583	missense	7010	exon17			ACCGCGTCCACAC	L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.2800T>C	9.37:g.27212818T>C	ENSP00000369375:p.Ser934Pro	55.0	1.0		23.0	6.0	NM_000459	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	ENST00000380036.4	37	CCDS6519.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.638681	0.87760	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000406359	D;D;D	0.82893	-1.66;-1.66;-1.66	5.37	5.37	0.77165	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.50627	D	0.000101	D	0.84088	0.5395	N	0.13043	0.29	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.999	D	0.87212	0.2248	10	0.72032	D	0.01	.	15.6507	0.77091	0.0:0.0:0.0:1.0	.	786;967;934	E7EWI2;Q59HG2;Q02763	.;.;TIE2_HUMAN	P	786;934;891	ENSP00000430686:S786P;ENSP00000369375:S934P;ENSP00000383977:S891P	ENSP00000369375:S934P	S	+	1	0	TEK	27202818	1.000000	0.71417	0.960000	0.40013	0.727000	0.41649	4.947000	0.63583	2.163000	0.67991	0.482000	0.46254	TCC	.		0.587	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3		
TEP1	7011	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20874511	20874511	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr14:20874511G>A	ENST00000262715.5	-	3	656	c.616C>T	c.(616-618)Cct>Tct	p.P206S	TEP1_ENST00000556935.1_Missense_Mutation_p.P206S	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	206					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CTATAAGAAGGCATTTGGGTC	0.522																																					p.P206S		.											.	TEP1	95	0			c.C616T						.						119.0	108.0	112.0					14																	20874511		2203	4300	6503	SO:0001583	missense	7011	exon3			AAGAAGGCATTTG		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.616C>T	14.37:g.20874511G>A	ENSP00000262715:p.Pro206Ser	48.0	1.0		29.0	7.0	NM_007110	A0AUV9	Missense_Mutation	SNP	ENST00000262715.5	37	CCDS9548.1	.	.	.	.	.	.	.	.	.	.	G	10.69	1.420125	0.25552	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935	T;D	0.84442	-0.2;-1.85	4.94	4.94	0.65067	.	0.000000	0.53938	D	0.000041	D	0.89546	0.6746	L	0.59436	1.845	0.80722	D	1	D;D	0.61080	0.989;0.982	D;P	0.63957	0.92;0.709	D	0.90102	0.4185	10	0.87932	D	0	-18.2627	13.843	0.63451	0.0:0.0:1.0:0.0	.	206;206	G3V5X7;Q99973	.;TEP1_HUMAN	S	206	ENSP00000262715:P206S;ENSP00000452574:P206S	ENSP00000262715:P206S	P	-	1	0	TEP1	19944351	1.000000	0.71417	0.943000	0.38184	0.003000	0.03518	4.209000	0.58493	2.718000	0.92993	0.655000	0.94253	CCT	.		0.522	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	
TMEM38B	55151	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	9	108536210	108536210	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr9:108536210G>A	ENST00000374692.3	+	6	842	c.725G>A	c.(724-726)tGg>tAg	p.W242*	TMEM38B_ENST00000374688.1_Nonsense_Mutation_p.W188*	NM_018112.1	NP_060582.1	Q9NVV0	TM38B_HUMAN	transmembrane protein 38B	242						integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)			kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	13						ACATTGAGTTGGATGCTATTT	0.408																																					p.W242X		.											.	TMEM38B	92	0			c.G725A						.						117.0	113.0	114.0					9																	108536210		2203	4300	6503	SO:0001587	stop_gained	55151	exon6			TGAGTTGGATGCT	BC031938	CCDS6768.1	9q31.3	2013-05-23	2004-12-21	2004-12-22	ENSG00000095209	ENSG00000095209			25535	protein-coding gene	gene with protein product		611236	"""chromosome 9 open reading frame 87"""	C9orf87		17611541, 23316006	Standard	NM_018112		Approved	FLJ10493, bA219P18.1, D4Ertd89e, TRIC-B	uc004bcu.2	Q9NVV0	OTTHUMG00000020429	ENST00000374692.3:c.725G>A	9.37:g.108536210G>A	ENSP00000363824:p.Trp242*	158.0	0.0		95.0	34.0	NM_018112	Q5JR63|Q5SVN5|Q5SVN6|Q5VTE2|Q6IA97	Nonsense_Mutation	SNP	ENST00000374692.3	37	CCDS6768.1	.	.	.	.	.	.	.	.	.	.	G	14.26	2.481203	0.44147	.	.	ENSG00000095209	ENST00000374692;ENST00000374688	.	.	.	4.81	4.81	0.61882	.	0.609679	0.17087	N	0.187523	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-3.5522	13.5504	0.61728	0.0:0.0:1.0:0.0	.	.	.	.	X	242;188	.	ENSP00000363820:W188X	W	+	2	0	TMEM38B	107576031	1.000000	0.71417	0.843000	0.33291	0.129000	0.20672	2.106000	0.41835	2.641000	0.89580	0.585000	0.79938	TGG	.		0.408	TMEM38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053517.1	NM_018112	
TP53	7157	hgsc.bcm.edu;bcgsc.ca	37	17	7579389	7579399	+	Frame_Shift_Del	DEL	GGGAAGGGACA	GGGAAGGGACA	-			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	GGGAAGGGACA	GGGAAGGGACA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr17:7579389_7579399delGGGAAGGGACA	ENST00000269305.4	-	4	477_487	c.288_298delTGTCCCTTCCC	c.(286-300)tctgtcccttcccagfs	p.VPSQ97fs	TP53_ENST00000420246.2_Frame_Shift_Del_p.VPSQ97fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.VPSQ97fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.VPSQ97fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Del_p.VPSQ97fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.VPSQ97fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	97	Interaction with WWOX.		V -> A (in a sporadic cancer; somatic mutation).|V -> F (in a sporadic cancer; somatic mutation).|V -> I (in familial cancer not matching LFS; germline mutation and in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q100*(12)|p.0?(8)|p.P98S(4)|p.S99fs*48(3)|p.S99fs*23(3)|p.P98L(3)|p.V97V(3)|p.Q100fs*37(3)|p.G59fs*23(3)|p.S99F(2)|p.V97I(1)|p.V73fs*9(1)|p.V97A(1)|p.P98fs*26(1)|p.S99P(1)|p.W91fs*13(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.S99fs*24(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TAGGTTTTCTGGGAAGGGACAGAAGATGACA	0.645		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.96_100del	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,head_neck,carcinoma,0	TP53	70225	53	Deletion - Frameshift(17)|Substitution - Nonsense(12)|Substitution - Missense(12)|Whole gene deletion(8)|Substitution - coding silent(3)|Insertion - Frameshift(1)	upper_aerodigestive_tract(7)|haematopoietic_and_lymphoid_tissue(7)|ovary(5)|large_intestine(4)|lung(4)|skin(4)|bone(4)|central_nervous_system(3)|kidney(3)|adrenal_gland(2)|urinary_tract(2)|breast(2)|pancreas(2)|stomach(1)|eye(1)|oesophagus(1)|liver(1)	c.288_298del	GRCh37	CM045203	TP53	M		.																																			SO:0001589	frameshift_variant	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	TTTTCTGGGAAGG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.288_298delTGTCCCTTCCC	17.37:g.7579389_7579399delGGGAAGGGACA	ENSP00000269305:p.Val97fs	195.0	0.0		65.0	23.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																			.		0.645	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TUBGCP2	10844	ucsc.edu;bcgsc.ca	37	10	135113524	135113524	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr10:135113524C>T	ENST00000252936.3	-	2	283	c.244G>A	c.(244-246)Gtg>Atg	p.V82M	TUBGCP2_ENST00000417178.2_De_novo_Start_InFrame|TUBGCP2_ENST00000543663.1_Missense_Mutation_p.V82M|TUBGCP2_ENST00000470829.1_5'UTR|TUBGCP2_ENST00000368563.2_Missense_Mutation_p.V82M			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	82					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		AACAGGTACACCAGCGGGTCA	0.478																																					p.V82M		.											.	TUBGCP2	90	0			c.G244A						.						164.0	147.0	153.0					10																	135113524		2203	4300	6503	SO:0001583	missense	10844	exon3			GGTACACCAGCGG	AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.244G>A	10.37:g.135113524C>T	ENSP00000252936:p.Val82Met	124.0	2.0		115.0	52.0	NM_001256617	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Missense_Mutation	SNP	ENST00000252936.3	37	CCDS7676.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.586569	0.86851	.	.	ENSG00000130640	ENST00000252936;ENST00000368563;ENST00000543663	T;T;T	0.45276	0.9;0.9;0.9	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.47154	0.1430	L	0.52759	1.655	0.80722	D	1	P;P;P	0.48162	0.906;0.848;0.848	P;B;B	0.47134	0.539;0.338;0.338	T	0.44742	-0.9308	10	0.48119	T	0.1	-39.7776	17.588	0.87988	0.0:1.0:0.0:0.0	.	82;82;82	F5H4L0;B7ZKL8;Q9BSJ2	.;.;GCP2_HUMAN	M	82	ENSP00000252936:V82M;ENSP00000357551:V82M;ENSP00000446093:V82M	ENSP00000252936:V82M	V	-	1	0	TUBGCP2	134963514	1.000000	0.71417	1.000000	0.80357	0.689000	0.40095	4.589000	0.61006	2.572000	0.86782	0.491000	0.48974	GTG	.		0.478	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051148.1		
UBXN1	51035	ucsc.edu;mdanderson.org	37	11	62445985	62445985	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr11:62445985C>A	ENST00000301935.5	-	3	368	c.202G>T	c.(202-204)Gag>Tag	p.E68*	UBXN1_ENST00000533000.1_5'Flank|UBXN1_ENST00000529640.1_Nonsense_Mutation_p.E68*|UBXN1_ENST00000524762.1_5'UTR|UBXN1_ENST00000294119.2_Nonsense_Mutation_p.E68*			Q04323	UBXN1_HUMAN	UBX domain protein 1	68	Interaction with BRCA1.				negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|K6-linked polyubiquitin binding (GO:0071796)|polyubiquitin binding (GO:0031593)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			endometrium(5)|lung(12)	17						CCGCCTTGCTCTGAGGAAGTG	0.542																																					p.E68X		.											.	UBXN1	90	0			c.G202T						.						79.0	83.0	81.0					11																	62445985		2202	4299	6501	SO:0001587	stop_gained	51035	exon3			CTTGCTCTGAGGA		CCDS8029.1, CCDS66105.1, CCDS73307.1	11q23	2014-02-12	2008-07-25		ENSG00000162191	ENSG00000162191		"""UBX domain containing"""	18402	protein-coding gene	gene with protein product	"""SAPK substrate protein 1"""					12838346, 20351172	Standard	NM_001286078		Approved	LOC51035, 2B28, UBXD10, SAKS1	uc001nuj.3	Q04323	OTTHUMG00000167580	ENST00000301935.5:c.202G>T	11.37:g.62445985C>A	ENSP00000303991:p.Glu68*	124.0	2.0		59.0	11.0	NM_015853	Q9BV93|Q9BVV5	Nonsense_Mutation	SNP	ENST00000301935.5	37		.	.	.	.	.	.	.	.	.	.	C	28.3	4.910551	0.92107	.	.	ENSG00000162191	ENST00000294119;ENST00000301935;ENST00000529640;ENST00000534176	.	.	.	5.61	4.69	0.59074	.	0.478868	0.24818	N	0.035350	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	-0.7777	8.3126	0.32080	0.0:0.76:0.1582:0.0818	.	.	.	.	X	68	.	ENSP00000294119:E68X	E	-	1	0	UBXN1	62202561	0.781000	0.28676	0.015000	0.15790	0.715000	0.41141	4.699000	0.61796	1.518000	0.48934	0.655000	0.94253	GAG	.		0.542	UBXN1-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000395153.1	NM_015853	
ULK4	54986	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	41954356	41954356	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr3:41954356C>G	ENST00000301831.4	-	9	1301	c.839G>C	c.(838-840)tGg>tCg	p.W280S	ULK4_ENST00000420927.1_Missense_Mutation_p.W280S	NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	280	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		AGCTTTCTTCCAAAATGAATG	0.373																																					p.W280S		.											.	ULK4	297	0			c.G839C						.						89.0	84.0	86.0					3																	41954356		1869	4095	5964	SO:0001583	missense	54986	exon9			TTCTTCCAAAATG	AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.839G>C	3.37:g.41954356C>G	ENSP00000301831:p.Trp280Ser	119.0	2.0		76.0	25.0	NM_017886	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	ENST00000301831.4	37	CCDS43071.1	.	.	.	.	.	.	.	.	.	.	C	19.90	3.913630	0.72983	.	.	ENSG00000168038	ENST00000301831;ENST00000420927	T;T	0.73575	-0.76;1.9	5.17	5.17	0.71159	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.428556	0.29355	N	0.012399	D	0.86581	0.5967	M	0.77616	2.38	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.88134	0.2840	10	0.72032	D	0.01	.	17.4307	0.87538	0.0:1.0:0.0:0.0	.	280;280	B4E2M4;Q96C45	.;ULK4_HUMAN	S	280	ENSP00000301831:W280S;ENSP00000412187:W280S	ENSP00000301831:W280S	W	-	2	0	ULK4	41929360	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	5.288000	0.65651	2.420000	0.82092	0.655000	0.94253	TGG	.		0.373	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1	XM_929989	
UNKL	64718	ucsc.edu;bcgsc.ca	37	16	1417119	1417119	+	Intron	SNP	G	G	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr16:1417119G>A	ENST00000389221.4	-	14	1887				UNKL_ENST00000397464.1_Intron|UNKL_ENST00000402641.2_Missense_Mutation_p.R173C|UNKL_ENST00000508903.2_Missense_Mutation_p.R674C|UNKL_ENST00000391893.2_Missense_Mutation_p.R170C|UNKL_ENST00000248104.7_Missense_Mutation_p.R170C|UNKL_ENST00000403703.1_Missense_Mutation_p.R173C	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				AGGTCCAGGCGCAGCTGACTC	0.716																																					p.R173C		.											.	UNKL	90	0			c.C517T						.																																			SO:0001627	intron_variant	64718	exon5			CCAGGCGCAGCTG	BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.1887+123C>T	16.37:g.1417119G>A		64.0	0.0		44.0	4.0	NM_023076	B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Missense_Mutation	SNP	ENST00000389221.4	37	CCDS53981.1	.	.	.	.	.	.	.	.	.	.	g	16.77	3.214760	0.58452	.	.	ENSG00000059145	ENST00000248104;ENST00000403703;ENST00000391893;ENST00000402641;ENST00000508903	T	0.76968	-1.06	4.88	4.88	0.63580	.	.	.	.	.	T	0.65428	0.2690	.	.	.	0.80722	D	1	P;P	0.39443	0.674;0.655	B;B	0.32583	0.148;0.076	T	0.67960	-0.5535	8	0.49607	T	0.09	.	9.282	0.37733	0.0989:0.0:0.9011:0.0	.	170;674	Q9H9P5-3;E9PDK2	.;.	C	170;173;170;173;674	ENSP00000422852:R674C	ENSP00000248104:R170C	R	-	1	0	UNKL	1357120	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	6.263000	0.72521	2.295000	0.77249	0.473000	0.43528	CGC	.		0.716	UNKL-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001037125	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	215802343	215802343	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr1:215802343G>A	ENST00000307340.3	-	71	15718	c.15332C>T	c.(15331-15333)aCa>aTa	p.T5111I	SNORD116_ENST00000365628.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.T5135I	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	5111					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACTCACAGGTGTCCCAGACCG	0.498										HNSCC(13;0.011)																											p.T5111I		.											.	USH2A	115	0			c.C15332T						.						111.0	114.0	113.0					1																	215802343		2203	4300	6503	SO:0001583	missense	7399	exon71			ACAGGTGTCCCAG	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.15332C>T	1.37:g.215802343G>A	ENSP00000305941:p.Thr5111Ile	164.0	0.0		109.0	13.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.081370	0.76528	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.13778	2.59;2.56	5.67	5.67	0.87782	.	0.202390	0.24187	U	0.040742	T	0.22666	0.0547	L	0.60455	1.87	0.40500	D	0.980631	P	0.50272	0.933	P	0.44860	0.462	T	0.01071	-1.1461	10	0.62326	D	0.03	.	19.7686	0.96352	0.0:0.0:1.0:0.0	.	5111	O75445	USH2A_HUMAN	I	5111;5135	ENSP00000305941:T5111I;ENSP00000355910:T5135I	ENSP00000305941:T5111I	T	-	2	0	USH2A	213868966	0.992000	0.36948	0.971000	0.41717	0.811000	0.45836	4.681000	0.61663	2.665000	0.90641	0.591000	0.81541	ACA	.		0.498	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
URB2	9816	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	229770867	229770867	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr1:229770867G>T	ENST00000258243.2	+	4	643	c.507G>T	c.(505-507)ttG>ttT	p.L169F		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	169						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						TAGCCCAGTTGTTTGAGGTCA	0.582																																					p.L169F		.											.	URB2	174	0			c.G507T						.						69.0	55.0	60.0					1																	229770867		2203	4300	6503	SO:0001583	missense	9816	exon4			CCAGTTGTTTGAG	D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.507G>T	1.37:g.229770867G>T	ENSP00000258243:p.Leu169Phe	104.0	1.0		81.0	27.0	NM_014777	Q5VYC9	Missense_Mutation	SNP	ENST00000258243.2	37	CCDS31052.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.932319	0.52866	.	.	ENSG00000135763	ENST00000258243	T	0.11063	2.81	5.68	-9.87	0.00470	.	0.155862	0.39615	N	0.001303	T	0.17280	0.0415	M	0.62723	1.935	0.26411	N	0.97626	D	0.89917	1.0	D	0.71414	0.973	T	0.02860	-1.1101	9	.	.	.	-12.7763	8.7134	0.34397	0.486:0.1709:0.3431:0.0	.	169	Q14146	URB2_HUMAN	F	169	ENSP00000258243:L169F	.	L	+	3	2	URB2	227837490	0.543000	0.26434	0.000000	0.03702	0.643000	0.38383	-0.283000	0.08433	-1.773000	0.01290	0.650000	0.86243	TTG	.		0.582	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	NM_014777	
VWDE	221806	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	12409323	12409323	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr7:12409323C>A	ENST00000275358.3	-	12	2797	c.2609G>T	c.(2608-2610)gGg>gTg	p.G870V		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	870						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						GTTATATTTCCCCTCCTCCAC	0.418																																					p.G870V		.											.	VWDE	68	0			c.G2609T						.						173.0	136.0	148.0					7																	12409323		692	1591	2283	SO:0001583	missense	221806	exon12			TATTTCCCCTCCT		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.2609G>T	7.37:g.12409323C>A	ENSP00000275358:p.Gly870Val	167.0	1.0		116.0	37.0	NM_001135924	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	37	CCDS47544.1	.	.	.	.	.	.	.	.	.	.	C	4.503	0.093270	0.08632	.	.	ENSG00000146530	ENST00000275358;ENST00000536307	D	0.81996	-1.56	4.83	4.83	0.62350	.	0.360297	0.28082	N	0.016676	T	0.74061	0.3667	L	0.48642	1.525	0.38269	D	0.942105	P	0.45126	0.851	B	0.40165	0.321	T	0.74124	-0.3766	10	0.05721	T	0.95	.	12.9438	0.58362	0.2029:0.7971:0.0:0.0	.	870	Q8N2E2	VWDE_HUMAN	V	870;324	ENSP00000275358:G870V	ENSP00000275358:G870V	G	-	2	0	VWDE	12375848	0.178000	0.23122	0.967000	0.41034	0.229000	0.25112	3.503000	0.53340	2.512000	0.84698	0.655000	0.94253	GGG	.		0.418	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
WDFY4	57705	broad.mit.edu;mdanderson.org	37	10	50022037	50022037	+	Silent	SNP	G	G	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr10:50022037G>A	ENST00000325239.5	+	30	5277	c.5250G>A	c.(5248-5250)caG>caA	p.Q1750Q	WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	1750						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						GGCTCCTGCAGAGGCACCACC	0.587																																					p.Q1750Q		.											.	WDFY4	22	0			c.G5250A						.						34.0	38.0	37.0					10																	50022037		692	1591	2283	SO:0001819	synonymous_variant	57705	exon31			CCTGCAGAGGCAC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.5250G>A	10.37:g.50022037G>A		37.0	0.0		16.0	4.0	NM_020945	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	ENST00000325239.5	37	CCDS44385.1	.	.	.	.	.	.	.	.	.	.	G	6.568	0.473137	0.12461	.	.	ENSG00000128815	ENST00000312002;ENST00000374161	.	.	.	5.83	3.93	0.45458	.	.	.	.	.	T	0.59335	0.2186	.	.	.	0.49389	D	0.999788	.	.	.	.	.	.	T	0.54675	-0.8258	4	.	.	.	.	9.2194	0.37366	0.0:0.153:0.6733:0.1737	.	.	.	.	K	841;297	.	.	E	+	1	0	WDFY4	49692043	1.000000	0.71417	0.321000	0.25320	0.797000	0.45037	3.069000	0.50026	0.758000	0.33059	0.591000	0.81541	GAG	.		0.587	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
WDR91	29062	broad.mit.edu;bcgsc.ca	37	7	134894445	134894445	+	Silent	SNP	C	C	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr7:134894445C>T	ENST00000354475.4	-	2	217	c.186G>A	c.(184-186)cgG>cgA	p.R62R	WDR91_ENST00000485942.1_5'Flank|WDR91_ENST00000423565.1_Silent_p.R27R|WDR91_ENST00000344400.5_Silent_p.R62R	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	62										breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						TCCAATAATCCCGAAGGGCAG	0.498																																					p.R62R		.											.	WDR91	137	0			c.G186A						.						107.0	109.0	108.0					7																	134894445		2203	4300	6503	SO:0001819	synonymous_variant	29062	exon2			ATAATCCCGAAGG	AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.186G>A	7.37:g.134894445C>T		102.0	2.0		53.0	23.0	NM_014149	A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Silent	SNP	ENST00000354475.4	37	CCDS34758.1																																																																																			.		0.498	WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340019.1	NM_014149	
ZBTB32	27033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36207170	36207170	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr19:36207170A>T	ENST00000392197.2	+	6	1478	c.1160A>T	c.(1159-1161)cAg>cTg	p.Q387L	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000341701.1_5'Flank|KMT2B_ENST00000222270.7_5'Flank|ZBTB32_ENST00000262630.3_Missense_Mutation_p.Q387L|KMT2B_ENST00000420124.1_5'Flank			Q9Y2Y4	ZBT32_HUMAN	zinc finger and BTB domain containing 32	387					DNA repair (GO:0006281)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cytokine production (GO:0001817)|T cell proliferation (GO:0042098)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(1)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	14	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTCAAGCATCAGATGGAGACG	0.627																																					p.Q387L		.											.	ZBTB32	92	0			c.A1160T						.						36.0	33.0	34.0					19																	36207170		2203	4300	6503	SO:0001583	missense	27033	exon5			AGCATCAGATGGA	AF130255	CCDS12471.1	19q13.1	2013-01-08			ENSG00000011590	ENSG00000011590		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16763	protein-coding gene	gene with protein product	"""repressor of GATA"""	605859				10572087	Standard	XM_005258739		Approved	TZFP, FAZF, FAXF, Rog, ZNF538	uc002oay.3	Q9Y2Y4	OTTHUMG00000048118	ENST00000392197.2:c.1160A>T	19.37:g.36207170A>T	ENSP00000376035:p.Gln387Leu	82.0	0.0		81.0	27.0	NM_014383	Q8WVP2	Missense_Mutation	SNP	ENST00000392197.2	37	CCDS12471.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.442828	0.83993	.	.	ENSG00000011590	ENST00000262630;ENST00000392197	T;T	0.07327	3.2;3.2	4.72	4.72	0.59763	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45867	D	0.000321	T	0.15435	0.0372	N	0.21142	0.635	0.49130	D	0.999756	D	0.76494	0.999	D	0.87578	0.998	T	0.05582	-1.0876	10	0.39692	T	0.17	-14.3215	12.206	0.54353	1.0:0.0:0.0:0.0	.	387	Q9Y2Y4	ZBT32_HUMAN	L	387	ENSP00000262630:Q387L;ENSP00000376035:Q387L	ENSP00000262630:Q387L	Q	+	2	0	ZBTB32	40899010	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.085000	0.76875	1.983000	0.57843	0.459000	0.35465	CAG	.		0.627	ZBTB32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109491.3	NM_014383	
ZNF85	7639	broad.mit.edu;ucsc.edu	37	19	21132332	21132332	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr19:21132332G>T	ENST00000328178.8	+	4	1125	c.1012G>T	c.(1012-1014)Gga>Tga	p.G338*	ZNF85_ENST00000601023.1_Nonsense_Mutation_p.G279*|ZNF85_ENST00000345030.6_Nonsense_Mutation_p.G305*	NM_001256173.1|NM_003429.4	NP_001243102.1|NP_003420.2	Q03923	ZNF85_HUMAN	zinc finger protein 85	338					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)	20						AATTCATACTGGAGAGAAACC	0.373																																					p.G368X		.											.	ZNF85	514	0			c.G1102T						.						43.0	48.0	47.0					19																	21132332		2199	4288	6487	SO:0001587	stop_gained	7639	exon5			CATACTGGAGAGA	U35376	CCDS32977.1, CCDS58657.1	19p12	2013-01-08	2006-05-12			ENSG00000105750		"""Zinc fingers, C2H2-type"", ""-"""	13160	protein-coding gene	gene with protein product		603899	"""zinc finger protein 85 (HPF4, HTF1)"""			2505992	Standard	NM_003429		Approved	HPF4, HTF1	uc031rjx.1	Q03923		ENST00000328178.8:c.1012G>T	19.37:g.21132332G>T	ENSP00000329793:p.Gly338*	87.0	1.0		47.0	12.0	NM_001256171	B9ZVP4|Q6NVI0	Nonsense_Mutation	SNP	ENST00000328178.8	37	CCDS32977.1	.	.	.	.	.	.	.	.	.	.	.	16.94	3.260799	0.59431	.	.	ENSG00000105750	ENST00000328178;ENST00000345030;ENST00000421385	.	.	.	1.35	0.209	0.15226	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	6.8919	0.24234	0.193:0.0:0.807:0.0	.	.	.	.	X	338;305;213	.	ENSP00000329793:G338X	G	+	1	0	ZNF85	20924172	0.179000	0.23135	0.343000	0.25615	0.418000	0.31294	0.835000	0.27531	0.681000	0.31386	0.462000	0.41574	GGA	.		0.373	ZNF85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463430.1	NM_003429	
ZNF85	7639	ucsc.edu;bcgsc.ca	37	19	21132585	21132585	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr19:21132585G>A	ENST00000328178.8	+	4	1378	c.1265G>A	c.(1264-1266)gGa>gAa	p.G422E	ZNF85_ENST00000601023.1_Missense_Mutation_p.G363E|ZNF85_ENST00000345030.6_Missense_Mutation_p.G389E	NM_001256173.1|NM_003429.4	NP_001243102.1|NP_003420.2	Q03923	ZNF85_HUMAN	zinc finger protein 85	422					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)	20						ATTCATACTGGAGAGAAGCCT	0.313																																					p.G452E		.											.	ZNF85	514	0			c.G1355A						.						22.0	24.0	24.0					19																	21132585		2198	4291	6489	SO:0001583	missense	7639	exon5			ATACTGGAGAGAA	U35376	CCDS32977.1, CCDS58657.1	19p12	2013-01-08	2006-05-12			ENSG00000105750		"""Zinc fingers, C2H2-type"", ""-"""	13160	protein-coding gene	gene with protein product		603899	"""zinc finger protein 85 (HPF4, HTF1)"""			2505992	Standard	NM_003429		Approved	HPF4, HTF1	uc031rjx.1	Q03923		ENST00000328178.8:c.1265G>A	19.37:g.21132585G>A	ENSP00000329793:p.Gly422Glu	123.0	2.0		79.0	22.0	NM_001256171	B9ZVP4|Q6NVI0	Missense_Mutation	SNP	ENST00000328178.8	37	CCDS32977.1	.	.	.	.	.	.	.	.	.	.	.	10.89	1.479588	0.26511	.	.	ENSG00000105750	ENST00000328178;ENST00000345030;ENST00000421385	T;T	0.25749	1.78;1.78	1.35	1.35	0.21983	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.33904	0.0879	L	0.28504	0.86	0.80722	D	1	P;D;D	0.89917	0.466;1.0;0.998	B;D;D	0.91635	0.392;0.999;0.937	T	0.05869	-1.0859	9	0.51188	T	0.08	.	9.5712	0.39429	0.0:0.0:1.0:0.0	.	389;363;422	Q03923-2;Q49A12;Q03923	.;.;ZNF85_HUMAN	E	422;389;297	ENSP00000329793:G422E;ENSP00000342340:G389E	ENSP00000329793:G422E	G	+	2	0	ZNF85	20924425	1.000000	0.71417	0.033000	0.17914	0.016000	0.09150	4.417000	0.59822	0.681000	0.31386	0.462000	0.41574	GGA	.		0.313	ZNF85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463430.1	NM_003429	
ZNF845	91664	ucsc.edu;bcgsc.ca	37	19	53854400	53854400	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr19:53854400G>T	ENST00000595091.1	+	5	691	c.472G>T	c.(472-474)Ggg>Tgg	p.G158W	ZNF845_ENST00000458035.1_Missense_Mutation_p.G158W			Q96IR2	ZN845_HUMAN	zinc finger protein 845	158					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						TCAGACCGAAGGGAAAATTGG	0.413																																					p.G158W		.											.	.	.	0			c.G472T						.						69.0	48.0	54.0					19																	53854400		692	1591	2283	SO:0001583	missense	91664	exon4			ACCGAAGGGAAAA	BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.472G>T	19.37:g.53854400G>T	ENSP00000470005:p.Gly158Trp	289.0	2.0		199.0	78.0	NM_138374		Missense_Mutation	SNP	ENST00000595091.1	37	CCDS46170.1	.	.	.	.	.	.	.	.	.	.	G	7.289	0.610761	0.14066	.	.	ENSG00000213799	ENST00000458035;ENST00000427984	T	0.08102	3.13	1.2	-1.44	0.08856	.	.	.	.	.	T	0.17619	0.0423	L	0.54323	1.7	0.09310	N	1	D	0.76494	0.999	D	0.78314	0.991	T	0.11348	-1.0591	9	0.48119	T	0.1	.	5.4591	0.16607	0.355:0.0:0.645:0.0	.	158	Q96IR2	ZN845_HUMAN	W	158	ENSP00000388311:G158W	ENSP00000412086:G158W	G	+	1	0	ZNF845	58546212	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.629000	0.24538	-0.380000	0.07894	-0.474000	0.04947	GGG	.		0.413	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908	
NUTM1	256646	ucsc.edu;bcgsc.ca	37	15	34642906	34642907	+	Splice_Site	DNP	CC	CC	AA			TCGA-BC-A69H-01A-11D-A30V-10	TCGA-BC-A69H-10A-01D-A30V-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e0f3c4-dcff-4718-8461-381609521e4f	371b4d98-49a4-4605-a24e-d7b92923da58	g.chr15:34642906_34642907CC>AA	ENST00000333756.4	+	3	882_883	c.727_728CC>AA	c.(727-729)CCa>AAa	p.P243K	NUTM1_ENST00000537011.1_Splice_Site_p.P271K|NUTM1_ENST00000438749.3_Splice_Site_p.P261K	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	243						cytoplasm (GO:0005737)|nucleus (GO:0005634)											GGGTTTTAGCCCAGTGCTTCGT	0.559																																					p.P271K		.											.	.	.	0			.						.																																			SO:0001630	splice_region_variant	0	.			TTTAGCCCAGTGC	AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	Exception_encountered	15.37:g.34642906_34642907delinsAA		114.0	2.0		68.0	25.0	.	B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Missense_Mutation	DNP	ENST00000333756.4	37	CCDS32190.1																																																																																			.		0.559	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418026.1	NM_175741	Missense_Mutation
