#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACAT2	39	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	160184055	160184055	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr6:160184055G>T	ENST00000367048.4	+	2	1920	c.160G>T	c.(160-162)Gag>Tag	p.E54*	SOD2_ENST00000535372.1_5'Flank|SOD2_ENST00000546087.1_5'Flank|ACAT2_ENST00000541436.1_Nonsense_Mutation_p.E83*	NM_005891.2	NP_005882.2	Q9BWD1	THIC_HUMAN	acetyl-CoA acetyltransferase 2	54					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acetyl-CoA C-acetyltransferase activity (GO:0003985)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(1)	9		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.51e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		AGATGTGTCTGAGGTCATCTT	0.502																																					p.E54X		.											.	ACAT2	91	0			c.G160T						.						158.0	152.0	154.0					6																	160184055		2203	4300	6503	SO:0001587	stop_gained	39	exon2			GTGTCTGAGGTCA	AF356877	CCDS5268.1	6q25.3	2014-05-19	2010-04-30		ENSG00000120437	ENSG00000120437	2.3.1.9		94	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	100678	"""acetyl-Coenzyme A acetyltransferase 2 (acetoacetyl Coenzyme A thiolase)"", ""acetyl-Coenzyme A acetyltransferase 2"""			2475872	Standard	NM_005891		Approved		uc010kjy.3	Q9BWD1	OTTHUMG00000015935	ENST00000367048.4:c.160G>T	6.37:g.160184055G>T	ENSP00000356015:p.Glu54*	214.0	0.0		224.0	55.0	NM_005891	B7Z233|E1P5B1|Q16146|Q5TCL7|Q8TDM4	Nonsense_Mutation	SNP	ENST00000367048.4	37	CCDS5268.1	.	.	.	.	.	.	.	.	.	.	G	39	7.334209	0.98217	.	.	ENSG00000120437	ENST00000367048;ENST00000541436	.	.	.	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-5.9042	19.5715	0.95421	0.0:0.0:1.0:0.0	.	.	.	.	X	54;83	.	ENSP00000356015:E54X	E	+	1	0	ACAT2	160104045	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.247000	0.95444	2.704000	0.92352	0.555000	0.69702	GAG	.		0.502	ACAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042912.1	NM_005891	
ACSM4	341392	broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	7470658	7470658	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr12:7470658G>C	ENST00000399422.4	+	5	849	c.801G>C	c.(799-801)tgG>tgC	p.W267C		NM_001080454.1	NP_001073923.1	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	267					acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty-acyl-CoA synthase activity (GO:0004321)|metal ion binding (GO:0046872)			endometrium(6)|kidney(1)|lung(14)	21						ATATCATATGGAATATGTCTG	0.418																																					p.W267C		.											.	.	.	0			c.G801C						.						112.0	110.0	111.0					12																	7470658		1946	4134	6080	SO:0001583	missense	341392	exon5			CATATGGAATATG		CCDS44825.1	12p13.31	2008-06-12			ENSG00000215009	ENSG00000215009		"""Acyl-CoA synthetase family"""	32016	protein-coding gene	gene with protein product	"""similar to olfactory specific medium-chain acyl CoA synthetase"""	614360				17762044	Standard	NM_001080454		Approved		uc001qsx.1	P0C7M7	OTTHUMG00000154975	ENST00000399422.4:c.801G>C	12.37:g.7470658G>C	ENSP00000382349:p.Trp267Cys	246.0	2.0		303.0	22.0	NM_001080454	A8MTI6	Missense_Mutation	SNP	ENST00000399422.4	37	CCDS44825.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.47|17.47	3.397840|3.397840	0.62177|0.62177	.|.	.|.	ENSG00000215009|ENSG00000215009	ENST00000524777|ENST00000399422	.|T	.|0.40756	.|1.02	4.07|4.07	4.07|4.07	0.47477|0.47477	.|AMP-dependent synthetase/ligase (1);	.|0.000000	.|0.37437	.|U	.|0.002084	T|T	0.66982|0.66982	0.2845|0.2845	M|M	0.86097|0.86097	2.795|2.795	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	T|T	0.73610|0.73610	-0.3928|-0.3928	5|10	.|0.72032	.|D	.|0.01	-17.3344|-17.3344	14.1486|14.1486	0.65367|0.65367	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|267	.|P0C7M7	.|ACSM4_HUMAN	Q|C	13|267	.|ENSP00000382349:W267C	.|ENSP00000382349:W267C	E|W	+|+	1|3	0|0	ACSM4|ACSM4	7361925|7361925	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	5.885000|5.885000	0.69736|0.69736	2.260000|2.260000	0.74910|0.74910	0.655000|0.655000	0.94253|0.94253	GAA|TGG	.		0.418	ACSM4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000337866.2	NM_001080454	
ADCY1	107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	45688359	45688359	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr7:45688359T>A	ENST00000297323.7	+	5	1133	c.1111T>A	c.(1111-1113)Tgt>Agt	p.C371S	ADCY1_ENST00000432715.1_Missense_Mutation_p.C146S	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	371					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	TGCCCACTGCTGTGTGGAGAT	0.562																																					p.C371S		.											.	ADCY1	95	0			c.T1111A						.						115.0	89.0	97.0					7																	45688359		2203	4300	6503	SO:0001583	missense	107	exon5			CACTGCTGTGTGG	L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.1111T>A	7.37:g.45688359T>A	ENSP00000297323:p.Cys371Ser	266.0	0.0		184.0	75.0	NM_021116	A4D2L8|Q75MI1	Missense_Mutation	SNP	ENST00000297323.7	37	CCDS34631.1	.	.	.	.	.	.	.	.	.	.	T	17.32	3.359538	0.61403	.	.	ENSG00000164742	ENST00000432715;ENST00000297323;ENST00000545300	D;D	0.84442	-1.85;-1.85	4.34	4.34	0.51931	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	D	0.86184	0.5872	M	0.64630	1.985	0.80722	D	1	D;P	0.56287	0.975;0.805	P;P	0.51101	0.659;0.585	D	0.86083	0.1545	10	0.45353	T	0.12	.	11.5212	0.50551	0.0:0.0:0.0:1.0	.	371;146	Q08828;C9J1J0	ADCY1_HUMAN;.	S	146;371;371	ENSP00000392721:C146S;ENSP00000297323:C371S	ENSP00000297323:C371S	C	+	1	0	ADCY1	45654884	1.000000	0.71417	0.997000	0.53966	0.944000	0.59088	7.277000	0.78572	1.820000	0.53075	0.459000	0.35465	TGT	.		0.562	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116	
ADCY1	107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	45717579	45717579	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr7:45717579T>A	ENST00000297323.7	+	9	1739	c.1717T>A	c.(1717-1719)Tta>Ata	p.L573I		NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	573					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CAGCCGCCTCTTAGAAGCCCG	0.507																																					p.L573I		.											.	ADCY1	95	0			c.T1717A						.						75.0	82.0	80.0					7																	45717579		2203	4300	6503	SO:0001583	missense	107	exon9			CGCCTCTTAGAAG	L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.1717T>A	7.37:g.45717579T>A	ENSP00000297323:p.Leu573Ile	222.0	0.0		180.0	61.0	NM_021116	A4D2L8|Q75MI1	Missense_Mutation	SNP	ENST00000297323.7	37	CCDS34631.1	.	.	.	.	.	.	.	.	.	.	T	7.392	0.631051	0.14322	.	.	ENSG00000164742	ENST00000297323;ENST00000545300	T	0.74526	-0.85	5.24	-4.52	0.03472	.	0.063315	0.64402	D	0.000015	T	0.29158	0.0725	N	0.00648	-1.295	0.31492	N	0.665802	B	0.02656	0.0	B	0.04013	0.001	T	0.50021	-0.8876	10	0.02654	T	1	.	6.9609	0.24597	0.181:0.6385:0.0:0.1804	.	573	Q08828	ADCY1_HUMAN	I	573	ENSP00000297323:L573I	ENSP00000297323:L573I	L	+	1	2	ADCY1	45684104	1.000000	0.71417	0.905000	0.35620	0.991000	0.79684	4.295000	0.59049	-0.584000	0.05913	-0.290000	0.09829	TTA	.		0.507	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116	
AHNAK	79026	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	62292811	62292811	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr11:62292811T>A	ENST00000378024.4	-	5	9352	c.9078A>T	c.(9076-9078)aaA>aaT	p.K3026N	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	3026					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				ATTTGGGCATTTTCACTTTGG	0.547																																					p.K3026N		.											.	AHNAK	109	0			c.A9078T						.						190.0	199.0	196.0					11																	62292811		2202	4299	6501	SO:0001583	missense	79026	exon5			GGGCATTTTCACT	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.9078A>T	11.37:g.62292811T>A	ENSP00000367263:p.Lys3026Asn	165.0	0.0		162.0	67.0	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	-	13.65	2.299384	0.40694	.	.	ENSG00000124942	ENST00000378024	T	0.01538	4.79	3.97	-0.0249	0.13937	.	.	.	.	.	T	0.08133	0.0203	M	0.85197	2.74	0.31884	N	0.618068	D	0.65815	0.995	D	0.79784	0.993	T	0.08166	-1.0735	9	0.35671	T	0.21	.	5.7294	0.18030	0.0:0.339:0.1383:0.5226	.	3026	Q09666	AHNK_HUMAN	N	3026	ENSP00000367263:K3026N	ENSP00000367263:K3026N	K	-	3	2	AHNAK	62049387	0.802000	0.28943	0.990000	0.47175	0.589000	0.36550	-0.152000	0.10159	-0.219000	0.10003	0.242000	0.17961	AAA	.		0.547	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
ANKHD1	54882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	139892497	139892497	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr5:139892497A>G	ENST00000360839.2	+	23	4343	c.4189A>G	c.(4189-4191)Att>Gtt	p.I1397V	ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.I1397V|ANKHD1_ENST00000297183.6_Missense_Mutation_p.I1397V	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1397						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATAGCAACAATTACAGATAA	0.318																																					p.I1397V		.											.	ANKHD1	185	0			c.A4189G						.						110.0	115.0	113.0					5																	139892497		2202	4300	6502	SO:0001583	missense	54882	exon23			GCAACAATTACAG	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.4189A>G	5.37:g.139892497A>G	ENSP00000354085:p.Ile1397Val	179.0	0.0		201.0	125.0	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	37	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	A	12.92	2.081916	0.36758	.	.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000310356;ENST00000235510;ENST00000421134;ENST00000412116;ENST00000431508;ENST00000532219	T;T;T;T;T;T	0.66099	-0.1;-0.14;-0.04;-0.19;1.71;-0.14	5.2	5.2	0.72013	.	0.052621	0.64402	D	0.000001	T	0.49745	0.1575	L	0.39633	1.23	0.52099	D	0.999942	B;B;B;B;P;B	0.35507	0.112;0.021;0.104;0.021;0.506;0.123	B;B;B;B;B;B	0.27796	0.023;0.01;0.051;0.004;0.083;0.034	T	0.48801	-0.9003	10	0.23302	T	0.38	.	15.4127	0.74941	1.0:0.0:0.0:0.0	.	1397;608;1397;1416;1397;1397	E9PF56;E7ET58;Q8IWZ3-4;E9PDP5;Q8IWZ2;Q8IWZ3	.;.;.;.;.;ANKH1_HUMAN	V	1397;1430;1397;1397;931;608;1416;550;53;1397	ENSP00000354085:I1397V;ENSP00000297183:I1397V;ENSP00000394489:I1416V;ENSP00000405602:I550V;ENSP00000393204:I53V;ENSP00000432016:I1397V	ENSP00000432016:I1397V	I	+	1	0	ANKHD1-EIF4EBP3;ANKHD1	139872681	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.385000	0.79763	2.106000	0.64143	0.456000	0.33151	ATT	.		0.318	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
ANKRD18B	441459	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	9	33548138	33548138	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr9:33548138T>G	ENST00000290943.6	+	9	1262	c.1166T>G	c.(1165-1167)aTa>aGa	p.I389R		NM_001244752.1	NP_001231681.1	A2A2Z9	AN18B_HUMAN	ankyrin repeat domain 18B	389										NS(1)|breast(1)|endometrium(2)|lung(1)|prostate(1)|stomach(1)	7						GAAGAAATGATAACAAAAAAA	0.323																																					p.I388R		.											.	.	.	0			c.T1163G						.																																			SO:0001583	missense	441459	exon9			AAATGATAACAAA			9p13.3	2013-01-10			ENSG00000230453	ENSG00000230453		"""Ankyrin repeat domain containing"""	23644	protein-coding gene	gene with protein product							Standard	NM_001244752		Approved	bA255A11.3	uc010mjw.2	A2A2Z9	OTTHUMG00000019776	ENST00000290943.6:c.1166T>G	9.37:g.33548138T>G	ENSP00000290943:p.Ile389Arg	154.0	0.0		113.0	92.0	NM_001244752		Missense_Mutation	SNP	ENST00000290943.6	37		.	.	.	.	.	.	.	.	.	.	t	12.71	2.020893	0.35606	.	.	ENSG00000230453	ENST00000290943	T	0.16324	2.35	1.61	1.61	0.23674	.	.	.	.	.	T	0.21841	0.0526	.	.	.	0.22112	N	0.999358	.	.	.	.	.	.	T	0.28744	-1.0034	5	0.72032	D	0.01	.	7.2784	0.26297	0.0:0.0:0.0:1.0	.	.	.	.	R	389	ENSP00000290943:I389R	ENSP00000290943:I389R	I	+	2	0	ANKRD18B	33538138	0.955000	0.32602	0.005000	0.12908	0.037000	0.13140	3.064000	0.49986	0.989000	0.38761	0.248000	0.18094	ATA	.		0.323	ANKRD18B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000313729.2	XM_001718334	
ANKRD26	22852	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	27324233	27324233	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr10:27324233T>C	ENST00000376087.4	-	24	3311	c.3146A>G	c.(3145-3147)aAt>aGt	p.N1049S	ANKRD26_ENST00000436985.2_Missense_Mutation_p.N1065S|ANKRD26_ENST00000376070.3_Missense_Mutation_p.N606S	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	1048					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						CACATCAAAATTCATTTTGTC	0.338																																					p.N1049S		.											.	ANKRD26	138	0			c.A3146G						.						96.0	89.0	92.0					10																	27324233		1856	4093	5949	SO:0001583	missense	22852	exon24			TCAAAATTCATTT	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.3146A>G	10.37:g.27324233T>C	ENSP00000365255:p.Asn1049Ser	126.0	0.0		155.0	69.0	NM_014915	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	ENST00000376087.4	37	CCDS41499.1	.	.	.	.	.	.	.	.	.	.	T	5.645	0.303739	0.10678	.	.	ENSG00000107890	ENST00000376070;ENST00000376087;ENST00000436985	T;T;T	0.14893	2.47;2.47;2.47	5.7	3.26	0.37387	.	0.098954	0.41194	D	0.000926	T	0.16300	0.0392	L	0.49640	1.575	0.09310	N	1	B;B;P	0.36282	0.136;0.084;0.546	B;B;B	0.34722	0.053;0.024;0.188	T	0.06954	-1.0798	10	0.52906	T	0.07	.	11.0481	0.47870	0.0:0.0:0.2962:0.7038	.	1049;1048;1065	Q9UPS8-3;Q9UPS8;A1L497	.;ANR26_HUMAN;.	S	606;1049;1065	ENSP00000365238:N606S;ENSP00000365255:N1049S;ENSP00000405112:N1065S	ENSP00000365238:N606S	N	-	2	0	ANKRD26	27364239	1.000000	0.71417	0.010000	0.14722	0.060000	0.15804	1.619000	0.36965	0.385000	0.24970	0.482000	0.46254	AAT	.		0.338	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1		
ANO4	121601	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	101381353	101381353	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr12:101381353A>T	ENST00000392977.3	+	8	849	c.639A>T	c.(637-639)ttA>ttT	p.L213F	ANO4_ENST00000538618.1_3'UTR|ANO4_ENST00000299222.9_5'UTR|ANO4_ENST00000392979.3_Missense_Mutation_p.L178F			Q32M45	ANO4_HUMAN	anoctamin 4	213					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						GGAGATGGTTACCTAAGAAGC	0.502										HNSCC(74;0.22)	OREG0022059	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L178F		.											.	ANO4	96	0			c.A534T						.						262.0	251.0	255.0					12																	101381353		2203	4300	6503	SO:0001583	missense	121601	exon7			ATGGTTACCTAAG	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.639A>T	12.37:g.101381353A>T	ENSP00000376703:p.Leu213Phe	87.0	0.0	1358	86.0	47.0	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	ENST00000392977.3	37		.	.	.	.	.	.	.	.	.	.	A	17.37	3.371406	0.61624	.	.	ENSG00000151572	ENST00000392979;ENST00000392977	T;T	0.70986	-0.52;-0.53	5.33	5.33	0.75918	.	0.000000	0.56097	D	0.000028	T	0.71550	0.3353	L	0.34521	1.04	0.80722	D	1	P;P	0.50443	0.893;0.935	P;P	0.57324	0.482;0.818	T	0.72121	-0.4386	10	0.45353	T	0.12	.	11.2781	0.49178	0.9269:0.0:0.0731:0.0	.	213;178	Q32M45;Q32M45-2	ANO4_HUMAN;.	F	178;213	ENSP00000376705:L178F;ENSP00000376703:L213F	ENSP00000376703:L213F	L	+	3	2	ANO4	99905484	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.443000	0.35057	2.020000	0.59435	0.533000	0.62120	TTA	.		0.502	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
APOB	338	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	21228347	21228347	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr2:21228347G>C	ENST00000233242.1	-	26	11520	c.11393C>G	c.(11392-11394)aCa>aGa	p.T3798R		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3798					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGAATATTTTGTTAACACATC	0.398																																					p.T3798R		.											.	APOB	175	0			c.C11393G						.						143.0	143.0	143.0					2																	21228347		2203	4300	6503	SO:0001583	missense	338	exon26			TATTTTGTTAACA	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.11393C>G	2.37:g.21228347G>C	ENSP00000233242:p.Thr3798Arg	138.0	1.0		146.0	30.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787007	0.70337	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.01099	5.34	5.57	3.77	0.43336	.	0.213386	0.32852	N	0.005572	T	0.05456	0.0144	M	0.72118	2.19	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.14227	-1.0480	10	0.87932	D	0	.	11.6215	0.51121	0.1434:0.0:0.8566:0.0	.	3798	P04114	APOB_HUMAN	R	3798	ENSP00000233242:T3798R	ENSP00000233242:T3798R	T	-	2	0	APOB	21081852	1.000000	0.71417	0.652000	0.29579	0.965000	0.64279	3.583000	0.53928	1.353000	0.45828	0.655000	0.94253	ACA	.		0.398	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
ARHGEF25	115557	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	58008160	58008160	+	Silent	SNP	C	C	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr12:58008160C>T	ENST00000286494.4	+	7	1163	c.703C>T	c.(703-705)Ctg>Ttg	p.L235L	AC025165.8_ENST00000356672.3_RNA|ARHGEF25_ENST00000333972.7_Silent_p.L274L|AC025165.8_ENST00000593846.1_RNA|AC025165.8_ENST00000610219.1_RNA|AC025165.8_ENST00000444467.1_RNA	NM_182947.3	NP_891992	Q86VW2	ARHGP_HUMAN	Rho guanine nucleotide exchange factor (GEF) 25	235	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytosol (GO:0005829)|myofibril (GO:0030016)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	28						TCCTGATTGGCTGGCTCAGCT	0.547																																					p.L274L		.											.	ARHGEF25	653	0			c.C820T						.						74.0	80.0	78.0					12																	58008160		2203	4300	6503	SO:0001819	synonymous_variant	115557	exon8			GATTGGCTGGCTC		CCDS8947.1, CCDS44931.1	12q13.3	2011-11-16			ENSG00000240771	ENSG00000240771		"""Rho guanine nucleotide exchange factors"""	30275	protein-coding gene	gene with protein product	"""RAC/CDC42 exchange factor"""	610215				12547822	Standard	NM_182947		Approved	GEFT, p63RhoGEF	uc009zpy.4	Q86VW2	OTTHUMG00000152516	ENST00000286494.4:c.703C>T	12.37:g.58008160C>T		149.0	0.0		152.0	12.0	NM_001111270	A6NJH5|A9CQZ6|F8W7Z4|Q8WV84|Q96E63	Silent	SNP	ENST00000286494.4	37	CCDS8947.1																																																																																			.		0.547	ARHGEF25-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000326561.1	NM_133483	
ARHGEF33	100271715	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	39164550	39164550	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr2:39164550C>T	ENST00000536934.1	+	7	725	c.640C>T	c.(640-642)Cat>Tat	p.H214Y	RN7SL96P_ENST00000582641.1_RNA|ARHGEF33_ENST00000409978.1_Missense_Mutation_p.H214Y|ARHGEF33_ENST00000398800.4_Missense_Mutation_p.H214Y			A8MVX0	ARG33_HUMAN	Rho guanine nucleotide exchange factor (GEF) 33	214							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|pancreas(1)|prostate(1)	5						GTCCAAGGGCCATCTCCCATC	0.552																																					p.H214Y		.											.	ARHGEF33	46	0			c.C640T						.						58.0	53.0	54.0					2																	39164550		692	1591	2283	SO:0001583	missense	100271715	exon7			AAGGGCCATCTCC		CCDS46263.1, CCDS46263.2	2p22.1	2012-07-24			ENSG00000214694	ENSG00000214694		"""Rho guanine nucleotide exchange factors"""	37252	protein-coding gene	gene with protein product							Standard	NM_001145451		Approved		uc021vgd.1	A8MVX0	OTTHUMG00000153540	ENST00000536934.1:c.640C>T	2.37:g.39164550C>T	ENSP00000445586:p.His214Tyr	145.0	0.0		154.0	14.0	NM_001145451	J3KPX2	Missense_Mutation	SNP	ENST00000536934.1	37		.	.	.	.	.	.	.	.	.	.	C	11.28	1.591271	0.28357	.	.	ENSG00000214694	ENST00000409978;ENST00000398800;ENST00000536934	T;T;T	0.46451	0.87;0.87;0.87	5.6	5.6	0.85130	.	0.404659	0.22383	U	0.060797	T	0.24044	0.0582	N	0.14661	0.345	0.26434	N	0.975884	B	0.12013	0.005	B	0.04013	0.001	T	0.11891	-1.0569	10	0.10377	T	0.69	-7.8255	11.9878	0.53157	0.0:0.9216:0.0:0.0784	.	214	A8MVX0	ARG33_HUMAN	Y	214	ENSP00000387020:H214Y;ENSP00000381780:H214Y;ENSP00000445586:H214Y	ENSP00000381780:H214Y	H	+	1	0	ARHGEF33	39018054	1.000000	0.71417	0.995000	0.50966	0.920000	0.55202	3.515000	0.53429	2.627000	0.88993	0.655000	0.94253	CAT	.		0.552	ARHGEF33-202	KNOWN	basic	protein_coding	protein_coding		NM_001145451	
ARIH2	10425	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49006060	49006060	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr3:49006060G>C	ENST00000356401.4	+	7	971	c.632G>C	c.(631-633)aGg>aCg	p.R211T	ARIH2_ENST00000490095.1_3'UTR|ARIH2_ENST00000449376.1_Missense_Mutation_p.R211T	NM_006321.2	NP_006312.1	O95376	ARI2_HUMAN	ariadne RBR E3 ubiquitin protein ligase 2	211					developmental cell growth (GO:0048588)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organismal development (GO:0007275)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R211M(1)		cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		GAGAAATACAGGCGCTACCTC	0.512																																					p.R211T		.											.	ARIH2	91	1	Substitution - Missense(1)	lung(1)	c.G632C						.						166.0	162.0	163.0					3																	49006060		2203	4300	6503	SO:0001583	missense	10425	exon7			AATACAGGCGCTA	AF099149	CCDS2780.1	3p21	2013-10-03	2013-10-03		ENSG00000177479	ENSG00000177479			690	protein-coding gene	gene with protein product	"""all-trans retinoic acid inducible RING finger"""	605615	"""ariadne (Drosophila) homolog 2"", ""ariadne homolog 2 (Drosophila)"""			10422847, 24058416	Standard	XM_005264798		Approved	TRIAD1	uc003cvb.3	O95376	OTTHUMG00000133547	ENST00000356401.4:c.632G>C	3.37:g.49006060G>C	ENSP00000348769:p.Arg211Thr	177.0	0.0		145.0	19.0	NM_006321	Q9HBZ6|Q9UEM9	Missense_Mutation	SNP	ENST00000356401.4	37	CCDS2780.1	.	.	.	.	.	.	.	.	.	.	G	32	5.180134	0.94846	.	.	ENSG00000177479	ENST00000356401;ENST00000449376;ENST00000444790;ENST00000395481	T;T	0.80480	-1.38;-1.38	5.95	5.95	0.96441	Zinc finger, C6HC-type (2);	0.000000	0.85682	D	0.000000	D	0.86310	0.5902	L	0.42744	1.35	0.80722	D	1	D;D;P	0.59357	0.979;0.985;0.618	P;D;P	0.72338	0.76;0.977;0.447	T	0.81353	-0.0971	10	0.21540	T	0.41	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	218;211;211	B3KMG5;Q53ET9;O95376	.;.;ARI2_HUMAN	T	211;211;210;35	ENSP00000348769:R211T;ENSP00000403222:R211T	ENSP00000348769:R211T	R	+	2	0	ARIH2	48981064	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.604000	0.82830	2.824000	0.97209	0.655000	0.94253	AGG	.		0.512	ARIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257525.1	NM_006321	
ARMC3	219681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	23244747	23244747	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr10:23244747A>G	ENST00000298032.5	+	4	262	c.178A>G	c.(178-180)Aaa>Gaa	p.K60E	ARMC3_ENST00000464017.1_3'UTR|ARMC3_ENST00000376528.4_5'UTR|ARMC3_ENST00000409049.3_Missense_Mutation_p.K60E|ARMC3_ENST00000409983.3_Missense_Mutation_p.K60E	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	60						extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TGAGGAAAATAAAACAACCCT	0.378																																					p.K60E		.											.	ARMC3	90	0			c.A178G						.						122.0	122.0	122.0					10																	23244747		2203	4300	6503	SO:0001583	missense	219681	exon4			GAAAATAAAACAA	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.178A>G	10.37:g.23244747A>G	ENSP00000298032:p.Lys60Glu	43.0	0.0		64.0	19.0	NM_173081	A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Missense_Mutation	SNP	ENST00000298032.5	37	CCDS7142.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.604019	0.87157	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376523;ENST00000409049	T;T;T	0.72505	-0.66;-0.66;-0.66	5.36	5.36	0.76844	Armadillo-like helical (1);Armadillo-type fold (1);	0.092218	0.64402	D	0.000001	T	0.82217	0.4989	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.91635	0.979;0.999	D	0.84109	0.0400	10	0.72032	D	0.01	-20.9279	15.659	0.77169	1.0:0.0:0.0:0.0	.	60;60	Q5W041-4;Q5W041	.;ARMC3_HUMAN	E	60	ENSP00000298032:K60E;ENSP00000386943:K60E;ENSP00000387288:K60E	ENSP00000298032:K60E	K	+	1	0	ARMC3	23284753	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	8.077000	0.89505	2.165000	0.68154	0.533000	0.62120	AAA	.		0.378	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047197.2	NM_173081	
ARMCX3	51566	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	100880696	100880696	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chrX:100880696delA	ENST00000341189.4	+	5	1593	c.727delA	c.(727-729)aatfs	p.N243fs	ARMCX3_ENST00000471229.2_Frame_Shift_Del_p.N243fs|ARMCX3_ENST00000537169.1_Frame_Shift_Del_p.N243fs|RP4-545K15.5_ENST00000564612.1_RNA|ARMCX3-AS1_ENST00000454228.1_RNA	NM_016607.3	NP_057691.1	Q9UH62	ARMX3_HUMAN	armadillo repeat containing, X-linked 3	243					cellular protein localization (GO:0034613)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of mitochondrial outer membrane (GO:0031307)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11						CATGCTTGCTAATTCCATTTC	0.388																																					p.N243fs		.											.	ARMCX3	131	0			c.727delA						.						92.0	81.0	85.0					X																	100880696		2203	4300	6503	SO:0001589	frameshift_variant	51566	exon5			CTTGCTAATTCCA	AY359079	CCDS14489.1	Xq22.1	2014-03-21			ENSG00000102401	ENSG00000102401		"""Armadillo repeat containing"""	24065	protein-coding gene	gene with protein product		300364				11162520, 11042152, 19304657, 16221301, 22569362	Standard	NM_016607		Approved	ALEX3, GASP6	uc004eia.1	Q9UH62	OTTHUMG00000022035	ENST00000341189.4:c.727delA	X.37:g.100880696delA	ENSP00000340672:p.Asn243fs	161.0	0.0		177.0	89.0	NM_016607	Q53HC6|Q7LCF5|Q9NPE4	Frame_Shift_Del	DEL	ENST00000341189.4	37	CCDS14489.1																																																																																			.		0.388	ARMCX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057568.2	NM_016607	
ATP7A	538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	77244075	77244075	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chrX:77244075T>C	ENST00000341514.6	+	3	613	c.458T>C	c.(457-459)cTg>cCg	p.L153P	ATP7A_ENST00000343533.5_Missense_Mutation_p.L153P|ATP7A_ENST00000350425.4_Intron	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	153					blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	ACTGGGACACTGGAGAAAAAG	0.433																																					p.L153P		.											.	ATP7A	130	0			c.T458C						.						118.0	115.0	116.0					X																	77244075		2203	4295	6498	SO:0001583	missense	538	exon3			GGACACTGGAGAA	L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.458T>C	X.37:g.77244075T>C	ENSP00000345728:p.Leu153Pro	199.0	0.0		237.0	89.0	NM_000052	B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	ENST00000341514.6	37	CCDS35339.1	.	.	.	.	.	.	.	.	.	.	T	4.813	0.151205	0.09185	.	.	ENSG00000165240	ENST00000343533;ENST00000341514;ENST00000400860;ENST00000355691	D;D	0.96232	-3.94;-3.95	5.21	2.77	0.32553	.	0.564178	0.17117	N	0.186409	D	0.86518	0.5952	N	0.04880	-0.145	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.74957	-0.3487	10	0.31617	T	0.26	-14.8364	0.1137	0.00058	0.2617:0.2487:0.2365:0.2531	.	153;163	Q04656;Q59HD1	ATP7A_HUMAN;.	P	153;153;153;163	ENSP00000343026:L153P;ENSP00000345728:L153P	ENSP00000345728:L153P	L	+	2	0	ATP7A	77130731	0.094000	0.21725	0.961000	0.40146	0.769000	0.43574	0.391000	0.20784	0.611000	0.30052	0.486000	0.48141	CTG	.		0.433	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057306.1	NM_000052	
BCAS1	8537	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	52645509	52645509	+	Missense_Mutation	SNP	C	C	T	rs146806249		TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr20:52645509C>T	ENST00000395961.3	-	4	311	c.145G>A	c.(145-147)Gac>Aac	p.D49N	BCAS1_ENST00000411563.1_5'UTR|BCAS1_ENST00000371440.3_Missense_Mutation_p.D49N|BCAS1_ENST00000371435.2_Missense_Mutation_p.D49N	NM_003657.2	NP_003648.2	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	49						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(23)|ovary(2)|skin(2)|stomach(1)|urinary_tract(1)	37	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			ATTCCCAAGTCGACTGTAAAC	0.443																																					p.D49N		.											.	BCAS1	652	0			c.G145A						.	C	ASN/ASP	1,4405		0,1,2202	40.0	38.0	39.0		145	4.1	1.0	20	dbSNP_134	39	0,8600		0,0,4300	no	missense	BCAS1	NM_003657.2	23	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	49/585	52645509	1,13005	2203	4300	6503	SO:0001583	missense	8537	exon4			CCAAGTCGACTGT	AF041260	CCDS13444.1	20q13.2	2006-11-10			ENSG00000064787	ENSG00000064787			974	protein-coding gene	gene with protein product		602968				9671742	Standard	NM_003657		Approved	NABC1, AIBC1	uc002xws.2	O75363	OTTHUMG00000032772	ENST00000395961.3:c.145G>A	20.37:g.52645509C>T	ENSP00000379290:p.Asp49Asn	33.0	0.0		36.0	18.0	NM_003657	A0AVG5|Q68CZ3	Missense_Mutation	SNP	ENST00000395961.3	37	CCDS13444.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.720736	0.48728	2.27E-4	0.0	ENSG00000064787	ENST00000371440;ENST00000395961;ENST00000371435	T;T;T	0.19105	2.17;2.17;2.17	5.05	4.09	0.47781	.	0.174194	0.39909	N	0.001234	T	0.35038	0.0918	L	0.52759	1.655	0.80722	D	1	D;D;D	0.89917	0.972;1.0;1.0	P;D;D	0.63703	0.525;0.917;0.917	T	0.02539	-1.1144	10	0.51188	T	0.08	-10.9768	11.4075	0.49906	0.0:0.909:0.0:0.091	.	49;49;49	G3XAF7;A0AVG7;O75363	.;.;BCAS1_HUMAN	N	49	ENSP00000360495:D49N;ENSP00000379290:D49N;ENSP00000360490:D49N	ENSP00000360490:D49N	D	-	1	0	BCAS1	52078916	0.954000	0.32549	0.958000	0.39756	0.196000	0.23810	2.570000	0.45981	2.487000	0.83934	0.462000	0.41574	GAC	C|1.000;T|0.000		0.443	BCAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079766.2	NM_003657	
BCL3	602	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	45260278	45260278	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr19:45260278C>T	ENST00000164227.5	+	4	768	c.524C>T	c.(523-525)cCg>cTg	p.P175L		NM_005178.4	NP_005169.2	P20749	BCL3_HUMAN	B-cell CLL/lymphoma 3	175					antimicrobial humoral response (GO:0019730)|cellular response to DNA damage stimulus (GO:0006974)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|protein import into nucleus, translocation (GO:0000060)|regulation of apoptotic process (GO:0042981)|regulation of DNA binding (GO:0051101)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to UV-C (GO:0010225)|response to virus (GO:0009615)|spleen development (GO:0048536)|T-helper 1 type immune response (GO:0042088)|T-helper 2 cell differentiation (GO:0045064)|transcription, DNA-templated (GO:0006351)	Bcl3-Bcl10 complex (GO:0032996)|Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	Lung NSC(12;0.000698)|all_lung(12;0.002)	Ovarian(192;0.0728)				CCCCAGACACCGCTCCACCTG	0.622			T	IGH@	CLL																																p.P175L		.		Dom	yes		19	19q13	602	B-cell CLL/lymphoma 3		L	.	BCL3	848	0			c.C524T						.						32.0	20.0	24.0					19																	45260278		2146	4186	6332	SO:0001583	missense	602	exon4			AGACACCGCTCCA	M31732	CCDS12642.2	19q13.1-q13.2	2013-01-10			ENSG00000069399	ENSG00000069399		"""Ankyrin repeat domain containing"""	998	protein-coding gene	gene with protein product	"""B-cell lymphoma 3-encoded protein"", ""B-cell leukemia/lymphoma 3"", ""chronic lymphatic leukemia protein"""	109560		D19S37, BCL4		1501714, 2180580	Standard	NM_005178		Approved		uc010xxe.2	P20749	OTTHUMG00000151517	ENST00000164227.5:c.524C>T	19.37:g.45260278C>T	ENSP00000164227:p.Pro175Leu	210.0	0.0		537.0	101.0	NM_005178		Missense_Mutation	SNP	ENST00000164227.5	37	CCDS12642.2	.	.	.	.	.	.	.	.	.	.	C	25.3	4.627946	0.87560	.	.	ENSG00000069399	ENST00000403534;ENST00000164227	T	0.71698	-0.59	4.95	4.95	0.65309	Ankyrin repeat-containing domain (3);	0.000000	0.42682	D	0.000680	D	0.85331	0.5672	M	0.84433	2.695	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87585	0.2487	10	0.62326	D	0.03	-13.5552	15.6745	0.77303	0.0:1.0:0.0:0.0	.	175	P20749	BCL3_HUMAN	L	135;175	ENSP00000164227:P175L	ENSP00000164227:P175L	P	+	2	0	BCL3	49952118	1.000000	0.71417	0.879000	0.34478	0.981000	0.71138	6.265000	0.72534	2.276000	0.75962	0.462000	0.41574	CCG	.		0.622	BCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322976.1	NM_005178	
BCOR	54880	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	39922123	39922123	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chrX:39922123T>A	ENST00000378444.4	-	9	4277	c.4049A>T	c.(4048-4050)tAc>tTc	p.Y1350F	BCOR_ENST00000397354.3_Missense_Mutation_p.Y1316F|BCOR_ENST00000342274.4_Missense_Mutation_p.Y1316F|BCOR_ENST00000378455.4_Missense_Mutation_p.Y1298F|BCOR_ENST00000378463.1_Missense_Mutation_p.Y193F	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1350					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						GTTGTCGGTGTATTTCTGCAG	0.527			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																														p.Y1350F		.		Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		.	BCOR	229	0			c.A4049T						.						128.0	100.0	109.0					X																	39922123		2202	4300	6502	SO:0001583	missense	54880	exon9			TCGGTGTATTTCT	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.4049A>T	X.37:g.39922123T>A	ENSP00000367705:p.Tyr1350Phe	373.0	1.0		341.0	118.0	NM_001123385	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Missense_Mutation	SNP	ENST00000378444.4	37	CCDS48093.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.61|13.61	2.289061|2.289061	0.40494|0.40494	.|.	.|.	ENSG00000183337|ENSG00000183337	ENST00000427012|ENST00000413905;ENST00000378463;ENST00000378455;ENST00000397354;ENST00000378444;ENST00000342274;ENST00000442018	.|T;T;T;T;T;T;T	.|0.70164	.|-0.41;0.98;1.04;1.01;1.01;1.01;-0.46	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	.|.	.|.	.|.	.|.	T|T	0.52208|0.52208	0.1720|0.1720	N|N	0.19112|0.19112	0.55|0.55	0.43457|0.43457	D|D	0.995655|0.995655	.|B;B;B	.|0.16166	.|0.007;0.016;0.016	.|B;B;B	.|0.15484	.|0.013;0.006;0.013	T|T	0.48281|0.48281	-0.9049|-0.9049	5|9	.|0.37606	.|T	.|0.19	-14.861|-14.861	14.0817|14.0817	0.64929|0.64929	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1298;1350;1316	.|Q6W2J9-4;Q6W2J9;Q6W2J9-2	.|.;BCOR_HUMAN;.	S|F	45|220;193;1298;1316;1350;1316;23	.|ENSP00000408006:Y220F;ENSP00000367724:Y193F;ENSP00000367716:Y1298F;ENSP00000380512:Y1316F;ENSP00000367705:Y1350F;ENSP00000345923:Y1316F;ENSP00000387552:Y23F	.|ENSP00000345923:Y1316F	T|Y	-|-	1|2	0|0	BCOR|BCOR	39807067|39807067	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.923000|0.923000	0.55619|0.55619	1.531000|1.531000	0.36018|0.36018	1.900000|1.900000	0.55004|0.55004	0.486000|0.486000	0.48141|0.48141	ACA|TAC	.		0.527	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745	
BRSK1	84446	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	55795935	55795935	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr19:55795935A>T	ENST00000309383.1	+	1	402	c.125A>T	c.(124-126)aAa>aTa	p.K42I	BRSK1_ENST00000585418.1_Missense_Mutation_p.K42I|BRSK1_ENST00000590333.1_Missense_Mutation_p.K58I	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	42	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		ACGCTGGGCAAAGGACAGACA	0.687																																					p.K42I		.											.	BRSK1	759	0			c.A125T						.						6.0	6.0	6.0					19																	55795935		1963	3929	5892	SO:0001583	missense	84446	exon1			TGGGCAAAGGACA	AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.125A>T	19.37:g.55795935A>T	ENSP00000310649:p.Lys42Ile	320.0	1.0		554.0	97.0	NM_032430	F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Missense_Mutation	SNP	ENST00000309383.1	37	CCDS12921.1	.	.	.	.	.	.	.	.	.	.	.	9.900	1.206522	0.22205	.	.	ENSG00000160469	ENST00000309383	T	0.67171	-0.25	3.02	1.98	0.26296	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.170949	0.35466	U	0.003181	T	0.76814	0.4040	M	0.82823	2.61	0.80722	D	1	P;P	0.52170	0.918;0.951	P;D	0.63033	0.815;0.91	T	0.76966	-0.2763	10	0.87932	D	0	.	5.6015	0.17357	0.8582:0.0:0.1418:0.0	.	42;58	Q8TDC3;Q8TDC3-2	BRSK1_HUMAN;.	I	42	ENSP00000310649:K42I	ENSP00000310649:K42I	K	+	2	0	BRSK1	60487747	1.000000	0.71417	0.997000	0.53966	0.088000	0.18126	4.589000	0.61006	1.337000	0.45525	0.147000	0.16070	AAA	.		0.687	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430	
CATIP	375307	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	219225314	219225314	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr2:219225314G>T	ENST00000289388.3	+	5	423	c.394G>T	c.(394-396)Gaa>Taa	p.E132*	C2orf62_ENST00000481940.1_3'UTR|AC021016.8_ENST00000411433.1_RNA	NM_198559.1	NP_940961.1	Q7Z7H3	CATIP_HUMAN		132					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCTCCCCATGGAACGGAAGAT	0.552																																					p.E132X		.											.	C2orf62	68	0			c.G394T						.						99.0	83.0	88.0					2																	219225314		2203	4300	6503	SO:0001587	stop_gained	375307	exon5			CCCATGGAACGGA																												ENST00000289388.3:c.394G>T	2.37:g.219225314G>T	ENSP00000289388:p.Glu132*	39.0	0.0		53.0	34.0	NM_198559		Nonsense_Mutation	SNP	ENST00000289388.3	37	CCDS2414.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.696440	0.30142	.	.	ENSG00000158428	ENST00000289388	.	.	.	4.36	3.48	0.39840	.	0.187935	0.44285	D	0.000479	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-3.8436	8.0276	0.30446	0.111:0.0:0.889:0.0	.	.	.	.	X	132	.	ENSP00000289388:E132X	E	+	1	0	C2orf62	218933558	1.000000	0.71417	0.815000	0.32552	0.192000	0.23643	3.157000	0.50716	1.047000	0.40274	-0.148000	0.13756	GAA	.		0.552	C2orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256771.1		
CA8	767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	61193683	61193683	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr8:61193683T>A	ENST00000317995.4	-	1	288	c.24A>T	c.(22-24)gaA>gaT	p.E8D		NM_004056.4	NP_004047.3	P35219	CAH8_HUMAN	carbonic anhydrase VIII	8					one-carbon metabolic process (GO:0006730)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasm (GO:0005737)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(6)|prostate(2)|skin(1)	16		all_cancers(86;0.172)|all_epithelial(80;0.0383)|all_lung(136;0.0413)|Lung NSC(129;0.0474)			Zonisamide(DB00909)	CGACGGTATCTTCGATGAAGC	0.677																																					p.E8D		.											.	CA8	90	0			c.A24T						.						71.0	56.0	61.0					8																	61193683		2186	4290	6476	SO:0001583	missense	767	exon1			GGTATCTTCGATG	L04656	CCDS6174.1	8q12.1	2012-08-21			ENSG00000178538	ENSG00000178538		"""Carbonic anhydrases"""	1382	protein-coding gene	gene with protein product		114815		CALS		17219437	Standard	NM_004056		Approved	CARP	uc003xtz.1	P35219	OTTHUMG00000165325	ENST00000317995.4:c.24A>T	8.37:g.61193683T>A	ENSP00000314407:p.Glu8Asp	44.0	0.0		44.0	19.0	NM_004056	A8K0A5|B3KQZ7|Q32MY2	Missense_Mutation	SNP	ENST00000317995.4	37	CCDS6174.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.101451	0.76983	.	.	ENSG00000178538	ENST00000317995	T	0.67865	-0.29	3.64	-4.2	0.03823	.	0.284967	0.32769	N	0.005663	T	0.47469	0.1447	L	0.36672	1.1	0.38712	D	0.953245	B	0.02656	0.0	B	0.01281	0.0	T	0.05937	-1.0855	10	0.87932	D	0	.	6.8076	0.23786	0.1449:0.5382:0.0:0.3169	.	8	P35219	CAH8_HUMAN	D	8	ENSP00000314407:E8D	ENSP00000314407:E8D	E	-	3	2	CA8	61356237	0.412000	0.25392	0.988000	0.46212	0.716000	0.41182	-0.663000	0.05299	-0.644000	0.05465	0.379000	0.24179	GAA	.		0.677	CA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383445.1		
CACTIN	58509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	3612206	3612206	+	Silent	SNP	G	G	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr19:3612206G>A	ENST00000429344.2	-	10	2044	c.1992C>T	c.(1990-1992)gaC>gaT	p.D664D	CACTIN-AS1_ENST00000592274.1_RNA|CACTIN_ENST00000221899.3_Silent_p.D596D|CACTIN_ENST00000248420.5_Silent_p.D664D	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit	664					cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										GGTTGTCAAAGTCGTAGTGCG	0.587																																					p.D664D		.											.	.	.	0			c.C1992T						.						133.0	149.0	143.0					19																	3612206		2170	4265	6435	SO:0001819	synonymous_variant	58509	exon10			GTCAAAGTCGTAG	BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.1992C>T	19.37:g.3612206G>A		274.0	0.0		617.0	456.0	NM_021231	A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Silent	SNP	ENST00000429344.2	37	CCDS45920.1	.	.	.	.	.	.	.	.	.	.	G	8.361	0.833183	0.16820	.	.	ENSG00000226800	ENST00000447295	.	.	.	4.02	2.97	0.34412	.	.	.	.	.	T	0.48333	0.1494	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.25467	-1.0131	5	0.18710	T	0.47	.	7.592	0.28027	0.2018:0.0:0.7982:0.0	.	.	.	.	I	160	.	ENSP00000412459:V160I	V	+	1	0	C19orf29OS	3563206	1.000000	0.71417	0.999000	0.59377	0.003000	0.03518	6.183000	0.72002	1.036000	0.39998	-0.152000	0.13540	GTC	.		0.587	CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457370.2		
CARD11	84433	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	2968238	2968238	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr7:2968238T>C	ENST00000396946.4	-	13	2151	c.1748A>G	c.(1747-1749)cAt>cGt	p.H583R		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	583					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CCACCTGCGATGGGGCGCGTC	0.662			Mis		DLBCL																																p.H583R		.		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	CARD11	870	0			c.A1748G						.						80.0	66.0	71.0					7																	2968238		2203	4300	6503	SO:0001583	missense	84433	exon13			CTGCGATGGGGCG	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.1748A>G	7.37:g.2968238T>C	ENSP00000380150:p.His583Arg	57.0	0.0		27.0	9.0	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	t	0.643	-0.812527	0.02798	.	.	ENSG00000198286	ENST00000396946;ENST00000355508	T;T	0.42513	0.97;0.97	4.96	0.974	0.19715	.	0.475226	0.21916	N	0.067239	T	0.19565	0.0470	N	0.08118	0	0.09310	N	1	B	0.14438	0.01	B	0.19148	0.024	T	0.18650	-1.0330	10	0.25751	T	0.34	-9.5868	7.9574	0.30051	0.1313:0.0:0.4092:0.4595	.	583	Q9BXL7	CAR11_HUMAN	R	583;54	ENSP00000380150:H583R;ENSP00000347695:H54R	ENSP00000347695:H54R	H	-	2	0	CARD11	2934764	0.962000	0.33011	0.008000	0.14137	0.833000	0.47200	1.739000	0.38217	-0.068000	0.12953	0.454000	0.30748	CAT	.		0.662	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
CATSPERD	257062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	5772804	5772804	+	Missense_Mutation	SNP	G	G	A	rs369818912		TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr19:5772804G>A	ENST00000381624.3	+	20	1830	c.1769G>A	c.(1768-1770)cGa>cAa	p.R590Q	CATSPERD_ENST00000309164.7_3'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	590					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											CCTAGGTGGCGAAAAGACAGT	0.612																																					p.R590Q		.											.	.	.	0			c.G1769A						.	G	GLN/ARG	0,4260		0,0,2130	83.0	87.0	86.0		1769	-4.8	0.0	19		86	1,8481		0,1,4240	no	missense	TMEM146	NM_152784.3	43	0,1,6370	AA,AG,GG		0.0118,0.0,0.0078	benign	590/799	5772804	1,12741	2130	4241	6371	SO:0001583	missense	257062	exon20			GGTGGCGAAAAGA	BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.1769G>A	19.37:g.5772804G>A	ENSP00000371037:p.Arg590Gln	156.0	0.0		209.0	65.0	NM_152784	Q6ZRP1	Missense_Mutation	SNP	ENST00000381624.3	37	CCDS12149.2	.	.	.	.	.	.	.	.	.	.	G	8.770	0.925745	0.18056	0.0	1.18E-4	ENSG00000174898	ENST00000381624;ENST00000309164;ENST00000381613	T	0.23552	1.9	3.01	-4.75	0.03239	.	2.340000	0.02425	N	0.082989	T	0.20618	0.0496	L	0.51422	1.61	0.09310	N	1	B	0.27351	0.176	B	0.15870	0.014	T	0.25537	-1.0129	10	0.62326	D	0.03	-1.6801	4.7864	0.13227	0.3131:0.0:0.5153:0.1716	.	590	Q86XM0	TM146_HUMAN	Q	590;261;259	ENSP00000371037:R590Q	ENSP00000310546:R261Q	R	+	2	0	TMEM146	5723804	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.497000	0.02289	-0.914000	0.03827	-1.267000	0.01435	CGA	.		0.612	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286953.2	NM_152784	
CBFA2T2	9139	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	32207387	32207387	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr20:32207387G>T	ENST00000346541.3	+	5	1049	c.512G>T	c.(511-513)cGt>cTt	p.R171L	CBFA2T2_ENST00000492345.1_Missense_Mutation_p.R142L|CBFA2T2_ENST00000359606.3_Missense_Mutation_p.R181L|CBFA2T2_ENST00000344201.3_Missense_Mutation_p.R142L|CBFA2T2_ENST00000375279.2_Missense_Mutation_p.R171L|CBFA2T2_ENST00000491618.1_3'UTR|CBFA2T2_ENST00000342704.6_Missense_Mutation_p.R162L|CBFA2T2_ENST00000397800.1_Missense_Mutation_p.R142L|CBFA2T2_ENST00000397798.2_Missense_Mutation_p.R142L	NM_005093.3	NP_005084.1	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 2	171	TAFH. {ECO:0000255|PROSITE- ProRule:PRU00440}.				epithelial cell differentiation (GO:0030855)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)	20						TTTCCCCTTCGTCCTTTTGTG	0.338																																					p.R171L	Esophageal Squamous(174;142 1955 14837 21276 28041)	.											.	CBFA2T2	92	0			c.G512T						.						84.0	86.0	85.0					20																	32207387		2203	4300	6503	SO:0001583	missense	9139	exon5			CCCTTCGTCCTTT	AF052210	CCDS13221.1, CCDS46590.1	20q11	2007-01-29			ENSG00000078699	ENSG00000078699		"""Zinc fingers, MYND-type"""	1536	protein-coding gene	gene with protein product		603672				9790752	Standard	XM_006723886		Approved	MTGR1, ZMYND3	uc002wze.1	O43439	OTTHUMG00000032261	ENST00000346541.3:c.512G>T	20.37:g.32207387G>T	ENSP00000262653:p.Arg171Leu	123.0	0.0		137.0	62.0	NM_005093	B2RAE6|F8W6D7|Q5TGE4|Q5TGE5|Q5TGE6|Q5TGE7|Q8IWF3|Q96B06|Q96L00|Q9H436|Q9UJP8|Q9UJP9|Q9UP24	Missense_Mutation	SNP	ENST00000346541.3	37	CCDS13221.1	.	.	.	.	.	.	.	.	.	.	G	32	5.186916	0.94923	.	.	ENSG00000078699	ENST00000375279;ENST00000342704;ENST00000417366;ENST00000344201;ENST00000346541;ENST00000397800;ENST00000397798;ENST00000359606	T;T;T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69	5.4	5.4	0.78164	TAFH/NHR1 (3);	0.000000	0.85682	D	0.000000	T	0.71358	0.3330	M	0.77820	2.39	0.80722	D	1	D;D	0.62365	0.991;0.989	D;D	0.80764	0.994;0.99	T	0.74907	-0.3504	10	0.87932	D	0	-0.6716	19.1707	0.93576	0.0:0.0:1.0:0.0	.	171;162	O43439;F8W6D7	MTG8R_HUMAN;.	L	171;162;162;142;171;142;142;181	ENSP00000364428:R171L;ENSP00000345810:R162L;ENSP00000408352:R162L;ENSP00000341865:R142L;ENSP00000262653:R171L;ENSP00000380902:R142L;ENSP00000380900:R142L;ENSP00000352622:R181L	ENSP00000345810:R162L	R	+	2	0	CBFA2T2	31671048	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.568000	0.82369	2.522000	0.85027	0.650000	0.86243	CGT	.		0.338	CBFA2T2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078708.2	NM_001032999	
CCDC134	79879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	42209427	42209427	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr22:42209427C>T	ENST00000255784.5	+	5	574	c.470C>T	c.(469-471)cCc>cTc	p.P157L	CCDC134_ENST00000402061.3_Intron	NM_024821.2	NP_079097.1	Q9H6E4	CC134_HUMAN	coiled-coil domain containing 134	157						extracellular region (GO:0005576)|membrane (GO:0016020)				large_intestine(1)|lung(2)|ovary(2)|skin(1)	6						AACCAGGGGCCCCACTCGCCC	0.577																																					p.P157L		.											.	CCDC134	92	0			c.C470T						.						51.0	49.0	50.0					22																	42209427		2203	4300	6503	SO:0001583	missense	79879	exon5			AGGGGCCCCACTC	AL021453	CCDS33654.1	22q13.2	2010-12-24			ENSG00000100147	ENSG00000100147			26185	protein-coding gene	gene with protein product						18087676	Standard	NM_024821		Approved	FLJ22349	uc003bbh.1	Q9H6E4	OTTHUMG00000151262	ENST00000255784.5:c.470C>T	22.37:g.42209427C>T	ENSP00000255784:p.Pro157Leu	187.0	1.0		166.0	128.0	NM_024821		Missense_Mutation	SNP	ENST00000255784.5	37	CCDS33654.1	.	.	.	.	.	.	.	.	.	.	C	15.74	2.922042	0.52653	.	.	ENSG00000100147	ENST00000255784	.	.	.	5.51	4.44	0.53790	.	0.167589	0.52532	D	0.000063	T	0.57710	0.2072	L	0.50333	1.59	0.58432	D	0.999998	B	0.32467	0.372	B	0.30855	0.121	T	0.62737	-0.6791	9	0.56958	D	0.05	-18.8769	16.9734	0.86306	0.0:0.8728:0.1272:0.0	.	157	Q9H6E4	CC134_HUMAN	L	157	.	ENSP00000255784:P157L	P	+	2	0	CCDC134	40539373	0.955000	0.32602	1.000000	0.80357	0.346000	0.29079	5.626000	0.67777	2.746000	0.94184	0.655000	0.94253	CCC	.		0.577	CCDC134-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000321964.1	NM_024821	
CCDC47	57003	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	61829358	61829358	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr17:61829358C>A	ENST00000225726.5	-	12	1695	c.1313G>T	c.(1312-1314)aGa>aTa	p.R438I	CCDC47_ENST00000582252.1_Missense_Mutation_p.R438I|CCDC47_ENST00000403162.3_Missense_Mutation_p.R438I|RP11-51F16.8_ENST00000580553.1_Nonsense_Mutation_p.E34*	NM_020198.2	NP_064583.2	Q96A33	CCD47_HUMAN	coiled-coil domain containing 47	438					calcium ion homeostasis (GO:0055074)|ER overload response (GO:0006983)|osteoblast differentiation (GO:0001649)|post-embryonic development (GO:0009791)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	18						CTTCTCTGCTCTTTTTTTCTC	0.463																																					p.R438I		.											.	CCDC47	90	0			c.G1313T						.						141.0	137.0	139.0					17																	61829358		2203	4300	6503	SO:0001583	missense	57003	exon12			TCTGCTCTTTTTT	AF226054	CCDS11643.1	17q23.3	2005-12-19				ENSG00000108588			24856	protein-coding gene	gene with protein product						12477932	Standard	NM_020198		Approved	GK001	uc002jbs.4	Q96A33		ENST00000225726.5:c.1313G>T	17.37:g.61829358C>A	ENSP00000225726:p.Arg438Ile	156.0	0.0		126.0	73.0	NM_020198	B2RAS8|D3DU20|Q96D00|Q96JZ7|Q9H3E4|Q9NRG3	Missense_Mutation	SNP	ENST00000225726.5	37	CCDS11643.1	.	.	.	.	.	.	.	.	.	.	C	16.41	3.116551	0.56505	.	.	ENSG00000108588	ENST00000225726;ENST00000403162	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	D	0.83184	0.5199	M	0.81497	2.545	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.85130	0.994;0.997	D	0.84786	0.0776	9	0.62326	D	0.03	-14.4897	18.3164	0.90223	0.0:1.0:0.0:0.0	.	438;438	Q96A33-2;Q96A33	.;CCD47_HUMAN	I	438	.	ENSP00000225726:R438I	R	-	2	0	CCDC47	59183090	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.809000	0.86057	2.566000	0.86566	0.563000	0.77884	AGA	.		0.463	CCDC47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444016.2	NM_020198	
CD5L	922	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	157804417	157804417	+	Silent	SNP	G	G	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr1:157804417G>A	ENST00000368174.4	-	4	594	c.498C>T	c.(496-498)ggC>ggT	p.G166G	CD5L_ENST00000484609.1_5'Flank	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	166	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GGAGGCTCCAGCCTGTCTGGC	0.612																																					p.G166G		.											.	CD5L	91	0			c.C498T						.						94.0	92.0	93.0					1																	157804417		2203	4300	6503	SO:0001819	synonymous_variant	922	exon4			GCTCCAGCCTGTC	U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.498C>T	1.37:g.157804417G>A		92.0	0.0		128.0	57.0	NM_005894	A8K7M5|Q6UX63	Silent	SNP	ENST00000368174.4	37	CCDS1171.1																																																																																			.		0.612	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894	
CEACAM18	729767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	51981868	51981868	+	5'Flank	SNP	C	C	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr19:51981868C>A	ENST00000396477.4	+	0	0				CEACAM18_ENST00000451626.1_Missense_Mutation_p.P52H	NM_001278392.1	NP_001265321.1	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 18											breast(1)|endometrium(4)|large_intestine(3)|lung(8)|skin(1)	17		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CTGGAGGGACCCCTCCTCCTG	0.627																																					p.P52H		.											.	CEACAM18	23	0			c.C155A						.						30.0	35.0	34.0					19																	51981868		1984	4147	6131	SO:0001631	upstream_gene_variant	729767	exon2			AGGGACCCCTCCT			19q13.41	2013-01-29				ENSG00000213822		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31949	protein-coding gene	gene with protein product							Standard	NM_001278392		Approved		uc002pwv.1	A8MTB9			19.37:g.51981868C>A	Exception_encountered	82.0	0.0		203.0	32.0	NM_001080405	C9JN24	Missense_Mutation	SNP	ENST00000396477.4	37		.	.	.	.	.	.	.	.	.	.	.	12.26	1.883505	0.33255	.	.	ENSG00000213822	ENST00000451626	T	0.05580	3.42	2.6	-1.17	0.09648	.	.	.	.	.	T	0.03477	0.0100	N	0.08118	0	0.09310	N	1	B	0.15719	0.014	B	0.11329	0.006	T	0.42137	-0.9469	9	0.62326	D	0.03	.	8.2875	0.31937	0.665:0.335:0.0:0.0	.	52	A8MTB9	CEA18_HUMAN	H	52	ENSP00000402203:P52H	ENSP00000402203:P52H	P	+	2	0	CEACAM18	56673680	0.020000	0.18652	0.002000	0.10522	0.011000	0.07611	-0.102000	0.10956	-0.143000	0.11334	-0.181000	0.13052	CCC	.		0.627	CEACAM18-001	PUTATIVE	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000323114.2		
CEP104	9731	broad.mit.edu;bcgsc.ca	37	1	3755593	3755593	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr1:3755593T>C	ENST00000378230.3	-	8	1150	c.826A>G	c.(826-828)Atg>Gtg	p.M276V	CEP104_ENST00000460038.1_5'Flank	NM_014704.3	NP_055519.1	O60308	CE104_HUMAN	centrosomal protein 104kDa	276						centriole (GO:0005814)	glutamate binding (GO:0016595)|glycine binding (GO:0016594)|thienylcyclohexylpiperidine binding (GO:0016596)			breast(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(14)|lung(8)|prostate(1)|skin(3)	39						TACTGCTCCATCTGCTGCTTC	0.587																																					p.M276V		.											.	CEP104	92	0			c.A826G						.						184.0	159.0	167.0					1																	3755593		2203	4300	6503	SO:0001583	missense	9731	exon8			GCTCCATCTGCTG	AB011134	CCDS30571.1	1p36.32	2014-02-20	2011-05-06	2011-05-06	ENSG00000116198	ENSG00000116198			24866	protein-coding gene	gene with protein product	"""glycine, glutamate, thienylcyclohexylpiperidine binding protein"""		"""KIAA0562"""	KIAA0562		7488117, 21399614	Standard	NM_014704		Approved	GlyBP, RP1-286D6.4	uc001aky.2	O60308	OTTHUMG00000003507	ENST00000378230.3:c.826A>G	1.37:g.3755593T>C	ENSP00000367476:p.Met276Val	193.0	0.0		145.0	6.0	NM_014704	Q5JSQ3|Q5SR24|Q5SR25|Q6PKF5|Q86W32|Q86X14	Missense_Mutation	SNP	ENST00000378230.3	37	CCDS30571.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.508650	0.85282	.	.	ENSG00000116198	ENST00000378230;ENST00000443466	T;T	0.47177	1.48;0.85	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.66906	0.2837	M	0.74647	2.275	0.80722	D	1	D;D	0.58268	0.979;0.982	P;D	0.68943	0.791;0.961	T	0.68284	-0.5449	10	0.44086	T	0.13	.	14.3262	0.66523	0.0:0.0:0.0:1.0	.	276;276	O60308-3;O60308	.;CE104_HUMAN	V	276;28	ENSP00000367476:M276V;ENSP00000411927:M28V	ENSP00000367476:M276V	M	-	1	0	CEP104	3745453	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.573000	0.82421	1.983000	0.57843	0.533000	0.62120	ATG	.		0.587	CEP104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009747.3	NM_014704	
CNGA2	1260	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	150912895	150912895	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chrX:150912895G>T	ENST00000329903.4	+	6	1953	c.1920G>T	c.(1918-1920)atG>atT	p.M640I		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	640					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					AAACCAAGATGAAACAGAACA	0.552																																					p.M640I		.											.	CNGA2	193	0			c.G1920T						.						97.0	85.0	89.0					X																	150912895		2203	4300	6503	SO:0001583	missense	1260	exon7			CAAGATGAAACAG	S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.1920G>T	X.37:g.150912895G>T	ENSP00000328478:p.Met640Ile	124.0	0.0		111.0	8.0	NM_005140	A0AVD0	Missense_Mutation	SNP	ENST00000329903.4	37	CCDS14701.1	.	.	.	.	.	.	.	.	.	.	G	9.999	1.232890	0.22626	.	.	ENSG00000183862	ENST00000329903	D	0.97016	-4.21	5.5	5.5	0.81552	.	0.158195	0.64402	D	0.000018	D	0.92848	0.7725	L	0.40543	1.245	0.30921	N	0.727989	B	0.02656	0.0	B	0.01281	0.0	D	0.89095	0.3485	10	0.36615	T	0.2	.	10.8688	0.46870	0.0:0.0:0.8122:0.1878	.	640	Q16280	CNGA2_HUMAN	I	640	ENSP00000328478:M640I	ENSP00000328478:M640I	M	+	3	0	CNGA2	150663551	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	2.963000	0.49184	2.297000	0.77311	0.529000	0.55759	ATG	.		0.552	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060888.1	NM_005140	
COL9A3	1299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	61467861	61467861	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr20:61467861A>T	ENST00000343916.3	+	29	1583	c.1580A>T	c.(1579-1581)gAg>gTg	p.E527V	COL9A3_ENST00000462700.1_Intron	NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3	527	Nonhelical region 3 (NC3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					CGCATCAGGGAGCTGTGTGGG	0.672																																					p.E527V		.											.	COL9A3	514	0			c.A1580T						.						30.0	35.0	33.0					20																	61467861		2201	4300	6501	SO:0001583	missense	1299	exon29			TCAGGGAGCTGTG	AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.1580A>T	20.37:g.61467861A>T	ENSP00000341640:p.Glu527Val	99.0	0.0		81.0	26.0	NM_001853	Q13681|Q9H4G9|Q9UPE2	Missense_Mutation	SNP	ENST00000343916.3	37	CCDS13505.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.098468	0.76870	.	.	ENSG00000092758	ENST00000343916	D	0.94232	-3.38	4.33	3.18	0.36537	.	0.171760	0.49916	D	0.000125	D	0.94712	0.8294	L	0.56340	1.77	0.58432	D	0.999999	D;D	0.76494	0.999;0.995	D;P	0.80764	0.994;0.593	D	0.93053	0.6467	10	0.45353	T	0.12	.	10.8599	0.46821	0.8414:0.1586:0.0:0.0	.	30;527	Q9BT15;Q14050	.;CO9A3_HUMAN	V	527	ENSP00000341640:E527V	ENSP00000341640:E527V	E	+	2	0	COL9A3	60938306	1.000000	0.71417	0.998000	0.56505	0.905000	0.53344	6.513000	0.73742	0.589000	0.29677	0.459000	0.35465	GAG	.		0.672	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080071.2	NM_001853	
COLGALT2	23127	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	183933105	183933105	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr1:183933105G>C	ENST00000361927.4	-	6	1253	c.882C>G	c.(880-882)atC>atG	p.I294M	COLGALT2_ENST00000546159.1_Missense_Mutation_p.I294M|COLGALT2_ENST00000367520.3_Missense_Mutation_p.I31M	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	294					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)										GCTTCAGGGGGATGGGCAGGT	0.522																																					p.I294M		.											.	.	.	0			c.C882G						.						155.0	122.0	133.0					1																	183933105		2203	4300	6503	SO:0001583	missense	23127	exon6			CAGGGGGATGGGC	AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.882C>G	1.37:g.183933105G>C	ENSP00000354960:p.Ile294Met	244.0	0.0		286.0	129.0	NM_015101	O60327|Q9BZR0	Missense_Mutation	SNP	ENST00000361927.4	37	CCDS1360.1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.761698	0.31228	.	.	ENSG00000198756	ENST00000546159;ENST00000361927;ENST00000367520	T;T	0.26223	1.75;1.75	5.74	3.86	0.44501	.	0.224837	0.44688	N	0.000438	T	0.08626	0.0214	N	0.01352	-0.895	0.36125	D	0.84576	B;B;B	0.25772	0.134;0.027;0.015	B;B;B	0.23275	0.045;0.027;0.007	T	0.12091	-1.0561	10	0.51188	T	0.08	.	7.3064	0.26451	0.1508:0.3373:0.5119:0.0	.	294;294;31	F5H3T5;Q8IYK4;Q5SXQ3	.;GT252_HUMAN;.	M	294;294;31	ENSP00000439112:I294M;ENSP00000354960:I294M	ENSP00000354960:I294M	I	-	3	3	GLT25D2	182199728	0.994000	0.37717	1.000000	0.80357	0.996000	0.88848	0.316000	0.19469	0.766000	0.33244	0.655000	0.94253	ATC	.		0.522	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086128.1	NM_015101	
CP	1356	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	148927024	148927024	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr3:148927024T>A	ENST00000264613.6	-	4	1017	c.755A>T	c.(754-756)gAc>gTc	p.D252V		NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	252	F5/8 type A 1.|Plastocyanin-like 2.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	CTCCTGGAAGTCTTCGTTGTC	0.373																																					p.D252V		.											.	CP	515	0			c.A755T						.						238.0	224.0	229.0					3																	148927024		2203	4300	6503	SO:0001583	missense	1356	exon4			TGGAAGTCTTCGT	M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.755A>T	3.37:g.148927024T>A	ENSP00000264613:p.Asp252Val	261.0	0.0		240.0	119.0	NM_000096	Q14063|Q2PP18|Q9UKS4	Missense_Mutation	SNP	ENST00000264613.6	37	CCDS3141.1	.	.	.	.	.	.	.	.	.	.	T	16.49	3.138204	0.56936	.	.	ENSG00000047457	ENST00000264613;ENST00000494544	D;D	0.98876	-5.2;-5.2	5.5	4.27	0.50696	Cupredoxin (2);Multicopper oxidase, type 1 (1);	0.215379	0.47093	D	0.000253	D	0.98163	0.9393	M	0.63208	1.945	0.80722	D	1	P;P;P	0.51791	0.948;0.948;0.907	P;P;P	0.55999	0.664;0.789;0.664	D	0.97231	0.9884	10	0.25106	T	0.35	-22.3529	12.199	0.54313	0.0:0.0:0.1424:0.8576	.	252;252;252	A8K5A4;P00450;Q1L857	.;CERU_HUMAN;.	V	252;35	ENSP00000264613:D252V;ENSP00000420545:D35V	ENSP00000264613:D252V	D	-	2	0	CP	150409714	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	4.683000	0.61679	2.064000	0.61679	0.528000	0.53228	GAC	.		0.373	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317498.1	NM_000096	
CRAT	1384	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	131859581	131859581	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr9:131859581T>A	ENST00000318080.2	-	12	1769	c.1475A>T	c.(1474-1476)aAg>aTg	p.K492M	RP11-247A12.1_ENST00000434250.1_RNA	NM_000755.3|NM_001257363.1	NP_000746|NP_001244292.1	P43155	CACP_HUMAN	carnitine O-acetyltransferase	492					carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-acetyltransferase activity (GO:0004092)|receptor binding (GO:0005102)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)	CAGCTCCACCTTCTGGTGCTC	0.612																																					p.K492M		.											.	CRAT	90	0			c.A1475T						.						46.0	32.0	37.0					9																	131859581		2197	4286	6483	SO:0001583	missense	1384	exon12			TCCACCTTCTGGT	X78706	CCDS6919.1	9q34.1	2010-04-27	2010-04-27		ENSG00000095321	ENSG00000095321	2.3.1.7		2342	protein-coding gene	gene with protein product		600184	"""carnitine acetyltransferase"""			7829107	Standard	NM_000755		Approved	CAT1	uc004bxh.3	P43155	OTTHUMG00000147343	ENST00000318080.2:c.1475A>T	9.37:g.131859581T>A	ENSP00000315013:p.Lys492Met	45.0	0.0		67.0	27.0	NM_000755	Q5T952|Q9BW16	Missense_Mutation	SNP	ENST00000318080.2	37	CCDS6919.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.0|25.0	4.589550|4.589550	0.86851|0.86851	.|.	.|.	ENSG00000095321|ENSG00000095321	ENST00000455396|ENST00000351352;ENST00000318080	.|D	.|0.91237	.|-2.81	5.69|5.69	4.53|4.53	0.55603|0.55603	.|.	.|0.096905	.|0.64402	.|D	.|0.000002	D|D	0.95743|0.95743	0.8615|0.8615	M|M	0.92268|0.92268	3.29|3.29	0.80722|0.80722	D|D	1|1	.|D	.|0.65815	.|0.995	.|D	.|0.73380	.|0.98	D|D	0.95297|0.95297	0.8400|0.8400	5|10	.|0.72032	.|D	.|0.01	-35.4726|-35.4726	9.8793|9.8793	0.41222|0.41222	0.0:0.0781:0.0:0.9219|0.0:0.0781:0.0:0.9219	.|.	.|492	.|P43155	.|CACP_HUMAN	D|M	90|411;492	.|ENSP00000315013:K492M	.|ENSP00000315013:K492M	E|K	-|-	3|2	2|0	CRAT|CRAT	130899402|130899402	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.955000|0.955000	0.61496|0.61496	4.103000|4.103000	0.57783|0.57783	0.944000|0.944000	0.37579|0.37579	0.528000|0.528000	0.53228|0.53228	GAA|AAG	.		0.612	CRAT-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253700.1		
CRIM1	51232	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	36691797	36691797	+	Splice_Site	SNP	T	T	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr2:36691797T>C	ENST00000280527.2	+	5	1357	c.990T>C	c.(988-990)aaT>aaC	p.N330N		NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	330					insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				AATGTGTTAATGGTACGTGGG	0.507																																					p.N330N		.											.	CRIM1	118	0			c.T990C						.						318.0	295.0	303.0					2																	36691797		2203	4300	6503	SO:0001630	splice_region_variant	51232	exon5			TGTTAATGGTACG	AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.991+1T>C	2.37:g.36691797T>C		294.0	0.0		268.0	83.0	NM_016441	Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Silent	SNP	ENST00000280527.2	37	CCDS1783.1																																																																																			.		0.507	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216878.2	NM_016441	Silent
CXCR4	7852	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	136872834	136872834	+	Missense_Mutation	SNP	T	T	A	rs374458307		TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr2:136872834T>A	ENST00000241393.3	-	2	768	c.664A>T	c.(664-666)Atc>Ttc	p.I222F	CXCR4_ENST00000466288.1_5'UTR|CXCR4_ENST00000409817.1_Missense_Mutation_p.I226F	NM_003467.2	NP_003458.1	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4	222					activation of MAPK activity (GO:0000187)|ameboidal cell migration (GO:0001667)|apoptotic process (GO:0006915)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular response to cytokine stimulus (GO:0071345)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|inflammatory response (GO:0006954)|motor neuron axon guidance (GO:0008045)|myelin maintenance (GO:0043217)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|neutrophil activation (GO:0042119)|patterning of blood vessels (GO:0001569)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of chemotaxis (GO:0050920)|response to hypoxia (GO:0001666)|response to virus (GO:0009615)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)|myosin light chain binding (GO:0032027)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)|Plerixafor(DB06809)	TTGGAGATGATAATGCAATAG	0.517																																					p.I226F		.											.	CXCR4	1082	0			c.A676T						.						163.0	152.0	156.0					2																	136872834		2203	4300	6503	SO:0001583	missense	7852	exon1			AGATGATAATGCA	AF005058	CCDS33295.1, CCDS46420.1	2q21	2014-09-17	2002-08-22		ENSG00000121966	ENSG00000121966		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	2561	protein-coding gene	gene with protein product		162643	"""chemokine (C-X-C motif), receptor 4 (fusin)"""			9599023, 9379028	Standard	NM_001008540		Approved	LESTR, NPY3R, HM89, NPYY3R, D2S201E, fusin, HSY3RR, NPYR, CD184	uc002tuz.3	P61073	OTTHUMG00000153583	ENST00000241393.3:c.664A>T	2.37:g.136872834T>A	ENSP00000241393:p.Ile222Phe	133.0	0.0		126.0	85.0	NM_001008540	B2R5N0|O60835|P30991|P56438|Q53S69|Q9BXA0|Q9UKN2	Missense_Mutation	SNP	ENST00000241393.3	37	CCDS46420.1	.	.	.	.	.	.	.	.	.	.	T	18.99	3.738980	0.69304	.	.	ENSG00000121966	ENST00000409817;ENST00000241393;ENST00000537957	T;T	0.57436	0.4;0.4	6.17	6.17	0.99709	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.84379	0.5459	H	0.98786	4.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	D	0.90701	0.4620	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	222;226	P61073;P61073-2	CXCR4_HUMAN;.	F	226;222;92	ENSP00000386884:I226F;ENSP00000241393:I222F	ENSP00000241393:I222F	I	-	1	0	CXCR4	136589304	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.289000	0.72696	2.371000	0.80710	0.533000	0.62120	ATC	.		0.517	CXCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331732.1		
CYB561	1534	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	61513455	61513455	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr17:61513455G>T	ENST00000392976.1	-	3	560	c.261C>A	c.(259-261)caC>caA	p.H87Q	CYB561_ENST00000581163.1_5'UTR|CYB561_ENST00000542042.1_Missense_Mutation_p.H154Q|CYB561_ENST00000448884.2_Missense_Mutation_p.H87Q|CYB561_ENST00000581573.1_Missense_Mutation_p.H87Q|CYB561_ENST00000584031.1_Missense_Mutation_p.H87Q|CYB561_ENST00000582297.1_Missense_Mutation_p.H87Q|CYB561_ENST00000582034.1_Missense_Mutation_p.H58Q|CYB561_ENST00000360793.3_Missense_Mutation_p.H87Q|CYB561_ENST00000392975.2_Missense_Mutation_p.H87Q|CYB561_ENST00000582997.1_Missense_Mutation_p.H94Q	NM_001017916.1	NP_001017916.1	P49447	CY561_HUMAN	cytochrome b561	87	Cytochrome b561. {ECO:0000255|PROSITE- ProRule:PRU00242}.				electron transport chain (GO:0022900)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)|transmembrane electron transfer carrier (GO:0022865)			lung(2)|ovary(1)|prostate(1)	4				READ - Rectum adenocarcinoma(1115;0.0689)		GCAGCAGCCCGTGCAGGACCT	0.617																																					p.H87Q		.											.	CYB561	91	0			c.C261A						.						146.0	117.0	127.0					17																	61513455		2203	4300	6503	SO:0001583	missense	1534	exon3			CAGCCCGTGCAGG		CCDS11636.1	17q23.3	2013-03-14	2013-03-14		ENSG00000008283	ENSG00000008283		"""Cytochrome b genes"""	2571	protein-coding gene	gene with protein product	"""ferric-chelate reductase 2"", ""cytochrome b561 family, member A1"""	600019				7959749, 23249217	Standard	XM_005257091		Approved	FRRS2, CYB561A1	uc002jas.3	P49447		ENST00000392976.1:c.261C>A	17.37:g.61513455G>T	ENSP00000376702:p.His87Gln	116.0	0.0		99.0	58.0	NM_001915	B2RE96|B7Z775|D3DU11|Q5BJG9|Q9BU05|Q9BWR9	Missense_Mutation	SNP	ENST00000392976.1	37	CCDS11636.1	.	.	.	.	.	.	.	.	.	.	G	6.059	0.379146	0.11466	.	.	ENSG00000008283	ENST00000360793;ENST00000392976;ENST00000392975;ENST00000448884;ENST00000542042	D;D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75;-1.75	4.87	-2.18	0.07037	Cytochrome b561, eukaryote (1);Cytochrome b561/ferric reductase transmembrane (2);	0.158856	0.56097	D	0.000037	D	0.91181	0.7222	M	0.93283	3.4	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.91635	0.999;0.999;0.974;0.996	D	0.89871	0.4023	10	0.87932	D	0	-10.7002	10.3904	0.44164	0.3942:0.0:0.6058:0.0	.	87;87;154;87	B7Z775;B3KTA1;F5H757;P49447	.;.;.;CY561_HUMAN	Q	87;87;87;87;154	ENSP00000354028:H87Q;ENSP00000376702:H87Q;ENSP00000376701:H87Q;ENSP00000400350:H87Q;ENSP00000442773:H154Q	ENSP00000354028:H87Q	H	-	3	2	CYB561	58867187	0.974000	0.33945	0.978000	0.43139	0.024000	0.10985	-0.034000	0.12225	-0.364000	0.08088	-1.149000	0.01842	CAC	.		0.617	CYB561-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444843.1	NM_001915	
DCHS2	54798	broad.mit.edu;bcgsc.ca	37	4	155156791	155156791	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr4:155156791A>G	ENST00000357232.4	-	25	7647	c.7648T>C	c.(7648-7650)Ttt>Ctt	p.F2550L		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2550					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AGTATCAGAAACACTAAAAAG	0.378																																					p.F2550L		.											.	DCHS2	94	0			c.T7648C						.						60.0	61.0	61.0					4																	155156791		2202	4300	6502	SO:0001583	missense	54798	exon25			TCAGAAACACTAA	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.7648T>C	4.37:g.155156791A>G	ENSP00000349768:p.Phe2550Leu	108.0	0.0		155.0	8.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	A	12.90	2.077548	0.36662	.	.	ENSG00000197410	ENST00000357232	T	0.50813	0.73	5.53	4.33	0.51752	.	0.000000	0.64402	D	0.000001	T	0.37046	0.0989	L	0.54323	1.7	0.80722	D	1	P	0.42409	0.779	B	0.35182	0.197	T	0.18461	-1.0336	10	0.16896	T	0.51	.	11.6868	0.51492	0.9291:0.0:0.0709:0.0	.	2550	Q6V1P9	PCD23_HUMAN	L	2550	ENSP00000349768:F2550L	ENSP00000349768:F2550L	F	-	1	0	DCHS2	155376241	0.958000	0.32768	0.328000	0.25416	0.425000	0.31504	2.365000	0.44196	2.096000	0.63516	0.383000	0.25322	TTT	.		0.378	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
DCHS2	54798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	155243495	155243495	+	Silent	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr4:155243495A>T	ENST00000357232.4	-	13	2798	c.2799T>A	c.(2797-2799)gtT>gtA	p.V933V		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	933	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GAATATTAACAACTGCCTGTC	0.363																																					p.V933V		.											.	DCHS2	94	0			c.T2799A						.						152.0	138.0	143.0					4																	155243495		2203	4300	6503	SO:0001819	synonymous_variant	54798	exon13			ATTAACAACTGCC	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.2799T>A	4.37:g.155243495A>T		85.0	0.0		110.0	48.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000357232.4	37	CCDS3785.1																																																																																			.		0.363	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
DENND5A	23258	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	9192221	9192221	+	Silent	SNP	G	G	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr11:9192221G>A	ENST00000328194.3	-	9	2330	c.2010C>T	c.(2008-2010)ttC>ttT	p.F670F	DENND5A_ENST00000527700.1_Silent_p.F13F|DENND5A_ENST00000530044.1_Silent_p.F670F	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	Q6IQ26	DEN5A_HUMAN	DENN/MADD domain containing 5A	670					positive regulation of Rab GTPase activity (GO:0032851)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(16)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GCAGCTTAGGGAAGAAGCCCG	0.473																																					p.F670F		.											.	DENND5A	91	0			c.C2010T						.						188.0	182.0	184.0					11																	9192221		2201	4296	6497	SO:0001819	synonymous_variant	23258	exon9			CTTAGGGAAGAAG	AB029014	CCDS31423.1, CCDS58119.1	11p15.3	2012-10-03	2008-08-14	2008-08-14	ENSG00000184014	ENSG00000184014		"""DENN/MADD domain containing"""	19344	protein-coding gene	gene with protein product			"""RAB6 interacting protein 1"""	RAB6IP1		10470851	Standard	NM_015213		Approved	KIAA1091, FLJ22354, FLJ33829, FLJ43455	uc001mhl.3	Q6IQ26	OTTHUMG00000165716	ENST00000328194.3:c.2010C>T	11.37:g.9192221G>A		197.0	1.0		242.0	16.0	NM_001243254	B4DJ15|E9PS91|Q96GN3|Q9H6U7|Q9UFV0|Q9UPR1	Silent	SNP	ENST00000328194.3	37	CCDS31423.1																																																																																			.		0.473	DENND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385910.2	NM_015213	
DLG1	1739	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	197023346	197023346	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr3:197023346T>A	ENST00000419354.1	-	3	308	c.22A>T	c.(22-24)Acc>Tcc	p.T8S	DLG1-AS1_ENST00000414529.1_RNA|MIR4797_ENST00000577559.1_RNA|DLG1_ENST00000450955.1_Missense_Mutation_p.T8S|DLG1_ENST00000346964.2_Missense_Mutation_p.T8S|DLG1_ENST00000314062.3_Missense_Mutation_p.T8S|DLG1-AS1_ENST00000430666.1_RNA|DLG1_ENST00000422288.1_Missense_Mutation_p.T8S|DLG1_ENST00000357674.4_Missense_Mutation_p.T8S|DLG1_ENST00000448528.2_Missense_Mutation_p.T8S|DLG1_ENST00000485409.1_5'UTR|DLG1_ENST00000392382.2_Missense_Mutation_p.T8S			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	8	L27. {ECO:0000255|PROSITE- ProRule:PRU00365}.				actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		GCTCTCTGGGTATCTGAGAAG	0.363																																					p.T8S		.											.	DLG1	118	0			c.A22T						.						116.0	116.0	116.0					3																	197023346		2203	4300	6503	SO:0001583	missense	1739	exon3			TCTGGGTATCTGA	U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.22A>T	3.37:g.197023346T>A	ENSP00000407531:p.Thr8Ser	81.0	0.0		116.0	49.0	NM_001204386	A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Missense_Mutation	SNP	ENST00000419354.1	37	CCDS43194.1	.	.	.	.	.	.	.	.	.	.	T	17.86	3.491614	0.64074	.	.	ENSG00000075711	ENST00000346964;ENST00000359922;ENST00000357674;ENST00000381807;ENST00000314062;ENST00000419354;ENST00000422288;ENST00000448528;ENST00000392382;ENST00000450955;ENST00000456699;ENST00000392380;ENST00000419553;ENST00000436682;ENST00000412364;ENST00000434148	T;T;T;T;T;T;T;T;T;T;T	0.47869	2.55;2.51;2.48;2.55;2.48;2.55;2.52;2.51;0.85;0.83;0.84	5.02	5.02	0.67125	L27 (2);L27-1 (1);	0.067727	0.64402	D	0.000016	T	0.40886	0.1135	L	0.36672	1.1	0.49582	D	0.999809	B;B;B;B	0.29988	0.264;0.073;0.149;0.264	B;B;B;B	0.32211	0.124;0.088;0.142;0.124	T	0.41556	-0.9502	10	0.66056	D	0.02	.	13.338	0.60528	0.0:0.0:0.0:1.0	.	8;8;8;8	Q12959-4;Q12959-3;Q12959;Q12959-2	.;.;DLG1_HUMAN;.	S	8	ENSP00000345731:T8S;ENSP00000350303:T8S;ENSP00000321087:T8S;ENSP00000407531:T8S;ENSP00000413238:T8S;ENSP00000391732:T8S;ENSP00000376187:T8S;ENSP00000411278:T8S;ENSP00000396474:T8S;ENSP00000376185:T8S;ENSP00000414189:T8S	ENSP00000321087:T8S	T	-	1	0	DLG1	198507743	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	3.546000	0.53656	2.185000	0.69588	0.528000	0.53228	ACC	.		0.363	DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000258170.2	NM_004087	
DMXL1	1657	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	118469442	118469442	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr5:118469442T>A	ENST00000311085.8	+	12	1903	c.1823T>A	c.(1822-1824)cTg>cAg	p.L608Q	DMXL1_ENST00000539542.1_Missense_Mutation_p.L608Q	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	608										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		GATGGTTCTCTGAATCAGTGG	0.338																																					p.L608Q		.											.	DMXL1	92	0			c.T1823A						.						95.0	95.0	95.0					5																	118469442		2202	4300	6502	SO:0001583	missense	1657	exon12			GTTCTCTGAATCA	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.1823T>A	5.37:g.118469442T>A	ENSP00000309690:p.Leu608Gln	176.0	0.0		194.0	52.0	NM_005509		Missense_Mutation	SNP	ENST00000311085.8	37	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.985608	0.74589	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.28069	1.63;2.49	5.43	5.43	0.79202	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.57140	0.2033	M	0.78049	2.395	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.59804	-0.7385	9	.	.	.	-5.6682	15.4658	0.75400	0.0:0.0:0.0:1.0	.	608;608	F5H269;Q9Y485	.;DMXL1_HUMAN	Q	608	ENSP00000309690:L608Q;ENSP00000439479:L608Q	.	L	+	2	0	DMXL1	118497341	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.698000	0.84413	2.072000	0.62099	0.482000	0.46254	CTG	.		0.338	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
DMXL2	23312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	51828802	51828802	+	Silent	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr15:51828802T>A	ENST00000251076.5	-	12	2162	c.1875A>T	c.(1873-1875)gcA>gcT	p.A625A	DMXL2_ENST00000449909.3_Silent_p.A625A|DMXL2_ENST00000543779.2_Silent_p.A625A	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	625						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		CAAAAGTGACTGCCCACTGAT	0.413																																					p.A625A		.											.	DMXL2	99	0			c.A1875T						.						124.0	115.0	118.0					15																	51828802		2195	4293	6488	SO:0001819	synonymous_variant	23312	exon12			AGTGACTGCCCAC	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.1875A>T	15.37:g.51828802T>A		165.0	1.0		94.0	69.0	NM_001174117	B2RTR3|B7ZMH3|F5GWF1|O94938	Silent	SNP	ENST00000251076.5	37	CCDS10141.1																																																																																			.		0.413	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
DNAH3	55567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	21061288	21061288	+	Silent	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr16:21061288T>A	ENST00000261383.3	-	30	4289	c.4290A>T	c.(4288-4290)ccA>ccT	p.P1430P	DNAH3_ENST00000415178.1_Silent_p.P1430P	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1430	AAA 1. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CAGTCCCAGCTGGACCCTCTG	0.522																																					p.P1430P		.											.	DNAH3	167	0			c.A4290T						.						179.0	162.0	168.0					16																	21061288		2201	4300	6501	SO:0001819	synonymous_variant	55567	exon30			CCCAGCTGGACCC	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.4290A>T	16.37:g.21061288T>A		65.0	0.0		62.0	25.0	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Silent	SNP	ENST00000261383.3	37	CCDS10594.1																																																																																			.		0.522	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
DOCK1	1793	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	128798514	128798514	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr10:128798514A>T	ENST00000280333.6	+	10	1037	c.928A>T	c.(928-930)Agg>Tgg	p.R310W	RP11-223P11.3_ENST00000601826.1_RNA|RP11-223P11.3_ENST00000601242.1_RNA|RP11-223P11.3_ENST00000594559.1_RNA|RP11-223P11.3_ENST00000595456.1_RNA|RP11-223P11.3_ENST00000594614.1_RNA	NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	310					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		CATGGAGCTGAGGGACAACAA	0.463																																					p.R310W		.											.	DOCK1	698	0			c.A928T						.						90.0	95.0	93.0					10																	128798514		1940	4156	6096	SO:0001583	missense	1793	exon10			GAGCTGAGGGACA	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.928A>T	10.37:g.128798514A>T	ENSP00000280333:p.Arg310Trp	132.0	0.0		125.0	46.0	NM_001380	A9Z1Z5	Missense_Mutation	SNP	ENST00000280333.6	37		.	.	.	.	.	.	.	.	.	.	A	19.65	3.867809	0.72065	.	.	ENSG00000150760	ENST00000280333	T	0.18016	2.24	4.0	4.0	0.46444	.	0.000000	0.85682	D	0.000000	T	0.26085	0.0636	L	0.34521	1.04	0.44719	D	0.997719	D;D	0.69078	0.993;0.997	D;D	0.64321	0.924;0.924	T	0.01617	-1.1311	10	0.87932	D	0	.	10.5292	0.44967	0.7123:0.2877:0.0:0.0	.	310;310	B2RUU3;Q14185	.;DOCK1_HUMAN	W	310	ENSP00000280333:R310W	ENSP00000280333:R310W	R	+	1	2	DOCK1	128688504	0.969000	0.33509	1.000000	0.80357	0.997000	0.91878	0.818000	0.27295	2.043000	0.60533	0.533000	0.62120	AGG	.		0.463	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
DOT1L	84444	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	2214500	2214500	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr19:2214500G>T	ENST00000398665.3	+	19	1864	c.1828G>T	c.(1828-1830)Gac>Tac	p.D610Y	AC004490.1_ENST00000585593.1_RNA|DOT1L_ENST00000608122.1_3'UTR	NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	610					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTGCAGCTGGACTGGGCCAC	0.642																																					p.D610Y		.											.	DOT1L	132	0			c.G1828T						.						33.0	37.0	36.0					19																	2214500		2128	4247	6375	SO:0001583	missense	84444	exon19			CAGCTGGACTGGG	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.1828G>T	19.37:g.2214500G>T	ENSP00000381657:p.Asp610Tyr	172.0	0.0		384.0	18.0	NM_032482	O60379|Q96JL1	Missense_Mutation	SNP	ENST00000398665.3	37	CCDS42460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.2|25.2	4.614498|4.614498	0.87359|0.87359	.|.	.|.	ENSG00000104885|ENSG00000104885	ENST00000398665;ENST00000221482|ENST00000440640	T|.	0.37915|.	1.17|.	4.99|4.99	4.99|4.99	0.66335|0.66335	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74535|0.74535	0.3729|0.3729	M|M	0.70275|0.70275	2.135|2.135	0.58432|0.58432	D|D	0.999995|0.999995	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.74648|0.74648	-0.3595|-0.3595	10|5	0.87932|.	D|.	0|.	-46.4337|-46.4337	17.278|17.278	0.87121|0.87121	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	610|.	Q8TEK3-2|.	.|.	Y|C	610|396	ENSP00000381657:D610Y|.	ENSP00000221482:D610Y|.	D|W	+|+	1|3	0|0	DOT1L|DOT1L	2165500|2165500	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	9.083000|9.083000	0.94067|0.94067	2.309000|2.309000	0.77851|0.77851	0.561000|0.561000	0.74099|0.74099	GAC|TGG	.		0.642	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
DRG1	4733	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	31799026	31799026	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr22:31799026G>T	ENST00000331457.4	+	3	339	c.178G>T	c.(178-180)Gcc>Tcc	p.A60S	DRG1_ENST00000433341.1_3'UTR	NM_004147.3	NP_004138.1	Q9Y295	DRG1_HUMAN	developmentally regulated GTP binding protein 1	60					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|polysome (GO:0005844)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|urinary_tract(1)	11						TTTTGATGTGGCCAAGACAGG	0.423																																					p.A60S		.											.	DRG1	90	0			c.G178T						.						261.0	234.0	243.0					22																	31799026		2203	4300	6503	SO:0001583	missense	4733	exon3			GATGTGGCCAAGA	AJ005940	CCDS13897.1	22q12.2	2010-02-26	2001-11-28		ENSG00000185721	ENSG00000185721			3029	protein-coding gene	gene with protein product		603952	"""developmentally regulated GTP-binding protein 1"""	NEDD3		7929244, 1449490	Standard	NM_004147		Approved		uc003aku.3	Q9Y295	OTTHUMG00000030792	ENST00000331457.4:c.178G>T	22.37:g.31799026G>T	ENSP00000329715:p.Ala60Ser	417.0	0.0		277.0	13.0	NM_004147	B2RDS8|Q6FGP8|Q8WW69|Q9UGF2	Missense_Mutation	SNP	ENST00000331457.4	37	CCDS13897.1	.	.	.	.	.	.	.	.	.	.	G	15.96	2.986392	0.53934	.	.	ENSG00000185721	ENST00000331457	T	0.44482	0.92	5.49	5.49	0.81192	.	0.097640	0.64402	D	0.000001	T	0.40791	0.1131	L	0.56340	1.77	0.80722	D	1	B	0.15141	0.012	B	0.10450	0.005	T	0.23868	-1.0176	10	0.15952	T	0.53	-27.4646	18.7282	0.91722	0.0:0.0:1.0:0.0	.	60	Q9Y295	DRG1_HUMAN	S	60	ENSP00000329715:A60S	ENSP00000329715:A60S	A	+	1	0	DRG1	30129026	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.937000	0.92936	2.734000	0.93682	0.655000	0.94253	GCC	.		0.423	DRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075680.5	NM_004147	
DSCAML1	57453	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	117301488	117301488	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr11:117301488G>A	ENST00000321322.6	-	32	5817	c.5816C>T	c.(5815-5817)gCg>gTg	p.A1939V	DSCAML1_ENST00000527706.1_Missense_Mutation_p.A1669V	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1879					axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GCCCCGGTCCGCATCCTGGGG	0.657																																					p.A1939V		.											.	DSCAML1	159	0			c.C5816T						.						179.0	154.0	163.0					11																	117301488		2201	4296	6497	SO:0001583	missense	57453	exon32			CGGTCCGCATCCT		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.5816C>T	11.37:g.117301488G>A	ENSP00000315465:p.Ala1939Val	140.0	0.0		152.0	9.0	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	G	13.76	2.333384	0.41297	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.60299	0.23;0.2	5.04	4.09	0.47781	.	.	.	.	.	T	0.37348	0.1000	N	0.08118	0	0.31442	N	0.671895	B	0.09022	0.002	B	0.10450	0.005	T	0.32693	-0.9897	9	0.35671	T	0.21	.	12.3343	0.55058	0.0:0.3658:0.6342:0.0	.	1879	Q8TD84	DSCL1_HUMAN	V	1669;1939;1646	ENSP00000434335:A1669V;ENSP00000315465:A1939V	ENSP00000315465:A1939V	A	-	2	0	DSCAML1	116806698	0.998000	0.40836	0.955000	0.39395	0.979000	0.70002	2.957000	0.49137	2.628000	0.89032	0.591000	0.81541	GCG	.		0.657	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
DUOX1	53905	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	45427708	45427708	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr15:45427708A>G	ENST00000321429.4	+	7	939	c.532A>G	c.(532-534)Atc>Gtc	p.I178V	DUOX1_ENST00000389037.3_Missense_Mutation_p.I178V	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	178	Peroxidase-like; mediates peroxidase activity.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		CGGCAGCGCCATCTATGGTTC	0.721																																					p.I178V		.											.	DUOX1	142	0			c.A532G						.						7.0	6.0	6.0					15																	45427708		2080	4145	6225	SO:0001583	missense	53905	exon7			AGCGCCATCTATG	AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.532A>G	15.37:g.45427708A>G	ENSP00000317997:p.Ile178Val	126.0	0.0		44.0	22.0	NM_017434	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	ENST00000321429.4	37	CCDS32221.1	.	.	.	.	.	.	.	.	.	.	.	18.04	3.534987	0.64972	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	T;T	0.66460	-0.21;-0.21	3.8	3.8	0.43715	.	0.000000	0.85682	D	0.000000	T	0.71476	0.3344	L	0.43923	1.385	0.80722	D	1	D	0.71674	0.998	D	0.83275	0.996	T	0.66504	-0.5907	10	0.19147	T	0.46	-29.7211	10.8148	0.46569	1.0:0.0:0.0:0.0	.	178	Q9NRD9	DUOX1_HUMAN	V	178	ENSP00000317997:I178V;ENSP00000373689:I178V	ENSP00000317997:I178V	I	+	1	0	DUOX1	43215000	1.000000	0.71417	1.000000	0.80357	0.345000	0.29048	6.982000	0.76173	1.708000	0.51301	0.455000	0.32223	ATC	.		0.721	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434	
EFNA4	1945	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	155039354	155039354	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr1:155039354G>T	ENST00000368409.3	+	2	355	c.262G>T	c.(262-264)Gca>Tca	p.A88S	EFNA3_ENST00000505139.1_Intron|EFNA4_ENST00000427683.2_Missense_Mutation_p.A88S|EFNA4_ENST00000359751.4_Missense_Mutation_p.A88S|EFNA3_ENST00000556931.1_Intron	NM_005227.2	NP_005218.1	P52798	EFNA4_HUMAN	ephrin-A4	88	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				axon guidance (GO:0007411)|bone remodeling (GO:0046849)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|osteoclast differentiation (GO:0030316)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|transmembrane-ephrin receptor activity (GO:0005005)			breast(1)|endometrium(1)|large_intestine(1)|ovary(1)	4	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			GTCCTGCCAGGCAGAGGGCCC	0.617																																					p.A88S		.											.	EFNA4	115	0			c.G262T						.						45.0	49.0	47.0					1																	155039354		2203	4300	6503	SO:0001583	missense	1945	exon2			TGCCAGGCAGAGG	AJ006352	CCDS1089.1, CCDS41407.1, CCDS44237.1	1q21-q22	2011-03-09			ENSG00000243364	ENSG00000243364		"""Ephrins"""	3224	protein-coding gene	gene with protein product		601380		EPLG4		8660976	Standard	NM_182690		Approved	LERK4		P52798	OTTHUMG00000035309	ENST00000368409.3:c.262G>T	1.37:g.155039354G>T	ENSP00000357394:p.Ala88Ser	172.0	0.0		236.0	82.0	NM_182690	C9JHJ8|G3XAK2|O95457|Q5SR71|Q6FI57	Missense_Mutation	SNP	ENST00000368409.3	37	CCDS1089.1	.	.	.	.	.	.	.	.	.	.	G	14.29	2.492044	0.44352	.	.	ENSG00000243364	ENST00000368409;ENST00000359751;ENST00000427683	T;T;T	0.43688	0.94;0.94;0.94	5.31	4.33	0.51752	Cupredoxin (2);	0.120943	0.53938	D	0.000048	T	0.26268	0.0641	N	0.20766	0.605	0.80722	D	1	P;P;B	0.40602	0.723;0.476;0.244	P;B;B	0.49708	0.62;0.1;0.099	T	0.05666	-1.0871	10	0.46703	T	0.11	-31.9773	11.0938	0.48132	0.0:0.1871:0.8129:0.0	.	88;88;88	P52798-2;P52798;G3XAK2	.;EFNA4_HUMAN;.	S	88	ENSP00000357394:A88S;ENSP00000352789:A88S;ENSP00000414378:A88S	ENSP00000352789:A88S	A	+	1	0	EFNA4	153305978	0.023000	0.18921	0.768000	0.31515	0.628000	0.37860	1.436000	0.34980	2.489000	0.83994	0.561000	0.74099	GCA	.		0.617	EFNA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000085421.2	NM_005227	
EGFL6	25975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	13645318	13645318	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chrX:13645318G>C	ENST00000361306.1	+	11	1731	c.1474G>C	c.(1474-1476)Gag>Cag	p.E492Q	EGFL6_ENST00000380602.3_Missense_Mutation_p.E493Q	NM_001167890.1|NM_015507.3	NP_001161362.1|NP_056322.2	Q8IUX8	EGFL6_HUMAN	EGF-like-domain, multiple 6	492	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)|skin(3)	23						CCTGGCATGGGAGAAGACCAC	0.438																																					p.E493Q		.											.	EGFL6	193	0			c.G1477C						.						140.0	129.0	133.0					X																	13645318		2203	4300	6503	SO:0001583	missense	25975	exon11			GCATGGGAGAAGA	AF186084	CCDS14155.1, CCDS55370.1	Xp22	2008-02-05	2002-10-09		ENSG00000198759	ENSG00000198759			3235	protein-coding gene	gene with protein product		300239	"""MAM and EGF domain containing"""	MAEG		10610727	Standard	NM_015507		Approved		uc004cvj.3	Q8IUX8	OTTHUMG00000021155	ENST00000361306.1:c.1474G>C	X.37:g.13645318G>C	ENSP00000355126:p.Glu492Gln	117.0	0.0		126.0	58.0	NM_001167890	B2RCB1|Q6UXJ1|Q8NBV0|Q8WYG3|Q9NY67|Q9NZL7|Q9UFK6	Missense_Mutation	SNP	ENST00000361306.1	37	CCDS14155.1	.	.	.	.	.	.	.	.	.	.	G	16.02	3.004762	0.54254	.	.	ENSG00000198759	ENST00000361306;ENST00000380602	T;T	0.02216	4.39;4.39	4.76	3.89	0.44902	Concanavalin A-like lectin/glucanase (1);MAM domain (2);	0.052439	0.64402	D	0.000001	T	0.09291	0.0229	M	0.62088	1.915	0.47547	D	0.999454	D;D	0.89917	0.996;1.0	D;D	0.91635	0.991;0.999	T	0.09952	-1.0651	10	0.33141	T	0.24	.	12.2856	0.54791	0.0852:0.0:0.9148:0.0	.	493;492	Q8IUX8-2;Q8IUX8	.;EGFL6_HUMAN	Q	492;493	ENSP00000355126:E492Q;ENSP00000369976:E493Q	ENSP00000355126:E492Q	E	+	1	0	EGFL6	13555239	1.000000	0.71417	0.977000	0.42913	0.775000	0.43874	5.076000	0.64413	0.805000	0.34159	0.544000	0.68410	GAG	.		0.438	EGFL6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055800.1	NM_015507	
EGFLAM	133584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	38350697	38350697	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr5:38350697G>C	ENST00000354891.3	+	4	732	c.386G>C	c.(385-387)cGg>cCg	p.R129P	EGFLAM_ENST00000322350.5_Missense_Mutation_p.R129P	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	129	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					AGCTCTCCTCGGCATGTCACC	0.478																																					p.R129P	Colon(62;485 1295 3347 17454)	.											.	EGFLAM	187	0			c.G386C						.						87.0	80.0	82.0					5																	38350697		2203	4300	6503	SO:0001583	missense	133584	exon4			CTCCTCGGCATGT	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.386G>C	5.37:g.38350697G>C	ENSP00000346964:p.Arg129Pro	74.0	0.0		75.0	23.0	NM_001205301	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	ENST00000354891.3	37	CCDS56363.1	.	.	.	.	.	.	.	.	.	.	g	16.05	3.012545	0.54468	.	.	ENSG00000164318	ENST00000354891;ENST00000322350	T;T	0.53640	0.61;0.61	4.92	-4.65	0.03339	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.256111	0.36200	N	0.002729	T	0.49029	0.1533	L	0.60455	1.87	0.31311	N	0.687192	D;D	0.56521	0.96;0.976	P;P	0.57324	0.662;0.818	T	0.55673	-0.8104	10	0.72032	D	0.01	-29.3369	7.2105	0.25931	0.5367:0.0:0.3513:0.112	.	129;129	Q63HQ2;Q63HQ2-2	EGFLA_HUMAN;.	P	129	ENSP00000346964:R129P;ENSP00000313084:R129P	ENSP00000313084:R129P	R	+	2	0	EGFLAM	38386454	0.000000	0.05858	0.079000	0.20413	0.843000	0.47879	-0.806000	0.04525	-0.955000	0.03636	0.462000	0.41574	CGG	.		0.478	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
EPHA4	2043	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	222365784	222365784	+	Missense_Mutation	SNP	C	C	T	rs375924623		TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr2:222365784C>T	ENST00000281821.2	-	4	973	c.932G>A	c.(931-933)cGa>cAa	p.R311Q	EPHA4_ENST00000409854.1_Missense_Mutation_p.R311Q|EPHA4_ENST00000409938.1_Missense_Mutation_p.R311Q|EPHA4_ENST00000392071.4_Missense_Mutation_p.R260Q	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	311	Cys-rich.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		GAAAAAGCCTCGGTCACAGGT	0.532																																					p.R311Q		.											.	EPHA4	1441	0			c.G932A						.	C	GLN/ARG	0,4406		0,0,2203	147.0	124.0	131.0		932	6.1	1.0	2		131	1,8599	1.2+/-3.3	0,1,4299	no	missense	EPHA4	NM_004438.3	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	311/987	222365784	1,13005	2203	4300	6503	SO:0001583	missense	2043	exon4			AAGCCTCGGTCAC	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.932G>A	2.37:g.222365784C>T	ENSP00000281821:p.Arg311Gln	62.0	0.0		56.0	12.0	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	ENST00000281821.2	37	CCDS2447.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.75|15.75	2.926449|2.926449	0.52759|0.52759	0.0|0.0	1.16E-4|1.16E-4	ENSG00000116106|ENSG00000116106	ENST00000441679|ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071	.|T;T;T;T	.|0.62232	.|0.04;0.04;0.04;0.04	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	.|0.060275	.|0.64402	.|D	.|0.000004	T|T	0.44456|0.44456	0.1294|0.1294	N|N	0.12746|0.12746	0.255|0.255	0.45962|0.45962	D|D	0.998785|0.998785	.|B	.|0.27910	.|0.193	.|B	.|0.21151	.|0.033	T|T	0.34403|0.34403	-0.9830|-0.9830	5|10	.|0.24483	.|T	.|0.36	.|.	16.8423|16.8423	0.85972|0.85972	0.0:0.8718:0.1281:0.0|0.0:0.8718:0.1281:0.0	.|.	.|311	.|P54764	.|EPHA4_HUMAN	K|Q	48|311;311;311;260	.|ENSP00000281821:R311Q;ENSP00000386276:R311Q;ENSP00000386829:R311Q;ENSP00000375923:R260Q	.|ENSP00000281821:R311Q	E|R	-|-	1|2	0|0	EPHA4|EPHA4	222074028|222074028	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.743000|3.743000	0.55104|0.55104	2.884000|2.884000	0.98904|0.98904	0.655000|0.655000	0.94253|0.94253	GAG|CGA	.		0.532	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
EXO1	9156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	242024779	242024779	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr1:242024779A>G	ENST00000366548.3	+	10	1609	c.1016A>G	c.(1015-1017)gAt>gGt	p.D339G	EXO1_ENST00000348581.5_Missense_Mutation_p.D339G|EXO1_ENST00000518483.1_Missense_Mutation_p.D339G	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1	339	Interaction with MSH3.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			GAACAGATCGATGACTACAAT	0.343								Editing and processing nucleases																													p.D339G		.											.	EXO1	661	0			c.A1016G						.						79.0	79.0	79.0					1																	242024779		2203	4300	6503	SO:0001583	missense	9156	exon10			AGATCGATGACTA	AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.1016A>G	1.37:g.242024779A>G	ENSP00000355506:p.Asp339Gly	61.0	0.0		95.0	43.0	NM_130398	O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	Missense_Mutation	SNP	ENST00000366548.3	37	CCDS1620.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.708908	0.89018	.	.	ENSG00000174371	ENST00000366548;ENST00000348581;ENST00000518483	T;T;T	0.34667	1.35;1.35;1.35	5.1	5.1	0.69264	-3&apos (1); exonuclease, C-terminal domain (1);5&apos (1);	0.054032	0.64402	D	0.000001	T	0.58104	0.2099	M	0.74647	2.275	0.80722	D	1	D;D;D	0.67145	0.986;0.996;0.969	P;D;P	0.66847	0.897;0.947;0.861	T	0.59279	-0.7484	10	0.40728	T	0.16	-11.5482	14.8368	0.70190	1.0:0.0:0.0:0.0	.	339;339;339	A8K5H6;Q9UQ84-4;Q9UQ84	.;.;EXO1_HUMAN	G	339	ENSP00000355506:D339G;ENSP00000311873:D339G;ENSP00000430251:D339G	ENSP00000311873:D339G	D	+	2	0	EXO1	240091402	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	8.834000	0.92094	2.057000	0.61298	0.533000	0.62120	GAT	.		0.343	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096405.1	NM_006027	
FABP9	646480	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	82371529	82371529	+	Silent	SNP	C	C	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr8:82371529C>A	ENST00000379071.2	-	2	172	c.117G>T	c.(115-117)ccG>ccT	p.P39P	RP11-157I4.4_ENST00000524085.2_RNA	NM_001080526.1	NP_001073995.1	Q0Z7S8	FABP9_HUMAN	fatty acid binding protein 9, testis	39					acrosome assembly (GO:0001675)	acrosomal vesicle (GO:0001669)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6			Epithelial(68;0.186)			TAGTTACTGTCGGTTTCACTA	0.423																																					p.P39P		.											.	FABP9	22	0			c.G117T						.						137.0	133.0	134.0					8																	82371529		2203	4300	6503	SO:0001819	synonymous_variant	646480	exon2			TACTGTCGGTTTC			8q21.13	2013-03-01			ENSG00000205186	ENSG00000205186		"""Fatty acid binding protein family"""	3563	protein-coding gene	gene with protein product						7958448	Standard	NM_001080526		Approved	PERF, T-FABP, PERF15	uc011lfo.2	Q0Z7S8	OTTHUMG00000164601	ENST00000379071.2:c.117G>T	8.37:g.82371529C>A		150.0	0.0		249.0	59.0	NM_001080526		Silent	SNP	ENST00000379071.2	37																																																																																				.		0.423	FABP9-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379367.2	NM_001080526	
FAM217B	63939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	58519115	58519115	+	Silent	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr20:58519115T>A	ENST00000358293.3	+	5	532	c.117T>A	c.(115-117)gcT>gcA	p.A39A	FAM217B_ENST00000469084.1_Intron|FAM217B_ENST00000360816.3_Silent_p.A39A	NM_001190826.1	NP_001177755.1	Q9NTX9	F217B_HUMAN	family with sequence similarity 217, member B	39																	GCCTCACAGCTGTCACCCAGC	0.493																																					p.A39A		.											.	.	.	0			c.T117A						.						48.0	49.0	49.0					20																	58519115		2203	4300	6503	SO:0001819	synonymous_variant	63939	exon4			CACAGCTGTCACC	AL109928	CCDS13484.1	20q13.33	2012-02-07	2012-02-07	2012-02-07	ENSG00000196227	ENSG00000196227			16170	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 177"""	C20orf177			Standard	NM_022106		Approved	dJ551D2.5	uc002ybc.3	Q9NTX9	OTTHUMG00000032873	ENST00000358293.3:c.117T>A	20.37:g.58519115T>A		136.0	0.0		189.0	62.0	NM_022106	B3KWH1|Q9NTA3	Silent	SNP	ENST00000358293.3	37	CCDS13484.1																																																																																			.		0.493	FAM217B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268139.1	NM_022106	
FAM71E2	284418	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55870535	55870535	+	Silent	SNP	C	C	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr19:55870535C>T	ENST00000424985.3	-	9	1894	c.1701G>A	c.(1699-1701)ttG>ttA	p.L567L	CTD-2105E13.6_ENST00000591954.3_Missense_Mutation_p.C117Y	NM_001145402.1	NP_001138874.1	Q8N5Q1	F71E2_HUMAN	family with sequence similarity 71, member E2	567										NS(1)|breast(3)|endometrium(2)|kidney(1)|skin(1)	8						TTCCTGTTGGCAACACGTCAA	0.627																																					p.L567L		.											.	.	.	0			c.G1701A						.						12.0	12.0	12.0					19																	55870535		692	1590	2282	SO:0001819	synonymous_variant	284418	exon9			TGTTGGCAACACG	AL834316		19q13.42	2014-04-02	2007-11-20	2007-11-20	ENSG00000180043	ENSG00000180043			25278	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 16"""	C19orf16			Standard	NM_001145402		Approved	DKFZp434G1729	uc002qkr.2	Q8N5Q1	OTTHUMG00000170357	ENST00000424985.3:c.1701G>A	19.37:g.55870535C>T		61.0	0.0		161.0	25.0	NM_001145402	Q8ND99	Silent	SNP	ENST00000424985.3	37																																																																																				.		0.627	FAM71E2-010	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000409063.4	NM_001145402	
FBN2	2201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	127714494	127714494	+	Missense_Mutation	SNP	G	G	T	rs199720456		TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr5:127714494G>T	ENST00000508053.1	-	18	2667	c.1693C>A	c.(1693-1695)Cag>Aag	p.Q565K	FBN2_ENST00000508989.1_Missense_Mutation_p.Q532K|FBN2_ENST00000262464.4_Missense_Mutation_p.Q565K|FBN2_ENST00000511489.1_5'Flank			P35556	FBN2_HUMAN	fibrillin 2	565	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GGAGTCCTCTGGAATCCAGCA	0.408																																					p.Q565K		.											.	FBN2	146	0			c.C1693A						.						102.0	96.0	98.0					5																	127714494		2203	4300	6503	SO:0001583	missense	2201	exon12			TCCTCTGGAATCC	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.1693C>A	5.37:g.127714494G>T	ENSP00000424571:p.Gln565Lys	102.0	0.0		89.0	31.0	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	G	19.43	3.826368	0.71143	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.87179	-2.22;-2.22;-2.22	4.26	4.26	0.50523	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.111526	0.41605	D	0.000851	D	0.84247	0.5430	N	0.12502	0.225	0.46901	D	0.999248	D;P	0.55800	0.973;0.865	P;P	0.58013	0.831;0.824	T	0.80957	-0.1150	10	0.15499	T	0.54	.	17.9883	0.89161	0.0:0.0:1.0:0.0	.	532;565	D6RJI3;P35556	.;FBN2_HUMAN	K	565;565;532	ENSP00000262464:Q565K;ENSP00000424571:Q565K;ENSP00000425596:Q532K	ENSP00000262464:Q565K	Q	-	1	0	FBN2	127742393	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.330000	0.79181	2.654000	0.90174	0.655000	0.94253	CAG	G|0.999;A|0.001		0.408	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
FBXO36	130888	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	230787284	230787284	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr2:230787284C>G	ENST00000283946.3	+	1	73	c.55C>G	c.(55-57)Cct>Gct	p.P19A	TRIP12_ENST00000389045.3_5'Flank|TRIP12_ENST00000543084.1_5'Flank|TRIP12_ENST00000409677.1_5'Flank|TRIP12_ENST00000389044.4_5'Flank|FBXO36_ENST00000373652.3_5'UTR|FBXO36_ENST00000409992.1_Missense_Mutation_p.P19A|TRIP12_ENST00000283943.5_5'Flank	NM_174899.4	NP_777559.3	Q8NEA4	FBX36_HUMAN	F-box protein 36	19										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	7		Renal(207;0.0112)|all_lung(227;0.0179)|Lung NSC(271;0.0804)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;7.56e-14)|all cancers(144;7.74e-11)|Lung(119;0.00488)|LUSC - Lung squamous cell carcinoma(224;0.008)		AGGCCCGCCGCCTAGCAAAGA	0.622																																					p.P19A		.											.	FBXO36	227	0			c.C55G						.						56.0	54.0	55.0					2																	230787284		2203	4300	6503	SO:0001583	missense	130888	exon1			CCGCCGCCTAGCA	BC033935	CCDS2472.1	2q37.1	2008-02-05	2004-06-15		ENSG00000153832	ENSG00000153832		"""F-boxes /  ""other"""""	27020	protein-coding gene	gene with protein product		609105	"""F-box only protein 36"""			12477932	Standard	NM_174899		Approved	Fbx36, FLJ37592	uc002vqa.3	Q8NEA4	OTTHUMG00000133206	ENST00000283946.3:c.55C>G	2.37:g.230787284C>G	ENSP00000283946:p.Pro19Ala	248.0	0.0		205.0	41.0	NM_174899	B3KVQ6|Q53TE6|Q8WWD4	Missense_Mutation	SNP	ENST00000283946.3	37	CCDS2472.1	.	.	.	.	.	.	.	.	.	.	C	11.13	1.547149	0.27652	.	.	ENSG00000153832	ENST00000283946;ENST00000409992	T	0.66460	-0.21	4.07	4.07	0.47477	.	0.174193	0.37304	N	0.002152	T	0.77130	0.4085	M	0.85945	2.785	0.40447	D	0.980105	D;P	0.69078	0.997;0.805	P;B	0.52881	0.712;0.201	T	0.83180	-0.0089	10	0.87932	D	0	0.0812	13.2649	0.60128	0.0:1.0:0.0:0.0	.	19;19	Q8NEA4;B8ZZQ1	FBX36_HUMAN;.	A	19	ENSP00000283946:P19A	ENSP00000283946:P19A	P	+	1	0	FBXO36	230495528	1.000000	0.71417	0.962000	0.40283	0.150000	0.21749	2.762000	0.47597	2.113000	0.64589	0.655000	0.94253	CCT	.		0.622	FBXO36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256919.2	NM_174899	
FBXW7	55294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	153273838	153273838	+	Intron	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr4:153273838A>T	ENST00000281708.4	-	3	1731				FBXW7_ENST00000296555.5_Intron|FBXW7_ENST00000263981.5_Silent_p.L15L|FBXW7_ENST00000603548.1_Intron|FBXW7_ENST00000603841.1_Intron	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase						cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)			NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				CTCCACAGTAAAGGCAAATGC	0.458			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.L15L		.		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	.	FBXW7	6296	0			c.T45A						.						73.0	69.0	70.0					4																	153273838		2203	4300	6503	SO:0001627	intron_variant	55294	exon1			ACAGTAAAGGCAA	AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.502-2562T>A	4.37:g.153273838A>T		55.0	0.0		57.0	17.0	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Silent	SNP	ENST00000281708.4	37	CCDS3777.1																																																																																			.		0.458	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
FHOD3	80206	ucsc.edu;bcgsc.ca	37	18	34182638	34182638	+	Splice_Site	SNP	G	G	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr18:34182638G>A	ENST00000359247.4	+	8	720	c.720G>A	c.(718-720)ggG>ggA	p.G240G	FHOD3_ENST00000445677.1_Splice_Site_p.G240G|FHOD3_ENST00000257209.4_Splice_Site_p.G240G|FHOD3_ENST00000591635.1_5'UTR|FHOD3_ENST00000590592.1_Splice_Site_p.G240G	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	240	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				TACTCATAGGGGTCAAACCTT	0.383																																					p.G240G		.											.	FHOD3	139	0			c.G720A						.						159.0	149.0	152.0					18																	34182638		2203	4300	6503	SO:0001630	splice_region_variant	80206	exon8			CATAGGGGTCAAA	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.719-1G>A	18.37:g.34182638G>A		183.0	2.0		220.0	93.0	NM_025135	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Silent	SNP	ENST00000359247.4	37																																																																																				.		0.383	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	Silent
FMN1	342184	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	33359290	33359290	+	Intron	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr15:33359290A>T	ENST00000559047.1	-	3	2043				FMN1_ENST00000561249.1_Intron|FMN1_ENST00000559150.1_Intron|FMN1_ENST00000334528.9_Missense_Mutation_p.S266T|FMN1_ENST00000558197.1_Missense_Mutation_p.S266T			Q68DA7	FMN1_HUMAN	formin 1						actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		TTCTCTCCAGAGACTTCTTTT	0.493																																					p.S266T		.											.	FMN1	23	0			c.T796A						.						77.0	80.0	79.0					15																	33359290		1899	4136	6035	SO:0001627	intron_variant	342184	exon1			CTCCAGAGACTTC	AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2044-2015T>A	15.37:g.33359290A>T		119.0	1.0		88.0	62.0	NM_001103184	Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	ENST00000559047.1	37		.	.	.	.	.	.	.	.	.	.	A	1.719	-0.497101	0.04291	.	.	ENSG00000248905	ENST00000334528	T	0.39997	1.05	5.59	3.36	0.38483	.	.	.	.	.	T	0.22820	0.0551	.	.	.	.	.	.	B;B	0.29301	0.241;0.152	B;B	0.29785	0.107;0.068	T	0.20075	-1.0286	7	0.06757	T	0.87	.	11.3526	0.49596	0.2274:0.0:0.7726:0.0	.	266;266	Q68DA7-3;Q68DA7-5	.;.	T	266	ENSP00000333950:S266T	ENSP00000333950:S266T	S	-	1	0	FMN1	31146582	0.003000	0.15002	0.064000	0.19789	0.070000	0.16714	0.294000	0.19047	1.348000	0.45733	-0.242000	0.12053	TCT	.		0.493	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000417414.1	NM_001103184	
GPX6	257202	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	28478622	28478622	+	Silent	SNP	G	G	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr6:28478622G>A	ENST00000474923.1	-	2	190	c.147C>T	c.(145-147)aaC>aaT	p.N49N	GPX6_ENST00000361902.1_Silent_p.N49N|GPX6_ENST00000483058.1_5'UTR			P59796	GPX6_HUMAN	glutathione peroxidase 6 (olfactory)	49					response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)			NS(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Glutathione(DB00143)	ACTCCTCGCCGTTGAGGGTGA	0.458																																					.		.											.	GPX6	95	0			.						.						115.0	110.0	111.0					6																	28478622		1963	4158	6121	SO:0001819	synonymous_variant	257202	.			CTCGCCGTTGAGG		CCDS43432.1	6p22.1	2012-03-01			ENSG00000198704	ENSG00000198704	1.11.1.9		4558	protein-coding gene	gene with protein product		607913	"""glutathione peroxidase pseudogene 3"""	GPXP3			Standard	NM_182701		Approved		uc021yrx.1	P59796	OTTHUMG00000044828	ENST00000474923.1:c.147C>T	6.37:g.28478622G>A		130.0	0.0		127.0	59.0	.	Q4PJ17	Silent	SNP	ENST00000474923.1	37																																																																																				.		0.458	GPX6-002	PUTATIVE	basic|exp_conf|seleno	protein_coding	protein_coding	OTTHUMT00000356246.5		
GRIP2	80852	broad.mit.edu;ucsc.edu	37	3	14555217	14555217	+	RNA	SNP	G	G	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr3:14555217G>T	ENST00000273083.3	-	0	1659							Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2						synaptic transmission (GO:0007268)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				endometrium(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	25						GTGGGCCAGTGCGGCGTCCCG	0.632																																					.		.											.	GRIP2	69	0			.						.						33.0	40.0	37.0					3																	14555217		2164	4252	6416			80852	.			GCCAGTGCGGCGT	AB051506		3p24-p23	2012-02-08			ENSG00000144596	ENSG00000144596			23841	protein-coding gene	gene with protein product							Standard	NM_001080423		Approved	KIAA1719	uc021wtn.1	Q9C0E4	OTTHUMG00000155544		3.37:g.14555217G>T		121.0	0.0		140.0	40.0	.	Q8TEH9|Q9H7H3	RNA	SNP	ENST00000273083.3	37																																																																																				.		0.632	GRIP2-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000340582.2	NM_001080423	
GRM3	2913	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	86416221	86416221	+	Silent	SNP	C	C	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr7:86416221C>T	ENST00000361669.2	+	3	2212	c.1113C>T	c.(1111-1113)cgC>cgT	p.R371R	GRM3_ENST00000546348.1_Intron|GRM3_ENST00000439827.1_Silent_p.R371R|GRM3_ENST00000394720.2_Silent_p.R369R|AC005009.2_ENST00000418031.1_RNA|AC005009.2_ENST00000452471.1_RNA|GRM3_ENST00000536043.1_Silent_p.R243R	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	371					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					ACCACAGGCGCGTCTGCGACA	0.567																																					p.R371R	GBM(52;969 1098 3139 52280)	.											.	GRM3	528	0			c.C1113T						.						101.0	85.0	90.0					7																	86416221		2203	4300	6503	SO:0001819	synonymous_variant	2913	exon3			CAGGCGCGTCTGC		CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.1113C>T	7.37:g.86416221C>T		95.0	0.0		88.0	36.0	NM_000840	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Silent	SNP	ENST00000361669.2	37	CCDS5600.1																																																																																			.		0.567	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2		
HCN4	10021	broad.mit.edu;mdanderson.org	37	15	73615574	73615574	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr15:73615574G>C	ENST00000261917.3	-	8	3853	c.2860C>G	c.(2860-2862)Ctc>Gtc	p.L954V		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	954	Pro-rich.				blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		TGCTCCGGGAGTCCCAGGCCT	0.741																																					p.L954V		.											.	HCN4	96	0			c.C2860G						.						5.0	8.0	7.0					15																	73615574		1862	3950	5812	SO:0001583	missense	10021	exon8			CCGGGAGTCCCAG	AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.2860C>G	15.37:g.73615574G>C	ENSP00000261917:p.Leu954Val	27.0	0.0		15.0	7.0	NM_005477	Q9UMQ7	Missense_Mutation	SNP	ENST00000261917.3	37	CCDS10248.1	.	.	.	.	.	.	.	.	.	.	G	5.964	0.361773	0.11296	.	.	ENSG00000138622	ENST00000261917	D	0.97665	-4.48	2.93	2.93	0.34026	.	.	.	.	.	D	0.93058	0.7790	L	0.36672	1.1	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	D	0.83747	0.0207	9	0.16896	T	0.51	.	9.5913	0.39548	0.0:0.4555:0.5445:0.0	.	954	Q9Y3Q4	HCN4_HUMAN	V	954	ENSP00000261917:L954V	ENSP00000261917:L954V	L	-	1	0	HCN4	71402627	0.959000	0.32827	0.822000	0.32727	0.683000	0.39861	1.931000	0.40134	1.465000	0.48006	0.448000	0.29417	CTC	.		0.741	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477	
HELB	92797	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	66703544	66703544	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr12:66703544A>T	ENST00000247815.4	+	4	895	c.836A>T	c.(835-837)cAg>cTg	p.Q279L		NM_033647.3	NP_387467.2	Q8NG08	HELB_HUMAN	helicase (DNA) B	279					DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication, synthesis of RNA primer (GO:0006269)		ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|single-stranded DNA-dependent ATP-dependent DNA helicase activity (GO:0017116)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	40			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		GCATTTTGTCAGTGTGAGTCT	0.383																																					p.Q279L		.											.	HELB	515	0			c.A836T						.						166.0	164.0	164.0					12																	66703544		2203	4300	6503	SO:0001583	missense	92797	exon4			TTTGTCAGTGTGA	AF319995	CCDS8976.1	12q14.2	2009-01-15			ENSG00000127311	ENSG00000127311			17196	protein-coding gene	gene with protein product		614539				12181327	Standard	NM_033647		Approved		uc001sti.3	Q8NG08	OTTHUMG00000169006	ENST00000247815.4:c.836A>T	12.37:g.66703544A>T	ENSP00000247815:p.Gln279Leu	147.0	0.0		156.0	101.0	NM_033647	A8K4C9|Q4G0T2|Q9H7L5	Missense_Mutation	SNP	ENST00000247815.4	37	CCDS8976.1	.	.	.	.	.	.	.	.	.	.	A	13.33	2.204879	0.38905	.	.	ENSG00000127311	ENST00000247815	T	0.13657	2.57	6.17	6.17	0.99709	.	0.063541	0.64402	D	0.000004	T	0.17789	0.0427	L	0.57536	1.79	0.35484	D	0.79843	P	0.42692	0.787	B	0.39217	0.294	T	0.14615	-1.0466	9	.	.	.	-15.0315	16.8222	0.85835	1.0:0.0:0.0:0.0	.	279	Q8NG08	HELB_HUMAN	L	279	ENSP00000247815:Q279L	.	Q	+	2	0	HELB	64989811	1.000000	0.71417	0.985000	0.45067	0.021000	0.10359	4.177000	0.58276	2.371000	0.80710	0.533000	0.62120	CAG	.		0.383	HELB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401919.1		
HIVEP3	59269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	42048714	42048714	+	Silent	SNP	C	C	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr1:42048714C>G	ENST00000372583.1	-	4	2640	c.1755G>C	c.(1753-1755)cgG>cgC	p.R585R	HIVEP3_ENST00000429157.2_Silent_p.R585R|HIVEP3_ENST00000247584.5_Silent_p.R585R|HIVEP3_ENST00000372584.1_Silent_p.R585R	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	585	No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				GCTTCAGCATCCGGGGGTGGG	0.602																																					p.R585R		.											.	HIVEP3	157	0			c.G1755C						.						50.0	52.0	52.0					1																	42048714		2203	4300	6503	SO:0001819	synonymous_variant	59269	exon4			CAGCATCCGGGGG	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.1755G>C	1.37:g.42048714C>G		115.0	0.0		91.0	68.0	NM_024503	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	37	CCDS463.1																																																																																			.		0.602	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
HPD	3242	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	122287654	122287654	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr12:122287654T>C	ENST00000289004.4	-	8	492	c.457A>G	c.(457-459)Atc>Gtc	p.I153V	HPD_ENST00000543163.1_Missense_Mutation_p.I114V|HPD_ENST00000543869.2_5'UTR	NM_002150.2	NP_002141	P32754	HPPD_HUMAN	4-hydroxyphenylpyruvate dioxygenase	153					cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	4-hydroxyphenylpyruvate dioxygenase activity (GO:0003868)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|urinary_tract(1)	18	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000105)|Epithelial(86;0.000352)|BRCA - Breast invasive adenocarcinoma(302;0.225)	Nitisinone(DB00348)	AATTGGCCGATGTAGTTCATC	0.597																																					p.I153V		.											.	HPD	90	0			c.A457G						.						143.0	115.0	125.0					12																	122287654		2203	4300	6503	SO:0001583	missense	3242	exon8			GGCCGATGTAGTT	BC014790	CCDS9224.1, CCDS53839.1	12q24.31	2013-09-19			ENSG00000158104	ENSG00000158104	1.13.11.27		5147	protein-coding gene	gene with protein product	"""glyoxalase domain containing 3"""	609695		PPD			Standard	NM_001171993		Approved	4-HPPD, 4HPPD, GLOD3	uc001ubj.3	P32754	OTTHUMG00000169081	ENST00000289004.4:c.457A>G	12.37:g.122287654T>C	ENSP00000289004:p.Ile153Val	140.0	0.0		165.0	36.0	NM_002150	A8K461|B3KQ63|Q13234	Missense_Mutation	SNP	ENST00000289004.4	37	CCDS9224.1	.	.	.	.	.	.	.	.	.	.	T	9.290	1.050298	0.19827	.	.	ENSG00000158104	ENST00000289004;ENST00000545969;ENST00000543163	T;T	0.61859	0.07;0.07	5.41	3.06	0.35304	.	0.408106	0.28493	N	0.015146	T	0.35189	0.0923	N	0.08118	0	0.09310	N	0.999992	B	0.02656	0.0	B	0.01281	0.0	T	0.27571	-1.0070	10	0.59425	D	0.04	-18.68	9.8108	0.40822	0.0:0.1404:0.0:0.8596	.	153	P32754	HPPD_HUMAN	V	153;150;114	ENSP00000289004:I153V;ENSP00000441677:I114V	ENSP00000289004:I153V	I	-	1	0	HPD	120772037	0.992000	0.36948	0.304000	0.25085	0.059000	0.15707	2.117000	0.41939	0.360000	0.24265	-0.274000	0.10170	ATC	.		0.597	HPD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402184.1	NM_002150	
HSH2D	84941	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	16263989	16263989	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr19:16263989A>G	ENST00000253680.6	+	6	883	c.352A>G	c.(352-354)Agg>Ggg	p.R118G	HSH2D_ENST00000593154.2_Missense_Mutation_p.R118G|HSH2D_ENST00000397372.4_Missense_Mutation_p.R29G|HSH2D_ENST00000588246.1_Missense_Mutation_p.R118G			Q96JZ2	HSH2D_HUMAN	hematopoietic SH2 domain containing	118	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of mitochondrial depolarization (GO:0051902)|positive regulation of signal transduction (GO:0009967)|T cell activation (GO:0042110)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(1)|kidney(1)|large_intestine(2)	4						TGAGCCGCGCAGGGAGCTGCT	0.632																																					p.R118G		.											.	.	.	0			c.A352G						.						13.0	17.0	16.0					19																	16263989		1997	4141	6138	SO:0001583	missense	84941	exon6			CCGCGCAGGGAGC	AK027792	CCDS74304.1	19p13.12	2013-02-14				ENSG00000196684		"""SH2 domain containing"""	24920	protein-coding gene	gene with protein product		608349				11700021	Standard	NM_032855		Approved	ALX, HSH2, FLJ14886	uc002ndp.4	Q96JZ2		ENST00000253680.6:c.352A>G	19.37:g.16263989A>G	ENSP00000253680:p.Arg118Gly	62.0	1.0		74.0	9.0	NM_032855	B5ME72|Q6ZNG7	Missense_Mutation	SNP	ENST00000253680.6	37		.	.	.	.	.	.	.	.	.	.	A	0.006	-2.022652	0.00414	.	.	ENSG00000196684	ENST00000397372;ENST00000253680	T	0.40476	1.03	4.63	2.27	0.28462	SH2 motif (2);	0.984122	0.08272	N	0.971323	T	0.07863	0.0197	N	0.00061	-2.33	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34329	-0.9833	10	0.05351	T	0.99	.	5.8675	0.18783	0.1068:0.1947:0.6985:0.0	.	61;118	Q96JZ2-2;Q96JZ2	.;HSH2D_HUMAN	G	29;118	ENSP00000253680:R118G	ENSP00000253680:R118G	R	+	1	2	HSH2D	16124989	0.000000	0.05858	0.005000	0.12908	0.235000	0.25334	-0.487000	0.06505	0.517000	0.28361	-0.285000	0.09966	AGG	.		0.632	HSH2D-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_032855	
HSPA6	3310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	161495008	161495008	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr1:161495008T>A	ENST00000309758.4	+	1	973	c.560T>A	c.(559-561)cTg>cAg	p.L187Q	RP11-25K21.6_ENST00000537821.2_RNA	NM_002155.3	NP_002146.2	P17066	HSP76_HUMAN	heat shock 70kDa protein 6 (HSP70B')	187					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|centriole (GO:0005814)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			endometrium(3)|large_intestine(5)|lung(9)|prostate(2)|skin(2)	21	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			GCCTATGGGCTGGACCGGCGG	0.647																																					p.L187Q		.											.	HSPA6	226	0			c.T560A						.						28.0	35.0	33.0					1																	161495008		2202	4297	6499	SO:0001583	missense	3310	exon1			ATGGGCTGGACCG		CCDS1231.1	1q23.3	2011-09-02	2002-08-29		ENSG00000173110	ENSG00000173110		"""Heat shock proteins / HSP70"""	5239	protein-coding gene	gene with protein product		140555	"""heat shock 70kD protein 6 (HSP70B')"""			1346391	Standard	NM_002155		Approved		uc001gaq.3	P17066	OTTHUMG00000034461	ENST00000309758.4:c.560T>A	1.37:g.161495008T>A	ENSP00000310219:p.Leu187Gln	267.0	0.0		314.0	120.0	NM_002155	Q1HBA8|Q8IYK7|Q9BT95	Missense_Mutation	SNP	ENST00000309758.4	37	CCDS1231.1	.	.	.	.	.	.	.	.	.	.	.	15.66	2.899944	0.52227	.	.	ENSG00000173110	ENST00000309758;ENST00000545155	T	0.01685	4.69	3.3	3.3	0.37823	.	0.000000	0.31577	U	0.007407	T	0.13457	0.0326	H	0.99732	4.735	0.53688	D	0.999973	D	0.89917	1.0	D	0.87578	0.998	T	0.09596	-1.0667	10	0.87932	D	0	-31.2204	9.6319	0.39785	0.0:0.0:0.0:1.0	.	187	P17066	HSP76_HUMAN	Q	187;163	ENSP00000310219:L187Q	ENSP00000310219:L187Q	L	+	2	0	HSPA6	159761632	1.000000	0.71417	0.748000	0.31131	0.440000	0.31957	6.802000	0.75175	1.351000	0.45789	0.398000	0.26397	CTG	.		0.647	HSPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083308.1	NM_002155	
IDO2	169355	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	39873103	39873103	+	Silent	SNP	C	C	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr8:39873103C>A	ENST00000389060.4	+	10	1206	c.1206C>A	c.(1204-1206)atC>atA	p.I402I	IDO2_ENST00000502986.2_Silent_p.I415I|IDO2_ENST00000343295.4_3'UTR			Q6ZQW0	I23O2_HUMAN	indoleamine 2,3-dioxygenase 2	402					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	heme binding (GO:0020037)|indoleamine 2,3-dioxygenase activity (GO:0033754)|metal ion binding (GO:0046872)|tryptophan 2,3-dioxygenase activity (GO:0004833)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	18						TGGAGTCAATCCTTCACCCAC	0.577																																					p.I415I		.											.	IDO2	24	0			c.C1245A						.						90.0	89.0	89.0					8																	39873103		1979	4158	6137	SO:0001819	synonymous_variant	169355	exon11			GTCAATCCTTCAC	AK128691		8p11.21	2012-04-19	2009-01-07	2009-01-07	ENSG00000188676	ENSG00000188676			27269	protein-coding gene	gene with protein product		612129	"""indoleamine-pyrrole 2,3 dioxygenase-like 1"""	INDOL1			Standard	NM_194294		Approved		uc010lwy.1	Q6ZQW0	OTTHUMG00000141271	ENST00000389060.4:c.1206C>A	8.37:g.39873103C>A		95.0	0.0		92.0	39.0	NM_194294	A4UD41	Silent	SNP	ENST00000389060.4	37																																																																																				.		0.577	IDO2-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372742.1	NM_194294	
IFNGR1	3459	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	137519200	137519200	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr6:137519200T>A	ENST00000367739.4	-	7	1559	c.1438A>T	c.(1438-1440)Aga>Tga	p.R480*	IFNGR1_ENST00000543628.1_Nonsense_Mutation_p.R452*	NM_000416.2	NP_000407.1	P15260	INGR1_HUMAN	interferon gamma receptor 1	480					cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)|signal transduction (GO:0007165)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|vesicle (GO:0031982)	interferon-gamma receptor activity (GO:0004906)			central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	18	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	TCTGTTGGTCTATAACCAATC	0.388																																					p.R480X		.											.	IFNGR1	91	0			c.A1438T						.						100.0	100.0	100.0					6																	137519200		2203	4300	6503	SO:0001587	stop_gained	3459	exon7			TTGGTCTATAACC		CCDS5185.1	6q23-q24	2014-09-17			ENSG00000027697	ENSG00000027697		"""Interferons"", ""CD molecules"""	5439	protein-coding gene	gene with protein product		107470		IFNGR			Standard	NM_000416		Approved	CD119	uc003qho.2	P15260	OTTHUMG00000015656	ENST00000367739.4:c.1438A>T	6.37:g.137519200T>A	ENSP00000356713:p.Arg480*	137.0	0.0		161.0	88.0	NM_000416	B4DFT7|E1P587|Q53Y96	Nonsense_Mutation	SNP	ENST00000367739.4	37	CCDS5185.1	.	.	.	.	.	.	.	.	.	.	T	17.97	3.517931	0.64634	.	.	ENSG00000027697	ENST00000367739;ENST00000543628	.	.	.	6.03	3.46	0.39613	.	0.131846	0.48286	D	0.000182	.	.	.	.	.	.	0.18873	N	0.999988	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-28.6577	10.9029	0.47062	0.0:0.0:0.3146:0.6854	.	.	.	.	X	480;452	.	ENSP00000356713:R480X	R	-	1	2	IFNGR1	137560893	0.940000	0.31905	0.061000	0.19648	0.267000	0.26476	2.670000	0.46833	1.066000	0.40716	0.533000	0.62120	AGA	.		0.388	IFNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042401.1		
ITIH6	347365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	54780134	54780134	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chrX:54780134A>T	ENST00000218436.6	-	11	3331	c.3302T>A	c.(3301-3303)cTg>cAg	p.L1101Q		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	1101					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										GTGCCCATTCAGTGTGAAGCA	0.498																																					p.L1101Q		.											.	.	.	0			c.T3302A						.						109.0	90.0	96.0					X																	54780134		2203	4300	6503	SO:0001583	missense	347365	exon11			CCATTCAGTGTGA	AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.3302T>A	X.37:g.54780134A>T	ENSP00000218436:p.Leu1101Gln	145.0	0.0		168.0	82.0	NM_198510	A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	A	11.65	1.702214	0.30232	.	.	ENSG00000102313	ENST00000218436	T	0.02682	4.2	3.25	3.25	0.37280	.	1.157720	0.06647	U	0.762144	T	0.06096	0.0158	L	0.34521	1.04	0.09310	N	1	D	0.55385	0.971	P	0.51355	0.667	T	0.48636	-0.9018	10	0.87932	D	0	.	10.1393	0.42725	1.0:0.0:0.0:0.0	.	1101	Q6UXX5	ITH5L_HUMAN	Q	1101	ENSP00000218436:L1101Q	ENSP00000218436:L1101Q	L	-	2	0	ITIH5L	54796859	0.510000	0.26171	0.381000	0.26106	0.439000	0.31926	6.608000	0.74168	0.984000	0.38629	0.341000	0.21757	CTG	.		0.498	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510	
KCNG1	3755	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	49621256	49621256	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr20:49621256T>C	ENST00000371571.4	-	3	1147	c.862A>G	c.(862-864)Att>Gtt	p.I288V	RP5-955M13.4_ENST00000424566.1_RNA|KCNG1_ENST00000506387.1_5'UTR	NM_002237.3	NP_002228.2	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G, member 1	288					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						GGCGCCTGAATGAGCCGCAGG	0.642																																					p.I288V		.											.	KCNG1	515	0			c.A862G						.						21.0	20.0	21.0					20																	49621256		2198	4295	6493	SO:0001583	missense	3755	exon3			CCTGAATGAGCCG	AF033383	CCDS13436.1	20q13	2011-07-05			ENSG00000026559	ENSG00000026559		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6248	protein-coding gene	gene with protein product		603788		KCNG		9434767, 16382104	Standard	NM_002237		Approved	Kv6.1, kH2, K13	uc002xwa.4	Q9UIX4	OTTHUMG00000032745	ENST00000371571.4:c.862A>G	20.37:g.49621256T>C	ENSP00000360626:p.Ile288Val	196.0	0.0		256.0	113.0	NM_002237	A8K3S4|O43528|Q5JXL5|Q9BRC1	Missense_Mutation	SNP	ENST00000371571.4	37	CCDS13436.1	.	.	.	.	.	.	.	.	.	.	T	8.742	0.919312	0.17982	.	.	ENSG00000026559	ENST00000371571	D	0.98455	-4.94	4.88	1.3	0.21679	Ion transport (1);	0.317848	0.38217	N	0.001775	D	0.93452	0.7911	N	0.17764	0.52	0.80722	D	1	B	0.12013	0.005	B	0.20577	0.03	D	0.86058	0.1530	9	.	.	.	.	8.1685	0.31241	0.0:0.2938:0.0:0.7062	.	288	Q9UIX4	KCNG1_HUMAN	V	288	ENSP00000360626:I288V	.	I	-	1	0	KCNG1	49054663	1.000000	0.71417	0.972000	0.41901	0.397000	0.30659	2.119000	0.41958	0.305000	0.22832	0.260000	0.18958	ATT	.		0.642	KCNG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079726.4	NM_002237	
KCNQ5	56479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	73879546	73879546	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr6:73879546C>T	ENST00000370398.1	+	11	1655	c.1546C>T	c.(1546-1548)Cca>Tca	p.P516S	KCNQ5_ENST00000414165.2_Intron|KCNQ5_ENST00000342056.2_Missense_Mutation_p.P535S|KCNQ5_ENST00000403813.2_Missense_Mutation_p.P507S|KCNQ5_ENST00000402622.2_Missense_Mutation_p.P526S|KCNQ5_ENST00000355635.3_Missense_Mutation_p.P517S|KCNQ5_ENST00000355194.4_Missense_Mutation_p.P516S	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	516					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	AGACCTCACCCCACCACTTAA	0.398																																					p.P535S	GBM(142;1375 1859 14391 23261 44706)	.											.	KCNQ5	158	0			c.C1603T						.						158.0	125.0	136.0					6																	73879546		2203	4300	6503	SO:0001583	missense	56479	exon12			CTCACCCCACCAC	AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.1546C>T	6.37:g.73879546C>T	ENSP00000359425:p.Pro516Ser	150.0	0.0		195.0	98.0	NM_001160133	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	ENST00000370398.1	37	CCDS4976.1	.	.	.	.	.	.	.	.	.	.	C	19.66	3.869182	0.72065	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000402622;ENST00000355635;ENST00000403813	D;D;D;D;D;D	0.99637	-6.29;-6.29;-6.29;-6.29;-6.29;-6.29	5.46	4.59	0.56863	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.056594	0.64402	D	0.000001	D	0.98975	0.9651	L	0.37850	1.14	0.80722	D	1	P;P;P;D	0.56287	0.832;0.875;0.849;0.975	P;P;P;P	0.59546	0.495;0.627;0.493;0.859	D	0.99116	1.0848	10	0.52906	T	0.07	.	16.2663	0.82581	0.0:0.8669:0.1331:0.0	.	526;535;507;516	Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82	.;.;.;KCNQ5_HUMAN	S	535;535;516;516;526;517;507	ENSP00000345055:P535S;ENSP00000347326:P516S;ENSP00000359425:P516S;ENSP00000385501:P526S;ENSP00000347853:P517S;ENSP00000384453:P507S	ENSP00000345055:P535S	P	+	1	0	KCNQ5	73936267	0.992000	0.36948	1.000000	0.80357	0.996000	0.88848	2.585000	0.46111	1.431000	0.47355	0.655000	0.94253	CCA	.		0.398	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041198.3	NM_019842	
KCNS1	3787	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	43727336	43727336	+	Splice_Site	SNP	C	C	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr20:43727336C>T	ENST00000306117.1	-	4	473	c.77G>A	c.(76-78)gGg>gAg	p.G26E	KCNS1_ENST00000537075.1_Splice_Site_p.G26E	NM_002251.3	NP_002242.2	Q96KK3	KCNS1_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1	26					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)			endometrium(1)|lung(3)|ovary(1)|stomach(1)	6		Myeloproliferative disorder(115;0.0122)				AGTGCTCCTCCCTGCGGACAC	0.652																																					p.G26E		.											.	KCNS1	90	0			c.G77A						.						7.0	8.0	8.0					20																	43727336		1995	4160	6155	SO:0001630	splice_region_variant	3787	exon4			CTCCTCCCTGCGG	AF043473	CCDS13342.1	20q12	2011-07-05			ENSG00000124134	ENSG00000124134		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6300	protein-coding gene	gene with protein product		602905				9305895, 16382104	Standard	NM_002251		Approved	Kv9.1	uc002xnc.3	Q96KK3	OTTHUMG00000033079	ENST00000306117.1:c.77-1G>A	20.37:g.43727336C>T		47.0	0.0		52.0	18.0	NM_002251	A2RUL9|B7ZM31|O43652|Q6DJU6	Missense_Mutation	SNP	ENST00000306117.1	37	CCDS13342.1	.	.	.	.	.	.	.	.	.	.	C	11.47	1.648526	0.29336	.	.	ENSG00000124134	ENST00000306117;ENST00000537075	D;D	0.96200	-3.94;-3.94	3.5	2.54	0.30619	.	27.440700	0.04882	U	0.447800	D	0.89643	0.6774	N	0.08118	0	0.09310	N	1	B	0.32010	0.351	B	0.35278	0.199	T	0.81581	-0.0867	10	0.18710	T	0.47	.	9.8096	0.40815	0.0:0.8919:0.0:0.1081	.	26	Q96KK3	KCNS1_HUMAN	E	26	ENSP00000307694:G26E;ENSP00000445595:G26E	ENSP00000307694:G26E	G	-	2	0	KCNS1	43160750	0.565000	0.26610	0.004000	0.12327	0.048000	0.14542	0.941000	0.29005	0.753000	0.32945	0.655000	0.94253	GGG	.		0.652	KCNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080507.3	NM_002251	Missense_Mutation
KCTD8	386617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	44177224	44177224	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr4:44177224A>T	ENST00000360029.3	-	2	1288	c.1005T>A	c.(1003-1005)gaT>gaA	p.D335E		NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	335					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						CATGTTTCCTATCTTCATGTT	0.398										HNSCC(17;0.042)																											p.D335E		.											.	KCTD8	92	0			c.T1005A						.						116.0	109.0	111.0					4																	44177224		2203	4300	6503	SO:0001583	missense	386617	exon2			TTTCCTATCTTCA	AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.1005T>A	4.37:g.44177224A>T	ENSP00000353129:p.Asp335Glu	116.0	0.0		113.0	53.0	NM_198353	A2RU39	Missense_Mutation	SNP	ENST00000360029.3	37	CCDS3467.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.231|9.231	1.035724|1.035724	0.19590|0.19590	.|.	.|.	ENSG00000183783|ENSG00000183783	ENST00000360029|ENST00000515268	T|.	0.36157|.	1.27|.	4.65|4.65	-4.54|-4.54	0.03452|0.03452	.|.	0.123995|.	0.35772|.	N|.	0.002991|.	T|T	0.16599|0.16599	0.0399|0.0399	N|N	0.14661|0.14661	0.345|0.345	0.22888|0.22888	N|N	0.998602|0.998602	B|.	0.09022|.	0.002|.	B|.	0.08055|.	0.003|.	T|T	0.28299|0.28299	-1.0048|-1.0048	10|5	0.02654|.	T|.	1|.	.|.	5.3121|5.3121	0.15835|0.15835	0.1932:0.1054:0.5168:0.1846|0.1932:0.1054:0.5168:0.1846	.|.	335|.	Q6ZWB6|.	KCTD8_HUMAN|.	E|K	335|71	ENSP00000353129:D335E|.	ENSP00000353129:D335E|.	D|I	-|-	3|2	2|0	KCTD8|KCTD8	43871981|43871981	0.395000|0.395000	0.25254|0.25254	0.953000|0.953000	0.39169|0.39169	0.950000|0.950000	0.60333|0.60333	-0.597000|-0.597000	0.05713|0.05713	-0.945000|-0.945000	0.03681|0.03681	-0.334000|-0.334000	0.08254|0.08254	GAT|ATA	.		0.398	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
KIF4B	285643	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	154395188	154395188	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr5:154395188A>G	ENST00000435029.4	+	1	1929	c.1769A>G	c.(1768-1770)aAc>aGc	p.N590S		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	590					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AAGAATGTCAACCAAGCCAAG	0.418																																					p.N590S		.											.	KIF4B	1	0			c.A1769G						.						84.0	86.0	85.0					5																	154395188		2203	4300	6503	SO:0001583	missense	285643	exon1			ATGTCAACCAAGC	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.1769A>G	5.37:g.154395188A>G	ENSP00000387875:p.Asn590Ser	145.0	0.0		157.0	7.0	NM_001099293		Missense_Mutation	SNP	ENST00000435029.4	37	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	a	8.860	0.946671	0.18356	.	.	ENSG00000226650	ENST00000435029	T	0.68765	-0.35	1.2	-0.14	0.13456	.	.	.	.	.	T	0.48909	0.1526	L	0.33710	1.025	0.44966	D	0.997981	B	0.33345	0.409	B	0.37480	0.251	T	0.19128	-1.0315	9	0.15066	T	0.55	.	5.2328	0.15432	0.7022:0.2978:0.0:0.0	.	590	Q2VIQ3	KIF4B_HUMAN	S	590	ENSP00000387875:N590S	ENSP00000387875:N590S	N	+	2	0	KIF4B	154375381	1.000000	0.71417	0.988000	0.46212	0.566000	0.35808	2.228000	0.42981	-0.035000	0.13691	-0.460000	0.05396	AAC	.		0.418	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1		
KLHL4	56062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	86873049	86873049	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chrX:86873049C>A	ENST00000373119.4	+	4	987	c.842C>A	c.(841-843)cCt>cAt	p.P281H	KLHL4_ENST00000373114.4_Missense_Mutation_p.P281H	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	281						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.P281H(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						CAGCTCCATCCTTCAAACTGC	0.423																																					p.P281H		.											KLHL4,NS,carcinoma,0	KLHL4	133	1	Substitution - Missense(1)	ovary(1)	c.C842A						.						106.0	87.0	93.0					X																	86873049		2203	4300	6503	SO:0001583	missense	56062	exon4			TCCATCCTTCAAA	AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.842C>A	X.37:g.86873049C>A	ENSP00000362211:p.Pro281His	335.0	0.0		343.0	155.0	NM_019117	B2RTW2|Q9Y3J5	Missense_Mutation	SNP	ENST00000373119.4	37	CCDS14457.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.356767	0.82243	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.77358	-1.09;-1.06	4.74	4.74	0.60224	.	0.061530	0.64402	D	0.000003	D	0.89753	0.6806	M	0.89715	3.055	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.72075	0.946;0.976	D	0.92014	0.5620	10	0.66056	D	0.02	.	15.9642	0.79952	0.0:1.0:0.0:0.0	.	281;281	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	H	281	ENSP00000362211:P281H;ENSP00000362206:P281H	ENSP00000362206:P281H	P	+	2	0	KLHL4	86759705	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.243000	0.78219	1.960000	0.56953	0.502000	0.49764	CCT	.		0.423	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1		
KNDC1	85442	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	135009191	135009191	+	Missense_Mutation	SNP	G	G	A	rs541722509		TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr10:135009191G>A	ENST00000304613.3	+	10	1621	c.1600G>A	c.(1600-1602)Gtt>Att	p.V534I	KNDC1_ENST00000368571.2_Missense_Mutation_p.V469I|KNDC1_ENST00000368572.2_Missense_Mutation_p.V534I			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	534	KIND 2. {ECO:0000255|PROSITE- ProRule:PRU00709}.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		TGTGGCCGCCGTTCTGTGGAC	0.667													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15057	0.0		0.0	False		,,,				2504	0.0				p.V534I		.											.	KNDC1	229	0			c.G1600A						.						48.0	44.0	45.0					10																	135009191		2202	4300	6502	SO:0001583	missense	85442	exon10			GCCGCCGTTCTGT	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.1600G>A	10.37:g.135009191G>A	ENSP00000304437:p.Val534Ile	346.0	0.0		257.0	65.0	NM_152643	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	G	10.94	1.494320	0.26774	.	.	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.41400	1.0;1.0;1.0	4.63	2.32	0.28847	KIND (2);	0.189090	0.34067	N	0.004291	T	0.24851	0.0603	L	0.45581	1.43	0.38564	D	0.949782	P;B	0.45428	0.858;0.221	B;B	0.32928	0.155;0.051	T	0.08806	-1.0704	10	0.32370	T	0.25	-39.5659	4.8812	0.13681	0.3953:0.0:0.6047:0.0	.	469;534	Q76NI1-2;Q76NI1	.;VKIND_HUMAN	I	534;534;469	ENSP00000304437:V534I;ENSP00000357561:V534I;ENSP00000357560:V469I	ENSP00000304437:V534I	V	+	1	0	KNDC1	134859181	0.108000	0.22018	0.624000	0.29186	0.129000	0.20672	1.040000	0.30278	1.085000	0.41206	0.306000	0.20318	GTT	.		0.667	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
KRT34	3885	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39535916	39535916	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr17:39535916A>G	ENST00000394001.1	-	4	812	c.782T>C	c.(781-783)gTg>gCg	p.V261A		NM_021013.3	NP_066293.2	O76011	KRT34_HUMAN	keratin 34	261	Linker 12.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Breast(137;0.000496)				GTTCAGGTCCACAGTGGGGGC	0.577																																					p.V261A		.											.	KRT34	90	0			c.T782C						.						98.0	77.0	84.0					17																	39535916		2203	4300	6503	SO:0001583	missense	3885	exon4			AGGTCCACAGTGG	Y16790	CCDS11390.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131737	ENSG00000131737		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6452	protein-coding gene	gene with protein product	"""hard keratin type I 4"""	602763	"""keratin, hair, acidic, 4"""	KRTHA4		2431943, 9756910, 16831889	Standard	NM_021013		Approved	Ha-4	uc002hwm.3	O76011	OTTHUMG00000133436	ENST00000394001.1:c.782T>C	17.37:g.39535916A>G	ENSP00000377570:p.Val261Ala	188.0	0.0		126.0	89.0	NM_021013	Q8IUT8|Q8N4W2	Missense_Mutation	SNP	ENST00000394001.1	37	CCDS11390.1	.	.	.	.	.	.	.	.	.	.	a	10.74	1.434655	0.25813	.	.	ENSG00000131737	ENST00000394001;ENST00000251648	.	.	.	4.6	4.6	0.57074	Filament (1);	0.000000	0.56097	D	0.000031	T	0.53077	0.1774	M	0.85197	2.74	0.28351	N	0.92092	B	0.33826	0.427	B	0.40940	0.344	T	0.60989	-0.7153	9	0.87932	D	0	.	4.3741	0.11262	0.7165:0.0:0.0955:0.188	.	261	O76011	KRT34_HUMAN	A	219;261	.	ENSP00000251648:V261A	V	-	2	0	KRT34	36789442	0.015000	0.18098	0.974000	0.42286	0.072000	0.16883	2.166000	0.42406	1.830000	0.53286	0.491000	0.48974	GTG	.		0.577	KRT34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257304.3	NM_021013	
KRTAP4-2	85291	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39334191	39334191	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr17:39334191A>T	ENST00000377726.2	-	1	269	c.226T>A	c.(226-228)Tgc>Agc	p.C76S		NM_033062.3	NP_149051	Q9BYR5	KRA42_HUMAN	keratin associated protein 4-2	76	20 X 5 AA repeats OF C-C-[GRQVS]-[SPT]- [VSTQ].					keratin filament (GO:0045095)				kidney(2)|lung(4)|upper_aerodigestive_tract(1)	7		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			CTGGGACGGCAGCAGGTGGTC	0.667																																					p.C76S		.											.	KRTAP4-2	44	0			c.T226A						.						43.0	49.0	47.0					17																	39334191		2203	4298	6501	SO:0001583	missense	85291	exon1			GACGGCAGCAGGT	AJ406934	CCDS11384.1	17q21.2	2013-06-25			ENSG00000244537	ENSG00000244537		"""Keratin associated proteins"""	18900	protein-coding gene	gene with protein product						11279113	Standard	NM_033062		Approved	KAP4.2	uc002hwd.3	Q9BYR5	OTTHUMG00000133437	ENST00000377726.2:c.226T>A	17.37:g.39334191A>T	ENSP00000366955:p.Cys76Ser	74.0	0.0		85.0	66.0	NM_033062	A0JP64	Missense_Mutation	SNP	ENST00000377726.2	37	CCDS11384.1	.	.	.	.	.	.	.	.	.	.	.	12.70	2.016391	0.35606	.	.	ENSG00000244537	ENST00000377726;ENST00000458321	T	0.02890	4.12	4.82	2.54	0.30619	.	0.000000	0.48286	U	0.000195	T	0.10465	0.0256	M	0.89478	3.035	0.31244	N	0.694795	D	0.63880	0.993	P	0.57620	0.824	T	0.07424	-1.0773	10	0.54805	T	0.06	.	3.2153	0.06696	0.6362:0.0:0.1903:0.1735	.	76	Q9BYR5	KRA42_HUMAN	S	76;193	ENSP00000366955:C76S	ENSP00000366955:C76S	C	-	1	0	KRTAP4-2	36587717	1.000000	0.71417	0.909000	0.35828	0.019000	0.09904	5.626000	0.67777	0.184000	0.20083	0.421000	0.28195	TGC	.		0.667	KRTAP4-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257305.1		
KRT38	8687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39597173	39597173	+	Start_Codon_SNP	SNP	T	T	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr17:39597173T>C	ENST00000246646.3	-	1	0	c.1A>G	c.(1-3)Atg>Gtg	p.M1V		NM_006771.3	NP_006762.3	O76015	KRT38_HUMAN	keratin 38	1	Head.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	29		Breast(137;0.000496)				GAAGAGGTCATGGTGTTGGGC	0.567																																					p.M1V		.											.	KRT38	92	0			c.A1G						.						42.0	46.0	45.0					17																	39597173		2203	4299	6502	SO:0001582	initiator_codon_variant	8687	exon1			AGGTCATGGTGTT	Y16794	CCDS11392.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000171360	ENSG00000171360		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6456	protein-coding gene	gene with protein product		604542	"""keratin, hair, acidic, 8"""	KRTHA8		9756910, 16831889	Standard	NM_006771		Approved		uc002hwq.1	O76015	OTTHUMG00000133439	ENST00000246646.3:c.1A>G	17.37:g.39597173T>C	ENSP00000246646:p.Met1Val	198.0	0.0		153.0	118.0	NM_006771	A2RRM5|Q6A164	Missense_Mutation	SNP	ENST00000246646.3	37	CCDS11392.1	.	.	.	.	.	.	.	.	.	.	T	10.88	1.474766	0.26511	.	.	ENSG00000171360	ENST00000246646	T	0.81163	-1.46	4.2	3.08	0.35506	.	0.000000	0.48767	U	0.000180	T	0.68265	0.2982	.	.	.	.	.	.	P	0.38504	0.634	B	0.30572	0.117	T	0.73113	-0.4085	8	0.59425	D	0.04	.	8.0037	0.30313	0.1825:0.0:0.0:0.8175	.	1	O76015	KRT38_HUMAN	V	1	ENSP00000246646:M1V	ENSP00000246646:M1V	M	-	1	0	KRT38	36850699	1.000000	0.71417	0.701000	0.30321	0.344000	0.29017	1.304000	0.33482	0.625000	0.30304	0.528000	0.53228	ATG	.		0.567	KRT38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257307.2	NM_006771	Missense_Mutation
MAGEB18	286514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	X	26157856	26157856	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chrX:26157856A>T	ENST00000325250.1	+	2	941	c.754A>T	c.(754-756)Aag>Tag	p.K252*		NM_173699.3	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	252	Interaction with LNX1.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(17)|skin(2)|stomach(1)|urinary_tract(2)	33						GGTGCAGCTAAAGTACCTGGA	0.478																																					p.K252X		.											.	MAGEB18	130	0			c.A754T						.						75.0	66.0	69.0					X																	26157856		2202	4300	6502	SO:0001587	stop_gained	286514	exon2			CAGCTAAAGTACC	AK057361	CCDS14216.1	Xp21.3	2008-02-05			ENSG00000176774	ENSG00000176774			28515	protein-coding gene	gene with protein product							Standard	NM_173699		Approved	MGC33889	uc004dbq.2	Q96M61	OTTHUMG00000021282	ENST00000325250.1:c.754A>T	X.37:g.26157856A>T	ENSP00000314543:p.Lys252*	245.0	0.0		251.0	79.0	NM_173699		Nonsense_Mutation	SNP	ENST00000325250.1	37	CCDS14216.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.655368	0.88056	.	.	ENSG00000176774	ENST00000325250	.	.	.	4.56	2.12	0.27331	.	0.218142	0.46442	D	0.000281	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.9674	0.09437	0.6776:0.2115:0.1109:0.0	.	.	.	.	X	252	.	ENSP00000314543:K252X	K	+	1	0	MAGEB18	26067777	0.512000	0.26186	0.007000	0.13788	0.631000	0.37964	1.631000	0.37092	0.326000	0.23384	0.486000	0.48141	AAG	.		0.478	MAGEB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056120.1	NM_173699	
MAGEC3	139081	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	140983104	140983104	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chrX:140983104T>C	ENST00000298296.1	+	5	959	c.959T>C	c.(958-960)cTg>cCg	p.L320P	MAGEC3_ENST00000443323.2_Intron|MAGEC3_ENST00000483584.1_3'UTR|MAGEC3_ENST00000536088.1_Intron|MAGEC3_ENST00000409007.1_5'Flank|MAGEC3_ENST00000448920.1_Missense_Mutation_p.L72P|MAGEC3_ENST00000544766.1_5'UTR	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	320	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					CGACTTGCACTGTGGGAGTCT	0.592																																					p.L320P		.											.	MAGEC3	555	0			c.T959C						.						123.0	112.0	116.0					X																	140983104		2203	4300	6503	SO:0001583	missense	139081	exon5			TTGCACTGTGGGA	AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.959T>C	X.37:g.140983104T>C	ENSP00000298296:p.Leu320Pro	329.0	1.0		337.0	132.0	NM_138702	Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	ENST00000298296.1	37	CCDS14676.1	.	.	.	.	.	.	.	.	.	.	N	0.095	-1.160694	0.01686	.	.	ENSG00000165509	ENST00000298296;ENST00000448920	T;T	0.48522	3.59;0.81	0.688	-1.38	0.09027	.	.	.	.	.	T	0.20740	0.0499	N	0.03608	-0.345	0.19300	N	0.999976	B	0.09022	0.002	B	0.01281	0.0	T	0.16070	-1.0415	8	0.87932	D	0	.	.	.	.	.	320	Q8TD91	MAGC3_HUMAN	P	320;72	ENSP00000298296:L320P;ENSP00000395092:L72P	ENSP00000298296:L320P	L	+	2	0	MAGEC3	140810770	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.873000	0.01637	-0.401000	0.07644	-0.632000	0.03989	CTG	.		0.592	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	NM_138702	
MAK	4117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	10818123	10818123	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr6:10818123C>A	ENST00000313243.2	-	4	620	c.238G>T	c.(238-240)Gaa>Taa	p.E80*	MAK_ENST00000474039.1_Nonsense_Mutation_p.E80*|SYCP2L_ENST00000543878.1_Intron|MAK_ENST00000536370.1_Nonsense_Mutation_p.E80*|MAK_ENST00000354489.2_Nonsense_Mutation_p.E80*|RP11-637O19.3_ENST00000480294.1_Intron|MAK_ENST00000538030.1_Nonsense_Mutation_p.E80*			P20794	MAK_HUMAN	male germ cell-associated kinase	80	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|photoreceptor cell maintenance (GO:0045494)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)	22	Breast(50;0.107)|Ovarian(93;0.107)	all_hematologic(90;0.117)				TTCATATATTCAAATATAAAA	0.274																																					p.E80X		.											.	MAK	335	0			c.G238T						.						24.0	27.0	26.0					6																	10818123		2173	4260	6433	SO:0001587	stop_gained	4117	exon4			TATATTCAAATAT		CCDS4516.1, CCDS75398.1, CCDS75399.1	6p24.2	2014-01-28			ENSG00000111837	ENSG00000111837			6816	protein-coding gene	gene with protein product		154235				16951154	Standard	NM_005906		Approved	dJ417M14.2, RP62	uc021ylk.1	P20794	OTTHUMG00000014247	ENST00000313243.2:c.238G>T	6.37:g.10818123C>A	ENSP00000313021:p.Glu80*	139.0	0.0		150.0	54.0	NM_005906	F1T0K6|G1FL29|Q547D0|Q9NUH7	Nonsense_Mutation	SNP	ENST00000313243.2	37	CCDS4516.1	.	.	.	.	.	.	.	.	.	.	C	38	7.207121	0.98136	.	.	ENSG00000111837	ENST00000313243;ENST00000354489;ENST00000538030;ENST00000536370	.	.	.	5.75	4.88	0.63580	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.1843	0.72986	0.0:0.9315:0.0:0.0685	.	.	.	.	X	80	.	ENSP00000313021:E80X	E	-	1	0	MAK	10926109	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.893000	0.69798	2.716000	0.92895	0.655000	0.94253	GAA	.		0.274	MAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039841.1	NM_005906	
MAMDC4	158056	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	139749459	139749459	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr9:139749459C>T	ENST00000317446.2	+	10	1144	c.1094C>T	c.(1093-1095)cCc>cTc	p.P365L	MAMDC4_ENST00000445819.1_Missense_Mutation_p.P365L|MAMDC4_ENST00000485732.1_3'UTR	NM_206920.2	NP_996803.2			MAM domain containing 4											breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	19	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		ACTCTggggcccggcgccccc	0.692																																					p.P365L		.											.	MAMDC4	156	0			c.C1094T						.						13.0	16.0	15.0					9																	139749459		2174	4271	6445	SO:0001583	missense	158056	exon10			TGGGGCCCGGCGC	AL834531	CCDS7010.1	9q34.3	2013-10-21			ENSG00000177943	ENSG00000177943			24083	protein-coding gene	gene with protein product	"""apical early endosomal glycoprotein precursor"", ""endotubin"""					7829488	Standard	NM_206920		Approved	AEGP, DKFZp434M1411	uc004cjs.3	Q6UXC1	OTTHUMG00000020951	ENST00000317446.2:c.1094C>T	9.37:g.139749459C>T	ENSP00000319388:p.Pro365Leu	42.0	0.0		74.0	37.0	NM_206920		Missense_Mutation	SNP	ENST00000317446.2	37	CCDS7010.1	.	.	.	.	.	.	.	.	.	.	.	2.063	-0.414851	0.04766	.	.	ENSG00000177943	ENST00000317446;ENST00000445819	T;T	0.02015	4.5;4.5	4.65	3.73	0.42828	.	0.379178	0.22542	N	0.058715	T	0.01940	0.0061	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.46527	-0.9185	10	0.26408	T	0.33	-6.3944	6.7173	0.23310	0.0:0.7777:0.0:0.2223	.	365	Q6UXC1-2	.	L	365	ENSP00000319388:P365L;ENSP00000411339:P365L	ENSP00000319388:P365L	P	+	2	0	MAMDC4	138869280	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.039000	0.12124	0.930000	0.37217	0.561000	0.74099	CCC	.		0.692	MAMDC4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254642.3	NM_206920	
MED18	54797	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	28657195	28657195	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr1:28657195A>G	ENST00000373842.4	+	2	231	c.22A>G	c.(22-24)Atg>Gtg	p.M8V	MED18_ENST00000479574.1_3'UTR|MED18_ENST00000398997.2_Missense_Mutation_p.M8V	NM_001127350.1|NM_017638.2	NP_001120822.1|NP_060108.2	Q9BUE0	MED18_HUMAN	mediator complex subunit 18	8						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7		Colorectal(325;0.000147)|Lung NSC(340;0.000818)|all_lung(284;0.000996)|Renal(390;0.00357)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0557)|Ovarian(437;0.113)		OV - Ovarian serous cystadenocarcinoma(117;2.36e-22)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0141)|READ - Rectum adenocarcinoma(331;0.0649)		TCCAGTCACCATGATGCCTGT	0.493																																					p.M8V		.											.	MED18	226	0			c.A22G						.						142.0	120.0	128.0					1																	28657195		2203	4300	6503	SO:0001583	missense	54797	exon2			GTCACCATGATGC	BC002694	CCDS322.1	1p35.3	2007-07-30	2007-07-30		ENSG00000130772	ENSG00000130772			25944	protein-coding gene	gene with protein product		612384	"""mediator of RNA polymerase II transcription, subunit 18 homolog (S. cerevisiae)"""			15175163	Standard	NM_001127350		Approved	FLJ20045, p28b	uc009vtg.3	Q9BUE0	OTTHUMG00000003537	ENST00000373842.4:c.22A>G	1.37:g.28657195A>G	ENSP00000362948:p.Met8Val	159.0	0.0		137.0	113.0	NM_017638	D3DPM1|Q9NXU9	Missense_Mutation	SNP	ENST00000373842.4	37	CCDS322.1	.	.	.	.	.	.	.	.	.	.	A	10.59	1.392142	0.25118	.	.	ENSG00000130772	ENST00000373842;ENST00000398997	.	.	.	5.45	5.45	0.79879	.	0.098154	0.64402	D	0.000001	T	0.15176	0.0366	N	0.02011	-0.69	0.24283	N	0.995197	B	0.02656	0.0	B	0.01281	0.0	T	0.12192	-1.0557	9	0.12103	T	0.63	-20.0887	14.4943	0.67674	1.0:0.0:0.0:0.0	.	8	Q9BUE0	MED18_HUMAN	V	8	.	ENSP00000362948:M8V	M	+	1	0	MED18	28529782	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.062000	0.71155	2.072000	0.62099	0.533000	0.62120	ATG	.		0.493	MED18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009856.1	NM_017638	
STRBP	55342	ucsc.edu;mdanderson.org	37	9	125873077	125873077	+	Intron	SNP	A	A	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr9:125873077A>C	ENST00000530364.1	-	2	31				MIR600HG_ENST00000385007.1_RNA			Q96SI9	STRBP_HUMAN	spermatid perinuclear RNA binding protein						cellular component movement (GO:0006928)|mechanosensory behavior (GO:0007638)|multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(6)|prostate(1)|skin(2)	26						TCTAAAAATGAGCCCTCCTCC	0.542																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	81571	.			AAAATGAGCCCTC	AK002169	CCDS6851.1, CCDS55337.1	9q33.1-q33.3	2008-08-29	2001-11-28		ENSG00000165209	ENSG00000165209			16462	protein-coding gene	gene with protein product		611138	"""spermatid perinuclear RNA-binding protein"", ""interleukin enhancer binding factor 3-like"""	ILF3L			Standard	NM_018387		Approved	FLJ11307, SPNR	uc004bns.3	Q96SI9	OTTHUMG00000020636	ENST00000530364.1:c.255-1045T>G	9.37:g.125873077A>C		93.0	0.0		111.0	45.0	.	Q32NB9|Q9BUE1|Q9BXG4|Q9H0B4|Q9H7V1|Q9NUK4	RNA	SNP	ENST00000530364.1	37																																																																																				.		0.542	STRBP-009	PUTATIVE	basic	processed_transcript	protein_coding	OTTHUMT00000392598.1		
MSANTD1	345222	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	3251094	3251094	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr4:3251094G>T	ENST00000438480.2	+	1	1892	c.145G>T	c.(145-147)Gcc>Tcc	p.A49S	MSANTD1_ENST00000507492.1_Missense_Mutation_p.A36S|MSANTD1_ENST00000510580.1_Missense_Mutation_p.A49S	NM_001042690.1	NP_001036155.1	Q6ZTZ1	MSD1_HUMAN	Myb/SANT-like DNA-binding domain containing 1	49	Myb-like.									endometrium(1)|lung(2)	3						CTGGACGGACGCCGAGATGCG	0.682																																					p.A49S		.											.	.	.	0			c.G145T						.						19.0	20.0	20.0					4																	3251094		2162	4263	6425	SO:0001583	missense	345222	exon1			ACGGACGCCGAGA		CCDS47003.1	4p16.2	2012-03-02	2012-03-02	2012-03-02	ENSG00000188981	ENSG00000188981			33741	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 44"""	C4orf44			Standard	NM_001042690		Approved	LOC345222	uc003ggs.3	Q6ZTZ1	OTTHUMG00000159977	ENST00000438480.2:c.145G>T	4.37:g.3251094G>T	ENSP00000411584:p.Ala49Ser	66.0	0.0		90.0	29.0	NM_001042690	C9J6V0	Missense_Mutation	SNP	ENST00000438480.2	37	CCDS47003.1	.	.	.	.	.	.	.	.	.	.	G	16.99	3.273875	0.59649	.	.	ENSG00000188981	ENST00000507492;ENST00000438480;ENST00000510580	T;T;T	0.42900	0.96;0.96;0.96	4.68	4.68	0.58851	.	0.362337	0.26220	N	0.025629	T	0.26268	0.0641	N	0.03324	-0.35	0.38826	D	0.955738	P;P	0.35242	0.492;0.492	B;B	0.41174	0.349;0.24	T	0.20974	-1.0259	10	0.16896	T	0.51	.	16.5959	0.84796	0.0:0.0:1.0:0.0	.	49;49	D6RD98;Q6ZTZ1	.;CD044_HUMAN	S	36;49;49	ENSP00000423547:A36S;ENSP00000411584:A49S;ENSP00000420966:A49S	ENSP00000411584:A49S	A	+	1	0	C4orf44	3220892	1.000000	0.71417	0.388000	0.26195	0.965000	0.64279	4.970000	0.63742	2.140000	0.66376	0.591000	0.81541	GCC	.		0.682	MSANTD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370924.1	NM_001012982	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9065780	9065780	+	Silent	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr19:9065780A>T	ENST00000397910.4	-	3	21869	c.21666T>A	c.(21664-21666)acT>acA	p.T7222T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7224	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATATGGCAACAGTTGTATCCT	0.488																																					p.T7222T		.											.	MUC16	566	0			c.T21666A						.						217.0	206.0	209.0					19																	9065780		2037	4184	6221	SO:0001819	synonymous_variant	94025	exon3			GGCAACAGTTGTA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.21666T>A	19.37:g.9065780A>T		270.0	1.0		153.0	106.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																			.		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MYO10	4651	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	16761637	16761637	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr5:16761637C>A	ENST00000513610.1	-	17	2129	c.1675G>T	c.(1675-1677)Ggt>Tgt	p.G559C		NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	559	Myosin motor.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						TCCAAGATACCTCGGACATCA	0.393																																					p.G559C		.											.	MYO10	3	0			c.G1675T						.						99.0	96.0	97.0					5																	16761637		1841	4092	5933	SO:0001583	missense	4651	exon17			AGATACCTCGGAC	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.1675G>T	5.37:g.16761637C>A	ENSP00000421280:p.Gly559Cys	59.0	0.0		53.0	29.0	NM_012334	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	ENST00000513610.1	37	CCDS54834.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.896607	0.91962	.	.	ENSG00000145555	ENST00000513610;ENST00000513882	T;T	0.76060	-0.99;-0.99	5.82	5.82	0.92795	Myosin head, motor domain (2);	.	.	.	.	D	0.92681	0.7674	H	0.98936	4.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.95040	0.8177	9	0.87932	D	0	.	20.1143	0.97922	0.0:1.0:0.0:0.0	.	200;559	Q69YP8;Q9HD67	.;MYO10_HUMAN	C	559;570	ENSP00000421280:G559C;ENSP00000421309:G570C	ENSP00000421280:G559C	G	-	1	0	MYO10	16814637	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.763000	0.85283	2.765000	0.95021	0.650000	0.86243	GGT	.		0.393	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334	
MYO5A	4644	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	52622690	52622690	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr15:52622690T>A	ENST00000399231.3	-	34	4583	c.4340A>T	c.(4339-4341)cAg>cTg	p.Q1447L	MYO5A_ENST00000399233.2_Missense_Mutation_p.Q1444L|MYO5A_ENST00000356338.6_Missense_Mutation_p.Q1420L|MYO5A_ENST00000358212.6_Missense_Mutation_p.Q1472L|MYO5A_ENST00000553916.1_Missense_Mutation_p.Q1445L	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	1447					actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		GTTCTCCATCTGGCCCACTTT	0.403																																					p.Q1447L		.											.	MYO5A	93	0			c.A4340T						.						129.0	116.0	120.0					15																	52622690		1840	4075	5915	SO:0001583	missense	4644	exon34			TCCATCTGGCCCA		CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.4340A>T	15.37:g.52622690T>A	ENSP00000382177:p.Gln1447Leu	192.0	0.0		154.0	101.0	NM_000259	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	ENST00000399231.3	37	CCDS42037.1	.	.	.	.	.	.	.	.	.	.	T	19.16	3.773455	0.69992	.	.	ENSG00000197535	ENST00000399231;ENST00000399229;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	T;T;T;T;T	0.20738	2.05;2.05;2.05;2.05;2.05	5.45	5.45	0.79879	.	0.842110	0.10855	N	0.626743	T	0.15132	0.0365	L	0.27053	0.805	0.80722	D	1	B;B;P	0.43352	0.006;0.005;0.804	B;B;B	0.33392	0.013;0.003;0.163	T	0.16630	-1.0396	10	0.24483	T	0.36	.	15.5017	0.75703	0.0:0.0:0.0:1.0	.	177;1447;1420	B5LY56;Q9Y4I1;Q9Y4I1-2	.;MYO5A_HUMAN;.	L	1447;954;1444;1420;1472;1050;1445	ENSP00000382177:Q1447L;ENSP00000382179:Q1444L;ENSP00000348693:Q1420L;ENSP00000350945:Q1472L;ENSP00000451109:Q1445L	ENSP00000348693:Q1420L	Q	-	2	0	MYO5A	50409982	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.841000	0.48223	2.068000	0.61886	0.455000	0.32223	CAG	.		0.403	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259	
MYRF	745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	61547380	61547380	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr11:61547380C>G	ENST00000278836.5	+	17	2410	c.2314C>G	c.(2314-2316)Ctg>Gtg	p.L772V	MYRF_ENST00000327797.1_Missense_Mutation_p.L418V|MYRF_ENST00000389602.4_Missense_Mutation_p.L163V|TMEM258_ENST00000535042.1_Intron|MYRF_ENST00000265460.5_Missense_Mutation_p.L763V	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor	772					central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CATCATTGCCCTGGTGGTGGT	0.597																																					p.L772V		.											.	.	.	0			c.C2314G						.						87.0	83.0	84.0					11																	61547380		2202	4299	6501	SO:0001583	missense	745	exon17			ATTGCCCTGGTGG		CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.2314C>G	11.37:g.61547380C>G	ENSP00000278836:p.Leu772Val	296.0	0.0		270.0	129.0	NM_001127392	O43582|Q9P1Q6	Missense_Mutation	SNP	ENST00000278836.5	37	CCDS44622.1	.	.	.	.	.	.	.	.	.	.	C	16.50	3.140041	0.56936	.	.	ENSG00000124920	ENST00000278836;ENST00000265460;ENST00000327797;ENST00000389602	T;T;T;T	0.58940	0.58;0.53;0.3;0.3	5.23	5.23	0.72850	.	0.181349	0.38111	N	0.001816	T	0.73481	0.3592	M	0.80616	2.505	0.58432	D	0.999992	D;D;P	0.71674	0.998;0.965;0.908	D;P;P	0.65773	0.938;0.837;0.656	T	0.76767	-0.2838	10	0.87932	D	0	-19.1061	10.5217	0.44922	0.0:0.8656:0.0:0.1344	.	163;763;772	B4DHB2;Q9Y2G1-2;Q9Y2G1	.;.;MRF_HUMAN	V	772;763;418;163	ENSP00000278836:L772V;ENSP00000265460:L763V;ENSP00000333261:L418V;ENSP00000374253:L163V	ENSP00000265460:L763V	L	+	1	2	C11orf9	61303956	0.966000	0.33281	1.000000	0.80357	0.993000	0.82548	1.787000	0.38704	2.610000	0.88304	0.563000	0.77884	CTG	.		0.597	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398519.2	NM_013279	
NCAM1	4684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	113078628	113078628	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr11:113078628A>G	ENST00000533760.1	+	7	1065	c.466A>G	c.(466-468)Atc>Gtc	p.I156V	NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000316851.7_Missense_Mutation_p.I264V|NCAM1_ENST00000401611.2_Missense_Mutation_p.I273V	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	274	Ig-like C2-type 2.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		CCAGCTGACCATCAAAAAGGT	0.488																																					p.I274V		.											.	NCAM1	23	0			c.A820G						.						71.0	71.0	71.0					11																	113078628		2037	4204	6241	SO:0001583	missense	4684	exon8			CTGACCATCAAAA		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.466A>G	11.37:g.113078628A>G	ENSP00000473281:p.Ile156Val	75.0	0.0		95.0	37.0	NM_001242608	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	ENST00000533760.1	37		.	.	.	.	.	.	.	.	.	.	A	9.363	1.068409	0.20067	.	.	ENSG00000149294	ENST00000531044;ENST00000401611;ENST00000316851	T;T	0.77750	-1.12;-1.12	5.71	4.57	0.56435	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.085585	0.85682	D	0.000000	T	0.70002	0.3174	.	.	.	0.80722	D	1	B;B;B;B;B	0.27286	0.136;0.122;0.087;0.133;0.174	B;B;B;B;B	0.34385	0.102;0.058;0.096;0.132;0.181	T	0.62358	-0.6871	9	0.22109	T	0.4	-10.0213	12.1467	0.54028	0.8716:0.0:0.0:0.1284	.	274;274;274;274;274	P13591-5;P13591-1;P13591;P13591-3;P13591-6	.;.;NCAM1_HUMAN;.;.	V	156;273;264	ENSP00000384055:I273V;ENSP00000318472:I264V	ENSP00000318472:I264V	I	+	1	0	NCAM1	112583838	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.979000	0.76154	0.970000	0.38263	0.533000	0.62120	ATC	.		0.488	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615	
NEB	4703	broad.mit.edu;bcgsc.ca	37	2	152418677	152418677	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr2:152418677A>C	ENST00000172853.10	-	93	13987	c.13840T>G	c.(13840-13842)Tgg>Ggg	p.W4614G	NEB_ENST00000603639.1_Missense_Mutation_p.W6315G|NEB_ENST00000409198.1_Missense_Mutation_p.W4614G|NEB_ENST00000604864.1_Missense_Mutation_p.W6315G|NEB_ENST00000397345.3_Missense_Mutation_p.W6315G|NEB_ENST00000427231.2_Missense_Mutation_p.W6315G			P20929	NEBU_HUMAN	nebulin	4614					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GGTGTATCCCAAACGTAGCAA	0.428																																					p.W6315G		.											.	NEB	145	0			c.T18943G						.						253.0	237.0	242.0					2																	152418677		1924	4123	6047	SO:0001583	missense	4703	exon121			TATCCCAAACGTA	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.13840T>G	2.37:g.152418677A>C	ENSP00000172853:p.Trp4614Gly	81.0	0.0		90.0	7.0	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	A	23.4	4.409684	0.83340	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853	T;T;T;T;T	0.21031	2.26;2.03;2.03;2.31;2.26	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.47655	0.1457	M	0.76002	2.32	0.80722	D	1	D;D	0.76494	0.999;0.985	D;D	0.87578	0.998;0.978	T	0.40776	-0.9545	10	0.41790	T	0.15	.	16.1616	0.81721	1.0:0.0:0.0:0.0	.	4614;1045	P20929;Q14215	NEBU_HUMAN;.	G	4614;6315;6315;663;1045;4614	ENSP00000386259:W4614G;ENSP00000380505:W6315G;ENSP00000416578:W6315G;ENSP00000410961:W1045G;ENSP00000172853:W4614G	ENSP00000172853:W4614G	W	-	1	0	NEB	152126923	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.339000	0.96797	2.221000	0.72209	0.454000	0.30748	TGG	.		0.428	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
NEB	4703	broad.mit.edu;bcgsc.ca	37	2	152502668	152502668	+	Silent	SNP	T	T	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr2:152502668T>C	ENST00000172853.10	-	55	7659	c.7512A>G	c.(7510-7512)aaA>aaG	p.K2504K	NEB_ENST00000603639.1_Silent_p.K2504K|NEB_ENST00000409198.1_Silent_p.K2504K|NEB_ENST00000604864.1_Silent_p.K2504K|NEB_ENST00000397345.3_Silent_p.K2504K|NEB_ENST00000427231.2_Silent_p.K2504K			P20929	NEBU_HUMAN	nebulin	2504					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTAAGTTTGCTTTAGCCAGAA	0.328																																					p.K2504K		.											.	NEB	145	0			c.A7512G						.						93.0	86.0	88.0					2																	152502668		1863	4125	5988	SO:0001819	synonymous_variant	4703	exon55			GTTTGCTTTAGCC	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.7512A>G	2.37:g.152502668T>C		106.0	0.0		136.0	6.0	NM_004543	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37																																																																																				.		0.328	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
NET1	10276	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	5494450	5494450	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr10:5494450A>G	ENST00000355029.4	+	5	635	c.493A>G	c.(493-495)Aag>Gag	p.K165E	NET1_ENST00000542715.1_5'UTR|NET1_ENST00000380359.3_Missense_Mutation_p.K111E	NM_001047160.2	NP_001040625.1	Q7Z628	ARHG8_HUMAN	neuroepithelial cell transforming 1	165					apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|myoblast migration (GO:0051451)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|kidney(2)|large_intestine(9)|lung(5)|prostate(2)|skin(1)	23						CATCACCATGAAGGAGTCTCT	0.527																																					p.K165E		.											.	NET1	290	0			c.A493G						.						97.0	84.0	89.0					10																	5494450		2203	4300	6503	SO:0001583	missense	10276	exon5			ACCATGAAGGAGT	AJ010046	CCDS7067.1, CCDS41483.1	10p15	2013-01-10	2008-09-12		ENSG00000173848	ENSG00000173848		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14592	protein-coding gene	gene with protein product		606450				8649828	Standard	NR_073040		Approved	ARHGEF8, NET1A	uc001iia.4	Q7Z628	OTTHUMG00000017596	ENST00000355029.4:c.493A>G	10.37:g.5494450A>G	ENSP00000347134:p.Lys165Glu	109.0	0.0		146.0	8.0	NM_001047160	Q12773|Q96D82|Q99903|Q9UEN6	Missense_Mutation	SNP	ENST00000355029.4	37	CCDS41483.1	.	.	.	.	.	.	.	.	.	.	A	12.03	1.816307	0.32145	.	.	ENSG00000173848	ENST00000355029;ENST00000380359	T;T	0.67523	-0.27;-0.27	5.54	5.54	0.83059	Dbl homology (DH) domain (1);	0.000000	0.43919	D	0.000520	T	0.63283	0.2498	M	0.65498	2.005	0.80722	D	1	B;B	0.25521	0.128;0.066	B;B	0.24394	0.053;0.053	T	0.59747	-0.7396	10	0.15499	T	0.54	-29.0071	14.5067	0.67758	1.0:0.0:0.0:0.0	.	111;165	Q5SQI7;Q7Z628	.;ARHG8_HUMAN	E	165;111	ENSP00000347134:K165E;ENSP00000369717:K111E	ENSP00000347134:K165E	K	+	1	0	NET1	5484450	1.000000	0.71417	0.999000	0.59377	0.211000	0.24417	7.306000	0.78905	2.093000	0.63338	0.533000	0.62120	AAG	.		0.527	NET1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000046553.3	NM_005863	
NSDHL	50814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	152018893	152018893	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chrX:152018893A>G	ENST00000370274.3	+	3	387	c.193A>G	c.(193-195)Aat>Gat	p.N65D	NSDHL_ENST00000440023.1_Missense_Mutation_p.N65D	NM_015922.2	NP_057006.1	Q15738	NSDHL_HUMAN	NAD(P) dependent steroid dehydrogenase-like	65					cholesterol biosynthetic process (GO:0006695)|hair follicle development (GO:0001942)|labyrinthine layer blood vessel development (GO:0060716)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|sterol-4-alpha-carboxylate 3-dehydrogenase (decarboxylating) activity (GO:0047012)			NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(5)	15	Acute lymphoblastic leukemia(192;6.56e-05)					ATATGCTGTCAATGTATTTGA	0.527																																					p.N65D		.											.	NSDHL	130	0			c.A193G						.						237.0	215.0	223.0					X																	152018893		2203	4300	6503	SO:0001583	missense	50814	exon3			GCTGTCAATGTAT	X96621	CCDS14717.1	Xq28	2011-09-14			ENSG00000147383	ENSG00000147383	1.1.1.170	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	13398	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 31E, member 1"""	300275				10710235, 12837764, 19027726	Standard	NM_015922		Approved	XAP104, H105e3, SDR31E1	uc004fgs.1	Q15738	OTTHUMG00000024185	ENST00000370274.3:c.193A>G	X.37:g.152018893A>G	ENSP00000359297:p.Asn65Asp	240.0	0.0		229.0	102.0	NM_015922	D3DWT6|O00344	Missense_Mutation	SNP	ENST00000370274.3	37	CCDS14717.1	.	.	.	.	.	.	.	.	.	.	a	14.18	2.458422	0.43634	.	.	ENSG00000147383	ENST00000370274;ENST00000440023;ENST00000432467	D;D;D	0.84223	-1.82;-1.82;-1.82	5.51	5.51	0.81932	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.141053	0.64402	D	0.000008	D	0.87051	0.6081	L	0.57536	1.79	0.41478	D	0.988143	D	0.55172	0.97	P	0.53401	0.725	D	0.86723	0.1943	10	0.40728	T	0.16	1.7125	12.4744	0.55805	1.0:0.0:0.0:0.0	.	65	Q15738	NSDHL_HUMAN	D	65	ENSP00000359297:N65D;ENSP00000391854:N65D;ENSP00000396266:N65D	ENSP00000359297:N65D	N	+	1	0	NSDHL	151769549	1.000000	0.71417	0.805000	0.32314	0.414000	0.31173	4.393000	0.59665	1.852000	0.53769	0.433000	0.28618	AAT	.		0.527	NSDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060927.1	NM_015922	
OR9G1	390174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	56468094	56468094	+	Silent	SNP	C	C	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr11:56468094C>A	ENST00000312153.1	+	1	231	c.231C>A	c.(229-231)acC>acA	p.T77T		NM_001005213.1	NP_001005213.1	Q8NH87	OR9G1_HUMAN	olfactory receptor, family 9, subfamily G, member 1	77						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|lung(25)|stomach(2)|upper_aerodigestive_tract(1)	31						CTGTCTACACCCCAAAGATCC	0.468																																					p.T77T		.											.	.	.	0			c.C231A						.						146.0	136.0	139.0					11																	56468094		2201	4296	6497	SO:0001819	synonymous_variant	504191	exon1			CTACACCCCAAAG	AB065500	CCDS31536.1	11q11	2012-08-09			ENSG00000174914	ENSG00000174914		"""GPCR / Class A : Olfactory receptors"""	15319	protein-coding gene	gene with protein product				OR9G5			Standard	NM_001005213		Approved			Q8NH87	OTTHUMG00000167112	ENST00000312153.1:c.231C>A	11.37:g.56468094C>A		199.0	0.0		234.0	53.0	NM_001013358	Q6IEU9|Q8NGQ0	Silent	SNP	ENST00000312153.1	37	CCDS31536.1																																																																																			.		0.468	OR9G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393253.1	NM_001005213	
OTOGL	283310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	80730730	80730730	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr12:80730730G>C	ENST00000547103.1	+	41	4749	c.4743G>C	c.(4741-4743)aaG>aaC	p.K1581N	OTOGL_ENST00000458043.2_Missense_Mutation_p.K1593N			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1581	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						GTTTTAAGAAGTTAAATGTGA	0.294																																					p.K1593N		.											.	.	.	0			c.G4779C						.						32.0	29.0	30.0					12																	80730730		1785	4042	5827	SO:0001583	missense	283310	exon41			TAAGAAGTTAAAT	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.4743G>C	12.37:g.80730730G>C	ENSP00000447211:p.Lys1581Asn	81.0	0.0		116.0	61.0	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.413|8.413	0.844612|0.844612	0.16963|0.16963	.|.	.|.	ENSG00000165899|ENSG00000165899	ENST00000547103;ENST00000458043|ENST00000298820	T;T|.	0.60171|.	0.21;0.21|.	4.92|4.92	3.05|3.05	0.35203|0.35203	.|.	.|.	.|.	.|.	.|.	T|T	0.52224|0.52224	0.1721|0.1721	M|M	0.65975|0.65975	2.015|2.015	0.27367|0.27367	N|N	0.955805|0.955805	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.44772|0.44772	-0.9306|-0.9306	7|5	0.17832|.	T|.	0.49|.	.|.	8.6387|8.6387	0.33964|0.33964	0.2833:0.0:0.7167:0.0|0.2833:0.0:0.7167:0.0	.|.	.|.	.|.	.|.	N|T	1581;1593|36	ENSP00000447211:K1581N;ENSP00000400895:K1593N|.	ENSP00000400895:K1593N|.	K|S	+|+	3|2	2|0	OTOGL|OTOGL	79254861|79254861	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.742000|0.742000	0.42306|0.42306	1.783000|1.783000	0.38664|0.38664	1.187000|1.187000	0.43000|0.43000	-0.218000|-0.218000	0.12543|0.12543	AAG|AGT	.		0.294	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
OXR1	55074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	107719001	107719001	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr8:107719001G>T	ENST00000442977.2	+	8	1354	c.1255G>T	c.(1255-1257)Gaa>Taa	p.E419*	OXR1_ENST00000517566.2_Nonsense_Mutation_p.E418*|OXR1_ENST00000445937.1_Nonsense_Mutation_p.E418*|OXR1_ENST00000452423.2_5'UTR|OXR1_ENST00000497705.1_Nonsense_Mutation_p.E351*|OXR1_ENST00000531443.1_Nonsense_Mutation_p.E418*|OXR1_ENST00000312046.6_Nonsense_Mutation_p.E411*	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	419					adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)			NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			AAATAATCTTGAAATGGCCAT	0.348																																					p.E419X		.											.	OXR1	68	0			c.G1255T						.						74.0	77.0	76.0					8																	107719001		2203	4300	6503	SO:0001587	stop_gained	55074	exon8			AATCTTGAAATGG	AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.1255G>T	8.37:g.107719001G>T	ENSP00000405424:p.Glu419*	80.0	0.0		177.0	19.0	NM_001198532	A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Nonsense_Mutation	SNP	ENST00000442977.2	37	CCDS56548.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.44|17.44	3.389482|3.389482	0.61956|0.61956	.|.	.|.	ENSG00000164830|ENSG00000164830	ENST00000445937;ENST00000531443;ENST00000517566;ENST00000442977;ENST00000497705;ENST00000312046|ENST00000519415	.|T	.|0.17213	.|2.29	5.76|5.76	4.89|4.89	0.63831|0.63831	.|.	0.726780|.	0.13942|.	N|.	0.352159|.	.|T	.|0.20780	.|0.0500	.|.	.|.	.|.	0.21697|0.21697	N|N	0.999584|0.999584	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.12811	.|-1.0533	.|6	0.52906|0.49607	T|T	0.07|0.09	-16.4775|-16.4775	9.0489|9.0489	0.36363|0.36363	0.137:0.1233:0.7396:0.0|0.137:0.1233:0.7396:0.0	.|.	.|.	.|.	.|.	X|F	418;418;418;419;351;411|131	.|ENSP00000430701:L131F	ENSP00000311026:E411X|ENSP00000430701:L131F	E|L	+|+	1|3	0|2	OXR1|OXR1	107788177|107788177	0.988000|0.988000	0.35896|0.35896	0.017000|0.017000	0.16124|0.16124	0.558000|0.558000	0.35554|0.35554	3.043000|3.043000	0.49823|0.49823	1.446000|1.446000	0.47643|0.47643	0.591000|0.591000	0.81541|0.81541	GAA|TTG	.		0.348	OXR1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_181354	
PAPD5	64282	broad.mit.edu;bcgsc.ca	37	16	50259196	50259196	+	Splice_Site	SNP	A	A	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr16:50259196A>G	ENST00000561678.1	+	9	1499	c.1425A>G	c.(1423-1425)gtA>gtG	p.V475V	PAPD5_ENST00000573002.1_3'UTR|PAPD5_ENST00000357464.3_Splice_Site_p.V506V|PAPD5_ENST00000436909.3_Splice_Site_p.V585V			Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5	459	Ser-rich.				histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)			endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		CTAGTGATGTAGTAAGTATGA	0.463																																					p.V585V		.											.	PAPD5	205	0			c.A1755G						.						95.0	93.0	94.0					16																	50259196		2017	4186	6203	SO:0001630	splice_region_variant	64282	exon11			TGATGTAGTAAGT	AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000561678.1:c.1425+1A>G	16.37:g.50259196A>G		99.0	2.0		121.0	45.0	NM_001040284	B4DV38|Q9NW67|Q9Y6C0	Silent	SNP	ENST00000561678.1	37																																																																																				.		0.463	PAPD5-002	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000423150.1	NM_022447	Silent
PCDH15	65217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	55996688	55996688	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr10:55996688C>A	ENST00000320301.6	-	9	1274	c.880G>T	c.(880-882)Gaa>Taa	p.E294*	PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395432.2_Nonsense_Mutation_p.E257*|PCDH15_ENST00000395442.1_Nonsense_Mutation_p.E294*|PCDH15_ENST00000414778.1_Nonsense_Mutation_p.E299*|PCDH15_ENST00000395430.1_Nonsense_Mutation_p.E294*|PCDH15_ENST00000395445.1_Nonsense_Mutation_p.E294*|PCDH15_ENST00000437009.1_Nonsense_Mutation_p.E294*|PCDH15_ENST00000395446.1_Nonsense_Mutation_p.E294*|PCDH15_ENST00000395440.1_Nonsense_Mutation_p.E294*|PCDH15_ENST00000373965.2_Nonsense_Mutation_p.E294*|PCDH15_ENST00000373955.1_Nonsense_Mutation_p.E294*|PCDH15_ENST00000395438.1_Nonsense_Mutation_p.E294*|PCDH15_ENST00000395433.1_Nonsense_Mutation_p.E272*|PCDH15_ENST00000361849.3_Nonsense_Mutation_p.E294*|PCDH15_ENST00000373957.3_Nonsense_Mutation_p.E272*	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	294	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GGGTTCAGTTCTTCCTGAAAA	0.398										HNSCC(58;0.16)																											p.E299X		.											.	PCDH15	193	0			c.G895T						.						142.0	138.0	140.0					10																	55996688		2203	4300	6503	SO:0001587	stop_gained	65217	exon10			TCAGTTCTTCCTG	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.880G>T	10.37:g.55996688C>A	ENSP00000322604:p.Glu294*	129.0	0.0		156.0	42.0	NM_001142763	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Nonsense_Mutation	SNP	ENST00000320301.6	37	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	40	8.166969	0.98686	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	.	.	.	5.19	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	.	9.0928	0.36621	0.0:0.7692:0.1483:0.0825	.	.	.	.	X	294;299;294;294;294;294;294;294;257;294;272;272;294;294;299;294;294	.	ENSP00000322604:E294X	E	-	1	0	PCDH15	55666694	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	3.046000	0.49846	1.189000	0.43028	0.650000	0.86243	GAA	.		0.398	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
PCDH9	5101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	13	67801363	67801363	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr13:67801363C>A	ENST00000377865.2	-	1	1344	c.1210G>T	c.(1210-1212)Gaa>Taa	p.E404*	PCDH9_ENST00000328454.5_Nonsense_Mutation_p.E404*|PCDH9_ENST00000377861.3_Nonsense_Mutation_p.E404*|PCDH9_ENST00000544246.1_Nonsense_Mutation_p.E404*|PCDH9_ENST00000456367.1_Nonsense_Mutation_p.E404*			Q9HC56	PCDH9_HUMAN	protocadherin 9	404	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		ACCTCTCTTTCAATAAAACAG	0.378																																					p.E404X		.											.	PCDH9	96	0			c.G1210T						.						91.0	88.0	89.0					13																	67801363		2203	4300	6503	SO:0001587	stop_gained	5101	exon2			CTCTTTCAATAAA	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.1210G>T	13.37:g.67801363C>A	ENSP00000367096:p.Glu404*	108.0	0.0		71.0	62.0	NM_203487	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Nonsense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.831922	0.91036	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	X	404	.	ENSP00000332060:E404X	E	-	1	0	PCDH9	66699364	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.920000	0.70017	2.941000	0.99782	0.655000	0.94253	GAA	.		0.378	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
PCF11	51585	hgsc.bcm.edu;bcgsc.ca	37	11	82879771	82879771	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr11:82879771delG	ENST00000298281.4	+	8	2846	c.2394delG	c.(2392-2394)atgfs	p.M798fs		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	798	Gly-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						CAGGACAAATGGGGGGAGGAG	0.522																																					p.M798fs		.											.	PCF11	23	0			c.2394delG						.						57.0	57.0	57.0					11																	82879771		1904	4105	6009	SO:0001589	frameshift_variant	51585	exon8			ACAAATGGGGGGA	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.2394delG	11.37:g.82879771delG	ENSP00000298281:p.Met798fs	80.0	0.0		117.0	16.0	NM_015885	A6H8W7|O43671|Q6P0X8	Frame_Shift_Del	DEL	ENST00000298281.4	37	CCDS44689.1																																																																																			.		0.522	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
PDE4DIP	9659	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	1	144923732	144923732	+	Silent	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr1:144923732T>A	ENST00000369354.3	-	6	915	c.726A>T	c.(724-726)gcA>gcT	p.A242A	PDE4DIP_ENST00000530740.1_Silent_p.A379A|PDE4DIP_ENST00000369356.4_Silent_p.A242A|PDE4DIP_ENST00000369351.3_Silent_p.A242A|PDE4DIP_ENST00000313382.9_Silent_p.A308A|PDE4DIP_ENST00000479408.2_Silent_p.A29A|PDE4DIP_ENST00000369349.3_Silent_p.A242A|PDE4DIP_ENST00000369359.4_Silent_p.A379A|PDE4DIP_ENST00000313431.9_Silent_p.A405A|PDE4DIP_ENST00000529945.1_Silent_p.A405A			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	242					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CCTGGAGTTCTGCCAAGTGGG	0.443			T	PDGFRB	MPD																																p.A405A		.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	663	0			c.A1215T						.						368.0	330.0	343.0					1																	144923732		2203	4300	6503	SO:0001819	synonymous_variant	9659	exon2			GAGTTCTGCCAAG	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.726A>T	1.37:g.144923732T>A		410.0	0.0		448.0	125.0	NM_001002811	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Silent	SNP	ENST00000369354.3	37	CCDS30824.1																																																																																			.		0.443	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
PEPD	5184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	34001941	34001941	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr19:34001941T>A	ENST00000244137.7	-	3	355	c.322A>T	c.(322-324)Atg>Ttg	p.M108L	PEPD_ENST00000436370.3_Intron|PEPD_ENST00000397032.4_Missense_Mutation_p.M108L	NM_000285.3	NP_000276.2	P12955	PEPD_HUMAN	peptidase D	108				M -> I (in Ref. 3; BAF83445). {ECO:0000305}.	cellular amino acid metabolic process (GO:0006520)|collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)	aminopeptidase activity (GO:0004177)|dipeptidase activity (GO:0016805)|manganese ion binding (GO:0030145)|metallocarboxypeptidase activity (GO:0004181)			endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	17	Esophageal squamous(110;0.137)					TACTTTCCCATCCAGGTGGCA	0.617																																					p.M108L		.											.	PEPD	92	0			c.A322T						.						34.0	37.0	36.0					19																	34001941		2015	4172	6187	SO:0001583	missense	5184	exon3			TTCCCATCCAGGT	BC015027	CCDS42544.1, CCDS54244.1, CCDS54245.1	19q13.11	2008-02-05				ENSG00000124299	3.4.13.9		8840	protein-coding gene	gene with protein product	"""prolidase"""	613230				2925654, 1972707	Standard	NM_000285		Approved		uc002nur.4	P12955		ENST00000244137.7:c.322A>T	19.37:g.34001941T>A	ENSP00000244137:p.Met108Leu	64.0	0.0		88.0	30.0	NM_000285	A8K3Z1|A8K416|A8K696|A8MX47|B4DDB7|B4DGJ1|E9PCE8|Q8TBN9|Q9BT75	Missense_Mutation	SNP	ENST00000244137.7	37	CCDS42544.1	.	.	.	.	.	.	.	.	.	.	T	14.87	2.664193	0.47572	.	.	ENSG00000124299	ENST00000244137;ENST00000397032	T;T	0.75821	-0.97;-0.97	4.9	4.9	0.64082	Peptidase M24B, X-Pro dipeptidase/aminopeptidase P N-terminal (1);	0.037944	0.85682	D	0.000000	T	0.68742	0.3034	L	0.46741	1.465	0.80722	D	1	B;B	0.17852	0.024;0.004	B;B	0.26969	0.075;0.011	T	0.64495	-0.6394	10	0.30078	T	0.28	-41.6574	13.6423	0.62257	0.0:0.0:0.0:1.0	.	108;108	A8MX47;P12955	.;PEPD_HUMAN	L	108	ENSP00000244137:M108L;ENSP00000380226:M108L	ENSP00000244137:M108L	M	-	1	0	PEPD	38693781	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.482000	0.66833	1.971000	0.57363	0.397000	0.26171	ATG	.		0.617	PEPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451432.3	NM_000285	
PGLYRP4	57115	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	153318651	153318651	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr1:153318651G>T	ENST00000359650.5	-	3	130	c.66C>A	c.(64-66)aaC>aaA	p.N22K	PGLYRP4_ENST00000490266.1_5'UTR|PGLYRP4_ENST00000368739.3_Missense_Mutation_p.N22K	NM_020393.2	NP_065126.2	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein 4	22					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)	p.N22K(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	23	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTTGTGTTTTGTTCCAGGAGG	0.473																																					p.N22K		.											.	PGLYRP4	94	1	Substitution - Missense(1)	breast(1)	c.C66A						.						238.0	237.0	237.0					1																	153318651		2203	4300	6503	SO:0001583	missense	57115	exon3			TGTTTTGTTCCAG	AF242518	CCDS30871.1	1q21	2008-02-05			ENSG00000163218	ENSG00000163218			30015	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I beta precursor"""	608198				11461926	Standard	XR_241090		Approved	SBBI67, PGRPIB, PGLYRPIbeta, PGRP-Ibeta	uc001fbo.3	Q96LB8	OTTHUMG00000037057	ENST00000359650.5:c.66C>A	1.37:g.153318651G>T	ENSP00000352672:p.Asn22Lys	229.0	0.0		302.0	141.0	NM_020393	A8K838|Q3B822|Q3B823|Q5SY63|Q5SY64|Q9HD75	Missense_Mutation	SNP	ENST00000359650.5	37	CCDS30871.1	.	.	.	.	.	.	.	.	.	.	G	10.60	1.396225	0.25205	.	.	ENSG00000163218	ENST00000368739;ENST00000359650	T;T	0.05139	3.5;3.49	3.25	-2.58	0.06228	.	.	.	.	.	T	0.00784	0.0026	N	0.08118	0	0.09310	N	1	P;P	0.38078	0.617;0.483	B;B	0.34242	0.178;0.086	T	0.44967	-0.9293	9	0.59425	D	0.04	-0.4372	0.9398	0.01353	0.2075:0.3901:0.1892:0.2132	.	22;22	Q96LB8-2;Q96LB8	.;PGRP4_HUMAN	K	22	ENSP00000357728:N22K;ENSP00000352672:N22K	ENSP00000352672:N22K	N	-	3	2	PGLYRP4	151585275	0.000000	0.05858	0.000000	0.03702	0.489000	0.33432	-0.142000	0.10311	-0.471000	0.06891	0.462000	0.41574	AAC	.		0.473	PGLYRP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000089978.1	NM_020393	
PHF5A	84844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	41863491	41863491	+	Silent	SNP	A	A	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr22:41863491A>G	ENST00000216252.3	-	3	275	c.204T>C	c.(202-204)gaT>gaC	p.D68D	PHF5A_ENST00000491254.1_5'UTR|ACO2_ENST00000396512.3_5'Flank|ACO2_ENST00000216254.4_5'Flank	NM_032758.3	NP_116147.1	Q7RTV0	PHF5A_HUMAN	PHD finger protein 5A	68					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of transcription, DNA-templated (GO:0045893)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|U12-type spliceosomal complex (GO:0005689)|U2 snRNP (GO:0005686)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(1)	4						AATAATAGGCATCAGAGACCC	0.493																																					p.D68D	Ovarian(15;130 571 1826 2981 46141)	.											.	PHF5A	91	0			c.T204C						.						95.0	77.0	83.0					22																	41863491		2203	4300	6503	SO:0001819	synonymous_variant	84844	exon3			ATAGGCATCAGAG	BC007321	CCDS14016.1	22q13.2	2014-02-14			ENSG00000100410	ENSG00000100410		"""Zinc fingers, PHD-type"""	18000	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 7"""					12054543, 12234937, 18076038	Standard	NM_032758		Approved	MGC1346, SF3b14b, INI, bK223H9.2, Rds3, SAP14b, SF3B7	uc003bab.3	Q7RTV0	OTTHUMG00000150966	ENST00000216252.3:c.204T>C	22.37:g.41863491A>G		171.0	0.0		141.0	99.0	NM_032758	Q9UH06	Silent	SNP	ENST00000216252.3	37	CCDS14016.1																																																																																			.		0.493	PHF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320686.1	NM_032758	
PHLDB2	90102	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	111603106	111603106	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr3:111603106delC	ENST00000431670.2	+	2	593	c.182delC	c.(181-183)accfs	p.T61fs	PHLDB2_ENST00000393923.3_Frame_Shift_Del_p.T88fs|PHLDB2_ENST00000481953.1_Frame_Shift_Del_p.T61fs|PHLDB2_ENST00000478922.1_Frame_Shift_Del_p.T61fs|PHLDB2_ENST00000393925.3_Frame_Shift_Del_p.T61fs|PHLDB2_ENST00000477695.1_Frame_Shift_Del_p.T61fs|PHLDB2_ENST00000412622.1_Frame_Shift_Del_p.T61fs	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	61						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						TCCTATTTAACCCTCTCACAA	0.483																																					p.T88fs		.											.	PHLDB2	96	0			c.263delC						.						141.0	146.0	144.0					3																	111603106		2203	4300	6503	SO:0001589	frameshift_variant	90102	exon3			ATTTAACCCTCTC		CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.182delC	3.37:g.111603106delC	ENSP00000405405:p.Thr61fs	102.0	0.0		111.0	66.0	NM_001134437	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Frame_Shift_Del	DEL	ENST00000431670.2	37	CCDS46886.1																																																																																			.		0.483	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354337.1	NM_145753	
PHLDB2	90102	hgsc.bcm.edu;bcgsc.ca	37	3	111603109	111603109	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr3:111603109T>G	ENST00000431670.2	+	2	596	c.185T>G	c.(184-186)cTc>cGc	p.L62R	PHLDB2_ENST00000393923.3_Missense_Mutation_p.L89R|PHLDB2_ENST00000481953.1_Missense_Mutation_p.L62R|PHLDB2_ENST00000478922.1_Missense_Mutation_p.L62R|PHLDB2_ENST00000393925.3_Missense_Mutation_p.L62R|PHLDB2_ENST00000477695.1_Missense_Mutation_p.L62R|PHLDB2_ENST00000412622.1_Missense_Mutation_p.L62R	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	62						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						TATTTAACCCTCTCACAACCT	0.478																																					p.L89R		.											.	PHLDB2	96	0			c.T266G						.						141.0	146.0	144.0					3																	111603109		2203	4300	6503	SO:0001583	missense	90102	exon3			TAACCCTCTCACA		CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.185T>G	3.37:g.111603109T>G	ENSP00000405405:p.Leu62Arg	100.0	0.0		111.0	68.0	NM_001134437	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	ENST00000431670.2	37	CCDS46886.1	.	.	.	.	.	.	.	.	.	.	T	19.64	3.865890	0.71949	.	.	ENSG00000144824	ENST00000359729;ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000478922;ENST00000477695;ENST00000393925;ENST00000481953	T;T;T;T;T;T	0.50001	0.76;0.88;0.79;0.81;0.88;0.79	5.87	5.87	0.94306	.	0.063315	0.64402	D	0.000005	T	0.65154	0.2664	L	0.56769	1.78	0.43919	D	0.996567	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.994;0.999;0.999;0.998	T	0.67573	-0.5636	10	0.87932	D	0	.	14.0962	0.65023	0.0:0.0:0.0:1.0	.	62;62;62;62;89	Q86SQ0;G5E9V3;E9PDY7;Q86SQ0-2;Q86SQ0-3	PHLB2_HUMAN;.;.;.;.	R	89;89;62;62;62;62;62;62;62	ENSP00000377500:L89R;ENSP00000405405:L62R;ENSP00000405292:L62R;ENSP00000418296:L62R;ENSP00000377502:L62R;ENSP00000418319:L62R	ENSP00000352764:L89R	L	+	2	0	PHLDB2	113085799	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.259000	0.65485	2.371000	0.80710	0.533000	0.62120	CTC	.		0.478	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354337.1	NM_145753	
PIK3CA	5290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E542K	Colon(199;1504 1750 3362 26421 31210 32040)	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,brain,glioma,0	PIK3CA	27752	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)	c.G1624A						.						56.0	56.0	56.0					3																	178936082		1809	4069	5878	SO:0001583	missense	5290	exon10			CTCTCTGAAATCA		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys	331.0	0.0		361.0	157.0	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA	.		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
PIP5K1B	8395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	71491629	71491629	+	Silent	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr9:71491629A>T	ENST00000265382.3	+	6	542	c.237A>T	c.(235-237)ccA>ccT	p.P79P	PIP5K1B_ENST00000541509.1_Silent_p.P79P	NM_003558.2	NP_003549.1	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, beta	79	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			breast(1)|large_intestine(2)|stomach(1)	4				Lung(182;0.133)		ATCACTACCCAGACTTTAGAT	0.383																																					p.P79P		.											.	PIP5K1B	240	0			c.A237T						.						123.0	123.0	123.0					9																	71491629		2203	4300	6503	SO:0001819	synonymous_variant	8395	exon6			CTACCCAGACTTT	U78579	CCDS6624.1, CCDS65063.1	9q13	2008-02-05			ENSG00000107242	ENSG00000107242			8995	protein-coding gene	gene with protein product		602745				9177790, 8841185	Standard	NM_003558		Approved	STM7, MSS4	uc004agu.4	O14986	OTTHUMG00000019976	ENST00000265382.3:c.237A>T	9.37:g.71491629A>T		102.0	0.0		127.0	57.0	NM_003558	A8K9L9|B4DIG7|P78518|P78519|Q5T5K6|Q5T5K8|Q5T5K9|Q5VZ00|Q7KYT5|Q8NHQ5|Q92749	Silent	SNP	ENST00000265382.3	37	CCDS6624.1																																																																																			.		0.383	PIP5K1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052561.2	NM_003558	
PIWIL2	55124	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	22146165	22146165	+	Silent	SNP	T	T	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr8:22146165T>C	ENST00000454009.2	+	8	1481	c.972T>C	c.(970-972)aaT>aaC	p.N324N	PIWIL2_ENST00000521356.1_Silent_p.N324N|PIWIL2_ENST00000356766.6_Silent_p.N324N	NM_001135721.1	NP_001129193.1	Q8TC59	PIWL2_HUMAN	piwi-like RNA-mediated gene silencing 2	324					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ-line stem cell maintenance (GO:0030718)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|piRNA metabolic process (GO:0034587)|positive regulation of meiosis I (GO:0060903)|positive regulation of translation (GO:0045727)|RNA 5'-end processing (GO:0000966)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(14)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	46				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		CCTTCTACAATGTTGTTTTCC	0.388																																					p.N324N		.											.	PIWIL2	91	0			c.T972C						.						135.0	113.0	121.0					8																	22146165		2203	4300	6503	SO:0001819	synonymous_variant	55124	exon8			CTACAATGTTGTT	AK001213	CCDS6029.1	8p24	2013-02-15	2013-02-15		ENSG00000197181	ENSG00000197181		"""Argonaute/PIWI family"""	17644	protein-coding gene	gene with protein product	"""Hiwi-like"", ""cancer/testis antigen 80"""	610312	"""piwi-like 2 (Drosophila)"""			11279525, 12906857	Standard	NM_018068		Approved	HILI, FLJ10351, Mili, CT80	uc003xbn.2	Q8TC59	OTTHUMG00000097767	ENST00000454009.2:c.972T>C	8.37:g.22146165T>C		185.0	0.0		188.0	105.0	NM_001135721	A8K4S3|A8K8S5|B0AZN9|B0AZP2|B4DR22|E7ECA4|Q96SW6|Q9NW28	Silent	SNP	ENST00000454009.2	37	CCDS6029.1																																																																																			.		0.388	PIWIL2-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000375438.1		
PLXDC2	84898	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	20453406	20453406	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr10:20453406delT	ENST00000377252.4	+	7	1634	c.793delT	c.(793-795)ttgfs	p.L265fs	PLXDC2_ENST00000377238.2_3'UTR|PLXDC2_ENST00000377242.3_Frame_Shift_Del_p.L216fs	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	265					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						GATTCCTGTCTTGGTCACACA	0.408																																					p.L265fs		.											.	PLXDC2	93	0			c.793delT						.						111.0	90.0	97.0					10																	20453406		2203	4300	6503	SO:0001589	frameshift_variant	84898	exon7			CCTGTCTTGGTCA	AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.793delT	10.37:g.20453406delT	ENSP00000366460:p.Leu265fs	86.0	0.0		105.0	43.0	NM_032812	Q96E59|Q96PD9|Q96SU9	Frame_Shift_Del	DEL	ENST00000377252.4	37	CCDS7132.1																																																																																			.		0.408	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047101.2	NM_032812	
PPP1R3F	89801	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	49126933	49126933	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chrX:49126933C>T	ENST00000055335.6	+	1	617	c.601C>T	c.(601-603)Cgc>Tgc	p.R201C	PPP1R3F_ENST00000495799.1_Intron|LL0XNC01-7P3.1_ENST00000602455.1_lincRNA|PPP1R3F_ENST00000466508.1_Intron|PPP1R3F_ENST00000438316.1_Intron	NM_033215.4	NP_149992.3	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory subunit 3F	201	CBM21. {ECO:0000255|PROSITE- ProRule:PRU00491}.				regulation of glycogen (starch) synthase activity (GO:2000465)|regulation of glycogen biosynthetic process (GO:0005979)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycogen binding (GO:2001069)|protein phosphatase binding (GO:0019903)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(4)	27	Ovarian(276;0.236)					CTACGTCCCGCGCAGCCCGCC	0.711																																					p.R201C		.											.	PPP1R3F	229	0			c.C601T						.						9.0	9.0	9.0					X																	49126933		2081	4086	6167	SO:0001583	missense	89801	exon1			GTCCCGCGCAGCC		CCDS35254.1, CCDS55415.1	Xp11.23	2012-04-17	2011-10-04		ENSG00000049769	ENSG00000049769		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14944	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3F"""			11948623	Standard	NM_033215		Approved	Hb2E	uc004dnh.2	Q6ZSY5	OTTHUMG00000024139	ENST00000055335.6:c.601C>T	X.37:g.49126933C>T	ENSP00000055335:p.Arg201Cys	28.0	0.0		36.0	14.0	NM_033215	A2VDJ8|B3KPW2|E9PCM3	Missense_Mutation	SNP	ENST00000055335.6	37	CCDS35254.1	.	.	.	.	.	.	.	.	.	.	c	16.97	3.268552	0.59540	.	.	ENSG00000049769	ENST00000055335	T	0.56776	0.44	3.68	2.7	0.31948	Putative phosphatase regulatory subunit (2);	0.000000	0.37219	N	0.002193	T	0.52256	0.1723	N	0.17082	0.46	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	T	0.56667	-0.7941	10	0.72032	D	0.01	-7.7459	9.6531	0.39910	0.0:0.7885:0.2115:0.0	.	201	Q6ZSY5	PPR3F_HUMAN	C	201	ENSP00000055335:R201C	ENSP00000055335:R201C	R	+	1	0	PPP1R3F	49013877	0.998000	0.40836	1.000000	0.80357	0.899000	0.52679	0.676000	0.25247	1.779000	0.52309	0.525000	0.51046	CGC	.		0.711	PPP1R3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060819.2	NM_033215	
PRKDC	5591	broad.mit.edu;ucsc.edu;mdanderson.org	37	8	48815178	48815178	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr8:48815178T>A	ENST00000314191.2	-	27	3276	c.3220A>T	c.(3220-3222)Aag>Tag	p.K1074*	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Nonsense_Mutation_p.K1074*	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	1074					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	CCCAGCCTCTTGAAAGCATTG	0.428								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)	.											.	PRKDC	1515	0			.						.						118.0	107.0	111.0					8																	48815178		1883	4105	5988	SO:0001587	stop_gained	5591	.			GCCTCTTGAAAGC		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.3220A>T	8.37:g.48815178T>A	ENSP00000313420:p.Lys1074*	87.0	0.0		74.0	35.0	.	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Nonsense_Mutation	SNP	ENST00000314191.2	37		.	.	.	.	.	.	.	.	.	.	T	40	8.325460	0.98762	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	.	.	.	4.86	4.86	0.63082	.	0.058180	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.7285	0.69362	0.0:0.0:0.0:1.0	.	.	.	.	X	1074	.	ENSP00000313420:K1074X	K	-	1	0	PRKDC	48977731	1.000000	0.71417	1.000000	0.80357	0.458000	0.32498	7.651000	0.83577	1.937000	0.56155	0.460000	0.39030	AAG	.		0.428	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	
PREX2	80243	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	69104009	69104009	+	Missense_Mutation	SNP	G	G	T	rs202233704		TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr8:69104009G>T	ENST00000288368.4	+	36	4676	c.4399G>T	c.(4399-4401)Gcc>Tcc	p.A1467S		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1467					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						ATCCAAAGCTGCCTATGTAGA	0.313																																					p.A1467S		.											.	PREX2	390	0			c.G4399T						.						98.0	98.0	98.0					8																	69104009		2203	4300	6503	SO:0001583	missense	80243	exon36			AAAGCTGCCTATG	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.4399G>T	8.37:g.69104009G>T	ENSP00000288368:p.Ala1467Ser	233.0	0.0		445.0	26.0	NM_024870	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.201109	0.58234	.	.	ENSG00000046889	ENST00000288368	T	0.59638	0.25	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.54334	0.1852	L	0.44542	1.39	0.58432	D	0.999999	B	0.28900	0.227	B	0.29353	0.101	T	0.55786	-0.8086	10	0.72032	D	0.01	.	18.7115	0.91658	0.0:0.0:1.0:0.0	.	1467	Q70Z35	PREX2_HUMAN	S	1467	ENSP00000288368:A1467S	ENSP00000288368:A1467S	A	+	1	0	PREX2	69266563	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.173000	0.77612	2.729000	0.93468	0.650000	0.86243	GCC	G|0.999;A|0.000		0.313	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
PRSS37	136242	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	141537672	141537672	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr7:141537672G>T	ENST00000350549.3	-	3	789	c.418C>A	c.(418-420)Caa>Aaa	p.Q140K	PRSS37_ENST00000438520.1_Missense_Mutation_p.Q140K	NM_001008270.2|NM_001171951.1	NP_001008271.2|NP_001165422.1	A4D1T9	PRS37_HUMAN	protease, serine, 37	140	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				binding of sperm to zona pellucida (GO:0007339)|cell migration (GO:0016477)|protein maturation (GO:0051604)	extracellular region (GO:0005576)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(3)	15						CTGTTTTCTTGGCTCCAGTCC	0.522																																					p.Q140K		.											.	PRSS37	91	0			c.C418A						.						154.0	140.0	145.0					7																	141537672		2203	4300	6503	SO:0001583	missense	136242	exon3			TTTCTTGGCTCCA		CCDS34764.1	7q34	2010-05-07			ENSG00000165076	ENSG00000165076		"""Serine peptidases / Serine peptidases"""	29211	protein-coding gene	gene with protein product							Standard	NM_001008270		Approved		uc003vws.2	A4D1T9	OTTHUMG00000157174	ENST00000350549.3:c.418C>A	7.37:g.141537672G>T	ENSP00000297767:p.Gln140Lys	214.0	0.0		175.0	78.0	NM_001171951	B2RPB5	Missense_Mutation	SNP	ENST00000350549.3	37	CCDS34764.1	.	.	.	.	.	.	.	.	.	.	G	4.507	0.094009	0.08632	.	.	ENSG00000165076	ENST00000350549;ENST00000438520	D;D	0.87729	-2.29;-2.29	5.65	3.73	0.42828	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.018330	0.07832	N	0.961480	T	0.77961	0.4209	L	0.28400	0.85	0.28473	N	0.915302	B;B	0.06786	0.001;0.001	B;B	0.17979	0.02;0.02	T	0.62412	-0.6860	10	0.05620	T	0.96	.	8.8757	0.35343	0.0825:0.0:0.7604:0.1571	.	140;140	B7ZMK3;A4D1T9	.;PRS37_HUMAN	K	140	ENSP00000297767:Q140K;ENSP00000414461:Q140K	ENSP00000297767:Q140K	Q	-	1	0	PRSS37	141184141	1.000000	0.71417	0.978000	0.43139	0.025000	0.11179	1.465000	0.35299	1.632000	0.50472	-0.140000	0.14226	CAA	.		0.522	PRSS37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347763.1	NM_001008270	
PSMD1	5707	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	231937074	231937074	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr2:231937074G>T	ENST00000308696.6	+	7	988	c.826G>T	c.(826-828)Gct>Tct	p.A276S	PSMD1_ENST00000373635.4_Missense_Mutation_p.A276S|PSMD1_ENST00000409643.1_Missense_Mutation_p.A276S	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	276					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	CACCCCTATTGCTTCTGTGCC	0.398																																					p.A276S		.											.	PSMD1	92	0			c.G826T						.						159.0	162.0	161.0					2																	231937074		2203	4300	6503	SO:0001583	missense	5707	exon7			CCTATTGCTTCTG	D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.826G>T	2.37:g.231937074G>T	ENSP00000309474:p.Ala276Ser	104.0	0.0		113.0	18.0	NM_002807	B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Missense_Mutation	SNP	ENST00000308696.6	37	CCDS2482.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.02|16.02	3.005039|3.005039	0.54254|0.54254	.|.	.|.	ENSG00000173692|ENSG00000173692	ENST00000308696;ENST00000373635;ENST00000409643|ENST00000444007	.|.	.|.	.|.	5.98|5.98	5.09|5.09	0.68999|0.68999	Armadillo-type fold (1);|.	0.095545|.	0.64402|.	D|.	0.000001|.	T|T	0.45196|0.45196	0.1330|0.1330	N|N	0.11341|0.11341	0.13|0.13	0.45867|0.45867	D|D	0.998725|0.998725	B;B|.	0.06786|.	0.0;0.001|.	B;B|.	0.06405|.	0.0;0.002|.	T|T	0.40194|0.40194	-0.9576|-0.9576	9|5	0.08179|.	T|.	0.78|.	-9.7803|-9.7803	15.5537|15.5537	0.76173|0.76173	0.0:0.2607:0.7393:0.0|0.0:0.2607:0.7393:0.0	.|.	276;276|.	Q99460;Q99460-2|.	PSMD1_HUMAN;.|.	S|F	276|127	.|.	ENSP00000309474:A276S|.	A|C	+|+	1|2	0|0	PSMD1|PSMD1	231645318|231645318	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.991000|0.991000	0.79684|0.79684	4.854000|4.854000	0.62918|0.62918	1.506000|1.506000	0.48736|0.48736	0.650000|0.650000	0.86243|0.86243	GCT|TGC	.		0.398	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256958.2		
PTCHD4	442213	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	48036326	48036326	+	Silent	SNP	C	C	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr6:48036326C>G	ENST00000339488.4	-	1	99	c.66G>C	c.(64-66)gtG>gtC	p.V22V	PTCHD4_ENST00000543600.1_Silent_p.V5V	NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	22						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										CTCTGCGAAGCACCTGCCGCA	0.622																																					p.V22V		.											.	.	.	0			c.G66C						.						7.0	9.0	8.0					6																	48036326		1922	4070	5992	SO:0001819	synonymous_variant	442213	exon1			GCGAAGCACCTGC		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.66G>C	6.37:g.48036326C>G		78.0	0.0		127.0	61.0	NM_001013732	B0QZ29|B4DRK3|Q5T884	Silent	SNP	ENST00000339488.4	37	CCDS34473.2	.	.	.	.	.	.	.	.	.	.	C	5.538	0.284247	0.10513	.	.	ENSG00000244694	ENST00000398738	.	.	.	4.54	3.64	0.41730	.	.	.	.	.	T	0.62841	0.2461	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63695	-0.6579	4	.	.	.	.	15.602	0.76631	0.0:0.824:0.176:0.0	.	.	.	.	P	22	.	.	A	-	1	0	C6orf138	48144285	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.890000	0.48609	2.061000	0.61500	0.442000	0.29010	GCT	.		0.622	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732	
PTH2R	5746	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	209345847	209345847	+	Frame_Shift_Del	DEL	G	G	-	rs151296979		TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr2:209345847delG	ENST00000272847.2	+	10	1247	c.1034delG	c.(1033-1035)tggfs	p.W345fs	PTH2R_ENST00000413482.1_3'UTR|AC019185.4_ENST00000424628.1_RNA	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	345					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)	p.W345L(2)		breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	ACCAAAATCTGGGAGACCAAT	0.358																																					p.W345fs		.											.	PTH2R	502	2	Substitution - Missense(2)	lung(2)	c.1034delG						.						101.0	99.0	99.0					2																	209345847		2203	4300	6503	SO:0001589	frameshift_variant	5746	exon10			AAATCTGGGAGAC	BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.1034delG	2.37:g.209345847delG	ENSP00000272847:p.Trp345fs	212.0	0.0		258.0	161.0	NM_005048	Q8N429	Frame_Shift_Del	DEL	ENST00000272847.2	37	CCDS2383.1																																																																																			.		0.358	PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256519.2	NM_005048	
PTPRQ	374462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	80936556	80936556	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr12:80936556G>T	ENST00000266688.5	+	28	3757	c.3757G>T	c.(3757-3759)Gac>Tac	p.D1253Y				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1299	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						CTGTACTTCAGACTTTGTATG	0.323																																					p.D1085Y		.											.	.	.	0			c.G3253T						.						84.0	71.0	75.0					12																	80936556		692	1590	2282	SO:0001583	missense	374462	exon20			ACTTCAGACTTTG	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.3757G>T	12.37:g.80936556G>T	ENSP00000266688:p.Asp1253Tyr	173.0	0.0		207.0	25.0	NM_001145026		Missense_Mutation	SNP	ENST00000266688.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.15|15.15	2.746579|2.746579	0.49257|0.49257	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000266688|ENST00000532722	T|.	0.58506|.	0.33|.	5.88|5.88	5.88|5.88	0.94601|0.94601	Fibronectin, type III (4);Immunoglobulin-like fold (1);|.	.|.	.|.	.|.	.|.	T|T	0.70902|0.70902	0.3277|0.3277	.|.	.|.	.|.	0.43377|0.43377	D|D	0.995477|0.995477	D|.	0.56287|.	0.975|.	P|.	0.50490|.	0.642|.	T|T	0.68534|0.68534	-0.5383|-0.5383	8|4	0.59425|.	D|.	0.04|.	.|.	14.3886|14.3886	0.66963|0.66963	0.0702:0.0:0.9298:0.0|0.0702:0.0:0.9298:0.0	.|.	1299|.	Q9UMZ3|.	PTPRQ_HUMAN|.	Y|H	1253|953	ENSP00000266688:D1253Y|.	ENSP00000266688:D1253Y|.	D|Q	+|+	1|3	0|2	PTPRQ|PTPRQ	79460687|79460687	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	2.628000|2.628000	0.46477|0.46477	2.785000|2.785000	0.95823|0.95823	0.650000|0.650000	0.86243|0.86243	GAC|CAG	.		0.323	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145026	
PXDNL	137902	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	52322116	52322116	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr8:52322116G>A	ENST00000356297.4	-	17	2168	c.2068C>T	c.(2068-2070)Cgg>Tgg	p.R690W	PXDNL_ENST00000543296.1_Missense_Mutation_p.R690W	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	690					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TCATTGTACCGGAATTCTGAA	0.617																																					p.R690W		.											.	PXDNL	70	0			c.C2068T						.						26.0	29.0	28.0					8																	52322116		2027	4177	6204	SO:0001583	missense	137902	exon17			TGTACCGGAATTC		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2068C>T	8.37:g.52322116G>A	ENSP00000348645:p.Arg690Trp	121.0	0.0		108.0	56.0	NM_144651	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	G	6.283	0.420284	0.11928	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.66460	-0.19;-0.21	3.59	-0.81	0.10860	.	.	.	.	.	T	0.51126	0.1656	L	0.49350	1.555	0.24931	N	0.991916	B	0.29212	0.237	B	0.16722	0.016	T	0.27773	-1.0064	8	.	.	.	.	4.912	0.13827	0.2831:0.1567:0.5602:0.0	.	690	A1KZ92	PXDNL_HUMAN	W	690	ENSP00000348645:R690W;ENSP00000444865:R690W	.	R	-	1	2	PXDNL	52484669	1.000000	0.71417	0.022000	0.16811	0.151000	0.21798	2.869000	0.48444	-0.517000	0.06461	0.462000	0.41574	CGG	.		0.617	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
RAI2	10742	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	17819079	17819079	+	Missense_Mutation	SNP	C	C	T	rs140631545		TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chrX:17819079C>T	ENST00000545871.1	-	3	1512	c.1052G>A	c.(1051-1053)cGg>cAg	p.R351Q	RAI2_ENST00000360011.1_Missense_Mutation_p.R351Q|RAI2_ENST00000331511.1_Missense_Mutation_p.R351Q|RAI2_ENST00000451717.1_Missense_Mutation_p.R351Q|RAI2_ENST00000415486.3_Missense_Mutation_p.R301Q	NM_001172739.1|NM_001172743.1	NP_001166210|NP_001166214	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	351					embryo development (GO:0009790)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	22	Hepatocellular(33;0.183)					CTCGGATTTCCGGTGGGCTGC	0.552																																					p.R351Q		.											.	RAI2	131	0			c.G1052A						.		GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,3835		0,0,1632,571	62.0	60.0	60.0		902,1052,1052,1052	5.3	1.0	X	dbSNP_134	60	1,6727		0,1,2427,1872	no	missense,missense,missense,missense	RAI2	NM_001172732.1,NM_001172739.1,NM_001172743.1,NM_021785.4	43,43,43,43	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	probably-damaging,probably-damaging,probably-damaging,probably-damaging	301/481,351/531,351/531,351/531	17819079	1,10562	2203	4300	6503	SO:0001583	missense	10742	exon3			GATTTCCGGTGGG	Z93242	CCDS14183.1, CCDS55374.1	Xp22	2008-02-05			ENSG00000131831	ENSG00000131831			9835	protein-coding gene	gene with protein product		300217				10049581, 10394933	Standard	NR_033348		Approved		uc010nfa.3	Q9Y5P3	OTTHUMG00000021209	ENST00000545871.1:c.1052G>A	X.37:g.17819079C>T	ENSP00000444210:p.Arg351Gln	132.0	0.0		149.0	12.0	NM_001172739	B1B1K2|B4DQM9|E7EMN4|Q8N6X7	Missense_Mutation	SNP	ENST00000545871.1	37	CCDS14183.1	.	.	.	.	.	.	.	.	.	.	c	18.38	3.611504	0.66558	0.0	1.49E-4	ENSG00000131831	ENST00000331511;ENST00000360011;ENST00000545871;ENST00000451717;ENST00000415486	T;T;T;T;T	0.38077	1.18;1.18;1.18;1.18;1.16	5.29	5.29	0.74685	.	0.074690	0.49305	D	0.000142	T	0.54532	0.1864	L	0.55481	1.735	0.37167	D	0.902861	D;D	0.89917	1.0;1.0	D;D	0.66847	0.947;0.947	T	0.62364	-0.6870	10	0.72032	D	0.01	-24.2176	15.8108	0.78561	0.0:1.0:0.0:0.0	.	301;351	E7EMN4;Q9Y5P3	.;RAI2_HUMAN	Q	351;351;351;351;301	ENSP00000333456:R351Q;ENSP00000353106:R351Q;ENSP00000444210:R351Q;ENSP00000401323:R351Q;ENSP00000392578:R301Q	ENSP00000333456:R351Q	R	-	2	0	RAI2	17729000	0.979000	0.34478	0.999000	0.59377	0.942000	0.58702	2.626000	0.46460	2.457000	0.83068	0.597000	0.82753	CGG	C|1.000;T|0.000		0.552	RAI2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055937.1	NM_021785	
RAP1GAP2	23108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	2929754	2929754	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr17:2929754G>A	ENST00000254695.8	+	21	2066	c.1976G>A	c.(1975-1977)aGt>aAt	p.S659N	RAP1GAP2_ENST00000542807.1_Missense_Mutation_p.S659N|RAP1GAP2_ENST00000366401.4_Missense_Mutation_p.S644N|RAP1GAP2_ENST00000540393.2_Missense_Mutation_p.S640N	NM_015085.4	NP_055900.4	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2	659	Ser-rich.				negative regulation of neuron projection development (GO:0010977)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|nuclear membrane (GO:0031965)	Rap GTPase activator activity (GO:0046582)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	11						GAGGGCGACAGTGGGGTAGGT	0.642																																					p.S659N		.											.	RAP1GAP2	1	0			c.G1976A						.						17.0	21.0	20.0					17																	2929754		2035	4084	6119	SO:0001583	missense	23108	exon21			GCGACAGTGGGGT	AB028962	CCDS45573.1, CCDS45574.1	17p13.3	2009-09-14	2009-09-14	2009-09-14		ENSG00000132359			29176	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 4"", ""GTPase activating Rap/RanGAP domain-like 4"""	GARNL4		15632203	Standard	NM_015085		Approved	KIAA1039	uc010ckd.3	Q684P5		ENST00000254695.8:c.1976G>A	17.37:g.2929754G>A	ENSP00000254695:p.Ser659Asn	144.0	0.0		119.0	98.0	NM_015085	B2RTY5|Q684P4|Q6AI00|Q6ZVF0|Q9UPW2	Missense_Mutation	SNP	ENST00000254695.8	37	CCDS45573.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.856625	0.51376	.	.	ENSG00000132359	ENST00000254695;ENST00000366401;ENST00000540393;ENST00000542807	D;D;D;D	0.89050	-2.46;-2.46;-2.46;-2.46	5.42	3.18	0.36537	.	0.191310	0.56097	D	0.000031	D	0.85678	0.5752	L	0.41236	1.265	0.28868	N	0.895103	B;B	0.30973	0.302;0.201	B;B	0.35971	0.215;0.107	T	0.81927	-0.0709	10	0.54805	T	0.06	-20.0906	15.1305	0.72520	0.0:0.0:0.7457:0.2542	.	644;659	Q684P5-2;Q684P5	.;RPGP2_HUMAN	N	659;644;640;659	ENSP00000254695:S659N;ENSP00000389824:S644N;ENSP00000439688:S640N;ENSP00000444890:S659N	ENSP00000254695:S659N	S	+	2	0	RAP1GAP2	2876504	1.000000	0.71417	0.914000	0.36105	0.923000	0.55619	3.901000	0.56303	1.277000	0.44412	0.462000	0.41574	AGT	.		0.642	RAP1GAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438208.2		
RB1CC1	9821	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	53540730	53540730	+	Splice_Site	SNP	T	T	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr8:53540730T>G	ENST00000025008.5	-	22	5023		c.e22-2		RB1CC1_ENST00000435644.2_Splice_Site|RB1CC1_ENST00000539297.1_Splice_Site|RB1CC1_ENST00000521611.1_Intron	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1						autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				ACCTGAAAACTGAATAAAGAA	0.313																																					.	GBM(180;1701 2102 13475 42023 52570)	.											.	RB1CC1	170	0			c.4500-2A>C						.						82.0	84.0	83.0					8																	53540730		2203	4300	6503	SO:0001630	splice_region_variant	9821	exon23			GAAAACTGAATAA	AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.4500-2A>C	8.37:g.53540730T>G		51.0	0.0		75.0	22.0	NM_014781	Q86YR4|Q8WVU9|Q92601	Splice_Site	SNP	ENST00000025008.5	37	CCDS34892.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.319238	0.81469	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000519912;ENST00000539297	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4755	0.75474	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	RB1CC1	53703283	1.000000	0.71417	0.936000	0.37596	0.955000	0.61496	7.698000	0.84413	2.050000	0.60909	0.482000	0.46254	.	.		0.313	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781	Intron
RELN	5649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	103292164	103292164	+	Silent	SNP	G	G	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr7:103292164G>T	ENST00000428762.1	-	15	1995	c.1836C>A	c.(1834-1836)atC>atA	p.I612I	RELN_ENST00000424685.2_Silent_p.I612I|RELN_ENST00000343529.5_Silent_p.I612I	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	612					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GTCCAGCACAGATCTCAGGTA	0.468																																					p.I612I	NSCLC(146;835 1944 15585 22231 52158)	.											.	RELN	574	0			c.C1836A						.						82.0	67.0	72.0					7																	103292164		2203	4300	6503	SO:0001819	synonymous_variant	5649	exon15			AGCACAGATCTCA		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.1836C>A	7.37:g.103292164G>T		104.0	0.0		76.0	42.0	NM_173054	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	CCDS47680.1																																																																																			.		0.468	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
RGS18	64407	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	192128370	192128370	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr1:192128370G>C	ENST00000367460.3	+	2	321	c.140G>C	c.(139-141)aGa>aCa	p.R47T	RGS18_ENST00000481707.1_3'UTR	NM_130782.2	NP_570138.1	Q9NS28	RGS18_HUMAN	regulator of G-protein signaling 18	47					G-protein coupled receptor signaling pathway (GO:0007186)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			kidney(1)|large_intestine(2)|lung(15)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AAAAGAAATAGACTAAGTCTT	0.378																																					p.R47T		.											.	RGS18	229	0			c.G140C						.						49.0	52.0	51.0					1																	192128370		2203	4299	6502	SO:0001583	missense	64407	exon2			GAAATAGACTAAG	AF268036	CCDS1374.1	1q31.2	2008-02-05	2007-08-14		ENSG00000150681	ENSG00000150681		"""Regulators of G-protein signaling"""	14261	protein-coding gene	gene with protein product		607192	"""regulator of G-protein signalling 18"""			11042171	Standard	NM_130782		Approved	RGS13	uc001gsg.3	Q9NS28	OTTHUMG00000035592	ENST00000367460.3:c.140G>C	1.37:g.192128370G>C	ENSP00000356430:p.Arg47Thr	81.0	0.0		141.0	15.0	NM_130782	B2RD23	Missense_Mutation	SNP	ENST00000367460.3	37	CCDS1374.1	.	.	.	.	.	.	.	.	.	.	G	14.46	2.541478	0.45280	.	.	ENSG00000150681	ENST00000367460	T	0.58060	0.36	5.88	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.71986	0.3405	M	0.83774	2.66	0.53688	D	0.999974	D	0.76494	0.999	D	0.66716	0.946	T	0.76599	-0.2900	10	0.87932	D	0	.	12.1049	0.53807	0.0796:0.0:0.9204:0.0	.	47	Q9NS28	RGS18_HUMAN	T	47	ENSP00000356430:R47T	ENSP00000356430:R47T	R	+	2	0	RGS18	190394993	0.975000	0.34042	0.783000	0.31826	0.153000	0.21895	5.789000	0.69029	1.493000	0.48517	-0.145000	0.13849	AGA	.		0.378	RGS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086382.1	NM_130782	
RIMBP3	85376	broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	20458548	20458548	+	Silent	SNP	G	G	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr22:20458548G>C	ENST00000426804.1	-	1	3238	c.2754C>G	c.(2752-2754)ctC>ctG	p.L918L	RN7SKP131_ENST00000363006.1_RNA	NM_015672.1	NP_056487.1	Q9UFD9	RIM3A_HUMAN	RIMS binding protein 3	918										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	13	Colorectal(54;0.0993)|Melanoma(16;0.165)		LUSC - Lung squamous cell carcinoma(15;0.0405)|Lung(15;0.224)			GCCCCGCTGGGAGTTGACTGG	0.617																																					p.L918L		.											.	.	.	0			c.C2754G						.						13.0	16.0	15.0					22																	20458548		1248	3137	4385	SO:0001819	synonymous_variant	85376	exon1			CGCTGGGAGTTGA	AB051453	CCDS46665.1	22q11.21	2014-05-06			ENSG00000196622	ENSG00000275793			29344	protein-coding gene	gene with protein product		612699				11258795, 17855024	Standard	NM_015672		Approved	KIAA1666, RIMBP3.1, RIMBP3A	uc002zsd.4	Q9UFD9	OTTHUMG00000188355	ENST00000426804.1:c.2754C>G	22.37:g.20458548G>C		1012.0	0.0		652.0	37.0	NM_015672	Q8IYP7|Q9BY94|Q9UFQ5	Silent	SNP	ENST00000426804.1	37	CCDS46665.1																																																																																			.		0.617	RIMBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318945.2	NM_015672	
RNASET2	8635	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	167343204	167343204	+	Missense_Mutation	SNP	C	C	T	rs41269593	byFrequency	TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr6:167343204C>T	ENST00000508775.1	-	9	1162	c.643G>A	c.(643-645)Gag>Aag	p.E215K	RNASET2_ENST00000476238.2_Missense_Mutation_p.E215K|RNASET2_ENST00000366855.6_Missense_Mutation_p.E177K|RP11-514O12.4_ENST00000507747.1_Intron	NM_003730.4	NP_003721.2	O00584	RNT2_HUMAN	ribonuclease T2	215					RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	ribonuclease activity (GO:0004540)|ribonuclease T2 activity (GO:0033897)|RNA binding (GO:0003723)			large_intestine(4)|lung(4)	8		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;1.53e-19)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00665)		TCCCCCGGCTCGGTGCAGTTT	0.547													C|||	7	0.00139776	0.0008	0.0014	5008	,	,		15353	0.0		0.005	False		,,,				2504	0.0				p.E215K		.											.	RNASET2	90	0			c.G643A						.	C	LYS/GLU	3,4403	6.2+/-15.9	0,3,2200	102.0	113.0	109.0		643	1.7	0.0	6	dbSNP_127	109	68,8532	39.8+/-96.3	0,68,4232	yes	missense	RNASET2	NM_003730.4	56	0,71,6432	TT,TC,CC		0.7907,0.0681,0.5459	benign	215/257	167343204	71,12935	2203	4300	6503	SO:0001583	missense	8635	exon9			CCGGCTCGGTGCA	AJ419866	CCDS5295.1	6q27	2014-05-20			ENSG00000026297	ENSG00000026297			21686	protein-coding gene	gene with protein product		612944				9192857	Standard	NM_003730		Approved	RNASE6PL, FLJ10907, bA514O12.3	uc003qve.3	O00584	OTTHUMG00000016009	ENST00000508775.1:c.643G>A	6.37:g.167343204C>T	ENSP00000426455:p.Glu215Lys	64.0	0.0		55.0	16.0	NM_003730	B2RDA7|E1P5C3|Q5T8Q0|Q8TCU2|Q9BZ46|Q9BZ47	Missense_Mutation	SNP	ENST00000508775.1	37	CCDS5295.1	3	0.0013736263736263737	0	0.0	1	0.0027624309392265192	0	0.0	2	0.002638522427440633	C	12.05	1.820127	0.32145	6.81E-4	0.007907	ENSG00000026297	ENST00000366855;ENST00000508775;ENST00000428859;ENST00000476238;ENST00000478180	T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0	4.57	1.66	0.24008	.	0.436718	0.25648	N	0.029229	T	0.64886	0.2639	L	0.39085	1.19	0.20074	N	0.999932	D;P	0.76494	0.999;0.575	D;B	0.69307	0.963;0.089	T	0.65121	-0.6245	10	0.20519	T	0.43	-0.1819	13.7228	0.62737	0.0:0.6066:0.3934:0.0	rs41269593	265;215	C9JIU8;O00584	.;RNT2_HUMAN	K	177;215;265;215;215	ENSP00000424947:E177K;ENSP00000426455:E215K;ENSP00000422846:E215K;ENSP00000426059:E215K	ENSP00000424947:E177K	E	-	1	0	RNASET2	167263194	0.013000	0.17824	0.000000	0.03702	0.001000	0.01503	0.453000	0.21811	0.016000	0.14998	0.655000	0.94253	GAG	C|0.996;T|0.004		0.547	RNASET2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043089.2	NM_003730	
RPS6KA6	27330	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	83389790	83389790	+	Splice_Site	SNP	C	C	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chrX:83389790C>T	ENST00000262752.2	-	8	653	c.646G>A	c.(646-648)Gat>Aat	p.D216N	RPS6KA6_ENST00000543399.1_Splice_Site_p.D216N	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	216	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						ATCTGCATACCTGTTAATTTG	0.239																																					p.D216N		.											.	RPS6KA6	615	0			c.G646A						.						37.0	36.0	36.0					X																	83389790		2181	4236	6417	SO:0001630	splice_region_variant	27330	exon8			GCATACCTGTTAA	AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.646+1G>A	X.37:g.83389790C>T		109.0	0.0		144.0	47.0	NM_014496	B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Missense_Mutation	SNP	ENST00000262752.2	37	CCDS14451.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.108502	0.77096	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	D;D	0.92965	-3.14;-3.14	4.62	3.73	0.42828	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97359	0.9136	H	0.97465	4.01	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.97620	1.0135	9	.	.	.	.	13.2717	0.60164	0.1599:0.8401:0.0:0.0	.	216;216	B7ZL90;Q9UK32	.;KS6A6_HUMAN	N	216	ENSP00000262752:D216N;ENSP00000440830:D216N	.	D	-	1	0	RPS6KA6	83276446	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	5.358000	0.66064	0.714000	0.32081	0.523000	0.50628	GAT	.		0.239	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057372.1	NM_014496	Missense_Mutation
SAGE1	55511	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	134989876	134989876	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chrX:134989876C>A	ENST00000370709.3	+	9	1035	c.1035C>A	c.(1033-1035)caC>caA	p.H345Q	SAGE1_ENST00000535938.1_Missense_Mutation_p.H345Q|SAGE1_ENST00000324447.3_Missense_Mutation_p.H345Q|SAGE1_ENST00000537770.1_Intron			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	345						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					CCATCACTCACAATGTCTGTG	0.448																																					p.H345Q		.											.	SAGE1	133	0			c.C1035A						.						117.0	92.0	100.0					X																	134989876		2203	4300	6503	SO:0001583	missense	55511	exon10			CACTCACAATGTC	AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.1035C>A	X.37:g.134989876C>A	ENSP00000359743:p.His345Gln	215.0	0.0		235.0	97.0	NM_018666	Q5JNW0	Missense_Mutation	SNP	ENST00000370709.3	37	CCDS14652.1	.	.	.	.	.	.	.	.	.	.	C	0.038	-1.297685	0.01364	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000370709	T;T;T	0.35236	1.32;1.32;1.32	1.53	-1.46	0.08800	.	.	.	.	.	T	0.12732	0.0309	N	0.04880	-0.145	0.09310	N	1	B	0.14012	0.009	B	0.04013	0.001	T	0.31280	-0.9949	9	0.07813	T	0.8	.	4.6613	0.12643	0.0:0.3751:0.0:0.6249	.	345	Q9NXZ1	SAGE1_HUMAN	Q	345	ENSP00000323191:H345Q;ENSP00000445959:H345Q;ENSP00000359743:H345Q	ENSP00000323191:H345Q	H	+	3	2	SAGE1	134817542	0.000000	0.05858	0.002000	0.10522	0.064000	0.16182	-2.065000	0.01386	-0.570000	0.06022	0.149000	0.16113	CAC	.		0.448	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058448.1	NM_018666	
SAMD9	54809	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	92732475	92732475	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr7:92732475C>A	ENST00000379958.2	-	3	3205	c.2936G>T	c.(2935-2937)tGt>tTt	p.C979F		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	979						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			GCGTACTCCACAGTAGTTCCC	0.388																																					p.C979F		.											.	SAMD9	140	0			c.G2936T						.						126.0	123.0	124.0					7																	92732475		2203	4300	6503	SO:0001583	missense	54809	exon2			ACTCCACAGTAGT	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.2936G>T	7.37:g.92732475C>A	ENSP00000369292:p.Cys979Phe	147.0	0.0		122.0	47.0	NM_001193307	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	ENST00000379958.2	37	CCDS34680.1	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.937307	0.00484	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.23147	1.92;2.73	4.88	-0.5	0.12012	.	0.628283	0.14950	N	0.288966	T	0.15435	0.0372	L	0.36672	1.1	0.09310	N	1	B	0.27971	0.196	B	0.14023	0.01	T	0.14008	-1.0488	10	0.59425	D	0.04	-0.0689	5.7348	0.18061	0.0:0.4519:0.1363:0.4119	.	979	Q5K651	SAMD9_HUMAN	F	979	ENSP00000369292:C979F;ENSP00000414529:C979F	ENSP00000369292:C979F	C	-	2	0	SAMD9	92570411	0.107000	0.21998	0.085000	0.20634	0.234000	0.25298	1.266000	0.33039	0.012000	0.14892	-0.208000	0.12717	TGT	.		0.388	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654	
SCAI	286205	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	127734043	127734043	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr9:127734043T>A	ENST00000336505.6	-	16	1538	c.1480A>T	c.(1480-1482)Agc>Tgc	p.S494C	SCAI_ENST00000373549.4_Missense_Mutation_p.S517C	NM_001144877.2	NP_001138349.1	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion	494					negative regulation of cell migration (GO:0030336)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(5)|stomach(1)|urinary_tract(1)	35						CTGCGCATGCTTGACAATCCA	0.418																																					p.S517C		.											.	SCAI	138	0			c.A1549T						.						136.0	123.0	127.0					9																	127734043		1861	4098	5959	SO:0001583	missense	286205	exon17			GCATGCTTGACAA	AK093983	CCDS43877.1, CCDS48017.1	9q34.11	2009-11-06	2009-07-09	2009-07-09	ENSG00000173611	ENSG00000173611			26709	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 126"""	C9orf126			Standard	NM_173690		Approved	FLJ36664, NET40	uc004bpd.3	Q8N9R8	OTTHUMG00000020667	ENST00000336505.6:c.1480A>T	9.37:g.127734043T>A	ENSP00000336756:p.Ser494Cys	147.0	0.0		197.0	93.0	NM_173690	Q3SXZ1|Q3SXZ2|Q5T163|Q8N1I4	Missense_Mutation	SNP	ENST00000336505.6	37	CCDS48017.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.176984	0.78564	.	.	ENSG00000173611	ENST00000336505;ENST00000373549	T;T	0.48522	0.81;0.81	4.95	4.95	0.65309	.	0.037833	0.85682	D	0.000000	T	0.66819	0.2828	M	0.71036	2.16	0.53688	D	0.999972	D;D	0.76494	0.999;0.999	D;D	0.79784	0.993;0.992	T	0.70421	-0.4876	10	0.62326	D	0.03	-9.8697	14.1109	0.65121	0.0:0.0:0.0:1.0	.	494;517	Q8N9R8;Q8N9R8-2	SCAI_HUMAN;.	C	494;517	ENSP00000336756:S494C;ENSP00000362650:S517C	ENSP00000336756:S494C	S	-	1	0	SCAI	126773864	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.309000	0.78937	1.996000	0.58369	0.533000	0.62120	AGC	.		0.418	SCAI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054055.3	NM_173690	
SCN11A	11280	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38888226	38888226	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr3:38888226A>T	ENST00000302328.3	-	26	5533	c.5335T>A	c.(5335-5337)Tct>Act	p.S1779T	SCN11A_ENST00000450244.1_Missense_Mutation_p.S1779T|SCN11A_ENST00000456224.3_Missense_Mutation_p.S1741T	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1779					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CCAAAGCTAGACAAGTCTCCA	0.532																																					p.S1779T		.											.	SCN11A	99	0			c.T5335A						.						160.0	141.0	148.0					3																	38888226		2203	4300	6503	SO:0001583	missense	11280	exon26			AGCTAGACAAGTC	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.5335T>A	3.37:g.38888226A>T	ENSP00000307599:p.Ser1779Thr	211.0	0.0		191.0	99.0	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	37	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	A	0.176	-1.067032	0.01934	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224	D;D;D	0.96168	-3.93;-3.93;-3.88	5.02	-9.2	0.00682	.	1.461070	0.04665	N	0.409654	D	0.87589	0.6215	N	0.20766	0.605	0.09310	N	1	B	0.17667	0.023	B	0.18263	0.021	T	0.77843	-0.2437	10	0.18710	T	0.47	.	7.767	0.28986	0.2719:0.0945:0.5404:0.0932	.	1779	Q9UI33	SCNBA_HUMAN	T	1779;1779;1741	ENSP00000307599:S1779T;ENSP00000400945:S1779T;ENSP00000416757:S1741T	ENSP00000307599:S1779T	S	-	1	0	SCN11A	38863230	0.000000	0.05858	0.000000	0.03702	0.095000	0.18619	-1.003000	0.03682	-1.944000	0.01038	-1.162000	0.01777	TCT	.		0.532	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
SIK1	150094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	44838314	44838314	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr21:44838314G>A	ENST00000270162.6	-	12	1702	c.1570C>T	c.(1570-1572)Ccg>Tcg	p.P524S		NM_173354.3	NP_775490.2	P57059	SIK1_HUMAN	salt-inducible kinase 1	524					cardiac muscle cell differentiation (GO:0055007)|cell cycle (GO:0007049)|entrainment of circadian clock by photoperiod (GO:0043153)|intracellular signal transduction (GO:0035556)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of triglyceride biosynthetic process (GO:0010868)|positive regulation of anoikis (GO:2000210)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell differentiation (GO:0045595)|regulation of mitotic cell cycle (GO:0007346)|regulation of myotube differentiation (GO:0010830)|regulation of sodium ion transport (GO:0002028)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|cAMP response element binding protein binding (GO:0008140)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|testis(2)|urinary_tract(1)	21					Dabrafenib(DB08912)	TGAGTGGCCGGGGTGCCACTG	0.701																																					p.P524S		.											.	SIK1	346	0			c.C1570T						.						19.0	22.0	21.0					21																	44838314		2199	4297	6496	SO:0001583	missense	150094	exon12			TGGCCGGGGTGCC	BC038504	CCDS33575.1	21q22.3	2008-12-23	2008-12-23	2008-12-23	ENSG00000142178	ENSG00000142178			11142	protein-coding gene	gene with protein product	"""myocardial SNF1-like kinase"""	605705	"""SNF1-like kinase"""	SNF1LK		7893599	Standard	NM_173354		Approved	msk	uc002zdf.2	P57059	OTTHUMG00000086874	ENST00000270162.6:c.1570C>T	21.37:g.44838314G>A	ENSP00000270162:p.Pro524Ser	52.0	0.0		55.0	39.0	NM_173354	A6NC84|Q5R2V5|Q6ZNL8|Q86YJ2	Missense_Mutation	SNP	ENST00000270162.6	37	CCDS33575.1	.	.	.	.	.	.	.	.	.	.	G	0.014	-1.574741	0.00887	.	.	ENSG00000142178	ENST00000270162	T	0.71341	-0.56	4.79	3.91	0.45181	.	0.314575	0.29314	N	0.012505	T	0.48768	0.1518	L	0.29908	0.895	0.09310	N	1	B	0.23442	0.085	B	0.16722	0.016	T	0.28839	-1.0031	10	0.07644	T	0.81	.	4.4526	0.11628	0.2351:0.1812:0.5837:0.0	.	524	P57059	SIK1_HUMAN	S	524	ENSP00000270162:P524S	ENSP00000270162:P524S	P	-	1	0	SIK1	43662742	1.000000	0.71417	0.460000	0.27093	0.001000	0.01503	1.862000	0.39448	1.013000	0.39391	-0.137000	0.14449	CCG	.		0.701	SIK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195654.1	NM_173354	
SLC18A2	6571	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	119001223	119001223	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr10:119001223G>C	ENST00000298472.5	+	2	162	c.19G>C	c.(19-21)Gcg>Ccg	p.A7P	SLC18A2_ENST00000497497.1_3'UTR|RP11-501J20.5_ENST00000425264.1_RNA	NM_003054.4	NP_003045.2	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 2	7					aging (GO:0007568)|cellular response to ammonium ion (GO:0071242)|cellular response to drug (GO:0035690)|death (GO:0016265)|dopamine transport (GO:0015872)|endocytic recycling (GO:0032456)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|negative regulation of neurotransmitter transport (GO:0051589)|neurotransmitter loading into synaptic vesicle (GO:0098700)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to corticosterone (GO:0051412)|response to herbicide (GO:0009635)|response to starvation (GO:0042594)|response to zinc ion (GO:0010043)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)|terminal bouton (GO:0043195)	amine transmembrane transporter activity (GO:0005275)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)|serotonin transmembrane transporter activity (GO:0015222)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)	29		Colorectal(252;0.19)		all cancers(201;0.029)	Amphetamine(DB00182)|Benzphetamine(DB00865)|Deserpidine(DB01089)|Dextroamphetamine(DB01576)|Ephedra(DB01363)|Ephedrine(DB01364)|Isometheptene(DB06706)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Propylhexedrine(DB06714)|Reserpine(DB00206)|Tetrabenazine(DB04844)	GAGCGAGCTGGCGCTGGTCCG	0.706																																					p.A7P		.											.	SLC18A2	90	0			c.G19C						.						19.0	19.0	19.0					10																	119001223		2202	4299	6501	SO:0001583	missense	6571	exon2			GAGCTGGCGCTGG	L14269	CCDS7599.1	10q25	2013-07-18	2013-07-18		ENSG00000165646	ENSG00000165646		"""Solute carriers"""	10935	protein-coding gene	gene with protein product		193001		VMAT2			Standard	NM_003054		Approved	SVMT, SVAT	uc001ldd.2	Q05940	OTTHUMG00000019121	ENST00000298472.5:c.19G>C	10.37:g.119001223G>C	ENSP00000298472:p.Ala7Pro	86.0	0.0		61.0	38.0	NM_003054	B2RC96|D3DRC4|Q15876|Q4G147|Q5VW49|Q9H3P6	Missense_Mutation	SNP	ENST00000298472.5	37	CCDS7599.1	.	.	.	.	.	.	.	.	.	.	G	17.02	3.281161	0.59758	.	.	ENSG00000165646	ENST00000298472	T	0.03889	3.77	5.09	4.19	0.49359	.	0.768875	0.12583	N	0.456298	T	0.02848	0.0085	N	0.04508	-0.205	0.09310	N	1	B	0.33448	0.412	B	0.30855	0.121	T	0.44997	-0.9291	10	0.56958	D	0.05	-7.9427	10.0113	0.41988	0.1614:0.0:0.8386:0.0	.	7	Q05940	VMAT2_HUMAN	P	7	ENSP00000298472:A7P	ENSP00000298472:A7P	A	+	1	0	SLC18A2	118991213	0.796000	0.28864	0.993000	0.49108	0.990000	0.78478	1.140000	0.31516	1.148000	0.42385	0.563000	0.77884	GCG	.		0.706	SLC18A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050563.1	NM_003054	
SLC25A12	8604	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	172700890	172700890	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr2:172700890G>A	ENST00000422440.2	-	5	491	c.454C>T	c.(454-456)Cag>Tag	p.Q152*	SLC25A12_ENST00000472748.1_5'UTR|SLC25A12_ENST00000392592.4_Nonsense_Mutation_p.Q45*	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12	152	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				aspartate transport (GO:0015810)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	TGGAGAAACTGCGTGAATTCT	0.333																																					p.Q152X		.											.	SLC25A12	90	0			c.C454T						.						147.0	162.0	157.0					2																	172700890		2203	4300	6503	SO:0001587	stop_gained	8604	exon5			GAAACTGCGTGAA	Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840		"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""			9722566, 10702666, 11566871	Standard	NM_003705		Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.454C>T	2.37:g.172700890G>A	ENSP00000388658:p.Gln152*	85.0	0.0		77.0	49.0	NM_003705	B3KR64|Q96AM8	Nonsense_Mutation	SNP	ENST00000422440.2	37	CCDS33327.1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.372544	0.42003	.	.	ENSG00000115840	ENST00000422440;ENST00000392592	.	.	.	5.8	5.8	0.92144	.	0.185538	0.48286	D	0.000198	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-8.4178	15.5404	0.76039	0.0:0.1374:0.8626:0.0	.	.	.	.	X	152;45	.	ENSP00000376371:Q45X	Q	-	1	0	SLC25A12	172409136	1.000000	0.71417	0.999000	0.59377	0.848000	0.48234	7.884000	0.87274	2.744000	0.94065	0.655000	0.94253	CAG	.		0.333	SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259010.2	NM_003705	
SLC44A5	204962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca|broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	75683603	75683604	+	Missense_Mutation	DNP	TG	TG	GT			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T|G	T|G	.	.	.	.	Unknown|.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr1:75683603_75683604TG>GT	ENST00000370855.5	-	18	1684_1685	c.1571_1572CA>AC	c.(1570-1572)gCA>gAC	p.A524D	SLC44A5_ENST00000370859.3_Missense_Mutation_p.A524D|SLC44A5_ENST00000535611.1_Missense_Mutation_p.A394D	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	524					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						TTTGAATTAATGCAATAATTAA	0.302																																					p.A524A|p.A524E		.											.	SLC44A5	95	0			c.A1572C|c.C1571A						.																																			SO:0001583	missense	204962	exon18			AATTAATGCAATA|ATTAATGCAATAA	BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.1571_1572delinsGT	1.37:g.75683603_75683604delinsGT	ENSP00000359892:p.Ala524Asp	126.0	0.0|1.0		102.0|99.0	71.0|69.0	NM_152697	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Silent|Missense_Mutation	SNP	ENST00000370855.5	37	CCDS667.1																																																																																			.		0.302	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	NM_152697	
SPATA5	166378	hgsc.bcm.edu;bcgsc.ca	37	4	123978434	123978445	+	Splice_Site	DEL	AAAGGGGCAGGT	AAAGGGGCAGGT	-			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	AAAGGGGCAGGT	AAAGGGGCAGGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr4:123978434_123978445delAAAGGGGCAGGT	ENST00000274008.4	+	13	2273_2282	c.2204_2213delAAAGGGGCAGGT	c.(2203-2214)gaaaggggcagg>gg	p.ERGR735del	SPATA5_ENST00000422835.2_3'UTR	NM_145207.2	NP_660208.2	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	735					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24						TTAGCAGTTGAAAGGGGCAGGTAAGAAGTATT	0.349																																					p.735_738del		.											.	SPATA5	90	0			c.2204_2213del						.																																			SO:0001630	splice_region_variant	166378	exon13			CAGTTGAAAGGGG	AF361489	CCDS3730.1	4q28.1	2010-04-21			ENSG00000145375	ENSG00000145375		"""ATPases / AAA-type"""	18119	protein-coding gene	gene with protein product	"""ATPase family gene 2 homolog (S. cerevisiae)"""	613940				16465403	Standard	NM_145207		Approved	SPAF, AFG2	uc003iez.4	Q8NB90	OTTHUMG00000133074	ENST00000274008.4:c.2213+1AAAGGGGCAGGT>-	4.37:g.123978434_123978445delAAAGGGGCAGGT		182.0	0.0		148.0	0.0	NM_145207	C9JT97|Q86XW1|Q8NI20|Q8TDL7	Frame_Shift_Del	DEL	ENST00000274008.4	37	CCDS3730.1																																																																																			.		0.349	SPATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256714.2	NM_145207	In_Frame_Del
SPTA1	6708	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	158590172	158590172	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr1:158590172G>T	ENST00000368147.4	-	44	6385	c.6205C>A	c.(6205-6207)Cct>Act	p.P2069T		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2069					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CAGTGCACAGGCTCTGACAAG	0.468																																					p.P2069T		.											.	SPTA1	142	0			c.C6205A						.						84.0	78.0	80.0					1																	158590172		1924	4149	6073	SO:0001583	missense	6708	exon44			GCACAGGCTCTGA	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6205C>A	1.37:g.158590172G>T	ENSP00000357129:p.Pro2069Thr	307.0	0.0		423.0	36.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.914933	0.52546	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.48836	0.8;0.8	5.05	3.16	0.36331	.	0.000000	0.31989	N	0.006747	T	0.49508	0.1561	M	0.72353	2.195	0.46774	D	0.999195	D	0.55605	0.972	D	0.68039	0.955	T	0.48091	-0.9065	10	0.33141	T	0.24	.	8.7768	0.34767	0.0795:0.0:0.7705:0.1501	.	2069	P02549	SPTA1_HUMAN	T	2069;2066	ENSP00000357130:P2069T;ENSP00000357129:P2066T	ENSP00000357129:P2066T	P	-	1	0	SPTA1	156856796	1.000000	0.71417	0.967000	0.41034	0.468000	0.32798	5.990000	0.70595	0.697000	0.31718	0.585000	0.79938	CCT	.		0.468	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
SPTBN2	6712	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66463896	66463896	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr11:66463896C>T	ENST00000533211.1	-	21	4461	c.4130G>A	c.(4129-4131)cGc>cAc	p.R1377H	SPTBN2_ENST00000529997.1_Missense_Mutation_p.R1377H|SPTBN2_ENST00000309996.2_Missense_Mutation_p.R1377H			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1377					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						AAAGAGGCTGCGGGCCTTGGC	0.632																																					p.R1377H		.											.	SPTBN2	155	0			c.G4130A						.						83.0	89.0	87.0					11																	66463896		2200	4295	6495	SO:0001583	missense	6712	exon20			AGGCTGCGGGCCT	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.4130G>A	11.37:g.66463896C>T	ENSP00000432568:p.Arg1377His	48.0	0.0		66.0	23.0	NM_006946	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	37	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.781893	0.90282	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.49432	0.78;0.78;0.78	4.85	4.85	0.62838	.	0.066599	0.64402	D	0.000004	T	0.62233	0.2411	M	0.75085	2.285	0.47994	D	0.999566	D	0.69078	0.997	P	0.60236	0.871	T	0.65685	-0.6108	10	0.66056	D	0.02	.	10.4728	0.44646	0.0:0.9098:0.0:0.0902	.	1377	O15020	SPTN2_HUMAN	H	1377	ENSP00000432568:R1377H;ENSP00000311489:R1377H;ENSP00000433593:R1377H	ENSP00000311489:R1377H	R	-	2	0	SPTBN2	66220472	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.599000	0.46231	2.531000	0.85337	0.557000	0.71058	CGC	.		0.632	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
STAT6	6778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57493655	57493655	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr12:57493655C>T	ENST00000300134.3	-	15	1964	c.1639G>A	c.(1639-1641)Gtt>Att	p.V547I	STAT6_ENST00000537215.2_Missense_Mutation_p.V437I|STAT6_ENST00000543873.2_Missense_Mutation_p.V547I|STAT6_ENST00000454075.3_Missense_Mutation_p.V547I|STAT6_ENST00000556155.1_Missense_Mutation_p.V547I|STAT6_ENST00000538913.2_Missense_Mutation_p.V437I	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	P42226	STAT6_HUMAN	signal transducer and activator of transcription 6, interleukin-4 induced	547	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|mammary gland epithelial cell proliferation (GO:0033598)|mammary gland morphogenesis (GO:0060443)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|T-helper 1 cell lineage commitment (GO:0002296)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein phosphatase binding (GO:0019903)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	28						AGGCTAGTAACGTACTGTTTG	0.557																																					p.V547I		.											.	STAT6	849	0			c.G1639A						.						100.0	92.0	95.0					12																	57493655		2203	4300	6503	SO:0001583	missense	6778	exon15			TAGTAACGTACTG	BC005823, BQ028928	CCDS8931.1, CCDS53804.1	12q13	2013-02-14				ENSG00000166888		"""SH2 domain containing"""	11368	protein-coding gene	gene with protein product		601512				9605853, 8085155	Standard	NM_003153		Approved	D12S1644, IL-4-STAT	uc001sna.3	P42226		ENST00000300134.3:c.1639G>A	12.37:g.57493655C>T	ENSP00000300134:p.Val547Ile	185.0	0.0		169.0	43.0	NM_001178079	A8K316|B7ZA27|F5GXI9|Q5FBW5|Q71UP4	Missense_Mutation	SNP	ENST00000300134.3	37	CCDS8931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.61|18.61	3.660387|3.660387	0.67586|0.67586	.|.	.|.	ENSG00000166888|ENSG00000166888	ENST00000553533|ENST00000300134;ENST00000535201;ENST00000538913;ENST00000543873;ENST00000556155;ENST00000537215;ENST00000454075;ENST00000542721;ENST00000542516;ENST00000555375	.|D;D;D;D;D;D;D	.|0.89196	.|-2.48;-2.48;-2.48;-2.48;-2.48;-2.48;-2.48	4.92|4.92	4.92|4.92	0.64577|0.64577	.|SH2 motif (4);	.|0.144343	.|0.46758	.|D	.|0.000268	D|D	0.88500|0.88500	0.6453|0.6453	L|L	0.27053|0.27053	0.805|0.805	0.42281|0.42281	D|D	0.992096|0.992096	.|D;P	.|0.58268	.|0.982;0.916	.|P;B	.|0.55785	.|0.784;0.387	D|D	0.90164|0.90164	0.4230|0.4230	5|10	.|0.72032	.|D	.|0.01	-23.5551|-23.5551	15.645|15.645	0.77042|0.77042	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|547;547	.|A8K4S9;P42226	.|.;STAT6_HUMAN	H|I	265|547;437;437;547;547;437;547;437;547;113	.|ENSP00000300134:V547I;ENSP00000445409:V437I;ENSP00000438451:V547I;ENSP00000451742:V547I;ENSP00000444530:V437I;ENSP00000401486:V547I;ENSP00000450921:V113I	.|ENSP00000300134:V547I	R|V	-|-	2|1	0|0	STAT6|STAT6	55779922|55779922	0.319000|0.319000	0.24607|0.24607	0.996000|0.996000	0.52242|0.52242	0.499000|0.499000	0.33736|0.33736	2.478000|2.478000	0.45189|0.45189	2.550000|2.550000	0.86006|0.86006	0.655000|0.655000	0.94253|0.94253	CGT|GTT	.		0.557	STAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412248.3	NM_003153	
STAB2	55576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	104149204	104149204	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr12:104149204A>G	ENST00000388887.2	+	62	7043	c.6839A>G	c.(6838-6840)aAc>aGc	p.N2280S	RP11-341G23.4_ENST00000551299.1_RNA	NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CCTAGACCCAACAAGAGTGAA	0.577																																					p.N2280S		.											.	STAB2	104	0			c.A6839G						.						149.0	127.0	135.0					12																	104149204		2203	4300	6503	SO:0001583	missense	55576	exon62			GACCCAACAAGAG	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.6839A>G	12.37:g.104149204A>G	ENSP00000373539:p.Asn2280Ser	149.0	0.0		156.0	86.0	NM_017564		Missense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	A	17.29	3.351579	0.61183	.	.	ENSG00000136011	ENST00000388887;ENST00000258495	T	0.31510	1.49	5.26	5.26	0.73747	C-type lectin fold (1);Link (3);C-type lectin-like (1);	0.112845	0.64402	D	0.000020	T	0.34221	0.0890	M	0.65975	2.015	0.44523	D	0.997477	B	0.33494	0.414	B	0.30716	0.119	T	0.23084	-1.0198	10	0.59425	D	0.04	.	15.2305	0.73383	1.0:0.0:0.0:0.0	.	2280	Q8WWQ8	STAB2_HUMAN	S	2280;967	ENSP00000373539:N2280S	ENSP00000258495:N967S	N	+	2	0	STAB2	102673334	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	8.606000	0.90888	1.989000	0.58080	0.529000	0.55759	AAC	.		0.577	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
STRIP1	85369	broad.mit.edu;bcgsc.ca	37	1	110586378	110586378	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr1:110586378T>C	ENST00000369795.3	+	10	1208	c.1186T>C	c.(1186-1188)Ttt>Ctt	p.F396L	STRIP1_ENST00000369796.1_Missense_Mutation_p.F301L	NM_033088.3	NP_149079.2	Q5VSL9	STRP1_HUMAN	striatin interacting protein 1	396					cortical actin cytoskeleton organization (GO:0030866)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)											GGGGGAGACGTTTCCCCTGGA	0.577																																					p.F396L		.											.	.	.	0			c.T1186C						.						71.0	65.0	67.0					1																	110586378		2203	4300	6503	SO:0001583	missense	85369	exon10			GAGACGTTTCCCC	AK027649	CCDS30798.1, CCDS59197.1	1p13.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000143093	ENSG00000143093			25916	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog A (yeast)"""		"""family with sequence similarity 40, member A"""	FAM40A		11214970, 12588993, 22782902, 22298706, 18782753	Standard	NM_033088		Approved	FLJ14743, KIAA1761, FAR11A	uc001dza.2	Q5VSL9	OTTHUMG00000170607	ENST00000369795.3:c.1186T>C	1.37:g.110586378T>C	ENSP00000358810:p.Phe396Leu	181.0	0.0		162.0	7.0	NM_033088	Q0V925|Q5VSL8|Q658K2|Q6ZV31|Q8N598|Q96SN2|Q9C0A2	Missense_Mutation	SNP	ENST00000369795.3	37	CCDS30798.1	.	.	.	.	.	.	.	.	.	.	T	15.34	2.804080	0.50315	.	.	ENSG00000143093	ENST00000369796;ENST00000369795	T;T	0.40756	1.02;1.02	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.20700	0.0498	L	0.44542	1.39	0.80722	D	1	B;B	0.32893	0.106;0.389	B;B	0.28709	0.069;0.093	T	0.05131	-1.0904	10	0.20519	T	0.43	-19.7728	16.1117	0.81270	0.0:0.0:0.0:1.0	.	301;396	Q5VSL9-2;Q5VSL9	.;FA40A_HUMAN	L	301;396	ENSP00000358811:F301L;ENSP00000358810:F396L	ENSP00000358810:F396L	F	+	1	0	FAM40A	110387901	0.997000	0.39634	0.870000	0.34147	0.887000	0.51463	2.980000	0.49321	2.287000	0.76781	0.482000	0.46254	TTT	.		0.577	STRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032213.1	NM_033088	
SYCP2	10388	hgsc.bcm.edu;broad.mit.edu	37	20	58467120	58467121	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr20:58467120_58467121insT	ENST00000357552.3	-	24	2513_2514	c.2288_2289insA	c.(2287-2289)aatfs	p.N763fs	SYCP2_ENST00000371001.2_Frame_Shift_Ins_p.N763fs			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	763					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			GACTTTGCACATTTTTGCTAGC	0.322																																					p.N763fs		.											.	SYCP2	525	0			c.2289_2290insA						.																																			SO:0001589	frameshift_variant	10388	exon23			TTGCACATTTTTG	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.2289dupA	20.37:g.58467125_58467125dupT	ENSP00000350162:p.Asn763fs	150.0	0.0		195.0	15.0	NM_014258	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Frame_Shift_Ins	INS	ENST00000357552.3	37	CCDS13482.1																																																																																			.		0.322	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258	
SYNGAP1	8831	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	33411166	33411166	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr6:33411166G>C	ENST00000418600.2	+	15	2938	c.2837G>C	c.(2836-2838)gGa>gCa	p.G946A	SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000428982.2_Missense_Mutation_p.G887A|SYNGAP1_ENST00000293748.5_Missense_Mutation_p.G946A	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	946					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						GGCGGCCATGGAGGGGGCGGT	0.657																																					p.G946A		.											.	SYNGAP1	48	0			c.G2837C						.						86.0	93.0	91.0					6																	33411166		2202	4299	6501	SO:0001583	missense	8831	exon15			GCCATGGAGGGGG	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.2837G>C	6.37:g.33411166G>C	ENSP00000403636:p.Gly946Ala	104.0	0.0		123.0	71.0	NM_006772	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	ENST00000418600.2	37	CCDS34434.2	.	.	.	.	.	.	.	.	.	.	G	1.835	-0.468821	0.04445	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	D;D;D	0.86562	-2.14;-2.14;-2.14	4.53	2.69	0.31865	.	0.953693	0.08554	N	0.928610	T	0.54431	0.1858	N	0.08118	0	0.23787	N	0.996849	P;P;P	0.38827	0.649;0.597;0.597	B;B;B	0.35727	0.209;0.133;0.133	T	0.46830	-0.9163	10	0.15066	T	0.55	.	10.7869	0.46411	0.0:0.3736:0.6264:0.0	.	946;946;946	Q96PV0;Q96PV0-2;Q96PV0-4	SYGP1_HUMAN;.;.	A	946;946;932;887	ENSP00000293748:G946A;ENSP00000403636:G946A;ENSP00000412475:G887A	ENSP00000293748:G946A	G	+	2	0	SYNGAP1	33519144	1.000000	0.71417	0.395000	0.26283	0.941000	0.58515	1.951000	0.40333	0.507000	0.28148	0.491000	0.48974	GGA	.		0.657	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407	
SYNPO2L	79933	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	10	75414002	75414002	+	Nonsense_Mutation	SNP	G	G	A	rs543087941		TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr10:75414002G>A	ENST00000394810.2	-	2	291	c.142C>T	c.(142-144)Cga>Tga	p.R48*	RP11-464F9.21_ENST00000607450.1_RNA|RP11-464F9.21_ENST00000606726.1_RNA	NM_001114133.1	NP_001107605.1	Q9H987	SYP2L_HUMAN	synaptopodin 2-like	48	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cytoskeleton (GO:0005856)|nucleus (GO:0005634)|Z disc (GO:0030018)				breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Prostate(51;0.0112)					TCCCTCTCTCGGAGTCCTGCT	0.532																																					p.R48X		.											.	SYNPO2L	91	0			c.C142T						.						111.0	97.0	101.0					10																	75414002		692	1591	2283	SO:0001587	stop_gained	79933	exon2			TCTCTCGGAGTCC	AK022983	CCDS7331.1, CCDS44438.1	10q22.3	2007-12-19			ENSG00000166317	ENSG00000166317			23532	protein-coding gene	gene with protein product							Standard	XM_005270158		Approved	FLJ12921	uc001jut.4	Q9H987	OTTHUMG00000018471	ENST00000394810.2:c.142C>T	10.37:g.75414002G>A	ENSP00000378289:p.Arg48*	175.0	0.0		143.0	14.0	NM_001114133	A5PKV9|Q68A20	Nonsense_Mutation	SNP	ENST00000394810.2	37	CCDS44438.1	.	.	.	.	.	.	.	.	.	.	G	36	5.964151	0.97151	.	.	ENSG00000166317	ENST00000372872;ENST00000394810	.	.	.	5.31	4.32	0.51571	.	0.201703	0.32819	U	0.005619	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-0.8396	5.8295	0.18572	0.1296:0.0:0.6637:0.2067	.	.	.	.	X	48	.	ENSP00000361963:R48X	R	-	1	2	SYNPO2L	75084008	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.961000	0.40432	2.495000	0.84180	0.455000	0.32223	CGA	.		0.532	SYNPO2L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316562.2	NM_024875	
T	6862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	166571945	166571945	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr6:166571945G>A	ENST00000296946.2	-	9	1634	c.1166C>T	c.(1165-1167)cCg>cTg	p.P389L	T_ENST00000366871.3_Missense_Mutation_p.P331L	NM_003181.3	NP_003172.1	O15178	BRAC_HUMAN	T, brachyury homolog (mouse)	389					anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|canonical Wnt signaling pathway (GO:0060070)|determination of heart left/right asymmetry (GO:0061371)|embryonic skeletal system development (GO:0048706)|heart morphogenesis (GO:0003007)|mesoderm development (GO:0007498)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate morphogenesis (GO:0001839)|neural tube closure (GO:0001843)|notochord formation (GO:0014028)|penetration of zona pellucida (GO:0007341)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|signal transduction (GO:0007165)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		CGCCGAGACCGGATGGGTGAG	0.726									Chordoma, Familial Clustering of																												p.P389L		.											.	T	516	0			c.C1166T						.						44.0	53.0	50.0					6																	166571945		2202	4298	6500	SO:0001583	missense	6862	exon9	Familial Cancer Database		GAGACCGGATGGG	AJ001699	CCDS5290.1, CCDS59045.1	6q27	2011-06-13	2001-11-28		ENSG00000164458	ENSG00000164458		"""T-boxes"""	11515	protein-coding gene	gene with protein product		601397	"""T brachyury (mouse) homolog"""			8963900	Standard	NM_003181		Approved		uc003quu.2	O15178	OTTHUMG00000015991	ENST00000296946.2:c.1166C>T	6.37:g.166571945G>A	ENSP00000296946:p.Pro389Leu	117.0	0.0		151.0	48.0	NM_003181	E7ERD6|Q4KMP4	Missense_Mutation	SNP	ENST00000296946.2	37	CCDS5290.1	.	.	.	.	.	.	.	.	.	.	G	5.921	0.353923	0.11182	.	.	ENSG00000164458	ENST00000366876;ENST00000296946;ENST00000366871	D;D	0.83419	-1.68;-1.72	4.71	2.86	0.33363	.	1.373470	0.04839	N	0.440181	T	0.63651	0.2529	L	0.54323	1.7	0.19575	N	0.999966	B;B;B	0.26547	0.152;0.001;0.044	B;B;B	0.10450	0.005;0.0;0.003	T	0.53092	-0.8487	10	0.12103	T	0.63	.	13.9359	0.64026	0.0:0.3165:0.6835:0.0	.	331;389;331	E7ERD6;O15178;Q4KMP4	.;BRAC_HUMAN;.	L	389;389;331	ENSP00000296946:P389L;ENSP00000355836:P331L	ENSP00000296946:P389L	P	-	2	0	T	166491935	0.815000	0.29118	0.000000	0.03702	0.001000	0.01503	4.591000	0.61019	0.459000	0.27016	-0.176000	0.13171	CCG	.		0.726	T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043037.2	NM_003181	
TAF1	6872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	70617219	70617219	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chrX:70617219G>A	ENST00000373790.4	+	23	3571	c.3520G>A	c.(3520-3522)Gaa>Aaa	p.E1174K	TAF1_ENST00000276072.3_Missense_Mutation_p.E1195K|TAF1_ENST00000449580.1_Missense_Mutation_p.E1174K|TAF1_ENST00000423759.1_Missense_Mutation_p.E1195K	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	1174					cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				GTTTCGAGATGAAGAGGGGAA	0.468																																					p.E1195K		.											.	TAF1	900	0			c.G3583A						.						185.0	130.0	149.0					X																	70617219		2203	4300	6503	SO:0001583	missense	6872	exon23			CGAGATGAAGAGG		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.3520G>A	X.37:g.70617219G>A	ENSP00000362895:p.Glu1174Lys	520.0	1.0		569.0	217.0	NM_004606	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	ENST00000373790.4	37	CCDS35325.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	25.2|25.2	4.613278|4.613278	0.87359|0.87359	.|.	.|.	ENSG00000147133|ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072|ENST00000483985	T;T;T;T|.	0.18174|.	2.23;2.23;2.23;2.23|.	4.91|4.91	4.91|4.91	0.64330|0.64330	.|.	0.193008|.	0.53938|.	D|.	0.000054|.	T|T	0.68933|0.68933	0.3055|0.3055	L|L	0.49571|0.49571	1.57|1.57	0.80722|0.80722	D|D	1|1	B;P;P|.	0.45348|.	0.029;0.774;0.856|.	B;B;P|.	0.47645|.	0.096;0.351;0.553|.	T|T	0.66709|0.66709	-0.5855|-0.5855	10|5	0.10902|.	T|.	0.67|.	.|.	17.5217|17.5217	0.87789|0.87789	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1174;1174;1195|.	P21675-4;P21675;P21675-2|.	.;TAF1_HUMAN;.|.	K|I	1174;1174;1195;1195|84	ENSP00000362895:E1174K;ENSP00000389000:E1174K;ENSP00000406549:E1195K;ENSP00000276072:E1195K|.	ENSP00000276072:E1195K|.	E|M	+|+	1|3	0|0	TAF1|TAF1	70533944|70533944	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.198000|9.198000	0.94994|0.94994	2.322000|2.322000	0.78497|0.78497	0.449000|0.449000	0.29647|0.29647	GAA|ATG	.		0.468	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	
TBC1D8	11138	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	101670763	101670763	+	Silent	SNP	G	G	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr2:101670763G>A	ENST00000376840.4	-	4	392	c.393C>T	c.(391-393)gcC>gcT	p.A131A	TBC1D8_ENST00000409318.1_Silent_p.A146A			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	131					blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						CCTCCTGCTCGGCGAGCCTGC	0.602																																					p.A131A		.											.	TBC1D8	25	0			c.C393T						.						22.0	25.0	24.0					2																	101670763		2022	4195	6217	SO:0001819	synonymous_variant	11138	exon4			CTGCTCGGCGAGC	AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.393C>T	2.37:g.101670763G>A		64.0	0.0		87.0	14.0	NM_001102426	A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Silent	SNP	ENST00000376840.4	37	CCDS46375.1																																																																																			.		0.602	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376092.1	NM_007063	
TCF4	6925	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	53018190	53018190	+	Silent	SNP	G	G	A	rs201061418		TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr18:53018190G>A	ENST00000356073.4	-	7	1025	c.414C>T	c.(412-414)acC>acT	p.T138T	TCF4_ENST00000567880.1_Intron|TCF4_ENST00000540999.1_Silent_p.T114T|TCF4_ENST00000565018.2_Silent_p.T138T|TCF4_ENST00000568740.1_Silent_p.T113T|TCF4_ENST00000398339.1_Silent_p.T240T|TCF4_ENST00000566286.1_Silent_p.T136T|TCF4_ENST00000543082.1_Silent_p.T96T|TCF4_ENST00000561992.1_Silent_p.T8T|TCF4_ENST00000566279.1_Intron|TCF4_ENST00000564403.2_Silent_p.T138T|TCF4_ENST00000568673.1_Silent_p.T114T|TCF4_ENST00000564228.1_Silent_p.T67T|TCF4_ENST00000354452.3_Silent_p.T138T|TCF4_ENST00000564999.1_Silent_p.T138T|TCF4_ENST00000537856.3_Silent_p.T8T|TCF4_ENST00000570177.2_Silent_p.T8T|TCF4_ENST00000544241.2_Silent_p.T67T|TCF4_ENST00000537578.1_Silent_p.T114T	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	138					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		TGGGCGAAAGGGTTCCTGGGT	0.438																																					p.T240T		.											.	TCF4	523	0			c.C720T						.						115.0	109.0	111.0					18																	53018190		2203	4300	6503	SO:0001819	synonymous_variant	6925	exon8			CGAAAGGGTTCCT	M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.414C>T	18.37:g.53018190G>A		182.0	1.0		205.0	102.0	NM_001243226	B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Silent	SNP	ENST00000356073.4	37	CCDS11960.1																																																																																			G|0.999;C|0.000		0.438	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256014.1	NM_003199	
TCP10L	140290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	33954534	33954534	+	Silent	SNP	G	G	A	rs531845693		TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr21:33954534G>A	ENST00000300258.3	-	3	449	c.336C>T	c.(334-336)caC>caT	p.H112H	TCP10L_ENST00000472557.1_Silent_p.H26H|AP000275.65_ENST00000553001.1_Silent_p.H286H	NM_144659.5	NP_653260.1	Q8TDR4	TCP1L_HUMAN	t-complex 10-like	112					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	protein self-association (GO:0043621)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)			breast(1)|central_nervous_system(1)|liver(1)|skin(1)	4						CTTGCCCCGCGTGTGGGGACG	0.498													G|||	1	0.000199681	0.0	0.0	5008	,	,		19625	0.001		0.0	False		,,,				2504	0.0				p.H112H		.											.	TCP10L	90	0			c.C336T						.						135.0	128.0	130.0					21																	33954534		2203	4300	6503	SO:0001819	synonymous_variant	140290	exon3			CCCCGCGTGTGGG	AF115967	CCDS13616.1	21p22.11	2012-09-20	2012-09-20		ENSG00000242220	ENSG00000242220			11657	protein-coding gene	gene with protein product		608365	"""t-complex 10 (a murine tcp homolog)-like"", ""t-complex 10 (mouse)-like"""			10830953	Standard	NM_144659		Approved	PRED77		Q8TDR4	OTTHUMG00000064901	ENST00000300258.3:c.336C>T	21.37:g.33954534G>A		321.0	0.0		240.0	112.0	NM_144659	Q53EW0|Q96LN5	Silent	SNP	ENST00000300258.3	37	CCDS13616.1	.	.	.	.	.	.	.	.	.	.	G	0.655	-0.807959	0.02819	.	.	ENSG00000159079	ENST00000431216	.	.	.	0.591	-1.18	0.09617	.	.	.	.	.	T	0.19967	0.0480	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21381	-1.0247	3	.	.	.	.	.	.	.	.	.	.	.	M	286	.	.	T	-	2	0	C21orf59	32876405	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.121000	0.10643	-1.291000	0.02368	-1.465000	0.01017	ACG	.		0.498	TCP10L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139350.1	NM_144659	
TECRL	253017	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	65274943	65274943	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr4:65274943C>T	ENST00000381210.3	-	1	237	c.127G>A	c.(127-129)Gcg>Acg	p.A43T	TECRL_ENST00000507440.1_Missense_Mutation_p.A43T	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	43					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						AGAGGGCCCGCTGAGAGTACA	0.388																																					p.A43T		.											.	TECRL	90	0			c.G127A						.						84.0	85.0	84.0					4																	65274943		2203	4300	6503	SO:0001583	missense	253017	exon1			GGCCCGCTGAGAG	AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.127G>A	4.37:g.65274943C>T	ENSP00000370607:p.Ala43Thr	123.0	0.0		123.0	12.0	NM_001010874		Missense_Mutation	SNP	ENST00000381210.3	37	CCDS33990.1	.	.	.	.	.	.	.	.	.	.	C	12.08	1.830169	0.32329	.	.	ENSG00000205678	ENST00000507440;ENST00000381210;ENST00000509536	T;T;T	0.46063	0.88;0.88;0.88	4.99	4.99	0.66335	.	0.250003	0.34531	N	0.003888	T	0.46560	0.1399	M	0.72118	2.19	0.31191	N	0.700919	P;P	0.46987	0.72;0.888	B;B	0.42163	0.275;0.378	T	0.62282	-0.6887	10	0.72032	D	0.01	-0.9371	15.3559	0.74425	0.0:1.0:0.0:0.0	.	43;43	Q6IN47;Q5HYJ1	.;TECRL_HUMAN	T	43	ENSP00000426043:A43T;ENSP00000370607:A43T;ENSP00000422497:A43T	ENSP00000370607:A43T	A	-	1	0	TECRL	64957538	1.000000	0.71417	0.876000	0.34364	0.015000	0.08874	1.694000	0.37752	2.471000	0.83476	0.655000	0.94253	GCG	.		0.388	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361705.4	NM_001010874	
TENM3	55714	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	183601698	183601698	+	Missense_Mutation	SNP	G	G	A	rs193270446	byFrequency	TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr4:183601698G>A	ENST00000511685.1	+	10	1765	c.1642G>A	c.(1642-1644)Gcc>Acc	p.A548T	TENM3_ENST00000502950.1_3'UTR|TENM3_ENST00000406950.2_Missense_Mutation_p.A548T			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	548	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TTTCACAGCCGCCTGTCCAGT	0.542													G|||	2	0.000399361	0.0	0.0	5008	,	,		16671	0.002		0.0	False		,,,				2504	0.0				p.A548T		.											.	.	.	0			c.G1642A						.						92.0	91.0	91.0					4																	183601698		1954	4145	6099	SO:0001583	missense	55714	exon9			ACAGCCGCCTGTC	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.1642G>A	4.37:g.183601698G>A	ENSP00000424226:p.Ala548Thr	123.0	0.0		161.0	46.0	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	37	CCDS47165.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	16.39	3.111021	0.56398	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	T;T	0.11277	2.79;2.79	5.39	5.39	0.77823	.	.	.	.	.	T	0.10337	0.0253	L	0.35723	1.085	0.58432	D	0.999994	B	0.28439	0.212	B	0.23852	0.049	T	0.18999	-1.0319	9	0.11794	T	0.64	.	19.3405	0.94339	0.0:0.0:1.0:0.0	.	548	Q9P273	TEN3_HUMAN	T	548	ENSP00000424226:A548T;ENSP00000385276:A548T	ENSP00000385276:A548T	A	+	1	0	ODZ3	183838692	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	6.358000	0.73055	2.791000	0.96007	0.655000	0.94253	GCC	G|0.999;A|0.001		0.542	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
TINAG	27283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	54186162	54186162	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr6:54186162C>T	ENST00000259782.4	+	3	583	c.487C>T	c.(487-489)Cag>Tag	p.Q163*	TINAG_ENST00000370864.3_Nonsense_Mutation_p.Q145*|TINAG_ENST00000370869.3_Nonsense_Mutation_p.Q159*|TINAG_ENST00000486436.1_3'UTR	NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	163					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			ATTAATTGAACAGGTCAATAA	0.388																																					p.Q163X		.											.	TINAG	93	0			c.C487T						.						128.0	117.0	121.0					6																	54186162		2203	4300	6503	SO:0001587	stop_gained	27283	exon3			ATTGAACAGGTCA	AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.487C>T	6.37:g.54186162C>T	ENSP00000259782:p.Gln163*	49.0	0.0		44.0	26.0	NM_014464	Q5T467|Q9UJW1|Q9ULZ4	Nonsense_Mutation	SNP	ENST00000259782.4	37	CCDS4955.1	.	.	.	.	.	.	.	.	.	.	C	17.62	3.435287	0.62955	.	.	ENSG00000137251	ENST00000370869;ENST00000259782;ENST00000370864	.	.	.	5.79	1.25	0.21368	.	1.259680	0.05190	N	0.502868	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	4.6647	0.12659	0.3102:0.494:0.0:0.1958	.	.	.	.	X	159;163;145	.	ENSP00000259782:Q163X	Q	+	1	0	TINAG	54294121	0.012000	0.17670	0.025000	0.17156	0.639000	0.38242	0.221000	0.17680	0.290000	0.22444	-0.309000	0.09137	CAG	.		0.388	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040984.1	NM_014464	
TMPRSS7	344805	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	111794166	111794166	+	Splice_Site	SNP	A	A	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr3:111794166A>G	ENST00000452346.2	+	15	1786		c.e15-1		TMPRSS7_ENST00000419127.1_Splice_Site			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7						proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TCTCCACCAAAGCCTGCAGCA	0.532																																					.		.											.	TMPRSS7	70	0			c.1406-2A>G						.						77.0	82.0	80.0					3																	111794166		1960	4153	6113	SO:0001630	splice_region_variant	344805	exon13			CACCAAAGCCTGC	BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.1784-1A>G	3.37:g.111794166A>G		109.0	0.0		104.0	6.0	NM_001042575	C9J8P7|E9PAS3|Q17RH4	Splice_Site	SNP	ENST00000452346.2	37		.	.	.	.	.	.	.	.	.	.	A	16.78	3.217759	0.58560	.	.	ENSG00000176040	ENST00000452346;ENST00000443106;ENST00000437906;ENST00000419127	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1495	0.72687	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMPRSS7	113276856	1.000000	0.71417	0.994000	0.49952	0.557000	0.35523	4.074000	0.57577	2.210000	0.71456	0.533000	0.62120	.	.		0.532	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000347592.2	XM_293599	Intron
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7579312	7579312	+	Splice_Site	SNP	C	C	A	rs55863639		TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr17:7579312C>A	ENST00000269305.4	-	4	564	c.375G>T	c.(373-375)acG>acT	p.T125T	TP53_ENST00000413465.2_Splice_Site_p.T125T|TP53_ENST00000420246.2_Splice_Site_p.T125T|TP53_ENST00000455263.2_Splice_Site_p.T125T|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Splice_Site_p.T125T|TP53_ENST00000359597.4_Splice_Site_p.T125T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	125	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		T -> A (in a sporadic cancer; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).|T -> M (in sporadic cancers; somatic mutation).|T -> P (in a sporadic cancer; somatic mutation).|T -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.T125T(51)|p.0?(8)|p.?(2)|p.V73fs*9(1)|p.G105_T125del21(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCAACTGACCGTGCAAGTCA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.T125T	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,mouth,carcinoma,-1	TP53	70225	66	Substitution - coding silent(51)|Whole gene deletion(8)|Deletion - Frameshift(3)|Unknown(2)|Deletion - In frame(1)|Insertion - In frame(1)	lung(21)|haematopoietic_and_lymphoid_tissue(14)|large_intestine(8)|upper_aerodigestive_tract(7)|bone(4)|central_nervous_system(3)|biliary_tract(3)|stomach(1)|liver(1)|urinary_tract(1)|kidney(1)|ovary(1)|pancreas(1)	c.G375T	GRCh37	CS004351|CS011573|CS971913	TP53	S	rs55863639	.						66.0	61.0	63.0					17																	7579312		2203	4300	6503	SO:0001630	splice_region_variant	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	ACTGACCGTGCAA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.375+1G>T	17.37:g.7579312C>A		157.0	0.0		159.0	124.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Silent	SNP	ENST00000269305.4	37	CCDS11118.1																																																																																			.		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Silent
TRAF7	84231	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2225896	2225896	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr16:2225896A>T	ENST00000326181.6	+	18	1820	c.1688A>T	c.(1687-1689)tAc>tTc	p.Y563F		NM_032271.2	NP_115647.2	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7, E3 ubiquitin protein ligase	563					activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of MAPK cascade (GO:0043410)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle (GO:0031410)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	23						GGCAGCGTCTACTCCATTGCT	0.577																																					p.Y563F		.											.	TRAF7	661	0			c.A1688T						.						150.0	114.0	126.0					16																	2225896		2197	4300	6497	SO:0001583	missense	84231	exon18			GCGTCTACTCCAT	AL136921	CCDS10461.1	16p13.3	2013-01-10	2012-02-23	2004-06-04	ENSG00000131653	ENSG00000131653		"""RING-type (C3HC4) zinc fingers"", ""WD repeat domain containing"""	20456	protein-coding gene	gene with protein product		606692	"""ring finger and WD repeat domain 1"", ""TNF receptor-associated factor 7"""	RFWD1		11230166, 15001576	Standard	NM_032271		Approved	RNF119, DKFZp586I021, MGC7807	uc002cow.3	Q6Q0C0	OTTHUMG00000128826	ENST00000326181.6:c.1688A>T	16.37:g.2225896A>T	ENSP00000318944:p.Tyr563Phe	195.0	1.0		217.0	87.0	NM_032271	Q9H073	Missense_Mutation	SNP	ENST00000326181.6	37	CCDS10461.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.665593	0.88251	.	.	ENSG00000131653	ENST00000326181	T	0.18502	2.21	5.01	3.91	0.45181	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.34454	0.0898	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.02774	-1.1112	10	0.40728	T	0.16	-47.6465	9.6466	0.39872	0.9169:0.0:0.0831:0.0	.	563	Q6Q0C0	TRAF7_HUMAN	F	563	ENSP00000318944:Y563F	ENSP00000318944:Y563F	Y	+	2	0	TRAF7	2165897	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.770000	0.68873	2.026000	0.59711	0.459000	0.35465	TAC	.		0.577	TRAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250762.1	NM_032271	
TRIP12	9320	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	230672989	230672989	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr2:230672989T>A	ENST00000283943.5	-	15	2352	c.2174A>T	c.(2173-2175)tAt>tTt	p.Y725F	TRIP12_ENST00000389045.3_Missense_Mutation_p.Y428F|TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389044.4_Missense_Mutation_p.Y773F	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	725					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TGTCAGTTCATACAACTCTTG	0.488																																					p.Y725F		.											.	TRIP12	572	0			c.A2174T						.						87.0	84.0	85.0					2																	230672989		2203	4300	6503	SO:0001583	missense	9320	exon15			AGTTCATACAACT	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.2174A>T	2.37:g.230672989T>A	ENSP00000283943:p.Tyr725Phe	43.0	0.0		30.0	5.0	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	ENST00000283943.5	37	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	T	18.31	3.596126	0.66332	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	T;T;T	0.34859	1.34;1.34;1.34	5.43	5.43	0.79202	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.42787	0.1218	N	0.20807	0.61	0.80722	D	1	D;P;P;P	0.63880	0.993;0.956;0.956;0.956	D;D;D;D	0.68192	0.956;0.931;0.931;0.931	T	0.22871	-1.0204	10	0.20519	T	0.43	.	15.7854	0.78297	0.0:0.0:0.0:1.0	.	731;428;773;725	D4HL82;Q14CF1;Q14CA3;Q14669	.;.;.;TRIPC_HUMAN	F	725;428;773	ENSP00000283943:Y725F;ENSP00000373697:Y428F;ENSP00000373696:Y773F	ENSP00000283943:Y725F	Y	-	2	0	TRIP12	230381233	1.000000	0.71417	0.994000	0.49952	0.910000	0.53928	7.953000	0.87836	2.187000	0.69744	0.383000	0.25322	TAT	.		0.488	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
TROVE2	6738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	193046176	193046176	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr1:193046176T>G	ENST00000367446.3	+	5	1292	c.1082T>G	c.(1081-1083)tTt>tGt	p.F361C	TROVE2_ENST00000367441.1_Missense_Mutation_p.F361C|TROVE2_ENST00000432079.1_Missense_Mutation_p.F86C|TROVE2_ENST00000416058.2_Missense_Mutation_p.F86C|TROVE2_ENST00000367444.3_Missense_Mutation_p.F361C|TROVE2_ENST00000400968.2_Missense_Mutation_p.F361C|TROVE2_ENST00000367445.3_Missense_Mutation_p.F361C|TROVE2_ENST00000460715.2_3'UTR|TROVE2_ENST00000367443.1_Missense_Mutation_p.F361C	NM_004600.5	NP_004591.2	P10155	RO60_HUMAN	TROVE domain family, member 2	361	TROVE. {ECO:0000255|PROSITE- ProRule:PRU00343}.|VWFA-like domain. {ECO:0000250}.				cilium morphogenesis (GO:0060271)|immune system development (GO:0002520)|response to UV (GO:0009411)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|RNA binding (GO:0003723)|U2 snRNA binding (GO:0030620)			biliary_tract(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|urinary_tract(1)	21						TATAAAACATTTAAGGTAGTG	0.294																																					p.F361C		.											.	TROVE2	115	0			c.T1082G						.						53.0	49.0	50.0					1																	193046176		1824	4079	5903	SO:0001583	missense	6738	exon5			AAACATTTAAGGT	BC036658	CCDS41449.1, CCDS1379.1, CCDS41450.1, CCDS41450.2, CCDS53451.1	1q31	2014-08-06	2005-06-14	2005-06-14	ENSG00000116747	ENSG00000116747			11313	protein-coding gene	gene with protein product		600063	"""Sjogren syndrome antigen A2 (60kDa, ribonucleoprotein autoantigen SS-A/Ro)"""	SSA2		8188321	Standard	NM_001042369		Approved	Ro60	uc001gss.3	P10155	OTTHUMG00000035675	ENST00000367446.3:c.1082T>G	1.37:g.193046176T>G	ENSP00000356416:p.Phe361Cys	90.0	0.0		154.0	64.0	NM_004600	B2RBB9|Q5LJ98|Q5LJ99|Q5LJA0|Q86WL3|Q86WL4|Q92787|Q9H1W6	Missense_Mutation	SNP	ENST00000367446.3	37	CCDS1379.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.985311	0.74474	.	.	ENSG00000116747	ENST00000400968;ENST00000416058;ENST00000367446;ENST00000367443;ENST00000367445;ENST00000367444;ENST00000367441	T;T;T;T;T;T;T	0.17213	2.29;2.29;2.29;2.29;2.29;2.29;2.29	5.81	5.81	0.92471	TROVE (2);	0.095324	0.64402	D	0.000001	T	0.49029	0.1533	M	0.89095	3.005	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.99;0.99;0.998;0.998	T	0.54118	-0.8341	10	0.42905	T	0.14	-17.0419	15.8769	0.79170	0.0:0.0:0.0:1.0	.	361;361;361;361	Q5LJ99;Q5LJ98;Q5LJA0;P10155	.;.;.;RO60_HUMAN	C	361;86;361;361;361;361;361	ENSP00000383752:F361C;ENSP00000411421:F86C;ENSP00000356416:F361C;ENSP00000356413:F361C;ENSP00000356415:F361C;ENSP00000356414:F361C;ENSP00000356411:F361C	ENSP00000356411:F361C	F	+	2	0	TROVE2	191312799	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	6.480000	0.73604	2.234000	0.73211	0.524000	0.50904	TTT	.		0.294	TROVE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086688.1	NM_004600	
TRPS1	7227	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	116599692	116599692	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr8:116599692T>A	ENST00000220888.5	-	4	2356	c.2197A>T	c.(2197-2199)Ata>Tta	p.I733L	TRPS1_ENST00000519076.1_Missense_Mutation_p.I487L|TRPS1_ENST00000395715.3_Missense_Mutation_p.I746L|TRPS1_ENST00000520276.1_Missense_Mutation_p.I737L|TRPS1_ENST00000519674.1_Missense_Mutation_p.I733L			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	733	Mediates interaction with GLI3.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			ATGGTGGATATGGCATGACCG	0.493									Langer-Giedion syndrome																												p.I746L		.											.	TRPS1	229	0			c.A2236T						.						175.0	178.0	177.0					8																	116599692		2011	4170	6181	SO:0001583	missense	7227	exon5	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	TGGATATGGCATG	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.2197A>T	8.37:g.116599692T>A	ENSP00000220888:p.Ile733Leu	267.0	0.0		465.0	84.0	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	37		.	.	.	.	.	.	.	.	.	.	T	10.38	1.333963	0.24253	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276;ENST00000519674	D;D;D;D;T	0.98264	-4.83;-4.81;-4.78;-4.81;1.0	5.86	-6.22	0.02058	.	1.038030	0.07571	N	0.918556	D	0.94000	0.8078	N	0.14661	0.345	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.001;0.0;0.002	T	0.82566	-0.0393	10	0.49607	T	0.09	.	14.7677	0.69651	0.0:0.3719:0.0:0.6281	.	737;733;746	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	L	746;733;487;737;733	ENSP00000379065:I746L;ENSP00000220888:I733L;ENSP00000428910:I487L;ENSP00000428680:I737L;ENSP00000429174:I733L	ENSP00000220888:I733L	I	-	1	0	TRPS1	116668867	0.000000	0.05858	0.000000	0.03702	0.414000	0.31173	-0.779000	0.04659	-1.580000	0.01644	-0.242000	0.12053	ATA	.		0.493	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
UBE2D3	7323	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	103722609	103722609	+	Splice_Site	SNP	A	A	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr4:103722609A>C	ENST00000453744.2	-	6	818		c.e6+1		UBE2D3_ENST00000504211.1_Splice_Site|UBE2D3_ENST00000394801.4_Splice_Site|UBE2D3_ENST00000343106.5_Splice_Site|UBE2D3_ENST00000502404.1_Splice_Site|UBE2D3_ENST00000338145.3_Splice_Site|UBE2D3_ENST00000350435.7_Splice_Site|UBE2D3_ENST00000321805.7_Splice_Site|UBE2D3_ENST00000394804.2_Splice_Site|UBE2D3_ENST00000357194.6_Splice_Site|UBE2D3_ENST00000349311.8_Splice_Site|UBE2D3_ENST00000505207.1_Splice_Site|UBE2D3_ENST00000394803.5_Splice_Site|UBE2D3_ENST00000507845.1_Splice_Site	NM_181891.1	NP_871620.1	P61077	UB2D3_HUMAN	ubiquitin-conjugating enzyme E2D 3						apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|lung(3)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)		AGAAATATTTACCTTTAGAAA	0.308																																					.		.											.	UBE2D3	226	0			c.304+2T>G						.						57.0	61.0	60.0					4																	103722609		2203	4290	6493	SO:0001630	splice_region_variant	7323	exon7			ATATTTACCTTTA	U39318	CCDS3659.1, CCDS3660.1, CCDS3661.1, CCDS75172.1	4q24	2011-05-19	2011-05-19		ENSG00000109332	ENSG00000109332		"""Ubiquitin-conjugating enzymes E2"""	12476	protein-coding gene	gene with protein product		602963	"""ubiquitin-conjugating enzyme E2D 3 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)"""			8530467	Standard	NM_181886		Approved	UbcH5C	uc003hwl.3	P61077	OTTHUMG00000131119	ENST00000453744.2:c.304+1T>G	4.37:g.103722609A>C		274.0	0.0		239.0	179.0	NM_003340	A6NJ93|A6NJB1|A6NM99|P47986|Q6IB88|Q6NXS4|Q8N924	Splice_Site	SNP	ENST00000453744.2	37	CCDS3660.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.151496	0.78001	.	.	ENSG00000109332	ENST00000453744;ENST00000394801;ENST00000394803;ENST00000394804;ENST00000343106;ENST00000321805;ENST00000350435;ENST00000338145;ENST00000349311;ENST00000504211;ENST00000357194;ENST00000505207;ENST00000507845;ENST00000502404	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4591	0.75339	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	UBE2D3	103941719	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.030000	0.93725	2.105000	0.64084	0.477000	0.44152	.	.		0.308	UBE2D3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253791.2	NM_181893	Intron
UNC79	57578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	94079314	94079314	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr14:94079314A>T	ENST00000393151.2	+	27	3926	c.3926A>T	c.(3925-3927)aAg>aTg	p.K1309M	UNC79_ENST00000555664.1_Missense_Mutation_p.K1309M|UNC79_ENST00000553484.1_Missense_Mutation_p.K1331M|UNC79_ENST00000256339.4_Missense_Mutation_p.K1132M			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1309					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						AACACGGTCAAGCGACACCTG	0.478																																					p.K1132M		.											.	.	.	0			c.A3395T						.						140.0	116.0	124.0					14																	94079314		2203	4300	6503	SO:0001583	missense	57578	exon27			CGGTCAAGCGACA	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.3926A>T	14.37:g.94079314A>T	ENSP00000376858:p.Lys1309Met	136.0	0.0		104.0	84.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	A	22.9	4.350711	0.82132	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.19250	2.16;2.16;2.17;2.16	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.32645	0.0836	N	0.22421	0.69	0.50171	D	0.999859	D	0.89917	1.0	D	0.85130	0.997	T	0.06499	-1.0823	10	0.34782	T	0.22	-23.6572	15.7162	0.77670	1.0:0.0:0.0:0.0	.	1331	C9JQL1	.	M	1132;1309;1331;1309;1331	ENSP00000256339:K1132M;ENSP00000450868:K1309M;ENSP00000451360:K1331M;ENSP00000376858:K1309M	ENSP00000256339:K1132M	K	+	2	0	KIAA1409	93149067	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.115000	0.64714	0.528000	0.53228	AAG	.		0.478	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	216073535	216073535	+	Silent	SNP	C	C	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr1:216073535C>T	ENST00000307340.3	-	40	7862	c.7476G>A	c.(7474-7476)tcG>tcA	p.S2492S	USH2A_ENST00000366943.2_Silent_p.S2492S|RP5-1111A8.3_ENST00000414995.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2492	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CATAGCTTAACGATGCAGAAG	0.368										HNSCC(13;0.011)																											p.S2492S		.											.	USH2A	115	0			c.G7476A						.						116.0	100.0	105.0					1																	216073535		2203	4300	6503	SO:0001819	synonymous_variant	7399	exon40			GCTTAACGATGCA	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7476G>A	1.37:g.216073535C>T		62.0	0.0		94.0	35.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	CCDS31025.1																																																																																			.		0.368	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
VEGFC	7424	hgsc.bcm.edu;bcgsc.ca	37	4	177605087	177605087	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr4:177605087A>C	ENST00000280193.2	-	7	1668	c.1253T>G	c.(1252-1254)aTg>aGg	p.M418R	RP11-313E19.2_ENST00000509194.1_RNA|RP11-313E19.2_ENST00000504017.1_RNA	NM_005429.2	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	418					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|induction of positive chemotaxis (GO:0050930)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein secretion (GO:0050714)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to drug (GO:0042493)|signal transduction (GO:0007165)|substrate-dependent cell migration (GO:0006929)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)			biliary_tract(1)|cervix(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(2)|skin(2)	41		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		TTAGCTCATCATTTGTGGTCT	0.433																																					p.M418R		.											.	VEGFC	710	0			c.T1253G						.						130.0	119.0	122.0					4																	177605087		1871	4101	5972	SO:0001583	missense	7424	exon7			CTCATCATTTGTG	BC035212	CCDS43285.1	4q34.3	2013-02-18				ENSG00000150630			12682	protein-coding gene	gene with protein product	"""vascular endothelial growth factor-related protein"""	601528				8617204	Standard	NM_005429		Approved	VRP	uc003ius.1	P49767		ENST00000280193.2:c.1253T>G	4.37:g.177605087A>C	ENSP00000280193:p.Met418Arg	84.0	0.0		108.0	8.0	NM_005429	B2R9Q8	Missense_Mutation	SNP	ENST00000280193.2	37	CCDS43285.1	.	.	.	.	.	.	.	.	.	.	A	0.014	-1.591238	0.00864	.	.	ENSG00000150630	ENST00000280193	.	.	.	.	.	.	.	0.901625	0.09679	N	0.770027	T	0.26593	0.0650	N	0.24115	0.695	0.09310	N	1	B	0.20368	0.044	B	0.19946	0.027	T	0.29458	-1.0011	7	0.87932	D	0	.	.	.	.	.	418	P49767	VEGFC_HUMAN	R	418	.	ENSP00000280193:M418R	M	-	2	0	VEGFC	177842081	0.001000	0.12720	0.018000	0.16275	0.076000	0.17211	0.000000	0.12993	0.000000	0.14550	0.000000	0.15137	ATG	.		0.433	VEGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361991.1	NM_005429	
VEGFC	7424	hgsc.bcm.edu;bcgsc.ca	37	4	177605087	177605087	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr4:177605087delA	ENST00000280193.2	-	7	1668	c.1253delT	c.(1252-1254)atgfs	p.M419fs	RP11-313E19.2_ENST00000509194.1_RNA|RP11-313E19.2_ENST00000504017.1_RNA	NM_005429.2	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	0					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|induction of positive chemotaxis (GO:0050930)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein secretion (GO:0050714)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to drug (GO:0042493)|signal transduction (GO:0007165)|substrate-dependent cell migration (GO:0006929)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)			biliary_tract(1)|cervix(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(2)|skin(2)	41		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		TTAGCTCATCATTTGTGGTCT	0.433																																					p.M418fs		.											.	VEGFC	710	0			c.1253delT						.						130.0	119.0	122.0					4																	177605087		1871	4101	5972	SO:0001589	frameshift_variant	7424	exon7			CTCATCATTTGTG	BC035212	CCDS43285.1	4q34.3	2013-02-18				ENSG00000150630			12682	protein-coding gene	gene with protein product	"""vascular endothelial growth factor-related protein"""	601528				8617204	Standard	NM_005429		Approved	VRP	uc003ius.1	P49767		ENST00000280193.2:c.1253delT	4.37:g.177605087delA	ENSP00000280193:p.Met419fs	83.0	0.0		103.0	49.0	NM_005429	B2R9Q8	Frame_Shift_Del	DEL	ENST00000280193.2	37	CCDS43285.1																																																																																			.		0.433	VEGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361991.1	NM_005429	
WDFY4	57705	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	49917873	49917873	+	Silent	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr10:49917873A>T	ENST00000325239.5	+	1	123	c.96A>T	c.(94-96)ccA>ccT	p.P32P	WDFY4_ENST00000360890.2_Silent_p.P32P|WDFY4_ENST00000413659.2_Silent_p.P32P	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	32						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CTGATGTCCCACATGGAGGGC	0.532																																					p.P32P		.											.	WDFY4	22	0			c.A96T						.						82.0	80.0	80.0					10																	49917873		692	1591	2283	SO:0001819	synonymous_variant	57705	exon2			TGTCCCACATGGA	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.96A>T	10.37:g.49917873A>T		68.0	1.0		65.0	21.0	NM_020945	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	ENST00000325239.5	37	CCDS44385.1																																																																																			.		0.532	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
WDR64	128025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	241946598	241946598	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr1:241946598C>T	ENST00000366552.2	+	22	2797	c.2590C>T	c.(2590-2592)Cgt>Tgt	p.R864C	WDR64_ENST00000437684.2_Missense_Mutation_p.R697C	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	864										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			GCTTTCCTGGCGTGCTCATTC	0.373																																					p.R864C		.											.	WDR64	91	0			c.C2590T						.						70.0	66.0	67.0					1																	241946598		2203	4300	6503	SO:0001583	missense	128025	exon22			TCCTGGCGTGCTC	AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.2590C>T	1.37:g.241946598C>T	ENSP00000355510:p.Arg864Cys	98.0	0.0		139.0	14.0	NM_144625	B1ANT0|Q7Z573|Q96LY9	Missense_Mutation	SNP	ENST00000366552.2	37		.	.	.	.	.	.	.	.	.	.	C	23.1	4.370414	0.82573	.	.	ENSG00000162843	ENST00000366552;ENST00000437684;ENST00000414635	T;T;T	0.51071	0.72;0.88;0.72	5.66	5.66	0.87406	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.102421	0.43416	D	0.000562	T	0.73257	0.3564	M	0.87180	2.865	0.41243	D	0.986658	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.986	T	0.78170	-0.2308	10	0.87932	D	0	-6.1842	16.6706	0.85266	0.0:1.0:0.0:0.0	.	864;417	B1ANS9;D1MPS4	WDR64_HUMAN;.	C	864;697;468	ENSP00000355510:R864C;ENSP00000402446:R697C;ENSP00000406656:R468C	ENSP00000355510:R864C	R	+	1	0	WDR64	240013221	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.839000	0.39220	2.690000	0.91761	0.655000	0.94253	CGT	.		0.373	WDR64-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144625	
ZMYM3	9203	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	70467743	70467743	+	Silent	SNP	C	C	T	rs200745411		TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chrX:70467743C>T	ENST00000353904.2	-	12	2176	c.1989G>A	c.(1987-1989)ctG>ctA	p.L663L	ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373998.1_Silent_p.L663L|ZMYM3_ENST00000314425.5_Silent_p.L663L|ZMYM3_ENST00000373988.1_Silent_p.L665L|ZMYM3_ENST00000373984.3_Silent_p.L665L	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	663					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					CCTGTTTGTACAGCAGCACAC	0.517																																					p.L663L		.											.	ZMYM3	131	0			c.G1989A						.						53.0	38.0	43.0					X																	70467743		2203	4299	6502	SO:0001819	synonymous_variant	9203	exon12			TTTGTACAGCAGC	AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.1989G>A	X.37:g.70467743C>T		190.0	0.0		204.0	67.0	NM_005096	D3DVV3|O15089|Q96E26	Silent	SNP	ENST00000353904.2	37	CCDS14409.1																																																																																			.		0.517	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057154.1	NM_201599	
ZNF135	7694	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58578450	58578450	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr19:58578450G>C	ENST00000313434.5	+	5	699	c.598G>C	c.(598-600)Gac>Cac	p.D200H	ZNF135_ENST00000439855.2_Missense_Mutation_p.D200H|ZNF135_ENST00000401053.4_Missense_Mutation_p.D224H|ZNF135_ENST00000511556.1_Missense_Mutation_p.D212H|ZNF135_ENST00000359978.6_Missense_Mutation_p.D212H|RN7SL526P_ENST00000469492.2_RNA|ZNF135_ENST00000506786.1_Missense_Mutation_p.D158H	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	200					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		GGAGAAGCCAGACCTAAATGT	0.453																																					p.D224H		.											.	ZNF135	91	0			c.G670C						.						71.0	70.0	70.0					19																	58578450		2203	4300	6503	SO:0001583	missense	7694	exon4			AAGCCAGACCTAA	U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		ENST00000313434.5:c.598G>C	19.37:g.58578450G>C	ENSP00000321406:p.Asp200His	50.0	0.0		110.0	34.0	NM_007134	B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Missense_Mutation	SNP	ENST00000313434.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.302|0.302	-0.973322|-0.973322	0.02215|0.02215	.|.	.|.	ENSG00000176293|ENSG00000176293	ENST00000504540;ENST00000401053;ENST00000359978;ENST00000439855;ENST00000313434;ENST00000511556;ENST00000506786|ENST00000391699	T;T;T;T;T;T|.	0.06528|.	3.39;3.46;3.41;3.41;3.39;3.29|.	3.07|3.07	-0.607|-0.607	0.11615|0.11615	.|.	.|.	.|.	.|.	.|.	T|T	0.17874|0.17874	0.0429|0.0429	N|N	0.11560|0.11560	0.145|0.145	0.09310|0.09310	N|N	1|1	B;P;B|.	0.37731|.	0.003;0.607;0.01|.	B;B;B|.	0.25759|.	0.001;0.063;0.003|.	T|T	0.30794|0.30794	-0.9966|-0.9966	9|5	0.31617|.	T|.	0.26|.	.|.	8.121|8.121	0.30971|0.30971	0.1218:0.6271:0.2511:0.0|0.1218:0.6271:0.2511:0.0	.|.	212;200;212|.	E9PEV2;P52742;Q8N1I7|.	.;ZN135_HUMAN;.|.	H|H	212;224;212;200;200;212;158|217	ENSP00000441410:D224H;ENSP00000369437:D212H;ENSP00000444828:D200H;ENSP00000321406:D200H;ENSP00000422074:D212H;ENSP00000427691:D158H|.	ENSP00000321406:D200H|.	D|Q	+|+	1|3	0|2	ZNF135|ZNF135	63270262|63270262	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.106000|0.106000	0.19336|0.19336	-0.230000|-0.230000	0.09083|0.09083	-0.026000|-0.026000	0.13895|0.13895	-0.312000|-0.312000	0.09012|0.09012	GAC|CAG	.		0.453	ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000361899.2	NM_003436	
ZNF142	7701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	219508734	219508734	+	Silent	SNP	G	G	T	rs185508464	byFrequency	TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr2:219508734G>T	ENST00000449707.1	-	8	2926	c.2505C>A	c.(2503-2505)gcC>gcA	p.A835A	ZNF142_ENST00000411696.2_Silent_p.A835A	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	835					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GGCAGCGGAAGGCTCGCCCCT	0.612																																					p.A835A	Colon(170;867 1942 8995 15834 18053)	.											.	ZNF142	137	0			c.C2505A						.						153.0	162.0	159.0					2																	219508734		2079	4197	6276	SO:0001819	synonymous_variant	7701	exon8			GCGGAAGGCTCGC	U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.2505C>A	2.37:g.219508734G>T		114.0	0.0		114.0	30.0	NM_001105537	Q92510	Silent	SNP	ENST00000449707.1	37	CCDS42817.1																																																																																			G|0.998;A|0.002		0.612	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1	NM_005081	
ZNF260	339324	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	37005748	37005748	+	Silent	SNP	T	T	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr19:37005748T>A	ENST00000523638.1	-	3	1514	c.393A>T	c.(391-393)acA>acT	p.T131T	ZNF260_ENST00000593142.1_Silent_p.T131T|ZNF260_ENST00000592282.1_Silent_p.T131T|ZNF260_ENST00000588993.1_Silent_p.T131T	NM_001166036.1|NM_001166037.1|NM_001166038.1	NP_001159508.1|NP_001159509.1|NP_001159510.1	Q3ZCT1	ZN260_HUMAN	zinc finger protein 260	131					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)	15	Esophageal squamous(110;0.162)					GTTTGGTTCCTGTATGATTTT	0.388																																					p.T131T		.											.	ZNF260	90	0			c.A393T						.						162.0	160.0	161.0					19																	37005748		2203	4300	6503	SO:0001819	synonymous_variant	339324	exon3			GGTTCCTGTATGA	AK122854	CCDS33003.1	19q13.12	2013-01-08				ENSG00000254004		"""Zinc fingers, C2H2-type"""	13499	protein-coding gene	gene with protein product		613749					Standard	NM_001166036		Approved	ozrf1, Zfp260	uc002oed.2	Q3ZCT1		ENST00000523638.1:c.393A>T	19.37:g.37005748T>A		86.0	1.0		211.0	40.0	NM_001166038	Q0VF43	Silent	SNP	ENST00000523638.1	37	CCDS33003.1																																																																																			.		0.388	ZNF260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109564.2	NM_001012756	
ZNF224	7767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	44611314	44611314	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr19:44611314A>T	ENST00000336976.6	+	6	1255	c.1001A>T	c.(1000-1002)cAt>cTt	p.H334L	AC084219.4_ENST00000592946.1_RNA	NM_013398.2	NP_037530.2	Q9NZL3	ZN224_HUMAN	zinc finger protein 224	334					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	19		Prostate(69;0.0435)				CTTAATAGTCATCGCATGATC	0.433																																					p.H334L		.											.	ZNF224	92	0			c.A1001T						.						166.0	163.0	164.0					19																	44611314		2203	4300	6503	SO:0001583	missense	7767	exon6			ATAGTCATCGCAT	AF187990	CCDS33046.1	19q13.2	2013-01-08	2004-02-13			ENSG00000267680		"""Zinc fingers, C2H2-type"", ""-"""	13017	protein-coding gene	gene with protein product		194555	"""zinc finger protein 255"", ""zinc finger protein 27"""	ZNF255, ZNF27			Standard	NM_013398		Approved	BMZF-2, KOX22	uc002oyh.2	Q9NZL3		ENST00000336976.6:c.1001A>T	19.37:g.44611314A>T	ENSP00000337368:p.His334Leu	74.0	0.0		175.0	44.0	NM_013398	A6NFW9|P17033|Q86V10|Q8IZC8|Q9UID9|Q9Y2P6	Missense_Mutation	SNP	ENST00000336976.6	37	CCDS33046.1	.	.	.	.	.	.	.	.	.	.	a	19.03	3.746934	0.69418	.	.	ENSG00000186019	ENST00000336976	D	0.86865	-2.18	2.95	2.95	0.34219	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.95790	0.8630	H	0.98965	4.385	0.31912	N	0.614539	D	0.76494	0.999	D	0.81914	0.995	D	0.94367	0.7592	9	0.87932	D	0	.	10.9531	0.47341	1.0:0.0:0.0:0.0	.	334	Q9NZL3	ZN224_HUMAN	L	334	ENSP00000337368:H334L	ENSP00000337368:H334L	H	+	2	0	ZNF224	49303154	1.000000	0.71417	0.019000	0.16419	0.298000	0.27526	8.373000	0.90131	1.592000	0.50018	0.482000	0.46254	CAT	.		0.433	ZNF224-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460477.1	NM_013398	
ZNF354C	30832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	178505747	178505747	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr5:178505747C>A	ENST00000315475.6	+	5	620	c.314C>A	c.(313-315)aCa>aAa	p.T105K		NM_014594.1	NP_055409.1	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	105					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|urinary_tract(3)	30	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		ATAGAAGAAACATCTCAGGGA	0.388																																					p.T105K		.											.	ZNF354C	91	0			c.C314A						.						70.0	73.0	72.0					5																	178505747		2203	4300	6503	SO:0001583	missense	30832	exon5			AAGAAACATCTCA		CCDS4443.1	5q35	2013-01-08			ENSG00000177932	ENSG00000177932		"""Zinc fingers, C2H2-type"", ""-"""	16736	protein-coding gene	gene with protein product						10786630	Standard	NM_014594		Approved	KID3	uc003mju.3	Q86Y25	OTTHUMG00000130888	ENST00000315475.6:c.314C>A	5.37:g.178505747C>A	ENSP00000324064:p.Thr105Lys	153.0	0.0		168.0	19.0	NM_014594	Q6P4P9|Q8NFX1	Missense_Mutation	SNP	ENST00000315475.6	37	CCDS4443.1	.	.	.	.	.	.	.	.	.	.	C	0.246	-1.009890	0.02095	.	.	ENSG00000177932	ENST00000315475	T	0.04809	3.55	4.09	-0.353	0.12594	.	.	.	.	.	T	0.02807	0.0084	L	0.34521	1.04	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.48163	-0.9059	9	0.06099	T	0.92	-0.8541	3.0714	0.06231	0.3007:0.4563:0.1477:0.0953	.	105	Q86Y25	Z354C_HUMAN	K	105	ENSP00000324064:T105K	ENSP00000324064:T105K	T	+	2	0	ZNF354C	178438353	0.182000	0.23173	0.001000	0.08648	0.049000	0.14656	0.596000	0.24044	0.086000	0.17137	0.591000	0.81541	ACA	.		0.388	ZNF354C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253473.2		
ZNF91	7644	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	23544469	23544469	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr19:23544469C>T	ENST00000300619.7	-	4	1517	c.1312G>A	c.(1312-1314)Gaa>Aaa	p.E438K	ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000397082.2_Missense_Mutation_p.E406K|ZNF91_ENST00000596528.1_5'Flank	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	438					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TTGCCACATTCTTCACACTTG	0.338																																					p.E438K		.											.	ZNF91	90	0			c.G1312A						.						24.0	26.0	25.0					19																	23544469		2043	4215	6258	SO:0001583	missense	7644	exon4			CACATTCTTCACA	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.1312G>A	19.37:g.23544469C>T	ENSP00000300619:p.Glu438Lys	62.0	0.0		51.0	9.0	NM_003430	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	C	9.646	1.140215	0.21205	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.07327	3.2;3.2	1.47	-2.08	0.07254	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11024	0.0269	L	0.28192	0.835	0.09310	N	1	D;D	0.61080	0.984;0.989	P;P	0.56474	0.799;0.729	T	0.32107	-0.9919	9	0.62326	D	0.03	.	9.4396	0.38659	0.0:0.5941:0.4059:0.0	.	406;438	Q05481-2;Q05481	.;ZNF91_HUMAN	K	438;406	ENSP00000300619:E438K;ENSP00000380272:E406K	ENSP00000300619:E438K	E	-	1	0	ZNF91	23336309	0.000000	0.05858	0.027000	0.17364	0.021000	0.10359	-0.241000	0.08940	-0.034000	0.13713	-1.027000	0.02421	GAA	.		0.338	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	
ZNF567	163081	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	37210908	37210908	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-5259-01A-31D-A20W-10	TCGA-CC-5259-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b2e2280d-a133-4737-b089-f4aab5b894a3	17b4c09e-50c8-408e-999f-5b31e55417fe	g.chr19:37210908A>T	ENST00000536254.2	+	6	1504	c.1282A>T	c.(1282-1284)Aaa>Taa	p.K428*	ZNF567_ENST00000392163.2_Nonsense_Mutation_p.K397*|ZNF567_ENST00000588311.1_Nonsense_Mutation_p.K397*|ZNF567_ENST00000585696.1_Nonsense_Mutation_p.K397*|ZNF850_ENST00000589390.1_Intron|ZNF567_ENST00000360729.4_Nonsense_Mutation_p.K397*			Q8N184	ZN567_HUMAN	zinc finger protein 567	428					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			TGAATGTGGGAAATCCTTCTC	0.408																																					p.K397X		.											.	ZNF567	90	0			c.A1189T						.						54.0	58.0	57.0					19																	37210908		2203	4300	6503	SO:0001587	stop_gained	163081	exon4			TGTGGGAAATCCT	AK093034	CCDS12495.1, CCDS74349.1	19q13.12	2013-10-08				ENSG00000189042		"""Zinc fingers, C2H2-type"", ""-"""	28696	protein-coding gene	gene with protein product						12477932	Standard	XM_006723064		Approved	MGC45586	uc002oep.4	Q8N184		ENST00000536254.2:c.1282A>T	19.37:g.37210908A>T	ENSP00000441838:p.Lys428*	39.0	0.0		97.0	10.0	NM_152603	B3KX49|Q6N044	Nonsense_Mutation	SNP	ENST00000536254.2	37		.	.	.	.	.	.	.	.	.	.	A	36	5.785643	0.96937	.	.	ENSG00000189042	ENST00000536254;ENST00000378686;ENST00000360729;ENST00000423498;ENST00000392163	.	.	.	4.88	4.88	0.63580	.	0.000000	0.48286	D	0.000200	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.7584	0.57350	1.0:0.0:0.0:0.0	.	.	.	.	X	428;372;397;427;397	.	ENSP00000353957:K397X	K	+	1	0	ZNF567	41902748	1.000000	0.71417	0.758000	0.31321	0.973000	0.67179	8.427000	0.90275	2.176000	0.68965	0.459000	0.35465	AAA	.		0.408	ZNF567-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000453549.1	NM_152603	
