#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABR	29	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	973210	973210	+	Splice_Site	SNP	C	C	G			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr17:973210C>G	ENST00000302538.5	-	9	1161	c.1015G>C	c.(1015-1017)Ggg>Cgg	p.G339R	ABR_ENST00000574437.1_Splice_Site_p.G293R|ABR_ENST00000536794.2_Splice_Site_p.G121R|ABR_ENST00000291107.2_Splice_Site_p.G302R|ABR_ENST00000544583.2_Splice_Site_p.G293R	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	339	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		CACACTCACCCTGCAGAGGTC	0.652																																					p.G339R	Esophageal Squamous(197;2016 2115 4129 29033 46447)	.											.	ABR	91	0			c.G1015C						.						56.0	49.0	51.0					17																	973210		2203	4300	6503	SO:0001630	splice_region_variant	29	exon9			CTCACCCTGCAGA	L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.1016+1G>C	17.37:g.973210C>G		69.0	0.0		94.0	35.0	NM_021962	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Missense_Mutation	SNP	ENST00000302538.5	37	CCDS10999.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.408485	0.83340	.	.	ENSG00000159842	ENST00000302538;ENST00000544583;ENST00000291107;ENST00000536794;ENST00000382259	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.77	5.77	0.91146	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.57888	0.2084	M	0.72353	2.195	0.80722	D	1	D;D;D;D	0.89917	0.996;0.974;1.0;0.996	D;P;D;D	0.97110	0.978;0.78;1.0;0.978	T	0.58446	-0.7635	10	0.72032	D	0.01	.	18.9737	0.92725	0.0:1.0:0.0:0.0	.	121;223;302;339	B7Z683;Q6ZT60;Q12979-2;Q12979	.;.;.;ABR_HUMAN	R	339;293;302;121;223	ENSP00000303909:G339R;ENSP00000442048:G293R;ENSP00000291107:G302R;ENSP00000437429:G121R	ENSP00000291107:G302R	G	-	1	0	ABR	919960	1.000000	0.71417	0.965000	0.40720	0.347000	0.29111	7.800000	0.85949	2.735000	0.93741	0.555000	0.69702	GGG	.		0.652	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206675.4		Missense_Mutation
ABR	29	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	973214	973214	+	Silent	SNP	A	A	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr17:973214A>T	ENST00000302538.5	-	9	1157	c.1011T>A	c.(1009-1011)tcT>tcA	p.S337S	ABR_ENST00000574437.1_Silent_p.S291S|ABR_ENST00000536794.2_Silent_p.S119S|ABR_ENST00000291107.2_Silent_p.S300S|ABR_ENST00000544583.2_Silent_p.S291S	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	337	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		CTCACCCTGCAGAGGTCTTCT	0.652																																					p.S337S	Esophageal Squamous(197;2016 2115 4129 29033 46447)	.											.	ABR	91	0			c.T1011A						.						59.0	52.0	55.0					17																	973214		2203	4300	6503	SO:0001819	synonymous_variant	29	exon9			CCCTGCAGAGGTC	L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.1011T>A	17.37:g.973214A>T		70.0	0.0		101.0	41.0	NM_021962	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Silent	SNP	ENST00000302538.5	37	CCDS10999.1																																																																																			.		0.652	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206675.4		
ADAMTS7	11173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	79069906	79069906	+	Silent	SNP	G	G	A	rs377763034		TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr15:79069906G>A	ENST00000388820.4	-	9	1557	c.1347C>T	c.(1345-1347)gaC>gaT	p.D449D	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	449	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CAGGAGGGTCGTCCAGGCACA	0.647																																					p.D449D		.											.	ADAMTS7	226	0			c.C1347T						.	A		0,4380		0,0,2190	58.0	48.0	52.0		1347	-8.0	0.1	15		52	1,8583		0,1,4291	no	coding-synonymous	ADAMTS7	NM_014272.3		0,1,6481	AA,AG,GG		0.0116,0.0,0.0077		449/1687	79069906	1,12963	2190	4292	6482	SO:0001819	synonymous_variant	11173	exon9			AGGGTCGTCCAGG	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.1347C>T	15.37:g.79069906G>A		55.0	0.0		61.0	17.0	NM_014272	Q14F51|Q6P7J9	Silent	SNP	ENST00000388820.4	37	CCDS32303.1																																																																																			.		0.647	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
ALDH8A1	64577	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	135265052	135265052	+	Missense_Mutation	SNP	C	C	T	rs200812012		TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr6:135265052C>T	ENST00000265605.2	-	2	259	c.191G>A	c.(190-192)cGc>cAc	p.R64H	RP11-349J5.2_ENST00000416448.2_RNA|ALDH8A1_ENST00000367845.2_Missense_Mutation_p.R64H|ALDH8A1_ENST00000367847.2_Missense_Mutation_p.R64H	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	64					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		CTGGGGGCTGCGGGATGACCA	0.592																																					p.R64H		.											.	ALDH8A1	94	0			c.G191A						.						45.0	49.0	47.0					6																	135265052		2203	4300	6503	SO:0001583	missense	64577	exon2			GGGCTGCGGGATG	AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.191G>A	6.37:g.135265052C>T	ENSP00000265605:p.Arg64His	33.0	0.0		41.0	27.0	NM_022568	B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Missense_Mutation	SNP	ENST00000265605.2	37	CCDS5171.1	.	.	.	.	.	.	.	.	.	.	c	11.91	1.780245	0.31502	.	.	ENSG00000118514	ENST00000265605;ENST00000367845;ENST00000367847	T;T;T	0.76186	-1.0;-1.0;1.53	6.07	0.0747	0.14396	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.550434	0.19098	N	0.122762	T	0.38612	0.1047	L	0.41710	1.295	0.09310	N	1	B;B;B	0.17038	0.02;0.016;0.02	B;B;B	0.13407	0.009;0.005;0.009	T	0.29088	-1.0023	10	0.59425	D	0.04	.	2.1588	0.03819	0.1224:0.3694:0.1202:0.388	.	64;64;64	B7Z521;Q9H2A2-2;Q9H2A2	.;.;AL8A1_HUMAN	H	64	ENSP00000265605:R64H;ENSP00000356819:R64H;ENSP00000356821:R64H	ENSP00000265605:R64H	R	-	2	0	ALDH8A1	135306745	0.004000	0.15560	0.525000	0.27900	0.798000	0.45092	0.448000	0.21726	0.476000	0.27440	-0.235000	0.12190	CGC	.		0.592	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042334.2		
ANKRD11	29123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	89350737	89350737	+	Missense_Mutation	SNP	C	C	T	rs370690185		TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr16:89350737C>T	ENST00000301030.4	-	9	2673	c.2213G>A	c.(2212-2214)cGt>cAt	p.R738H	ANKRD11_ENST00000378330.2_Missense_Mutation_p.R738H	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	738	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TTTATTCGAACGGTCTTTCTC	0.373																																					p.R738H		.											.	ANKRD11	139	0			c.G2213A						.	C	HIS/ARG	0,4396		0,0,2198	57.0	58.0	57.0		2213	5.7	0.7	16		57	2,8596	2.2+/-6.3	0,2,4297	no	missense	ANKRD11	NM_013275.4	29	0,2,6495	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	738/2664	89350737	2,12992	2198	4299	6497	SO:0001583	missense	29123	exon9			TTCGAACGGTCTT	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.2213G>A	16.37:g.89350737C>T	ENSP00000301030:p.Arg738His	578.0	0.0		426.0	206.0	NM_001256183	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	37	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	C	14.38	2.517965	0.44763	0.0	2.33E-4	ENSG00000167522	ENST00000301030;ENST00000378330;ENST00000330736	T;T	0.41400	1.0;1.0	5.7	5.7	0.88788	.	0.081220	0.49305	D	0.000148	T	0.41282	0.1152	L	0.56769	1.78	0.80722	D	1	P;P	0.52463	0.953;0.921	B;B	0.38194	0.267;0.137	T	0.49428	-0.8941	10	0.72032	D	0.01	.	17.3282	0.87255	0.0:1.0:0.0:0.0	.	357;738	Q7Z5E5;Q6UB99	.;ANR11_HUMAN	H	738;738;357	ENSP00000301030:R738H;ENSP00000367581:R738H	ENSP00000301030:R738H	R	-	2	0	ANKRD11	87878238	0.998000	0.40836	0.708000	0.30435	0.064000	0.16182	4.014000	0.57145	2.696000	0.92011	0.561000	0.74099	CGT	.		0.373	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
ANKRD34A	284615	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	145474788	145474788	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr1:145474788G>T	ENST00000323397.4	+	4	2753	c.1460G>T	c.(1459-1461)aGt>aTt	p.S487I	LIX1L_ENST00000369308.3_5'Flank|RP11-315I20.1_ENST00000600340.1_RNA	NM_001039888.2	NP_001034977.1	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34A	487						cytoplasm (GO:0005737)				endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	20	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGCTTCCAGAGTCTAGGTGGG	0.627																																					p.S487I		.											.	ANKRD34A	68	0			c.G1460T						.						14.0	16.0	15.0					1																	145474788		2202	4299	6501	SO:0001583	missense	284615	exon4			TCCAGAGTCTAGG	AK128050	CCDS72874.1	1q21.1	2013-01-10	2007-11-20	2007-11-20	ENSG00000181039	ENSG00000272031		"""Ankyrin repeat domain containing"""	27639	protein-coding gene	gene with protein product			"""ankyrin repeat domain 34"""	ANKRD34			Standard	NM_001039888		Approved		uc001enq.1	Q69YU3	OTTHUMG00000013740	ENST00000323397.4:c.1460G>T	1.37:g.145474788G>T	ENSP00000314103:p.Ser487Ile	35.0	0.0		125.0	28.0	NM_001039888	B3KSU3	Missense_Mutation	SNP	ENST00000323397.4	37	CCDS30829.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.567226	0.45694	.	.	ENSG00000181039	ENST00000323397	T	0.72394	-0.65	4.95	4.95	0.65309	.	0.817225	0.11261	N	0.582578	T	0.40645	0.1125	N	0.22421	0.69	0.36766	D	0.883537	P	0.45126	0.851	B	0.35688	0.208	T	0.49204	-0.8964	10	0.87932	D	0	-8.3853	9.2048	0.37282	0.0957:0.0:0.9043:0.0	.	487	Q69YU3	AN34A_HUMAN	I	487	ENSP00000314103:S487I	ENSP00000314103:S487I	S	+	2	0	ANKRD34A	144186145	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.040000	0.49799	2.563000	0.86464	0.650000	0.86243	AGT	.		0.627	ANKRD34A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038512.1		
AP5Z1	9907	ucsc.edu;bcgsc.ca	37	7	4830316	4830316	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr7:4830316G>A	ENST00000348624.4	+	16	2045	c.1951G>A	c.(1951-1953)Ggc>Agc	p.G651S	AP5Z1_ENST00000490487.1_Intron|MIR4656_ENST00000579503.1_RNA	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	651					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)											GTGGGCCATCGGCGAGTACCT	0.647																																					p.G651S		.											.	.	.	0			c.G1951A						.						39.0	46.0	43.0					7																	4830316		1991	4139	6130	SO:0001583	missense	9907	exon16			GCCATCGGCGAGT	AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.1951G>A	7.37:g.4830316G>A	ENSP00000297562:p.Gly651Ser	38.0	0.0		45.0	5.0	NM_014855	Q8N3X2|Q96H80	Missense_Mutation	SNP	ENST00000348624.4	37	CCDS47528.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035231	0.75617	.	.	ENSG00000242802	ENST00000348624	T	0.66815	-0.23	5.16	5.16	0.70880	Armadillo-like helical (1);	.	.	.	.	D	0.84502	0.5486	M	0.87269	2.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.994;1.0	D	0.87242	0.2267	9	0.87932	D	0	.	17.9791	0.89136	0.0:0.0:1.0:0.0	.	1362;651	A4D1Z4;O43299	.;K0415_HUMAN	S	651	ENSP00000297562:G651S	ENSP00000297562:G651S	G	+	1	0	KIAA0415	4796842	1.000000	0.71417	0.941000	0.38009	0.105000	0.19272	9.375000	0.97178	2.555000	0.86185	0.549000	0.68633	GGC	.		0.647	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323771.1		
ATP1A2	477	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	160106761	160106761	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr1:160106761A>T	ENST00000361216.3	+	20	2869	c.2780A>T	c.(2779-2781)cAg>cTg	p.Q927L	ATP1A2_ENST00000392233.3_Missense_Mutation_p.Q927L	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	927					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			GTGGTGGTGCAGTGGGCTGAC	0.607																																					p.Q927L		.											.	ATP1A2	518	0			c.A2780T						.						184.0	144.0	157.0					1																	160106761		2203	4300	6503	SO:0001583	missense	477	exon20			TGGTGCAGTGGGC	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.2780A>T	1.37:g.160106761A>T	ENSP00000354490:p.Gln927Leu	116.0	0.0		286.0	52.0	NM_000702	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	ENST00000361216.3	37	CCDS1196.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	26.6|26.6	4.754991|4.754991	0.89843|0.89843	.|.	.|.	ENSG00000018625|ENSG00000018625	ENST00000361216;ENST00000392233;ENST00000435866|ENST00000447527	D;D|.	0.97256|.	-4.31;-4.31|.	4.65|4.65	4.65|4.65	0.58169|0.58169	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);|.	0.060913|.	0.64402|.	D|.	0.000003|.	D|D	0.86251|0.86251	0.5888|0.5888	H|H	0.98295|0.98295	4.195|4.195	0.80722|0.80722	D|D	1|1	D;D|.	0.58268|.	0.977;0.982|.	D;D|.	0.67900|.	0.924;0.954|.	D|D	0.90695|0.90695	0.4616|0.4616	10|5	0.87932|.	D|.	0|.	.|.	12.3814|12.3814	0.55309|0.55309	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	827;927|.	F5GXJ7;P50993|.	.;AT1A2_HUMAN|.	L|C	927;927;630|621	ENSP00000354490:Q927L;ENSP00000376066:Q927L|.	ENSP00000354490:Q927L|.	Q|S	+|+	2|1	0|0	ATP1A2|ATP1A2	158373385|158373385	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	9.084000|9.084000	0.94076|0.94076	2.073000|2.073000	0.62155|0.62155	0.529000|0.529000	0.55759|0.55759	CAG|AGT	.		0.607	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	NM_000702	
BAZ1B	9031	hgsc.bcm.edu;bcgsc.ca	37	7	72903721	72903721	+	Splice_Site	SNP	T	T	C			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr7:72903721T>C	ENST00000339594.4	-	6	1032	c.694A>G	c.(694-696)Atc>Gtc	p.I232V	BAZ1B_ENST00000404251.1_Splice_Site_p.I232V	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	232	Mediates the tyrosine-protein kinase activity.				cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				TTACTGATGATCTAGGTTAAA	0.393																																					p.I232V	Esophageal Squamous(112;1167 1561 21085 43672 48228)	.											.	BAZ1B	159	0			c.A694G						.						108.0	94.0	99.0					7																	72903721		2203	4300	6503	SO:0001630	splice_region_variant	9031	exon6			TGATGATCTAGGT	AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.694-1A>G	7.37:g.72903721T>C		269.0	0.0		214.0	12.0	NM_032408	B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Missense_Mutation	SNP	ENST00000339594.4	37	CCDS5549.1	.	.	.	.	.	.	.	.	.	.	T	4.518	0.096070	0.08681	.	.	ENSG00000009954	ENST00000339594;ENST00000404251	T;T	0.57436	0.4;0.4	5.88	4.72	0.59763	.	0.113674	0.64402	N	0.000009	T	0.25865	0.0630	N	0.08118	0	0.38723	D	0.953488	B	0.02656	0.0	B	0.04013	0.001	T	0.14727	-1.0462	10	0.05721	T	0.95	-9.0796	8.3585	0.32344	0.0:0.1502:0.0:0.8498	.	232	Q9UIG0	BAZ1B_HUMAN	V	232	ENSP00000342434:I232V;ENSP00000385442:I232V	ENSP00000342434:I232V	I	-	1	0	BAZ1B	72541657	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.480000	0.53172	1.050000	0.40346	0.533000	0.62120	ATC	.		0.393	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252123.4	NM_032408	Missense_Mutation
BRSK2	9024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	1472640	1472640	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr11:1472640C>T	ENST00000528841.1	+	15	1919	c.1535C>T	c.(1534-1536)tCg>tTg	p.S512L	BRSK2_ENST00000544817.1_Missense_Mutation_p.S207L|BRSK2_ENST00000382179.1_Missense_Mutation_p.S558L|BRSK2_ENST00000531197.1_Missense_Mutation_p.S512L|BRSK2_ENST00000308230.5_Missense_Mutation_p.S534L|BRSK2_ENST00000526678.1_Missense_Mutation_p.S534L|BRSK2_ENST00000308219.9_Missense_Mutation_p.S512L|BRSK2_ENST00000528710.1_Missense_Mutation_p.S452L			Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2	512					actin cytoskeleton reorganization (GO:0031532)|axonogenesis (GO:0007409)|establishment of cell polarity (GO:0030010)|exocytosis (GO:0006887)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitotic nuclear division (GO:0007067)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(4)|large_intestine(1)|lung(5)	10		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		ACACCAGAGTCGTCCCCAGAG	0.637																																					p.S558L		.											.	BRSK2	333	0			c.C1673T						.						87.0	100.0	95.0					11																	1472640		2144	4234	6378	SO:0001583	missense	9024	exon15			CAGAGTCGTCCCC	AF020089	CCDS41590.1, CCDS58106.1, CCDS58107.1, CCDS58108.1, CCDS60696.1	11p15.5	2008-02-05	2003-09-11	2005-01-27	ENSG00000174672	ENSG00000174672			11405	protein-coding gene	gene with protein product	"""serine/threonine kinase 29"""	609236	"""chromsosome 11 open reading frame 7"""	C11orf7, STK29		9852686, 9929968	Standard	NM_001256629		Approved	PEN11B	uc001ltm.4	Q8IWQ3	OTTHUMG00000167089	ENST00000528841.1:c.1535C>T	11.37:g.1472640C>T	ENSP00000432000:p.Ser512Leu	43.0	0.0		50.0	20.0	NM_001256630	B3KVE9|E9PLM7|O60843|O95099|Q5J5B4|Q6ZMQ4|Q8TB60	Missense_Mutation	SNP	ENST00000528841.1	37	CCDS58107.1	.	.	.	.	.	.	.	.	.	.	C	16.75	3.209415	0.58343	.	.	ENSG00000174672	ENST00000308219;ENST00000531197;ENST00000308230;ENST00000528841;ENST00000526678;ENST00000528710;ENST00000382179;ENST00000544817	T;T;T;T;T;T;T;T	0.60920	0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15	3.81	3.81	0.43845	.	0.000000	0.64402	U	0.000001	T	0.76666	0.4019	M	0.80847	2.515	0.58432	D	0.999993	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.998;0.999;0.972;0.978	T	0.81850	-0.0743	10	0.87932	D	0	.	15.8948	0.79326	0.0:1.0:0.0:0.0	.	534;558;512;512;512	Q8IWQ3-4;Q8IWQ3-5;Q8IWQ3-3;Q8IWQ3;Q8IWQ3-2	.;.;.;BRSK2_HUMAN;.	L	512;512;534;512;534;452;558;207	ENSP00000310697:S512L;ENSP00000431152:S512L;ENSP00000310805:S534L;ENSP00000432000:S512L;ENSP00000433370:S534L;ENSP00000433235:S452L;ENSP00000371614:S558L;ENSP00000445168:S207L	ENSP00000310697:S512L	S	+	2	0	BRSK2	1429216	1.000000	0.71417	0.821000	0.32701	0.078000	0.17371	4.560000	0.60802	1.981000	0.57761	0.462000	0.41574	TCG	.		0.637	BRSK2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393033.1	NM_003957	
C7orf43	55262	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	99752913	99752913	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr7:99752913G>T	ENST00000316937.3	-	10	1746	c.1561C>A	c.(1561-1563)Cag>Aag	p.Q521K	C7orf43_ENST00000457641.1_Missense_Mutation_p.Q252K|C7orf43_ENST00000394035.2_Missense_Mutation_p.Q97K|C7orf43_ENST00000498638.1_5'Flank|C7orf43_ENST00000419841.1_Missense_Mutation_p.Q289K|MIR4658_ENST00000584344.1_RNA	NM_018275.3	NP_060745.3	Q8WVR3	CG043_HUMAN	chromosome 7 open reading frame 43	521										breast(1)|endometrium(3)|large_intestine(3)|lung(2)|prostate(1)	10	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GAAGGCTGCTGGTGGGAGAAG	0.682																																					p.Q521K		.											.	C7orf43	90	0			c.C1561A						.						22.0	24.0	24.0					7																	99752913		2177	4275	6452	SO:0001583	missense	55262	exon10			GCTGCTGGTGGGA		CCDS5687.1	7q22.1	2011-11-25			ENSG00000146826	ENSG00000146826			25604	protein-coding gene	gene with protein product						12477932	Standard	NM_018275		Approved	FLJ10925	uc003utr.3	Q8WVR3	OTTHUMG00000154862	ENST00000316937.3:c.1561C>A	7.37:g.99752913G>T	ENSP00000324741:p.Gln521Lys	29.0	0.0		31.0	8.0	NM_018275	A4D2A9|D6W5U4|Q9BQJ1|Q9BUB6|Q9NV47	Missense_Mutation	SNP	ENST00000316937.3	37	CCDS5687.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.96|15.96	2.987262|2.987262	0.53934|0.53934	.|.	.|.	ENSG00000146826|ENSG00000146826	ENST00000456769|ENST00000394035;ENST00000457641;ENST00000316937;ENST00000275726;ENST00000419841	.|T;T;T;T	.|0.54279	.|0.58;0.58;0.58;0.58	5.31|5.31	4.43|4.43	0.53597|0.53597	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.58119|0.58119	0.2100|0.2100	N|N	0.24115|0.24115	0.695|0.695	0.44282|0.44282	D|D	0.997149|0.997149	.|P;D;D;P	.|0.61080	.|0.877;0.989;0.989;0.954	.|D;D;D;D	.|0.70487	.|0.932;0.969;0.969;0.932	T|T	0.62029|0.62029	-0.6940|-0.6940	5|10	.|0.59425	.|D	.|0.04	-7.9522|-7.9522	13.8354|13.8354	0.63406|0.63406	0.0:0.1544:0.8456:0.0|0.0:0.1544:0.8456:0.0	.|.	.|289;140;147;521	.|E9PFF9;Q8WVR3-2;Q8WVR3-3;Q8WVR3	.|.;.;.;CG043_HUMAN	Q|K	426|97;252;521;140;289	.|ENSP00000377600:Q97K;ENSP00000396432:Q252K;ENSP00000324741:Q521K;ENSP00000406326:Q289K	.|ENSP00000275726:Q140K	P|Q	-|-	2|1	0|0	C7orf43|C7orf43	99590849|99590849	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	8.333000|8.333000	0.90026|0.90026	1.218000|1.218000	0.43458|0.43458	0.561000|0.561000	0.74099|0.74099	CCA|CAG	.		0.682	C7orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337395.2	NM_018275	
C8orf22	492307	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	49985398	49985398	+	Silent	SNP	C	C	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr8:49985398C>T	ENST00000303202.8	+	2	182	c.9C>T	c.(7-9)tcC>tcT	p.S3S	C8orf22_ENST00000517663.1_Silent_p.S3S|C8orf22_ENST00000522267.1_Silent_p.S3S|C8orf22_ENST00000399653.4_Silent_p.S3S	NM_001256598.1	NP_001243527.1	Q8WWR9	PDPFL_HUMAN	chromosome 8 open reading frame 22	3					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)					large_intestine(1)|lung(7)|prostate(1)	9		all_cancers(86;0.0452)|all_epithelial(80;0.000863)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				CCATGGCATCCGTACCTTCCA	0.418																																					p.S3S		.											.	.	.	0			c.C9T						.						167.0	157.0	160.0					8																	49985398		1890	4125	6015	SO:0001819	synonymous_variant	492307	exon2			GGCATCCGTACCT	BC017981	CCDS47854.1, CCDS59101.1, CCDS59102.1	8q11.21	2012-04-11			ENSG00000168333	ENSG00000168333			31745	protein-coding gene	gene with protein product							Standard	NM_001007176		Approved		uc031tba.1	Q8WWR9	OTTHUMG00000164217	ENST00000303202.8:c.9C>T	8.37:g.49985398C>T		190.0	0.0		158.0	40.0	NM_001256598	G3V137|Q8WVI1	Silent	SNP	ENST00000303202.8	37	CCDS59101.1																																																																																			.		0.418	C8orf22-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377837.1	NM_001007176	
C8orf34	116328	hgsc.bcm.edu;bcgsc.ca	37	8	69434170	69434170	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr8:69434170G>T	ENST00000539993.1	+	6	1193	c.644G>T	c.(643-645)tGg>tTg	p.W215L	C8orf34_ENST00000518698.1_Missense_Mutation_p.W301L|C8orf34_ENST00000348340.2_Missense_Mutation_p.W215L|C8orf34_ENST00000349492.3_3'UTR|C8orf34_ENST00000337103.4_Missense_Mutation_p.W190L			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34	215										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			AATGACCAATGGGAAAGTGAA	0.418																																					p.W301L		.											.	C8orf34	153	0			c.G902T						.						101.0	97.0	98.0					8																	69434170		2203	4300	6503	SO:0001583	missense	116328	exon6			ACCAATGGGAAAG	AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.644G>T	8.37:g.69434170G>T	ENSP00000438159:p.Trp215Leu	128.0	0.0		95.0	7.0	NM_052958	A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Missense_Mutation	SNP	ENST00000539993.1	37		.	.	.	.	.	.	.	.	.	.	G	24.8	4.568212	0.86439	.	.	ENSG00000165084	ENST00000518698;ENST00000539993;ENST00000348340;ENST00000337103	T;T;T	0.44482	0.92;0.95;0.95	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.62913	0.2467	L	0.60455	1.87	0.50039	D	0.999845	P;D	0.71674	0.952;0.998	P;D	0.80764	0.6;0.994	T	0.57825	-0.7744	9	.	.	.	-6.5266	19.961	0.97250	0.0:0.0:1.0:0.0	.	215;215	Q49A92;Q49A92-3	CH034_HUMAN;.	L	301;215;215;190	ENSP00000427820:W301L;ENSP00000438159:W215L;ENSP00000337174:W190L	.	W	+	2	0	C8orf34	69596724	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.551000	0.73909	2.783000	0.95769	0.655000	0.94253	TGG	.		0.418	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_052958	
CALY	50632	ucsc.edu;bcgsc.ca	37	10	135140403	135140403	+	Silent	SNP	G	G	A	rs142159746	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr10:135140403G>A	ENST00000252939.4	-	4	432	c.339C>T	c.(337-339)tgC>tgT	p.C113C	ZNF511_ENST00000368554.4_Intron|RP11-122K13.14_ENST00000605518.1_lincRNA|CALY_ENST00000467611.1_5'Flank|CALY_ENST00000368558.1_Silent_p.C113C|CALY_ENST00000368556.2_Silent_p.C113C	NM_015722.3	NP_056537.1	Q9NYX4	CALY_HUMAN	calcyon neuron-specific vesicular protein	113					clathrin coat assembly (GO:0048268)|dopamine receptor signaling pathway (GO:0007212)|endocytosis (GO:0006897)|positive regulation of endocytosis (GO:0045807)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)	clathrin light chain binding (GO:0032051)			kidney(1)|lung(2)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;6.94e-06)|OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)	Apomorphine(DB00714)|Clozapine(DB00363)|Trifluoperazine(DB00831)	AGCCGTCGGGGCAGGTGAACT	0.682													G|||	21	0.00419329	0.0159	0.0	5008	,	,		14453	0.0		0.0	False		,,,				2504	0.0				p.C113C		.											.	CALY	68	0			c.C339T						.	G		75,4325	63.5+/-100.7	0,75,2125	51.0	41.0	44.0		339	2.4	1.0	10	dbSNP_134	44	0,8590		0,0,4295	no	coding-synonymous	CALY	NM_015722.3		0,75,6420	AA,AG,GG		0.0,1.7045,0.5774		113/218	135140403	75,12915	2200	4295	6495	SO:0001819	synonymous_variant	50632	exon4			GTCGGGGCAGGTG	AF225903	CCDS7678.1	10q26.3	2008-07-02	2008-01-16	2008-01-16	ENSG00000130643	ENSG00000130643			17938	protein-coding gene	gene with protein product		604647	"""dopamine receptor D1 interacting protein"""	DRD1IP		10698743, 17623072	Standard	NM_015722		Approved	CALCYON, NSG3	uc001lmo.2	Q9NYX4	OTTHUMG00000019310	ENST00000252939.4:c.339C>T	10.37:g.135140403G>A		70.0	2.0		93.0	10.0	NM_015722	Q5VWX3|Q5VWY5|Q5VWY6	Silent	SNP	ENST00000252939.4	37	CCDS7678.1																																																																																			G|0.994;A|0.006		0.682	CALY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051122.1	NM_015722	
CCDC146	57639	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	76922297	76922297	+	Missense_Mutation	SNP	A	A	C	rs77337116	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr7:76922297A>C	ENST00000285871.4	+	18	2571	c.2444A>C	c.(2443-2445)aAt>aCt	p.N815T	CCDC146_ENST00000431197.1_Missense_Mutation_p.N529T|CCDC146_ENST00000415740.2_3'UTR	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	815										breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				AGGATCAAAAATGCAACTGAG	0.413													A|||	17	0.00339457	0.0121	0.0014	5008	,	,		20143	0.0		0.0	False		,,,				2504	0.0				p.N815T		.											.	CCDC146	70	0			c.A2444C						.	A	THR/ASN	26,4380	32.6+/-62.9	0,26,2177	99.0	95.0	97.0		2444	1.6	0.2	7	dbSNP_131	97	1,8599	1.2+/-3.3	0,1,4299	yes	missense	CCDC146	NM_020879.2	65	0,27,6476	CC,CA,AA		0.0116,0.5901,0.2076	benign	815/956	76922297	27,12979	2203	4300	6503	SO:0001583	missense	57639	exon18			TCAAAAATGCAAC	BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.2444A>C	7.37:g.76922297A>C	ENSP00000285871:p.Asn815Thr	50.0	0.0		41.0	5.0	NM_020879	A8K8X6|Q9P223	Missense_Mutation	SNP	ENST00000285871.4	37	CCDS34671.1	7	0.003205128205128205	6	0.012195121951219513	1	0.0027624309392265192	0	0.0	0	0.0	A	3.929	-0.016615	0.07681	0.005901	1.16E-4	ENSG00000135205	ENST00000285871;ENST00000431197	T;T	0.41065	1.01;1.01	5.39	1.59	0.23543	.	0.650141	0.16794	N	0.199268	T	0.19765	0.0475	L	0.36672	1.1	0.22213	N	0.999284	B;B	0.09022	0.0;0.002	B;B	0.06405	0.0;0.002	T	0.13072	-1.0523	10	0.36615	T	0.2	-5.2033	3.381	0.07255	0.6453:0.142:0.0763:0.1363	.	529;815	Q8IYE0-2;Q8IYE0	.;CC146_HUMAN	T	815;529	ENSP00000285871:N815T;ENSP00000413885:N529T	ENSP00000285871:N815T	N	+	2	0	AC007000.1	76760233	0.991000	0.36638	0.187000	0.23214	0.060000	0.15804	3.062000	0.49971	0.294000	0.22547	0.460000	0.39030	AAT	A|0.998;C|0.002		0.413	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341449.1	NM_020879	
CD2BP2	10421	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	16	30365266	30365266	+	Missense_Mutation	SNP	G	G	A	rs149209324	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr16:30365266G>A	ENST00000305596.3	-	4	506	c.331C>T	c.(331-333)Cgg>Tgg	p.R111W	CD2BP2_ENST00000569466.1_Missense_Mutation_p.R111W|RP11-347C12.10_ENST00000563252.1_lincRNA	NM_006110.2	NP_006101.1	O95400	CD2B2_HUMAN	CD2 (cytoplasmic tail) binding protein 2	111					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of phosphatase activity (GO:0010923)|RNA splicing (GO:0008380)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	ribonucleoprotein complex binding (GO:0043021)			breast(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	15						TGAGCATCCCGGTTCAGGAAG	0.627																																					p.R111W		.											.	CD2BP2	91	0			c.C331T						.		TRP/ARG	7,4387		0,7,2190	76.0	73.0	74.0		331	4.9	1.0	16	dbSNP_134	74	0,8600		0,0,4300	yes	missense	CD2BP2	NM_006110.2	101	0,7,6490	AA,AG,GG		0.0,0.1593,0.0539	probably-damaging	111/342	30365266	7,12987	2197	4300	6497	SO:0001583	missense	10421	exon4			CATCCCGGTTCAG	AF104222	CCDS10675.1	16p11.2	2012-04-17	2006-03-28		ENSG00000169217	ENSG00000169217		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 59"""	604470	"""CD2 antigen (cytoplasmic tail)-binding protein 2"""			9843987	Standard	NM_006110		Approved	LIN1, Snu40, PPP1R59	uc002dxs.3	O95400	OTTHUMG00000132397	ENST00000305596.3:c.331C>T	16.37:g.30365266G>A	ENSP00000304903:p.Arg111Trp	46.0	0.0		58.0	6.0	NM_006110	B2RDX2|Q9ULP2	Missense_Mutation	SNP	ENST00000305596.3	37	CCDS10675.1	.	.	.	.	.	.	.	.	.	.	N	19.74	3.883996	0.72410	0.001593	0.0	ENSG00000169217	ENST00000305596	T	0.32023	1.47	4.87	4.87	0.63330	.	0.203875	0.44688	D	0.000436	T	0.30885	0.0779	L	0.54323	1.7	0.32787	N	0.501743	D	0.58620	0.983	B	0.43680	0.427	T	0.51926	-0.8643	10	0.72032	D	0.01	10.5895	10.556	0.45118	0.0:0.0:0.6981:0.3019	.	111	O95400	CD2B2_HUMAN	W	111	ENSP00000304903:R111W	ENSP00000304903:R111W	R	-	1	2	CD2BP2	30272767	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.333000	0.43912	2.523000	0.85059	0.558000	0.71614	CGG	G|0.999;A|0.001		0.627	CD2BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255528.1	NM_006110	
COL6A3	1293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	238249681	238249681	+	Silent	SNP	G	G	A	rs145136426	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr2:238249681G>A	ENST00000295550.4	-	38	8330	c.7878C>T	c.(7876-7878)agC>agT	p.S2626S	COL6A3_ENST00000472056.1_Silent_p.S2019S|COL6A3_ENST00000347401.3_Silent_p.S2425S|COL6A3_ENST00000353578.4_Silent_p.S2420S|COL6A3_ENST00000346358.4_Silent_p.S2426S|COL6A3_ENST00000409809.1_Silent_p.S2420S	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2626	Nonhelical region.|VWFA 12. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TGGTCTCAGCGCTGTCTAAGA	0.552																																					p.S2626S		.											.	COL6A3	526	0			c.C7878T						.	G	,,	0,4406		0,0,2203	202.0	192.0	196.0		7878,6057,7260	4.2	1.0	2	dbSNP_134	196	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	COL6A3	NM_004369.3,NM_057166.4,NM_057167.3	,,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,,	2626/3178,2019/2571,2420/2972	238249681	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	1293	exon38			CTCAGCGCTGTCT	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.7878C>T	2.37:g.238249681G>A		189.0	0.0		196.0	36.0	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	37	CCDS33412.1																																																																																			G|1.000;A|0.000		0.552	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
COL8A1	1295	ucsc.edu;bcgsc.ca	37	3	99514182	99514182	+	Silent	SNP	C	C	T	rs61753448	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr3:99514182C>T	ENST00000261037.3	+	5	1817	c.1437C>T	c.(1435-1437)ctC>ctT	p.L479L	COL8A1_ENST00000273342.4_Silent_p.L479L	NM_001850.4	NP_001841.2	P27658	CO8A1_HUMAN	collagen, type VIII, alpha 1	479	Triple-helical region (COL1).				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen type VIII trimer (GO:0005591)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)				breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(15)|skin(5)|upper_aerodigestive_tract(1)	27						CAGGGCTTCTCGGACCTAAGG	0.627													C|||	21	0.00419329	0.0151	0.0014	5008	,	,		17939	0.0		0.0	False		,,,				2504	0.0				p.L479L		.											.	COL8A1	90	0			c.C1437T						.	C	,	56,4348		0,56,2146	17.0	17.0	17.0		1437,1437	0.2	1.0	3	dbSNP_129	17	0,8594		0,0,4297	no	coding-synonymous,coding-synonymous	COL8A1	NM_001850.3,NM_020351.2	,	0,56,6443	TT,TC,CC		0.0,1.2716,0.4308	,	479/745,479/745	99514182	56,12942	2202	4297	6499	SO:0001819	synonymous_variant	1295	exon5			GCTTCTCGGACCT	AF170702	CCDS2934.1	3q11.1-q13.2	2013-01-16			ENSG00000144810	ENSG00000144810		"""Collagens"""	2215	protein-coding gene	gene with protein product		120251	"""chromosome 3 open reading frame 7"""	C3orf7		2029894	Standard	NM_001850		Approved	MGC9568	uc003dth.2	P27658	OTTHUMG00000148669	ENST00000261037.3:c.1437C>T	3.37:g.99514182C>T		32.0	0.0		31.0	6.0	NM_001850	D3DN42|Q53XI6|Q96D07	Silent	SNP	ENST00000261037.3	37	CCDS2934.1																																																																																			C|0.996;T|0.004		0.627	COL8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309001.1	NM_001850	
CPXM2	119587	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	125639753	125639753	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr10:125639753C>A	ENST00000241305.3	-	2	531	c.377G>T	c.(376-378)cGt>cTt	p.R126L	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	126					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		ACGGGCCACACGGACACTGTG	0.542																																					p.R126L		.											.	CPXM2	92	0			c.G377T						.						217.0	205.0	209.0					10																	125639753		2203	4300	6503	SO:0001583	missense	119587	exon2			GCCACACGGACAC	AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.377G>T	10.37:g.125639753C>A	ENSP00000241305:p.Arg126Leu	207.0	0.0		203.0	61.0	NM_198148	B4E3Q2	Missense_Mutation	SNP	ENST00000241305.3	37	CCDS7637.1	.	.	.	.	.	.	.	.	.	.	C	2.986	-0.209163	0.06140	.	.	ENSG00000121898	ENST00000241305;ENST00000418782	D	0.96073	-3.9	3.76	-2.33	0.06724	.	1.253220	0.05575	N	0.571736	D	0.87787	0.6265	N	0.08118	0	0.21762	N	0.999554	B	0.23650	0.089	B	0.20184	0.028	T	0.78170	-0.2308	10	0.46703	T	0.11	-1.6276	7.4296	0.27120	0.0:0.4323:0.318:0.2497	.	126	Q8N436	CPXM2_HUMAN	L	126	ENSP00000241305:R126L	ENSP00000241305:R126L	R	-	2	0	CPXM2	125629743	0.000000	0.05858	0.001000	0.08648	0.137000	0.21094	-0.230000	0.09083	-0.448000	0.07128	-0.211000	0.12701	CGT	.		0.542	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050853.1	NM_198148	
CPZ	8532	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	8605903	8605903	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr4:8605903C>T	ENST00000360986.4	+	4	871	c.697C>T	c.(697-699)Cag>Tag	p.Q233*	CPZ_ENST00000429646.2_5'UTR|CPZ_ENST00000382480.2_Nonsense_Mutation_p.Q96*|CPZ_ENST00000315782.6_Nonsense_Mutation_p.Q222*	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	233					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CCGCCCCGGCCAGCACGAGCT	0.692																																					p.Q233X		.											.	CPZ	93	0			c.C697T						.						9.0	10.0	9.0					4																	8605903		2179	4266	6445	SO:0001587	stop_gained	8532	exon4			CCCGGCCAGCACG	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.697C>T	4.37:g.8605903C>T	ENSP00000354255:p.Gln233*	55.0	0.0		88.0	46.0	NM_001014447	O00520|Q96MX2	Nonsense_Mutation	SNP	ENST00000360986.4	37	CCDS33953.1	.	.	.	.	.	.	.	.	.	.	C	38	6.749772	0.97809	.	.	ENSG00000109625	ENST00000360986;ENST00000382480;ENST00000315782	.	.	.	3.86	3.86	0.44501	.	0.477193	0.23416	N	0.048414	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-25.9624	15.9374	0.79723	0.0:1.0:0.0:0.0	.	.	.	.	X	233;96;222	.	ENSP00000315074:Q222X	Q	+	1	0	CPZ	8656803	0.923000	0.31300	1.000000	0.80357	0.884000	0.51177	1.265000	0.33027	1.973000	0.57446	0.555000	0.69702	CAG	.		0.692	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207001.4	NM_003652	
CYP11B2	1585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	143994118	143994118	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr8:143994118G>A	ENST00000323110.2	-	8	1228	c.1226C>T	c.(1225-1227)tCg>tTg	p.S409L		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	409					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	GCGACCCAGCGAGTAGAGGAA	0.622									Familial Hyperaldosteronism type I																												p.S409L		.											.	CYP11B2	90	0			c.C1226T						.						93.0	90.0	91.0					8																	143994118		2203	4300	6503	SO:0001583	missense	1585	exon8	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	CCCAGCGAGTAGA	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.1226C>T	8.37:g.143994118G>A	ENSP00000325822:p.Ser409Leu	92.0	0.0		106.0	15.0	NM_000498	B0ZBE4|Q16726	Missense_Mutation	SNP	ENST00000323110.2	37	CCDS6393.1	.	.	.	.	.	.	.	.	.	.	.	19.93	3.918803	0.73098	.	.	ENSG00000179142	ENST00000323110	T	0.69435	-0.4	3.52	3.52	0.40303	.	0.442635	0.19241	N	0.119173	T	0.66366	0.2782	L	0.56769	1.78	0.33867	D	0.63453	P	0.47106	0.89	P	0.46659	0.523	T	0.75439	-0.3317	10	0.36615	T	0.2	.	12.9218	0.58237	0.0:0.0:1.0:0.0	.	409	P19099	C11B2_HUMAN	L	409	ENSP00000325822:S409L	ENSP00000325822:S409L	S	-	2	0	CYP11B2	143991120	0.678000	0.27586	0.156000	0.22583	0.007000	0.05969	4.006000	0.57083	1.937000	0.56155	0.563000	0.77884	TCG	.		0.622	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1		
DGCR6L	85359	hgsc.bcm.edu;bcgsc.ca	37	22	20302911	20302911	+	Missense_Mutation	SNP	C	C	T	rs573329481		TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr22:20302911C>T	ENST00000248879.3	-	4	552	c.461G>A	c.(460-462)aGc>aAc	p.S154N	XXbac-B444P24.13_ENST00000608275.1_RNA|DGCR6L_ENST00000405465.3_Missense_Mutation_p.S116N	NM_033257.3	NP_150282.2	Q9BY27	DGC6L_HUMAN	DiGeorge syndrome critical region gene 6-like	154						nucleus (GO:0005634)				endometrium(1)|kidney(1)|lung(2)|stomach(1)	5	Colorectal(54;0.0993)					CTCCAGTGTGCTCTGCTGGTC	0.677													.|||	1	0.000199681	0.0008	0.0	5008	,	,		16282	0.0		0.0	False		,,,				2504	0.0				p.S154N		.											.	DGCR6L	90	0			c.G461A						.						95.0	79.0	84.0					22																	20302911		2203	4299	6502	SO:0001583	missense	85359	exon4			AGTGTGCTCTGCT	AF228708	CCDS13778.1	22q11.21	2013-02-19			ENSG00000128185	ENSG00000128185			18551	protein-coding gene	gene with protein product		609459				11157784	Standard	NM_033257		Approved	FLJ10666	uc002zrx.3	Q9BY27	OTTHUMG00000150583	ENST00000248879.3:c.461G>A	22.37:g.20302911C>T	ENSP00000248879:p.Ser154Asn	91.0	0.0		134.0	10.0	NM_033257	A8K1N7|B3KMC0|D3DX29|Q9BW33	Missense_Mutation	SNP	ENST00000248879.3	37	CCDS13778.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.693723	0.48202	.	.	ENSG00000128185	ENST00000248879;ENST00000405465	T;T	0.35048	1.33;1.33	2.04	2.04	0.26737	.	0.089386	0.85682	D	0.000000	T	0.34861	0.0912	N	0.16602	0.42	0.36620	D	0.875729	P;D	0.59357	0.489;0.985	B;D	0.67231	0.265;0.95	T	0.30563	-0.9974	10	0.39692	T	0.17	-31.2466	6.6364	0.22885	0.0:0.6984:0.3015:0.0	.	154;154	B3KMC0;Q9BY27	.;DGC6L_HUMAN	N	154;116	ENSP00000248879:S154N;ENSP00000386052:S116N	ENSP00000248879:S154N	S	-	2	0	DGCR6L	18682911	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.798000	0.38814	1.463000	0.47967	0.461000	0.40582	AGC	.		0.677	DGCR6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318970.3	NM_033257	
DLEC1	9940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38150949	38150949	+	Silent	SNP	T	T	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr3:38150949T>A	ENST00000308059.6	+	22	3177	c.3156T>A	c.(3154-3156)ccT>ccA	p.P1052P	DLEC1_ENST00000452631.2_Silent_p.P1052P|DLEC1_ENST00000346219.3_Silent_p.P1052P					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		TGGCCCTCCCTTGTCACGTGT	0.562																																					p.P1052P		.											.	DLEC1	161	0			c.T3156A						.						95.0	95.0	95.0					3																	38150949		1902	4128	6030	SO:0001819	synonymous_variant	9940	exon22			CCTCCCTTGTCAC	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.3156T>A	3.37:g.38150949T>A		65.0	0.0		78.0	11.0	NM_007337		Silent	SNP	ENST00000308059.6	37	CCDS2672.2																																																																																			.		0.562	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	
DUSP21	63904	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	44703615	44703615	+	Silent	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chrX:44703615G>A	ENST00000339042.4	+	1	367	c.237G>A	c.(235-237)tcG>tcA	p.S79S		NM_022076.3	NP_071359.3	Q9H596	DUS21_HUMAN	dual specificity phosphatase 21	79	Sufficient for mitochondrial localization. {ECO:0000250}.|Tyrosine-protein phosphatase.				peptidyl-tyrosine dephosphorylation (GO:0035335)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|skin(3)	19						CTCGTGACTCGCGTCTCTACG	0.527																																					p.S79S		.											.	DUSP21	289	0			c.G237A						.						200.0	156.0	171.0					X																	44703615		2203	4300	6503	SO:0001819	synonymous_variant	63904	exon1			TGACTCGCGTCTC	AF143321	CCDS14264.1	Xp11.4-p11.23	2011-06-09			ENSG00000189037	ENSG00000189037		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	20476	protein-coding gene	gene with protein product		300678				12408986	Standard	NM_022076		Approved		uc004dgd.3	Q9H596	OTTHUMG00000021401	ENST00000339042.4:c.237G>A	X.37:g.44703615G>A		83.0	1.0		127.0	97.0	NM_022076	Q0VDA6|Q6IAJ6|Q6YDQ8	Silent	SNP	ENST00000339042.4	37	CCDS14264.1																																																																																			.		0.527	DUSP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056323.1	NM_022076	
ELK1	2002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	47496430	47496430	+	Silent	SNP	C	C	T	rs143440705		TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chrX:47496430C>T	ENST00000247161.3	-	5	1269	c.1170G>A	c.(1168-1170)ccG>ccA	p.P390P	ELK1_ENST00000592066.1_Silent_p.P336P|ELK1_ENST00000376983.3_Silent_p.P390P	NM_005229.4	NP_005220.2	P19419	ELK1_HUMAN	ELK1, member of ETS oncogene family	390	Sufficient for interaction with MAD2L2.				cell differentiation (GO:0030154)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|skin(2)	10						AGAGCTTGGCCGGGCTACGGG	0.617																																					p.P390P		.											.	ELK1	660	0			c.G1170A						.	C	,	4,3829		0,3,1,1629,568	39.0	37.0	37.0		1170,1170	-9.1	0.8	X	dbSNP_134	37	0,6727		0,0,0,2428,1871	no	coding-synonymous,coding-synonymous	ELK1	NM_001114123.1,NM_005229.3	,	0,3,1,4057,2439	TT,TC,T,CC,C		0.0,0.1044,0.0379	,	390/429,390/429	47496430	4,10556	2201	4299	6500	SO:0001819	synonymous_variant	2002	exon6			CTTGGCCGGGCTA	M25269	CCDS14283.1, CCDS59165.1	Xp11.23	2010-07-20			ENSG00000126767	ENSG00000126767			3321	protein-coding gene	gene with protein product		311040				2539641	Standard	NM_001114123		Approved		uc010nhv.4	P19419	OTTHUMG00000021452	ENST00000247161.3:c.1170G>A	X.37:g.47496430C>T		91.0	0.0		122.0	15.0	NM_001114123	B2R7H4|O75606|O95058|Q969X8|Q9UJM4	Silent	SNP	ENST00000247161.3	37	CCDS14283.1																																																																																			C|1.000;T|0.000		0.617	ELK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056436.1	NM_005229	
FBN2	2201	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	5	127873149	127873149	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr5:127873149C>A	ENST00000508053.1	-	7	1122	c.148G>T	c.(148-150)Gct>Tct	p.A50S	FBN2_ENST00000262464.4_Missense_Mutation_p.A50S|FBN2_ENST00000508989.1_Missense_Mutation_p.A50S			P35556	FBN2_HUMAN	fibrillin 2	50					anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CCTGCTGTAGCGGACCGAACC	0.736																																					p.A50S		.											.	FBN2	146	0			c.G148T						.						13.0	16.0	15.0					5																	127873149		2191	4290	6481	SO:0001583	missense	2201	exon1			CTGTAGCGGACCG	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.148G>T	5.37:g.127873149C>A	ENSP00000424571:p.Ala50Ser	17.0	0.0		51.0	16.0	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	13.35	2.210148	0.39003	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989;ENST00000502468	D;D;D;T	0.85773	-1.82;-1.82;-2.03;-0.59	4.92	4.92	0.64577	.	0.000000	0.51477	D	0.000091	T	0.69806	0.3152	N	0.08118	0	0.25687	N	0.98574	P;P;P;B	0.47034	0.777;0.789;0.889;0.358	B;B;B;B	0.41236	0.241;0.17;0.351;0.122	T	0.63708	-0.6576	10	0.29301	T	0.29	.	10.8968	0.47027	0.0:0.911:0.0:0.089	.	50;50;50;50	P35556-2;E9PHW4;D6RJI3;P35556	.;.;.;FBN2_HUMAN	S	50	ENSP00000262464:A50S;ENSP00000424571:A50S;ENSP00000425596:A50S;ENSP00000424753:A50S	ENSP00000262464:A50S	A	-	1	0	FBN2	127901048	0.615000	0.27026	0.991000	0.47740	0.144000	0.21451	1.017000	0.29989	2.431000	0.82371	0.591000	0.81541	GCT	.		0.736	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
GALNTL5	168391	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	7	151664464	151664464	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr7:151664464G>A	ENST00000392800.2	+	2	387	c.133G>A	c.(133-135)Gct>Act	p.A45T	GALNTL5_ENST00000431418.2_Missense_Mutation_p.A45T	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5	45					spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		GCCTCTGTCAGCTTGGTCCCC	0.428																																					p.A45T		.											.	GALNTL5	92	0			c.G133A						.						62.0	63.0	63.0					7																	151664464		2203	4300	6503	SO:0001583	missense	168391	exon2			CTGTCAGCTTGGT	AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.133G>A	7.37:g.151664464G>A	ENSP00000376548:p.Ala45Thr	264.0	0.0		203.0	12.0	NM_145292	Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Missense_Mutation	SNP	ENST00000392800.2	37	CCDS5929.1	.	.	.	.	.	.	.	.	.	.	G	9.617	1.132789	0.21041	.	.	ENSG00000106648	ENST00000431418;ENST00000392800	T;T	0.59224	0.28;0.28	4.33	-8.67	0.00863	.	1.962090	0.02605	N	0.101470	T	0.33323	0.0859	N	0.22421	0.69	0.09310	N	1	B	0.22604	0.072	B	0.18871	0.023	T	0.11567	-1.0582	10	0.21014	T	0.42	.	2.7292	0.05222	0.5072:0.2096:0.1778:0.1054	.	45	Q7Z4T8	GLTL5_HUMAN	T	45	ENSP00000392582:A45T;ENSP00000376548:A45T	ENSP00000376548:A45T	A	+	1	0	GALNTL5	151295397	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-1.359000	0.02602	-1.821000	0.01213	0.650000	0.86243	GCT	.		0.428	GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348395.1	NM_145292	
GCNT2	2651	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	10529561	10529561	+	Silent	SNP	A	A	G			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr6:10529561A>G	ENST00000379597.3	+	1	973	c.417A>G	c.(415-417)gcA>gcG	p.A139A	GCNT2_ENST00000495262.1_Silent_p.A139A|GCNT2_ENST00000397423.2_Intron|GCNT2_ENST00000410107.1_Intron			Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)	139					maintenance of lens transparency (GO:0036438)|negative regulation of cell-substrate adhesion (GO:0010812)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of protein kinase B signaling (GO:0051897)|posttranscriptional regulation of gene expression (GO:0010608)|protein glycosylation (GO:0006486)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			endometrium(2)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)	12	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		TTAAAGGTGCAGTGAAACAGT	0.507																																					p.A139A		.											.	GCNT2	92	0			c.A417G						.						82.0	75.0	77.0					6																	10529561		2203	4300	6503	SO:0001819	synonymous_variant	2651	exon3			AGGTGCAGTGAAA	L41605	CCDS4512.1, CCDS4513.1, CCDS34338.1	6p24.2	2014-07-18	2006-02-23		ENSG00000111846	ENSG00000111846	2.4.1.150	"""Blood group antigens"", ""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4204	protein-coding gene	gene with protein product	"""Ii blood group"", ""unassigned linkage group 3"""	600429	"""glucosaminyl (N-acetyl) transferase 5"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Ii blood group)"", ""cataract, congenital"""	NACGT1, II, GCNT5, CCAT		8449405, 9915862	Standard	NM_145649		Approved	IGNT, NAGCT1, bA421M1.1, bA360O19.2, ULG3	uc003mze.3	Q06430	OTTHUMG00000014244	ENST00000379597.3:c.417A>G	6.37:g.10529561A>G		69.0	1.0		111.0	40.0	NM_145649		Silent	SNP	ENST00000379597.3	37	CCDS34338.1																																																																																			.		0.507	GCNT2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327912.3	NM_145649	
GPR98	84059	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	90079720	90079720	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr5:90079720A>C	ENST00000405460.2	+	67	13595	c.13499A>C	c.(13498-13500)cAc>cCc	p.H4500P	GPR98_ENST00000425867.2_Missense_Mutation_p.H161P	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	4500					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CTTGGGCGCCACCTAGTGAGC	0.438																																					p.H4500P		.											.	GPR98	103	0			c.A13499C						.						58.0	57.0	57.0					5																	90079720		1841	4083	5924	SO:0001583	missense	84059	exon67			GGCGCCACCTAGT	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.13499A>C	5.37:g.90079720A>C	ENSP00000384582:p.His4500Pro	92.0	1.0		116.0	27.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	A	17.18	3.324957	0.60634	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.25085	1.82;1.82	5.97	5.97	0.96955	.	0.141940	0.64402	D	0.000004	T	0.50599	0.1625	M	0.73962	2.25	0.40287	D	0.978467	D;D;D	0.76494	0.998;0.996;0.999	P;P;D	0.67548	0.896;0.731;0.952	T	0.49670	-0.8915	10	0.38643	T	0.18	.	16.4454	0.83928	1.0:0.0:0.0:0.0	.	161;4500;161	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	P	4500;4500;161	ENSP00000384582:H4500P;ENSP00000392618:H161P	ENSP00000296619:H4500P	H	+	2	0	GPR98	90115476	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.852000	0.69488	2.275000	0.75901	0.533000	0.62120	CAC	.		0.438	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
GTF2IRD1	9569	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	73932488	73932488	+	Silent	SNP	C	C	G	rs112098981	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr7:73932488C>G	ENST00000265755.3	+	5	834	c.441C>G	c.(439-441)gcC>gcG	p.A147A	GTF2IRD1_ENST00000476977.1_Silent_p.A147A|GTF2IRD1_ENST00000455841.2_Silent_p.A179A|GTF2IRD1_ENST00000489094.1_3'UTR|GTF2IRD1_ENST00000424337.2_Silent_p.A147A	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	147					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TGGGAAGGGCCAGTGTGGTGC	0.701													C|||	15	0.00299521	0.0113	0.0	5008	,	,		15718	0.0		0.0	False		,,,				2504	0.0				p.A179A		.											.	GTF2IRD1	94	0			c.C537G						.	C	,,	42,4342		1,40,2151	14.0	14.0	14.0		537,441,441	1.5	1.0	7	dbSNP_132	14	0,8592		0,0,4296	no	coding-synonymous,coding-synonymous,coding-synonymous	GTF2IRD1	NM_001199207.1,NM_005685.3,NM_016328.2	,,	1,40,6447	GG,GC,CC		0.0,0.958,0.3237	,,	179/977,147/945,147/960	73932488	42,12934	2192	4296	6488	SO:0001819	synonymous_variant	9569	exon5			AAGGGCCAGTGTG	AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.441C>G	7.37:g.73932488C>G		74.0	0.0		91.0	9.0	NM_001199207	O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Silent	SNP	ENST00000265755.3	37	CCDS5571.1																																																																																			C|0.996;G|0.004		0.701	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328	
GTPBP8	29083	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	3	112711969	112711969	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr3:112711969C>A	ENST00000383678.2	+	2	515	c.433C>A	c.(433-435)Cca>Aca	p.P145T	GTPBP8_ENST00000467752.1_Missense_Mutation_p.P34T|GTPBP8_ENST00000383677.3_Intron|RP11-484K9.4_ENST00000609673.1_RNA|GTPBP8_ENST00000473129.1_5'UTR	NM_014170.2	NP_054889.2	Q8N3Z3	GTPB8_HUMAN	GTP-binding protein 8 (putative)	145	EngB-type G.				barrier septum assembly (GO:0000917)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	6						CTCCAAAAAACCAGTATGTTG	0.333																																					p.P145T		.											.	GTPBP8	90	0			c.C433A						.						97.0	97.0	97.0					3																	112711969		2203	4300	6503	SO:0001583	missense	29083	exon2			AAAAAACCAGTAT	BC037163	CCDS33820.1, CCDS33821.1	3q13.2	2008-02-05			ENSG00000163607	ENSG00000163607			25007	protein-coding gene	gene with protein product							Standard	NM_014170		Approved	HSPC135	uc003dzn.3	Q8N3Z3	OTTHUMG00000159268	ENST00000383678.2:c.433C>A	3.37:g.112711969C>A	ENSP00000373176:p.Pro145Thr	360.0	0.0		284.0	17.0	NM_014170	A6NE99|A6NN11|A8K0P6|Q5I0Y4	Missense_Mutation	SNP	ENST00000383678.2	37	CCDS33820.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.5|22.5	4.301768|4.301768	0.81136|0.81136	.|.	.|.	ENSG00000163607|ENSG00000163607	ENST00000305485|ENST00000383678;ENST00000467752	.|T;T	.|0.22743	.|1.94;1.94	5.65|5.65	5.65|5.65	0.86999|0.86999	.|GTP-binding domain, HSR1-related (1);	1.009650|.	0.07954|.	N|.	0.981389|.	T|T	0.59046|0.59046	0.2165|0.2165	H|H	0.95470|0.95470	3.675|3.675	0.80722|0.80722	D|D	1|1	.|D	.|0.59767	.|0.986	.|P	.|0.62885	.|0.908	T|T	0.72141|0.72141	-0.4380|-0.4380	7|9	0.52906|0.87932	T|D	0.07|0	-28.0696|-28.0696	18.5031|18.5031	0.90889|0.90889	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|145	.|Q8N3Z3	.|GTPB8_HUMAN	K|T	168|145;34	.|ENSP00000373176:P145T;ENSP00000417632:P34T	ENSP00000303802:N168K|ENSP00000373176:P145T	N|P	+|+	3|1	2|0	GTPBP8|GTPBP8	114194659|114194659	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.902000|0.902000	0.53008|0.53008	6.916000|6.916000	0.75776|0.75776	2.661000|2.661000	0.90470|0.90470	0.467000|0.467000	0.42956|0.42956	AAC|CCA	.		0.333	GTPBP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354260.2	NM_014170	
HIPK1	204851	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	114500821	114500821	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr1:114500821A>G	ENST00000369558.1	+	8	2121	c.1889A>G	c.(1888-1890)cAg>cGg	p.Q630R	HIPK1_ENST00000369559.4_Missense_Mutation_p.Q630R|HIPK1_ENST00000369554.2_Missense_Mutation_p.Q630R|HIPK1_ENST00000369553.1_Missense_Mutation_p.Q236R|HIPK1_ENST00000406344.1_Missense_Mutation_p.Q236R|HIPK1_ENST00000369561.4_Missense_Mutation_p.Q596R|HIPK1_ENST00000369555.2_Missense_Mutation_p.Q630R|HIPK1_ENST00000340480.4_Missense_Mutation_p.Q256R|HIPK1_ENST00000426820.2_Missense_Mutation_p.Q630R			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	630					anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTTGCCCAGCAGGGTGTTTCC	0.478																																					p.Q630R		.											.	HIPK1	361	0			c.A1889G						.						110.0	108.0	109.0					1																	114500821		2203	4300	6503	SO:0001583	missense	204851	exon8			CCCAGCAGGGTGT	AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.1889A>G	1.37:g.114500821A>G	ENSP00000358571:p.Gln630Arg	229.0	1.0		229.0	95.0	NM_198268	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	ENST00000369558.1	37	CCDS867.1	.	.	.	.	.	.	.	.	.	.	A	14.22	2.471346	0.43942	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561;ENST00000340480;ENST00000369553;ENST00000406344	T;T;T;T;T;T;T;T;T;T	0.52295	0.76;0.78;0.8;0.85;0.85;0.8;0.67;3.79;2.88;2.88	5.23	5.23	0.72850	.	0.000000	0.64402	D	0.000004	T	0.31295	0.0792	N	0.10874	0.06	0.43598	D	0.995955	B;P;P	0.48294	0.019;0.851;0.908	B;P;D	0.64144	0.03;0.775;0.922	T	0.18398	-1.0338	10	0.09338	T	0.73	.	15.2844	0.73816	1.0:0.0:0.0:0.0	.	236;630;630	Q86Z02-4;Q86Z02;Q86Z02-2	.;HIPK1_HUMAN;.	R	701;630;630;630;630;630;596;256;236;236	ENSP00000407442:Q701R;ENSP00000358572:Q630R;ENSP00000409673:Q630R;ENSP00000358567:Q630R;ENSP00000358568:Q630R;ENSP00000358571:Q630R;ENSP00000358574:Q596R;ENSP00000340956:Q256R;ENSP00000358566:Q236R;ENSP00000384960:Q236R	ENSP00000340956:Q256R	Q	+	2	0	HIPK1	114302344	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.599000	0.46231	2.192000	0.70111	0.459000	0.35465	CAG	.		0.478	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268	
HTATSF1	27336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	135593320	135593320	+	Silent	SNP	C	C	G			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chrX:135593320C>G	ENST00000218364.4	+	9	1590	c.1416C>G	c.(1414-1416)ccC>ccG	p.P472P	HTATSF1_ENST00000535601.1_Silent_p.P472P	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	472	Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					AGGGCTGCCCCAAAAGAGGGT	0.443																																					p.P472P		.											.	HTATSF1	132	0			c.C1416G						.						45.0	50.0	48.0					X																	135593320		2187	4280	6467	SO:0001819	synonymous_variant	27336	exon10			CTGCCCCAAAAGA	U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.1416C>G	X.37:g.135593320C>G		66.0	0.0		72.0	14.0	NM_001163280	D3DWG9|Q59G06|Q99730	Silent	SNP	ENST00000218364.4	37	CCDS14657.1																																																																																			.		0.443	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1	NM_014500	
IGF2R	3482	ucsc.edu;bcgsc.ca	37	6	160471532	160471532	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr6:160471532A>G	ENST00000356956.1	+	19	2690	c.2542A>G	c.(2542-2544)Agt>Ggt	p.S848G		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	848					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	GGTTTCCATCAGTAACTTGGG	0.532																																					p.S848G		.											.	IGF2R	118	0			c.A2542G						.						103.0	100.0	101.0					6																	160471532		2203	4300	6503	SO:0001583	missense	3482	exon19			TCCATCAGTAACT	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.2542A>G	6.37:g.160471532A>G	ENSP00000349437:p.Ser848Gly	53.0	0.0		54.0	5.0	NM_000876	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	37	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.205534	0.79127	.	.	ENSG00000197081	ENST00000356956	T	0.02158	4.42	4.97	4.97	0.65823	Mannose-6-phosphate receptor, binding (1);	0.081675	0.85682	D	0.000000	T	0.03695	0.0105	M	0.76002	2.32	0.58432	D	0.999996	D	0.56746	0.977	P	0.52066	0.689	T	0.50550	-0.8815	10	0.37606	T	0.19	-10.8116	13.5083	0.61497	1.0:0.0:0.0:0.0	.	848	P11717	MPRI_HUMAN	G	848	ENSP00000349437:S848G	ENSP00000349437:S848G	S	+	1	0	IGF2R	160391522	1.000000	0.71417	0.955000	0.39395	0.735000	0.41995	6.389000	0.73199	1.997000	0.58415	0.402000	0.26972	AGT	.		0.532	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
KCNJ2	3759	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	68172290	68172290	+	Silent	SNP	T	T	C			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr17:68172290T>C	ENST00000243457.3	+	2	1493	c.1110T>C	c.(1108-1110)aaT>aaC	p.N370N	KCNJ2_ENST00000535240.1_Silent_p.N370N	NM_000891.2	NP_000882.1	P63252	KCNJ2_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 2	370					cardiac muscle cell action potential involved in contraction (GO:0086002)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|magnesium ion transport (GO:0015693)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of resting membrane potential (GO:0060075)|regulation of skeletal muscle contraction via regulation of action potential (GO:0014861)|relaxation of cardiac muscle (GO:0055119)|relaxation of skeletal muscle (GO:0090076)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of membrane (GO:0031224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(13)|skin(1)|urinary_tract(1)	25	Breast(10;1.64e-08)					TCCTCTCAAATGCAAATTCAT	0.433																																					p.N370N		.											.	KCNJ2	90	0			c.T1110C						.						113.0	120.0	117.0					17																	68172290		2203	4300	6503	SO:0001819	synonymous_variant	3759	exon2			CTCAAATGCAAAT	AF011904	CCDS11688.1	17q24.3	2014-09-17				ENSG00000123700		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6263	protein-coding gene	gene with protein product		600681				7696590, 11240146, 16382105	Standard	NM_000891		Approved	Kir2.1, IRK1, LQT7	uc002jir.3	P63252		ENST00000243457.3:c.1110T>C	17.37:g.68172290T>C		93.0	0.0		144.0	14.0	NM_000891	O15110|P48049	Silent	SNP	ENST00000243457.3	37	CCDS11688.1																																																																																			.		0.433	KCNJ2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450889.1	NM_000891	
AREL1	9870	ucsc.edu;bcgsc.ca	37	14	75131540	75131540	+	Splice_Site	SNP	T	T	C			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr14:75131540T>C	ENST00000356357.4	-	18	2707	c.2192A>G	c.(2191-2193)aAg>aGg	p.K731R	AREL1_ENST00000557401.1_5'UTR	NM_001039479.1	NP_001034568.1	O15033	AREL1_HUMAN	apoptosis resistant E3 ubiquitin protein ligase 1	731	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TCCATTTACCTTTTCTCTGAA	0.453																																					p.K731R		.											.	KIAA0317	525	0			c.A2192G						.						90.0	84.0	86.0					14																	75131540		1928	4134	6062	SO:0001630	splice_region_variant	9870	exon18			TTTACCTTTTCTC	AB002315	CCDS41971.1	14q24.2	2013-04-15	2013-04-15	2013-04-15	ENSG00000119682	ENSG00000119682			20363	protein-coding gene	gene with protein product		615380	"""KIAA0317"""	KIAA0317		9205841, 23479728	Standard	XM_006720344		Approved		uc001xqb.3	O15033	OTTHUMG00000154499	ENST00000356357.4:c.2193+1A>G	14.37:g.75131540T>C		62.0	0.0		43.0	4.0	NM_001039479	B4E2C7|Q7LDY1|Q8IYY9	Missense_Mutation	SNP	ENST00000356357.4	37	CCDS41971.1	.	.	.	.	.	.	.	.	.	.	T	18.82	3.705205	0.68615	.	.	ENSG00000119682	ENST00000356357;ENST00000543377;ENST00000556202	T;T	0.58358	0.34;0.34	5.24	5.24	0.73138	HECT (4);	0.000000	0.85682	D	0.000000	T	0.57154	0.2034	L	0.38175	1.15	0.80722	D	1	D	0.59767	0.986	P	0.58970	0.849	T	0.51060	-0.8753	10	0.18710	T	0.47	.	15.4313	0.75102	0.0:0.0:0.0:1.0	.	731	O15033	K0317_HUMAN	R	731;570;570	ENSP00000348714:K731R;ENSP00000452101:K570R	ENSP00000348714:K731R	K	-	2	0	KIAA0317	74201293	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.737000	0.84957	2.101000	0.63845	0.455000	0.32223	AAG	.		0.453	AREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335517.2	NM_014821	Missense_Mutation
KIF17	57576	ucsc.edu;bcgsc.ca	37	1	21014017	21014017	+	Missense_Mutation	SNP	G	G	A	rs114229809	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr1:21014017G>A	ENST00000247986.2	-	8	2112	c.1802C>T	c.(1801-1803)cCg>cTg	p.P601L	KIF17_ENST00000375044.1_Missense_Mutation_p.P501L|KIF17_ENST00000400463.3_Missense_Mutation_p.P601L|KIF17_ENST00000490034.1_Intron			Q9P2E2	KIF17_HUMAN	kinesin family member 17	601					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		CACCTCCTGCGGCTCCTCTTG	0.642													G|||	3	0.000599042	0.0023	0.0	5008	,	,		17858	0.0		0.0	False		,,,				2504	0.0				p.P601L		.											.	KIF17	94	0			c.C1802T						.	G	LEU/PRO,LEU/PRO	12,4394	16.8+/-37.8	0,12,2191	33.0	36.0	35.0		1802,1802	-0.4	0.0	1	dbSNP_132	35	0,8600		0,0,4300	yes	missense,missense	KIF17	NM_001122819.1,NM_020816.2	98,98	0,12,6491	AA,AG,GG		0.0,0.2724,0.0923	possibly-damaging,possibly-damaging	601/1029,601/1030	21014017	12,12994	2203	4300	6503	SO:0001583	missense	57576	exon8			TCCTGCGGCTCCT	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.1802C>T	1.37:g.21014017G>A	ENSP00000247986:p.Pro601Leu	47.0	0.0		42.0	4.0	NM_020816	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	ENST00000247986.2	37	CCDS213.1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	G	11.66	1.706008	0.30232	0.002724	0.0	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986	T;T;T	0.71698	-0.59;-0.45;-0.45	4.6	-0.415	0.12355	.	.	.	.	.	T	0.49218	0.1544	L	0.42245	1.32	0.09310	N	1	B;B	0.11235	0.003;0.004	B;B	0.08055	0.003;0.002	T	0.47849	-0.9085	9	0.66056	D	0.02	.	4.4696	0.11706	0.2313:0.0:0.5971:0.1717	.	601;601	Q9P2E2-3;Q9P2E2	.;KIF17_HUMAN	L	501;601;601	ENSP00000364184:P501L;ENSP00000383311:P601L;ENSP00000247986:P601L	ENSP00000247986:P601L	P	-	2	0	KIF17	20886604	0.000000	0.05858	0.000000	0.03702	0.069000	0.16628	-0.055000	0.11807	-0.182000	0.10602	0.467000	0.42956	CCG	G|0.999;A|0.001		0.642	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276995.1	NM_020816	
KIF26B	55083	hgsc.bcm.edu;bcgsc.ca	37	1	245862258	245862258	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr1:245862258G>A	ENST00000407071.2	+	14	6537	c.6097G>A	c.(6097-6099)Gcg>Acg	p.A2033T	KIF26B_ENST00000366518.4_Missense_Mutation_p.A1652T	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	2033					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CGAGGTCCGCGCGAAGTACGA	0.567																																					p.A2033T		.											.	KIF26B	25	0			c.G6097A						.						73.0	80.0	78.0					1																	245862258		2105	4222	6327	SO:0001583	missense	55083	exon14			GTCCGCGCGAAGT	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.6097G>A	1.37:g.245862258G>A	ENSP00000385545:p.Ala2033Thr	76.0	0.0		172.0	8.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	37	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.458239	0.84317	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	D;D	0.82433	-1.61;-1.6	5.82	5.82	0.92795	.	.	.	.	.	D	0.90352	0.6981	M	0.65975	2.015	0.58432	D	0.999999	D	0.89917	1.0	D	0.66602	0.945	D	0.90525	0.4491	9	0.87932	D	0	.	20.099	0.97865	0.0:0.0:1.0:0.0	.	2033	Q2KJY2	KI26B_HUMAN	T	2033;1652;1649	ENSP00000385545:A2033T;ENSP00000355475:A1652T	ENSP00000355475:A1652T	A	+	1	0	KIF26B	243928881	1.000000	0.71417	0.991000	0.47740	0.678000	0.39670	9.838000	0.99474	2.752000	0.94435	0.655000	0.94253	GCG	.		0.567	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
KRT83	3889	hgsc.bcm.edu;bcgsc.ca	37	12	52708547	52708547	+	Silent	SNP	G	G	A	rs564164020		TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr12:52708547G>A	ENST00000293670.3	-	9	1412	c.1350C>T	c.(1348-1350)tcC>tcT	p.S450S	AC121757.1_ENST00000594763.1_5'Flank	NM_002282.3	NP_002273.3	P78385	KRT83_HUMAN	keratin 83	450	Tail.				aging (GO:0007568)|epidermis development (GO:0008544)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(4)|stomach(7)|upper_aerodigestive_tract(1)	32	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TCACCGGCCGGGAGCCCGACA	0.657													g|||	1	0.000199681	0.0008	0.0	5008	,	,		15357	0.0		0.0	False		,,,				2504	0.0				p.S450S	GBM(41;747 834 12702 24089 39393)|Esophageal Squamous(97;805 1414 12559 28198 31861)	.											.	KRT83	91	0			c.C1350T						.						21.0	22.0	22.0					12																	52708547		2191	4294	6485	SO:0001819	synonymous_variant	3889	exon9			CGGCCGGGAGCCC	X99141	CCDS8823.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000170523	ENSG00000170523		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6460	protein-coding gene	gene with protein product	"""hard keratin type II"""	602765	"""keratin, hair, basic, 3"""	KRTHB3		9084137, 16831889	Standard	NM_002282		Approved	Hb-3	uc001saf.2	P78385	OTTHUMG00000169632	ENST00000293670.3:c.1350C>T	12.37:g.52708547G>A		87.0	0.0		111.0	10.0	NM_002282	A1A4S9|B2RC21|Q6NT21|Q9NSB3	Silent	SNP	ENST00000293670.3	37	CCDS8823.1																																																																																			.		0.657	KRT83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405182.1	NM_002282	
LBP	3929	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	36999419	36999419	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr20:36999419G>A	ENST00000217407.2	+	11	1348	c.1187G>A	c.(1186-1188)aGc>aAc	p.S396N		NM_004139.3	NP_004130.2	P18428	LBP_HUMAN	lipopolysaccharide binding protein	396					acute-phase response (GO:0006953)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of molecule of bacterial origin (GO:0032490)|innate immune response (GO:0045087)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of tumor necrosis factor production (GO:0032720)|opsonization (GO:0008228)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage activation (GO:0043032)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of respiratory burst involved in inflammatory response (GO:0060265)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(1)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				TTCAATACCAGCAAGATCACT	0.502																																					p.S396N		.											.	LBP	91	0			c.G1187A						.						165.0	146.0	153.0					20																	36999419		2203	4300	6503	SO:0001583	missense	3929	exon11			ATACCAGCAAGAT		CCDS13304.1	20q11.23	2011-08-16	2001-11-28		ENSG00000129988	ENSG00000129988		"""BPI fold containing"""	6517	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 2"""	151990	"""lipopolysaccharide-binding protein"""			8432532	Standard	NM_004139		Approved	BPIFD2	uc002xic.2	P18428	OTTHUMG00000032447	ENST00000217407.2:c.1187G>A	20.37:g.36999419G>A	ENSP00000217407:p.Ser396Asn	135.0	0.0		233.0	22.0	NM_004139	B2R938|O43438|Q92672|Q9H403|Q9UD66	Missense_Mutation	SNP	ENST00000217407.2	37	CCDS13304.1	.	.	.	.	.	.	.	.	.	.	G	5.785	0.329173	0.10956	.	.	ENSG00000129988	ENST00000217407;ENST00000538599	T	0.09538	2.97	4.87	1.41	0.22369	Lipid-binding serum glycoprotein, C-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.297164	0.34484	N	0.003938	T	0.06280	0.0162	L	0.28014	0.82	0.22127	N	0.999342	B	0.14012	0.009	B	0.25405	0.06	T	0.44559	-0.9320	10	0.09843	T	0.71	-10.8147	6.6596	0.23007	0.1187:0.3223:0.559:0.0	.	396	P18428	LBP_HUMAN	N	396	ENSP00000217407:S396N	ENSP00000217407:S396N	S	+	2	0	LBP	36432833	0.999000	0.42202	0.999000	0.59377	0.582000	0.36321	1.820000	0.39032	0.121000	0.18284	-0.300000	0.09419	AGC	.		0.502	LBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079174.2	NM_004139	
LRIT2	340745	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	85981835	85981835	+	Silent	SNP	G	G	A	rs140185624	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr10:85981835G>A	ENST00000372113.4	-	3	1499	c.1494C>T	c.(1492-1494)cgC>cgT	p.R498R	LRIT2_ENST00000538192.1_Silent_p.R508R	NM_001017924.2	NP_001017924.1	A6NDA9	LRIT2_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 2	498						integral component of membrane (GO:0016021)		p.R498R(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|prostate(6)|urinary_tract(1)	32						GAAGACAGCCGCGCAGGACCC	0.632																																					p.R498R		.											.	LRIT2	92	1	Substitution - coding silent(1)	lung(1)	c.C1494T						.	G		1,4405		0,1,2202	36.0	43.0	41.0		1494	2.8	0.0	10	dbSNP_134	41	2,8596		0,2,4297	no	coding-synonymous	LRIT2	NM_001017924.2		0,3,6499	AA,AG,GG		0.0233,0.0227,0.0231		498/551	85981835	3,13001	2203	4299	6502	SO:0001819	synonymous_variant	340745	exon3			ACAGCCGCGCAGG		CCDS31234.1, CCDS60581.1	10q23.2	2013-01-11	2007-06-19	2007-06-19	ENSG00000204033	ENSG00000204033		"""Immunoglobulin superfamily / I-set domain containing"""	23443	protein-coding gene	gene with protein product			"""leucine rich repeat containing 22"""	LRRC22			Standard	NM_001017924		Approved	AC022389.4	uc001kcy.3	A6NDA9	OTTHUMG00000018633	ENST00000372113.4:c.1494C>T	10.37:g.85981835G>A		75.0	0.0		109.0	11.0	NM_001017924	B7ZME6	Silent	SNP	ENST00000372113.4	37	CCDS31234.1																																																																																			G|1.000;A|0.000		0.632	LRIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049110.4	XM_291697	
MAP3K2	10746	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	128075798	128075798	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr2:128075798C>A	ENST00000409947.1	-	13	1423	c.1141G>T	c.(1141-1143)Gaa>Taa	p.E381*	MAP3K2_ENST00000344908.5_Nonsense_Mutation_p.E381*|RNU6-1147P_ENST00000363380.1_RNA			Q9Y2U5	M3K2_HUMAN	mitogen-activated protein kinase kinase kinase 2	381	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|cellular response to mechanical stimulus (GO:0071260)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.E381*(1)		central_nervous_system(1)|large_intestine(1)|lung(3)|ovary(2)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0706)	Bosutinib(DB06616)	ACAGCCAATTCTCTTCCTGTA	0.438																																					p.E381X		.											.	MAP3K2	1403	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1141T						.						109.0	106.0	107.0					2																	128075798		1862	4093	5955	SO:0001587	stop_gained	10746	exon12			CCAATTCTCTTCC	AF111105	CCDS46404.1	2q21.1	2011-06-09			ENSG00000169967	ENSG00000169967		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6854	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 2"""	609487		MEKK2		8621389, 10085062	Standard	NM_006609		Approved	MEKK2B	uc002toj.2	Q9Y2U5	OTTHUMG00000153397	ENST00000409947.1:c.1141G>T	2.37:g.128075798C>A	ENSP00000387246:p.Glu381*	118.0	0.0		114.0	13.0	NM_006609	B9EG87|Q53QL9|Q53S75|Q59GZ6|Q8NC32|Q9NYK3	Nonsense_Mutation	SNP	ENST00000409947.1	37	CCDS46404.1	.	.	.	.	.	.	.	.	.	.	C	39	7.772382	0.98480	.	.	ENSG00000169967	ENST00000409947;ENST00000344908	.	.	.	5.69	4.81	0.61882	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	16.6685	0.85259	0.0:0.8701:0.1299:0.0	.	.	.	.	X	381	.	ENSP00000343463:E381X	E	-	1	0	MAP3K2	127792268	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	7.734000	0.84928	1.389000	0.46526	-0.291000	0.09656	GAA	.		0.438	MAP3K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331014.1	NM_006609	
NACAD	23148	broad.mit.edu;bcgsc.ca	37	7	45120507	45120507	+	Missense_Mutation	SNP	A	A	T	rs188128267	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr7:45120507A>T	ENST00000490531.2	-	6	4538	c.4519T>A	c.(4519-4521)Tgc>Agc	p.C1507S		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	1507					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						tcttcctTGCACTCCAGCCTC	0.647													A|||	3	0.000599042	0.0015	0.0014	5008	,	,		17691	0.0		0.0	False		,,,				2504	0.0				p.C1507S		.											.	.	.	0			c.T4519A						.						35.0	33.0	34.0					7																	45120507		692	1591	2283	SO:0001583	missense	23148	exon6			CCTTGCACTCCAG	AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.4519T>A	7.37:g.45120507A>T	ENSP00000420477:p.Cys1507Ser	40.0	0.0		35.0	4.0	NM_001146334		Missense_Mutation	SNP	ENST00000490531.2	37	CCDS47582.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	A	7.979	0.750720	0.15778	.	.	ENSG00000136274	ENST00000490531	T	0.10668	2.85	4.16	0.406	0.16366	.	0.096296	0.64402	D	0.000001	T	0.04182	0.0116	L	0.27053	0.805	0.09310	N	1	B	0.30664	0.289	B	0.26693	0.072	T	0.29119	-1.0022	10	0.08381	T	0.77	-8.9714	0.7348	0.00963	0.3754:0.1525:0.1091:0.363	.	1507	O15069	NACAD_HUMAN	S	1507	ENSP00000420477:C1507S	ENSP00000420477:C1507S	C	-	1	0	NACAD	45087032	0.942000	0.31987	0.009000	0.14445	0.696000	0.40369	2.265000	0.43311	0.671000	0.31185	0.363000	0.22086	TGC	A|0.999;T|0.000		0.647	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353652.2	NM_001146334	
NBEA	26960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	36046548	36046548	+	Missense_Mutation	SNP	C	C	T	rs371213802		TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr13:36046548C>T	ENST00000400445.3	+	41	6994	c.6460C>T	c.(6460-6462)Ctc>Ttc	p.L2154F	NBEA_ENST00000310336.4_Missense_Mutation_p.L2154F|NBEA_ENST00000540320.1_Missense_Mutation_p.L2154F|NBEA_ENST00000379939.2_Missense_Mutation_p.L2151F	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2154					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CCCAGTGGTTCTCAGCACCCC	0.572																																					p.L2154F		.											.	NBEA	144	0			c.C6460T						.						57.0	60.0	59.0					13																	36046548		1997	4162	6159	SO:0001583	missense	26960	exon41			GTGGTTCTCAGCA	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.6460C>T	13.37:g.36046548C>T	ENSP00000383295:p.Leu2154Phe	22.0	0.0		32.0	12.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	C	19.23	3.788096	0.70337	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518	T;T;T;T	0.56611	0.45;0.45;0.45;0.45	5.51	5.51	0.81932	PH-BEACH domain (1);	0.000000	0.85682	D	0.000000	T	0.49729	0.1574	L	0.51853	1.615	0.80722	D	1	B;B	0.29531	0.024;0.247	B;B	0.22880	0.019;0.042	T	0.47005	-0.9150	10	0.45353	T	0.12	.	19.4328	0.94778	0.0:1.0:0.0:0.0	.	2154;2151	Q8NFP9;Q5T321	NBEA_HUMAN;.	F	2154;2154;2151;2154;781	ENSP00000440951:L2154F;ENSP00000383295:L2154F;ENSP00000369271:L2151F;ENSP00000308534:L2154F	ENSP00000308534:L2154F	L	+	1	0	NBEA	34944548	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.697000	0.61782	2.584000	0.87258	0.563000	0.77884	CTC	.		0.572	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
NMBR	4829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	142396836	142396836	+	Silent	SNP	G	G	C			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr6:142396836G>C	ENST00000258042.1	-	3	1262	c.1122C>G	c.(1120-1122)acC>acG	p.T374T	NMBR_ENST00000480652.1_Intron	NM_002511.2	NP_002502.2	P28336	NMBR_HUMAN	neuromedin B receptor	374					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			breast(2)|central_nervous_system(3)|endometrium(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		AAACAGAATTGGTCACCATGT	0.443																																					p.T374T		.											.	NMBR	946	0			c.C1122G						.						117.0	106.0	110.0					6																	142396836		2203	4300	6503	SO:0001819	synonymous_variant	4829	exon3			AGAATTGGTCACC		CCDS5196.1	6q24.1	2014-02-21			ENSG00000135577	ENSG00000135577		"""GPCR / Class A : Bombesin receptors"""	7843	protein-coding gene	gene with protein product	"""bombesin receptor 1"""	162341					Standard	NM_002511		Approved	BB1	uc003qiu.3	P28336	OTTHUMG00000015704	ENST00000258042.1:c.1122C>G	6.37:g.142396836G>C		168.0	0.0		169.0	46.0	NM_002511	E9KL38|Q5VUK8	Silent	SNP	ENST00000258042.1	37	CCDS5196.1																																																																																			.		0.443	NMBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042479.1		
NOX5	79400	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	69348934	69348934	+	Silent	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr15:69348934G>A	ENST00000388866.3	+	16	2237	c.2196G>A	c.(2194-2196)aaG>aaA	p.K732K	NOX5_ENST00000448182.3_Silent_p.K686K|NOX5_ENST00000455873.3_Silent_p.K697K|NOX5_ENST00000530406.2_Silent_p.K704K|NOX5_ENST00000260364.5_Silent_p.K714K	NM_001184779.1|NM_024505.3	NP_001171708.1|NP_078781.3	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5	732					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cytokine secretion (GO:0050663)|cytokinesis (GO:0000910)|endothelial cell proliferation (GO:0001935)|oxidation-reduction process (GO:0055114)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|proton transport (GO:0015992)|regulation of fusion of sperm to egg plasma membrane (GO:0043012)|regulation of proton transport (GO:0010155)|superoxide anion generation (GO:0042554)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|hydrogen ion channel activity (GO:0015252)|NADP binding (GO:0050661)|superoxide-generating NADPH oxidase activity (GO:0016175)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35						CTGAGAAGAAGGGCAAGGTGC	0.527																																					p.K732K		.											.	NOX5	136	0			c.G2196A						.						91.0	87.0	89.0					15																	69348934		2200	4298	6498	SO:0001819	synonymous_variant	79400	exon16			GAAGAAGGGCAAG	AF317889	CCDS32276.1, CCDS32276.2, CCDS53953.1, CCDS53954.1	15q22.31	2013-01-10			ENSG00000255346	ENSG00000255346		"""EF-hand domain containing"""	14874	protein-coding gene	gene with protein product		606572				11483596	Standard	NM_001184779		Approved	NOX5A, NOX5B	uc002ars.2	Q96PH1	OTTHUMG00000133320	ENST00000388866.3:c.2196G>A	15.37:g.69348934G>A		74.0	1.0		111.0	17.0	NM_024505	B2RBJ4|Q08AN2|Q08AN3|Q8TEQ1|Q8TER4|Q96PH2|Q96PJ8|Q96PJ9|Q9H6E0|Q9HAM8	Silent	SNP	ENST00000388866.3	37	CCDS32276.2																																																																																			.		0.527	NOX5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257124.2	NM_024505	
OR10R2	343406	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	158450031	158450031	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr1:158450031T>C	ENST00000368152.1	+	1	364	c.364T>C	c.(364-366)Ttc>Ctc	p.F122L	RP11-144L1.4_ENST00000426251.1_RNA|RP11-144L1.4_ENST00000419738.1_RNA	NM_001004472.1	NP_001004472.1	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R, member 2	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(26)|pancreas(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	41	all_hematologic(112;0.0378)					TCTTCAAATGTTCTTCTTCCT	0.453																																					p.F122L		.											.	OR10R2	161	0			c.T364C						.						401.0	335.0	357.0					1																	158450031		2203	4300	6503	SO:0001583	missense	343406	exon1			CAAATGTTCTTCT	AB065640	CCDS30898.1	1q23.1	2012-08-09			ENSG00000198965	ENSG00000198965		"""GPCR / Class A : Olfactory receptors"""	14820	protein-coding gene	gene with protein product							Standard	NM_001004472		Approved	OR10R2Q	uc010pik.2	Q8NGX6	OTTHUMG00000019632	ENST00000368152.1:c.364T>C	1.37:g.158450031T>C	ENSP00000357134:p.Phe122Leu	396.0	0.0		657.0	53.0	NM_001004472	Q5VWM8|Q6IFS1|Q96R61	Missense_Mutation	SNP	ENST00000368152.1	37	CCDS30898.1	.	.	.	.	.	.	.	.	.	.	t	21.6	4.174090	0.78452	.	.	ENSG00000198965	ENST00000368152	T	0.02067	4.47	4.48	4.48	0.54585	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.03477	0.0100	M	0.68728	2.09	0.36402	D	0.863218	P	0.50943	0.94	P	0.52424	0.698	T	0.41360	-0.9513	9	0.52906	T	0.07	.	12.8873	0.58051	0.0:0.0:0.0:1.0	.	122	Q8NGX6	O10R2_HUMAN	L	122	ENSP00000357134:F122L	ENSP00000357134:F122L	F	+	1	0	OR10R2	156716655	0.999000	0.42202	1.000000	0.80357	0.931000	0.56810	3.223000	0.51231	1.847000	0.53656	0.533000	0.62120	TTC	.		0.453	OR10R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051847.2	NM_001004472	
OR9A4	130075	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	141618875	141618875	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr7:141618875C>T	ENST00000548136.1	+	1	259	c.200C>T	c.(199-201)gCc>gTc	p.A67V	MGAM_ENST00000497554.1_Intron	NM_001001656.1	NP_001001656.1	Q8NGU2	OR9A4_HUMAN	olfactory receptor, family 9, subfamily A, member 4	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|large_intestine(9)|lung(7)|prostate(1)|skin(2)	22	Melanoma(164;0.0171)					CACCTCTCTGCCCTGGAGATC	0.493																																					p.A67V		.											.	OR9A4	91	0			c.C200T						.						129.0	135.0	133.0					7																	141618875		2203	4300	6503	SO:0001583	missense	130075	exon1			TCTCTGCCCTGGA		CCDS43661.1	7q34	2012-10-03			ENSG00000258083	ENSG00000258083		"""GPCR / Class A : Olfactory receptors"""	15095	protein-coding gene	gene with protein product							Standard	NM_001001656		Approved		uc003vwu.1	Q8NGU2	OTTHUMG00000158370	ENST00000548136.1:c.200C>T	7.37:g.141618875C>T	ENSP00000448789:p.Ala67Val	205.0	1.0		199.0	44.0	NM_001001656	B9EGV6|Q6IFI4	Missense_Mutation	SNP	ENST00000548136.1	37	CCDS43661.1	.	.	.	.	.	.	.	.	.	.	.	0.355	-0.942720	0.02322	.	.	ENSG00000258083	ENST00000548136	T	0.00547	6.66	3.8	-0.887	0.10587	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00271	0.0008	N	0.02736	-0.51	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.35748	-0.9776	9	0.42905	T	0.14	-4.2865	7.5477	0.27777	0.0:0.5535:0.0:0.4465	.	67	Q8NGU2	OR9A4_HUMAN	V	67	ENSP00000448789:A67V	ENSP00000386148:A67V	A	+	2	0	OR9A4	141265344	0.000000	0.05858	0.549000	0.28204	0.183000	0.23260	0.828000	0.27435	0.065000	0.16485	-0.290000	0.09829	GCC	.		0.493	OR9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350806.3	NM_001001656	
PAPPA2	60676	broad.mit.edu;bcgsc.ca	37	1	176671815	176671815	+	Silent	SNP	G	G	A	rs114236977	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr1:176671815G>A	ENST00000367662.3	+	9	4473	c.3309G>A	c.(3307-3309)tcG>tcA	p.S1103S		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1103					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GAGAAGCTTCGCCTCCTCTGA	0.498													g|||	13	0.00259585	0.0098	0.0	5008	,	,		19012	0.0		0.0	False		,,,				2504	0.0				p.S1103S		.											.	PAPPA2	548	0			c.G3309A						.	A		14,3924		0,14,1955	96.0	95.0	95.0		3309	-10.5	0.8	1	dbSNP_132	95	1,8301		0,1,4150	no	coding-synonymous	PAPPA2	NM_020318.2		0,15,6105	AA,AG,GG		0.012,0.3555,0.1225		1103/1792	176671815	15,12225	1969	4151	6120	SO:0001819	synonymous_variant	60676	exon9			AGCTTCGCCTCCT	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.3309G>A	1.37:g.176671815G>A		90.0	1.0		152.0	10.0	NM_020318	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Silent	SNP	ENST00000367662.3	37	CCDS41438.1																																																																																			G|0.998;A|0.002		0.498	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
PIK3C2G	5288	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	18439830	18439830	+	Missense_Mutation	SNP	C	C	T	rs186647102		TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr12:18439830C>T	ENST00000266497.5	+	2	766	c.728C>T	c.(727-729)aCg>aTg	p.T243M	PIK3C2G_ENST00000433979.1_Missense_Mutation_p.T243M|PIK3C2G_ENST00000538779.1_Missense_Mutation_p.T243M|PIK3C2G_ENST00000535651.1_Missense_Mutation_p.T243M|RERGL_ENST00000541632.1_Intron|PIK3C2G_ENST00000536967.1_3'UTR			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	243					chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				AGCAGCAATACGAGTCTGGCC	0.303																																					p.T243M		.											.	PIK3C2G	1312	0			c.C728T						.	C	MET/THR	1,3621		0,1,1810	46.0	44.0	45.0		728	-7.8	0.0	12		45	0,8138		0,0,4069	no	missense	PIK3C2G	NM_004570.4	81	0,1,5879	TT,TC,CC		0.0,0.0276,0.0085	benign	243/1446	18439830	1,11759	1811	4069	5880	SO:0001583	missense	5288	exon3			GCAATACGAGTCT	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.728C>T	12.37:g.18439830C>T	ENSP00000266497:p.Thr243Met	362.0	0.0		386.0	41.0	NM_004570	A1L3U0	Missense_Mutation	SNP	ENST00000266497.5	37	CCDS44839.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	1.410	-0.575720	0.03882	2.76E-4	0.0	ENSG00000139144	ENST00000535651;ENST00000433979;ENST00000266497;ENST00000538779	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	3.87	-7.75	0.01236	.	3.323350	0.00633	N	0.000496	T	0.15349	0.0370	N	0.02539	-0.55	0.09310	N	1	B;B;B	0.10296	0.002;0.003;0.002	B;B;B	0.04013	0.0;0.001;0.0	T	0.22591	-1.0212	10	0.51188	T	0.08	3.3615	1.6425	0.02755	0.4079:0.1576:0.2966:0.1379	.	242;243;243	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	M	243	ENSP00000443850:T243M;ENSP00000404845:T243M;ENSP00000266497:T243M;ENSP00000445381:T243M	ENSP00000266497:T243M	T	+	2	0	PIK3C2G	18331097	0.000000	0.05858	0.000000	0.03702	0.500000	0.33767	-2.001000	0.01465	-3.046000	0.00261	-0.438000	0.05819	ACG	C|0.999;T|0.000		0.303	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570	
PIKFYVE	200576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	209190043	209190043	+	Silent	SNP	C	C	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr2:209190043C>T	ENST00000264380.4	+	20	2666	c.2508C>T	c.(2506-2508)ggC>ggT	p.G836G		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	836					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						AGCACCTAGGCTGTACAATCA	0.398																																					p.G836G		.											.	PIKFYVE	583	0			c.C2508T						.						80.0	74.0	76.0					2																	209190043		2203	4300	6503	SO:0001819	synonymous_variant	200576	exon20			CCTAGGCTGTACA	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.2508C>T	2.37:g.209190043C>T		153.0	0.0		158.0	23.0	NM_015040	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Silent	SNP	ENST00000264380.4	37	CCDS2382.1																																																																																			.		0.398	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	
PLIN4	729359	hgsc.bcm.edu;bcgsc.ca	37	19	4517618	4517618	+	Silent	SNP	G	G	A	rs7250771	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr19:4517618G>A	ENST00000301286.3	-	1	98	c.99C>T	c.(97-99)gcC>gcT	p.A33A		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	33						cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						TGGGGTCAGCGGCCGGCCGGG	0.692													G|||	41	0.0081869	0.0303	0.0	5008	,	,		12624	0.0		0.001	False		,,,				2504	0.0				p.A33A		.											.	PLIN4	68	0			c.C99T						.	G		108,3804		3,102,1851	11.0	14.0	13.0		99	-4.2	0.0	19	dbSNP_116	13	0,8248		0,0,4124	no	coding-synonymous	PLIN4	NM_001080400.1		3,102,5975	AA,AG,GG		0.0,2.7607,0.8882		33/1358	4517618	108,12052	1956	4124	6080	SO:0001819	synonymous_variant	729359	exon1			GTCAGCGGCCGGC	AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.99C>T	19.37:g.4517618G>A		47.0	0.0		101.0	7.0	NM_001080400	A6NEI2	Silent	SNP	ENST00000301286.3	37	CCDS45927.1																																																																																			G|0.991;A|0.009		0.692	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
POLA1	5422	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	24741360	24741360	+	Silent	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chrX:24741360G>A	ENST00000379059.3	+	11	1173	c.1158G>A	c.(1156-1158)acG>acA	p.T386T	POLA1_ENST00000379068.3_Silent_p.T392T	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	386					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	TCGAGCGAACGCTTTACTTCC	0.423																																					p.T386T		.											.	POLA1	229	0			c.G1158A						.						183.0	166.0	172.0					X																	24741360		2203	4300	6503	SO:0001819	synonymous_variant	5422	exon11			GCGAACGCTTTAC		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.1158G>A	X.37:g.24741360G>A		175.0	1.0		194.0	131.0	NM_016937	Q86UQ7	Silent	SNP	ENST00000379059.3	37	CCDS14214.1																																																																																			.		0.423	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937	
PPL	5493	ucsc.edu;bcgsc.ca	37	16	4945711	4945711	+	Missense_Mutation	SNP	C	C	T	rs74003551	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr16:4945711C>T	ENST00000345988.2	-	10	1068	c.979G>A	c.(979-981)Gaa>Aaa	p.E327K	PPL_ENST00000590782.2_Missense_Mutation_p.E325K	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	327					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						TTCACGTCTTCGTGAAACTAG	0.577													T|||	12	0.00239617	0.0083	0.0	5008	,	,		20091	0.001		0.0	False		,,,				2504	0.0				p.E327K		.											.	PPL	95	0			c.G979A						.	T	LYS/GLU	34,4360	822.0+/-416.4	1,32,2164	97.0	82.0	87.0		979	4.1	1.0	16	dbSNP_130	87	0,8600		0,0,4300	yes	missense	PPL	NM_002705.4	56	1,32,6464	TT,TC,CC		0.0,0.7738,0.2617	benign	327/1757	4945711	34,12960	2197	4300	6497	SO:0001583	missense	5493	exon10			CGTCTTCGTGAAA	AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.979G>A	16.37:g.4945711C>T	ENSP00000340510:p.Glu327Lys	75.0	0.0		62.0	6.0	NM_002705	O60314|O60454|Q14C98	Missense_Mutation	SNP	ENST00000345988.2	37	CCDS10526.1	8	0.003663003663003663	7	0.014227642276422764	0	0.0	1	0.0017482517482517483	0	0.0	T	2.639	-0.284600	0.05605	0.007738	0.0	ENSG00000118898	ENST00000345988	D	0.92545	-3.06	4.12	4.12	0.48240	.	0.118098	0.56097	N	0.000029	T	0.69342	0.3100	N	0.02391	-0.57	0.21220	N	0.999759	B	0.02656	0.0	B	0.01281	0.0	T	0.59284	-0.7483	10	0.02654	T	1	.	9.7938	0.40722	0.0:0.0827:0.0:0.9173	.	327	O60437	PEPL_HUMAN	K	327	ENSP00000340510:E327K	ENSP00000340510:E327K	E	-	1	0	PPL	4885712	1.000000	0.71417	0.977000	0.42913	0.065000	0.16274	4.848000	0.62874	0.736000	0.32559	-0.521000	0.04368	GAA	C|0.997;T|0.003		0.577	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705	
PRDM2	7799	ucsc.edu;bcgsc.ca	37	1	14109178	14109178	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr1:14109178A>G	ENST00000235372.7	+	8	5744	c.4888A>G	c.(4888-4890)Agt>Ggt	p.S1630G	PRDM2_ENST00000343137.4_Missense_Mutation_p.S1429G|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000413440.1_Missense_Mutation_p.S1429G|PRDM2_ENST00000311066.5_Missense_Mutation_p.S1630G|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000503842.1_Intron	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	1630					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		CACCTTGGCGAGTAAGAAAAG	0.498																																					p.S1630G		.											.	PRDM2	116	0			c.A4888G						.						57.0	62.0	60.0					1																	14109178		2203	4300	6503	SO:0001583	missense	7799	exon8			TTGGCGAGTAAGA	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.4888A>G	1.37:g.14109178A>G	ENSP00000235372:p.Ser1630Gly	60.0	0.0		56.0	6.0	NM_015866	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	37	CCDS150.1	.	.	.	.	.	.	.	.	.	.	A	9.562	1.118654	0.20877	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.01572	4.87;4.76;4.77;4.77	6.07	4.94	0.65067	.	0.267685	0.46145	N	0.000309	T	0.02929	0.0087	L	0.57536	1.79	0.36311	D	0.857655	P;B;B	0.47762	0.9;0.001;0.001	B;B;B	0.40940	0.344;0.001;0.003	T	0.51818	-0.8657	10	0.54805	T	0.06	.	11.1446	0.48424	0.9278:0.0:0.0722:0.0	.	1488;1630;1630	Q5THJ0;Q13029;Q13029-2	.;PRDM2_HUMAN;.	G	1630;1630;1630;1429;1429	ENSP00000235372:S1630G;ENSP00000312352:S1630G;ENSP00000411103:S1429G;ENSP00000341621:S1429G	ENSP00000235372:S1630G	S	+	1	0	PRDM2	13981765	0.990000	0.36364	0.953000	0.39169	0.159000	0.22180	2.838000	0.48199	1.117000	0.41842	0.533000	0.62120	AGT	.		0.498	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
PRSS16	10279	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	27218849	27218849	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr6:27218849C>T	ENST00000230582.3	+	6	635	c.620C>T	c.(619-621)gCc>gTc	p.A207V	PRSS16_ENST00000421826.2_Intron	NM_005865.3	NP_005856.1	Q9NQE7	TSSP_HUMAN	protease, serine, 16 (thymus)	207					protein catabolic process (GO:0030163)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|lysosome (GO:0005764)	serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						GCGTCGGTCGCCTCCTCCGCC	0.642																																					p.A207V	NSCLC(178;1118 2105 17078 23587 44429)	.											.	PRSS16	94	0			c.C620T						.						68.0	77.0	74.0					6																	27218849		2203	4300	6503	SO:0001583	missense	10279	exon6			CGGTCGCCTCCTC	AF052514	CCDS4623.1	6p21	2010-05-07			ENSG00000112812	ENSG00000112812		"""Serine peptidases / Serine peptidases"""	9480	protein-coding gene	gene with protein product		607169				10527559	Standard	NM_005865		Approved	TSSP	uc003nja.3	Q9NQE7	OTTHUMG00000016167	ENST00000230582.3:c.620C>T	6.37:g.27218849C>T	ENSP00000230582:p.Ala207Val	69.0	0.0		115.0	26.0	NM_005865	O75416	Missense_Mutation	SNP	ENST00000230582.3	37	CCDS4623.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.398981	0.83120	.	.	ENSG00000112812	ENST00000230582;ENST00000343467	T	0.26660	1.72	3.87	3.87	0.44632	.	0.000000	0.85682	D	0.000000	T	0.45597	0.1350	M	0.86740	2.835	0.51482	D	0.999928	D;P	0.69078	0.997;0.736	D;B	0.79108	0.992;0.367	T	0.50206	-0.8855	10	0.62326	D	0.03	-11.4193	11.6135	0.51074	0.0:1.0:0.0:0.0	.	207;207	C9JI59;Q9NQE7	.;TSSP_HUMAN	V	207	ENSP00000230582:A207V	ENSP00000230582:A207V	A	+	2	0	PRSS16	27326828	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	2.658000	0.46733	2.456000	0.83038	0.563000	0.77884	GCC	.		0.642	PRSS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043418.2		
PSMC2	5701	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	102988209	102988209	+	Silent	SNP	G	G	A	rs61729405	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr7:102988209G>A	ENST00000435765.1	+	2	462	c.51G>A	c.(49-51)aaG>aaA	p.K17K	DNAJC2_ENST00000379263.3_5'Flank|DNAJC2_ENST00000412522.1_5'Flank|PSMC2_ENST00000544811.1_5'UTR|PSMC2_ENST00000292644.3_Silent_p.K17K	NM_002803.3	NP_002794.1	P35998	PRS7_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 2	17					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|osteoblast differentiation (GO:0001649)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	21						AGGATGAGAAGGACGACAAGC	0.587													G|||	25	0.00499201	0.0189	0.0	5008	,	,		18047	0.0		0.0	False		,,,				2504	0.0				p.K17K		.											.	PSMC2	90	0			c.G51A						.	G	,	69,4337	63.5+/-100.7	0,69,2134	133.0	114.0	121.0		51,51	2.5	1.0	7	dbSNP_129	121	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	PSMC2	NM_001204453.1,NM_002803.3	,	0,69,6434	AA,AG,GG		0.0,1.566,0.5305	,	17/142,17/434	102988209	69,12937	2203	4300	6503	SO:0001819	synonymous_variant	5701	exon1			TGAGAAGGACGAC	D11094	CCDS5731.1	7q22.1-q22.3	2010-04-21			ENSG00000161057	ENSG00000161057		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9548	protein-coding gene	gene with protein product	"""proteasome 26S subunit, ATPase, 2"", ""mammalian suppressor of sgv-1 of yeast"", ""protease 26S subunit 7"", ""putative protein product of Nbla10058"""	154365				9473509, 1377363	Standard	NM_002803		Approved	MSS1, S7, Nbla10058	uc003vbs.3	P35998	OTTHUMG00000157206	ENST00000435765.1:c.51G>A	7.37:g.102988209G>A		78.0	0.0		73.0	7.0	NM_001204453	A4D0Q1|B7Z5E2|Q3LIA5|Q9UDI3	Silent	SNP	ENST00000435765.1	37	CCDS5731.1																																																																																			G|0.994;A|0.006		0.587	PSMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347922.1	NM_002803	
PTPN13	5783	ucsc.edu;bcgsc.ca	37	4	87695667	87695667	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr4:87695667G>A	ENST00000411767.2	+	33	5554	c.5491G>A	c.(5491-5493)Ggg>Agg	p.G1831R	PTPN13_ENST00000427191.2_Missense_Mutation_p.G1812R|PTPN13_ENST00000316707.6_Missense_Mutation_p.G1640R|PTPN13_ENST00000511467.1_Missense_Mutation_p.G1836R|PTPN13_ENST00000436978.1_Missense_Mutation_p.G1836R			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1831	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		GCTAAAACCTGGGGACCGGCT	0.383																																					p.G1836R		.											.	PTPN13	230	0			c.G5506A						.						50.0	50.0	50.0					4																	87695667		1847	4099	5946	SO:0001583	missense	5783	exon33			AAACCTGGGGACC		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.5491G>A	4.37:g.87695667G>A	ENSP00000407249:p.Gly1831Arg	56.0	0.0		45.0	4.0	NM_080685	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	37	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.306945	0.81247	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.59364	0.27;0.27;0.27;0.27;0.27	5.5	4.64	0.57946	PDZ/DHR/GLGF (4);	0.000000	0.49305	D	0.000145	D	0.82669	0.5087	H	0.94542	3.55	0.80722	D	1	P;D;D;D	0.89917	0.889;1.0;1.0;1.0	B;D;D;D	0.97110	0.399;1.0;1.0;1.0	D	0.88404	0.3017	10	0.87932	D	0	.	16.5196	0.84310	0.0:0.1311:0.8689:0.0	.	1640;1812;1831;1836	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	R	1812;1836;1640;1831;1836;1780	ENSP00000408368:G1812R;ENSP00000394794:G1836R;ENSP00000322675:G1640R;ENSP00000407249:G1831R;ENSP00000426626:G1836R	ENSP00000322675:G1640R	G	+	1	0	PTPN13	87914691	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.262000	0.78410	1.425000	0.47237	0.563000	0.77884	GGG	.		0.383	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
RBBP8	5932	hgsc.bcm.edu;bcgsc.ca	37	18	20562244	20562244	+	Silent	SNP	G	G	A	rs149495397	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr18:20562244G>A	ENST00000399722.2	+	7	843	c.492G>A	c.(490-492)ccG>ccA	p.P164P	RBBP8_ENST00000327155.5_Silent_p.P164P|RBBP8_ENST00000399725.2_Silent_p.P164P|RBBP8_ENST00000360790.5_Silent_p.P164P	NM_203291.1	NP_976036.1	Q99708	COM1_HUMAN	retinoblastoma binding protein 8	164					blastocyst hatching (GO:0001835)|cell cycle checkpoint (GO:0000075)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|G2 DNA damage checkpoint (GO:0031572)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	damaged DNA binding (GO:0003684)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			central_nervous_system(1)|cervix(2)|endometrium(5)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	24	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			CAGATTCACCGATAACAGCCT	0.418								Homologous recombination					G|||	3	0.000599042	0.0023	0.0	5008	,	,		21621	0.0		0.0	False		,,,				2504	0.0				p.P164P		.											.	RBBP8	659	0			c.G492A						.	G	,,	6,4400	12.9+/-30.5	0,6,2197	153.0	131.0	138.0		492,492,492	-9.1	0.8	18	dbSNP_134	138	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	RBBP8	NM_002894.2,NM_203291.1,NM_203292.1	,,	0,6,6497	AA,AG,GG		0.0,0.1362,0.0461	,,	164/898,164/898,164/868	20562244	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	5932	exon7			TTCACCGATAACA	AF043431	CCDS11874.1, CCDS11875.1	18q11.2	2012-11-05	2001-11-28		ENSG00000101773	ENSG00000101773			9891	protein-coding gene	gene with protein product	"""CTBP-interacting protein"""	604124	"""retinoblastoma-binding protein 8"", ""Seckel syndrome 2"""	SCKL2		9721205, 17965729, 21998596	Standard	NM_002894		Approved	CtIP, RIM, COM1	uc002ktw.3	Q99708	OTTHUMG00000131769	ENST00000399722.2:c.492G>A	18.37:g.20562244G>A		159.0	0.0		139.0	8.0	NM_203292	A6NKN2|A8K8W6|E7ETY1|O75371|Q8NHQ3	Silent	SNP	ENST00000399722.2	37	CCDS11875.1																																																																																			G|0.999;A|0.001		0.418	RBBP8-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446387.1	NM_203291	
RCSD1	92241	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	167666539	167666539	+	Silent	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr1:167666539G>A	ENST00000367854.3	+	6	1009	c.678G>A	c.(676-678)gaG>gaA	p.E226E	RCSD1_ENST00000537350.1_Silent_p.E196E	NM_052862.3	NP_443094.3	Q6JBY9	CPZIP_HUMAN	RCSD domain containing 1	226					cellular hyperosmotic response (GO:0071474)|skeletal muscle contraction (GO:0003009)	actin filament (GO:0005884)	actin filament binding (GO:0051015)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	24	all_hematologic(923;0.215)					CAGCGGGAGAGGGAGTGAGAA	0.592																																					p.E226E		.											.	RCSD1	517	0			c.G678A						.						64.0	68.0	67.0					1																	167666539		2203	4300	6503	SO:0001819	synonymous_variant	92241	exon6			GGGAGAGGGAGTG	BC072399	CCDS1263.1	1q24.2	2008-02-05			ENSG00000198771	ENSG00000198771			28310	protein-coding gene	gene with protein product		610579				12477932	Standard	NM_052862		Approved	MK2S4, MGC21854	uc001gem.3	Q6JBY9	OTTHUMG00000035318	ENST00000367854.3:c.678G>A	1.37:g.167666539G>A		106.0	1.0		217.0	65.0	NM_052862	B1AK48|Q4G0E7|Q6IN93|Q8IZM2|Q96DX0|Q9NST4	Silent	SNP	ENST00000367854.3	37	CCDS1263.1																																																																																			.		0.592	RCSD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085451.1	NM_052862	
RELN	5649	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	103130238	103130238	+	Silent	SNP	G	G	A	rs78218774	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr7:103130238G>A	ENST00000428762.1	-	60	9873	c.9714C>T	c.(9712-9714)caC>caT	p.H3238H	RELN_ENST00000343529.5_Silent_p.H3238H|RELN_ENST00000424685.2_Silent_p.H3238H|CTB-107G13.1_ENST00000422488.1_RNA	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	3238	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TGCAGTATCCGTGCCCGCTGC	0.552													G|||	73	0.0145767	0.053	0.0029	5008	,	,		16677	0.001		0.0	False		,,,				2504	0.0				p.H3238H	NSCLC(146;835 1944 15585 22231 52158)	.											.	RELN	574	0			c.C9714T						.	G	,	159,4247	108.2+/-146.6	4,151,2048	96.0	71.0	79.0		9714,9714	-4.4	0.7	7	dbSNP_131	79	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous	RELN	NM_005045.3,NM_173054.2	,	4,154,6345	AA,AG,GG		0.0349,3.6087,1.2456	,	3238/3461,3238/3459	103130238	162,12844	2203	4300	6503	SO:0001819	synonymous_variant	5649	exon60			GTATCCGTGCCCG		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.9714C>T	7.37:g.103130238G>A		55.0	0.0		64.0	8.0	NM_173054	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	CCDS47680.1																																																																																			G|0.988;A|0.012		0.552	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
SH3RF2	153769	hgsc.bcm.edu;bcgsc.ca	37	5	145393600	145393600	+	Silent	SNP	C	C	T	rs35761990	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr5:145393600C>T	ENST00000511217.1	+	4	1087	c.1035C>T	c.(1033-1035)gaC>gaT	p.D345D	SH3RF2_ENST00000359120.4_Silent_p.D345D			Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	345					negative regulation of phosphatase activity (GO:0010923)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGAAAGCAGACGTTCCTTCCA	0.532													C|||	32	0.00638978	0.0242	0.0	5008	,	,		20335	0.0		0.0	False		,,,				2504	0.0				p.D345D		.											.	SH3RF2	92	0			c.C1035T						.	C		108,4298	86.3+/-125.0	2,104,2097	93.0	91.0	92.0		1035	-4.6	0.0	5	dbSNP_126	92	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SH3RF2	NM_152550.3		2,105,6396	TT,TC,CC		0.0116,2.4512,0.8381		345/730	145393600	109,12897	2203	4300	6503	SO:0001819	synonymous_variant	153769	exon5			AGCAGACGTTCCT	AL833297	CCDS4280.1	5q32	2013-01-09	2011-11-04	2011-11-04	ENSG00000156463	ENSG00000156463		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26299	protein-coding gene	gene with protein product	"""heart protein phosphatase 1-binding protein"", ""POSH-eliminating RING protein"""	613377	"""protein phosphatase 1, regulatory subunit 39"""	PPP1R39		22128169	Standard	NM_152550		Approved	FLJ23654, RNF158, Hepp1, POSHER	uc003lnt.3	Q8TEC5	OTTHUMG00000129685	ENST00000511217.1:c.1035C>T	5.37:g.145393600C>T		88.0	0.0		84.0	5.0	NM_152550	A8K961|Q08AM9|Q6GMR9|Q8N5S8|Q96LP8	Silent	SNP	ENST00000511217.1	37	CCDS4280.1																																																																																			C|0.990;T|0.010		0.532	SH3RF2-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372804.1	NM_152550	
SH3TC2	79628	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	148407322	148407322	+	Missense_Mutation	SNP	C	C	T	rs138040787		TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr5:148407322C>T	ENST00000515425.1	-	11	2074	c.1973G>A	c.(1972-1974)cGc>cAc	p.R658H	SH3TC2_ENST00000538184.1_Missense_Mutation_p.R205H|SH3TC2_ENST00000512049.1_Missense_Mutation_p.R651H|SH3TC2_ENST00000394358.2_Missense_Mutation_p.R543H|SH3TC2_ENST00000513340.1_5'Flank	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	658			R -> C (in CMT4C; heterozygous in one German patient with affected sibling). {ECO:0000269|PubMed:14574644}.		cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGCTGCAGGCGCTCGGCAAA	0.617																																					p.R658H		.											.	SH3TC2	92	0			c.G1973A						.	C	HIS/ARG	0,4406		0,0,2203	47.0	54.0	52.0		1973	6.2	1.0	5	dbSNP_134	52	3,8597	3.0+/-9.4	0,3,4297	yes	missense	SH3TC2	NM_024577.3	29	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	possibly-damaging	658/1289	148407322	3,13003	2203	4300	6503	SO:0001583	missense	79628	exon11			TGCAGGCGCTCGG	AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.1973G>A	5.37:g.148407322C>T	ENSP00000423660:p.Arg658His	46.0	0.0		60.0	14.0	NM_024577	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	ENST00000515425.1	37	CCDS4293.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.938799	0.52972	0.0	3.49E-4	ENSG00000169247	ENST00000538184;ENST00000515425;ENST00000512049;ENST00000394358	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	6.16	6.16	0.99307	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.59459	0.2195	M	0.67700	2.07	0.54753	D	0.999983	P;D;D;D	0.58268	0.896;0.982;0.982;0.982	B;B;B;B	0.41571	0.189;0.36;0.36;0.36	T	0.62817	-0.6774	10	0.44086	T	0.13	-17.8698	11.6865	0.51490	0.0:0.8957:0.0:0.1043	.	543;651;658;658	C9JLC3;Q14CC0;E9PDF1;Q8TF17	.;.;.;S3TC2_HUMAN	H	205;658;651;543	ENSP00000441427:R205H;ENSP00000423660:R658H;ENSP00000421860:R651H;ENSP00000377886:R543H	ENSP00000377886:R543H	R	-	2	0	SH3TC2	148387515	0.996000	0.38824	0.985000	0.45067	0.827000	0.46813	3.263000	0.51546	2.937000	0.99478	0.650000	0.86243	CGC	C|1.000;T|0.000		0.617	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	NM_024577	
SLC5A11	115584	hgsc.bcm.edu;bcgsc.ca	37	16	24888677	24888677	+	Silent	SNP	G	G	A	rs9932619	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr16:24888677G>A	ENST00000347898.3	+	7	1198	c.576G>A	c.(574-576)acG>acA	p.T192T	SLC5A11_ENST00000424767.2_Silent_p.T157T|SLC5A11_ENST00000565769.1_Silent_p.T128T|SLC5A11_ENST00000569071.1_Silent_p.T128T|SLC5A11_ENST00000449109.2_Silent_p.T128T|SLC5A11_ENST00000568579.1_Silent_p.T122T|SLC5A11_ENST00000545376.1_Silent_p.T122T|SLC5A11_ENST00000567758.1_Silent_p.T157T|SLC5A11_ENST00000539472.1_Silent_p.T128T	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11											endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		CTGTATACACGGTTGCTGGTA	0.527													G|||	150	0.0299521	0.1036	0.0159	5008	,	,		21015	0.0		0.002	False		,,,				2504	0.0				p.T192T		.											.	SLC5A11	92	0			c.G576A						.	G		396,3998	197.7+/-221.8	15,366,1816	223.0	177.0	192.0		576	-10.4	0.0	16	dbSNP_119	192	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	SLC5A11	NM_052944.2		15,370,6112	AA,AG,GG		0.0465,9.0123,3.0783		192/676	24888677	400,12594	2197	4300	6497	SO:0001819	synonymous_variant	115584	exon7			ATACACGGTTGCT	AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.576G>A	16.37:g.24888677G>A		143.0	0.0		133.0	10.0	NM_052944		Silent	SNP	ENST00000347898.3	37	CCDS10625.1																																																																																			G|0.962;A|0.038		0.527	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214091.3	NM_052944	
SNRNP200	23020	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	96952176	96952176	+	Silent	SNP	C	C	T	rs115923152	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr2:96952176C>T	ENST00000323853.5	-	29	3953	c.3876G>A	c.(3874-3876)ccG>ccA	p.P1292P	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	1292					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						GGTACTTCTCCGGCAAGATCA	0.522													C|||	17	0.00339457	0.0121	0.0014	5008	,	,		19632	0.0		0.0	False		,,,				2504	0.0				p.P1292P		.											.	SNRNP200	162	0			c.G3876A						.	C		64,4342	59.9+/-96.7	0,64,2139	70.0	80.0	77.0		3876	-10.2	0.5	2	dbSNP_132	77	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SNRNP200	NM_014014.4		0,65,6438	TT,TC,CC		0.0116,1.4526,0.4998		1292/2137	96952176	65,12941	2203	4300	6503	SO:0001819	synonymous_variant	23020	exon29			CTTCTCCGGCAAG	AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.3876G>A	2.37:g.96952176C>T		33.0	0.0		54.0	11.0	NM_014014	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Silent	SNP	ENST00000323853.5	37	CCDS2020.1																																																																																			C|0.995;T|0.005		0.522	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014	
SNX8	29886	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	2317903	2317903	+	Silent	SNP	G	G	A	rs78286162|rs563557441	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr7:2317903G>A	ENST00000222990.3	-	2	174	c.132C>T	c.(130-132)atC>atT	p.I44I		NM_013321.2	NP_037453.1	Q9Y5X2	SNX8_HUMAN	sorting nexin 8	44					early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)	early endosome membrane (GO:0031901)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(2)|skin(3)	26		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		CCTGCTGCACGATGGCCTGGG	0.647													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17047	0.0		0.0	False		,,,				2504	0.0				p.I44I		.											.	SNX8	290	0			c.C132T						.						35.0	33.0	34.0					7																	2317903		2203	4300	6503	SO:0001819	synonymous_variant	29886	exon2			CTGCACGATGGCC	AF121858	CCDS5331.1	7p22.3	2010-08-05			ENSG00000106266	ENSG00000106266		"""Sorting nexins"""	14972	protein-coding gene	gene with protein product		614905					Standard	NM_013321		Approved	Mvp1	uc003slw.3	Q9Y5X2	OTTHUMG00000151512	ENST00000222990.3:c.132C>T	7.37:g.2317903G>A		62.0	0.0		86.0	11.0	NM_013321	A4D207|Q96I67	Silent	SNP	ENST00000222990.3	37	CCDS5331.1																																																																																			G|0.999;A|0.001		0.647	SNX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322949.2		
SP1	6667	ucsc.edu;bcgsc.ca	37	12	53805020	53805020	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr12:53805020T>C	ENST00000327443.4	+	6	2452	c.2354T>C	c.(2353-2355)tTc>tCc	p.F785S	SP1_ENST00000426431.2_Missense_Mutation_p.F778S	NM_001251825.1|NM_138473.2	NP_001238754.1|NP_612482.2	P08047	SP1_HUMAN	Sp1 transcription factor	785	Domain D.|VZV IE62-binding.				cellular lipid metabolic process (GO:0044255)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|gene expression (GO:0010467)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|ossification (GO:0001503)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	bHLH transcription factor binding (GO:0043425)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|histone deacetylase binding (GO:0042826)|HMG box domain binding (GO:0071837)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.00527)		GGCAATGGCTTCTGAGATCAG	0.557																																					p.F785S		.											.	SP1	228	0			c.T2354C						.						68.0	59.0	62.0					12																	53805020		2203	4300	6503	SO:0001583	missense	6667	exon6			ATGGCTTCTGAGA	J03133	CCDS8857.1, CCDS44898.1	12q13.1	2013-01-08						"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11205	protein-coding gene	gene with protein product	"""specificity protein 1"""	189906				1662663	Standard	NM_003109		Approved		uc001scw.3	P08047	OTTHUMG00000170047	ENST00000327443.4:c.2354T>C	12.37:g.53805020T>C	ENSP00000329357:p.Phe785Ser	30.0	0.0		36.0	4.0	NM_138473	E4Z9M7|G5E9M8|Q86TN8|Q9H3Q5|Q9NR51|Q9NY21|Q9NYE7	Missense_Mutation	SNP	ENST00000327443.4	37	CCDS8857.1	.	.	.	.	.	.	.	.	.	.	T	12.42	1.933831	0.34096	.	.	ENSG00000185591	ENST00000327443;ENST00000426431	T;T	0.10288	2.92;2.89	5.0	5.0	0.66597	.	0.000000	0.64402	D	0.000011	T	0.08582	0.0213	N	0.08118	0	0.43724	D	0.996208	D	0.53885	0.963	P	0.46885	0.53	T	0.22034	-1.0228	10	0.87932	D	0	.	13.0614	0.59010	0.0:0.0:0.0:1.0	.	785	P08047	SP1_HUMAN	S	785;778	ENSP00000329357:F785S;ENSP00000404263:F778S	ENSP00000329357:F785S	F	+	2	0	SP1	52091287	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.498000	0.35660	2.251000	0.74343	0.456000	0.33151	TTC	.		0.557	SP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407044.1		
SPON1	10418	broad.mit.edu;mdanderson.org	37	11	14282206	14282206	+	RNA	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr11:14282206G>A	ENST00000534587.1	-	0	480				SPON1_ENST00000310358.7_RNA																							AAGGGCATGCGAACCCGACAG	0.567																																					.		.											.	SPON1	1	0			.						.						90.0	92.0	91.0					11																	14282206		2095	4209	6304			10418	.			GCATGCGAACCCG																													11.37:g.14282206G>A		105.0	1.0		119.0	11.0	.		RNA	SNP	ENST00000534587.1	37		.	.	.	.	.	.	.	.	.	.	G	17.41	3.382837	0.61845	.	.	ENSG00000152268	ENST00000310358	.	.	.	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.66197	0.2765	.	.	.	0.45995	D	0.998801	D	0.89917	1.0	D	0.87578	0.998	T	0.59936	-0.7360	7	0.07813	T	0.8	.	15.5774	0.76404	0.0:0.0:1.0:0.0	.	635	Q9HCB6	SPON1_HUMAN	Q	634	.	ENSP00000309297:R634Q	R	+	2	0	SPON1	14238782	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.263000	0.95617	2.528000	0.85240	0.561000	0.74099	CGA	.		0.567	RP11-21L19.1-001	KNOWN	basic	antisense	antisense	OTTHUMT00000386031.1		
T	6862	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	166579327	166579327	+	Splice_Site	SNP	A	A	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr6:166579327A>T	ENST00000296946.2	-	4	941	c.473T>A	c.(472-474)aTc>aAc	p.I158N	T_ENST00000366871.3_Splice_Site_p.I158N	NM_003181.3	NP_003172.1	O15178	BRAC_HUMAN	T, brachyury homolog (mouse)	158					anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|canonical Wnt signaling pathway (GO:0060070)|determination of heart left/right asymmetry (GO:0061371)|embryonic skeletal system development (GO:0048706)|heart morphogenesis (GO:0003007)|mesoderm development (GO:0007498)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate morphogenesis (GO:0001839)|neural tube closure (GO:0001843)|notochord formation (GO:0014028)|penetration of zona pellucida (GO:0007341)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|signal transduction (GO:0007165)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		GTTCAGCATGATCTGAGGGAG	0.507									Chordoma, Familial Clustering of																												p.I158N		.											.	T	516	0			c.T473A						.						265.0	244.0	251.0					6																	166579327		2203	4300	6503	SO:0001630	splice_region_variant	6862	exon4	Familial Cancer Database		AGCATGATCTGAG	AJ001699	CCDS5290.1, CCDS59045.1	6q27	2011-06-13	2001-11-28		ENSG00000164458	ENSG00000164458		"""T-boxes"""	11515	protein-coding gene	gene with protein product		601397	"""T brachyury (mouse) homolog"""			8963900	Standard	NM_003181		Approved		uc003quu.2	O15178	OTTHUMG00000015991	ENST00000296946.2:c.472-1T>A	6.37:g.166579327A>T		101.0	1.0		93.0	13.0	NM_003181	E7ERD6|Q4KMP4	Missense_Mutation	SNP	ENST00000296946.2	37	CCDS5290.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.323755	0.81580	.	.	ENSG00000164458	ENST00000366876;ENST00000296946;ENST00000366871	D;D;D	0.90844	-2.74;-2.74;-2.74	5.04	5.04	0.67666	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.96685	0.8918	H	0.97707	4.06	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98023	1.0372	10	0.87932	D	0	.	13.9889	0.64353	1.0:0.0:0.0:0.0	.	158;158;158	E7ERD6;O15178;Q4KMP4	.;BRAC_HUMAN;.	N	158	ENSP00000355841:I158N;ENSP00000296946:I158N;ENSP00000355836:I158N	ENSP00000296946:I158N	I	-	2	0	T	166499317	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.685000	0.91246	1.896000	0.54893	0.459000	0.35465	ATC	.		0.507	T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043037.2	NM_003181	Missense_Mutation
TACC2	10579	ucsc.edu;bcgsc.ca	37	10	123845611	123845611	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr10:123845611A>G	ENST00000369005.1	+	4	3936	c.3596A>G	c.(3595-3597)gAg>gGg	p.E1199G	TACC2_ENST00000515273.1_Missense_Mutation_p.E1199G|TACC2_ENST00000513429.1_Intron|TACC2_ENST00000515603.1_Missense_Mutation_p.E1199G|TACC2_ENST00000453444.2_Missense_Mutation_p.E1199G|TACC2_ENST00000334433.3_Missense_Mutation_p.E1199G|TACC2_ENST00000358010.1_Intron	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	1199					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CCAGCCAGAGAGCTGGGTGGG	0.607																																					p.E1199G		.											.	TACC2	296	0			c.A3596G						.						44.0	48.0	46.0					10																	123845611		2203	4299	6502	SO:0001583	missense	10579	exon4			CCAGAGAGCTGGG	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.3596A>G	10.37:g.123845611A>G	ENSP00000358001:p.Glu1199Gly	30.0	0.0		41.0	4.0	NM_206862	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	37	CCDS7626.1	.	.	.	.	.	.	.	.	.	.	A	16.17	3.046006	0.55110	.	.	ENSG00000138162	ENST00000369005;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000453444;ENST00000340076	T;T;T;T;T	0.12879	2.78;2.64;2.66;2.78;2.64	5.25	4.05	0.47172	.	0.475431	0.15748	N	0.246555	T	0.18593	0.0446	L	0.32530	0.975	0.09310	N	1	D;D;D	0.64830	0.994;0.994;0.987	P;P;P	0.54544	0.755;0.755;0.755	T	0.03957	-1.0989	10	0.87932	D	0	-10.5982	9.5661	0.39400	0.8235:0.1765:0.0:0.0	.	1199;1199;1199	E9PBC6;E7EMZ9;O95359	.;.;TACC2_HUMAN	G	1199;1199;1199;1199;1199;1189	ENSP00000358001:E1199G;ENSP00000424467:E1199G;ENSP00000427618:E1199G;ENSP00000334280:E1199G;ENSP00000395048:E1199G	ENSP00000334280:E1199G	E	+	2	0	TACC2	123835601	0.002000	0.14202	0.020000	0.16555	0.008000	0.06430	0.208000	0.17415	1.975000	0.57531	0.448000	0.29417	GAG	.		0.607	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1		
TAF4B	6875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	23807168	23807168	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr18:23807168C>T	ENST00000269142.5	+	1	1269	c.271C>T	c.(271-273)Cct>Tct	p.P91S	TAF4B_ENST00000578121.1_Missense_Mutation_p.P91S|TAF4B_ENST00000400466.2_Missense_Mutation_p.P91S	NM_005640.1	NP_005631.1	Q92750	TAF4B_HUMAN	TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa	91					gene expression (GO:0010467)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|NF-kappaB binding (GO:0051059)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|prostate(1)|skin(1)	29	all_cancers(21;0.00151)|Lung NSC(5;0.000401)|all_lung(6;0.00115)|Ovarian(20;0.124)		Epithelial(2;9.57e-07)|all cancers(3;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(3;1.96e-05)|LUSC - Lung squamous cell carcinoma(2;0.00594)|Lung(2;0.0267)			GCTGCCTGCTCCTCAGATAGT	0.607																																					p.P91S		.											.	TAF4B	71	0			c.C271T						.						80.0	86.0	84.0					18																	23807168		1977	4162	6139	SO:0001583	missense	6875	exon1			CCTGCTCCTCAGA	Y09321	CCDS42421.1	18q11.1	2008-08-01	2002-08-29	2001-12-07		ENSG00000141384			11538	protein-coding gene	gene with protein product	"""TATA box binding protein (TBP)-associated factor 4B"""	601689	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C2, 105kD"""	TAF2C2		8858156, 10849440	Standard	XM_005258339		Approved	TAFII105	uc002kvu.4	Q92750		ENST00000269142.5:c.271C>T	18.37:g.23807168C>T	ENSP00000269142:p.Pro91Ser	155.0	0.0		200.0	33.0	NM_005640	Q29YA4|Q29YA5	Missense_Mutation	SNP	ENST00000269142.5	37	CCDS42421.1	.	.	.	.	.	.	.	.	.	.	C	11.15	1.553495	0.27739	.	.	ENSG00000141384	ENST00000418698;ENST00000269142;ENST00000400466	T;T;T	0.36340	1.26;1.49;1.26	4.7	3.81	0.43845	.	0.258920	0.30940	N	0.008579	T	0.44435	0.1293	L	0.59436	1.845	0.26207	N	0.979353	P;D	0.69078	0.924;0.997	P;P	0.57911	0.603;0.829	T	0.22695	-1.0209	10	0.30854	T	0.27	-9.6706	7.8075	0.29211	0.0:0.8871:0.0:0.1129	.	91;91	Q92750;A4PBF7	TAF4B_HUMAN;.	S	91	ENSP00000389365:P91S;ENSP00000269142:P91S;ENSP00000383314:P91S	ENSP00000269142:P91S	P	+	1	0	TAF4B	22061166	1.000000	0.71417	0.932000	0.37286	0.735000	0.41995	2.181000	0.42547	2.140000	0.66376	0.455000	0.32223	CCT	.		0.607	TAF4B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000446260.3	NM_005640	
TBC1D2	55357	hgsc.bcm.edu;bcgsc.ca	37	9	100991356	100991356	+	Missense_Mutation	SNP	G	G	A	rs139062706	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr9:100991356G>A	ENST00000375064.1	-	5	894	c.856C>T	c.(856-858)Cgc>Tgc	p.R286C	TBC1D2_ENST00000493589.2_5'UTR|TBC1D2_ENST00000375066.5_Missense_Mutation_p.R286C|TBC1D2_ENST00000342112.5_Missense_Mutation_p.R68C	NM_001267571.1	NP_001254500.1	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	286					positive regulation of Rab GTPase activity (GO:0032851)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)	cadherin binding (GO:0045296)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		TTGTTCTGGCGCTTGGCTTTC	0.527													G|||	6	0.00119808	0.0045	0.0	5008	,	,		20065	0.0		0.0	False		,,,				2504	0.0				p.R286C		.											.	TBC1D2	93	0			c.C856T						.						154.0	127.0	136.0					9																	100991356		2203	4300	6503	SO:0001583	missense	55357	exon5			TCTGGCGCTTGGC	AY026527	CCDS35080.1, CCDS59137.1, CCDS75865.1	9q22.32	2011-11-30			ENSG00000095383	ENSG00000095383			18026	protein-coding gene	gene with protein product	"""prostate antigen recognized and identified by SEREX"""	609871					Standard	NM_018421		Approved	PARIS1, TBC1D2A, Armus	uc011lvb.2	Q9BYX2	OTTHUMG00000020343	ENST00000375064.1:c.856C>T	9.37:g.100991356G>A	ENSP00000364205:p.Arg286Cys	216.0	0.0		196.0	8.0	NM_001267571	B3KWD1|B4DQ05|B9A6J7|Q59EU0|Q5TBQ5|Q6IPC7|Q7L1K8|Q8WYT1|Q9H6A2|Q9NSH4	Missense_Mutation	SNP	ENST00000375064.1	37		5	0.0022893772893772895	5	0.01016260162601626	0	0.0	0	0.0	0	0.0	G	15.66	2.899850	0.52227	.	.	ENSG00000095383	ENST00000375064;ENST00000375066;ENST00000342112	T;T;T	0.14266	2.52;2.97;2.52	4.96	2.95	0.34219	.	1.142240	0.06207	N	0.684334	T	0.14184	0.0343	L	0.57536	1.79	0.80722	D	1	D;D	0.58268	0.97;0.982	B;P	0.44732	0.27;0.459	T	0.15607	-1.0431	10	0.72032	D	0.01	.	9.5627	0.39380	0.0:0.0:0.5912:0.4088	.	286;286	Q9BYX2;Q9BYX2-2	TBD2A_HUMAN;.	C	286;286;68	ENSP00000364205:R286C;ENSP00000364207:R286C;ENSP00000341567:R68C	ENSP00000341567:R68C	R	-	1	0	TBC1D2	100031177	0.542000	0.26426	1.000000	0.80357	0.978000	0.69477	0.716000	0.25836	1.300000	0.44818	0.655000	0.94253	CGC	G|0.999;A|0.001		0.527	TBC1D2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000053366.1	NM_018421	
TBX1	6899	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	19751756	19751756	+	Silent	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr22:19751756G>A	ENST00000329705.7	+	5	720	c.591G>A	c.(589-591)ccG>ccA	p.P197P	TBX1_ENST00000359500.3_Silent_p.P197P|TBX1_ENST00000332710.4_Silent_p.P197P	NM_080646.1	NP_542377.1	O43435	TBX1_HUMAN	T-box 1	197					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|aorta morphogenesis (GO:0035909)|artery morphogenesis (GO:0048844)|blood vessel development (GO:0001568)|blood vessel morphogenesis (GO:0048514)|blood vessel remodeling (GO:0001974)|cell fate specification (GO:0001708)|cell proliferation (GO:0008283)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|coronary artery morphogenesis (GO:0060982)|determination of left/right symmetry (GO:0007368)|ear morphogenesis (GO:0042471)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic viscerocranium morphogenesis (GO:0048703)|enamel mineralization (GO:0070166)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|lymph vessel development (GO:0001945)|mesenchymal cell apoptotic process (GO:0097152)|mesoderm development (GO:0007498)|middle ear morphogenesis (GO:0042474)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle organ morphogenesis (GO:0048644)|muscle tissue morphogenesis (GO:0060415)|negative regulation of cell differentiation (GO:0045596)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|parathyroid gland development (GO:0060017)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of tongue muscle cell differentiation (GO:2001037)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of organ morphogenesis (GO:2000027)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retinoic acid receptor signaling pathway (GO:0048384)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|social behavior (GO:0035176)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|tongue morphogenesis (GO:0043587)|transcription, DNA-templated (GO:0006351)|vagus nerve morphogenesis (GO:0021644)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|lung(3)|ovary(2)	8	Colorectal(54;0.0993)	all_lung(157;3.05e-06)				ACTACCACCCGGACTCGCCTG	0.662																																					p.P197P		.											TBX1,NS,carcinoma,+1	TBX1	154	0			c.G591A						.						73.0	59.0	64.0					22																	19751756		2203	4300	6503	SO:0001819	synonymous_variant	6899	exon5			CCACCCGGACTCG	AF012131	CCDS13765.1, CCDS13766.1, CCDS13767.1	22q11.21	2014-09-17			ENSG00000184058	ENSG00000184058		"""T-boxes"""	11592	protein-coding gene	gene with protein product		602054	"""velocardiofacial syndrome"""	VCF		9268629, 23000736	Standard	NM_080646		Approved	CATCH22	uc002zqa.1	O43435	OTTHUMG00000150421	ENST00000329705.7:c.591G>A	22.37:g.19751756G>A		47.0	0.0		69.0	22.0	NM_080647	C6G493|C6G494|O43436|Q96RJ2	Silent	SNP	ENST00000329705.7	37	CCDS13766.1																																																																																			.		0.662	TBX1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318033.1	NM_080647	
TRHR	7201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	110131528	110131528	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr8:110131528C>G	ENST00000518632.1	+	3	1392	c.1041C>G	c.(1039-1041)aaC>aaG	p.N347K	TRHR_ENST00000311762.2_Missense_Mutation_p.N347K			P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	347					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thyrotropin-releasing hormone receptor activity (GO:0004997)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(12)|prostate(4)|skin(4)|urinary_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			AACCTGCTAACTACAGTGTGG	0.473																																					p.N347K		.											.	TRHR	620	0			c.C1041G						.						151.0	144.0	146.0					8																	110131528		2203	4299	6502	SO:0001583	missense	7201	exon2			TGCTAACTACAGT		CCDS6311.1	8q23.1	2013-09-20			ENSG00000174417	ENSG00000174417			12299	protein-coding gene	gene with protein product		188545				8128317	Standard	NM_003301		Approved		uc003ymz.4	P34981	OTTHUMG00000164910	ENST00000518632.1:c.1041C>G	8.37:g.110131528C>G	ENSP00000430711:p.Asn347Lys	163.0	0.0		222.0	27.0	NM_003301	Q2M339	Missense_Mutation	SNP	ENST00000518632.1	37	CCDS6311.1	.	.	.	.	.	.	.	.	.	.	C	2.612	-0.290575	0.05568	.	.	ENSG00000174417	ENST00000518632;ENST00000311762	T;T	0.57436	0.4;0.4	5.86	4.99	0.66335	.	0.338377	0.38492	N	0.001661	T	0.34077	0.0885	L	0.31207	0.915	0.45307	D	0.998304	B	0.06786	0.001	B	0.06405	0.002	T	0.14811	-1.0459	10	0.13470	T	0.59	-10.856	5.968	0.19336	0.0:0.6717:0.1587:0.1696	.	347	P34981	TRFR_HUMAN	K	347	ENSP00000430711:N347K;ENSP00000309818:N347K	ENSP00000309818:N347K	N	+	3	2	TRHR	110200704	0.449000	0.25689	0.996000	0.52242	0.928000	0.56348	0.646000	0.24797	1.492000	0.48499	0.585000	0.79938	AAC	.		0.473	TRHR-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380892.1		
UBE3B	89910	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	109972536	109972536	+	Silent	SNP	C	C	T	rs61999293	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr12:109972536C>T	ENST00000342494.3	+	28	3751	c.3156C>T	c.(3154-3156)cgC>cgT	p.R1052R	UBE3B_ENST00000434735.2_Silent_p.R1052R	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	1052	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						GCGTCCTCCGCGAGAAGCTGC	0.642													C|||	5	0.000998403	0.003	0.0014	5008	,	,		21084	0.0		0.0	False		,,,				2504	0.0				p.R1052R		.											.	UBE3B	660	0			c.C3156T						.	C	,	19,4387	26.2+/-53.5	0,19,2184	107.0	94.0	98.0		3156,3156	-0.3	0.9	12	dbSNP_129	98	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	UBE3B	NM_130466.2,NM_183415.1	,	0,19,6484	TT,TC,CC		0.0,0.4312,0.1461	,	1052/1069,1052/1069	109972536	19,12987	2203	4300	6503	SO:0001819	synonymous_variant	89910	exon28			CCTCCGCGAGAAG	BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.3156C>T	12.37:g.109972536C>T		58.0	0.0		94.0	18.0	NM_130466	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Silent	SNP	ENST00000342494.3	37	CCDS9129.1																																																																																			C|0.998;T|0.002		0.642	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403119.1	NM_183415	
USP20	10868	broad.mit.edu;bcgsc.ca	37	9	132636968	132636968	+	Silent	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr9:132636968G>A	ENST00000315480.4	+	18	2012	c.1854G>A	c.(1852-1854)aaG>aaA	p.K618K	USP20_ENST00000358355.1_Silent_p.K618K|USP20_ENST00000372429.3_Silent_p.K618K			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	618	USP.				endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				TCCTTGCCAAGGAGTGCACAT	0.612																																					p.K618K		.											.	USP20	658	0			c.G1854A						.						85.0	93.0	90.0					9																	132636968		2139	4250	6389	SO:0001819	synonymous_variant	10868	exon18			TGCCAAGGAGTGC	AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.1854G>A	9.37:g.132636968G>A		54.0	0.0		63.0	6.0	NM_001008563	Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Silent	SNP	ENST00000315480.4	37	CCDS43892.1																																																																																			.		0.612	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054604.2		
VPS39	23339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	42492106	42492106	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr15:42492106G>A	ENST00000348544.4	-	2	126	c.127C>T	c.(127-129)Cgg>Tgg	p.R43W	VPS39_ENST00000318006.5_Missense_Mutation_p.R43W|VPS39_ENST00000568357.1_5'UTR|MIR627_ENST00000384979.1_RNA			Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39 homolog (S. cerevisiae)	43	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	small GTPase regulator activity (GO:0005083)			breast(2)|kidney(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		ACGTCCTTCCGAATCCTATAG	0.348																																					p.R43W		.											.	VPS39	229	0			c.C127T						.						71.0	71.0	71.0					15																	42492106		2203	4299	6502	SO:0001583	missense	23339	exon2			CCTTCCGAATCCT	AF280814	CCDS10083.1, CCDS73710.1	15q14	2008-02-05	2006-12-19		ENSG00000166887	ENSG00000166887			20593	protein-coding gene	gene with protein product		612188	"""vacuolar protein sorting 39 (yeast)"""			11448994	Standard	XM_005254259		Approved	KIAA0770, VAM6	uc001zpc.3	Q96JC1	OTTHUMG00000130467	ENST00000348544.4:c.127C>T	15.37:g.42492106G>A	ENSP00000335193:p.Arg43Trp	180.0	0.0		162.0	29.0	NM_015289	O94869|Q71SQ6|Q7Z3V3|Q96B93|Q96RM0	Missense_Mutation	SNP	ENST00000348544.4	37	CCDS10083.1	.	.	.	.	.	.	.	.	.	.	G	19.53	3.845655	0.71603	.	.	ENSG00000166887	ENST00000318006;ENST00000348544	T;T	0.18338	2.22;2.22	4.88	3.96	0.45880	Citron-like (2);	0.058692	0.64402	D	0.000004	T	0.24236	0.0587	L	0.34521	1.04	0.36010	D	0.837962	P;P	0.49185	0.92;0.902	P;P	0.55222	0.771;0.502	T	0.23547	-1.0185	10	0.66056	D	0.02	-19.6016	12.9477	0.58382	0.0:0.0:0.5939:0.4061	.	43;43	Q96JC1;Q96JC1-2	VPS39_HUMAN;.	W	43	ENSP00000326534:R43W;ENSP00000335193:R43W	ENSP00000326534:R43W	R	-	1	2	VPS39	40279398	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.597000	0.54031	1.403000	0.46800	0.563000	0.77884	CGG	.		0.348	VPS39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000420472.1	NM_015289	
VWA8	23078	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	42303780	42303780	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr13:42303780C>G	ENST00000379310.3	-	23	2604	c.2536G>C	c.(2536-2538)Gta>Cta	p.V846L	VWA8_ENST00000281496.6_Missense_Mutation_p.V846L	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	846						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										GCCTCATCTACTACCAGAATA	0.338																																					p.V846L		.											.	.	.	0			c.G2536C						.						143.0	137.0	139.0					13																	42303780		2203	4300	6503	SO:0001583	missense	23078	exon23			CATCTACTACCAG	AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.2536G>C	13.37:g.42303780C>G	ENSP00000368612:p.Val846Leu	297.0	0.0		227.0	24.0	NM_015058	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	ENST00000379310.3	37	CCDS41881.1	.	.	.	.	.	.	.	.	.	.	C	17.40	3.380281	0.61845	.	.	ENSG00000102763	ENST00000251030;ENST00000379310;ENST00000281496	T;T	0.17691	2.26;2.26	5.55	3.84	0.44239	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.354917	0.30011	N	0.010636	T	0.13286	0.0322	N	0.12527	0.23	0.44956	D	0.997976	P	0.44429	0.835	P	0.49477	0.612	T	0.13045	-1.0524	10	0.30078	T	0.28	.	8.537	0.33368	0.0:0.6565:0.0:0.3435	.	846	A3KMH1	K0564_HUMAN	L	750;846;846	ENSP00000368612:V846L;ENSP00000281496:V846L	ENSP00000251030:V750L	V	-	1	0	KIAA0564	41201780	0.947000	0.32204	0.493000	0.27502	0.945000	0.59286	1.660000	0.37397	0.908000	0.36671	0.655000	0.94253	GTA	.		0.338	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	
XRCC5	7520	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	217012796	217012805	+	Splice_Site	DEL	TTTCCAACAG	TTTCCAACAG	-			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	TTTCCAACAG	TTTCCAACAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr2:217012796_217012805delTTTCCAACAG	ENST00000392133.3	+	16	1937		c.e16-1		XRCC5_ENST00000392132.2_Splice_Site			P13010	XRCC5_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)						brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to fatty acid (GO:0071398)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|hematopoietic stem cell differentiation (GO:0060218)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of type I interferon production (GO:0032481)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|kidney(3)|large_intestine(8)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		ATCCTTACTTTTTCCAACAGTGTCTGCTGC	0.433								Non-homologous end-joining																													.		.											.	XRCC5	970	0			.						.																																			SO:0001630	splice_region_variant	7520	.			TTACTTTTTCCAA	AF039597	CCDS2402.1	2q35	2008-07-31	2008-07-31		ENSG00000079246	ENSG00000079246			12833	protein-coding gene	gene with protein product	"""Ku autoantigen, 80kDa"""	194364	"""X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 80kD)"""			9636207, 9214634	Standard	NM_021141		Approved	KU80, KARP-1, Ku86, KUB2	uc002vfy.3	P13010	OTTHUMG00000133059	ENST00000392133.3:c.1477-1TTTCCAACAG>-	2.37:g.217012796_217012805delTTTCCAACAG		306.0	0.0		289.0	22.0	.	A8K3X5|Q0Z7V0|Q4VBQ5|Q53HH7|Q7M4N0|Q9UCQ0|Q9UCQ1	Splice_Site	DEL	ENST00000392133.3	37	CCDS2402.1																																																																																			.		0.433	XRCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256675.3	NM_021141	Intron
ZNF777	27153	ucsc.edu;bcgsc.ca	37	7	149152828	149152828	+	Missense_Mutation	SNP	G	G	C	rs76797088	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr7:149152828G>C	ENST00000247930.4	-	2	609	c.286C>G	c.(286-288)Ccc>Gcc	p.P96A		NM_015694.2	NP_056509.2	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	96					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(5)|lung(17)|ovary(1)|skin(2)|urinary_tract(1)	26	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			GAAGCCAGGGGGCCCTGGAGA	0.612													G|||	89	0.0177716	0.0605	0.013	5008	,	,		14414	0.0		0.0	False		,,,				2504	0.0				p.P96A		.											.	ZNF777	136	0			c.C286G						.	G	ALA/PRO	232,3528		9,214,1657	79.0	91.0	88.0		286	-0.6	0.1	7	dbSNP_132	88	1,8203		0,1,4101	yes	missense	ZNF777	NM_015694.2	27	9,215,5758	CC,CG,GG		0.0122,6.1702,1.9475	benign	96/832	149152828	233,11731	1880	4102	5982	SO:0001583	missense	27153	exon2			CCAGGGGGCCCTG	AB033111	CCDS43675.1	7q36.1	2013-01-08			ENSG00000196453	ENSG00000196453		"""Zinc fingers, C2H2-type"", ""-"""	22213	protein-coding gene	gene with protein product							Standard	NM_015694		Approved	KIAA1285	uc003wfv.3	Q9ULD5	OTTHUMG00000158967	ENST00000247930.4:c.286C>G	7.37:g.149152828G>C	ENSP00000247930:p.Pro96Ala	50.0	1.0		55.0	8.0	NM_015694	Q8N2R2|Q8N659	Missense_Mutation	SNP	ENST00000247930.4	37	CCDS43675.1	26	0.011904761904761904	23	0.046747967479674794	3	0.008287292817679558	0	0.0	0	0.0	G	9.559	1.117920	0.20877	0.061702	1.22E-4	ENSG00000196453	ENST00000247930	T	0.05025	3.51	4.66	-0.64	0.11493	.	0.627108	0.13673	N	0.370717	T	0.00384	0.0012	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42916	-0.9423	10	0.49607	T	0.09	-2.7706	0.8774	0.01227	0.2917:0.1595:0.3854:0.1634	.	96	Q9ULD5-2	.	A	96	ENSP00000247930:P96A	ENSP00000247930:P96A	P	-	1	0	ZNF777	148783761	0.000000	0.05858	0.133000	0.22050	0.922000	0.55478	0.111000	0.15458	-0.514000	0.06488	0.462000	0.41574	CCC	G|0.987;C|0.013		0.612	ZNF777-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352708.1	NM_015694	
ZNF8	7554	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58806191	58806191	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr19:58806191G>T	ENST00000196548.5	+	4	1148	c.1017G>T	c.(1015-1017)aaG>aaT	p.K339N	ZNF8_ENST00000608843.1_Missense_Mutation_p.K339N|AC010642.1_ENST00000591325.1_3'UTR			P17098	ZNF8_HUMAN	zinc finger protein 8	339					BMP signaling pathway (GO:0030509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	19		all_cancers(17;6.46e-05)|Lung NSC(17;0.0233)|all_neural(62;0.0381)|all_epithelial(17;0.0427)|all_lung(17;0.057)|Ovarian(87;0.17)|Colorectal(82;0.227)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.00619)		CTGGGGAGAAGCCCTATGAGT	0.562																																					p.K339N		.											.	ZNF8	91	0			c.G1017T						.						91.0	94.0	93.0					19																	58806191		2203	4300	6503	SO:0001583	missense	7554	exon4			GGAGAAGCCCTAT	M29581	CCDS12974.1	19q13.43	2013-01-08	2006-05-09					"""Zinc fingers, C2H2-type"", ""-"""	13154	protein-coding gene	gene with protein product		194532	"""zinc finger protein 8 (clone HF.18)"""			2106481	Standard	NM_021089		Approved	HF.18, Zfp128	uc002qry.1	P17098		ENST00000196548.5:c.1017G>T	19.37:g.58806191G>T	ENSP00000196548:p.Lys339Asn	82.0	1.0		100.0	11.0	NM_021089	Q6PI99	Missense_Mutation	SNP	ENST00000196548.5	37	CCDS12974.1	.	.	.	.	.	.	.	.	.	.	G	16.43	3.120745	0.56613	.	.	ENSG00000083842	ENST00000196548;ENST00000546178	T	0.26067	1.76	4.82	-3.26	0.05064	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49916	D	0.000125	T	0.46308	0.1386	M	0.84585	2.705	0.35356	D	0.787803	D	0.89917	1.0	D	0.87578	0.998	T	0.55958	-0.8058	10	0.87932	D	0	-28.3264	8.5744	0.33590	0.6863:0.1212:0.1925:0.0	.	339	P17098	ZNF8_HUMAN	N	339;54	ENSP00000196548:K339N	ENSP00000196548:K339N	K	+	3	2	ZNF8	63498003	0.039000	0.19947	0.981000	0.43875	0.830000	0.47004	-0.083000	0.11286	-0.399000	0.07668	-0.322000	0.08575	AAG	.		0.562	ZNF8-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000459135.1	NM_021089	
ROBO2	6092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	77607249	77607250	+	Missense_Mutation	DNP	TC	TC	AT			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr3:77607249_77607250TC>AT	ENST00000461745.1	+	9	2286_2287	c.1386_1387TC>AT	c.(1384-1389)gaTCca>gaATca	p.462_463DP>ES	ROBO2_ENST00000332191.8_Missense_Mutation_p.462_463DP>ES|ROBO2_ENST00000487694.3_Missense_Mutation_p.478_479DP>ES	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	462	Ig-like C2-type 5.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CGGGTAGAGATCCAAGAGCAAC	0.406																																					p.DP462ES		.											.	.	.	0			.						.																																			SO:0001583	missense	6092	.			TAGAGATCCAAGA	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	Exception_encountered	3.37:g.77607249_77607250delinsAT	ENSP00000417164:p.D462_P463delinsES	114.0	0.0		166.0	65.0	.	O43608|Q19AB4|Q19AB5	Missense_Mutation	DNP	ENST00000461745.1	37	CCDS43109.1																																																																																			.		0.406	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
