#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA10	10349	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	67183861	67183861	+	Missense_Mutation	SNP	A	A	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr17:67183861A>T	ENST00000269081.4	-	20	3200	c.2291T>A	c.(2290-2292)tTc>tAc	p.F764Y	ABCA10_ENST00000416101.2_3'UTR	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	764					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					TAACTTTAAGAAGCGAAGTGT	0.373																																					p.F764Y		.											.	ABCA10	93	0			c.T2291A						.						130.0	124.0	126.0					17																	67183861		2203	4300	6503	SO:0001583	missense	10349	exon20			TTTAAGAAGCGAA	AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.2291T>A	17.37:g.67183861A>T	ENSP00000269081:p.Phe764Tyr	147.0	1.0		162.0	35.0	NM_080282	C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	ENST00000269081.4	37	CCDS11684.1	.	.	.	.	.	.	.	.	.	.	A	16.93	3.258290	0.59321	.	.	ENSG00000154263	ENST00000269081	T	0.77489	-1.1	2.76	2.76	0.32466	.	.	.	.	.	D	0.84991	0.5595	M	0.73430	2.235	0.58432	D	0.999995	D;D	0.76494	0.999;0.996	D;P	0.66351	0.943;0.904	D	0.85864	0.1412	9	0.87932	D	0	.	10.8415	0.46718	1.0:0.0:0.0:0.0	.	764;764	E5RFN6;Q8WWZ4	.;ABCAA_HUMAN	Y	764	ENSP00000269081:F764Y	ENSP00000269081:F764Y	F	-	2	0	ABCA10	64695456	0.134000	0.22483	0.063000	0.19743	0.102000	0.19082	4.397000	0.59690	1.139000	0.42245	0.338000	0.21704	TTC	.		0.373	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282	
ACAD11	84129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	132337601	132337601	+	Missense_Mutation	SNP	C	C	T	rs542883164		TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr3:132337601C>T	ENST00000264990.6	-	11	2262	c.1291G>A	c.(1291-1293)Gag>Aag	p.E431K	ACAD11_ENST00000355458.3_Missense_Mutation_p.E431K|ACAD11_ENST00000481970.2_Missense_Mutation_p.E431K|ACAD11_ENST00000545291.1_Intron	NM_032169.4	NP_115545	Q709F0	ACD11_HUMAN	acyl-CoA dehydrogenase family, member 11	431					fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)	mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|peroxisome (GO:0005777)	flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|very-long-chain-acyl-CoA dehydrogenase activity (GO:0017099)			breast(2)|endometrium(6)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	36						CAGAGACCCTCGACTTTGGCC	0.418													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15389	0.0		0.0	False		,,,				2504	0.0				p.E431K		.											.	ACAD11	91	0			c.G1291A						.						68.0	65.0	66.0					3																	132337601		2203	4300	6503	SO:0001583	missense	84129	exon11			GACCCTCGACTTT	BC019607	CCDS3074.1	3q22.1	2010-04-30	2010-04-30		ENSG00000240303	ENSG00000240303			30211	protein-coding gene	gene with protein product		614288	"""acyl-Coenzyme A dehydrogenase family, member 11"""				Standard	NM_032169		Approved	FLJ12592		Q709F0	OTTHUMG00000159780	ENST00000264990.6:c.1291G>A	3.37:g.132337601C>T	ENSP00000264990:p.Glu431Lys	202.0	0.0		238.0	63.0	NM_032169	Q08AF0|Q658N9|Q658Y2|Q6ZND2|Q8WUT6|Q9H9R3	Missense_Mutation	SNP	ENST00000264990.6	37	CCDS3074.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.361158	0.82353	.	.	ENSG00000240303	ENST00000355458;ENST00000264990;ENST00000481970	D;D;T	0.99701	-6.45;-6.45;1.85	5.52	5.52	0.82312	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	.	.	.	.	D	0.99507	0.9824	M	0.66560	2.04	0.80722	D	1	P;D	0.64830	0.908;0.994	B;P	0.57101	0.158;0.813	D	0.98826	1.0749	9	0.56958	D	0.05	.	19.3995	0.94621	0.0:1.0:0.0:0.0	.	431;431	D6RDI8;Q709F0	.;ACD11_HUMAN	K	431	ENSP00000347636:E431K;ENSP00000264990:E431K;ENSP00000420907:E431K	ENSP00000264990:E431K	E	-	1	0	ACAD11	133820291	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	4.549000	0.60726	2.754000	0.94517	0.650000	0.86243	GAG	.		0.418	ACAD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357279.2	NM_032169	
ACRV1	56	hgsc.bcm.edu;bcgsc.ca	37	11	125542541	125542541	+	Missense_Mutation	SNP	T	T	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr11:125542541T>C	ENST00000533904.1	-	4	1087	c.745A>G	c.(745-747)Acg>Gcg	p.T249A	ACRV1_ENST00000345274.1_Missense_Mutation_p.T139A|CHEK1_ENST00000428830.2_Intron|ACRV1_ENST00000453509.1_Missense_Mutation_p.T160A|ACRV1_ENST00000527795.1_Missense_Mutation_p.T179A|ACRV1_ENST00000348856.3_Missense_Mutation_p.T149A|ACRV1_ENST00000353070.1_Missense_Mutation_p.T65A|ACRV1_ENST00000530048.1_Missense_Mutation_p.T194A|ACRV1_ENST00000425431.1_Missense_Mutation_p.T105A|ACRV1_ENST00000315608.3_Missense_Mutation_p.T230A|ACRV1_ENST00000445562.1_Missense_Mutation_p.T154A			P26436	ASPX_HUMAN	acrosomal vesicle protein 1	249					multicellular organismal development (GO:0007275)	acrosomal vesicle (GO:0001669)				kidney(1)|large_intestine(3)|lung(2)	6	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0179)|Lung NSC(97;0.0185)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0713)		TGCATCCTCGTTCCATGGGAG	0.453																																					p.T249A		.											.	ACRV1	90	0			c.A745G						.						189.0	163.0	172.0					11																	125542541		2201	4299	6500	SO:0001583	missense	56	exon4			TCCTCGTTCCATG	AK223335	CCDS8460.1, CCDS8461.1, CCDS44759.1, CCDS44761.1	11q24.2	2012-05-16			ENSG00000134940	ENSG00000134940			127	protein-coding gene	gene with protein product	"""sperm protein 10"""	102525				1693291, 8288254	Standard	NM_001612		Approved	SPACA2, SP-10, D11S4365	uc001qcs.3	P26436	OTTHUMG00000165854	ENST00000533904.1:c.745A>G	11.37:g.125542541T>C	ENSP00000432816:p.Thr249Ala	76.0	0.0		88.0	4.0	NM_001612	Q53FF4	Missense_Mutation	SNP	ENST00000533904.1	37	CCDS8460.1	.	.	.	.	.	.	.	.	.	.	T	18.54	3.646568	0.67358	.	.	ENSG00000134940	ENST00000533904;ENST00000433875;ENST00000257382;ENST00000426183;ENST00000453509;ENST00000445562;ENST00000348856;ENST00000345274;ENST00000425431;ENST00000353070;ENST00000315608;ENST00000530048;ENST00000527795	T;T;T;T;T;T;T;T;T;T;T;T;T	0.26223	1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75	4.28	4.28	0.50868	.	0.374057	0.23483	N	0.047686	T	0.46946	0.1419	M	0.72118	2.19	0.34724	D	0.729022	D;D;D;D;D;D;D;D;D	0.89917	0.999;0.999;1.0;0.996;0.999;1.0;0.999;0.999;0.992	D;D;D;D;D;D;D;D;P	0.87578	0.996;0.979;0.998;0.99;0.997;0.998;0.963;0.995;0.85	T	0.60326	-0.7285	10	0.56958	D	0.05	-5.3828	10.1032	0.42517	0.0:0.0:0.0:1.0	.	249;230;139;65;154;194;105;179;160	P26436;P26436-2;P26436-8;P26436-11;P26436-6;P26436-3;P26436-10;P26436-4;P26436-5	ASPX_HUMAN;.;.;.;.;.;.;.;.	A	249;230;194;179;160;154;149;139;105;65;230;194;179	ENSP00000432816:T249A;ENSP00000407846:T230A;ENSP00000257382:T194A;ENSP00000411583:T179A;ENSP00000397448:T160A;ENSP00000412653:T154A;ENSP00000257385:T149A;ENSP00000257383:T139A;ENSP00000395453:T105A;ENSP00000257386:T65A;ENSP00000317684:T230A;ENSP00000433720:T194A;ENSP00000436819:T179A	ENSP00000257382:T194A	T	-	1	0	ACRV1	125047751	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.139000	0.50577	2.158000	0.67659	0.533000	0.62120	ACG	.		0.453	ACRV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386722.1	NM_001612	
ADAMTS1	9510	hgsc.bcm.edu;bcgsc.ca	37	21	28212774	28212774	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr21:28212774A>G	ENST00000284984.3	-	5	1940	c.1486T>C	c.(1486-1488)Tcc>Ccc	p.S496P		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	496	Disintegrin.				heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		CAGTGTTTGGAGTCCTCCCCA	0.577																																					p.S496P		.											.	ADAMTS1	272	0			c.T1486C						.						73.0	63.0	66.0					21																	28212774		2203	4300	6503	SO:0001583	missense	9510	exon5			GTTTGGAGTCCTC	AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.1486T>C	21.37:g.28212774A>G	ENSP00000284984:p.Ser496Pro	64.0	0.0		70.0	4.0	NM_006988	D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Missense_Mutation	SNP	ENST00000284984.3	37	CCDS33524.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.694959	0.88830	.	.	ENSG00000154734	ENST00000284984	T	0.63255	-0.03	5.14	5.14	0.70334	ADAM, cysteine-rich (1);	.	.	.	.	D	0.82999	0.5159	M	0.92219	3.285	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.86269	0.1660	9	0.49607	T	0.09	.	15.4124	0.74937	1.0:0.0:0.0:0.0	.	496	Q9UHI8	ATS1_HUMAN	P	496	ENSP00000284984:S496P	ENSP00000284984:S496P	S	-	1	0	ADAMTS1	27134645	1.000000	0.71417	0.933000	0.37362	0.894000	0.52154	8.761000	0.91691	2.284000	0.76573	0.528000	0.53228	TCC	.		0.577	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171650.2		
ADAMTS6	11174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	64748641	64748641	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr5:64748641C>T	ENST00000536360.1	-	5	1549	c.736G>A	c.(736-738)Gtg>Atg	p.V246M				Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 6	246						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(3)	18		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		TCAATGCTCACTGATCTCTTC	0.433																																					p.V246M		.											.	ADAMTS6	226	0			c.G736A						.						211.0	182.0	192.0					5																	64748641		2203	4300	6503	SO:0001583	missense	11174	exon5			TGCTCACTGATCT	AF140674	CCDS3983.2	5q13	2008-07-18	2005-08-19		ENSG00000049192	ENSG00000049192		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	222	protein-coding gene	gene with protein product	"""a disintegrin and metalloproteinase with thrombospondin motifs 6"""	605008	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 6"""			10464288	Standard	NM_197941		Approved	ADAM-TS6	uc003jtp.3	Q9UKP5	OTTHUMG00000074079	ENST00000536360.1:c.736G>A	5.37:g.64748641C>T	ENSP00000440995:p.Val246Met	251.0	0.0		324.0	58.0	NM_197941	Q59EX6|Q5IR87|Q5IR88|Q5IR89|Q68DL1	Missense_Mutation	SNP	ENST00000536360.1	37		.	.	.	.	.	.	.	.	.	.	C	14.04	2.417701	0.42918	.	.	ENSG00000049192	ENST00000381055;ENST00000261306;ENST00000464680;ENST00000536360	T;T;T	0.62105	0.11;0.23;0.05	5.49	3.72	0.42706	Metallopeptidase, catalytic domain (1);	0.188644	0.45606	D	0.000349	T	0.51924	0.1703	L	0.36672	1.1	0.51012	D	0.999902	B	0.23806	0.091	B	0.28784	0.094	T	0.49283	-0.8956	10	0.59425	D	0.04	.	9.9769	0.41789	0.0:0.7833:0.0:0.2167	.	246	Q9UKP5	ATS6_HUMAN	M	246	ENSP00000370443:V246M;ENSP00000423551:V246M;ENSP00000440995:V246M	ENSP00000261306:V246M	V	-	1	0	ADAMTS6	64784397	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.373000	0.34272	0.689000	0.31550	0.563000	0.77884	GTG	.		0.433	ADAMTS6-201	KNOWN	basic	protein_coding	protein_coding		NM_197941	
AGL	178	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	100340249	100340249	+	Missense_Mutation	SNP	G	G	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr1:100340249G>A	ENST00000294724.4	+	8	1443	c.965G>A	c.(964-966)aGg>aAg	p.R322K	AGL_ENST00000370165.3_Missense_Mutation_p.R322K|AGL_ENST00000477753.1_3'UTR|AGL_ENST00000361522.4_Missense_Mutation_p.R305K|AGL_ENST00000370163.3_Missense_Mutation_p.R322K|AGL_ENST00000361302.3_Missense_Mutation_p.R306K|AGL_ENST00000370161.2_Missense_Mutation_p.R306K|AGL_ENST00000361915.3_Missense_Mutation_p.R322K	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	322					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		TTAGAAAATAGGCGAGTAACC	0.333																																					p.R322K		.											.	AGL	92	0			c.G965A						.						82.0	73.0	76.0					1																	100340249		2203	4300	6503	SO:0001583	missense	178	exon8			AAAATAGGCGAGT	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.965G>A	1.37:g.100340249G>A	ENSP00000294724:p.Arg322Lys	57.0	1.0		64.0	9.0	NM_000644	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	ENST00000294724.4	37	CCDS759.1	.	.	.	.	.	.	.	.	.	.	G	0.412	-0.913011	0.02415	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	D;D;D;D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68;-1.68;-1.68;-1.68	5.04	4.12	0.48240	Glycoside hydrolase, superfamily (1);	0.227401	0.45126	N	0.000390	T	0.34542	0.0901	N	0.04297	-0.235	0.25466	N	0.987877	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.34551	-0.9824	10	0.02654	T	1	.	7.9666	0.30102	0.0817:0.0:0.7603:0.158	.	305;306;322	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	K	322;322;322;322;306;306;305	ENSP00000355106:R322K;ENSP00000359184:R322K;ENSP00000359182:R322K;ENSP00000294724:R322K;ENSP00000354971:R306K;ENSP00000359180:R306K;ENSP00000354635:R305K	ENSP00000294724:R322K	R	+	2	0	AGL	100112837	0.859000	0.29813	0.580000	0.28601	0.397000	0.30659	1.812000	0.38952	1.254000	0.44035	-0.225000	0.12378	AGG	.		0.333	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028	
AMPD3	272	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	10503698	10503698	+	Missense_Mutation	SNP	G	G	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr11:10503698G>T	ENST00000396554.3	+	4	883	c.542G>T	c.(541-543)cGc>cTc	p.R181L	AMPD3_ENST00000444303.2_Missense_Mutation_p.R13L	NM_000480.2	NP_000471.1	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3	172					ADP metabolic process (GO:0046031)|AMP catabolic process (GO:0006196)|ATP metabolic process (GO:0046034)|energy homeostasis (GO:0097009)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(3)|skin(1)	25				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		GCCTACCACCGCTTCCCGCGG	0.612																																					p.R181L		.											.	AMPD3	291	0			c.G542T						.						85.0	91.0	89.0					11																	10503698		2201	4294	6495	SO:0001583	missense	272	exon4			ACCACCGCTTCCC	M84722	CCDS7802.1, CCDS41617.1, CCDS44537.1, CCDS53601.1	11p15	2010-02-10	2010-02-10			ENSG00000133805	3.5.4.6		470	protein-coding gene	gene with protein product	"""erythrocyte-specific AMP deaminase"""	102772	"""adenosine monophosphate deaminase (isoform E)"""			1400401	Standard	NM_001172430		Approved		uc001min.1	Q01432		ENST00000396554.3:c.542G>T	11.37:g.10503698G>T	ENSP00000379802:p.Arg181Leu	51.0	0.0		69.0	10.0	NM_000480	A0AUX0|B7Z2S2|B7Z763|B7Z877	Missense_Mutation	SNP	ENST00000396554.3	37	CCDS7802.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.004679	0.93287	.	.	ENSG00000133805	ENST00000444303;ENST00000396554;ENST00000524866;ENST00000396553;ENST00000528723;ENST00000529507	T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96	5.88	4.97	0.65823	.	0.097493	0.64402	D	0.000001	T	0.60157	0.2247	M	0.84683	2.71	0.54753	D	0.999986	D;B;D	0.54397	0.966;0.447;0.966	P;B;P	0.52514	0.701;0.242;0.701	T	0.67530	-0.5647	10	0.52906	T	0.07	-14.7447	15.134	0.72549	0.0676:0.0:0.9324:0.0	.	179;172;181	B7Z763;Q01432;A0AUX0	.;AMPD3_HUMAN;.	L	13;181;172;172;179;172	ENSP00000396000:R13L;ENSP00000379802:R181L;ENSP00000433284:R172L;ENSP00000379801:R172L;ENSP00000436987:R179L;ENSP00000431648:R172L	ENSP00000379801:R172L	R	+	2	0	AMPD3	10460274	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	6.666000	0.74446	1.489000	0.48450	0.655000	0.94253	CGC	.		0.612	AMPD3-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385783.2	NM_000480	
ANXA13	312	hgsc.bcm.edu;broad.mit.edu	37	8	124705521	124705521	+	Nonsense_Mutation	SNP	C	C	T	rs146521013		TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr8:124705521C>T	ENST00000419625.1	-	8	630	c.558G>A	c.(556-558)tgG>tgA	p.W186*	ANXA13_ENST00000262219.6_Nonsense_Mutation_p.W227*	NM_004306.2	NP_004297.2	P27216	ANX13_HUMAN	annexin A13	186					cell differentiation (GO:0030154)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|exocytic vesicle (GO:0070382)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylglycerol binding (GO:1901611)|phosphatidylserine binding (GO:0001786)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	25	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00288)			CATCAGTGCCCCAGCGGCCTT	0.463																																					p.W227X		.											.	ANXA13	93	0			c.G681A						.						142.0	143.0	142.0					8																	124705521		2203	4300	6503	SO:0001587	stop_gained	312	exon9			AGTGCCCCAGCGG	Z11502	CCDS34939.1, CCDS47917.1	8q24.13	2005-11-09			ENSG00000104537	ENSG00000104537		"""Annexins"""	536	protein-coding gene	gene with protein product		602573		ANX13		9503022	Standard	NM_004306		Approved		uc003yqt.3	P27216	OTTHUMG00000164987	ENST00000419625.1:c.558G>A	8.37:g.124705521C>T	ENSP00000390809:p.Trp186*	90.0	0.0		166.0	9.0	NM_001003954	Q9BQR5	Nonsense_Mutation	SNP	ENST00000419625.1	37	CCDS47917.1	.	.	.	.	.	.	.	.	.	.	C	36	5.644737	0.96704	.	.	ENSG00000104537	ENST00000262219;ENST00000419625	.	.	.	5.41	5.41	0.78517	.	0.314542	0.39909	N	0.001227	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.3145	0.90215	0.0:1.0:0.0:0.0	.	.	.	.	X	227;186	.	ENSP00000262219:W227X	W	-	3	0	ANXA13	124774702	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.234000	0.43035	2.701000	0.92244	0.650000	0.86243	TGG	C|1.000;A|0.000		0.463	ANXA13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381308.1	NM_004306	
AQP5	362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	50357929	50357929	+	Missense_Mutation	SNP	G	G	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr12:50357929G>C	ENST00000293599.6	+	3	731	c.583G>C	c.(583-585)Gtc>Ctc	p.V195L	RP11-469H8.6_ENST00000552379.1_RNA|RP11-469H8.6_ENST00000550530.1_RNA|RP11-469H8.6_ENST00000550214.1_RNA	NM_001651.2	NP_001642.1	P55064	AQP5_HUMAN	aquaporin 5	195					camera-type eye morphogenesis (GO:0048593)|carbon dioxide transport (GO:0015670)|excretion (GO:0007588)|odontogenesis (GO:0042476)|pancreatic juice secretion (GO:0030157)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	water channel activity (GO:0015250)			large_intestine(1)|lung(3)	4						CCCTGCGGTGGTCATGAATCG	0.607																																					p.V195L		.											.	AQP5	90	0			c.G583C						.						126.0	105.0	112.0					12																	50357929		2203	4300	6503	SO:0001583	missense	362	exon3			GCGGTGGTCATGA	U46569	CCDS8793.1	12q13	2013-09-10				ENSG00000161798		"""Ion channels / Aquaporins"""	638	protein-coding gene	gene with protein product		600442				8621489, 23830519	Standard	NM_001651		Approved		uc001rvo.3	P55064	OTTHUMG00000169710	ENST00000293599.6:c.583G>C	12.37:g.50357929G>C	ENSP00000293599:p.Val195Leu	82.0	0.0		107.0	15.0	NM_001651	Q6FGW8	Missense_Mutation	SNP	ENST00000293599.6	37	CCDS8793.1	.	.	.	.	.	.	.	.	.	.	G	11.92	1.784050	0.31593	.	.	ENSG00000161798	ENST00000293599	D	0.86497	-2.13	5.07	0.489	0.16854	Aquaporin-like (2);	0.424918	0.19449	N	0.113991	T	0.74809	0.3765	N	0.25286	0.73	0.32061	N	0.595644	B	0.02656	0.0	B	0.08055	0.003	T	0.66448	-0.5921	10	0.31617	T	0.26	-36.1104	8.0666	0.30665	0.4327:0.0:0.5673:0.0	.	195	P55064	AQP5_HUMAN	L	195	ENSP00000293599:V195L	ENSP00000293599:V195L	V	+	1	0	AQP5	48644196	0.018000	0.18449	0.860000	0.33809	0.724000	0.41520	0.077000	0.14738	0.244000	0.21351	0.655000	0.94253	GTC	.		0.607	AQP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405542.2	NM_001651	
ARID1B	57492	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	157522125	157522125	+	Missense_Mutation	SNP	C	C	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr6:157522125C>A	ENST00000350026.5	+	17	4359	c.4358C>A	c.(4357-4359)gCa>gAa	p.A1453E	ARID1B_ENST00000275248.4_Missense_Mutation_p.A1448E|ARID1B_ENST00000367148.1_Missense_Mutation_p.A1506E|ARID1B_ENST00000346085.5_Missense_Mutation_p.A1466E	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1453					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		AATATGTGGGCAGCACGCAAT	0.632																																					p.A1466E		.											.	ARID1B	154	0			c.C4397A						.						43.0	47.0	45.0					6																	157522125		2203	4296	6499	SO:0001583	missense	57492	exon18			TGTGGGCAGCACG	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.4358C>A	6.37:g.157522125C>A	ENSP00000055163:p.Ala1453Glu	69.0	0.0		126.0	16.0	NM_020732	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	ENST00000350026.5	37	CCDS5251.2	.	.	.	.	.	.	.	.	.	.	C	11.91	1.778375	0.31502	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000414678	T;T;T;T;T	0.02032	4.82;4.83;4.82;4.82;4.49	5.08	5.08	0.68730	.	0.175751	0.50627	D	0.000120	T	0.00845	0.0028	N	0.08118	0	0.36525	D	0.870411	B;B;B	0.19200	0.02;0.034;0.034	B;B;B	0.21708	0.016;0.036;0.036	T	0.61564	-0.7037	10	0.27785	T	0.31	.	18.8669	0.92296	0.0:1.0:0.0:0.0	.	1453;1466;1448	Q8NFD5;Q8NFD5-2;G3XAA0	ARI1B_HUMAN;.;.	E	1466;1453;1506;1448;975	ENSP00000344546:A1466E;ENSP00000055163:A1453E;ENSP00000356116:A1506E;ENSP00000275248:A1448E;ENSP00000412835:A975E	ENSP00000275248:A1448E	A	+	2	0	ARID1B	157563817	0.931000	0.31567	0.957000	0.39632	0.958000	0.62258	2.049000	0.41288	2.528000	0.85240	0.591000	0.81541	GCA	.		0.632	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
ATAD2B	54454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	23980414	23980414	+	Missense_Mutation	SNP	G	G	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr2:23980414G>T	ENST00000238789.5	-	25	4295	c.3952C>A	c.(3952-3954)Cca>Aca	p.P1318T	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	1318						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAGTTTCTGGTTTTTCTTTT	0.393																																					p.P1318T		.											.	ATAD2B	68	0			c.C3952A						.						181.0	175.0	177.0					2																	23980414		1823	4085	5908	SO:0001583	missense	54454	exon25			TTTCTGGTTTTTC	AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.3952C>A	2.37:g.23980414G>T	ENSP00000238789:p.Pro1318Thr	186.0	0.0		219.0	53.0	NM_017552	B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	ENST00000238789.5	37	CCDS46227.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.12|11.12	1.545640|1.545640	0.27652|0.27652	.|.	.|.	ENSG00000119778|ENSG00000119778	ENST00000381024|ENST00000238789;ENST00000546030	.|D	.|0.91351	.|-2.83	5.27|5.27	3.36|3.36	0.38483|0.38483	.|.	.|2.650130	.|0.01891	.|N	.|0.038537	D|D	0.82426|0.82426	0.5034|0.5034	N|N	0.12182|0.12182	0.205|0.205	0.31462|0.31462	N|N	0.669472|0.669472	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.06405	.|0.001;0.002	T|T	0.72261|0.72261	-0.4345|-0.4345	5|10	.|0.24483	.|T	.|0.36	.|.	6.5557|6.5557	0.22460|0.22460	0.077:0.1065:0.6428:0.1738|0.077:0.1065:0.6428:0.1738	.|.	.|1318;1313	.|Q9ULI0;Q9ULI0-2	.|ATD2B_HUMAN;.	K|T	593|1318;486	.|ENSP00000238789:P1318T	.|ENSP00000238789:P1318T	N|P	-|-	3|1	2|0	ATAD2B|ATAD2B	23833918|23833918	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.989000|0.989000	0.77384|0.77384	1.311000|1.311000	0.33562|0.33562	1.355000|1.355000	0.45865|0.45865	0.563000|0.563000	0.77884|0.77884	AAC|CCA	.		0.393	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324333.1	NM_017552	
ATP11B	23200	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	182566270	182566270	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr3:182566270C>T	ENST00000323116.5	+	10	1036	c.776C>T	c.(775-777)gCg>gTg	p.A259V	ATP11B_ENST00000482794.1_3'UTR	NM_014616.2	NP_055431.1	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	259					aminophospholipid transport (GO:0015917)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|ion transmembrane transporter activity (GO:0015075)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	41	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			ACAGGTGTTGCGGTATACACT	0.303																																					p.A259V		.											.	ATP11B	93	0			c.C776T						.						54.0	56.0	55.0					3																	182566270		2203	4294	6497	SO:0001583	missense	23200	exon10			GTGTTGCGGTATA	AF156548	CCDS33896.1	3q27	2010-04-20	2007-09-19		ENSG00000058063	ENSG00000058063		"""ATPases / P-type"""	13553	protein-coding gene	gene with protein product		605869	"""ATPase, Class VI, type 11B"""			10231032, 11015572	Standard	NM_014616		Approved	ATPIF, ATPIR, KIAA0956	uc003flb.3	Q9Y2G3	OTTHUMG00000158295	ENST00000323116.5:c.776C>T	3.37:g.182566270C>T	ENSP00000321195:p.Ala259Val	190.0	0.0		232.0	59.0	NM_014616	Q96FN1|Q9UKK7	Missense_Mutation	SNP	ENST00000323116.5	37	CCDS33896.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.3|22.3	4.272222|4.272222	0.80580|0.80580	.|.	.|.	ENSG00000058063|ENSG00000058063	ENST00000323116|ENST00000498086	D|.	0.82803|.	-1.65|.	5.4|5.4	5.4|5.4	0.78164|0.78164	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.54224|0.54224	0.1845|0.1845	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.76071|.	0.987|.	T|T	0.49021|0.49021	-0.8982|-0.8982	10|5	0.02654|.	T|.	1|.	.|.	19.2267|19.2267	0.93820|0.93820	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	259|.	Q9Y2G3|.	AT11B_HUMAN|.	V|W	259|60	ENSP00000321195:A259V|.	ENSP00000321195:A259V|.	A|R	+|+	2|1	0|2	ATP11B|ATP11B	184048964|184048964	1.000000|1.000000	0.71417|0.71417	0.968000|0.968000	0.41197|0.41197	0.542000|0.542000	0.35054|0.35054	7.360000|7.360000	0.79487|0.79487	2.563000|2.563000	0.86464|0.86464	0.551000|0.551000	0.68910|0.68910	GCG|CGG	.		0.303	ATP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350598.1	NM_014616	
BIRC6	57448	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	32613893	32613893	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr2:32613893delA	ENST00000421745.2	+	4	855	c.721delA	c.(721-723)aaafs	p.K241fs		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	241					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TGAACTCAAGAAAATAAATCA	0.448																																					p.K241fs	Pancreas(94;175 1509 16028 18060 45422)	.											.	BIRC6	233	0			c.721delA						.						154.0	131.0	138.0					2																	32613893		2203	4300	6503	SO:0001589	frameshift_variant	57448	exon4			CTCAAGAAAATAA	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.721delA	2.37:g.32613893delA	ENSP00000393596:p.Lys241fs	171.0	0.0		173.0	30.0	NM_016252	Q9ULD1	Frame_Shift_Del	DEL	ENST00000421745.2	37	CCDS33175.2																																																																																			.		0.448	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
BMP5	653	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	55639030	55639030	+	Missense_Mutation	SNP	T	T	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr6:55639030T>C	ENST00000370830.3	-	4	1542	c.844A>G	c.(844-846)Aac>Gac	p.N282D	BMP5_ENST00000446683.2_Missense_Mutation_p.N282D	NM_021073.2	NP_066551.1	P22003	BMP5_HUMAN	bone morphogenetic protein 5	282					cartilage development (GO:0051216)|growth (GO:0040007)|male genitalia development (GO:0030539)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of steroid biosynthetic process (GO:0010894)|ossification (GO:0001503)|pattern specification process (GO:0007389)|positive regulation of dendrite development (GO:1900006)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)|type B pancreatic cell development (GO:0003323)	extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	45	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			GATTTTACGTTGATACTGCGT	0.428																																					p.N282D		.											.	BMP5	516	0			c.A844G						.						162.0	143.0	150.0					6																	55639030		2203	4300	6503	SO:0001583	missense	653	exon4			TTACGTTGATACT		CCDS4958.1	6p12.1	2014-01-30			ENSG00000112175	ENSG00000112175		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1072	protein-coding gene	gene with protein product		112265				1427904, 11580864	Standard	NM_021073		Approved		uc003pcq.3	P22003	OTTHUMG00000014903	ENST00000370830.3:c.844A>G	6.37:g.55639030T>C	ENSP00000359866:p.Asn282Asp	175.0	0.0		230.0	32.0	NM_021073	B4E0Y4|Q9H547|Q9NTM5	Missense_Mutation	SNP	ENST00000370830.3	37	CCDS4958.1	.	.	.	.	.	.	.	.	.	.	T	10.93	1.489979	0.26686	.	.	ENSG00000112175	ENST00000370830;ENST00000446683	T;T	0.63744	-0.06;-0.06	5.74	5.74	0.90152	Transforming growth factor-beta, N-terminal (1);	0.167852	0.64402	D	0.000006	T	0.45357	0.1338	N	0.26130	0.795	0.50171	D	0.999852	P;P	0.46621	0.866;0.881	P;P	0.48921	0.515;0.595	T	0.41305	-0.9516	10	0.22109	T	0.4	.	16.0486	0.80740	0.0:0.0:0.0:1.0	.	282;282	B4E0Y4;P22003	.;BMP5_HUMAN	D	282	ENSP00000359866:N282D;ENSP00000391818:N282D	ENSP00000359866:N282D	N	-	1	0	BMP5	55746989	1.000000	0.71417	0.998000	0.56505	0.145000	0.21501	7.694000	0.84235	2.183000	0.69458	0.533000	0.62120	AAC	.		0.428	BMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041000.1		
BTBD6	90135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105716119	105716119	+	Missense_Mutation	SNP	G	G	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr14:105716119G>A	ENST00000392554.3	+	4	865	c.568G>A	c.(568-570)Gtc>Atc	p.V190I	BRF1_ENST00000546474.1_Intron|BRF1_ENST00000440513.3_Intron|BTBD6_ENST00000463376.2_Missense_Mutation_p.V115I|BRF1_ENST00000551787.1_5'Flank|BTBD6_ENST00000327471.3_Missense_Mutation_p.V115I|BRF1_ENST00000379937.2_Intron|BRF1_ENST00000392557.4_5'Flank|BRF1_ENST00000379932.4_5'Flank|BTBD6_ENST00000536364.1_Missense_Mutation_p.V190I|BRF1_ENST00000446501.2_5'Flank|BRF1_ENST00000327359.3_Intron			Q96KE9	BTBD6_HUMAN	BTB (POZ) domain containing 6	190						cytoplasm (GO:0005737)				endometrium(1)|lung(3)	4		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.0163)|Epithelial(46;0.0391)	Epithelial(152;0.18)		GAACGCCTGCGTCCTGCTGTC	0.592																																					p.V190I		.											.	BTBD6	90	0			c.G568A						.						49.0	53.0	51.0					14																	105716119		2202	4300	6502	SO:0001583	missense	90135	exon5			GCCTGCGTCCTGC	AF353674	CCDS10002.1, CCDS10002.2	14q32.33	2013-01-08			ENSG00000184887	ENSG00000184887		"""BTB/POZ domain containing"""	19897	protein-coding gene	gene with protein product							Standard	NM_033271		Approved	BDPL	uc010tyq.2	Q96KE9	OTTHUMG00000029887	ENST00000392554.3:c.568G>A	14.37:g.105716119G>A	ENSP00000376337:p.Val190Ile	50.0	0.0		99.0	31.0	NM_033271	Q8IVQ7|Q9BR94	Missense_Mutation	SNP	ENST00000392554.3	37	CCDS10002.2	.	.	.	.	.	.	.	.	.	.	G	16.82	3.228519	0.58777	.	.	ENSG00000184887	ENST00000536364;ENST00000537513;ENST00000392554;ENST00000463376;ENST00000327471	T;T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.69;-0.69	4.63	4.63	0.57726	BTB/Kelch-associated (1);	0.000000	0.85682	D	0.000000	T	0.70133	0.3189	L	0.52905	1.665	0.80722	D	1	B	0.31519	0.327	B	0.31245	0.126	T	0.71189	-0.4666	10	0.44086	T	0.13	-44.1425	14.9721	0.71243	0.0:0.0:1.0:0.0	.	190	Q96KE9	BTBD6_HUMAN	I	190;190;190;115;115	ENSP00000443091:V190I;ENSP00000446223:V190I;ENSP00000376337:V190I;ENSP00000418150:V115I;ENSP00000329361:V115I	ENSP00000329361:V115I	V	+	1	0	BTBD6	104787164	1.000000	0.71417	0.985000	0.45067	0.710000	0.40934	6.556000	0.73932	2.102000	0.63906	0.462000	0.41574	GTC	.		0.592	BTBD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000074556.4		
C11orf74	119710	hgsc.bcm.edu;bcgsc.ca	37	11	36631742	36631742	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr11:36631742A>G	ENST00000334307.5	+	2	204	c.89A>G	c.(88-90)cAa>cGa	p.Q30R	C11orf74_ENST00000534635.1_Missense_Mutation_p.Q30R|C11orf74_ENST00000446510.2_Missense_Mutation_p.Q30R|C11orf74_ENST00000347206.4_Missense_Mutation_p.Q30R	NM_138787.2	NP_620142.2	Q86VG3	CK074_HUMAN	chromosome 11 open reading frame 74	30										breast(1)|kidney(1)|large_intestine(1)|lung(5)	8	all_lung(20;0.226)	all_hematologic(20;0.0118)				TGTCATGAGCAAACATATGAT	0.313																																					p.G30G		.											.	C11orf74	68	0			c.G89G						.						83.0	83.0	83.0					11																	36631742		2202	4298	6500	SO:0001583	missense	119710	exon2			ATGAGCAAACATA	AK095997, BC009561	CCDS7904.1, CCDS60762.1	11p12	2012-08-10			ENSG00000166352	ENSG00000166352			25142	protein-coding gene	gene with protein product						12477932	Standard	NM_001276722		Approved	FLJ38678, HEPIS	uc031pzr.1	Q86VG3	OTTHUMG00000166397	ENST00000334307.5:c.89A>G	11.37:g.36631742A>G	ENSP00000334848:p.Gln30Arg	57.0	0.0		81.0	4.0	NM_138787	D3DR18|Q96DD6	Silent	SNP	ENST00000334307.5	37	CCDS7904.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.268274	0.80469	.	.	ENSG00000166352	ENST00000334307;ENST00000531554;ENST00000347206;ENST00000534635;ENST00000446510;ENST00000530697;ENST00000527108;ENST00000532470	.	.	.	6.17	6.17	0.99709	.	0.208574	0.34932	N	0.003563	T	0.79540	0.4463	M	0.78801	2.425	0.45580	D	0.998528	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.81922	-0.0711	9	0.87932	D	0	-21.2486	14.5632	0.68156	1.0:0.0:0.0:0.0	.	30;30	Q86VG3;Q86VG3-2	CK074_HUMAN;.	R	30	.	ENSP00000334848:Q30R	Q	+	2	0	C11orf74	36588318	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	2.766000	0.47629	2.371000	0.80710	0.533000	0.62120	CAA	.		0.313	C11orf74-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389567.1	NM_138787	
C2orf44	80304	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	24261849	24261849	+	Silent	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr2:24261849C>T	ENST00000295148.4	-	2	573	c.516G>A	c.(514-516)gtG>gtA	p.V172V	C2orf44_ENST00000406895.3_Silent_p.V172V	NM_025203.2	NP_079479.1	Q9H6R7	CB044_HUMAN	chromosome 2 open reading frame 44	172									C2orf44/ALK(2)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTACTGCCACCACCAGCCTCA	0.547			T	ALK	NSCLC																																p.V172V		.		Dom	yes		2	2p23.3	80304	chromosome 2 open reading frame 44		E	.	C2orf44	154	0			c.G516A						.						53.0	47.0	49.0					2																	24261849		2203	4300	6503	SO:0001819	synonymous_variant	80304	exon2			TGCCACCACCAGC	AK025598	CCDS1705.1, CCDS46229.1	2p23.3	2012-07-30			ENSG00000163026	ENSG00000163026			26157	protein-coding gene	gene with protein product						22327622	Standard	NM_025203		Approved	FLJ21945	uc002rep.2	Q9H6R7	OTTHUMG00000125498	ENST00000295148.4:c.516G>A	2.37:g.24261849C>T		77.0	0.0		83.0	21.0	NM_025203	D6W532|Q8IYK0|Q9HBP5	Silent	SNP	ENST00000295148.4	37	CCDS1705.1																																																																																			.		0.547	C2orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246825.1	NM_025203	
CACNA1B	774	ucsc.edu;mdanderson.org	37	9	140991051	140991051	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr9:140991051A>G	ENST00000371372.1	+	37	5355	c.5210A>G	c.(5209-5211)gAc>gGc	p.D1737G	CACNA1B_ENST00000277551.2_Missense_Mutation_p.D1737G|CACNA1B_ENST00000371365.2_Missense_Mutation_p.D101G|CACNA1B_ENST00000371363.1_Missense_Mutation_p.D1735G|CACNA1B_ENST00000371355.4_Missense_Mutation_p.D1738G|CACNA1B_ENST00000371357.1_Missense_Mutation_p.D1736G|CACNA1B_ENST00000277549.5_Missense_Mutation_p.D931G	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1737	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GCTGAATACGACCCGGCTGCG	0.562																																					p.D1737G		.											.	CACNA1B	138	0			c.A5210G						.						90.0	89.0	89.0					9																	140991051		2092	4230	6322	SO:0001583	missense	774	exon36			AATACGACCCGGC	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.5210A>G	9.37:g.140991051A>G	ENSP00000360423:p.Asp1737Gly	69.0	2.0		83.0	8.0	NM_001243812	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	37	CCDS59522.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.957850	0.73902	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355;ENST00000371365	D;D;D;D;D;D;D	0.99319	-5.6;-5.66;-5.74;-5.61;-5.59;-5.59;-5.18	4.44	4.44	0.53790	.	0.000000	0.85682	D	0.000000	D	0.99456	0.9807	M	0.89534	3.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98442	1.0587	10	0.87932	D	0	.	14.0193	0.64543	1.0:0.0:0.0:0.0	.	1736;1735	B1AQK7;B1AQK6	.;.	G	1737;1737;931;1735;1736;1738;101	ENSP00000360423:D1737G;ENSP00000277551:D1737G;ENSP00000277549:D931G;ENSP00000360414:D1735G;ENSP00000360408:D1736G;ENSP00000360406:D1738G;ENSP00000360416:D101G	ENSP00000277549:D931G	D	+	2	0	CACNA1B	140110872	1.000000	0.71417	1.000000	0.80357	0.702000	0.40608	9.191000	0.94940	1.782000	0.52362	0.455000	0.32223	GAC	.		0.562	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
CACNB1	782	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	37341067	37341067	+	Silent	SNP	G	G	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr17:37341067G>T	ENST00000394303.3	-	8	906	c.699C>A	c.(697-699)atC>atA	p.I233I	CACNB1_ENST00000394310.3_Silent_p.I233I|CACNB1_ENST00000582877.1_5'Flank|CACNB1_ENST00000344140.5_Silent_p.I278I	NM_000723.4	NP_000714.3	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1 subunit	233					axon guidance (GO:0007411)|protein targeting to membrane (GO:0006612)|transport (GO:0006810)	sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	16					Dronedarone(DB04855)|Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GTCCCACCAGGATGATGGGCC	0.592																																					p.I278I	Esophageal Squamous(5;100 366 38393 41452 45827)	.											.	CACNB1	154	0			c.C834A						.						57.0	50.0	52.0					17																	37341067		2203	4300	6503	SO:0001819	synonymous_variant	782	exon8			CACCAGGATGATG		CCDS11334.1, CCDS42311.1, CCDS45665.1	17q21-q22	2013-03-20			ENSG00000067191	ENSG00000067191		"""Calcium channel subunits"""	1401	protein-coding gene	gene with protein product		114207		CACNLB1		8381767, 8395940	Standard	NM_000723		Approved		uc002hrm.2	Q02641	OTTHUMG00000133217	ENST00000394303.3:c.699C>A	17.37:g.37341067G>T		89.0	0.0		131.0	23.0	NM_199247	A8K114|O15331|Q02639|Q02640|Q8N3X9|Q9C085|Q9UD79	Silent	SNP	ENST00000394303.3	37	CCDS42311.1																																																																																			.		0.592	CACNB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256945.3		
CASR	846	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	121980604	121980604	+	Missense_Mutation	SNP	A	A	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr3:121980604A>T	ENST00000490131.1	+	4	1094	c.722A>T	c.(721-723)gAa>gTa	p.E241V	CASR_ENST00000498619.1_Missense_Mutation_p.E241V|CASR_ENST00000296154.5_Missense_Mutation_p.E241V	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	241					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	GACTTCAGTGAACTCATCTCC	0.512																																					p.E241V		.											.	CASR	97	0			c.A722T						.						165.0	177.0	173.0					3																	121980604		2203	4300	6503	SO:0001583	missense	846	exon4			TCAGTGAACTCAT	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.722A>T	3.37:g.121980604A>T	ENSP00000418685:p.Glu241Val	182.0	0.0		221.0	20.0	NM_001178065	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	37	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	A	11.11	1.542488	0.27563	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.87729	-2.29;-2.29;-2.29	6.17	6.17	0.99709	Extracellular ligand-binding receptor (1);	0.045100	0.85682	D	0.000000	D	0.83580	0.5285	L	0.42008	1.315	0.53005	D	0.99996	B;B	0.32409	0.37;0.248	B;B	0.30316	0.114;0.047	D	0.83400	0.0022	10	0.72032	D	0.01	.	16.0034	0.80327	1.0:0.0:0.0:0.0	.	241;241	E7ENE0;P41180	.;CASR_HUMAN	V	241	ENSP00000418685:E241V;ENSP00000420194:E241V;ENSP00000296154:E241V	ENSP00000296154:E241V	E	+	2	0	CASR	123463294	1.000000	0.71417	0.921000	0.36526	0.354000	0.29330	7.211000	0.77933	2.371000	0.80710	0.533000	0.62120	GAA	.		0.512	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388	
CELSR1	9620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	46794440	46794440	+	Missense_Mutation	SNP	C	C	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr22:46794440C>A	ENST00000262738.3	-	11	5506	c.5507G>T	c.(5506-5508)gGa>gTa	p.G1836V		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1836	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GCCTCGGAATCCACGGCGCAC	0.672																																					p.G1836V		.											.	CELSR1	525	0			c.G5507T						.						52.0	45.0	47.0					22																	46794440		2203	4300	6503	SO:0001583	missense	9620	exon11			CGGAATCCACGGC	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.5507G>T	22.37:g.46794440C>A	ENSP00000262738:p.Gly1836Val	97.0	0.0		71.0	22.0	NM_014246	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	C	16.22	3.062264	0.55432	.	.	ENSG00000075275	ENST00000262738	T	0.72505	-0.66	4.93	4.93	0.64822	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.64402	U	0.000002	D	0.85847	0.5792	M	0.85945	2.785	0.80722	D	1	D;P	0.89917	1.0;0.771	D;P	0.97110	1.0;0.475	D	0.87832	0.2645	10	0.56958	D	0.05	.	17.7518	0.88436	0.0:1.0:0.0:0.0	.	157;1836	B7Z7U7;Q9NYQ6	.;CELR1_HUMAN	V	1836	ENSP00000262738:G1836V	ENSP00000262738:G1836V	G	-	2	0	CELSR1	45173104	1.000000	0.71417	0.077000	0.20336	0.185000	0.23345	6.762000	0.74950	2.284000	0.76573	0.591000	0.81541	GGA	.		0.672	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
CLEC18B	497190	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	74452060	74452060	+	Missense_Mutation	SNP	G	G	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr16:74452060G>C	ENST00000339953.5	-	3	474	c.353C>G	c.(352-354)gCg>gGg	p.A118G		NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B	118	SCP.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						AACAAAGGACGCCAAGCCCGC	0.662																																					p.A118G		.											.	CLEC18B	90	0			c.C353G						.						55.0	61.0	59.0					16																	74452060		2108	4214	6322	SO:0001583	missense	497190	exon3			AAGGACGCCAAGC	AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839		"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product							Standard	NM_001011880		Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.353C>G	16.37:g.74452060G>C	ENSP00000341051:p.Ala118Gly	403.0	2.0		300.0	79.0	NM_001011880	B4DF90	Missense_Mutation	SNP	ENST00000339953.5	37	CCDS32484.1	.	.	.	.	.	.	.	.	.	.	g	1.275	-0.611840	0.03690	.	.	ENSG00000140839	ENST00000429489;ENST00000339953;ENST00000268492	T	0.07688	3.17	3.57	1.57	0.23409	CAP domain (3);	0.620711	0.16876	N	0.195903	T	0.07999	0.0200	L	0.43152	1.355	0.09310	N	1	B;B	0.28760	0.055;0.221	B;B	0.35607	0.059;0.206	T	0.36696	-0.9737	10	0.27082	T	0.32	.	5.4958	0.16802	0.2666:0.0:0.7334:0.0	.	118;118	C9JSV1;Q6UXF7	.;CL18B_HUMAN	G	118	ENSP00000341051:A118G	ENSP00000268492:A118G	A	-	2	0	CLEC18B	73009561	0.005000	0.15991	0.001000	0.08648	0.039000	0.13416	1.038000	0.30254	0.215000	0.20761	-0.321000	0.08615	GCG	.		0.662	CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434697.1	NM_001011880	
CNTLN	54875	broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	17409335	17409335	+	Missense_Mutation	SNP	T	T	C	rs369583267		TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr9:17409335T>C	ENST00000380647.3	+	16	2744	c.2660T>C	c.(2659-2661)aTt>aCt	p.I887T	CNTLN_ENST00000262360.5_Missense_Mutation_p.I887T|CNTLN_ENST00000425824.1_Missense_Mutation_p.I887T			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	887					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		GGAACAATTATTGTAGAAACA	0.353																																					p.I887T		.											.	CNTLN	91	0			c.T2660C						.	T	THR/ILE	2,3614		0,2,1806	101.0	98.0	99.0		2660	3.6	1.0	9		99	0,8150		0,0,4075	no	missense	CNTLN	NM_017738.2	89	0,2,5881	CC,CT,TT		0.0,0.0553,0.017	benign	887/1407	17409335	2,11764	1808	4075	5883	SO:0001583	missense	54875	exon16			CAATTATTGTAGA	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.2660T>C	9.37:g.17409335T>C	ENSP00000370021:p.Ile887Thr	234.0	1.0		295.0	20.0	NM_017738	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	ENST00000380647.3	37	CCDS43789.1	.	.	.	.	.	.	.	.	.	.	T	14.33	2.502309	0.44455	5.53E-4	0.0	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	T;T;T	0.21191	2.02;2.02;2.29	5.94	3.58	0.41010	.	.	.	.	.	T	0.18718	0.0449	L	0.56769	1.78	0.29964	N	0.819101	B;B;B	0.10296	0.002;0.003;0.0	B;B;B	0.11329	0.006;0.006;0.004	T	0.23547	-1.0185	9	0.15066	T	0.55	.	7.0824	0.25239	0.0:0.1739:0.0:0.8261	.	887;887;887	Q9NXG0;C9J1F9;Q9NXG0-2	CNTLN_HUMAN;.;.	T	887	ENSP00000370021:I887T;ENSP00000392798:I887T;ENSP00000262360:I887T	ENSP00000262360:I887T	I	+	2	0	CNTLN	17399335	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	1.583000	0.36579	1.031000	0.39867	0.482000	0.46254	ATT	.		0.353	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
COL4A4	1286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	228012135	228012135	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr2:228012135C>T	ENST00000396625.3	-	2	272	c.65G>A	c.(64-66)gGt>gAt	p.G22D	COL4A4_ENST00000329662.7_Missense_Mutation_p.G22D	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	22					axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		TCACCAGGGACCTGTGGCCAA	0.413																																					p.G22D		.											.	COL4A4	142	0			c.G65A						.						246.0	258.0	254.0					2																	228012135		1919	4135	6054	SO:0001583	missense	1286	exon2			CAGGGACCTGTGG		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.65G>A	2.37:g.228012135C>T	ENSP00000379866:p.Gly22Asp	62.0	0.0		56.0	8.0	NM_000092	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	ENST00000396625.3	37	CCDS42828.1	.	.	.	.	.	.	.	.	.	.	c	0.261	-0.999385	0.02128	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.90004	-2.6;-2.55	4.59	-6.5	0.01884	.	.	.	.	.	T	0.69931	0.3166	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.60219	-0.7306	9	0.11182	T	0.66	.	2.3552	0.04293	0.1402:0.3799:0.1208:0.3591	.	22	P53420	CO4A4_HUMAN	D	22	ENSP00000379866:G22D;ENSP00000328553:G22D	ENSP00000328553:G22D	G	-	2	0	COL4A4	227720379	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-0.870000	0.04228	-1.041000	0.03266	-1.945000	0.00491	GGT	.		0.413	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
COPS5	10987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	67974167	67974167	+	Missense_Mutation	SNP	G	G	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr8:67974167G>A	ENST00000357849.4	-	1	385	c.65C>T	c.(64-66)gCt>gTt	p.A22V	AC109335.1_ENST00000578628.1_RNA|COPS5_ENST00000517736.1_Intron|CSPP1_ENST00000412460.1_5'Flank|CSPP1_ENST00000262210.5_5'Flank|COPS5_ENST00000519963.1_5'UTR	NM_006837.2	NP_006828.2	Q92905	CSN5_HUMAN	COP9 signalosome subunit 5	22					cullin deneddylation (GO:0010388)|exosomal secretion (GO:1990182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein deneddylation (GO:0000338)|protein deubiquitination (GO:0016579)|regulation of cell cycle (GO:0051726)|regulation of JNK cascade (GO:0046328)|transcription from RNA polymerase II promoter (GO:0006366)|translation (GO:0006412)|translational initiation (GO:0006413)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|eukaryotic translation initiation factor 3 complex (GO:0005852)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|transcription coactivator activity (GO:0003713)|translation initiation factor activity (GO:0003743)|ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|skin(3)	14	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00389)|OV - Ovarian serous cystadenocarcinoma(28;0.00691)|all cancers(69;0.0205)|BRCA - Breast invasive adenocarcinoma(89;0.153)			GATACTCTGAGCTTCCTGCAT	0.557																																					p.A22V		.											.	COPS5	660	0			c.C65T						.						149.0	135.0	139.0					8																	67974167		2203	4300	6503	SO:0001583	missense	10987	exon1			CTCTGAGCTTCCT	U65928	CCDS6198.1	8q13.1	2013-03-14	2013-03-14		ENSG00000121022	ENSG00000121022			2240	protein-coding gene	gene with protein product		604850	"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 5"", ""COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)"""			8837781, 9341143	Standard	NM_006837		Approved	JAB1, SGN5, MOV-34, CSN5	uc003xxe.3	Q92905	OTTHUMG00000164563	ENST00000357849.4:c.65C>T	8.37:g.67974167G>A	ENSP00000350512:p.Ala22Val	71.0	0.0		92.0	7.0	NM_006837	O15386|Q6AW95|Q86WQ4|Q9BQ17	Missense_Mutation	SNP	ENST00000357849.4	37	CCDS6198.1	.	.	.	.	.	.	.	.	.	.	G	11.17	1.559240	0.27827	.	.	ENSG00000121022	ENST00000357849	.	.	.	5.68	5.68	0.88126	.	0.102356	0.64402	D	0.000001	T	0.13586	0.0329	N	0.00358	-1.6	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38520	-0.9657	9	0.02654	T	1	-11.8083	12.4651	0.55753	0.0764:0.0:0.9236:0.0	.	22	Q92905	CSN5_HUMAN	V	22	.	ENSP00000350512:A22V	A	-	2	0	COPS5	68136721	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.806000	0.75195	2.838000	0.97847	0.655000	0.94253	GCT	.		0.557	COPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379245.2		
CPNE4	131034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	131624109	131624109	+	Splice_Site	SNP	T	T	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr3:131624109T>A	ENST00000512055.1	-	6	2305	c.179A>T	c.(178-180)gAg>gTg	p.E60V	CPNE4_ENST00000511604.1_Splice_Site_p.E60V|CPNE4_ENST00000502818.1_Splice_Site_p.E78V|CPNE4_ENST00000512332.1_Splice_Site_p.E78V|CPNE4_ENST00000429747.1_Splice_Site_p.E60V			Q96A23	CPNE4_HUMAN	copine IV	60	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						CATGCCTACCTCAAACCACTG	0.443																																					p.E60V		.											.	CPNE4	92	0			c.A179T						.						135.0	125.0	129.0					3																	131624109		2203	4300	6503	SO:0001630	splice_region_variant	131034	exon2			CCTACCTCAAACC	H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.180+1A>T	3.37:g.131624109T>A		126.0	0.0		133.0	27.0	NM_130808	D3DNC5|Q8TEX1	Missense_Mutation	SNP	ENST00000512055.1	37	CCDS3072.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.195935	0.78902	.	.	ENSG00000196353	ENST00000512055;ENST00000429747;ENST00000512332;ENST00000511604;ENST00000502818;ENST00000505881;ENST00000514999;ENST00000505957	T;T;T;T;T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43;-0.43;-0.43;-0.43;1.06	5.56	5.56	0.83823	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.048095	0.85682	D	0.000000	D	0.83912	0.5357	M	0.89785	3.06	0.80722	D	1	D;D	0.61697	0.99;0.99	P;D	0.64321	0.854;0.924	D	0.87615	0.2506	10	0.87932	D	0	-14.8361	15.7219	0.77718	0.0:0.0:0.0:1.0	.	78;60	Q96A23-2;Q96A23	.;CPNE4_HUMAN	V	60;60;78;60;78;60;60;60	ENSP00000421705:E60V;ENSP00000411904:E60V;ENSP00000424853:E78V;ENSP00000423811:E60V;ENSP00000421646:E78V;ENSP00000425506:E60V;ENSP00000427561:E60V;ENSP00000421394:E60V	ENSP00000411904:E60V	E	-	2	0	CPNE4	133106799	1.000000	0.71417	1.000000	0.80357	0.553000	0.35397	7.698000	0.84413	2.112000	0.64535	0.533000	0.62120	GAG	.		0.443	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356583.4	NM_130808	Missense_Mutation
CRISPLD1	83690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	75927121	75927121	+	Missense_Mutation	SNP	G	G	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr8:75927121G>A	ENST00000262207.4	+	6	1169	c.701G>A	c.(700-702)gGc>gAc	p.G234D	CRISPLD1_ENST00000523524.1_Missense_Mutation_p.G46D|CRISPLD1_ENST00000517786.1_Missense_Mutation_p.G48D	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	234					face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			TTTGGAGGGGGCTGTAGAGAA	0.428																																					p.G234D		.											.	CRISPLD1	91	0			c.G701A						.						57.0	52.0	53.0					8																	75927121		2203	4300	6503	SO:0001583	missense	83690	exon6			GAGGGGGCTGTAG	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.701G>A	8.37:g.75927121G>A	ENSP00000262207:p.Gly234Asp	141.0	0.0		143.0	31.0	NM_031461	B2RA60|B7Z929	Missense_Mutation	SNP	ENST00000262207.4	37	CCDS6219.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.381005	0.82792	.	.	ENSG00000121005	ENST00000262207;ENST00000523524;ENST00000517786	T;T;D	0.82711	0.27;-1.23;-1.64	4.69	4.69	0.59074	.	0.112857	0.64402	D	0.000010	D	0.82346	0.5017	M	0.67397	2.05	0.53005	D	0.999963	P;P	0.52577	0.954;0.514	B;B	0.41412	0.356;0.159	D	0.84987	0.0892	10	0.49607	T	0.09	.	17.8197	0.88647	0.0:0.0:1.0:0.0	.	48;234	B7Z929;Q9H336	.;CRLD1_HUMAN	D	234;46;48	ENSP00000262207:G234D;ENSP00000430105:G46D;ENSP00000429746:G48D	ENSP00000262207:G234D	G	+	2	0	CRISPLD1	76089676	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.604000	0.82830	2.429000	0.82318	0.460000	0.39030	GGC	.		0.428	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461	
CPSF1	29894	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	8	145634528	145634528	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr8:145634528G>T	ENST00000349769.3	-	2	109	c.15C>A	c.(13-15)taC>taA	p.Y5*	GS1-393G12.14_ENST00000607491.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	5					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GCGCCTGTTTGTACACGGCGT	0.677																																					p.Y5X	NSCLC(133;1088 1848 27708 34777 35269)	.											.	CPSF1	91	0			c.C15A						.						91.0	84.0	86.0					8																	145634528		2203	4300	6503	SO:0001587	stop_gained	29894	exon2			CTGTTTGTACACG	U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.15C>A	8.37:g.145634528G>T	ENSP00000339353:p.Tyr5*	42.0	0.0		30.0	8.0	NM_013291	Q96AF0	Nonsense_Mutation	SNP	ENST00000349769.3	37	CCDS34966.1	.	.	.	.	.	.	.	.	.	.	G	38	6.704147	0.97776	.	.	ENSG00000071894	ENST00000349769;ENST00000531042	.	.	.	5.14	3.3	0.37823	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.0503	8.4787	0.33030	0.0846:0.0:0.7636:0.1518	.	.	.	.	X	5	.	ENSP00000339353:Y5X	Y	-	3	2	CPSF1	145605336	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.793000	0.69060	1.162000	0.42619	0.556000	0.70494	TAC	.		0.677	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382422.2	NM_013291	
CSN3	1448	broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	71115098	71115098	+	Silent	SNP	T	T	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr4:71115098T>C	ENST00000304954.3	+	4	557	c.471T>C	c.(469-471)acT>acC	p.T157T		NM_005212.2	NP_005203.2	Q9UNS2	CSN3_HUMAN	casein kappa	0					cullin deneddylation (GO:0010388)|in utero embryonic development (GO:0001701)|response to light stimulus (GO:0009416)|signal transduction (GO:0007165)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18						GTGTAGTCACTCCAGAAGCTT	0.448																																					p.T157T		.											.	CSN3	93	0			c.T471C						.						70.0	69.0	69.0					4																	71115098		2203	4300	6503	SO:0001819	synonymous_variant	1448	exon4			AGTCACTCCAGAA	U51899	CCDS3538.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000171209	ENSG00000171209			2446	protein-coding gene	gene with protein product		601695	"""casein, kappa"""	CSN10		8863730, 9050925	Standard	NM_005212		Approved		uc003hfe.4	P07498	OTTHUMG00000129399	ENST00000304954.3:c.471T>C	4.37:g.71115098T>C		77.0	1.0		115.0	12.0	NM_005212	B2R683|B4DY81|O43191|Q7LDR6	Silent	SNP	ENST00000304954.3	37	CCDS3538.1																																																																																			.		0.448	CSN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251555.1	NM_005212	
CUL1	8454	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	148456419	148456422	+	Frame_Shift_Del	DEL	CTGT	CTGT	-			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	CTGT	CTGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr7:148456419_148456422delCTGT	ENST00000325222.4	+	5	786_789	c.507_510delCTGT	c.(505-510)gactgtfs	p.DC169fs	CUL1_ENST00000602748.1_Frame_Shift_Del_p.DC169fs|CUL1_ENST00000409469.1_Frame_Shift_Del_p.DC169fs	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	169					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			CTTGGAGAGACTGTCTGTTCAGGC	0.397																																					p.169_170del		.											.	CUL1	226	0			c.507_510del						.																																			SO:0001589	frameshift_variant	8454	exon5			GAGAGACTGTCTG	U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.507_510delCTGT	7.37:g.148456423_148456426delCTGT	ENSP00000326804:p.Asp169fs	125.0	0.0		184.0	29.0	NM_003592	D3DWG3|O60719|Q08AL6|Q8IYW1	Frame_Shift_Del	DEL	ENST00000325222.4	37	CCDS34772.1																																																																																			.		0.397	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467785.1	NM_003592	
DDX56	54606	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	44612257	44612257	+	Missense_Mutation	SNP	C	C	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr7:44612257C>A	ENST00000258772.5	-	4	576	c.470G>T	c.(469-471)cGt>cTt	p.R157L	DDX56_ENST00000485367.1_5'UTR|DDX56_ENST00000431640.1_Missense_Mutation_p.R157L	NM_001257189.1|NM_019082.3	NP_001244118.1|NP_061955.1	Q9NY93	DDX56_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 56	157	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)	16						CAGGGAGTCACGAAGTTTCAG	0.517																																					p.R157L		.											.	DDX56	227	0			c.G470T						.						143.0	139.0	140.0					7																	44612257		2203	4300	6503	SO:0001583	missense	54606	exon4			GAGTCACGAAGTT	AJ131712	CCDS5492.1, CCDS59053.1	7p13	2012-02-23	2012-02-23		ENSG00000136271	ENSG00000136271		"""DEAD-boxes"""	18193	protein-coding gene	gene with protein product	"""nucleolar helicase of 61 kDa"""	608023	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 56"""			10749921	Standard	NM_019082		Approved	NOH61	uc003tlg.4	Q9NY93	OTTHUMG00000129211	ENST00000258772.5:c.470G>T	7.37:g.44612257C>A	ENSP00000258772:p.Arg157Leu	133.0	0.0		209.0	51.0	NM_001257189	A4D2K9|C9JV95|Q6IAE2|Q9H9I8	Missense_Mutation	SNP	ENST00000258772.5	37	CCDS5492.1	.	.	.	.	.	.	.	.	.	.	.	11.51	1.660906	0.29515	.	.	ENSG00000136271	ENST00000258772;ENST00000431640	T;T	0.32753	1.44;1.44	5.48	1.7	0.24286	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.245391	0.41097	D	0.000958	T	0.19604	0.0471	L	0.28400	0.85	0.35968	D	0.835132	B;B	0.13145	0.006;0.007	B;B	0.17979	0.02;0.01	T	0.15838	-1.0423	10	0.22109	T	0.4	-2.929	9.567	0.39405	0.0:0.7103:0.0:0.2897	.	157;157	C9JV95;Q9NY93	.;DDX56_HUMAN	L	157	ENSP00000258772:R157L;ENSP00000393488:R157L	ENSP00000258772:R157L	R	-	2	0	DDX56	44578782	0.196000	0.23350	0.038000	0.18304	0.964000	0.63967	0.585000	0.23879	0.105000	0.17753	-0.140000	0.14226	CGT	.		0.517	DDX56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251291.1	NM_019082	
DEFB113	245927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	49936572	49936572	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr6:49936572T>A	ENST00000398718.1	-	2	66	c.67A>T	c.(67-69)Aaa>Taa	p.K23*		NM_001037729.1	NP_001032818.1	Q30KQ7	DB113_HUMAN	defensin, beta 113	23					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	7	Lung NSC(77;0.042)					CTTGTTTTTTTCTGTGGAACT	0.353																																					p.K23X		.											.	DEFB113	90	0			c.A67T						.						83.0	80.0	81.0					6																	49936572		1845	4089	5934	SO:0001587	stop_gained	245927	exon2			TTTTTTTCTGTGG	DQ012017	CCDS43472.1	6p12.3	2010-03-30			ENSG00000214642	ENSG00000214642		"""Defensins, beta"""	18094	protein-coding gene	gene with protein product						11854508, 16033865	Standard	NM_001037729		Approved	DEFB-13	uc011dwq.2	Q30KQ7	OTTHUMG00000160210	ENST00000398718.1:c.67A>T	6.37:g.49936572T>A	ENSP00000381703:p.Lys23*	99.0	0.0		97.0	21.0	NM_001037729		Nonsense_Mutation	SNP	ENST00000398718.1	37	CCDS43472.1	.	.	.	.	.	.	.	.	.	.	T	7.878	0.729576	0.15507	.	.	ENSG00000214642	ENST00000398718	.	.	.	4.15	-1.11	0.09840	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.3815	3.9562	0.09391	0.0:0.2118:0.3772:0.411	.	.	.	.	X	23	.	.	K	-	1	0	DEFB113	50044531	0.942000	0.31987	0.098000	0.21074	0.081000	0.17604	0.491000	0.22419	-0.040000	0.13580	-0.472000	0.04984	AAA	.		0.353	DEFB113-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359666.1		
DEFB128	245939	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	168643	168643	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr20:168643C>T	ENST00000334391.4	-	2	223	c.166G>A	c.(166-168)Gat>Aat	p.D56N		NM_001037732.1	NP_001032821.1	Q7Z7B8	DB128_HUMAN	defensin, beta 128	56					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5		all_cancers(10;0.00499)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.122)			TCTTCTTCATCATTAGCACAA	0.378																																					p.D56N		.											.	DEFB128	135	0			c.G166A						.						356.0	326.0	336.0					20																	168643		2203	4300	6503	SO:0001583	missense	245939	exon2			CTTCATCATTAGC	AF525930	CCDS33430.1	20p13	2011-03-29			ENSG00000185982	ENSG00000185982		"""Defensins, beta"""	18106	protein-coding gene	gene with protein product	"""defensin, beta 28"""					11854508, 16033865	Standard	NM_001037732		Approved	DEFB-28	uc002wcz.1	Q7Z7B8	OTTHUMG00000043057	ENST00000334391.4:c.166G>A	20.37:g.168643C>T	ENSP00000335382:p.Asp56Asn	321.0	2.0		459.0	108.0	NM_001037732	B2RU29	Missense_Mutation	SNP	ENST00000334391.4	37	CCDS33430.1	.	.	.	.	.	.	.	.	.	.	c	9.038	0.989043	0.18966	.	.	ENSG00000185982	ENST00000334391	T	0.18016	2.24	4.39	1.4	0.22301	.	0.751776	0.11840	N	0.524398	T	0.09730	0.0239	.	.	.	0.09310	N	1	B	0.25904	0.137	B	0.20767	0.031	T	0.30297	-0.9983	9	0.39692	T	0.17	-11.5227	3.0962	0.06311	0.1837:0.5429:0.1773:0.096	.	56	Q7Z7B8	DB128_HUMAN	N	56	ENSP00000335382:D56N	ENSP00000335382:D56N	D	-	1	0	DEFB128	116643	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.054000	0.11826	0.367000	0.24454	-0.139000	0.14373	GAT	.		0.378	DEFB128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000101361.2	NM_001037732	
DICER1	23405	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	95556981	95556981	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr14:95556981C>T	ENST00000526495.1	-	29	5914	c.5623G>A	c.(5623-5625)Gac>Aac	p.D1875N	DICER1_ENST00000541352.1_Silent_p.T1820T|DICER1_ENST00000343455.3_Missense_Mutation_p.D1875N|DICER1_ENST00000556045.1_Missense_Mutation_p.D773N|DICER1_ENST00000393063.1_Missense_Mutation_p.D1875N|DICER1_ENST00000527414.1_Missense_Mutation_p.D1875N|DICER1_ENST00000527416.2_5'UTR			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	1875	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		ACCTTCCCGTCGTAAGTTCTC	0.423			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																												p.D1875N		.	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	.	DICER1	961	0			c.G5623A						.						165.0	168.0	167.0					14																	95556981		2203	4300	6503	SO:0001583	missense	23405	exon28	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	TCCCGTCGTAAGT	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.5623G>A	14.37:g.95556981C>T	ENSP00000437256:p.Asp1875Asn	211.0	0.0		326.0	118.0	NM_030621	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	ENST00000526495.1	37	CCDS9931.1	.	.	.	.	.	.	.	.	.	.	C	33	5.227452	0.95173	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000556045	T;T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07;-0.07	6.07	6.07	0.98685	Double-stranded RNA-binding (2);	0.095905	0.64402	D	0.000001	T	0.52725	0.1752	.	.	.	0.80722	D	1	B;P	0.48589	0.431;0.912	B;B	0.34138	0.104;0.176	T	0.54403	-0.8299	9	0.34782	T	0.22	-26.5162	20.6593	0.99626	0.0:1.0:0.0:0.0	.	773;1875	B3KRG4;Q9UPY3	.;DICER_HUMAN	N	1875;1875;1875;1875;773	ENSP00000343745:D1875N;ENSP00000437256:D1875N;ENSP00000376783:D1875N;ENSP00000435681:D1875N;ENSP00000451041:D773N	ENSP00000343745:D1875N	D	-	1	0	DICER1	94626734	1.000000	0.71417	0.571000	0.28486	0.931000	0.56810	7.324000	0.79115	2.885000	0.99019	0.655000	0.94253	GAC	.		0.423	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1		
DNAH14	127602	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	225525167	225525167	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr1:225525167C>T	ENST00000445597.2	+	45	7685	c.7685C>T	c.(7684-7686)gCt>gTt	p.A2562V	DNAH14_ENST00000439375.2_Missense_Mutation_p.A3334V|DNAH14_ENST00000430092.1_Missense_Mutation_p.A3334V			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	2562					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						ATTGAAAATGCTATGAAGACA	0.458																																					p.A3334V		.											.	DNAH14	23	0			c.C10001T						.						41.0	38.0	39.0					1																	225525167		692	1591	2283	SO:0001583	missense	127602	exon65			AAAATGCTATGAA	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.7685C>T	1.37:g.225525167C>T	ENSP00000409472:p.Ala2562Val	283.0	0.0		331.0	59.0	NM_001373	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	37		.	.	.	.	.	.	.	.	.	.	C	24.4	4.522249	0.85600	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	T;T;T	0.31510	1.49;1.49;1.49	5.09	5.09	0.68999	.	0.473555	0.15708	N	0.248553	T	0.70710	0.3255	H	0.96833	3.89	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.80625	-0.1299	10	0.87932	D	0	.	17.6019	0.88027	0.0:1.0:0.0:0.0	.	3334	Q0VDD8-4	.	V	2562;3334;3334	ENSP00000409472:A2562V;ENSP00000414402:A3334V;ENSP00000392061:A3334V	ENSP00000414402:A3334V	A	+	2	0	DNAH14	223591790	0.996000	0.38824	0.412000	0.26496	0.972000	0.66771	3.395000	0.52558	2.529000	0.85273	0.536000	0.68110	GCT	.		0.458	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
DNAH6	1768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	84932627	84932627	+	Missense_Mutation	SNP	C	C	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr2:84932627C>A	ENST00000237449.6	+	51	8491	c.8483C>A	c.(8482-8484)gCa>gAa	p.A2828E	DNAH6_ENST00000389394.3_Missense_Mutation_p.A2828E			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	2828	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TGGCCATCAGCAAAGCAACTT	0.328																																					p.A2828E		.											.	DNAH6	69	0			c.C8483A						.						61.0	50.0	53.0					2																	84932627		692	1591	2283	SO:0001583	missense	1768	exon52			CATCAGCAAAGCA	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.8483C>A	2.37:g.84932627C>A	ENSP00000237449:p.Ala2828Glu	65.0	0.0		105.0	19.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	37	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.580866	0.86748	.	.	ENSG00000115423	ENST00000389394;ENST00000237449	T;T	0.80480	-1.38;-1.38	5.49	5.49	0.81192	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.47455	D	0.000226	D	0.93986	0.8074	H	0.98048	4.135	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95827	0.8855	10	0.87932	D	0	.	18.5012	0.90882	0.0:1.0:0.0:0.0	.	2828	Q9C0G6	DYH6_HUMAN	E	2828	ENSP00000374045:A2828E;ENSP00000237449:A2828E	ENSP00000237449:A2828E	A	+	2	0	DNAH6	84786138	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	3.845000	0.55880	2.727000	0.93392	0.650000	0.86243	GCA	.		0.328	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
DOK5	55816	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	53226977	53226977	+	Missense_Mutation	SNP	A	A	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr20:53226977A>C	ENST00000262593.5	+	6	1000	c.650A>C	c.(649-651)gAg>gCg	p.E217A	DOK5_ENST00000395939.1_Missense_Mutation_p.E109A	NM_018431.3	NP_060901.2	Q9P104	DOK5_HUMAN	docking protein 5	217	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				MAPK cascade (GO:0000165)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)		receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|skin(1)	19			Colorectal(105;0.202)			CGAGACGGGGAGGCCATCTAT	0.483																																					p.E217A		.											.	DOK5	227	0			c.A650C						.						86.0	77.0	80.0					20																	53226977		2203	4300	6503	SO:0001583	missense	55816	exon6			ACGGGGAGGCCAT	AF132732	CCDS13446.1, CCDS13447.1	20q13.2	2013-01-10	2002-11-28	2002-11-29	ENSG00000101134	ENSG00000101134		"""Pleckstrin homology (PH) domain containing"""	16173	protein-coding gene	gene with protein product		608334	"""chromosome 20 open reading frame 180"""	C20orf180		11470823	Standard	XM_005260451		Approved	dJ805C22.1	uc002xwy.3	Q9P104	OTTHUMG00000032778	ENST00000262593.5:c.650A>C	20.37:g.53226977A>C	ENSP00000262593:p.Glu217Ala	143.0	0.0		171.0	20.0	NM_018431	Q5T7Y0|Q5TE53|Q8TEW7|Q96H13|Q9BZ24|Q9NQF4|Q9Y411	Missense_Mutation	SNP	ENST00000262593.5	37	CCDS13446.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.430303	0.83776	.	.	ENSG00000101134	ENST00000262593;ENST00000395939	T;T	0.76448	-1.02;-1.02	5.54	5.54	0.83059	Pleckstrin homology-type (1);Insulin receptor substrate-1, PTB (3);	0.000000	0.85682	D	0.000000	D	0.87192	0.6116	M	0.78223	2.4	0.58432	D	0.999999	P;P	0.52577	0.868;0.954	P;D	0.67725	0.563;0.953	D	0.87147	0.2206	10	0.42905	T	0.14	-14.1726	14.8793	0.70519	1.0:0.0:0.0:0.0	.	109;217	Q9P104-2;Q9P104	.;DOK5_HUMAN	A	217;109	ENSP00000262593:E217A;ENSP00000379270:E109A	ENSP00000262593:E217A	E	+	2	0	DOK5	52660384	1.000000	0.71417	0.995000	0.50966	0.969000	0.65631	9.181000	0.94874	2.115000	0.64714	0.533000	0.62120	GAG	.		0.483	DOK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079777.2		
DSE	29940	hgsc.bcm.edu;broad.mit.edu	37	6	116757465	116757465	+	Missense_Mutation	SNP	G	G	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr6:116757465G>C	ENST00000331677.3	+	7	2278	c.1834G>C	c.(1834-1836)Ggt>Cgt	p.G612R	DSE_ENST00000359564.2_Missense_Mutation_p.G612R|DSE_ENST00000452085.3_Missense_Mutation_p.G612R|DSE_ENST00000537543.1_Missense_Mutation_p.G631R			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	612					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		GCAGAGAGATGGTCTCTATAA	0.488																																					p.G612R		.											.	DSE	91	0			c.G1834C						.						123.0	110.0	115.0					6																	116757465		2203	4300	6503	SO:0001583	missense	29940	exon6			AGAGATGGTCTCT	AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.1834G>C	6.37:g.116757465G>C	ENSP00000332151:p.Gly612Arg	52.0	0.0		135.0	6.0	NM_001080976	Q5R3K6	Missense_Mutation	SNP	ENST00000331677.3	37	CCDS5107.1	.	.	.	.	.	.	.	.	.	.	G	17.36	3.370207	0.61624	.	.	ENSG00000111817	ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04	6.01	6.01	0.97437	.	0.250132	0.47455	D	0.000228	T	0.61825	0.2378	L	0.56769	1.78	0.54753	D	0.999989	P;P	0.49635	0.926;0.926	P;B	0.47626	0.552;0.413	T	0.64833	-0.6314	10	0.62326	D	0.03	-16.2979	20.5211	0.99222	0.0:0.0:1.0:0.0	.	631;612	B7Z765;Q9UL01	.;DSE_HUMAN	R	612;631;612;612	ENSP00000404049:G612R;ENSP00000441152:G631R;ENSP00000332151:G612R;ENSP00000352567:G612R	ENSP00000332151:G612R	G	+	1	0	DSE	116864158	1.000000	0.71417	0.997000	0.53966	0.959000	0.62525	7.935000	0.87658	2.861000	0.98227	0.650000	0.86243	GGT	G|1.000;A|0.000		0.488	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041940.2	NM_013352	
DYNC2H1	79659	hgsc.bcm.edu;bcgsc.ca	37	11	103027464	103027464	+	Silent	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr11:103027464A>G	ENST00000375735.2	+	26	4236	c.4092A>G	c.(4090-4092)gaA>gaG	p.E1364E	DYNC2H1_ENST00000398093.3_Silent_p.E1364E|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1364	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TGCCAAAAGAACAGACACGCT	0.348																																					p.E1364E		.											.	DYNC2H1	68	0			c.A4092G						.						56.0	56.0	56.0					11																	103027464		1847	4090	5937	SO:0001819	synonymous_variant	79659	exon26			AAAAGAACAGACA	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.4092A>G	11.37:g.103027464A>G		67.0	0.0		81.0	4.0	NM_001377	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Silent	SNP	ENST00000375735.2	37	CCDS53701.1																																																																																			.		0.348	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
ECE1	1889	broad.mit.edu;bcgsc.ca	37	1	21599363	21599363	+	Missense_Mutation	SNP	T	T	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr1:21599363T>C	ENST00000374893.6	-	4	396	c.322A>G	c.(322-324)Acc>Gcc	p.T108A	ECE1_ENST00000357071.4_Missense_Mutation_p.T96A|ECE1_ENST00000436918.2_Missense_Mutation_p.T108A|ECE1_ENST00000415912.2_Missense_Mutation_p.T92A|ECE1_ENST00000264205.6_Missense_Mutation_p.T105A	NM_001397.2	NP_001388.1	P42892	ECE1_HUMAN	endothelin converting enzyme 1	108					bradykinin catabolic process (GO:0010815)|calcitonin catabolic process (GO:0010816)|ear development (GO:0043583)|embryonic digit morphogenesis (GO:0042733)|endothelin maturation (GO:0034959)|heart development (GO:0007507)|hormone catabolic process (GO:0042447)|peptide hormone processing (GO:0016486)|pharyngeal system development (GO:0060037)|positive regulation of receptor recycling (GO:0001921)|protein processing (GO:0016485)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|substance P catabolic process (GO:0010814)	early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of endosome membrane (GO:0031302)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)|Weibel-Palade body (GO:0033093)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)			endometrium(5)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	25		Lung NSC(340;1.14e-05)|all_lung(284;1.23e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00147)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0183)|OV - Ovarian serous cystadenocarcinoma(117;4.83e-27)|COAD - Colon adenocarcinoma(152;1.36e-06)|GBM - Glioblastoma multiforme(114;1.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000162)|STAD - Stomach adenocarcinoma(196;0.00326)|KIRC - Kidney renal clear cell carcinoma(1967;0.00755)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.206)		ATGGAGCTGGTCACTGAGACA	0.602																																					p.T108A		.											.	ECE1	93	0			c.A322G						.						86.0	82.0	83.0					1																	21599363		2203	4300	6503	SO:0001583	missense	1889	exon4			AGCTGGTCACTGA	D49471	CCDS215.1, CCDS44081.1, CCDS44082.1, CCDS44083.1	1p36.1	2008-02-05			ENSG00000117298	ENSG00000117298			3146	protein-coding gene	gene with protein product		600423		ECE		7805846, 7864876, 17592116	Standard	NM_001397		Approved		uc001bei.2	P42892	OTTHUMG00000002625	ENST00000374893.6:c.322A>G	1.37:g.21599363T>C	ENSP00000364028:p.Thr108Ala	131.0	2.0		165.0	7.0	NM_001397	A8K3P1|B4E291|Q14217|Q17RN5|Q2Z2K8|Q58GE7|Q5THM5|Q5THM7|Q5THM8|Q9UJQ6|Q9UPF4|Q9UPM4|Q9Y501	Missense_Mutation	SNP	ENST00000374893.6	37	CCDS215.1	.	.	.	.	.	.	.	.	.	.	T	7.882	0.730381	0.15507	.	.	ENSG00000117298	ENST00000415912;ENST00000357071;ENST00000374893;ENST00000436918;ENST00000264205;ENST00000481130;ENST00000527991	T;T;T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19;-1.19;-1.19	5.75	5.75	0.90469	.	0.052927	0.85682	D	0.000000	T	0.53932	0.1827	N	0.11341	0.13	0.48696	D	0.999693	B;B;B;B;B	0.06786	0.001;0.0;0.0;0.001;0.0	B;B;B;B;B	0.04013	0.001;0.0;0.0;0.001;0.001	T	0.52472	-0.8571	10	0.02654	T	1	-51.5286	9.4076	0.38471	0.0:0.0797:0.0:0.9203	.	108;92;108;96;105	B4DKB2;Q2Z2K8;P42892;P42892-2;P42892-4	.;.;ECE1_HUMAN;.;.	A	92;96;108;108;105;94;91	ENSP00000405088:T92A;ENSP00000349581:T96A;ENSP00000364028:T108A;ENSP00000388439:T108A;ENSP00000264205:T105A;ENSP00000436633:T94A	ENSP00000264205:T105A	T	-	1	0	ECE1	21471950	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.218000	0.51192	2.206000	0.71126	0.533000	0.62120	ACC	.		0.602	ECE1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007470.2	NM_001397	
EPPK1	83481	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	8	144940354	144940354	+	Silent	SNP	G	G	A	rs375604799		TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr8:144940354G>A	ENST00000525985.1	-	2	7139	c.7068C>T	c.(7066-7068)cgC>cgT	p.R2356R				P58107	EPIPL_HUMAN	epiplakin 1	2356						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCACGGGCACGCGGTGGCTGT	0.692																																					p.R2356R		.											.	EPPK1	25	0			c.C7068T						.	G		2,4332		0,2,2165	195.0	189.0	191.0		7068	1.3	1.0	8		191	0,8472		0,0,4236	no	coding-synonymous	EPPK1	NM_031308.1		0,2,6401	AA,AG,GG		0.0,0.0461,0.0156		2356/2420	144940354	2,12804	2167	4236	6403	SO:0001819	synonymous_variant	83481	exon1			GGGCACGCGGTGG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.7068C>T	8.37:g.144940354G>A		23.0	0.0		22.0	10.0	NM_031308	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																				.		0.692	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
ERCC4	2072	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	14041704	14041704	+	Missense_Mutation	SNP	T	T	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr16:14041704T>C	ENST00000311895.7	+	11	2260	c.2251T>C	c.(2251-2253)Tac>Cac	p.Y751H		NM_005236.2	NP_005227.1	Q92889	XPF_HUMAN	excision repair cross-complementation group 4	751	ERCC4.|Nuclease.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair involved in interstrand cross-link repair (GO:1901255)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|resolution of meiotic recombination intermediates (GO:0000712)|response to UV (GO:0009411)|telomere maintenance (GO:0000723)|telomere maintenance via telomere shortening (GO:0010834)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	chromosome, telomeric region (GO:0000781)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleotide-excision repair factor 1 complex (GO:0000110)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endodeoxyribonuclease activity (GO:0004520)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(5)|lung(12)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	38						CATGTCCCGCTACTACAAGCG	0.507			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.Y751H		.	yes	Rec		Xeroderma pigmentosum (F)	16	16p13.3-p13.13	2072	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""		E	.	ERCC4	665	0			c.T2251C						.						109.0	107.0	108.0					16																	14041704		2197	4300	6497	SO:0001583	missense	2072	exon11	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	TCCCGCTACTACA	L76568	CCDS32390.1	16p13.3	2014-09-17	2014-03-07		ENSG00000175595	ENSG00000175595			3436	protein-coding gene	gene with protein product	"""xeroderma pigmentosum, complementation group F"""	133520	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""	XPF		9579555, 8887684	Standard	NM_005236		Approved	RAD1, FANCQ	uc002dce.2	Q92889	OTTHUMG00000048194	ENST00000311895.7:c.2251T>C	16.37:g.14041704T>C	ENSP00000310520:p.Tyr751His	82.0	1.0		85.0	33.0	NM_005236	A5PKV6|A8K111|O00140|Q8TD83	Missense_Mutation	SNP	ENST00000311895.7	37	CCDS32390.1	.	.	.	.	.	.	.	.	.	.	T	15.90	2.970795	0.53614	.	.	ENSG00000175595	ENST00000311895;ENST00000389138	T	0.20738	2.05	5.79	4.7	0.59300	DNA repair nuclease, XPF-type/Helicase (1);Restriction endonuclease, type II-like (1);ERCC4 domain (2);	0.118028	0.64402	D	0.000012	T	0.12817	0.0311	N	0.05050	-0.12	0.47441	D	0.99942	B	0.28584	0.216	B	0.39706	0.307	T	0.16867	-1.0388	10	0.10902	T	0.67	-6.8858	11.0669	0.47980	0.0:0.0721:0.0:0.9279	.	751	Q92889	XPF_HUMAN	H	751;739	ENSP00000310520:Y751H	ENSP00000310520:Y751H	Y	+	1	0	ERCC4	13949205	1.000000	0.71417	0.995000	0.50966	0.922000	0.55478	5.775000	0.68915	1.024000	0.39682	0.533000	0.62120	TAC	.		0.507	ERCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109634.2	NM_005236	
FAIM2	23017	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	50281167	50281167	+	Splice_Site	SNP	A	A	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr12:50281167A>T	ENST00000320634.3	-	11	896		c.e11+1		FAIM2_ENST00000550890.1_Splice_Site	NM_012306.3	NP_036438.2	Q9BWQ8	LFG2_HUMAN	Fas apoptotic inhibitory molecule 2						apoptotic process (GO:0006915)|cerebellar granular layer development (GO:0021681)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum development (GO:0021549)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of neuron apoptotic process (GO:0043524)|regulation of neuron apoptotic process (GO:0043523)|response to ischemia (GO:0002931)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|postsynaptic membrane (GO:0045211)				endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|skin(2)	14						GACCACACTCACCAATGTAAA	0.577																																					.		.											.	FAIM2	230	0			c.801+2T>A						.						129.0	95.0	106.0					12																	50281167		2203	4300	6503	SO:0001630	splice_region_variant	23017	exon12			ACACTCACCAATG	AB023167	CCDS8791.1	12q13	2010-03-18				ENSG00000135472			17067	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 2"""	604306				10231032, 10535980	Standard	NM_012306		Approved	KIAA0950, LFG, NMP35, LIFEGUARD, TMBIM2, LFG2	uc001rvj.2	Q9BWQ8	OTTHUMG00000169808	ENST00000320634.3:c.801+1T>A	12.37:g.50281167A>T		32.0	0.0		47.0	10.0	NM_012306	A8K1W6|B3KR08|Q9UJY9|Q9Y2F7	Splice_Site	SNP	ENST00000320634.3	37	CCDS8791.1	.	.	.	.	.	.	.	.	.	.	A	17.68	3.449226	0.63178	.	.	ENSG00000135472	ENST00000320634;ENST00000550890;ENST00000550635;ENST00000552669	.	.	.	4.36	4.36	0.52297	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8714	0.41177	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAIM2	48567434	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	5.056000	0.64287	1.841000	0.53522	0.379000	0.24179	.	.		0.577	FAIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405984.1	NM_012306	Intron
FAM208A	23272	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	56680996	56680996	+	Missense_Mutation	SNP	G	G	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr3:56680996G>A	ENST00000493960.2	-	14	1779	c.1769C>T	c.(1768-1770)tCa>tTa	p.S590L	FAM208A_ENST00000431842.2_Missense_Mutation_p.S194L|FAM208A_ENST00000355628.5_Missense_Mutation_p.S590L	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	590							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						TCTGGGAGCTGAGTATAAGAA	0.303																																					p.S590L		.											.	.	.	0			c.C1769T						.						30.0	33.0	32.0					3																	56680996		2198	4294	6492	SO:0001583	missense	23272	exon14			GGAGCTGAGTATA	AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.1769C>T	3.37:g.56680996G>A	ENSP00000417509:p.Ser590Leu	201.0	0.0		241.0	31.0	NM_001112736	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	ENST00000493960.2	37	CCDS46853.1	.	.	.	.	.	.	.	.	.	.	G	9.606	1.129899	0.21041	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.11821	2.74;2.91;2.91	5.38	5.38	0.77491	.	0.246251	0.29178	N	0.012916	T	0.11879	0.0289	N	0.25647	0.755	0.34260	D	0.679742	B;P;P	0.35272	0.045;0.493;0.493	B;B;B	0.39258	0.031;0.215;0.295	T	0.21177	-1.0253	10	0.26408	T	0.33	-1.2621	12.6157	0.56576	0.0747:0.0:0.9253:0.0	.	590;590;194	Q9UK61-3;Q9UK61-4;Q9UK61-2	.;.;.	L	194;590;590	ENSP00000399410:S194L;ENSP00000417509:S590L;ENSP00000347845:S590L	ENSP00000347845:S590L	S	-	2	0	C3orf63	56656036	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.899000	0.63245	2.793000	0.96121	0.655000	0.94253	TCA	.		0.303	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224	
FAT3	120114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	92616495	92616495	+	Silent	SNP	C	C	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr11:92616495C>A	ENST00000298047.6	+	23	12890	c.12873C>A	c.(12871-12873)gcC>gcA	p.A4291A	FAT3_ENST00000533797.1_Silent_p.A626A|FAT3_ENST00000525166.1_Silent_p.A4141A|FAT3_ENST00000489716.1_3'UTR|FAT3_ENST00000409404.2_Silent_p.A4291A			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	4291					homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACCTCCCCGCCGTGTCACCCT	0.652										TCGA Ovarian(4;0.039)																											p.A4291A		.											.	FAT3	73	0			c.C12873A						.						22.0	28.0	26.0					11																	92616495		2021	4085	6106	SO:0001819	synonymous_variant	120114	exon23			CCCCGCCGTGTCA	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.12873C>A	11.37:g.92616495C>A		36.0	0.0		25.0	10.0	NM_001008781	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37																																																																																				.		0.652	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
FATE1	89885	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	150884642	150884642	+	Silent	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chrX:150884642A>G	ENST00000370350.3	+	1	136	c.51A>G	c.(49-51)gcA>gcG	p.A17A		NM_033085.2	NP_149076.1	Q969F0	FATE1_HUMAN	fetal and adult testis expressed 1	17						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(6)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)					TGTCCCTGGCAGAAGAACTGA	0.537																																					p.A17A		.											.	FATE1	131	0			c.A51G						.						87.0	66.0	74.0					X																	150884642		2040	3766	5806	SO:0001819	synonymous_variant	89885	exon1			CCTGGCAGAAGAA	AF249872	CCDS14700.1	Xq28	2009-03-25			ENSG00000147378	ENSG00000147378			24683	protein-coding gene	gene with protein product	"""cancer/testis antigen 43"""	300450				11694338	Standard	NM_033085		Approved	FATE, CT43	uc004fex.3	Q969F0	OTTHUMG00000024172	ENST00000370350.3:c.51A>G	X.37:g.150884642A>G		175.0	0.0		146.0	39.0	NM_033085		Silent	SNP	ENST00000370350.3	37	CCDS14700.1																																																																																			.		0.537	FATE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060885.1	NM_033085	
FCAMR	83953	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207133090	207133090	+	Missense_Mutation	SNP	T	T	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr1:207133090T>C	ENST00000324852.4	-	7	1981	c.1507A>G	c.(1507-1509)Atg>Gtg	p.M503V	FCAMR_ENST00000450945.2_Silent_p.P235P|FCAMR_ENST00000400962.3_Silent_p.P235P|FCAMR_ENST00000486178.1_5'UTR	NM_001170631.1	NP_001164102.1	Q8WWV6	FCAMR_HUMAN	Fc receptor, IgA, IgM, high affinity	458					immune system process (GO:0002376)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(1)	11						AGGGCCAGCATGGTAGAGACA	0.532																																					p.M503V	Ovarian(199;1883 2142 16966 44409 45154)	.											.	FCAMR	91	0			c.A1507G						.						147.0	143.0	144.0					1																	207133090		1568	3582	5150	SO:0001583	missense	83953	exon7			CCAGCATGGTAGA	AF354295	CCDS41460.1, CCDS53468.1	1q32.1	2013-01-14			ENSG00000162897	ENSG00000162897		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	24692	protein-coding gene	gene with protein product		605484				11779189	Standard	NM_001122979		Approved	FKSG87, FCA/MR, CD351	uc001hfa.4	Q8WWV6	OTTHUMG00000036579	ENST00000324852.4:c.1507A>G	1.37:g.207133090T>C	ENSP00000316491:p.Met503Val	93.0	0.0		88.0	23.0	NM_001170631	Q32M82|Q8WWV5|Q96SA2	Missense_Mutation	SNP	ENST00000324852.4	37	CCDS53468.1	.	.	.	.	.	.	.	.	.	.	T	0.016	-1.528754	0.00959	.	.	ENSG00000162897	ENST00000324852	T	0.03663	3.85	4.63	-8.22	0.01037	.	.	.	.	.	T	0.01029	0.0034	.	.	.	0.24552	N	0.994019	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42832	-0.9428	8	0.02654	T	1	-1.0385	2.1438	0.03782	0.2183:0.4507:0.1091:0.2219	.	478;458	D2KTA8;Q8WWV6	.;FCAMR_HUMAN	V	503	ENSP00000316491:M503V	ENSP00000316491:M503V	M	-	1	0	FCAMR	205199713	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.284000	0.02793	-1.872000	0.01136	-1.229000	0.01577	ATG	.		0.532	FCAMR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088969.2	NM_032029	
FEV	54738	hgsc.bcm.edu;broad.mit.edu	37	2	219849754	219849754	+	Missense_Mutation	SNP	T	T	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr2:219849754T>C	ENST00000295727.1	-	1	625	c.44A>G	c.(43-45)tAc>tGc	p.Y15C		NM_017521.2	NP_059991.1	Q99581	FEV_HUMAN	FEV (ETS oncogene family)	15					cell differentiation (GO:0030154)|neuron fate specification (GO:0048665)|neuron maturation (GO:0042551)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)		EWSR1/FEV(11)|FUS/FEV(2)	large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	4		Renal(207;0.0474)		Epithelial(149;9.77e-07)|all cancers(144;0.000167)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACCTGGCAGGTACATGTTGAT	0.697			T	"""EWSR1,  FUS"""	Ewing sarcoma																																p.Y15C	NSCLC(198;941 2228 4658 24163 34665)	.		Dom	yes		2	2q36	54738	FEV protein - (HSRNAFEV)		M	.	FEV	846	0			c.A44G						.						9.0	9.0	9.0					2																	219849754		2130	4192	6322	SO:0001583	missense	54738	exon1			GGCAGGTACATGT		CCDS2428.1	2q36	2008-02-05			ENSG00000163497	ENSG00000163497			18562	protein-coding gene	gene with protein product		607150	"""FEV (fifth Ewing variant)"""			9121764	Standard	NM_017521		Approved	Pet-1	uc002vji.1	Q99581	OTTHUMG00000133080	ENST00000295727.1:c.44A>G	2.37:g.219849754T>C	ENSP00000295727:p.Tyr15Cys	48.0	0.0		73.0	4.0	NM_017521		Missense_Mutation	SNP	ENST00000295727.1	37	CCDS2428.1	.	.	.	.	.	.	.	.	.	.	T	16.07	3.019993	0.54576	.	.	ENSG00000163497	ENST00000295727	T	0.40476	1.03	3.6	3.6	0.41247	.	1.997360	0.02604	U	0.101365	T	0.50871	0.1641	N	0.14661	0.345	0.47276	D	0.999378	D	0.67145	0.996	D	0.74674	0.984	T	0.41556	-0.9502	10	0.45353	T	0.12	.	11.3339	0.49492	0.0:0.0:0.0:1.0	.	15	Q99581	FEV_HUMAN	C	15	ENSP00000295727:Y15C	ENSP00000295727:Y15C	Y	-	2	0	FEV	219557998	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.737000	0.62066	1.496000	0.48567	0.460000	0.39030	TAC	.		0.697	FEV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256725.1		
GABRQ	55879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	151815446	151815446	+	Missense_Mutation	SNP	A	A	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chrX:151815446A>C	ENST00000370306.2	+	4	364	c.344A>C	c.(343-345)aAa>aCa	p.K115T		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	115					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CAGACTTGGAAAGATTCACGC	0.463																																					p.K115T		.											.	GABRQ	133	0			c.A344C						.						247.0	191.0	210.0					X																	151815446		2203	4300	6503	SO:0001583	missense	55879	exon4			CTTGGAAAGATTC	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.344A>C	X.37:g.151815446A>C	ENSP00000359329:p.Lys115Thr	179.0	0.0		149.0	61.0	NM_018558	A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	ENST00000370306.2	37	CCDS14707.1	.	.	.	.	.	.	.	.	.	.	A	15.74	2.921464	0.52653	.	.	ENSG00000147402	ENST00000370306	T	0.76448	-1.02	5.51	4.38	0.52667	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.46758	D	0.000265	T	0.72811	0.3507	L	0.27975	0.815	0.32420	N	0.549513	P	0.51791	0.948	P	0.57425	0.82	T	0.76170	-0.3057	10	0.51188	T	0.08	.	3.7045	0.08395	0.7044:0.0:0.2956:0.0	.	115	Q9UN88	GBRT_HUMAN	T	115	ENSP00000359329:K115T	ENSP00000359329:K115T	K	+	2	0	GABRQ	151566102	1.000000	0.71417	0.999000	0.59377	0.478000	0.33099	4.577000	0.60922	1.844000	0.53588	0.441000	0.28932	AAA	.		0.463	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558	
GBF1	8729	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	104125298	104125298	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr10:104125298A>G	ENST00000369983.3	+	18	2508	c.2248A>G	c.(2248-2250)Atg>Gtg	p.M750V		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	750	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		GGACAAGAAGATGATTGGAGA	0.498																																					p.M751V		.											.	GBF1	91	0			c.A2251G						.						115.0	111.0	112.0					10																	104125298		2203	4300	6503	SO:0001583	missense	8729	exon18			AAGAAGATGATTG	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.2248A>G	10.37:g.104125298A>G	ENSP00000359000:p.Met750Val	131.0	0.0		117.0	6.0	NM_001199378	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	ENST00000369983.3	37	CCDS7533.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.892879	0.91889	.	.	ENSG00000107862	ENST00000369983	T	0.53206	0.63	5.79	5.79	0.91817	SEC7-like (4);	0.000000	0.85682	D	0.000000	T	0.59783	0.2219	L	0.45581	1.43	0.80722	D	1	D;D;P	0.67145	0.996;0.991;0.906	P;D;P	0.63033	0.904;0.91;0.626	T	0.56643	-0.7945	10	0.35671	T	0.21	-19.3013	16.1303	0.81428	1.0:0.0:0.0:0.0	.	750;750;750	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	V	750	ENSP00000359000:M750V	ENSP00000359000:M750V	M	+	1	0	GBF1	104115288	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.094000	0.94168	2.218000	0.71995	0.533000	0.62120	ATG	.		0.498	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
GFM2	84340	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	74037421	74037421	+	Missense_Mutation	SNP	T	T	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr5:74037421T>C	ENST00000296805.3	-	11	1320	c.863A>G	c.(862-864)gAt>gGt	p.D288G	GFM2_ENST00000427854.2_Missense_Mutation_p.D288G|GFM2_ENST00000509430.1_Missense_Mutation_p.D288G|GFM2_ENST00000345239.2_Missense_Mutation_p.D288G	NM_032380.3	NP_115756.2			G elongation factor, mitochondrial 2											breast(2)|endometrium(2)|large_intestine(4)|lung(5)|prostate(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)		AAATTCATCATCCAAATCTGC	0.284																																					p.D288G		.											.	GFM2	90	0			c.A863G						.						43.0	45.0	44.0					5																	74037421		2197	4287	6484	SO:0001583	missense	84340	exon11			TCATCATCCAAAT	AF111808	CCDS4023.1, CCDS4024.1, CCDS47232.1	5q13	2008-02-05			ENSG00000164347	ENSG00000164347			29682	protein-coding gene	gene with protein product		606544				11735030	Standard	NM_001281302		Approved	EFG2, FLJ21661	uc003kdh.1	Q969S9	OTTHUMG00000102058	ENST00000296805.3:c.863A>G	5.37:g.74037421T>C	ENSP00000296805:p.Asp288Gly	327.0	1.0		420.0	97.0	NM_032380		Missense_Mutation	SNP	ENST00000296805.3	37	CCDS4023.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.562243	0.86335	.	.	ENSG00000164347	ENST00000296805;ENST00000345239;ENST00000546082;ENST00000509430;ENST00000427854;ENST00000509097	T;T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04;-1.04	5.88	5.88	0.94601	Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	D	0.000000	D	0.91178	0.7221	M	0.93898	3.47	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.995;1.0;1.0;0.997	D	0.93318	0.6690	10	0.87932	D	0	-23.2977	16.2868	0.82725	0.0:0.0:0.0:1.0	.	288;288;288;288;288	F5H687;Q969S9-3;Q969S9-5;Q969S9-2;Q969S9	.;.;.;.;RRF2M_HUMAN	G	288;288;288;288;288;246	ENSP00000296805:D288G;ENSP00000296804:D288G;ENSP00000427004:D288G;ENSP00000405808:D288G;ENSP00000421717:D246G	ENSP00000296805:D288G	D	-	2	0	GFM2	74073177	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.782000	0.85680	2.244000	0.73946	0.460000	0.39030	GAT	.		0.284	GFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219860.2	NM_032380	
GLA	2717	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	100658874	100658874	+	Silent	SNP	G	G	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chrX:100658874G>T	ENST00000218516.3	-	2	315	c.294C>A	c.(292-294)ccC>ccA	p.P98P	RPL36A-HNRNPH2_ENST00000409170.3_Intron|GLA_ENST00000479445.1_5'UTR	NM_000169.2	NP_000160.1	P06280	AGAL_HUMAN	galactosidase, alpha	98					glycoside catabolic process (GO:0016139)|glycosphingolipid catabolic process (GO:0046479)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric-oxide synthase activity (GO:0051001)|oligosaccharide metabolic process (GO:0009311)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-galactosidase activity (GO:0004557)|catalytic activity (GO:0003824)|galactoside binding (GO:0016936)|hydrolase activity (GO:0016787)|protein homodimerization activity (GO:0042803)|raffinose alpha-galactosidase activity (GO:0052692)|receptor binding (GO:0005102)			endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						AATCTCTTTGGGGAGCCATCC	0.478																																					p.P98P	Colon(193;776 2816 31189 44474)	.											.	GLA	130	0			c.C294A						.						190.0	171.0	177.0					X																	100658874		2203	4300	6503	SO:0001819	synonymous_variant	2717	exon2			TCTTTGGGGAGCC	X16889	CCDS14484.1	Xq21.3-q22	2014-09-17			ENSG00000102393	ENSG00000102393	3.2.1.22		4296	protein-coding gene	gene with protein product		300644					Standard	NM_000169		Approved	GALA	uc004ehl.1	P06280	OTTHUMG00000022026	ENST00000218516.3:c.294C>A	X.37:g.100658874G>T		135.0	0.0		99.0	36.0	NM_000169	Q6LER7	Silent	SNP	ENST00000218516.3	37	CCDS14484.1																																																																																			.		0.478	GLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057540.1		
GOLGA2	2801	hgsc.bcm.edu;mdanderson.org	37	9	131020812	131020812	+	Missense_Mutation	SNP	C	C	A	rs143073995	byFrequency	TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr9:131020812C>A	ENST00000421699.2	-	21	2142	c.2130G>T	c.(2128-2130)gaG>gaT	p.E710D	GOLGA2_ENST00000609374.1_Missense_Mutation_p.E698D|AL590708.1_ENST00000408370.1_RNA	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	710	Poly-Glu.				mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						cctcctcctcctcctcatcct	0.652																																					p.E710D		.											.	GOLGA2	91	0			c.G2130T						.						41.0	36.0	38.0					9																	131020812		2203	4300	6503	SO:0001583	missense	2801	exon21			CTCCTCCTCCTCA	L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.2130G>T	9.37:g.131020812C>A	ENSP00000416097:p.Glu710Asp	32.0	0.0		42.0	8.0	NM_004486	Q6GRM9|Q9BRB0|Q9NYF9	Missense_Mutation	SNP	ENST00000421699.2	37	CCDS6896.2	.	.	.	.	.	.	.	.	.	.	a	3.615	-0.078829	0.07141	.	.	ENSG00000167110	ENST00000421699	D	0.89746	-2.56	1.03	-2.07	0.07276	.	1.118960	0.07333	U	0.879535	T	0.76335	0.3973	N	0.08118	0	0.09310	N	1	P	0.51933	0.949	P	0.47251	0.542	T	0.67554	-0.5641	10	0.15952	T	0.53	.	4.3404	0.11106	0.0:0.5807:0.0:0.4192	.	710	Q08379	GOGA2_HUMAN	D	710	ENSP00000416097:E710D	ENSP00000416097:E710D	E	-	3	2	GOLGA2	130060633	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.550000	0.23345	-0.517000	0.06461	-0.531000	0.04308	GAG	C|0.990;A|0.010		0.652	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054358.2	NM_004486	
GPR132	29933	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	105517685	105517686	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr14:105517685_105517686insT	ENST00000329797.3	-	4	1699_1700	c.788_789insA	c.(787-789)ctcfs	p.L263fs	GPR132_ENST00000392585.2_Frame_Shift_Ins_p.L254fs|GPR132_ENST00000539291.2_Frame_Shift_Ins_p.L263fs|GPR132_ENST00000546679.1_5'Flank	NM_001278694.1|NM_001278696.1|NM_013345.2	NP_001265623.1|NP_001265625.1|NP_037477.1	Q9UNW8	GP132_HUMAN	G protein-coupled receptor 132	263					G1/S transition of mitotic cell cycle (GO:0000082)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	18		all_cancers(154;0.0953)|Melanoma(154;0.155)|all_epithelial(191;0.219)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.02)|all cancers(159;0.0419)|OV - Ovarian serous cystadenocarcinoma(161;0.0521)		CGGCTTTGACGAGGAGAACCAG	0.574																																					p.L263fs		.											.	GPR132	92	0			c.789_790insA						.																																			SO:0001589	frameshift_variant	29933	exon4			TTTGACGAGGAGA	AF083955	CCDS9997.1, CCDS61567.1	14q32.3	2012-08-21			ENSG00000183484	ENSG00000183484		"""GPCR / Class A : Orphans"""	17482	protein-coding gene	gene with protein product	"""G2 accumulation"""	606167				12086852	Standard	NM_013345		Approved	G2A	uc001yqd.3	Q9UNW8	OTTHUMG00000140173	ENST00000329797.3:c.788_789insA	14.37:g.105517685_105517686insT	ENSP00000328818:p.Leu263fs	59.0	0.0		193.0	39.0	NM_013345	A8K7X7|B4E144|Q9BSU2	Frame_Shift_Ins	INS	ENST00000329797.3	37	CCDS9997.1																																																																																			.		0.574	GPR132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409278.1	NM_013345	
GPR132	29933	hgsc.bcm.edu;bcgsc.ca	37	14	105517686	105517686	+	Missense_Mutation	SNP	A	A	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr14:105517686A>T	ENST00000329797.3	-	4	1699	c.788T>A	c.(787-789)cTc>cAc	p.L263H	GPR132_ENST00000392585.2_Missense_Mutation_p.L254H|GPR132_ENST00000539291.2_Missense_Mutation_p.L263H|GPR132_ENST00000546679.1_5'Flank	NM_001278694.1|NM_001278696.1|NM_013345.2	NP_001265623.1|NP_001265625.1|NP_037477.1	Q9UNW8	GP132_HUMAN	G protein-coupled receptor 132	263					G1/S transition of mitotic cell cycle (GO:0000082)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	18		all_cancers(154;0.0953)|Melanoma(154;0.155)|all_epithelial(191;0.219)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.02)|all cancers(159;0.0419)|OV - Ovarian serous cystadenocarcinoma(161;0.0521)		GGCTTTGACGAGGAGAACCAG	0.577																																					p.L263H		.											.	GPR132	92	0			c.T788A						.						102.0	103.0	103.0					14																	105517686		2203	4300	6503	SO:0001583	missense	29933	exon4			TTGACGAGGAGAA	AF083955	CCDS9997.1, CCDS61567.1	14q32.3	2012-08-21			ENSG00000183484	ENSG00000183484		"""GPCR / Class A : Orphans"""	17482	protein-coding gene	gene with protein product	"""G2 accumulation"""	606167				12086852	Standard	NM_013345		Approved	G2A	uc001yqd.3	Q9UNW8	OTTHUMG00000140173	ENST00000329797.3:c.788T>A	14.37:g.105517686A>T	ENSP00000328818:p.Leu263His	59.0	0.0		193.0	41.0	NM_013345	A8K7X7|B4E144|Q9BSU2	Missense_Mutation	SNP	ENST00000329797.3	37	CCDS9997.1	.	.	.	.	.	.	.	.	.	.	A	18.50	3.638117	0.67130	.	.	ENSG00000183484	ENST00000329797;ENST00000392585;ENST00000539291	T;T;T	0.47869	0.83;0.83;0.83	4.98	4.98	0.66077	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000002	T	0.70404	0.3220	M	0.84219	2.685	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.75955	-0.3135	10	0.87932	D	0	.	13.857	0.63534	1.0:0.0:0.0:0.0	.	254;263	B4E144;Q9UNW8	.;GP132_HUMAN	H	263;254;263	ENSP00000328818:L263H;ENSP00000376364:L254H;ENSP00000438094:L263H	ENSP00000328818:L263H	L	-	2	0	GPR132	104588731	1.000000	0.71417	0.412000	0.26496	0.288000	0.27193	9.071000	0.93980	1.865000	0.54081	0.460000	0.39030	CTC	.		0.577	GPR132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409278.1	NM_013345	
GRAMD1B	57476	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	123489856	123489856	+	Frame_Shift_Del	DEL	C	C	-	rs148264959	byFrequency	TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr11:123489856delC	ENST00000529750.1	+	19	2378	c.2051delC	c.(2050-2052)tccfs	p.S684fs	GRAMD1B_ENST00000322282.7_Frame_Shift_Del_p.S684fs|GRAMD1B_ENST00000456860.2_Frame_Shift_Del_p.S691fs|GRAMD1B_ENST00000450171.2_Frame_Shift_Del_p.S371fs	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	684						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		CTCTTAGAGTCCCAACAAAAG	0.522																																					p.S684fs		.											.	GRAMD1B	69	0			c.2051delC						.						55.0	52.0	53.0					11																	123489856		1923	4119	6042	SO:0001589	frameshift_variant	57476	exon19			TAGAGTCCCAACA	AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.2051delC	11.37:g.123489856delC	ENSP00000436500:p.Ser684fs	50.0	0.0		51.0	14.0	NM_020716	Q6UW85|Q9ULL9	Frame_Shift_Del	DEL	ENST00000529750.1	37	CCDS53720.1																																																																																			.		0.522	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2	XM_370660	
GRM3	2913	broad.mit.edu;bcgsc.ca	37	7	86469096	86469096	+	Missense_Mutation	SNP	T	T	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr7:86469096T>C	ENST00000361669.2	+	4	3365	c.2266T>C	c.(2266-2268)Ttc>Ctc	p.F756L	GRM3_ENST00000536043.1_Missense_Mutation_p.F628L|GRM3_ENST00000439827.1_Intron|GRM3_ENST00000546348.1_Missense_Mutation_p.F348L|GRM3_ENST00000394720.2_Intron	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	756					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					TGTGTACGCCTTCAAAACGCG	0.443																																					p.F756L	GBM(52;969 1098 3139 52280)	.											.	GRM3	528	0			c.T2266C						.						118.0	102.0	108.0					7																	86469096		2203	4300	6503	SO:0001583	missense	2913	exon4			TACGCCTTCAAAA		CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.2266T>C	7.37:g.86469096T>C	ENSP00000355316:p.Phe756Leu	86.0	1.0		135.0	6.0	NM_000840	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	ENST00000361669.2	37	CCDS5600.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.303013	0.81136	.	.	ENSG00000198822	ENST00000361669;ENST00000546348;ENST00000536043	D;D;D	0.89270	-2.49;-2.49;-2.49	5.54	5.54	0.83059	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.96216	0.8766	H	0.96547	3.84	0.80722	D	1	D;D;D	0.89917	0.986;1.0;0.998	P;D;D	0.91635	0.897;0.999;0.988	D	0.97054	0.9766	10	0.54805	T	0.06	.	14.853	0.70313	0.0:0.0:0.0:1.0	.	348;628;756	B7Z204;F5GYZ2;Q14832	.;.;GRM3_HUMAN	L	756;348;628	ENSP00000355316:F756L;ENSP00000444064:F348L;ENSP00000441407:F628L	ENSP00000355316:F756L	F	+	1	0	GRM3	86307032	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.103000	0.63969	0.460000	0.39030	TTC	.		0.443	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2		
HIST1H4K	8362	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	27799271	27799271	+	Missense_Mutation	SNP	C	C	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr6:27799271C>A	ENST00000357549.2	-	1	34	c.35G>T	c.(34-36)gGc>gTc	p.G12V		NM_003541.2	NP_003532.1	P62805	H4_HUMAN	histone cluster 1, H4k	12					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|lung(3)|ovary(1)|prostate(1)	7						GCCGCCTTTGCCAAGACCCTT	0.632																																					p.G12V		.											.	HIST1H4K	90	0			c.G35T						.						10.0	11.0	11.0					6																	27799271		1891	3810	5701	SO:0001583	missense	8362	exon1			CCTTTGCCAAGAC	X60483	CCDS4631.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197914	ENSG00000273542		"""Histones / Replication-dependent"""	4784	protein-coding gene	gene with protein product		602825	"""H4 histone family, member D"", ""histone 1, H4k"""	H4FD		9439656, 12408966	Standard	NM_003541		Approved	H4/d, H4F2iii, dJ160A22.1	uc003njr.3	P62805	OTTHUMG00000014488	ENST00000357549.2:c.35G>T	6.37:g.27799271C>A	ENSP00000350159:p.Gly12Val	275.0	1.0		317.0	53.0	NM_003541	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000357549.2	37	CCDS4631.1	.	.	.	.	.	.	.	.	.	.	.	14.23	2.474409	0.43942	.	.	ENSG00000197914	ENST00000357549	.	.	.	4.05	4.05	0.47172	.	0.000000	0.53938	U	0.000052	T	0.69663	0.3136	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.75838	-0.3176	6	0.87932	D	0	.	15.6683	0.77252	0.0:1.0:0.0:0.0	.	.	.	.	V	12	.	ENSP00000350159:G12V	G	-	2	0	HIST1H4K	27907250	1.000000	0.71417	0.117000	0.21633	0.183000	0.23260	6.973000	0.76116	1.981000	0.57761	0.644000	0.83932	GGC	.		0.632	HIST1H4K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040156.1	NM_003541	
HPS1	3257	hgsc.bcm.edu;broad.mit.edu	37	10	100179909	100179909	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr10:100179909A>G	ENST00000325103.6	-	18	1983	c.1750T>C	c.(1750-1752)Tct>Cct	p.S584P	HPS1_ENST00000361490.4_Missense_Mutation_p.S584P|HPS1_ENST00000467246.1_5'UTR	NM_000195.3	NP_000186.2	Q92902	HPS1_HUMAN	Hermansky-Pudlak syndrome 1	584					blood coagulation (GO:0007596)|eye pigmentation (GO:0048069)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of natural killer cell activation (GO:0032816)|retina development in camera-type eye (GO:0060041)|secretion of lysosomal enzymes (GO:0033299)|visual perception (GO:0007601)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	protein dimerization activity (GO:0046983)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.234)		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)		TGGATCAGAGACCAGACCTGG	0.582									Hermansky-Pudlak syndrome																												p.S584P		.											.	HPS1	91	0			c.T1750C						.						134.0	116.0	122.0					10																	100179909		2203	4300	6503	SO:0001583	missense	3257	exon18	Familial Cancer Database	HPS, HPS1-8	TCAGAGACCAGAC	U79136	CCDS7475.1, CCDS7476.1	10q23.1-q23.3	2014-06-18		2002-05-01	ENSG00000107521	ENSG00000107521			5163	protein-coding gene	gene with protein product		604982	"""Hermansky-Pudlak syndrome"""	HPS		8541858, 7573033	Standard	NM_182639		Approved		uc021pwv.1	Q92902	OTTHUMG00000018876	ENST00000325103.6:c.1750T>C	10.37:g.100179909A>G	ENSP00000326649:p.Ser584Pro	69.0	0.0		75.0	4.0	NM_000195	A8MRT2|O15402|O15502|Q5TAA3|Q8WXE5	Missense_Mutation	SNP	ENST00000325103.6	37	CCDS7475.1	.	.	.	.	.	.	.	.	.	.	A	19.52	3.843616	0.71488	.	.	ENSG00000107521	ENST00000325103;ENST00000361490;ENST00000407891	T;T	0.47528	0.84;0.84	5.45	0.523	0.17060	.	0.576373	0.19226	N	0.119539	T	0.61274	0.2334	M	0.79475	2.455	0.80722	D	1	D;D;D	0.53312	0.959;0.959;0.959	P;P;P	0.54100	0.742;0.742;0.742	T	0.69752	-0.5060	10	0.62326	D	0.03	.	16.0411	0.80683	0.4704:0.5296:0.0:0.0	.	551;584;585	Q92902-2;Q8WXE5;D3DR62	.;.;.	P	584;584;551	ENSP00000326649:S584P;ENSP00000355310:S584P	ENSP00000326649:S584P	S	-	1	0	HPS1	100169899	0.995000	0.38212	1.000000	0.80357	0.929000	0.56500	0.362000	0.20284	0.082000	0.17018	0.459000	0.35465	TCT	.		0.582	HPS1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049776.1	NM_000195, NM_182637, NM_182638, NM_182639	
HRG	3273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	186383833	186383833	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr3:186383833A>G	ENST00000232003.4	+	1	93	c.13A>G	c.(13-15)Att>Gtt	p.I5V	RP11-134F2.2_ENST00000428501.1_RNA|HRG_ENST00000468154.1_Intron|RP11-134F2.2_ENST00000455926.1_RNA	NM_000412.2	NP_000403.1	P04196	HRG_HUMAN	histidine-rich glycoprotein	5					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|defense response to fungus (GO:0050832)|fibrinolysis (GO:0042730)|heme export (GO:0097037)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood vessel remodeling (GO:2000504)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of immune response to tumor cell (GO:0002839)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet activation (GO:0010543)|regulation of protein complex assembly (GO:0043254)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|response to organic cyclic compound (GO:0014070)	blood microparticle (GO:0072562)|endolysosome (GO:0036019)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|phagolysosome membrane (GO:0061474)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heme binding (GO:0020037)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|immunoglobulin binding (GO:0019865)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(12)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0683)		GAAGGCACTCATTGCAGCACT	0.448																																					p.I5V		.											.	HRG	91	0			c.A13G						.						104.0	90.0	94.0					3																	186383833		2203	4300	6503	SO:0001583	missense	3273	exon1			GCACTCATTGCAG		CCDS3280.1	3q27	2008-07-18			ENSG00000113905	ENSG00000113905			5181	protein-coding gene	gene with protein product	"""histidine-proline rich glycoprotein"", ""thrombophilia due to elevated HRG"""	142640				1678514	Standard	NM_000412		Approved	HRGP, HPRG	uc003fqq.3	P04196	OTTHUMG00000156578	ENST00000232003.4:c.13A>G	3.37:g.186383833A>G	ENSP00000232003:p.Ile5Val	106.0	0.0		111.0	26.0	NM_000412	B9EK35|D3DNU7	Missense_Mutation	SNP	ENST00000232003.4	37	CCDS3280.1	.	.	.	.	.	.	.	.	.	.	A	0.015	-1.547153	0.00926	.	.	ENSG00000113905	ENST00000232003	T	0.16897	2.31	5.6	-8.96	0.00761	.	1.332170	0.04902	N	0.451571	T	0.09905	0.0243	L	0.39898	1.24	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.43572	-0.9383	10	0.02654	T	1	5.4587	9.548	0.39293	0.2499:0.541:0.2092:0.0	.	5	P04196	HRG_HUMAN	V	5	ENSP00000232003:I5V	ENSP00000232003:I5V	I	+	1	0	HRG	187866527	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-2.547000	0.00931	-1.503000	0.01812	-0.316000	0.08728	ATT	.		0.448	HRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344655.1	NM_000412	
HSPG2	3339	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	22159859	22159872	+	Frame_Shift_Del	DEL	AAGTAGGGCACCAC	AAGTAGGGCACCAC	-			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	AAGTAGGGCACCAC	AAGTAGGGCACCAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr1:22159859_22159872delAAGTAGGGCACCAC	ENST00000374695.3	-	80	11063_11076	c.10984_10997delGTGGTGCCCTACTT	c.(10984-10998)gtggtgccctacttcfs	p.VVPYF3662fs	HSPG2_ENST00000486901.1_5'Flank	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	3662	Ig-like C2-type 22.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GGTCTGCGTGAAGTAGGGCACCACCCGCTCTGCC	0.603																																					p.3662_3666del		.											.	HSPG2	141	0			c.10984_10997del						.																																			SO:0001589	frameshift_variant	3339	exon80			TGCGTGAAGTAGG	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.10984_10997delGTGGTGCCCTACTT	1.37:g.22159859_22159872delAAGTAGGGCACCAC	ENSP00000363827:p.Val3662fs	85.0	0.0		108.0	10.0	NM_005529	Q16287|Q5SZI3|Q9H3V5	Frame_Shift_Del	DEL	ENST00000374695.3	37	CCDS30625.1																																																																																			.		0.603	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
IFT172	26160	hgsc.bcm.edu;bcgsc.ca	37	2	27679434	27679434	+	Silent	SNP	T	T	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr2:27679434T>C	ENST00000260570.3	-	30	3418	c.3315A>G	c.(3313-3315)agA>agG	p.R1105R		NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	1105					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					TATTAAGCAGTCTAACTGCAG	0.562																																					p.R1105R		.											.	IFT172	154	0			c.A3315G						.						127.0	119.0	121.0					2																	27679434		2203	4300	6503	SO:0001819	synonymous_variant	26160	exon30			AAGCAGTCTAACT	AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.3315A>G	2.37:g.27679434T>C		74.0	0.0		81.0	4.0	NM_015662	A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Silent	SNP	ENST00000260570.3	37	CCDS1755.1																																																																																			.		0.562	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250213.2	NM_015662	
IGDCC3	9543	broad.mit.edu;ucsc.edu;mdanderson.org	37	15	65621829	65621829	+	Missense_Mutation	SNP	G	G	A	rs372129215		TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr15:65621829G>A	ENST00000327987.4	-	13	2355	c.2104C>T	c.(2104-2106)Cgg>Tgg	p.R702W	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	702					neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						AGCTGGCCCCGCTGTCCCCGT	0.652																																					p.R702W		.											.	IGDCC3	93	0			c.C2104T						.	G	TRP/ARG	1,4391		0,1,2195	39.0	46.0	44.0		2104	1.7	0.3	15		44	0,8578		0,0,4289	no	missense	IGDCC3	NM_004884.3	101	0,1,6484	AA,AG,GG		0.0,0.0228,0.0077	probably-damaging	702/815	65621829	1,12969	2196	4289	6485	SO:0001583	missense	9543	exon13			GGCCCCGCTGTCC	AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.2104C>T	15.37:g.65621829G>A	ENSP00000332773:p.Arg702Trp	28.0	1.0		39.0	6.0	NM_004884	O95215	Missense_Mutation	SNP	ENST00000327987.4	37	CCDS10205.1	.	.	.	.	.	.	.	.	.	.	G	8.938	0.965134	0.18583	2.28E-4	0.0	ENSG00000174498	ENST00000327987	T	0.66280	-0.2	5.81	1.69	0.24217	.	0.433998	0.21420	N	0.074838	T	0.41971	0.1182	N	0.24115	0.695	0.20563	N	0.999883	B	0.14438	0.01	B	0.06405	0.002	T	0.32348	-0.9910	10	0.72032	D	0.01	-6.7562	4.5816	0.12262	0.0738:0.1165:0.3664:0.4432	.	702	Q8IVU1	IGDC3_HUMAN	W	702	ENSP00000332773:R702W	ENSP00000332773:R702W	R	-	1	2	IGDCC3	63408882	0.898000	0.30612	0.309000	0.25155	0.143000	0.21401	0.859000	0.27858	0.062000	0.16340	0.555000	0.69702	CGG	.		0.652	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256826.1	NM_004884	
IKBKB	3551	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	42176090	42176090	+	Missense_Mutation	SNP	C	C	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr8:42176090C>G	ENST00000520810.1	+	13	1447	c.1261C>G	c.(1261-1263)Ctc>Gtc	p.L421V	IKBKB_ENST00000522147.1_Intron|IKBKB_ENST00000520835.1_Missense_Mutation_p.L419V|IKBKB_ENST00000416505.2_Missense_Mutation_p.L362V|IKBKB_ENST00000379708.3_Missense_Mutation_p.L198V	NM_001556.2	NP_001547.1	O14920	IKKB_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	421					B cell homeostasis (GO:0001782)|cellular response to tumor necrosis factor (GO:0071356)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cation channel activity (GO:2001259)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|serine phosphorylation of STAT protein (GO:0042501)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			breast(4)|lung(1)|ovary(2)|skin(1)	8	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Arsenic trioxide(DB01169)|Auranofin(DB00995)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	CAAGAGGAATCTCGCCTTCTT	0.527																																					p.L421V		.											.	IKBKB	1164	0			c.C1261G						.						87.0	84.0	85.0					8																	42176090		2203	4300	6503	SO:0001583	missense	3551	exon13			AGGAATCTCGCCT	AF029684	CCDS6128.1, CCDS55228.1, CCDS56535.1	8p11.2	2008-08-18			ENSG00000104365	ENSG00000104365			5960	protein-coding gene	gene with protein product		603258				9878263, 9763654	Standard	NM_001556		Approved	IKK2, NFKBIKB, IKK-beta, IKKB	uc003xow.2	O14920	OTTHUMG00000164092	ENST00000520810.1:c.1261C>G	8.37:g.42176090C>G	ENSP00000430684:p.Leu421Val	100.0	0.0		77.0	12.0	NM_001556	B4DZ30|B4E0U4|O75327	Missense_Mutation	SNP	ENST00000520810.1	37	CCDS6128.1	.	.	.	.	.	.	.	.	.	.	C	18.97	3.736000	0.69189	.	.	ENSG00000104365	ENST00000520810;ENST00000416505;ENST00000520835;ENST00000379708	D;D;D;T	0.83755	-1.62;-1.76;-1.58;1.89	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.90383	0.6990	M	0.79258	2.445	0.58432	D	0.999999	D;D;D;D;D	0.76494	0.999;0.997;0.997;0.995;0.995	D;D;D;P;D	0.78314	0.991;0.966;0.991;0.831;0.953	D	0.89706	0.3908	10	0.44086	T	0.13	-24.9799	14.2701	0.66147	0.0:0.927:0.0:0.073	.	362;419;198;372;421	B4E0U4;O14920-2;B3KRB7;Q59GL9;O14920	.;.;.;.;IKKB_HUMAN	V	421;362;419;198	ENSP00000430684:L421V;ENSP00000404920:L362V;ENSP00000430868:L419V;ENSP00000369030:L198V	ENSP00000369030:L198V	L	+	1	0	IKBKB	42295247	0.992000	0.36948	0.180000	0.23079	0.606000	0.37113	3.446000	0.52928	2.740000	0.93945	0.555000	0.69702	CTC	.		0.527	IKBKB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377214.1		
IL1F10	84639	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	113831957	113831957	+	Silent	SNP	G	G	T	rs199770962	byFrequency	TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr2:113831957G>T	ENST00000393197.2	+	2	505	c.84G>T	c.(82-84)ctG>ctT	p.L28L	IL1F10_ENST00000337569.3_Intron|IL1F10_ENST00000341010.2_Silent_p.L28L	NM_032556.5	NP_115945.4	Q8WWZ1	IL1FA_HUMAN	interleukin 1 family, member 10 (theta)	28						extracellular space (GO:0005615)				endometrium(1)|lung(6)|ovary(1)	8						GCCAGCTGCTGGTGGGAGATC	0.522													G|||	2	0.000399361	0.0	0.0	5008	,	,		21405	0.002		0.0	False		,,,				2504	0.0				p.L28L		.											.	IL1F10	91	0			c.G84T						.						112.0	100.0	104.0					2																	113831957		2203	4300	6503	SO:0001819	synonymous_variant	84639	exon3			GCTGCTGGTGGGA	AY026753	CCDS2112.1	2q13	2011-07-14			ENSG00000136697	ENSG00000136697		"""Interleukins and interleukin receptors"""	15552	protein-coding gene	gene with protein product	"""FIL1- theta"", ""interleukin-1 receptor antagonist FKSG75"""	615296				11747621, 11991723, 11991722	Standard	NM_173161		Approved	FKSG75, IL-1HY2, IL-1F10, IL1-theta, MGC11983, MGC119832, MGC119833	uc002tiu.3	Q8WWZ1	OTTHUMG00000131339	ENST00000393197.2:c.84G>T	2.37:g.113831957G>T		135.0	0.0		140.0	11.0	NM_173161	Q53SR9|Q56AT8|Q7RTZ5|Q969H5|Q9BYX1	Silent	SNP	ENST00000393197.2	37	CCDS2112.1																																																																																			G|0.999;T|0.001		0.522	IL1F10-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330725.1	NM_173161	
ITGA7	3679	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56088716	56088716	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr12:56088716C>T	ENST00000555728.1	-	16	2202	c.2174G>A	c.(2173-2175)gGg>gAg	p.G725E	ITGA7_ENST00000553804.1_Missense_Mutation_p.G685E|ITGA7_ENST00000394230.2_Missense_Mutation_p.G685E|ITGA7_ENST00000347027.6_Missense_Mutation_p.G675E|ITGA7_ENST00000394229.2_Missense_Mutation_p.G681E|ITGA7_ENST00000257879.6_Missense_Mutation_p.G681E|ITGA7_ENST00000257880.7_Missense_Mutation_p.G725E|ITGA7_ENST00000452168.2_Missense_Mutation_p.G588E			Q13683	ITA7_HUMAN	integrin, alpha 7	725					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						GACTGGCTGCCCACTCAGTGC	0.612																																					p.G685E		.											.	ITGA7	229	0			c.G2054A						.						52.0	52.0	52.0					12																	56088716		2203	4300	6503	SO:0001583	missense	3679	exon15			GGCTGCCCACTCA		CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.2174G>A	12.37:g.56088716C>T	ENSP00000452387:p.Gly725Glu	49.0	0.0		61.0	6.0	NM_001144996	B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Missense_Mutation	SNP	ENST00000555728.1	37		.	.	.	.	.	.	.	.	.	.	C	13.89	2.371490	0.42003	.	.	ENSG00000135424	ENST00000553804;ENST00000257879;ENST00000347027;ENST00000452168;ENST00000257880;ENST00000394230;ENST00000394229;ENST00000555728	T;T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86	4.95	4.95	0.65309	Integrin alpha-2 (1);	0.201844	0.42294	N	0.000730	T	0.44912	0.1316	L	0.43152	1.355	0.48901	D	0.999723	B;B;B;P	0.39601	0.007;0.368;0.017;0.68	B;B;B;P	0.44860	0.018;0.329;0.051;0.462	T	0.40997	-0.9533	10	0.49607	T	0.09	.	9.6719	0.40017	0.0:0.9039:0.0:0.0961	.	588;725;685;744	Q13683-13;Q13683;Q13683-3;Q4LE35	.;ITA7_HUMAN;.;.	E	685;681;675;588;725;685;681;725	ENSP00000452120:G685E;ENSP00000257879:G681E;ENSP00000343009:G675E;ENSP00000393844:G588E;ENSP00000257880:G725E;ENSP00000377777:G685E;ENSP00000377776:G681E;ENSP00000452387:G725E	ENSP00000257879:G681E	G	-	2	0	ITGA7	54374983	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.267000	0.58877	2.471000	0.83476	0.561000	0.74099	GGG	.		0.612	ITGA7-014	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000410138.1	NM_002206	
JAK1	3716	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	65335078	65335078	+	Missense_Mutation	SNP	T	T	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr1:65335078T>A	ENST00000342505.4	-	6	811	c.563A>T	c.(562-564)gAg>gTg	p.E188V		NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	188	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	CCCTAGACACTCGTTCTCAAT	0.512			Mis		ALL																																p.E188V		.		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	.	JAK1	3900	0			c.A563T						.						145.0	139.0	141.0					1																	65335078		2023	4191	6214	SO:0001583	missense	3716	exon6			AGACACTCGTTCT	M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.563A>T	1.37:g.65335078T>A	ENSP00000343204:p.Glu188Val	100.0	0.0		123.0	35.0	NM_002227	Q59GQ2|Q9UD26	Missense_Mutation	SNP	ENST00000342505.4	37	CCDS41346.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.665413	0.88251	.	.	ENSG00000162434	ENST00000342505	T	0.72725	-0.68	5.33	5.33	0.75918	FERM central domain (1);Band 4.1 domain (1);FERM domain (1);	.	.	.	.	D	0.83004	0.5160	M	0.85859	2.78	0.58432	D	0.999999	D	0.76494	0.999	D	0.83275	0.996	D	0.86395	0.1738	9	0.87932	D	0	.	15.6084	0.76692	0.0:0.0:0.0:1.0	.	188	P23458	JAK1_HUMAN	V	188	ENSP00000343204:E188V	ENSP00000343204:E188V	E	-	2	0	JAK1	65107666	1.000000	0.71417	0.999000	0.59377	0.767000	0.43475	7.676000	0.84012	2.152000	0.67230	0.533000	0.62120	GAG	.		0.512	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1	NM_002227	
KCND1	3750	hgsc.bcm.edu;bcgsc.ca	37	X	48823420	48823420	+	Silent	SNP	T	T	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chrX:48823420T>C	ENST00000218176.3	-	2	2512	c.1215A>G	c.(1213-1215)ccA>ccG	p.P405P	KCND1_ENST00000376477.1_Silent_p.P28P	NM_004979.4	NP_004970.3	Q9NSA2	KCND1_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 1	405					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	24					Dalfampridine(DB06637)	ACACAATGACTGGCACAGGCA	0.577																																					p.P405P		.											.	KCND1	133	0			c.A1215G						.						136.0	91.0	106.0					X																	48823420		2203	4300	6503	SO:0001819	synonymous_variant	3750	exon2			AATGACTGGCACA	AF166003	CCDS14314.1	Xp11.23	2012-07-05			ENSG00000102057	ENSG00000102057		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6237	protein-coding gene	gene with protein product		300281				10729221, 16382104	Standard	NM_004979		Approved	Kv4.1	uc004dlx.1	Q9NSA2	OTTHUMG00000024127	ENST00000218176.3:c.1215A>G	X.37:g.48823420T>C		82.0	0.0		88.0	6.0	NM_004979	A6NEF1|B2RCG0|O75671	Silent	SNP	ENST00000218176.3	37	CCDS14314.1																																																																																			.		0.577	KCND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060774.1	NM_004979	
KCNK9	51305	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	140630800	140630800	+	Missense_Mutation	SNP	G	G	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr8:140630800G>A	ENST00000520439.1	-	2	889	c.826C>T	c.(826-828)Cct>Tct	p.P276S	KCNK9_ENST00000303015.1_Missense_Mutation_p.P276S|KCNK9_ENST00000523477.1_5'Flank	NM_001282534.1	NP_001269463.1	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	276					cochlea development (GO:0090102)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			NS(1)|endometrium(9)|kidney(1)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)	43	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)		Doxapram(DB00561)|Halothane(DB01159)	GGCTCCTCAGGGATGTGAATG	0.637																																					p.P276S		.											.	KCNK9	93	0			c.C826T						.						46.0	52.0	50.0					8																	140630800		2203	4300	6503	SO:0001583	missense	51305	exon2			CCTCAGGGATGTG	AF212829	CCDS6377.1	8q24.3	2012-03-07			ENSG00000169427	ENSG00000169427		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6283	protein-coding gene	gene with protein product		605874				10734076, 16382106	Standard	NM_001282534		Approved	K2p9.1, TASK3, TASK-3	uc003yvf.1	Q9NPC2	OTTHUMG00000164186	ENST00000520439.1:c.826C>T	8.37:g.140630800G>A	ENSP00000430676:p.Pro276Ser	44.0	1.0		33.0	8.0	NM_016601	Q2M290|Q540F2	Missense_Mutation	SNP	ENST00000520439.1	37	CCDS6377.1	.	.	.	.	.	.	.	.	.	.	G	0.021	-1.420570	0.01136	.	.	ENSG00000169427	ENST00000522317;ENST00000303015;ENST00000520439	T;T;T	0.14893	2.47;2.47;2.47	5.76	1.86	0.25419	.	0.407307	0.25461	N	0.030520	T	0.06781	0.0173	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.42396	-0.9454	10	0.10111	T	0.7	.	8.0047	0.30319	0.1268:0.2486:0.6246:0.0	.	276	Q9NPC2	KCNK9_HUMAN	S	276	ENSP00000429847:P276S;ENSP00000302166:P276S;ENSP00000430676:P276S	ENSP00000302166:P276S	P	-	1	0	KCNK9	140699982	1.000000	0.71417	0.000000	0.03702	0.001000	0.01503	4.499000	0.60380	0.047000	0.15862	0.591000	0.81541	CCT	.		0.637	KCNK9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378473.1	NM_016601	
KDM2A	22992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66982895	66982895	+	Missense_Mutation	SNP	A	A	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr11:66982895A>T	ENST00000529006.2	+	7	1017	c.571A>T	c.(571-573)Atg>Ttg	p.M191L	KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000398645.2_Missense_Mutation_p.M191L	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	191	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						CATCTTGGAGATGCAGTACCC	0.478																																					p.M191L		.											.	KDM2A	661	0			c.A571T						.						101.0	98.0	99.0					11																	66982895		2001	4168	6169	SO:0001583	missense	22992	exon7			TTGGAGATGCAGT	BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.571A>T	11.37:g.66982895A>T	ENSP00000432786:p.Met191Leu	66.0	0.0		81.0	18.0	NM_012308	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Missense_Mutation	SNP	ENST00000529006.2	37	CCDS44657.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.390848	0.82902	.	.	ENSG00000173120	ENST00000398645;ENST00000529006	T;T	0.69435	-0.4;-0.4	5.76	5.76	0.90799	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.000000	0.85682	D	0.000000	T	0.60958	0.2309	L	0.55103	1.725	0.80722	D	1	B	0.30455	0.28	B	0.25987	0.065	T	0.58160	-0.7685	10	0.24483	T	0.36	-3.2157	15.2488	0.73526	1.0:0.0:0.0:0.0	.	191	Q9Y2K7	KDM2A_HUMAN	L	191	ENSP00000381640:M191L;ENSP00000432786:M191L	ENSP00000381640:M191L	M	+	1	0	KDM2A	66739471	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.942000	0.92970	2.201000	0.70794	0.533000	0.62120	ATG	.		0.478	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393140.2	NM_012308	
KIRREL	55243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158061246	158061246	+	Silent	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr1:158061246C>T	ENST00000359209.6	+	11	1438	c.1371C>T	c.(1369-1371)acC>acT	p.T457T	KIRREL_ENST00000368172.1_Silent_p.T271T|KIRREL_ENST00000368173.3_Silent_p.T473T|KIRREL_ENST00000392272.2_Silent_p.T354T|KIRREL_ENST00000360089.4_Silent_p.T293T|KIRREL_ENST00000416935.2_Silent_p.T357T			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	457	Ig-like C2-type 5.				excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)	p.T293T(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					CCACGCTCACCATCAACAATG	0.577																																					p.T457T		.											KIRREL,NS,carcinoma,0	KIRREL	91	1	Substitution - coding silent(1)	ovary(1)	c.C1371T						.						158.0	138.0	145.0					1																	158061246		2203	4300	6503	SO:0001819	synonymous_variant	55243	exon11			GCTCACCATCAAC	AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.1371C>T	1.37:g.158061246C>T		57.0	0.0		64.0	12.0	NM_018240	Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Silent	SNP	ENST00000359209.6	37	CCDS1172.2																																																																																			.		0.577	KIRREL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058342.3	NM_018240	
KRT86	3892	broad.mit.edu;ucsc.edu;mdanderson.org	37	12	52699516	52699516	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr12:52699516G>T	ENST00000423955.2	+	8	1148	c.970G>T	c.(970-972)Gag>Tag	p.E324*	KRT86_ENST00000544024.1_Nonsense_Mutation_p.E324*|KRT86_ENST00000293525.5_Nonsense_Mutation_p.E324*|RP11-845M18.6_ENST00000552441.1_RNA			O43790	KRT86_HUMAN	keratin 86	324	Coil 2.|Rod.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		GGAGATCAACGAGCTGAACCG	0.587																																					p.E324X		.											.	KRT86	91	0			c.G970T						.						128.0	113.0	118.0					12																	52699516		2203	4300	6503	SO:0001587	stop_gained	3892	exon6			ATCAACGAGCTGA	X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000423955.2:c.970G>T	12.37:g.52699516G>T	ENSP00000444533:p.Glu324*	93.0	1.0		127.0	24.0	NM_002284	P78387	Nonsense_Mutation	SNP	ENST00000423955.2	37	CCDS41785.1	.	.	.	.	.	.	.	.	.	.	G	38	7.122731	0.98077	.	.	ENSG00000170442;ENSG00000170442;ENSG00000170442;ENSG00000258832	ENST00000544024;ENST00000423955;ENST00000293525;ENST00000553310	.	.	.	4.73	4.73	0.59995	.	0.000000	0.44285	U	0.000464	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.8834	0.79222	0.0:0.0:1.0:0.0	.	.	.	.	X	324	.	ENSP00000293525:E324X	E	+	1	0	AC021066.1;KRT86	50985783	1.000000	0.71417	0.997000	0.53966	0.961000	0.63080	9.752000	0.98900	2.195000	0.70347	0.505000	0.49811	GAG	.		0.587	KRT86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404911.1	NM_002284	
KRTAP29-1	100533177	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	17	39459053	39459053	+	Silent	SNP	G	G	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr17:39459053G>A	ENST00000391353.1	-	1	50	c.51C>T	c.(49-51)ccC>ccT	p.P17P		NM_001257309.1	NP_001244238.1	A8MX34	KR291_HUMAN	keratin associated protein 29-1	17	7 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)											TGGTGATGGTGGGCACAGCTG	0.522																																					p.P17P		.											.	.	.	0			c.C51T						.																																			SO:0001819	synonymous_variant	100533177	exon1			GATGGTGGGCACA		CCDS62183.1	17q21.2	2013-06-20			ENSG00000212658	ENSG00000212658		"""Keratin associated proteins"""	34211	protein-coding gene	gene with protein product							Standard	NM_001257309		Approved	KAP29.2	uc031rai.1	A8MX34	OTTHUMG00000133662	ENST00000391353.1:c.51C>T	17.37:g.39459053G>A		57.0	0.0		58.0	13.0	NM_001257309		Silent	SNP	ENST00000391353.1	37																																																																																				.		0.522	KRTAP29-1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000257828.2		
LCE1E	353135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152759984	152759984	+	Missense_Mutation	SNP	C	C	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr1:152759984C>A	ENST00000368770.3	+	2	262	c.209C>A	c.(208-210)tCt>tAt	p.S70Y	LCE1E_ENST00000368771.1_Missense_Mutation_p.S70Y	NM_178353.1	NP_848130.1	Q5T753	LCE1E_HUMAN	late cornified envelope 1E	70	Cys-rich.				keratinization (GO:0031424)					lung(5)|stomach(1)	6	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGCTGCAGCTCTGGGGGAGGT	0.682																																					p.S70Y		.											.	LCE1E	90	0			c.C209A						.						35.0	44.0	41.0					1																	152759984		2203	4298	6501	SO:0001583	missense	353135	exon2			GCAGCTCTGGGGG	BC038391	CCDS1024.1	1q21.3	2008-02-05			ENSG00000186226	ENSG00000186226		"""Late cornified envelopes"""	29466	protein-coding gene	gene with protein product		612607				11698679	Standard	NM_178353		Approved	LEP5	uc001fan.3	Q5T753	OTTHUMG00000012405	ENST00000368770.3:c.209C>A	1.37:g.152759984C>A	ENSP00000357759:p.Ser70Tyr	134.0	0.0		95.0	46.0	NM_178353	D3DV30	Missense_Mutation	SNP	ENST00000368770.3	37	CCDS1024.1	.	.	.	.	.	.	.	.	.	.	C	9.777	1.174286	0.21704	.	.	ENSG00000186226	ENST00000368771;ENST00000368770	T;T	0.06294	3.32;3.32	4.06	4.06	0.47325	.	0.000000	0.34959	N	0.003545	T	0.17195	0.0413	M	0.87900	2.915	0.27825	N	0.941652	D	0.69078	0.997	D	0.78314	0.991	T	0.01360	-1.1375	10	0.87932	D	0	.	11.9094	0.52731	0.0:1.0:0.0:0.0	.	70	Q5T753	LCE1E_HUMAN	Y	70	ENSP00000357760:S70Y;ENSP00000357759:S70Y	ENSP00000357759:S70Y	S	+	2	0	LCE1E	151026608	0.996000	0.38824	1.000000	0.80357	0.773000	0.43773	1.958000	0.40402	2.237000	0.73441	0.514000	0.50259	TCT	.		0.682	LCE1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034525.1	NM_178353	
LCT	3938	hgsc.bcm.edu;bcgsc.ca	37	2	136566972	136566972	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr2:136566972C>T	ENST00000264162.2	-	8	2955	c.2945G>A	c.(2944-2946)cGg>cAg	p.R982Q	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	982	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TGGGAAAATCCGAGACCAGGA	0.498																																					p.R982Q		.											.	LCT	101	0			c.G2945A						.						74.0	79.0	77.0					2																	136566972		2203	4300	6503	SO:0001583	missense	3938	exon8			AAAATCCGAGACC	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.2945G>A	2.37:g.136566972C>T	ENSP00000264162:p.Arg982Gln	68.0	0.0		85.0	5.0	NM_002299	Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	C	32	5.188696	0.94923	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.61158	0.13	5.78	5.78	0.91487	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.047713	0.85682	D	0.000000	D	0.84853	0.5564	H	0.96365	3.81	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89003	0.3423	10	0.87932	D	0	-30.6945	20.0139	0.97470	0.0:1.0:0.0:0.0	.	982	P09848	LPH_HUMAN	Q	982;414	ENSP00000264162:R982Q	ENSP00000264162:R982Q	R	-	2	0	LCT	136283442	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.818000	0.86416	2.724000	0.93272	0.563000	0.77884	CGG	.		0.498	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299	
LOXL4	84171	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	100013493	100013493	+	Missense_Mutation	SNP	C	C	T	rs375427147		TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr10:100013493C>T	ENST00000260702.3	-	11	1802	c.1652G>A	c.(1651-1653)cGc>cAc	p.R551H	RP11-34A14.3_ENST00000433374.1_RNA	NM_032211.6	NP_115587.6	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4	551	Lysyl-oxidase like.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|receptor complex (GO:0043235)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(8)|ovary(4)|prostate(1)|skin(2)	26		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		GCTGAGCGGGCGGTCCTCCAA	0.627																																					p.R551H		.											.	LOXL4	230	0			c.G1652A						.	C	HIS/ARG	0,4406		0,0,2203	76.0	73.0	74.0		1652	4.9	1.0	10		74	1,8599	1.2+/-3.3	0,1,4299	no	missense	LOXL4	NM_032211.6	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	551/757	100013493	1,13005	2203	4300	6503	SO:0001583	missense	84171	exon11			AGCGGGCGGTCCT	AF338441	CCDS7473.1	10q24	2008-08-01			ENSG00000138131	ENSG00000138131			17171	protein-coding gene	gene with protein product		607318				11292829	Standard	XM_005270216		Approved	FLJ21889, LOXC	uc001kpa.1	Q96JB6	OTTHUMG00000018874	ENST00000260702.3:c.1652G>A	10.37:g.100013493C>T	ENSP00000260702:p.Arg551His	39.0	0.0		37.0	5.0	NM_032211	Q5W0B3|Q96DY1|Q96PC0|Q9H6T5	Missense_Mutation	SNP	ENST00000260702.3	37	CCDS7473.1	.	.	.	.	.	.	.	.	.	.	C	34	5.348214	0.95807	0.0	1.16E-4	ENSG00000138131	ENST00000260702	T	0.32753	1.44	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.64670	0.2619	M	0.91196	3.185	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73401	-0.3994	10	0.66056	D	0.02	.	16.9772	0.86316	0.0:1.0:0.0:0.0	.	551	Q96JB6	LOXL4_HUMAN	H	551	ENSP00000260702:R551H	ENSP00000260702:R551H	R	-	2	0	LOXL4	100003483	1.000000	0.71417	0.999000	0.59377	0.935000	0.57460	7.651000	0.83577	2.536000	0.85505	0.491000	0.48974	CGC	.		0.627	LOXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049766.1	NM_032211	
PLPPR3	79948	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	814544	814544	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr19:814544A>G	ENST00000520876.3	-	7	799	c.721T>C	c.(721-723)Ttt>Ctt	p.F241L	LPPR3_ENST00000359894.2_Missense_Mutation_p.F269L|MIR3187_ENST00000583431.1_RNA	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN		241						integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										GCGATGGCAAAGGCGAAGACC	0.647																																					p.F269L		.											.	.	.	0			c.T805C						.						60.0	61.0	61.0					19																	814544		2195	4300	6495	SO:0001583	missense	0	exon6			TGGCAAAGGCGAA																												ENST00000520876.3:c.721T>C	19.37:g.814544A>G	ENSP00000430297:p.Phe241Leu	32.0	0.0		32.0	4.0	NM_024888	Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Missense_Mutation	SNP	ENST00000520876.3	37	CCDS58636.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.1|24.1	4.491003|4.491003	0.84962|0.84962	.|.	.|.	ENSG00000129951|ENSG00000129951	ENST00000300947;ENST00000359894;ENST00000520876|ENST00000517665;ENST00000521445	T;T|.	0.72942|.	-0.7;-0.7|.	4.66|4.66	4.66|4.66	0.58398|0.58398	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.41604|0.41604	0.1166|0.1166	N|N	0.14661|0.14661	0.345|0.345	0.58432|0.58432	D|D	0.999991|0.999991	P;P;D|.	0.71674|.	0.92;0.884;0.998|.	P;P;D|.	0.80764|.	0.662;0.772;0.994|.	T|T	0.29882|0.29882	-0.9997|-0.9997	10|5	0.21540|.	T|.	0.41|.	-16.1034|-16.1034	13.2541|13.2541	0.60068|0.60068	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	242;241;269|.	Q6T4P5-2;Q6T4P5;Q6T4P5-3|.	.;LPPR3_HUMAN;.|.	L|P	242;269;241|29;190	ENSP00000352962:F269L;ENSP00000430297:F241L|.	ENSP00000300947:F242L|.	F|L	-|-	1|2	0|0	AC006273.1|AC006273.1	765544|765544	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.732000|0.732000	0.41865|0.41865	8.658000|8.658000	0.91110|0.91110	1.734000|1.734000	0.51633|0.51633	0.454000|0.454000	0.30748|0.30748	TTT|CTT	.		0.647	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379096.3		
LRP1	4035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57577928	57577928	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr12:57577928C>T	ENST00000243077.3	+	37	6456	c.5990C>T	c.(5989-5991)tCc>tTc	p.S1997F		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1997					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CTCAATGGCTCCTTCCGCTAC	0.592																																					p.S1997F		.											.	LRP1	596	0			c.C5990T						.						74.0	58.0	64.0					12																	57577928		2203	4300	6503	SO:0001583	missense	4035	exon37			ATGGCTCCTTCCG	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.5990C>T	12.37:g.57577928C>T	ENSP00000243077:p.Ser1997Phe	74.0	0.0		104.0	12.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	C	33	5.244038	0.95272	.	.	ENSG00000123384	ENST00000243077	D	0.96265	-3.96	4.84	4.84	0.62591	Six-bladed beta-propeller, TolB-like (1);	0.152639	0.43919	D	0.000507	D	0.98185	0.9400	M	0.86343	2.81	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	D	0.98316	1.0526	10	0.46703	T	0.11	.	16.9352	0.86201	0.0:1.0:0.0:0.0	.	1997	Q07954	LRP1_HUMAN	F	1997	ENSP00000243077:S1997F	ENSP00000243077:S1997F	S	+	2	0	LRP1	55864195	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.879000	0.69690	2.532000	0.85374	0.555000	0.69702	TCC	.		0.592	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
LRRC46	90506	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	45914305	45914305	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr17:45914305C>T	ENST00000269025.4	+	8	1148	c.785C>T	c.(784-786)cCt>cTt	p.P262L		NM_033413.3	NP_219481.1	Q96FV0	LRC46_HUMAN	leucine rich repeat containing 46	262										endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)	9						GAGACAGTCCCTGAGGCCGTC	0.647																																					p.P262L		.											.	LRRC46	91	0			c.C785T						.						80.0	85.0	83.0					17																	45914305		2203	4300	6503	SO:0001583	missense	90506	exon8			CAGTCCCTGAGGC		CCDS11518.1	17q21.32	2005-08-09				ENSG00000141294			25047	protein-coding gene	gene with protein product						12477932	Standard	NM_033413		Approved	MGC16309	uc002ima.3	Q96FV0		ENST00000269025.4:c.785C>T	17.37:g.45914305C>T	ENSP00000269025:p.Pro262Leu	86.0	0.0		114.0	6.0	NM_033413	A8K9Q0	Missense_Mutation	SNP	ENST00000269025.4	37	CCDS11518.1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.299764	0.40694	.	.	ENSG00000141294	ENST00000269025	T	0.74526	-0.85	4.98	2.97	0.34412	.	0.462400	0.18525	N	0.138655	T	0.68201	0.2975	M	0.68317	2.08	0.09310	N	1	B;B	0.30068	0.267;0.267	B;B	0.28139	0.086;0.086	T	0.63107	-0.6711	10	0.87932	D	0	-2.1674	6.3328	0.21279	0.1825:0.7229:0.0:0.0946	.	262;262	A8K9Q0;Q96FV0	.;LRC46_HUMAN	L	262	ENSP00000269025:P262L	ENSP00000269025:P262L	P	+	2	0	LRRC46	43269304	0.001000	0.12720	0.001000	0.08648	0.151000	0.21798	0.347000	0.20014	0.617000	0.30160	0.551000	0.68910	CCT	.		0.647	LRRC46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441377.1	NM_033413	
LTV1	84946	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	144184607	144184607	+	Silent	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr6:144184607A>G	ENST00000367576.5	+	11	1505	c.1371A>G	c.(1369-1371)agA>agG	p.R457R	ZC2HC1B_ENST00000539295.1_5'Flank|ZC2HC1B_ENST00000237275.6_5'Flank	NM_032860.3	NP_116249.2	Q96GA3	LTV1_HUMAN	LTV1 ribosome biogenesis factor	457						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(155;2.72e-06)|GBM - Glioblastoma multiforme(68;0.0372)		TGGAGAAAAGAAGGCAAGAAA	0.378																																					p.R457R		.											.	LTV1	91	0			c.A1371G						.						99.0	98.0	99.0					6																	144184607		2203	4300	6503	SO:0001819	synonymous_variant	84946	exon11			GAAAAGAAGGCAA	BC009855	CCDS5201.1	6q24.2	2014-02-03	2014-02-03	2006-02-06	ENSG00000135521	ENSG00000135521			21173	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 93"", ""LTV1 homolog (S. cerevisiae)"""	C6orf93			Standard	NM_032860		Approved	FLJ14909, dJ468K18.4	uc003qjs.3	Q96GA3	OTTHUMG00000015733	ENST00000367576.5:c.1371A>G	6.37:g.144184607A>G		201.0	0.0		260.0	77.0	NM_032860	Q96JX8	Silent	SNP	ENST00000367576.5	37	CCDS5201.1																																																																																			.		0.378	LTV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042532.1	NM_032860	
MAP4K5	11183	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	50923302	50923302	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr14:50923302A>G	ENST00000013125.4	-	14	1265	c.947T>C	c.(946-948)aTc>aCc	p.I316T	RP11-406H23.2_ENST00000555257.1_lincRNA	NM_006575.4|NM_198794.2	NP_006566.2|NP_942089.1	Q9Y4K4	M4K5_HUMAN	mitogen-activated protein kinase kinase kinase kinase 5	316					activation of JUN kinase activity (GO:0007257)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	all_epithelial(31;0.000415)|Breast(41;0.0102)					ATGACGAATGATTGCATGGGG	0.318																																					p.I316T		.											.	MAP4K5	546	0			c.T947C						.						64.0	59.0	61.0					14																	50923302		1844	4086	5930	SO:0001583	missense	11183	exon14			CGAATGATTGCAT	U77129		14q11.2-q21	2011-06-09				ENSG00000012983		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6867	protein-coding gene	gene with protein product	"""germinal center kinase-related"""	604923				9038372, 8274451	Standard	NM_198794		Approved	KHS1, GCKR, KHS	uc001wyb.3	Q9Y4K4		ENST00000013125.4:c.947T>C	14.37:g.50923302A>G	ENSP00000013125:p.Ile316Thr	64.0	0.0		127.0	7.0	NM_006575	Q8IYF6	Missense_Mutation	SNP	ENST00000013125.4	37		.	.	.	.	.	.	.	.	.	.	A	16.33	3.092439	0.55968	.	.	ENSG00000012983	ENST00000013125	T	0.12984	2.63	5.8	5.8	0.92144	Protein kinase-like domain (1);	0.427648	0.27773	N	0.017917	T	0.08802	0.0218	N	0.14661	0.345	0.30483	N	0.772132	B;B	0.12013	0.0;0.005	B;B	0.09377	0.0;0.004	T	0.13495	-1.0507	10	0.12430	T	0.62	.	15.1301	0.72517	1.0:0.0:0.0:0.0	.	316;316	B2R928;Q9Y4K4	.;M4K5_HUMAN	T	316	ENSP00000013125:I316T	ENSP00000013125:I316T	I	-	2	0	MAP4K5	49993052	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.751000	0.62169	2.213000	0.71641	0.528000	0.53228	ATC	.		0.318	MAP4K5-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000410880.1	NM_006575	
MICAL3	57553	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	18299504	18299504	+	Silent	SNP	G	G	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr22:18299504G>C	ENST00000441493.2	-	27	5749	c.5397C>G	c.(5395-5397)ctC>ctG	p.L1799L	MICAL3_ENST00000580469.1_5'Flank	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1799					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		CGTCGCTGGAGAGGTCTGAGT	0.642																																					p.L1799L		.											.	MICAL3	68	0			c.C5397G						.						22.0	27.0	26.0					22																	18299504		2004	4117	6121	SO:0001819	synonymous_variant	57553	exon27			GCTGGAGAGGTCT	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.5397C>G	22.37:g.18299504G>C		23.0	1.0		31.0	14.0	NM_015241	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Silent	SNP	ENST00000441493.2	37	CCDS46659.1	.	.	.	.	.	.	.	.	.	.	G	1.387	-0.581946	0.03827	.	.	ENSG00000093100	ENST00000252134	.	.	.	5.7	-2.78	0.05859	.	.	.	.	.	T	0.66954	0.2842	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66329	-0.5951	4	.	.	.	.	16.7028	0.85363	0.1157:0.6938:0.1904:0.0	.	.	.	.	C	781	.	.	S	-	2	0	XXbac-B461K10.4	16679504	0.930000	0.31532	0.975000	0.42487	0.058000	0.15608	0.043000	0.13971	-0.599000	0.05798	-0.882000	0.02950	TCT	.		0.642	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
MORC1	27136	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	108723940	108723940	+	Missense_Mutation	SNP	C	C	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr3:108723940C>A	ENST00000483760.1	-	18	1970	c.1927G>T	c.(1927-1929)Gtc>Ttc	p.V643F	MORC1_ENST00000232603.5_Missense_Mutation_p.V664F					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						GCTAGTTTGACATTTTCTGGC	0.338																																					p.V664F		.											.	MORC1	98	0			c.G1990T						.						96.0	100.0	99.0					3																	108723940		2203	4300	6503	SO:0001583	missense	27136	exon19			GTTTGACATTTTC	AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.1927G>T	3.37:g.108723940C>A	ENSP00000417282:p.Val643Phe	108.0	0.0		119.0	25.0	NM_014429		Missense_Mutation	SNP	ENST00000483760.1	37		.	.	.	.	.	.	.	.	.	.	C	15.09	2.729876	0.48833	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	T;T	0.08193	3.14;3.12	4.44	-0.535	0.11879	.	0.929268	0.08916	N	0.875125	T	0.04679	0.0127	L	0.27053	0.805	0.09310	N	1	P;P	0.40476	0.718;0.718	B;B	0.33690	0.168;0.168	T	0.38542	-0.9656	10	0.33940	T	0.23	0.1732	4.2726	0.10794	0.0:0.4279:0.1757:0.3964	.	643;664	E7ERX1;Q86VD1	.;MORC1_HUMAN	F	664;643	ENSP00000232603:V664F;ENSP00000417282:V643F	ENSP00000232603:V664F	V	-	1	0	MORC1	110206630	0.000000	0.05858	0.000000	0.03702	0.740000	0.42216	-0.877000	0.04197	-0.114000	0.11936	0.557000	0.71058	GTC	.		0.338	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1		
MS4A6A	64231	hgsc.bcm.edu;bcgsc.ca	37	11	59947379	59947379	+	Silent	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr11:59947379A>G	ENST00000530839.1	-	4	699	c.207T>C	c.(205-207)gcT>gcC	p.A69A	MS4A6A_ENST00000528851.1_Silent_p.A69A|MS4A6A_ENST00000529054.1_Silent_p.A97A|MS4A6A_ENST00000323961.3_Silent_p.A69A|MS4A6A_ENST00000529906.1_5'UTR|MS4A6A_ENST00000420732.2_Silent_p.A69A|MS4A6A_ENST00000426738.2_Intron|MS4A6A_ENST00000532169.1_Silent_p.A69A|MS4A6A_ENST00000533023.1_Intron|MS4A6A_ENST00000412309.2_Silent_p.A97A	NM_152852.2	NP_690591.1	Q9H2W1	M4A6A_HUMAN	membrane-spanning 4-domains, subfamily A, member 6A	69						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GAGAGAAGGAAGCAGATGCCA	0.438																																					p.A97A		.											.	MS4A6A	90	0			c.T291C						.						100.0	92.0	95.0					11																	59947379		2201	4295	6496	SO:0001819	synonymous_variant	64231	exon4			GAAGGAAGCAGAT	AB013104	CCDS7981.1, CCDS44615.1, CCDS44616.1, CCDS58134.1	11q12.1	2008-03-25			ENSG00000110077	ENSG00000110077			13375	protein-coding gene	gene with protein product		606548		MS4A6		11245982, 11401424	Standard	NM_152852		Approved	CD20L3	uc010rla.2	Q9H2W1	OTTHUMG00000167241	ENST00000530839.1:c.207T>C	11.37:g.59947379A>G		95.0	0.0		121.0	5.0	NM_001247999	A8K755|F8W9K1|Q7Z4E8|Q8TBV7|Q8TEZ4|Q8TEZ5|Q96PG6|Q9H2L1|Q9H2N3|Q9H3V1|Q9HC76	Silent	SNP	ENST00000530839.1	37	CCDS7981.1																																																																																			.		0.438	MS4A6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393848.1		
MSRB2	22921	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	23393130	23393130	+	Missense_Mutation	SNP	C	C	G	rs201493683		TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr10:23393130C>G	ENST00000376510.3	+	2	279	c.176C>G	c.(175-177)aCc>aGc	p.T59S		NM_012228.3	NP_036360.3	Q9Y3D2	MSRB2_HUMAN	methionine sulfoxide reductase B2	59					actin filament polymerization (GO:0030041)|protein repair (GO:0030091)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)	actin binding (GO:0003779)|peptide-methionine (R)-S-oxide reductase activity (GO:0033743)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(1)	9					L-Methionine(DB00134)	AAGAAACTAACCCCGGAGCAG	0.443																																					p.T59S	Esophageal Squamous(89;1240 1363 4973 30188 42299)	.											.	MSRB2	90	0			c.C176G						.						83.0	81.0	82.0					10																	23393130		1908	4129	6037	SO:0001583	missense	22921	exon2			AACTAACCCCGGA	AF122004	CCDS41495.1	10p12	2004-12-07	2004-12-06	2004-12-07	ENSG00000148450	ENSG00000148450			17061	protein-coding gene	gene with protein product		613782	"""methionine sulfoxide reductase B"""	MSRB		8749308, 10375640	Standard	NM_012228		Approved	PILB, CGI-131, CBS1, CBS-1	uc001iro.3	Q9Y3D2	OTTHUMG00000017812	ENST00000376510.3:c.176C>G	10.37:g.23393130C>G	ENSP00000365693:p.Thr59Ser	101.0	0.0		117.0	25.0	NM_012228	Q17R44|Q4G1C7|Q9Y5W6	Missense_Mutation	SNP	ENST00000376510.3	37	CCDS41495.1	.	.	.	.	.	.	.	.	.	.	C	16.35	3.097652	0.56075	.	.	ENSG00000148450	ENST00000376510	T	0.78003	-1.14	4.79	3.88	0.44766	Mss4-like (1);Methionine sulphoxide reductase B (3);	0.053873	0.64402	D	0.000001	T	0.69450	0.3112	L	0.33710	1.025	0.36486	D	0.868135	B	0.25235	0.121	B	0.34590	0.186	T	0.71567	-0.4554	10	0.51188	T	0.08	-1.569	9.252	0.37560	0.0:0.897:0.0:0.103	.	59	Q9Y3D2	MSRB2_HUMAN	S	59	ENSP00000365693:T59S	ENSP00000365693:T59S	T	+	2	0	MSRB2	23433136	0.993000	0.37304	0.997000	0.53966	0.869000	0.49853	2.713000	0.47194	1.325000	0.45301	0.557000	0.71058	ACC	C|0.999;T|0.001		0.443	MSRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047205.1	NM_012228	
MUC4	4585	hgsc.bcm.edu;broad.mit.edu	37	3	195511811	195511811	+	Missense_Mutation	SNP	G	G	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr3:195511811G>T	ENST00000463781.3	-	2	7099	c.6640C>A	c.(6640-6642)Cct>Act	p.P2214T	MUC4_ENST00000475231.1_Missense_Mutation_p.P2214T|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGGGCTGGTGACA	0.597																																					p.P2214T		.											.	MUC4	90	0			c.C6640A						.						40.0	33.0	35.0					3																	195511811		690	1590	2280	SO:0001583	missense	4585	exon2			AGGAAGGGCTGGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6640C>A	3.37:g.195511811G>T	ENSP00000417498:p.Pro2214Thr	139.0	0.0		118.0	6.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	T	3.380	-0.126487	0.06795	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30981	1.51;1.52	.	.	.	.	.	.	.	.	T	0.12178	0.0296	N	0.19112	0.55	0.18873	N	0.999982	B	0.14805	0.011	B	0.04013	0.001	T	0.22243	-1.0222	6	.	.	.	.	.	.	.	.	2214	E7ESK3	.	T	2214	ENSP00000417498:P2214T;ENSP00000420243:P2214T	.	P	-	1	0	MUC4	196996206	0.000000	0.05858	0.010000	0.14722	0.013000	0.08279	-2.224000	0.01213	-2.656000	0.00421	-2.446000	0.00210	CCT	CGT|0.250;GGC|0.250;GGCT|0.250;TGTC|0.250		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MXRA5	25878	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	3241431	3241431	+	Missense_Mutation	SNP	A	A	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chrX:3241431A>T	ENST00000217939.6	-	5	2449	c.2295T>A	c.(2293-2295)ttT>ttA	p.F765L		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	765						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GTCTAGATTCAAACACTCTGC	0.448																																					p.F765L		.											.	MXRA5	136	0			c.T2295A						.						123.0	107.0	113.0					X																	3241431		2203	4300	6503	SO:0001583	missense	25878	exon5			AGATTCAAACACT	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.2295T>A	X.37:g.3241431A>T	ENSP00000217939:p.Phe765Leu	280.0	0.0		210.0	81.0	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	a	10.84	1.462709	0.26248	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.64618	-0.11	3.63	-3.24	0.05094	.	0.000000	0.41605	U	0.000852	T	0.46268	0.1384	L	0.32530	0.975	0.25647	N	0.986139	B	0.15719	0.014	B	0.12156	0.007	T	0.28808	-1.0032	10	0.52906	T	0.07	.	12.7505	0.57306	0.8856:0.0:0.1144:0.0	.	765	Q9NR99	MXRA5_HUMAN	L	765	ENSP00000217939:F765L	ENSP00000217939:F765L	F	-	3	2	MXRA5	3251431	1.000000	0.71417	0.021000	0.16686	0.029000	0.11900	0.786000	0.26844	-0.933000	0.03737	-0.395000	0.06472	TTT	.		0.448	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
MYH10	4628	hgsc.bcm.edu;bcgsc.ca	37	17	8480586	8480586	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr17:8480586A>G	ENST00000269243.4	-	5	739	c.601T>C	c.(601-603)Tca>Cca	p.S201P	MYH10_ENST00000379980.4_Missense_Mutation_p.S201P|MYH10_ENST00000360416.3_Missense_Mutation_p.S201P|MYH10_ENST00000396239.1_Missense_Mutation_p.S201P	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	201	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						CCTTTATGTGAAGAAGCAACA	0.343																																					p.S201P		.											.	MYH10	92	0			c.T601C						.						114.0	116.0	116.0					17																	8480586		2203	4300	6503	SO:0001583	missense	4628	exon5			TATGTGAAGAAGC	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.601T>C	17.37:g.8480586A>G	ENSP00000269243:p.Ser201Pro	89.0	0.0		87.0	4.0	NM_005964	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	ENST00000269243.4	37	CCDS11144.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.842738	0.91197	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	D;D;D;D	0.89123	-2.47;-2.47;-2.47;-2.47	5.01	5.01	0.66863	Myosin head, motor domain (2);	0.060192	0.64402	D	0.000002	D	0.93164	0.7823	M	0.75085	2.285	0.80722	D	1	P;D;B	0.53312	0.595;0.959;0.452	P;P;P	0.61397	0.868;0.888;0.778	D	0.93742	0.7051	10	0.62326	D	0.03	.	14.8427	0.70237	1.0:0.0:0.0:0.0	.	201;201;201	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	P	201	ENSP00000269243:S201P;ENSP00000353590:S201P;ENSP00000379539:S201P;ENSP00000369315:S201P	ENSP00000269243:S201P	S	-	1	0	MYH10	8421311	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.776000	0.91776	2.223000	0.72356	0.533000	0.62120	TCA	.		0.343	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2		
MYCBPAP	84073	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	48603556	48603556	+	Silent	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr17:48603556C>T	ENST00000323776.5	+	14	2388	c.2226C>T	c.(2224-2226)agC>agT	p.S742S	MYCBPAP_ENST00000436259.2_Silent_p.S705S	NM_032133.4	NP_115509.4			MYCBP associated protein											breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			ATGTGGACAGCACCAAGAGCC	0.602																																					p.S742S		.											.	MYCBPAP	230	0			c.C2226T						.						90.0	94.0	92.0					17																	48603556		2203	4300	6503	SO:0001819	synonymous_variant	84073	exon14			GGACAGCACCAAG	BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.2226C>T	17.37:g.48603556C>T		55.0	0.0		65.0	22.0	NM_032133		Silent	SNP	ENST00000323776.5	37	CCDS32680.2																																																																																			.		0.602	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347814.1	NM_032133	
NCAM1	4684	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	113085206	113085206	+	Silent	SNP	T	T	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr11:113085206T>A	ENST00000533760.1	+	8	1277	c.678T>A	c.(676-678)tcT>tcA	p.S226S	NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000316851.7_Silent_p.S334S|NCAM1_ENST00000401611.2_Silent_p.S343S	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	344	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		GGAGGACTTCTACCCGGAACA	0.522																																					p.S344S		.											.	NCAM1	23	0			c.T1032A						.						60.0	62.0	61.0					11																	113085206		1914	4123	6037	SO:0001819	synonymous_variant	4684	exon9			GACTTCTACCCGG		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.678T>A	11.37:g.113085206T>A		81.0	0.0		112.0	11.0	NM_001242608	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Silent	SNP	ENST00000533760.1	37																																																																																				.		0.522	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615	
NXPE3	91775	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	101540640	101540640	+	Missense_Mutation	SNP	A	A	G	rs200530322		TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr3:101540640A>G	ENST00000491511.2	+	8	2478	c.1522A>G	c.(1522-1524)Atc>Gtc	p.I508V	NXPE3_ENST00000477909.1_Missense_Mutation_p.I508V|NXPE3_ENST00000422132.1_Missense_Mutation_p.I508V|RP11-49I4.3_ENST00000490324.2_RNA|NXPE3_ENST00000273347.5_Missense_Mutation_p.I508V	NM_001134456.1	NP_001127928.1	Q969Y0	NXPE3_HUMAN	neurexophilin and PC-esterase domain family, member 3	508						extracellular region (GO:0005576)											GCTGGACACCATCCTTCGGAG	0.557													A|||	1	0.000199681	0.0008	0.0	5008	,	,		20066	0.0		0.0	False		,,,				2504	0.0				p.I508V		.											.	.	.	0			c.A1522G						.						110.0	105.0	107.0					3																	101540640		2203	4300	6503	SO:0001583	missense	91775	exon8			GACACCATCCTTC	AK054664	CCDS2945.1	3q12.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000144815	ENSG00000144815			28238	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member C"""	FAM55C		12975309	Standard	NM_001134456		Approved	MGC15606	uc003dvn.3	Q969Y0	OTTHUMG00000159179	ENST00000491511.2:c.1522A>G	3.37:g.101540640A>G	ENSP00000417485:p.Ile508Val	141.0	1.0		156.0	42.0	NM_145037	A8K0X4|D3DN53|Q7Z2S8	Missense_Mutation	SNP	ENST00000491511.2	37	CCDS2945.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	A	2.370	-0.344508	0.05208	.	.	ENSG00000144815	ENST00000273347;ENST00000491511;ENST00000477909;ENST00000422132	T;T;T;T	0.17528	2.27;2.27;2.27;2.27	6.03	-2.54	0.06307	.	0.331384	0.35772	N	0.002998	T	0.05686	0.0149	N	0.02751	-0.505	0.09310	N	0.999996	B	0.02656	0.0	B	0.01281	0.0	T	0.37596	-0.9699	10	0.08179	T	0.78	-5.3518	14.6697	0.68934	0.3815:0.0:0.6185:0.0	.	508	Q969Y0	FA55C_HUMAN	V	508	ENSP00000273347:I508V;ENSP00000417485:I508V;ENSP00000418369:I508V;ENSP00000396421:I508V	ENSP00000273347:I508V	I	+	1	0	FAM55C	103023330	0.178000	0.23122	0.220000	0.23810	0.981000	0.71138	0.159000	0.16442	-0.417000	0.07461	0.533000	0.62120	ATC	A|1.000;G|0.000		0.557	NXPE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353711.2	NM_145037	
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	228511085	228511085	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr1:228511085A>G	ENST00000422127.1	+	56	15474	c.15430A>G	c.(15430-15432)Agc>Ggc	p.S5144G	OBSCN_ENST00000366709.4_Missense_Mutation_p.S2263G|OBSCN_ENST00000366707.4_Missense_Mutation_p.S2778G|OBSCN_ENST00000570156.2_Missense_Mutation_p.S6101G|OBSCN_ENST00000284548.11_Missense_Mutation_p.S5144G	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5144	Ig-like 49.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GTATCCTGTGAGCTTTGACTG	0.517																																					p.S6101G		.											.	OBSCN	403	0			c.A18301G						.						75.0	77.0	77.0					1																	228511085		2130	4228	6358	SO:0001583	missense	84033	exon67			CCTGTGAGCTTTG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.15430A>G	1.37:g.228511085A>G	ENSP00000409493:p.Ser5144Gly	90.0	0.0		122.0	5.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	A	28.5	4.928582	0.92389	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31	5.07	5.07	0.68467	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.81612	0.4859	M	0.79926	2.475	0.39861	D	0.973371	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.82673	-0.0341	10	0.36615	T	0.2	.	14.9992	0.71459	1.0:0.0:0.0:0.0	.	5144;5144	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	G	5144;5144;2778;2263	ENSP00000284548:S5144G;ENSP00000409493:S5144G;ENSP00000355668:S2778G;ENSP00000355670:S2263G	ENSP00000284548:S5144G	S	+	1	0	OBSCN	226577708	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	7.073000	0.76784	2.125000	0.65367	0.533000	0.62120	AGC	.		0.517	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
ODF2	4957	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	131256869	131256872	+	Frame_Shift_Del	DEL	TGAG	TGAG	-			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	TGAG	TGAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr9:131256869_131256872delTGAG	ENST00000434106.3	+	17	2196_2199	c.1833_1836delTGAG	c.(1831-1836)gctgagfs	p.AE611fs	ODF2_ENST00000448249.3_Frame_Shift_Del_p.AE530fs|ODF2_ENST00000444119.2_Frame_Shift_Del_p.AE587fs|ODF2_ENST00000604420.1_Frame_Shift_Del_p.AE611fs|ODF2_ENST00000372791.3_Frame_Shift_Del_p.AE592fs|ODF2_ENST00000393527.3_Frame_Shift_Del_p.AE587fs|ODF2_ENST00000372814.3_Frame_Shift_Del_p.AE655fs|ODF2_ENST00000372807.5_Frame_Shift_Del_p.AE606fs|ODF2_ENST00000351030.3_Frame_Shift_Del_p.AE606fs|ODF2_ENST00000393533.2_Frame_Shift_Del_p.AE611fs|ODF2_ENST00000546203.1_Frame_Shift_Del_p.AE592fs	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	611					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)	p.E588G(1)|p.E656G(1)|p.E612G(1)		autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						CGAAGCTGGCTGAGTGCCAAGACC	0.578																																					p.675_676del		.											.	ODF2	69	3	Substitution - Missense(3)	kidney(3)	c.2025_2028del						.																																			SO:0001589	frameshift_variant	4957	exon17			GCTGGCTGAGTGC	AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.1833_1836delTGAG	9.37:g.131256869_131256872delTGAG	ENSP00000403453:p.Ala611fs	63.0	0.0		102.0	22.0	NM_153435	B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Frame_Shift_Del	DEL	ENST00000434106.3	37	CCDS56588.1																																																																																			.		0.578	ODF2-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054449.3		
OPCML	4978	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	132527021	132527021	+	Missense_Mutation	SNP	T	T	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr11:132527021T>A	ENST00000331898.7	-	2	939	c.361A>T	c.(361-363)Aat>Tat	p.N121Y	OPCML_ENST00000524381.1_Missense_Mutation_p.N114Y|OPCML_ENST00000529038.1_5'UTR|OPCML_ENST00000374778.4_Missense_Mutation_p.N80Y|OPCML_ENST00000541867.1_Missense_Mutation_p.N121Y	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	121	Ig-like C2-type 1.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)			endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		TTGGGATGATTGTCTGTCTGC	0.502																																					p.N121Y		.											.	OPCML	93	0			c.A361T						.						220.0	181.0	194.0					11																	132527021		2201	4297	6498	SO:0001583	missense	4978	exon2			GATGATTGTCTGT	BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.361A>T	11.37:g.132527021T>A	ENSP00000330862:p.Asn121Tyr	175.0	0.0		243.0	54.0	NM_002545	B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Missense_Mutation	SNP	ENST00000331898.7	37	CCDS8492.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.795007	0.90453	.	.	ENSG00000183715	ENST00000331898;ENST00000524381;ENST00000374778;ENST00000416724;ENST00000541867	T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19	5.83	5.83	0.93111	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.052133	0.85682	D	0.000000	T	0.77280	0.4107	M	0.70275	2.135	0.52099	D	0.999949	D;D;D;D	0.58620	0.966;0.983;0.966;0.966	D;P;P;P	0.64321	0.924;0.908;0.889;0.842	T	0.79713	-0.1688	10	0.72032	D	0.01	-20.5804	16.1846	0.81942	0.0:0.0:0.0:1.0	.	121;114;121;121	B7ZLQ1;Q7Z3W6;B7ZLQ0;Q14982	.;.;.;OPCM_HUMAN	Y	121;114;80;88;121	ENSP00000330862:N121Y;ENSP00000434750:N114Y;ENSP00000363910:N80Y;ENSP00000445496:N121Y	ENSP00000330862:N121Y	N	-	1	0	OPCML	132032231	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.190000	0.72057	2.229000	0.72834	0.533000	0.62120	AAT	.		0.502	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374689.3	NM_001012393	
OPLAH	26873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	145112137	145112137	+	Silent	SNP	C	C	T	rs546232581		TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr8:145112137C>T	ENST00000426825.1	-	11	1590	c.1509G>A	c.(1507-1509)ctG>ctA	p.L503L	OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	503					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGTCCATGCCCAGGGCCCGGG	0.657																																					p.L503L		.											.	OPLAH	68	0			c.G1509A						.						20.0	25.0	23.0					8																	145112137		2128	4227	6355	SO:0001819	synonymous_variant	26873	exon11			CATGCCCAGGGCC	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.1509G>A	8.37:g.145112137C>T		77.0	0.0		43.0	9.0	NM_017570	A5PKY8|Q75W65|Q9Y4Q0	Silent	SNP	ENST00000426825.1	37																																																																																				.		0.657	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017570	
OR51G2	81282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4936238	4936238	+	Missense_Mutation	SNP	A	A	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr11:4936238A>C	ENST00000322013.3	-	1	684	c.656T>G	c.(655-657)aTc>aGc	p.I219S	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005238.1	NP_001005238.1	Q8NGK0	O51G2_HUMAN	olfactory receptor, family 51, subfamily G, member 2	219						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|large_intestine(9)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGAGAAGAGGATGAGCAGTGA	0.517																																					p.I219S		.											.	OR51G2	70	0			c.T656G						.						144.0	113.0	123.0					11																	4936238		2201	4298	6499	SO:0001583	missense	81282	exon1			AAGAGGATGAGCA	AB065794	CCDS31365.1	11p15.4	2012-08-09			ENSG00000176893	ENSG00000176893		"""GPCR / Class A : Olfactory receptors"""	15198	protein-coding gene	gene with protein product							Standard	NM_001005238		Approved		uc001lzr.1	Q8NGK0	OTTHUMG00000066501	ENST00000322013.3:c.656T>G	11.37:g.4936238A>C	ENSP00000322593:p.Ile219Ser	101.0	0.0		116.0	32.0	NM_001005238	Q6IFH7	Missense_Mutation	SNP	ENST00000322013.3	37	CCDS31365.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.160945	0.78226	.	.	ENSG00000176893	ENST00000322013	T	0.00333	8.07	5.58	5.58	0.84498	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000092	T	0.01661	0.0053	H	0.98199	4.17	0.53688	D	0.999978	D	0.89917	1.0	D	0.91635	0.999	T	0.08066	-1.0740	10	0.87932	D	0	.	14.7226	0.69317	1.0:0.0:0.0:0.0	.	219	Q8NGK0	O51G2_HUMAN	S	219	ENSP00000322593:I219S	ENSP00000322593:I219S	I	-	2	0	OR51G2	4892814	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	5.806000	0.69150	2.343000	0.79666	0.533000	0.62120	ATC	.		0.517	OR51G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142174.1	NM_001005238	
OR51I1	390063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5462447	5462447	+	Missense_Mutation	SNP	G	G	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr11:5462447G>T	ENST00000380211.1	-	1	297	c.298C>A	c.(298-300)Ctg>Atg	p.L100M	HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron	NM_001005288.2	NP_001005288.1	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I, member 1	100					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L100L(1)		central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATCTGGACCAGGCAAGCATTA	0.453																																					p.L100M		.											.	OR51I1	69	1	Substitution - coding silent(1)	lung(1)	c.C298A						.						140.0	123.0	129.0					11																	5462447		2201	4297	6498	SO:0001583	missense	390063	exon1			GGACCAGGCAAGC	BK004429	CCDS31382.1	11p15.4	2012-08-09			ENSG00000167359	ENSG00000167359		"""GPCR / Class A : Olfactory receptors"""	15200	protein-coding gene	gene with protein product							Standard	NM_001005288		Approved		uc010qze.2	Q9H343	OTTHUMG00000066908	ENST00000380211.1:c.298C>A	11.37:g.5462447G>T	ENSP00000369559:p.Leu100Met	89.0	0.0		139.0	37.0	NM_001005288	B9EKW2|Q6IF33	Missense_Mutation	SNP	ENST00000380211.1	37	CCDS31382.1	.	.	.	.	.	.	.	.	.	.	G	10.54	1.378082	0.24944	.	.	ENSG00000167359	ENST00000317283;ENST00000321307;ENST00000380211	T	0.21543	2.0	5.78	1.53	0.23141	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43416	D	0.000565	T	0.32466	0.0830	L	0.54323	1.7	0.09310	N	1	D	0.76494	0.999	D	0.83275	0.996	T	0.06734	-1.0810	10	0.49607	T	0.09	.	3.7444	0.08542	0.3241:0.0:0.5063:0.1696	.	100	Q9H343	O51I1_HUMAN	M	85;97;100	ENSP00000369559:L100M	ENSP00000348350:L85M	L	-	1	2	OR51I1	5419023	0.000000	0.05858	0.976000	0.42696	0.329000	0.28539	-2.635000	0.00868	0.266000	0.21894	-0.290000	0.09829	CTG	.		0.453	OR51I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143399.1	NM_001005288	
OR6B3	150681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	240984862	240984862	+	Missense_Mutation	SNP	G	G	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr2:240984862G>C	ENST00000319423.4	-	1	627	c.628C>G	c.(628-630)Cca>Gca	p.P210A	PRR21_ENST00000408934.1_5'Flank	NM_173351.1	NP_775486.1	Q8NGW1	OR6B3_HUMAN	olfactory receptor, family 6, subfamily B, member 3	210						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(10)|lung(4)|ovary(2)|prostate(1)	18		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;1.05e-29)|all cancers(36;3.52e-28)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		GCCAGGAGTGGAAACACCAGG	0.587																																					p.P210A		.											.	OR6B3	68	0			c.C628G						.						63.0	70.0	68.0					2																	240984862		2141	4244	6385	SO:0001583	missense	150681	exon1			GGAGTGGAAACAC		CCDS42837.1	2q37.3	2013-09-23	2002-11-13	2002-11-15	ENSG00000178586	ENSG00000178586		"""GPCR / Class A : Olfactory receptors"""	15042	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 3 pseudogene"""	OR6B3P			Standard	NM_173351		Approved	OR6B3Q	uc010zoe.2	Q8NGW1	OTTHUMG00000152399	ENST00000319423.4:c.628C>G	2.37:g.240984862G>C	ENSP00000322435:p.Pro210Ala	256.0	0.0		279.0	55.0	NM_173351	Q6IFH3	Missense_Mutation	SNP	ENST00000319423.4	37	CCDS42837.1	.	.	.	.	.	.	.	.	.	.	g	10.32	1.317894	0.23994	.	.	ENSG00000178586	ENST00000319423	T	0.56275	0.47	4.09	3.2	0.36748	GPCR, rhodopsin-like superfamily (1);	0.145705	0.31519	N	0.007506	T	0.66056	0.2751	M	0.64676	1.99	0.33789	D	0.625263	D	0.76494	0.999	D	0.75484	0.986	T	0.73786	-0.3873	10	0.36615	T	0.2	.	12.1077	0.53821	0.0:0.1752:0.8248:0.0	.	210	Q8NGW1	OR6B3_HUMAN	A	210	ENSP00000322435:P210A	ENSP00000322435:P210A	P	-	1	0	OR6B3	240633535	0.263000	0.24083	0.177000	0.23020	0.045000	0.14185	0.989000	0.29629	1.267000	0.44247	-0.243000	0.11985	CCA	.		0.587	OR6B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326078.1		
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	82389961	82389961	+	Silent	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr7:82389961A>G	ENST00000333891.9	-	24	15619	c.15282T>C	c.(15280-15282)tcT>tcC	p.S5094S		NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CTACCTGAAGAGAATGTCCTG	0.308																																					p.S5094S		.											.	PCLO	29	0			c.T15282C						.						118.0	117.0	118.0					7																	82389961		1823	4072	5895	SO:0001819	synonymous_variant	27445	exon24			CTGAAGAGAATGT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.15282T>C	7.37:g.82389961A>G		390.0	0.0		508.0	113.0	NM_033026		Silent	SNP	ENST00000333891.9	37	CCDS47630.1																																																																																			.		0.308	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PDCD4	27250	hgsc.bcm.edu;bcgsc.ca	37	10	112641040	112641040	+	Silent	SNP	T	T	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr10:112641040T>C	ENST00000280154.7	+	3	367	c.93T>C	c.(91-93)gcT>gcC	p.A31A	PDCD4_ENST00000393104.2_Silent_p.A20A	NM_001199492.1|NM_014456.4	NP_001186421.1|NP_055271.2	Q53EL6	PDCD4_HUMAN	programmed cell death 4 (neoplastic transformation inhibitor)	31					apoptotic process (GO:0006915)|cell aging (GO:0007569)|negative regulation of cell cycle (GO:0045786)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	13		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		AAGAAAATGCTGGGACTGAGG	0.338																																					p.A31A	Ovarian(115;1498 1603 9363 40056 40885)	.											.	PDCD4	291	0			c.T93C						.						82.0	92.0	88.0					10																	112641040		2203	4300	6503	SO:0001819	synonymous_variant	27250	exon3			AAATGCTGGGACT	U83908	CCDS7567.1, CCDS44478.1	10q24	2008-08-01			ENSG00000150593	ENSG00000150593			8763	protein-coding gene	gene with protein product	"""nuclear antigen H731"""	608610				9759869	Standard	NM_014456		Approved	H731	uc001kzh.3	Q53EL6	OTTHUMG00000019048	ENST00000280154.7:c.93T>C	10.37:g.112641040T>C		92.0	0.0		91.0	4.0	NM_014456	B2RCV4|B5ME91|O15501|Q5VZS6|Q6PJI5|Q8TAR5|Q99834	Silent	SNP	ENST00000280154.7	37	CCDS7567.1																																																																																			.		0.338	PDCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050361.1	NM_014456	
PDIA5	10954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	122849447	122849447	+	Silent	SNP	C	C	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr3:122849447C>A	ENST00000316218.7	+	11	989	c.894C>A	c.(892-894)gtC>gtA	p.V298V		NM_006810.3	NP_006801.1	Q14554	PDIA5_HUMAN	protein disulfide isomerase family A, member 5	298	Thioredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00691}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	oxidoreductase activity (GO:0016491)|protein disulfide isomerase activity (GO:0003756)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	21				GBM - Glioblastoma multiforme(114;0.0427)		CTGTCCTCGTCATGTTCCACG	0.562																																					p.V298V		.											.	PDIA5	91	0			c.C894A						.						144.0	119.0	127.0					3																	122849447		2203	4300	6503	SO:0001819	synonymous_variant	10954	exon11			CCTCGTCATGTTC	AK054963	CCDS3020.1	3q21.1	2009-11-20	2005-06-29		ENSG00000065485	ENSG00000065485	5.3.4.1	"""Protein disulfide isomerases"""	24811	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 5"""			7556671	Standard	NM_006810		Approved	PDIR, FLJ30401	uc003egc.2	Q14554	OTTHUMG00000159558	ENST00000316218.7:c.894C>A	3.37:g.122849447C>A		113.0	0.0		121.0	26.0	NM_006810	D3DN95|Q9BV43	Silent	SNP	ENST00000316218.7	37	CCDS3020.1																																																																																			.		0.562	PDIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356192.1	NM_006810	
PEG3	5178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	57334962	57334962	+	Splice_Site	SNP	G	G	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr19:57334962G>A	ENST00000326441.9	-	5	843	c.480C>T	c.(478-480)ttC>ttT	p.F160F	ZIM2_ENST00000593931.1_Silent_p.F34F|PEG3_ENST00000594706.1_5'Flank|PEG3_ENST00000423103.2_Splice_Site_p.F160F|PEG3_ENST00000593695.1_Splice_Site_p.F34F|ZIM2_ENST00000599935.1_Silent_p.F34F|ZIM2_ENST00000391708.3_Silent_p.F34F|ZIM2_ENST00000221722.5_Silent_p.F34F|ZIM2_ENST00000593711.1_Silent_p.F34F|PEG3_ENST00000598410.1_Silent_p.F34F|ZIM2_ENST00000601070.1_Silent_p.F34F	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	160					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		ACTCACCACTGAAAGAATGGA	0.577																																					p.F160F		.											.	PEG3	164	0			c.C480T						.						243.0	172.0	196.0					19																	57334962		2203	4300	6503	SO:0001630	splice_region_variant	5178	exon4			ACCACTGAAAGAA	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.481+1C>T	19.37:g.57334962G>A		47.0	0.0		70.0	15.0	NM_001146184	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Silent	SNP	ENST00000326441.9	37	CCDS12948.1																																																																																			.		0.577	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		Silent
PHF11	51131	hgsc.bcm.edu;bcgsc.ca	37	13	50080776	50080776	+	Missense_Mutation	SNP	T	T	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr13:50080776T>C	ENST00000378319.3	+	2	141	c.100T>C	c.(100-102)Ttt>Ctt	p.F34L	PHF11_ENST00000488958.1_5'UTR|PHF11_ENST00000357596.3_5'UTR	NM_001040443.1	NP_001035533.1	Q9UIL8	PHF11_HUMAN	PHD finger protein 11	34					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			large_intestine(3)|lung(1)	4		Lung NSC(96;2.1e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.38e-09)		TATAGGTGTCTTTCAGGTTGC	0.418																																					p.F34L		.											.	PHF11	90	0			c.T100C						.						95.0	89.0	91.0					13																	50080776		2203	4300	6503	SO:0001583	missense	51131	exon2			GGTGTCTTTCAGG	AB011031	CCDS31975.1, CCDS41887.1	13q14.11	2014-05-20			ENSG00000136147	ENSG00000136147		"""Zinc fingers, PHD-type"""	17024	protein-coding gene	gene with protein product	"""IgE responsiveness (atopic)"""	607796				10508479, 15057823	Standard	XM_005266417		Approved	NY-REN-34, BCAP, IGER	uc001vdb.3	Q9UIL8	OTTHUMG00000016916	ENST00000378319.3:c.100T>C	13.37:g.50080776T>C	ENSP00000367570:p.Phe34Leu	45.0	0.0		54.0	4.0	NM_001040443	Q5W0A4|Q5W0A6|Q9Y5A2	Missense_Mutation	SNP	ENST00000378319.3	37	CCDS31975.1	.	.	.	.	.	.	.	.	.	.	T	12.90	2.077362	0.36662	.	.	ENSG00000136147	ENST00000378319	T	0.72725	-0.68	4.78	4.78	0.61160	.	0.780292	0.11255	N	0.583203	T	0.61553	0.2356	L	0.48642	1.525	0.80722	D	1	B;B	0.16166	0.002;0.016	B;B	0.10450	0.003;0.005	T	0.51228	-0.8732	10	0.11182	T	0.66	-3.2169	10.8893	0.46986	0.0:0.0:0.0:1.0	.	34;34	B4DTX8;Q9UIL8	.;PHF11_HUMAN	L	34	ENSP00000367570:F34L	ENSP00000367570:F34L	F	+	1	0	PHF11	48978777	0.991000	0.36638	1.000000	0.80357	0.708000	0.40852	2.456000	0.44997	2.156000	0.67533	0.528000	0.53228	TTT	.		0.418	PHF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044915.1	NM_016119	
PIK3R2	5296	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	18266738	18266738	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr19:18266738C>T	ENST00000593731.1	+	2	609	c.49C>T	c.(49-51)Cgg>Tgg	p.R17W	PIK3R2_ENST00000222254.8_Missense_Mutation_p.R17W			O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2 (beta)	17	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	phosphatidylinositol 3-kinase regulator activity (GO:0035014)|receptor tyrosine kinase binding (GO:0030971)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(3)|pancreas(1)|stomach(1)	24					Isoprenaline(DB01064)	CCCGTTCCGCCGGGAGCGGCC	0.731																																					p.R17W		.											.	PIK3R2	1311	0			c.C49T						.						6.0	5.0	6.0					19																	18266738		1931	3824	5755	SO:0001583	missense	5296	exon2			TTCCGCCGGGAGC		CCDS12371.1	19p13.11	2013-03-28	2008-02-04		ENSG00000105647	ENSG00000105647		"""SH2 domain containing"""	8980	protein-coding gene	gene with protein product		603157				1314371	Standard	NM_005027		Approved	P85B, p85	uc002nia.2	O00459	OTTHUMG00000183383	ENST00000593731.1:c.49C>T	19.37:g.18266738C>T	ENSP00000471914:p.Arg17Trp	17.0	0.0		16.0	7.0	NM_005027	Q5EAT5|Q9UPH9	Missense_Mutation	SNP	ENST00000593731.1	37	CCDS12371.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.489309	0.84962	.	.	ENSG00000105647	ENST00000222254	T	0.08008	3.14	4.34	3.18	0.36537	Src homology-3 domain (3);	0.064269	0.64402	D	0.000009	T	0.11665	0.0284	L	0.38175	1.15	0.30854	N	0.734226	D	0.69078	0.997	P	0.53490	0.727	T	0.01413	-1.1361	10	0.87932	D	0	-27.3178	8.7743	0.34751	0.3481:0.6519:0.0:0.0	.	17	O00459	P85B_HUMAN	W	17	ENSP00000222254:R17W	ENSP00000222254:R17W	R	+	1	2	PIK3R2	18127738	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.487000	0.66863	2.140000	0.66376	0.462000	0.41574	CGG	.		0.731	PIK3R2-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000466386.2	NM_005027	
PKP4	8502	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	159481873	159481873	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr2:159481873C>T	ENST00000389759.3	+	7	1199	c.1087C>T	c.(1087-1089)Caa>Taa	p.Q363*	PKP4_ENST00000389757.3_Nonsense_Mutation_p.Q363*	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	363					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						TGACATGGAGCAATTCGGACA	0.552										HNSCC(62;0.18)																											p.Q363X		.											.	PKP4	97	0			c.C1087T						.						86.0	73.0	78.0					2																	159481873		2203	4300	6503	SO:0001587	stop_gained	8502	exon7			ATGGAGCAATTCG	X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.1087C>T	2.37:g.159481873C>T	ENSP00000374409:p.Gln363*	223.0	0.0		268.0	48.0	NM_001005476	Q86W91	Nonsense_Mutation	SNP	ENST00000389759.3	37	CCDS33305.1	.	.	.	.	.	.	.	.	.	.	C	37	6.094775	0.97276	.	.	ENSG00000144283	ENST00000428353;ENST00000389757;ENST00000389759	.	.	.	5.67	4.78	0.61160	.	0.353767	0.29646	N	0.011565	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-1.4514	16.2064	0.82133	0.1343:0.8657:0.0:0.0	.	.	.	.	X	215;363;363	.	ENSP00000374407:Q363X	Q	+	1	0	PKP4	159190119	0.995000	0.38212	0.289000	0.24876	0.998000	0.95712	5.278000	0.65592	1.499000	0.48617	0.655000	0.94253	CAA	.		0.552	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333250.1		
PPP2R3C	55012	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	35577440	35577440	+	Missense_Mutation	SNP	T	T	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr14:35577440T>A	ENST00000261475.5	-	5	760	c.407A>T	c.(406-408)cAa>cTa	p.Q136L	PPP2R3C_ENST00000555644.1_Missense_Mutation_p.Q136L	NM_017917.2	NP_060387.2	Q969Q6	P2R3C_HUMAN	protein phosphatase 2, regulatory subunit B'', gamma	136					activation of protein kinase activity (GO:0032147)|B cell homeostasis (GO:0001782)|positive regulation of B cell differentiation (GO:0045579)|regulation of antimicrobial humoral response (GO:0002759)|regulation of mitochondrial depolarization (GO:0051900)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)	15	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;8.62e-06)|LUAD - Lung adenocarcinoma(48;1.42e-05)|Epithelial(34;0.0177)|all cancers(34;0.0491)	GBM - Glioblastoma multiforme(112;0.0803)		TGTGAAAAATTGCCTAAGAAA	0.284																																					p.Q136L		.											.	PPP2R3C	227	0			c.A407T						.						47.0	51.0	50.0					14																	35577440		2202	4295	6497	SO:0001583	missense	55012	exon5			AAAAATTGCCTAA	AK000651	CCDS9654.1	14q13.2	2010-06-18	2010-06-18	2007-01-22	ENSG00000092020	ENSG00000092020		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	17485	protein-coding gene	gene with protein product		615902	"""chromosome 14 open reading frame 10"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma"""	C14orf10		12167160, 16129705	Standard	NM_017917		Approved	FLJ20644, G4-1, G5PR	uc001wss.3	Q969Q6	OTTHUMG00000140224	ENST00000261475.5:c.407A>T	14.37:g.35577440T>A	ENSP00000261475:p.Gln136Leu	53.0	0.0		102.0	17.0	NM_017917	B4DEN7|D3DS97|D3DS98|Q5GJ55|Q5GJ56|Q6P4G2|Q86TZ3|Q9NWR9	Missense_Mutation	SNP	ENST00000261475.5	37	CCDS9654.1	.	.	.	.	.	.	.	.	.	.	T	12.60	1.987577	0.35036	.	.	ENSG00000092020	ENST00000261475;ENST00000554361;ENST00000555644;ENST00000557278	T;T	0.28069	1.63;1.63	5.53	5.53	0.82687	.	0.277847	0.41097	D	0.000953	T	0.11922	0.0290	N	0.02539	-0.55	0.37520	D	0.917518	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.19877	-1.0292	10	0.09338	T	0.73	-7.8834	11.6506	0.51286	0.0:0.0:0.1481:0.8519	.	136;136	Q86US5;Q969Q6	.;P2R3C_HUMAN	L	136;108;136;136	ENSP00000261475:Q136L;ENSP00000450716:Q108L	ENSP00000261475:Q136L	Q	-	2	0	PPP2R3C	34647191	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	4.810000	0.62598	2.104000	0.64026	0.528000	0.53228	CAA	.		0.284	PPP2R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276687.1	NM_017917	
PTPRM	5797	hgsc.bcm.edu;bcgsc.ca	37	18	8384641	8384641	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr18:8384641A>G	ENST00000332175.8	+	28	4999	c.3962A>G	c.(3961-3963)gAg>gGg	p.E1321G	PTPRM_ENST00000400053.4_Missense_Mutation_p.E1259G|PTPRM_ENST00000580170.1_Missense_Mutation_p.E1334G|PTPRM_ENST00000400060.4_Missense_Mutation_p.E1335G|PTPRM_ENST00000444013.1_Missense_Mutation_p.E1108G	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1321	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GACCTGGAAGAGGACATCATC	0.463																																					p.E1334G		.											.	PTPRM	228	0			c.A4001G						.						146.0	127.0	133.0					18																	8384641		2203	4300	6503	SO:0001583	missense	5797	exon30			TGGAAGAGGACAT	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.3962A>G	18.37:g.8384641A>G	ENSP00000331418:p.Glu1321Gly	94.0	0.0		128.0	6.0	NM_001105244	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	A	16.59	3.164727	0.57476	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	D;D;D;D	0.84223	-1.82;-1.82;-1.82;-1.82	5.41	5.41	0.78517	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	D	0.87943	0.6305	L	0.33293	1	0.58432	D	0.999999	P;B;D	0.69078	0.947;0.006;0.997	P;B;D	0.79108	0.88;0.004;0.992	D	0.87183	0.2229	10	0.35671	T	0.21	.	15.4745	0.75468	1.0:0.0:0.0:0.0	.	1108;1334;1321	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	G	1321;1335;1259;1108	ENSP00000331418:E1321G;ENSP00000382933:E1335G;ENSP00000382927:E1259G;ENSP00000387608:E1108G	ENSP00000331418:E1321G	E	+	2	0	PTPRM	8374641	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	6.281000	0.72632	2.049000	0.60858	0.372000	0.22366	GAG	.		0.463	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
PTPRQ	374462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	81014071	81014071	+	Missense_Mutation	SNP	T	T	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr12:81014071T>A	ENST00000266688.5	+	37	5516	c.5516T>A	c.(5515-5517)aTc>aAc	p.I1839N				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1885					regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						GAAATCTACATCATAGGTGCT	0.348																																					p.I1671N		.											.	.	.	0			c.T5012A						.						170.0	133.0	144.0					12																	81014071		692	1590	2282	SO:0001583	missense	374462	exon29			TCTACATCATAGG	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.5516T>A	12.37:g.81014071T>A	ENSP00000266688:p.Ile1839Asn	165.0	0.0		177.0	35.0	NM_001145026		Missense_Mutation	SNP	ENST00000266688.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.24|15.24	2.775931|2.775931	0.49786|0.49786	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000266688|ENST00000532722	T|.	0.36157|.	1.27|.	5.29|5.29	5.29|5.29	0.74685|0.74685	.|.	.|.	.|.	.|.	.|.	T|T	0.53449|0.53449	0.1797|0.1797	.|.	.|.	.|.	0.30508|0.30508	N|N	0.769704|0.769704	P|.	0.39624|.	0.681|.	B|.	0.34536|.	0.185|.	T|T	0.55774|0.55774	-0.8088|-0.8088	8|4	0.35671|.	T|.	0.21|.	.|.	15.5213|15.5213	0.75869|0.75869	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1885|.	Q9UMZ3|.	PTPRQ_HUMAN|.	N|T	1839|1540	ENSP00000266688:I1839N|.	ENSP00000266688:I1839N|.	I|S	+|+	2|1	0|0	PTPRQ|PTPRQ	79538202|79538202	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.736000|0.736000	0.42039|0.42039	6.303000|6.303000	0.72794|0.72794	2.129000|2.129000	0.65627|0.65627	0.454000|0.454000	0.30748|0.30748	ATC|TCA	.		0.348	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145026	
RAB37	326624	ucsc.edu;bcgsc.ca;mdanderson.org	37	17	72741039	72741039	+	Missense_Mutation	SNP	C	C	G	rs543387119		TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr17:72741039C>G	ENST00000392613.5	+	7	516	c.460C>G	c.(460-462)Cgt>Ggt	p.R154G	RAB37_ENST00000392610.1_Missense_Mutation_p.R154G|RAB37_ENST00000392614.4_Missense_Mutation_p.R159G|RAB37_ENST00000402449.4_Missense_Mutation_p.R147G|RAB37_ENST00000392612.3_Missense_Mutation_p.R117G|MIR3615_ENST00000585285.1_RNA|RAB37_ENST00000340415.3_Missense_Mutation_p.R147G|RAB37_ENST00000392615.5_Missense_Mutation_p.R122G|RAB37_ENST00000528438.1_Missense_Mutation_p.R127G	NM_001006638.2	NP_001006639.1	Q96AX2	RAB37_HUMAN	RAB37, member RAS oncogene family	154					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|secretory granule (GO:0030141)	GTP binding (GO:0005525)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	12						AAGAGTGATCCGTTCCGAAGA	0.612											OREG0024716	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R159G		.											.	RAB37	230	0			c.C475G						.						112.0	93.0	100.0					17																	72741039		2203	4300	6503	SO:0001583	missense	326624	exon7			GTGATCCGTTCCG	BC040547	CCDS11703.1, CCDS32722.1, CCDS54161.1, CCDS54162.1	17q25.2	2008-02-05			ENSG00000172794	ENSG00000172794		"""RAB, member RAS oncogene"""	30268	protein-coding gene	gene with protein product		609956				10722846	Standard	NM_175738		Approved		uc002jlk.3	Q96AX2	OTTHUMG00000134282	ENST00000392613.5:c.460C>G	17.37:g.72741039C>G	ENSP00000376389:p.Arg154Gly	122.0	2.0	1139	150.0	38.0	NM_001163989	A8MXF5|A8MYT0|Q8IWA7	Missense_Mutation	SNP	ENST00000392613.5	37	CCDS32722.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.163354	0.38217	.	.	ENSG00000172794	ENST00000340415;ENST00000402449;ENST00000469248;ENST00000528438;ENST00000392615;ENST00000392614;ENST00000392613;ENST00000392612;ENST00000392610	T;T;T;T;T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08;-1.08;-1.08;-1.08;-1.08	5.33	4.36	0.52297	Small GTP-binding protein domain (1);	0.291326	0.35291	N	0.003306	T	0.70798	0.3265	N	0.12746	0.255	0.37651	D	0.922391	P;P;P;P;P;P	0.51147	0.879;0.942;0.75;0.853;0.75;0.75	P;P;P;B;P;B	0.53593	0.73;0.73;0.454;0.325;0.454;0.339	T	0.76291	-0.3013	10	0.51188	T	0.08	.	11.4718	0.50272	0.3257:0.6743:0.0:0.0	.	117;122;159;147;154;147	A8MXF5;A8MZI4;A8MYT0;Q96AX2-2;Q96AX2;A8MSP2	.;.;.;.;RAB37_HUMAN;.	G	147;147;147;127;122;159;154;117;154	ENSP00000341354:R147G;ENSP00000383934:R147G;ENSP00000432086:R127G;ENSP00000376391:R122G;ENSP00000376390:R159G;ENSP00000376389:R154G;ENSP00000376388:R117G;ENSP00000376387:R154G	ENSP00000341354:R147G	R	+	1	0	RAB37	70252634	0.996000	0.38824	0.877000	0.34402	0.353000	0.29299	3.613000	0.54152	1.370000	0.46153	-0.310000	0.09108	CGT	.		0.612	RAB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258872.2	NM_175738	
RBMXL3	139804	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	114424946	114424946	+	Silent	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chrX:114424946C>T	ENST00000424776.3	+	1	984	c.942C>T	c.(940-942)gcC>gcT	p.A314A	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	314							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						GCGGCGCTGCCCCTGTGTGGG	0.627																																					p.A314A		.											.	.	.	0			c.C942T						.						32.0	34.0	33.0					X																	114424946		692	1591	2283	SO:0001819	synonymous_variant	139804	exon1			CGCTGCCCCTGTG	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.942C>T	X.37:g.114424946C>T		144.0	0.0		130.0	11.0	NM_001145346	B4DXC0	Silent	SNP	ENST00000424776.3	37	CCDS55478.1																																																																																			.		0.627	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057968.3	NM_001145346	
SASH1	23328	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	148846461	148846461	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr6:148846461A>G	ENST00000367467.3	+	11	1719	c.1244A>G	c.(1243-1245)aAt>aGt	p.N415S	AL033378.1_ENST00000411390.2_RNA	NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	415					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		GACTTGACGAATCGCTCTCTG	0.453																																					p.N415S		.											.	SASH1	90	0			c.A1244G						.						216.0	198.0	204.0					6																	148846461		2203	4300	6503	SO:0001583	missense	23328	exon11			TGACGAATCGCTC	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.1244A>G	6.37:g.148846461A>G	ENSP00000356437:p.Asn415Ser	61.0	0.0		67.0	17.0	NM_015278	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	ENST00000367467.3	37	CCDS5212.1	.	.	.	.	.	.	.	.	.	.	A	18.97	3.735475	0.69189	.	.	ENSG00000111961	ENST00000367467;ENST00000535767	T	0.43688	0.94	5.63	5.63	0.86233	.	0.196718	0.53938	D	0.000057	T	0.48150	0.1484	L	0.43152	1.355	0.51767	D	0.999932	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.42849	-0.9427	10	0.40728	T	0.16	-33.4466	16.1339	0.81465	1.0:0.0:0.0:0.0	.	396;415	Q6P4R9;O94885	.;SASH1_HUMAN	S	415;176	ENSP00000356437:N415S	ENSP00000356437:N415S	N	+	2	0	SASH1	148888154	1.000000	0.71417	0.384000	0.26145	0.821000	0.46438	7.102000	0.77005	2.271000	0.75665	0.533000	0.62120	AAT	.		0.453	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278	
SCFD1	23256	hgsc.bcm.edu;bcgsc.ca	37	14	31107344	31107345	+	Frame_Shift_Ins	INS	-	-	ACTAT			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr14:31107344_31107345insACTAT	ENST00000458591.2	+	5	553_554	c.326_327insACTAT	c.(325-330)caactafs	p.-111fs	SCFD1_ENST00000421551.3_Frame_Shift_Ins_p.-52fs|SCFD1_ENST00000396629.2_Frame_Shift_Ins_p.-19fs|SCFD1_ENST00000541123.1_5'UTR|SCFD1_ENST00000544052.2_Frame_Shift_Ins_p.-44fs	NM_016106.3	NP_057190.2	Q8WVM8	SCFD1_HUMAN	sec1 family domain containing 1						post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|response to hypoxia (GO:0001666)|response to toxic substance (GO:0009636)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle docking involved in exocytosis (GO:0006904)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi transport complex (GO:0017119)|Golgi-associated vesicle (GO:0005798)|plasma membrane (GO:0005886)	syntaxin binding (GO:0019905)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)	13	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		CTTCGAAATCAACTATATGAAT	0.287																																					p.Q109fs		.											.	SCFD1	226	0			c.326_327insACTAT						.																																			SO:0001589	frameshift_variant	23256	exon5			GAAATCAACTATA	AF110646	CCDS9639.1, CCDS45092.1, CCDS58308.1	14q12	2006-04-04	2004-01-15	2004-01-16	ENSG00000092108	ENSG00000092108			20726	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 163"""	C14orf163			Standard	NM_016106		Approved	RA410, KIAA0917, STXBP1L2, SLY1	uc001wqm.2	Q8WVM8	OTTHUMG00000029420	ENST00000458591.2:c.327_331dupACTAT	14.37:g.31107345_31107349dupACTAT	ENSP00000390783:p.Tyr111fs	151.0	1.0		206.0	50.0	NM_016106	A8K2Z5|B7Z4U7|B7Z594|O60754|O94990|Q7Z529|Q9BZI3|Q9UNL3|Q9Y6A8	Frame_Shift_Ins	INS	ENST00000458591.2	37	CCDS9639.1																																																																																			.		0.287	SCFD1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276612.3	NM_182835	
SCN11A	11280	hgsc.bcm.edu;bcgsc.ca	37	3	38921489	38921489	+	Silent	SNP	T	T	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr3:38921489T>C	ENST00000302328.3	-	19	3543	c.3345A>G	c.(3343-3345)ggA>ggG	p.G1115G	SCN11A_ENST00000444237.2_Silent_p.G1115G|SCN11A_ENST00000450244.1_Silent_p.G1115G|SCN11A_ENST00000456224.3_Silent_p.G1077G	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1115					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGAAATACTTTCCAAATCCGA	0.403																																					p.G1115G		.											.	SCN11A	99	0			c.A3345G						.						76.0	72.0	73.0					3																	38921489		2203	4300	6503	SO:0001819	synonymous_variant	11280	exon19			ATACTTTCCAAAT	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3345A>G	3.37:g.38921489T>C		80.0	0.0		88.0	4.0	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Silent	SNP	ENST00000302328.3	37	CCDS33737.1																																																																																			.		0.403	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
SETX	23064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	135204112	135204112	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr9:135204112A>G	ENST00000224140.5	-	10	3055	c.2873T>C	c.(2872-2874)aTa>aCa	p.I958T	SETX_ENST00000372169.2_Missense_Mutation_p.I958T|SETX_ENST00000393220.1_Missense_Mutation_p.I958T	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	958					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		GTCTCTGTCTATCTGAGAATC	0.423																																					p.I958T		.											.	SETX	93	0			c.T2873C						.						99.0	95.0	96.0					9																	135204112		2203	4300	6503	SO:0001583	missense	23064	exon10			CTGTCTATCTGAG	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.2873T>C	9.37:g.135204112A>G	ENSP00000224140:p.Ile958Thr	173.0	0.0		206.0	29.0	NM_015046	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	37	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	A	16.00	2.997014	0.54147	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.87887	-2.21;-2.31;-1.92	5.63	5.63	0.86233	.	7739.210000	0.00166	N	0.000000	D	0.84683	0.5526	N	0.24115	0.695	0.33344	D	0.570162	B;B;B	0.30361	0.277;0.181;0.277	B;B;B	0.30495	0.116;0.054;0.116	T	0.68659	-0.5350	10	0.87932	D	0	.	15.329	0.74190	1.0:0.0:0.0:0.0	.	958;958;958	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	T	958	ENSP00000224140:I958T;ENSP00000361242:I958T;ENSP00000376913:I958T	ENSP00000224140:I958T	I	-	2	0	SETX	134193933	0.844000	0.29557	0.974000	0.42286	0.954000	0.61252	3.164000	0.50770	2.281000	0.76405	0.533000	0.62120	ATA	.		0.423	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
SLBP	7884	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	1701341	1701341	+	Missense_Mutation	SNP	G	G	C	rs200085408		TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr4:1701341G>C	ENST00000489418.1	-	5	795	c.429C>G	c.(427-429)aaC>aaG	p.N143K	SLBP_ENST00000488267.1_Missense_Mutation_p.N108K|SLBP_ENST00000429429.2_Missense_Mutation_p.N104K|SLBP_ENST00000318386.4_Missense_Mutation_p.N150K	NM_006527.2	NP_006518.1	Q14493	SLBP_HUMAN	stem-loop binding protein	143	RNA-binding.				gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA transport (GO:0051028)|nuclear cell cycle DNA replication (GO:0033260)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone pre-mRNA 3'end processing complex (GO:0071204)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	histone pre-mRNA DCP binding (GO:0071208)|histone pre-mRNA stem-loop binding (GO:0071207)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(2)|lung(2)	5		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.0055)			TCTTCCCATAGTTGATCTGCT	0.423																																					p.N143K		.											.	SLBP	90	0			c.C429G						.						169.0	155.0	160.0					4																	1701341		2203	4300	6503	SO:0001583	missense	7884	exon5			CCCATAGTTGATC	Z71188	CCDS3350.1	4p16.3	2008-02-11	2008-02-11		ENSG00000163950	ENSG00000163950			10904	protein-coding gene	gene with protein product	"""histone binding protein"""	602422	"""stem-loop (histone) binding protein"""			9049306, 1338771	Standard	NM_006527		Approved	HBP	uc003gdi.1	Q14493	OTTHUMG00000089349	ENST00000489418.1:c.429C>G	4.37:g.1701341G>C	ENSP00000417686:p.Asn143Lys	195.0	0.0		264.0	49.0	NM_006527	B3KRJ5	Missense_Mutation	SNP	ENST00000489418.1	37	CCDS3350.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	19.50|19.50|19.50	3.838587|3.838587|3.838587	0.71373|0.71373|0.71373	.|.|.	.|.|.	ENSG00000163950|ENSG00000163950|ENSG00000163950	ENST00000480936|ENST00000429429;ENST00000489418;ENST00000460392;ENST00000318386;ENST00000488267|ENST00000483348	.|.|.	.|.|.	.|.|.	5.19|5.19|5.19	3.16|3.16|3.16	0.36331|0.36331|0.36331	.|.|.	.|0.144333|.	.|0.64402|.	.|D|.	.|0.000012|.	T|T|T	0.63070|0.63070|0.63070	0.2480|0.2480|0.2480	M|M|M	0.66939|0.66939|0.66939	2.045|2.045|2.045	0.58432|0.58432|0.58432	D|D|D	0.999994|0.999994|0.999994	.|D;P;P;P;P|.	.|0.62365|.	.|0.991;0.915;0.835;0.734;0.915|.	.|P;P;P;P;P|.	.|0.54026|.	.|0.74;0.72;0.466;0.549;0.72|.	T|T|T	0.61451|0.61451|0.61451	-0.7060|-0.7060|-0.7060	5|9|5	.|0.39692|.	.|T|.	.|0.17|.	-5.3723|-5.3723|-5.3723	9.3219|9.3219|9.3219	0.37968|0.37968|0.37968	0.2754:0.0:0.7246:0.0|0.2754:0.0:0.7246:0.0|0.2754:0.0:0.7246:0.0	.|.|.	.|108;150;104;123;143|.	.|E7EUV9;F8W8D3;B3KRJ5;C9IY53;Q14493|.	.|.;.;.;.;SLBP_HUMAN|.	V|K|S	151|104;143;123;150;108|98	.|.|.	.|ENSP00000316490:N150K|.	L|N|T	-|-|-	1|3|2	2|2|0	SLBP|SLBP|SLBP	1671139|1671139|1671139	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.997000|0.997000|0.997000	0.91878|0.91878|0.91878	2.337000|2.337000|2.337000	0.43947|0.43947|0.43947	1.201000|1.201000|1.201000	0.43203|0.43203|0.43203	0.644000|0.644000|0.644000	0.83932|0.83932|0.83932	CTA|AAC|ACT	G|0.999;C|0.001		0.423	SLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000203176.1	NM_006527	
SLC38A2	54407	hgsc.bcm.edu;bcgsc.ca	37	12	46756927	46756927	+	Splice_Site	SNP	T	T	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr12:46756927T>C	ENST00000256689.5	-	13	1500	c.1056A>G	c.(1054-1056)gaA>gaG	p.E352E	SLC38A2_ENST00000547252.1_5'Flank|SLC38A2_ENST00000551374.1_Splice_Site_p.E190E	NM_018976.4	NP_061849.2	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2	352					amino acid transport (GO:0006865)|glutamate secretion (GO:0014047)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|sodium ion transport (GO:0006814)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	18	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)		ACTCAACATGTTCTACAGGGA	0.393																																					p.E352E	Ovarian(9;448 492 8335 28722 40361)	.											.	SLC38A2	226	0			c.A1056G						.						137.0	128.0	131.0					12																	46756927		2203	4300	6503	SO:0001630	splice_region_variant	54407	exon13			AACATGTTCTACA	AB037803	CCDS8749.1	12q13.11	2014-08-12			ENSG00000134294	ENSG00000134294		"""Solute carriers"""	13448	protein-coding gene	gene with protein product		605180				10747860, 17237199	Standard	NM_018976		Approved	SAT2, ATA2, KIAA1382, SNAT2	uc001rpg.3	Q96QD8	OTTHUMG00000169471	ENST00000256689.5:c.1055-1A>G	12.37:g.46756927T>C		64.0	0.0		75.0	4.0	NM_018976	Q6IA88|Q6ZMG2|Q9HAV3|Q9NVA8|Q9P2G5	Silent	SNP	ENST00000256689.5	37	CCDS8749.1																																																																																			.		0.393	SLC38A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404226.1		Silent
SLC50A1	55974	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	155110121	155110121	+	Missense_Mutation	SNP	G	G	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr1:155110121G>A	ENST00000368404.4	+	4	429	c.367G>A	c.(367-369)Gag>Aag	p.E123K	SLC50A1_ENST00000368405.3_Intron|SLC50A1_ENST00000368401.5_Missense_Mutation_p.E68K|SLC50A1_ENST00000303343.8_Intron|SLC50A1_ENST00000484157.1_Missense_Mutation_p.E58K	NM_018845.3	NP_061333.2	Q9BRV3	SWET1_HUMAN	solute carrier family 50 (sugar efflux transporter), member 1	123					carbohydrate transport (GO:0008643)|DNA recombination (GO:0006310)|glucoside transport (GO:0042946)|positive regulation of gene expression, epigenetic (GO:0045815)	endomembrane system (GO:0012505)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucoside transmembrane transporter activity (GO:0042947)			endometrium(1)|lung(1)|ovary(1)|skin(1)	4						ACCCAACCCTGAGGCCCGGCT	0.582																																					p.E123K		.											.	SLC50A1	69	0			c.G367A						.						74.0	76.0	75.0					1																	155110121		2203	4300	6503	SO:0001583	missense	55974	exon4			AACCCTGAGGCCC	AF126023, AF126024	CCDS1093.1, CCDS44238.1, CCDS44239.1, CCDS72929.1, CCDS72930.1	1q22	2013-07-17	2013-07-17	2010-11-30	ENSG00000169241	ENSG00000169241		"""Solute carriers"""	30657	protein-coding gene	gene with protein product	"""stromal cell protein"""	613683	"""recombination activating gene 1 activating protein 1"""	RAG1AP1		21107422	Standard	NM_018845		Approved	SCP, RP11-540D14.5, slv, RZPDo834D038D, HsSWEET1, SWEET1	uc001fhj.4	Q9BRV3	OTTHUMG00000035333	ENST00000368404.4:c.367G>A	1.37:g.155110121G>A	ENSP00000357389:p.Glu123Lys	68.0	0.0		97.0	28.0	NM_018845	Q5SR64|Q6IAK6|Q96DC5|Q9UHQ2|Q9UHQ3	Missense_Mutation	SNP	ENST00000368404.4	37	CCDS1093.1	.	.	.	.	.	.	.	.	.	.	G	17.64	3.440450	0.63067	.	.	ENSG00000169241	ENST00000484157;ENST00000368404;ENST00000368401	.	.	.	5.08	3.15	0.36227	.	0.792831	0.12180	N	0.492158	T	0.10551	0.0258	N	0.08118	0	0.09310	N	0.999997	D;P	0.62365	0.991;0.615	P;B	0.56434	0.798;0.28	T	0.05920	-1.0856	9	0.20519	T	0.43	-1.0217	5.9692	0.19342	0.2946:0.0:0.7054:0.0	.	68;123	Q9BRV3-2;Q9BRV3	.;SWET1_HUMAN	K	58;123;68	.	ENSP00000357386:E68K	E	+	1	0	SLC50A1	153376745	0.016000	0.18221	0.003000	0.11579	0.944000	0.59088	1.819000	0.39022	1.434000	0.47414	0.655000	0.94253	GAG	.		0.582	SLC50A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085505.1	NM_018845	
SLC9C2	284525	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	173476077	173476077	+	Missense_Mutation	SNP	A	A	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr1:173476077A>C	ENST00000367714.3	-	25	3565	c.3143T>G	c.(3142-3144)aTc>aGc	p.I1048S	SLC9C2_ENST00000466087.1_5'UTR	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	1048					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										ATACACAATGATAACAAATTT	0.333																																					p.I1048S		.											.	.	.	0			c.T3143G						.						136.0	125.0	129.0					1																	173476077		2203	4300	6503	SO:0001583	missense	284525	exon25			ACAATGATAACAA	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.3143T>G	1.37:g.173476077A>C	ENSP00000356687:p.Ile1048Ser	169.0	0.0		184.0	38.0	NM_178527	Q86UF3	Missense_Mutation	SNP	ENST00000367714.3	37	CCDS1308.1	.	.	.	.	.	.	.	.	.	.	A	17.31	3.356160	0.61293	.	.	ENSG00000162753	ENST00000367714	T	0.06849	3.25	5.58	5.58	0.84498	.	0.215417	0.32671	N	0.005785	T	0.09686	0.0238	M	0.68952	2.095	0.58432	D	0.999997	D	0.54397	0.966	P	0.49012	0.598	T	0.01287	-1.1395	10	0.87932	D	0	-30.2794	12.1245	0.53909	1.0:0.0:0.0:0.0	.	1048	Q5TAH2	S9A11_HUMAN	S	1048	ENSP00000356687:I1048S	ENSP00000356687:I1048S	I	-	2	0	SLC9A11	171742700	0.558000	0.26554	0.206000	0.23566	0.889000	0.51656	4.799000	0.62517	2.123000	0.65237	0.421000	0.28195	ATC	.		0.333	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527	
SNAP29	9342	hgsc.bcm.edu;bcgsc.ca	37	22	21235343	21235343	+	Silent	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr22:21235343A>G	ENST00000215730.7	+	3	569	c.441A>G	c.(439-441)aaA>aaG	p.K147K		NM_004782.3	NP_004773.1	O95721	SNP29_HUMAN	synaptosomal-associated protein, 29kDa	147					autophagic vacuole fusion (GO:0000046)|exocytosis (GO:0006887)|membrane fusion (GO:0061025)|protein transport (GO:0015031)|vesicle targeting (GO:0006903)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|synapse (GO:0045202)	SNAP receptor activity (GO:0005484)			breast(1)|endometrium(1)|large_intestine(5)|lung(1)|upper_aerodigestive_tract(1)	9	all_cancers(11;2.77e-25)|all_epithelial(7;8.92e-24)|Lung NSC(8;1.49e-15)|all_lung(8;2.54e-14)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000592)|Lung(15;0.0117)			AAAGATTGAAAGAAGCTATAA	0.378																																					p.K147K		.											.	SNAP29	278	0			c.A441G						.						69.0	63.0	65.0					22																	21235343		2203	4300	6503	SO:0001819	synonymous_variant	9342	exon3			ATTGAAAGAAGCT	AF115436	CCDS13784.1	22q11.21	2008-06-10	2002-08-29		ENSG00000099940	ENSG00000099940			11133	protein-coding gene	gene with protein product	"""soluble 29 kDa NSF attachment protein"""	604202	"""synaptosomal-associated protein, 29kD"""			9852078, 10591208	Standard	NM_004782		Approved	SNAP-29, CEDNIK	uc011ahw.2	O95721	OTTHUMG00000150765	ENST00000215730.7:c.441A>G	22.37:g.21235343A>G		101.0	0.0		84.0	4.0	NM_004782		Silent	SNP	ENST00000215730.7	37	CCDS13784.1																																																																																			.		0.378	SNAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320000.4	NM_004782	
SNAPC1	6617	hgsc.bcm.edu;bcgsc.ca	37	14	62233751	62233751	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr14:62233751A>G	ENST00000216294.4	+	2	390	c.286A>G	c.(286-288)Aag>Gag	p.K96E	RP11-618G20.1_ENST00000555937.1_RNA	NM_003082.3	NP_003073.1	Q16533	SNPC1_HUMAN	small nuclear RNA activating complex, polypeptide 1, 43kDa	96	SNAPC3-binding.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.0639)|BRCA - Breast invasive adenocarcinoma(234;0.186)		ACCAAAACAAAAGGTAATACT	0.274																																					p.K96E	NSCLC(27;223 907 37180 39193 46568)	.											.	SNAPC1	90	0			c.A286G						.						84.0	82.0	82.0					14																	62233751		2203	4298	6501	SO:0001583	missense	6617	exon2			AAACAAAAGGTAA	Z47542	CCDS9755.1	14q22	2008-08-11	2002-08-29		ENSG00000023608	ENSG00000023608			11134	protein-coding gene	gene with protein product		600591	"""small nuclear RNA activating complex, polypeptide 1, 43kD"""			9644240	Standard	NM_003082		Approved	SNAP43, PTFgamma	uc001xft.3	Q16533	OTTHUMG00000140343	ENST00000216294.4:c.286A>G	14.37:g.62233751A>G	ENSP00000216294:p.Lys96Glu	97.0	0.0		86.0	4.0	NM_003082		Missense_Mutation	SNP	ENST00000216294.4	37	CCDS9755.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.292265	0.80914	.	.	ENSG00000023608	ENST00000216294	.	.	.	6.06	4.86	0.63082	.	0.142009	0.64402	D	0.000004	T	0.74711	0.3752	M	0.80422	2.495	0.42701	D	0.993611	D	0.58970	0.984	P	0.56612	0.802	T	0.78996	-0.1983	9	0.62326	D	0.03	-21.1355	12.9864	0.58594	0.7604:0.2396:0.0:0.0	.	96	Q16533	SNPC1_HUMAN	E	96	.	ENSP00000216294:K96E	K	+	1	0	SNAPC1	61303504	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.686000	0.54685	2.324000	0.78689	0.533000	0.62120	AAG	.		0.274	SNAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276976.2	NM_003082	
SNRK	54861	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	43344896	43344896	+	Missense_Mutation	SNP	G	G	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr3:43344896G>T	ENST00000296088.7	+	3	505	c.201G>T	c.(199-201)atG>atT	p.M67I	SNRK_ENST00000429705.2_Missense_Mutation_p.M67I|SNRK_ENST00000454177.1_Missense_Mutation_p.M67I|SNRK_ENST00000437827.1_Intron|SNRK_ENST00000462810.1_3'UTR	NM_017719.4	NP_060189.3			SNF related kinase											breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(5)|prostate(1)|skin(2)|stomach(1)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0636)|Kidney(284;0.0792)		TGAGATGCATGAAACTAGTGC	0.423																																					p.M67I		.											.	SNRK	815	0			c.G201T						.						112.0	107.0	108.0					3																	43344896		1924	4143	6067	SO:0001583	missense	54861	exon3			ATGCATGAAACTA	D43636	CCDS43075.1	3p22.1	2005-08-09			ENSG00000163788	ENSG00000163788			30598	protein-coding gene	gene with protein product		612760				8654423, 7788527	Standard	NM_017719		Approved	FLJ20224, HSNFRK, KIAA0096	uc003cmt.4	Q9NRH2	OTTHUMG00000156491	ENST00000296088.7:c.201G>T	3.37:g.43344896G>T	ENSP00000296088:p.Met67Ile	146.0	1.0		163.0	49.0	NM_017719		Missense_Mutation	SNP	ENST00000296088.7	37	CCDS43075.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.773559	0.90108	.	.	ENSG00000163788	ENST00000454177;ENST00000429705;ENST00000296088	D;D;D	0.83075	-1.68;-1.68;-1.68	5.43	5.43	0.79202	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.89750	0.6805	L	0.55103	1.725	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.999	D	0.90424	0.4419	10	0.87932	D	0	.	19.218	0.93785	0.0:0.0:1.0:0.0	.	67;67	Q9NRH2-2;Q9NRH2	.;SNRK_HUMAN	I	67	ENSP00000401246:M67I;ENSP00000411375:M67I;ENSP00000296088:M67I	ENSP00000296088:M67I	M	+	3	0	SNRK	43319900	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.538000	0.85594	0.655000	0.94253	ATG	.		0.423	SNRK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344325.1	NM_017719	
MTCL1	23255	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	8813094	8813094	+	Missense_Mutation	SNP	G	G	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr18:8813094G>C	ENST00000306329.11	+	10	3679	c.3679G>C	c.(3679-3681)Gtc>Ctc	p.V1227L	SOGA2_ENST00000518815.1_Missense_Mutation_p.V261L|SOGA2_ENST00000517570.1_Missense_Mutation_p.V867L|SOGA2_ENST00000359865.3_Missense_Mutation_p.V908L|SOGA2_ENST00000400050.3_Missense_Mutation_p.V867L|SOGA2_ENST00000306285.7_Missense_Mutation_p.V261L																							TCACAGCCTGGTCATGGACCT	0.587																																					p.V908L		.											.	.	.	0			c.G2722C						.						53.0	50.0	51.0					18																	8813094		2203	4300	6503	SO:0001583	missense	23255	exon12			AGCCTGGTCATGG																												ENST00000306329.11:c.3679G>C	18.37:g.8813094G>C	ENSP00000305027:p.Val1227Leu	135.0	0.0		156.0	14.0	NM_015210		Missense_Mutation	SNP	ENST00000306329.11	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.56|18.56	3.650848|3.650848	0.67472|0.67472	.|.	.|.	ENSG00000168502|ENSG00000168502	ENST00000519823|ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050;ENST00000306285	.|T;T;T;T	.|0.36340	.|2.36;2.35;2.36;1.26	4.96|4.96	4.96|4.96	0.65561|0.65561	.|.	.|0.000000	.|0.43579	.|D	.|0.000549	T|T	0.38374|0.38374	0.1038|0.1038	M|M	0.77103|0.77103	2.36|2.36	0.31616|0.31616	N|N	0.6509|0.6509	.|B;B	.|0.31077	.|0.307;0.259	.|B;B	.|0.22753	.|0.031;0.041	T|T	0.53613|0.53613	-0.8414|-0.8414	5|10	.|0.54805	.|T	.|0.06	-25.4183|-25.4183	12.7885|12.7885	0.57520|0.57520	0.0787:0.0:0.9213:0.0|0.0787:0.0:0.9213:0.0	.|.	.|1218;908	.|Q9Y4B5;Q9Y4B5-3	.|CC165_HUMAN;.	A|L	41|929;867;908;867;261	.|ENSP00000429556:V867L;ENSP00000352927:V908L;ENSP00000382924:V867L;ENSP00000303670:V261L	.|ENSP00000303670:V261L	G|V	+|+	2|1	0|0	CCDC165|CCDC165	8803094|8803094	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	4.757000|4.757000	0.62213|0.62213	2.586000|2.586000	0.87340|0.87340	0.462000|0.462000	0.41574|0.41574	GGT|GTC	.		0.587	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1		
SP4	6671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	21469601	21469601	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr7:21469601A>G	ENST00000222584.3	+	3	1036	c.818A>G	c.(817-819)aAc>aGc	p.N273S		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	273					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						GTGATAAACAACGTGGCTGCC	0.512																																					p.N273S		.											.	SP4	95	0			c.A818G						.						71.0	65.0	67.0					7																	21469601		2203	4300	6503	SO:0001583	missense	6671	exon3			TAAACAACGTGGC		CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.818A>G	7.37:g.21469601A>G	ENSP00000222584:p.Asn273Ser	130.0	0.0		174.0	44.0	NM_003112	O60402|Q32M52	Missense_Mutation	SNP	ENST00000222584.3	37	CCDS5373.1	.	.	.	.	.	.	.	.	.	.	A	0.398	-0.919762	0.02396	.	.	ENSG00000105866	ENST00000222584	T	0.07021	3.23	4.94	1.24	0.21308	.	0.132837	0.64402	N	0.000002	T	0.02767	0.0083	N	0.04090	-0.28	0.44234	D	0.997076	B	0.06786	0.001	B	0.04013	0.001	T	0.46456	-0.9190	10	0.02654	T	1	.	8.1388	0.31071	0.6845:0.0:0.3155:0.0	.	273	Q02446	SP4_HUMAN	S	273	ENSP00000222584:N273S	ENSP00000222584:N273S	N	+	2	0	SP4	21436126	0.950000	0.32346	0.930000	0.37139	0.996000	0.88848	2.331000	0.43894	0.057000	0.16193	0.533000	0.62120	AAC	.		0.512	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211617.2	NM_003112	
SULT1A2	6799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	28606943	28606943	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr16:28606943C>T	ENST00000395630.1	-	3	552	c.202G>A	c.(202-204)Gaa>Aaa	p.E68K	SULT1A2_ENST00000335715.4_Missense_Mutation_p.E68K|SULT1A2_ENST00000533150.1_Missense_Mutation_p.E68K	NM_177528.2	NP_803564	P50226	ST1A2_HUMAN	sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2	68					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|amine biosynthetic process (GO:0009309)|catecholamine metabolic process (GO:0006584)|phenol-containing compound metabolic process (GO:0018958)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|flavonol 3-sulfotransferase activity (GO:0047894)|sulfotransferase activity (GO:0008146)			NS(2)|breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(3)|skin(2)	14						TGACACTTTTCCAGGTCACCG	0.587																																					p.E68K		.											.	SULT1A2	90	0			c.G202A						.						94.0	86.0	89.0					16																	28606943		2197	4300	6497	SO:0001583	missense	6799	exon3			ACTTTTCCAGGTC	U34804	CCDS10636.1	16p12.1	2008-02-05			ENSG00000197165	ENSG00000197165	2.8.2.1	"""Sulfotransferases, cytosolic"""	11454	protein-coding gene	gene with protein product		601292		STP2		8661000, 8912648	Standard	NM_001054		Approved	HAST4	uc002dqh.2	P50226	OTTHUMG00000048082	ENST00000395630.1:c.202G>A	16.37:g.28606943C>T	ENSP00000378992:p.Glu68Lys	99.0	0.0		121.0	47.0	NM_001054	A9QY25|P78393|Q14CJ7	Missense_Mutation	SNP	ENST00000395630.1	37	CCDS10636.1	.	.	.	.	.	.	.	.	.	.	c	9.160	1.018388	0.19355	.	.	ENSG00000197165	ENST00000533150;ENST00000335715;ENST00000395630;ENST00000526384	D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66	4.7	1.52	0.23074	Sulfotransferase domain (1);	0.411184	0.24403	N	0.038833	T	0.72779	0.3503	L	0.47078	1.49	0.19945	N	0.999944	B	0.06786	0.001	B	0.08055	0.003	T	0.61505	-0.7049	10	0.48119	T	0.1	.	4.6656	0.12664	0.0:0.539:0.1788:0.2822	.	68	P50226	ST1A2_HUMAN	K	68	ENSP00000435271:E68K;ENSP00000338742:E68K;ENSP00000378992:E68K;ENSP00000435358:E68K	ENSP00000338742:E68K	E	-	1	0	SULT1A2	28514444	0.006000	0.16342	0.036000	0.18154	0.031000	0.12232	0.366000	0.20365	0.383000	0.24910	0.556000	0.70494	GAA	.		0.587	SULT1A2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109415.2	NM_001054	
SRCAP	10847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30750366	30750366	+	Missense_Mutation	SNP	C	C	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr16:30750366C>G	ENST00000262518.4	+	34	9390	c.9005C>G	c.(9004-9006)cCa>cGa	p.P3002R	RP11-2C24.4_ENST00000483578.1_lincRNA|SRCAP_ENST00000395059.2_Missense_Mutation_p.P2940R|SRCAP_ENST00000344771.4_Missense_Mutation_p.P2844R	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	3002	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			TCAACGTCCCCACCCAAACGG	0.597																																					p.P3002R		.											.	SRCAP	94	0			c.C9005G						.						149.0	117.0	127.0					16																	30750366		2197	4300	6497	SO:0001583	missense	10847	exon34			CGTCCCCACCCAA	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.9005C>G	16.37:g.30750366C>G	ENSP00000262518:p.Pro3002Arg	54.0	0.0		84.0	6.0	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	C	8.005	0.756188	0.15846	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.93488	-3.2;-3.23;-3.22	5.13	5.13	0.70059	.	0.000000	0.49916	D	0.000133	D	0.91546	0.7330	N	0.08118	0	0.28469	N	0.915492	D;D	0.69078	0.997;0.995	D;P	0.65010	0.931;0.854	D	0.87078	0.2164	10	0.87932	D	0	-8.6141	13.9377	0.64034	0.0:1.0:0.0:0.0	.	2940;3002	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	R	3002;2940;2844	ENSP00000262518:P3002R;ENSP00000378499:P2940R;ENSP00000343042:P2844R	ENSP00000262518:P3002R	P	+	2	0	SRCAP	30657867	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.813000	0.69201	2.663000	0.90544	0.563000	0.77884	CCA	.		0.597	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
TAF1	6872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	70607151	70607151	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chrX:70607151A>G	ENST00000373790.4	+	15	2315	c.2264A>G	c.(2263-2265)cAt>cGt	p.H755R	TAF1_ENST00000276072.3_Missense_Mutation_p.H776R|TAF1_ENST00000449580.1_Missense_Mutation_p.H755R|TAF1_ENST00000423759.1_Missense_Mutation_p.H776R	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	755	Histone acetyltransferase (HAT).				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				ATTTATCTTCATAAGATGCCA	0.373																																					p.H776R		.											.	TAF1	900	0			c.A2327G						.						137.0	127.0	131.0					X																	70607151		2203	4300	6503	SO:0001583	missense	6872	exon15			ATCTTCATAAGAT		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.2264A>G	X.37:g.70607151A>G	ENSP00000362895:p.His755Arg	256.0	0.0		235.0	86.0	NM_004606	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	ENST00000373790.4	37	CCDS35325.1	.	.	.	.	.	.	.	.	.	.	.	20.9	4.068723	0.76301	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.20332	2.08;2.08;2.08;2.08	5.03	5.03	0.67393	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.090151	0.85682	D	0.000000	T	0.52709	0.1751	M	0.89478	3.035	0.80722	D	1	D;P	0.76494	0.999;0.709	D;P	0.85130	0.997;0.781	T	0.62905	-0.6755	10	0.87932	D	0	.	14.1119	0.65126	1.0:0.0:0.0:0.0	.	755;776	P21675;P21675-2	TAF1_HUMAN;.	R	755;755;776;776	ENSP00000362895:H755R;ENSP00000389000:H755R;ENSP00000406549:H776R;ENSP00000276072:H776R	ENSP00000276072:H776R	H	+	2	0	TAF1	70523876	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.954000	0.93051	1.779000	0.52309	0.373000	0.22412	CAT	.		0.373	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	
TBCD	6904	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	80888501	80888501	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr17:80888501A>G	ENST00000355528.4	+	33	3225	c.3095A>G	c.(3094-3096)gAc>gGc	p.D1032G	TBCD_ENST00000539345.2_Missense_Mutation_p.D1032G	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	1032					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			ATCTTTGAGGACAACCTTCTG	0.602																																					p.D1032G		.											.	TBCD	22	0			c.A3095G						.						96.0	94.0	94.0					17																	80888501		2028	4182	6210	SO:0001583	missense	6904	exon33			TTGAGGACAACCT	BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.3095A>G	17.37:g.80888501A>G	ENSP00000347719:p.Asp1032Gly	83.0	1.0		107.0	23.0	NM_005993	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	ENST00000355528.4	37	CCDS45818.1	.	.	.	.	.	.	.	.	.	.	A	14.37	2.514693	0.44763	.	.	ENSG00000141556	ENST00000355528;ENST00000334614;ENST00000539345	T	0.32023	1.47	4.63	3.46	0.39613	Armadillo-like helical (1);Armadillo-type fold (1);Tubulin-specific chaperone D, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.42200	0.1192	M	0.72894	2.215	0.80722	D	1	P;P;P	0.52692	0.906;0.955;0.843	P;P;P	0.54544	0.641;0.755;0.544	T	0.31194	-0.9952	9	.	.	.	.	7.5872	0.27999	0.7825:0.2175:0.0:0.0	.	783;1032;1032	F8WC00;Q9BTW9;Q9BTW9-4	.;TBCD_HUMAN;.	G	1032;783;24	ENSP00000347719:D1032G	.	D	+	2	0	TBCD	78481790	1.000000	0.71417	1.000000	0.80357	0.554000	0.35429	3.083000	0.50136	1.723000	0.51488	0.482000	0.46254	GAC	.		0.602	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439415.1	NM_005993	
TECTA	7007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	121058616	121058616	+	Silent	SNP	C	C	T	rs559874132		TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr11:121058616C>T	ENST00000392793.1	+	21	6346	c.6075C>T	c.(6073-6075)acC>acT	p.T2025T	TECTA_ENST00000264037.2_Silent_p.T2025T			O75443	TECTA_HUMAN	tectorin alpha	2025	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TTCACGTCACCGTCTTTAAAT	0.438													C|||	1	0.000199681	0.0	0.0	5008	,	,		22638	0.0		0.0	False		,,,				2504	0.001				p.T2025T		.											.	TECTA	225	0			c.C6075T						.						183.0	159.0	167.0					11																	121058616		2203	4299	6502	SO:0001819	synonymous_variant	7007	exon20			CGTCACCGTCTTT	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.6075C>T	11.37:g.121058616C>T		93.0	0.0		89.0	24.0	NM_005422		Silent	SNP	ENST00000392793.1	37	CCDS8434.1																																																																																			.		0.438	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
TEK	7010	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	27190548	27190548	+	Missense_Mutation	SNP	C	C	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr9:27190548C>G	ENST00000380036.4	+	10	1791	c.1349C>G	c.(1348-1350)gCc>gGc	p.A450G	TEK_ENST00000519097.1_Missense_Mutation_p.A303G|TEK_ENST00000406359.4_Missense_Mutation_p.A407G	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	450	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	CCCCTGAATGCCCCAAACGTG	0.418																																					p.A450G		.											.	TEK	1584	0			c.C1349G						.						186.0	179.0	182.0					9																	27190548		2203	4300	6503	SO:0001583	missense	7010	exon10			TGAATGCCCCAAA	L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.1349C>G	9.37:g.27190548C>G	ENSP00000369375:p.Ala450Gly	184.0	0.0		183.0	17.0	NM_000459	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	ENST00000380036.4	37	CCDS6519.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.490725	0.64074	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000346448;ENST00000406359;ENST00000519080	T;T;T;T	0.55760	0.5;0.5;0.5;0.5	5.55	5.55	0.83447	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.43919	U	0.000513	T	0.69043	0.3067	L	0.53249	1.67	0.46149	D	0.998891	P;P;D;P	0.69078	0.611;0.866;0.997;0.801	B;P;D;B	0.80764	0.253;0.61;0.994;0.334	T	0.69109	-0.5232	10	0.54805	T	0.06	.	17.6716	0.88220	0.0:1.0:0.0:0.0	.	303;483;407;450	E7EWI2;Q59HG2;B4DHD3;Q02763	.;.;.;TIE2_HUMAN	G	303;450;407;407;260	ENSP00000430686:A303G;ENSP00000369375:A450G;ENSP00000383977:A407G;ENSP00000428337:A260G	ENSP00000343716:A407G	A	+	2	0	TEK	27180548	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	4.702000	0.61817	2.610000	0.88304	0.591000	0.81541	GCC	.		0.418	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3		
TEN1	100134934	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	73996268	73996268	+	Silent	SNP	G	G	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr17:73996268G>T	ENST00000397640.1	+	4	595	c.297G>T	c.(295-297)ggG>ggT	p.G99G	CDK3_ENST00000448471.1_5'Flank|TEN1_ENST00000416485.1_Silent_p.G98G|TEN1_ENST00000588202.1_3'UTR|TEN1-CDK3_ENST00000567351.1_RNA|CDK3_ENST00000425876.2_5'Flank	NM_001113324.2	NP_001106795.2	Q86WV5	TEN1L_HUMAN	TEN1 CST complex subunit	99						nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)			breast(1)	1						GTGTGGAGGGGATGAACCTGC	0.612																																					p.G99G		.											.	.	.	0			c.G297T						.						72.0	69.0	70.0					17																	73996268		692	1591	2283	SO:0001819	synonymous_variant	100134934	exon4			GGAGGGGATGAAC		CCDS45780.1, CCDS45780.2	17q25.1	2013-05-23	2013-05-23	2011-06-14	ENSG00000257949	ENSG00000257949			37242	protein-coding gene	gene with protein product		613130	"""chromosome 17 open reading frame 106"", ""TEN1 telomerase capping complex subunit homolog (S. cerevisiae)"""	C17orf106		19854130	Standard	NM_001113324		Approved	FLJ39785		Q86WV5	OTTHUMG00000132686	ENST00000397640.1:c.297G>T	17.37:g.73996268G>T		46.0	0.0		67.0	18.0	NM_001113324	I3L0C7	Silent	SNP	ENST00000397640.1	37	CCDS45780.2																																																																																			.		0.612	TEN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255983.1	NM_001113324	
TENM4	26011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	78775891	78775891	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr11:78775891C>T	ENST00000278550.7	-	6	847	c.385G>A	c.(385-387)Gtg>Atg	p.V129M		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	129	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										CACAGACGCACGGGGTGCTCA	0.647																																					p.V129M		.											.	.	.	0			c.G385A						.						31.0	31.0	31.0					11																	78775891		692	1591	2283	SO:0001583	missense	26011	exon6			GACGCACGGGGTG	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.385G>A	11.37:g.78775891C>T	ENSP00000278550:p.Val129Met	45.0	0.0		48.0	12.0	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	C	16.04	3.009528	0.54361	.	.	ENSG00000149256	ENST00000278550	T	0.39229	1.09	4.69	3.78	0.43462	Teneurin intracellular, N-terminal (2);	0.078666	0.49916	N	0.000135	T	0.19644	0.0472	N	0.04203	-0.255	0.46927	D	0.99925	B;B	0.29085	0.232;0.028	B;B	0.24269	0.052;0.018	T	0.06463	-1.0825	9	.	.	.	.	13.1	0.59214	0.0:0.9217:0.0:0.0783	.	129;129	G3CAT1;Q6N022	.;TEN4_HUMAN	M	129	ENSP00000278550:V129M	.	V	-	1	0	ODZ4	78453539	0.998000	0.40836	0.867000	0.34043	0.986000	0.74619	3.884000	0.56175	1.325000	0.45301	0.563000	0.77884	GTG	.		0.647	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
TEX15	56154	broad.mit.edu;ucsc.edu;mdanderson.org	37	8	30701385	30701385	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr8:30701385G>A	ENST00000256246.2	-	1	5223	c.5149C>T	c.(5149-5151)Cga>Tga	p.R1717*		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1717					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.R1717*(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		AGCAAGCTTCGCAATGTTGGT	0.388																																					p.R1717X		.											.	TEX15	97	1	Substitution - Nonsense(1)	large_intestine(1)	c.C5149T						.						142.0	133.0	136.0					8																	30701385		2203	4300	6503	SO:0001587	stop_gained	56154	exon1			AGCTTCGCAATGT	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.5149C>T	8.37:g.30701385G>A	ENSP00000256246:p.Arg1717*	99.0	1.0		91.0	30.0	NM_031271		Nonsense_Mutation	SNP	ENST00000256246.2	37	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	G	44	11.233117	0.99534	.	.	ENSG00000133863	ENST00000256246	.	.	.	5.69	4.79	0.61399	.	0.000000	0.48767	D	0.000161	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	12.4557	0.55702	0.0:0.0:0.6716:0.3283	.	.	.	.	X	1717	.	ENSP00000256246:R1717X	R	-	1	2	TEX15	30820927	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.381000	0.52455	1.323000	0.45263	0.563000	0.77884	CGA	.		0.388	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
TMEM87A	25963	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	42556385	42556385	+	Missense_Mutation	SNP	A	A	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr15:42556385A>C	ENST00000389834.4	-	4	572	c.308T>G	c.(307-309)tTg>tGg	p.L103W	TMEM87A_ENST00000448392.1_Missense_Mutation_p.L42W|TMEM87A_ENST00000307216.6_Missense_Mutation_p.L103W|TMEM87A_ENST00000568432.1_5'UTR	NM_015497.3	NP_056312.2	Q8NBN3	TM87A_HUMAN	transmembrane protein 87A	103						integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24		all_cancers(109;4.28e-16)|all_epithelial(112;1.04e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;1.03e-06)		TTCCAAATACAACTCTACTTC	0.353																																					p.L103W		.											.	TMEM87A	91	0			c.T308G						.						123.0	123.0	123.0					15																	42556385		2203	4299	6502	SO:0001583	missense	25963	exon4			AAATACAACTCTA	AF132733	CCDS32205.1, CCDS45243.1, CCDS66742.1	15q15.1	2005-10-30				ENSG00000103978			24522	protein-coding gene	gene with protein product						12477932	Standard	XM_005254287		Approved	DKFZP564G2022	uc021sjr.1	Q8NBN3		ENST00000389834.4:c.308T>G	15.37:g.42556385A>C	ENSP00000374484:p.Leu103Trp	211.0	0.0		220.0	69.0	NM_001110503	Q6NT77|Q8NCA4|Q9BS46|Q9P103|Q9Y3Y7	Missense_Mutation	SNP	ENST00000389834.4	37	CCDS32205.1	.	.	.	.	.	.	.	.	.	.	A	5.471	0.271964	0.10349	.	.	ENSG00000103978	ENST00000389834;ENST00000448392;ENST00000535305;ENST00000307216	.	.	.	5.12	0.727	0.18254	.	1.021790	0.07834	N	0.961879	T	0.14787	0.0357	N	0.08118	0	0.09310	N	1	B;P;P	0.39862	0.139;0.612;0.692	B;B;B	0.38712	0.013;0.062;0.28	T	0.13845	-1.0494	9	0.52906	T	0.07	-0.0032	2.9635	0.05900	0.0888:0.1558:0.4345:0.3208	.	103;42;103	Q8NBN3;Q8NBN3-3;Q8NBN3-2	TM87A_HUMAN;.;.	W	103;42;79;103	.	ENSP00000305894:L103W	L	-	2	0	TMEM87A	40343677	0.004000	0.15560	0.465000	0.27155	0.041000	0.13682	0.013000	0.13310	0.011000	0.14865	-1.075000	0.02238	TTG	.		0.353	TMEM87A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420482.2	NM_015497	
TMC3	342125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	81625157	81625157	+	Missense_Mutation	SNP	G	G	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr15:81625157G>T	ENST00000359440.5	-	22	3041	c.2906C>A	c.(2905-2907)gCt>gAt	p.A969D	TMC3_ENST00000558726.1_Missense_Mutation_p.A970D|RP11-761I4.3_ENST00000560851.1_RNA|RP11-761I4.3_ENST00000560973.1_RNA|RP11-761I4.3_ENST00000559781.1_RNA	NM_001080532.1	NP_001074001.1			transmembrane channel-like 3											autonomic_ganglia(2)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	34						AAAATGAGGAGCCCGACGGAG	0.562																																					p.A969D		.											.	TMC3	70	0			c.C2906A						.						14.0	15.0	14.0					15																	81625157		1832	4072	5904	SO:0001583	missense	342125	exon22			TGAGGAGCCCGAC	AY263163	CCDS45324.1	15q24.3	2006-11-24				ENSG00000188869			22995	protein-coding gene	gene with protein product						12906855, 12812529	Standard	NM_001080532		Approved		uc021ssk.1	Q7Z5M5		ENST00000359440.5:c.2906C>A	15.37:g.81625157G>T	ENSP00000352413:p.Ala969Asp	47.0	0.0		72.0	18.0	NM_001080532		Missense_Mutation	SNP	ENST00000359440.5	37	CCDS45324.1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.124492	0.37533	.	.	ENSG00000188869	ENST00000359440	T	0.64991	-0.13	5.42	0.139	0.14798	.	1.300320	0.06203	U	0.683653	T	0.53514	0.1801	L	0.54323	1.7	0.09310	N	1	B	0.31125	0.309	B	0.25140	0.058	T	0.47169	-0.9138	10	0.72032	D	0.01	0.0156	5.7645	0.18219	0.1932:0.0:0.5731:0.2337	.	969	Q7Z5M5	TMC3_HUMAN	D	969	ENSP00000352413:A969D	ENSP00000352413:A969D	A	-	2	0	TMC3	79412212	0.044000	0.20184	0.000000	0.03702	0.013000	0.08279	2.217000	0.42880	0.009000	0.14813	0.655000	0.94253	GCT	.		0.562	TMC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417795.3	NM_181841	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7578478	7578478	+	Missense_Mutation	SNP	G	G	T	rs137852790|rs137852791		TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr17:7578478G>T	ENST00000269305.4	-	5	641	c.452C>A	c.(451-453)cCc>cAc	p.P151H	TP53_ENST00000455263.2_Missense_Mutation_p.P151H|TP53_ENST00000413465.2_Missense_Mutation_p.P151H|TP53_ENST00000420246.2_Missense_Mutation_p.P151H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.P151H|TP53_ENST00000359597.4_Missense_Mutation_p.P151H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	151	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934874). {ECO:0000269|PubMed:7682763}.|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P151H(31)|p.P151R(9)|p.0?(8)|p.P151L(7)|p.T150fs*16(6)|p.?(5)|p.P58H(2)|p.P19H(2)|p.P151_V173del23(1)|p.P152_P153del(1)|p.P152fs*28(1)|p.T57fs*16(1)|p.P151del(1)|p.D148_T155delDSTPPPGT(1)|p.T150_P153delTPPP(1)|p.P153fs*28(1)|p.D148fs*23(1)|p.P152del(1)|p.S149fs*72(1)|p.S149fs*17(1)|p.P58R(1)|p.Q144_G154del11(1)|p.P19R(1)|p.Q144fs*16(1)|p.P152fs*14(1)|p.P151fs*30(1)|p.T18fs*16(1)|p.T150_P151delTP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCGGGCGGGGGTGTGGAATC	0.607		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.P151H	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,-1	TP53	70225	90	Substitution - Missense(53)|Deletion - Frameshift(14)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Insertion - Frameshift(2)	lung(17)|large_intestine(13)|ovary(10)|skin(8)|oesophagus(8)|breast(6)|stomach(5)|haematopoietic_and_lymphoid_tissue(5)|central_nervous_system(4)|bone(4)|upper_aerodigestive_tract(3)|soft_tissue(2)|urinary_tract(2)|liver(2)|vulva(1)	c.C452A						.						54.0	55.0	55.0					17																	7578478		2203	4300	6503	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GGCGGGGGTGTGG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.452C>A	17.37:g.7578478G>T	ENSP00000269305:p.Pro151His	61.0	0.0		68.0	17.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	16.15	3.040562	0.55003	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99887	-7.53;-7.53;-7.53;-7.53;-7.53;-7.53;-7.53;-7.53;-7.53	5.59	4.63	0.57726	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.110207	0.64402	D	0.000007	D	0.99891	0.9948	M	0.91406	3.205	0.53688	D	0.999972	D;P;D;P;P;P;D	0.89917	0.99;0.807;1.0;0.793;0.948;0.84;1.0	P;P;D;P;P;P;D	0.97110	0.84;0.754;0.995;0.625;0.841;0.868;1.0	D	0.96236	0.9172	10	0.87932	D	0	-14.1156	12.4691	0.55777	0.0812:0.0:0.9188:0.0	.	112;151;151;58;151;151;151	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	151;151;151;151;151;151;140;58;19;58;19;151	ENSP00000410739:P151H;ENSP00000352610:P151H;ENSP00000269305:P151H;ENSP00000398846:P151H;ENSP00000391127:P151H;ENSP00000391478:P151H;ENSP00000425104:P19H;ENSP00000423862:P58H;ENSP00000424104:P151H	ENSP00000269305:P151H	P	-	2	0	TP53	7519203	1.000000	0.71417	0.974000	0.42286	0.058000	0.15608	6.711000	0.74675	1.515000	0.48885	0.655000	0.94253	CCC	.		0.607	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
USP30	84749	hgsc.bcm.edu;bcgsc.ca	37	12	109519740	109519740	+	Silent	SNP	T	T	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr12:109519740T>C	ENST00000257548.5	+	9	876	c.783T>C	c.(781-783)ggT>ggC	p.G261G	USP30_ENST00000392784.2_Silent_p.G230G	NM_032663.3	NP_116052.2	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30	261	USP.				mitochondrial fusion (GO:0008053)|mitochondrion degradation (GO:0000422)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(7)|kidney(1)|large_intestine(1)|liver(2)|lung(11)|prostate(1)|skin(3)|stomach(2)	28						TGCTGTAGGGTCACCCATTGA	0.443																																					p.G261G		.											.	USP30	658	0			c.T783C						.						215.0	189.0	198.0					12																	109519740		2203	4300	6503	SO:0001819	synonymous_variant	84749	exon9			GTAGGGTCACCCA	BC022094	CCDS9123.2	12q23.3	2006-01-20	2005-08-08		ENSG00000135093	ENSG00000135093		"""Ubiquitin-specific peptidases"""	20065	protein-coding gene	gene with protein product		612492	"""ubiquitin specific protease 30"""			12838346	Standard	XM_005253962		Approved	MGC10702, FLJ40511	uc010sxi.2	Q70CQ3	OTTHUMG00000133613	ENST00000257548.5:c.783T>C	12.37:g.109519740T>C		94.0	0.0		155.0	7.0	NM_032663	Q8WTU7|Q96JX4|Q9BSS3	Silent	SNP	ENST00000257548.5	37	CCDS9123.2																																																																																			.		0.443	USP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257733.2	NM_032663	
USP4	7375	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49362451	49362451	+	Missense_Mutation	SNP	C	C	A	rs117411669	byFrequency	TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr3:49362451C>A	ENST00000265560.4	-	5	555	c.509G>T	c.(508-510)cGg>cTg	p.R170L	USP4_ENST00000416417.1_Missense_Mutation_p.R170L|USP4_ENST00000351842.4_Missense_Mutation_p.R170L|USP4_ENST00000415188.1_Missense_Mutation_p.R170L	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	170	Necessary for interaction with SART3. {ECO:0000269|PubMed:20595234}.|Ubiquitin-like 1.				negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		GAATAGCTTCCGCATCTCTTT	0.488																																					p.R170L		.											.	USP4	660	0			c.G509T						.						162.0	162.0	162.0					3																	49362451		2203	4300	6503	SO:0001583	missense	7375	exon5			AGCTTCCGCATCT	U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.509G>T	3.37:g.49362451C>A	ENSP00000265560:p.Arg170Leu	131.0	0.0		150.0	42.0	NM_199443	A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Missense_Mutation	SNP	ENST00000265560.4	37	CCDS2793.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.966271	0.92855	.	.	ENSG00000114316	ENST00000351842;ENST00000265560;ENST00000416417;ENST00000415188	T;T;T	0.30981	2.01;2.16;1.51	5.51	5.51	0.81932	.	0.061185	0.64402	D	0.000002	T	0.57198	0.2037	M	0.74467	2.265	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.76575	0.988;0.94	T	0.56282	-0.8005	10	0.46703	T	0.11	-17.6222	17.9838	0.89150	0.0:1.0:0.0:0.0	.	170;170	Q13107-2;Q13107	.;UBP4_HUMAN	L	170	ENSP00000341028:R170L;ENSP00000265560:R170L;ENSP00000400623:R170L	ENSP00000265560:R170L	R	-	2	0	USP4	49337455	1.000000	0.71417	0.951000	0.38953	0.626000	0.37791	5.974000	0.70465	2.604000	0.88044	0.491000	0.48974	CGG	C|0.999;T|0.001		0.488	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346069.1	NM_199443	
VPS13B	157680	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	100829851	100829851	+	Missense_Mutation	SNP	A	A	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr8:100829851A>C	ENST00000358544.2	+	45	8367	c.8256A>C	c.(8254-8256)caA>caC	p.Q2752H	VPS13B_ENST00000357162.2_Missense_Mutation_p.Q2727H|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2752					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ACATTGGTCAAGATGGACAAG	0.398																																					p.Q2752H	Colon(161;2205 2542 7338 31318)	.											.	VPS13B	301	0			c.A8256C						.						110.0	104.0	106.0					8																	100829851		2203	4300	6503	SO:0001583	missense	157680	exon45			TGGTCAAGATGGA	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.8256A>C	8.37:g.100829851A>C	ENSP00000351346:p.Gln2752His	147.0	0.0		232.0	49.0	NM_017890	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	A	13.44	2.237867	0.39598	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.70045	-0.45;-0.45	5.61	-1.03	0.10102	.	0.398694	0.25759	N	0.028484	T	0.36386	0.0965	N	0.08118	0	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.003	T	0.03818	-1.1001	10	0.48119	T	0.1	.	2.745	0.05264	0.5313:0.1103:0.2513:0.1071	.	2727;2752	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	H	2727;2752	ENSP00000349685:Q2727H;ENSP00000351346:Q2752H	ENSP00000349685:Q2727H	Q	+	3	2	VPS13B	100899027	0.999000	0.42202	1.000000	0.80357	0.999000	0.98932	0.661000	0.25023	0.143000	0.18926	0.533000	0.62120	CAA	.		0.398	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
WDHD1	11169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	55467661	55467661	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr14:55467661C>T	ENST00000360586.3	-	9	808	c.743G>A	c.(742-744)gGt>gAt	p.G248D	WDHD1_ENST00000420358.2_Missense_Mutation_p.G125D|WDHD1_ENST00000421192.1_Missense_Mutation_p.G125D	NM_007086.3	NP_009017.1	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	248					heterochromatin maintenance (GO:0070829)|regulation of chromosome organization (GO:0033044)|RNA processing (GO:0006396)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(2)	42						ATTAATACTACCTGCAGCTAA	0.333																																					p.G248D		.											.	WDHD1	91	0			c.G743A						.						159.0	163.0	162.0					14																	55467661		2203	4300	6503	SO:0001583	missense	11169	exon9			ATACTACCTGCAG	AJ006266	CCDS9721.1, CCDS41955.1	14q22.2	2013-01-09			ENSG00000198554	ENSG00000198554		"""WD repeat domain containing"""	23170	protein-coding gene	gene with protein product	"""CTF4, chromosome transmission fidelity factor 4 homolog (S. cerevisiae)"""	608126				9175701, 20028748	Standard	NM_007086		Approved	AND-1, CTF4, CHTF4	uc001xbm.2	O75717	OTTHUMG00000140304	ENST00000360586.3:c.743G>A	14.37:g.55467661C>T	ENSP00000353793:p.Gly248Asp	207.0	0.0		306.0	128.0	NM_007086	C9JW18|F6W0U7	Missense_Mutation	SNP	ENST00000360586.3	37	CCDS9721.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.040405	0.93630	.	.	ENSG00000198554	ENST00000360586;ENST00000421192;ENST00000420358	T;T;T	0.70164	4.5;-0.46;-0.46	5.56	5.56	0.83823	WD40/YVTN repeat-like-containing domain (1);Translation initiation factor 2A, beta propellor-like domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.87014	0.6072	M	0.93898	3.47	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.89426	0.3713	10	0.59425	D	0.04	.	19.5251	0.95201	0.0:1.0:0.0:0.0	.	248	O75717	WDHD1_HUMAN	D	248;125;125	ENSP00000353793:G248D;ENSP00000391049:G125D;ENSP00000399349:G125D	ENSP00000353793:G248D	G	-	2	0	WDHD1	54537411	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.562000	0.67346	2.615000	0.88500	0.591000	0.81541	GGT	.		0.333	WDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276897.2	NM_007086	
WDR1	9948	hgsc.bcm.edu;bcgsc.ca	37	4	10099482	10099482	+	Silent	SNP	A	A	G			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr4:10099482A>G	ENST00000499869.2	-	5	604	c.411T>C	c.(409-411)tcT>tcC	p.S137S	WDR1_ENST00000502702.1_Intron|WDR1_ENST00000382452.2_Silent_p.S137S|WDR1_ENST00000382451.2_Intron			O75083	WDR1_HUMAN	WD repeat domain 1	137					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sensory perception of sound (GO:0007605)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|lung(5)|ovary(2)|pancreas(1)|urinary_tract(1)	12				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		CGCCCACAGAAGAGCCACTAT	0.493																																					p.S137S		.											.	WDR1	48	0			c.T411C						.						52.0	52.0	52.0					4																	10099482		1989	4172	6161	SO:0001819	synonymous_variant	9948	exon5			CACAGAAGAGCCA	AF020260	CCDS54739.1, CCDS54740.1	4p16.1	2013-01-09			ENSG00000071127	ENSG00000071127		"""WD repeat domain containing"""	12754	protein-coding gene	gene with protein product		604734				10036186	Standard	NM_017491		Approved		uc021xlv.1	O75083	OTTHUMG00000160253	ENST00000499869.2:c.411T>C	4.37:g.10099482A>G		57.0	0.0		92.0	4.0	NM_017491	A8K6E9|A8MPU4|O75313|Q8N6E5|Q9UG05|Q9UG78|Q9UQE0	Silent	SNP	ENST00000499869.2	37	CCDS54740.1																																																																																			.		0.493	WDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359877.1		
WNK2	65268	hgsc.bcm.edu;broad.mit.edu	37	9	96021717	96021717	+	Missense_Mutation	SNP	C	C	A			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr9:96021717C>A	ENST00000297954.4	+	11	2887	c.2887C>A	c.(2887-2889)Ccc>Acc	p.P963T	WNK2_ENST00000427277.2_Missense_Mutation_p.P575T|WNK2_ENST00000395475.2_3'UTR|WNK2_ENST00000395477.2_Missense_Mutation_p.P963T|WNK2_ENST00000349097.3_Missense_Mutation_p.P575T|WNK2_ENST00000356055.3_5'UTR	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	963					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						ACCCACGCTGCCCCCTCAACC	0.692																																					p.P963T		.											.	WNK2	765	0			c.C2887A						.						45.0	42.0	43.0					9																	96021717		2177	4250	6427	SO:0001583	missense	65268	exon11			ACGCTGCCCCCTC	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.2887C>A	9.37:g.96021717C>A	ENSP00000297954:p.Pro963Thr	31.0	0.0		21.0	4.0	NM_006648	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Missense_Mutation	SNP	ENST00000297954.4	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	c|c|c	1.974|1.974|1.974	-0.435765|-0.435765|-0.435765	0.04636|0.04636|0.04636	.|.|.	.|.|.	ENSG00000165238|ENSG00000165238|ENSG00000165238	ENST00000411624|ENST00000432730|ENST00000297954;ENST00000395477;ENST00000349097;ENST00000427277	.|.|T;T;T;T	.|.|0.70045	.|.|-0.45;-0.4;0.12;0.12	1.82|1.82|1.82	-1.72|-1.72|-1.72	0.08107|0.08107|0.08107	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|.|T	0.34745|.|0.34745	0.0908|.|0.0908	N|N|N	0.08118|0.08118|0.08118	0|0|0	0.09310|0.09310|0.09310	N|N|N	0.999991|0.999991|0.999991	.|.|B;B;B;B;B	.|.|0.24317	.|.|0.101;0.038;0.061;0.101;0.061	.|.|B;B;B;B;B	.|.|0.12837	.|.|0.008;0.008;0.006;0.008;0.006	T|.|T	0.17623|.|0.17623	-1.0363|.|-1.0363	5|.|8	.|.|.	.|.|.	.|.|.	.|.|.	1.4464|1.4464|1.4464	0.02365|0.02365|0.02365	0.3453:0.3433:0.0:0.3115|0.3453:0.3433:0.0:0.3115|0.3453:0.3433:0.0:0.3115	.|.|.	.|.|963;963;566;963;963	.|.|Q9Y3S1-2;Q9Y3S1-4;A6PVR4;F8W9F9;Q9Y3S1	.|.|.;.;.;.;WNK2_HUMAN	D|X|T	566|958|963;963;575;575	.|.|ENSP00000297954:P963T;ENSP00000378860:P963T;ENSP00000297876:P575T;ENSP00000411181:P575T	.|.|.	A|C|P	+|+|+	2|3|1	0|2|0	WNK2|WNK2|WNK2	95061538|95061538|95061538	0.023000|0.023000|0.023000	0.18921|0.18921|0.18921	0.038000|0.038000|0.038000	0.18304|0.18304|0.18304	0.040000|0.040000|0.040000	0.13550|0.13550|0.13550	1.441000|1.441000|1.441000	0.35035|0.35035|0.35035	0.478000|0.478000|0.478000	0.27488|0.27488|0.27488	0.482000|0.482000|0.482000	0.46254|0.46254|0.46254	GCC|TGC|CCC	.		0.692	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317359.1	NM_006648	
ZNF318	24149	broad.mit.edu;mdanderson.org	37	6	43325451	43325451	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr6:43325451C>T	ENST00000361428.2	-	3	678	c.601G>A	c.(601-603)Ggt>Agt	p.G201S	ZNF318_ENST00000318149.3_Missense_Mutation_p.G201S	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	201					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			CGCTCAAGACCCCGAGAGCAC	0.468																																					p.G201S		.											.	ZNF318	157	0			c.G601A						.						113.0	116.0	115.0					6																	43325451		2203	4300	6503	SO:0001583	missense	24149	exon3			CAAGACCCCGAGA	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.601G>A	6.37:g.43325451C>T	ENSP00000354964:p.Gly201Ser	68.0	0.0		106.0	24.0	NM_014345	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	ENST00000361428.2	37	CCDS4895.2	.	.	.	.	.	.	.	.	.	.	C	19.11	3.763774	0.69878	.	.	ENSG00000171467	ENST00000318149;ENST00000361428	T;T	0.04758	3.56;3.56	5.62	2.83	0.33086	.	0.435500	0.25830	N	0.028029	T	0.03564	0.0102	N	0.24115	0.695	0.32982	D	0.523756	D	0.89917	1.0	D	0.91635	0.999	T	0.43491	-0.9388	10	0.39692	T	0.17	-2.101	5.9403	0.19189	0.0:0.6396:0.1378:0.2226	.	201	Q5VUA4	ZN318_HUMAN	S	201	ENSP00000323032:G201S;ENSP00000354964:G201S	ENSP00000323032:G201S	G	-	1	0	ZNF318	43433429	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	1.726000	0.38085	0.304000	0.22809	-0.300000	0.09419	GGT	.		0.468	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345	
ZNF429	353088	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	21720474	21720474	+	Missense_Mutation	SNP	A	A	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr19:21720474A>T	ENST00000358491.4	+	4	1827	c.1619A>T	c.(1618-1620)gAa>gTa	p.E540V	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	540					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						TACAAATGTGAAGAATGTGGC	0.363																																					p.E540V		.											.	ZNF429	516	0			c.A1619T						.						41.0	46.0	44.0					19																	21720474		2134	4269	6403	SO:0001583	missense	353088	exon4			AATGTGAAGAATG	AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.1619A>T	19.37:g.21720474A>T	ENSP00000351280:p.Glu540Val	32.0	0.0		42.0	10.0	NM_001001415	A6NLV7|Q9BZE6	Missense_Mutation	SNP	ENST00000358491.4	37	CCDS42537.1	.	.	.	.	.	.	.	.	.	.	.	1.769	-0.484820	0.04352	.	.	ENSG00000197013	ENST00000358491	T	0.07800	3.16	0.876	0.876	0.19138	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17619	0.0423	M	0.63169	1.94	0.09310	N	1	D	0.67145	0.996	D	0.63957	0.92	T	0.11251	-1.0595	9	0.48119	T	0.1	.	3.6737	0.08284	0.7461:0.0:0.2539:0.0	.	540	Q86V71	ZN429_HUMAN	V	540	ENSP00000351280:E540V	ENSP00000351280:E540V	E	+	2	0	ZNF429	21512314	0.000000	0.05858	0.285000	0.24819	0.285000	0.27093	-0.758000	0.04766	0.251000	0.21505	0.248000	0.18094	GAA	.		0.363	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463981.1	NM_001001415	
ZNF507	22847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	32873386	32873386	+	Missense_Mutation	SNP	G	G	C			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr19:32873386G>C	ENST00000311921.4	+	5	2566	c.2374G>C	c.(2374-2376)Ggg>Cgg	p.G792R	ZNF507_ENST00000544431.1_Missense_Mutation_p.G796R|ZNF507_ENST00000355898.5_Missense_Mutation_p.G792R	NM_001136156.1|NM_014910.4	NP_001129628.1|NP_055725.2	Q8TCN5	ZN507_HUMAN	zinc finger protein 507	792					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	31	Esophageal squamous(110;0.162)					CTCTCTGTGTGGGTATGTGTG	0.398																																					p.G792R		.											.	ZNF507	230	0			c.G2374C						.						294.0	292.0	292.0					19																	32873386		2203	4300	6503	SO:0001583	missense	22847	exon6			CTGTGTGGGTATG	AB029007	CCDS32985.1	19q13.12	2008-02-05				ENSG00000168813		"""Zinc fingers, C2H2-type"""	23783	protein-coding gene	gene with protein product							Standard	NM_014910		Approved	KIAA1084	uc002ntd.3	Q8TCN5		ENST00000311921.4:c.2374G>C	19.37:g.32873386G>C	ENSP00000312277:p.Gly792Arg	178.0	0.0		196.0	37.0	NM_001136156	A8K911|Q2TBF1|Q6MZU0|Q9UPR8	Missense_Mutation	SNP	ENST00000311921.4	37	CCDS32985.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.839148	0.91117	.	.	ENSG00000168813	ENST00000355898;ENST00000311921;ENST00000544431	T;T;T	0.36340	4.32;4.32;1.26	5.36	5.36	0.76844	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.043473	0.85682	D	0.000000	T	0.64170	0.2574	M	0.79343	2.45	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.67565	-0.5638	10	0.87932	D	0	.	19.4637	0.94929	0.0:0.0:1.0:0.0	.	792	Q8TCN5	ZN507_HUMAN	R	792;792;796	ENSP00000348162:G792R;ENSP00000312277:G792R;ENSP00000441549:G796R	ENSP00000312277:G792R	G	+	1	0	ZNF507	37565226	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.374000	0.97172	2.675000	0.91044	0.655000	0.94253	GGG	.		0.398	ZNF507-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450301.3	NM_014910	
ZNF541	84215	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	48047823	48047823	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A3EP-01A-11D-A22F-10	TCGA-BD-A3EP-11A-12D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9cd66ad6-837c-48db-b3a9-ed3e2558eef5	631a4a75-d468-41a0-9bf7-693499a63901	g.chr19:48047823C>T	ENST00000391901.3	-	3	1962	c.1963G>A	c.(1963-1965)Gcg>Acg	p.A655T	ZNF541_ENST00000314121.4_Missense_Mutation_p.A655T|ZNF541_ENST00000448976.1_Missense_Mutation_p.A655T			Q9H0D2	ZN541_HUMAN	zinc finger protein 541	655					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(1)|lung(2)|prostate(1)|skin(1)	9						GTTGGAACCGCGGCCACTTTC	0.632																																					.		.											.	ZNF541	23	0			.						.						34.0	35.0	35.0					19																	48047823		692	1591	2283	SO:0001583	missense	84215	.			GAACCGCGGCCAC	AL136846	CCDS46133.1, CCDS46133.2	19q13.33	2013-01-08			ENSG00000118156	ENSG00000118156		"""Zinc fingers, C2H2-type"""	25294	protein-coding gene	gene with protein product						11230166	Standard	NM_001277075		Approved	DKFZp434I1930	uc002phg.5	Q9H0D2	OTTHUMG00000141262	ENST00000391901.3:c.1963G>A	19.37:g.48047823C>T	ENSP00000375770:p.Ala655Thr	42.0	0.0		63.0	20.0	.	Q8NDK8	Missense_Mutation	SNP	ENST00000391901.3	37		.	.	.	.	.	.	.	.	.	.	C	0.012	-1.676130	0.00751	.	.	ENSG00000118156	ENST00000391901;ENST00000314121;ENST00000448976	T;T;T	0.14266	2.59;2.52;2.52	5.12	-10.2	0.00374	.	1.067670	0.07259	N	0.867222	T	0.04724	0.0128	N	0.14661	0.345	0.09310	N	1	B;B;B	0.10296	0.001;0.003;0.001	B;B;B	0.04013	0.0;0.001;0.001	T	0.27938	-1.0059	10	0.10902	T	0.67	-0.0038	4.7166	0.12898	0.0879:0.1085:0.3028:0.5008	.	655;655;655	Q9H0D2;Q9H0D2-2;Q9H0D2-3	ZN541_HUMAN;.;.	T	655	ENSP00000375770:A655T;ENSP00000313258:A655T;ENSP00000410847:A655T	ENSP00000313258:A655T	A	-	1	0	ZNF541	52739635	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.899000	0.01600	-2.943000	0.00296	-1.240000	0.01540	GCG	.		0.632	ZNF541-001	KNOWN	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000280415.1	NM_032255	
