#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABHD3	171586	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	19263896	19263896	+	Silent	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr18:19263896C>T	ENST00000289119.2	-	4	679	c.540G>A	c.(538-540)gcG>gcA	p.A180A	ABHD3_ENST00000578270.1_5'UTR|MIR320C1_ENST00000408566.1_RNA|ABHD3_ENST00000579875.1_Intron|RP11-13N13.6_ENST00000578583.1_RNA|ABHD3_ENST00000580981.1_Intron	NM_138340.4	NP_612213.2	Q8WU67	ABHD3_HUMAN	abhydrolase domain containing 3	180						integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|prostate(2)	10						GATTCTCCCCCGCCACTCCTC	0.279																																					p.A180A		.											.	ABHD3	90	0			c.G540A						.						67.0	75.0	72.0					18																	19263896		2203	4294	6497	SO:0001819	synonymous_variant	171586	exon4			CTCCCCCGCCACT	AK024880	CCDS32802.1	18q11.1	2011-02-16			ENSG00000158201	ENSG00000158201		"""Abhydrolase domain containing"""	18718	protein-coding gene	gene with protein product		612197					Standard	NM_138340		Approved	LABH3	uc002ktl.2	Q8WU67		ENST00000289119.2:c.540G>A	18.37:g.19263896C>T		189.0	0.0		193.0	46.0	NM_138340	B0YIV0|B7Z5C2|O43411	Silent	SNP	ENST00000289119.2	37	CCDS32802.1																																																																																			.		0.279	ABHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444757.1		
ACAN	176	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	89417182	89417182	+	Silent	SNP	C	C	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr15:89417182C>A	ENST00000561243.1	+	16	7443	c.7443C>A	c.(7441-7443)gtC>gtA	p.V2481V	ACAN_ENST00000352105.7_Intron|ACAN_ENST00000439576.2_Silent_p.V2481V|ACAN_ENST00000559004.1_Silent_p.V2443V			P16112	PGCA_HUMAN	aggrecan	2366					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			AGGGGTTTGTCCAGCGCCACA	0.637																																					p.V2481V		.											.	ACAN	25	0			c.C7443A						.						44.0	55.0	51.0					15																	89417182		2153	4241	6394	SO:0001819	synonymous_variant	176	exon17			GTTTGTCCAGCGC	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.7443C>A	15.37:g.89417182C>A		107.0	0.0		95.0	9.0	NM_013227	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Silent	SNP	ENST00000561243.1	37	CCDS53970.1																																																																																			.		0.637	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
ADCYAP1R1	117	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	31104532	31104532	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr7:31104532G>T	ENST00000304166.4	+	3	426	c.137G>T	c.(136-138)gGc>gTc	p.G46V	ADCYAP1R1_ENST00000409363.1_Missense_Mutation_p.G46V|ADCYAP1R1_ENST00000409489.1_Missense_Mutation_p.G46V|ADCYAP1R1_ENST00000396211.2_Missense_Mutation_p.G46V	NM_001118.4|NM_001199635.1|NM_001199636.1	NP_001109.2|NP_001186564.1|NP_001186565.1	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary) receptor type I	46					activation of adenylate cyclase activity (GO:0007190)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(1)|large_intestine(4)|liver(2)|lung(24)|ovary(1)|skin(2)|stomach(1)	35						GAGCTGATGGGCTTCAATGAT	0.567																																					p.G46V	Ovarian(44;225 1186 2158 11092)	.											.	ADCYAP1R1	91	0			c.G137T						.						78.0	68.0	71.0					7																	31104532		2203	4300	6503	SO:0001583	missense	117	exon3			TGATGGGCTTCAA		CCDS5433.1, CCDS56480.1, CCDS56481.1	7p14.3	2012-09-20			ENSG00000078549	ENSG00000078549		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	242	protein-coding gene	gene with protein product	"""PACAP receptor 1"""	102981				7902709	Standard	NM_001199635		Approved	PAC1, PACAPR, PAC1R	uc003tcg.3	P41586	OTTHUMG00000023884	ENST00000304166.4:c.137G>T	7.37:g.31104532G>T	ENSP00000306620:p.Gly46Val	99.0	0.0		49.0	5.0	NM_001118	A8K1Y1|B7ZLA7|B8ZZK3|Q17S10	Missense_Mutation	SNP	ENST00000304166.4	37	CCDS5433.1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.370625	0.42003	.	.	ENSG00000078549	ENST00000304166;ENST00000409363;ENST00000431811;ENST00000396211;ENST00000409489	T;T;T;T;T	0.48836	1.13;1.1;0.85;0.8;0.8	5.58	4.7	0.59300	GPCR, family 2, extracellular hormone receptor domain (1);	0.366385	0.25464	N	0.030485	T	0.35068	0.0919	L	0.29908	0.895	0.58432	D	0.999996	B;B;B;B;B	0.29936	0.262;0.138;0.215;0.035;0.016	B;B;B;B;B	0.29353	0.101;0.065;0.101;0.037;0.011	T	0.16305	-1.0407	10	0.42905	T	0.14	.	10.3064	0.43683	0.0911:0.0:0.9089:0.0	.	46;46;46;46;46	B7ZLA7;Q17S10;E9PFU5;B8ZZK3;P41586	.;.;.;.;PACR_HUMAN	V	46	ENSP00000306620:G46V;ENSP00000387335:G46V;ENSP00000400893:G46V;ENSP00000379514:G46V;ENSP00000386395:G46V	ENSP00000306620:G46V	G	+	2	0	ADCYAP1R1	31071057	0.999000	0.42202	0.952000	0.39060	0.897000	0.52465	3.470000	0.53100	1.349000	0.45751	0.563000	0.77884	GGC	.		0.567	ADCYAP1R1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215041.3	NM_001118	
ARFGEF1	10565	broad.mit.edu;bcgsc.ca	37	8	68184028	68184028	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr8:68184028A>G	ENST00000262215.3	-	10	1870	c.1481T>C	c.(1480-1482)gTc>gCc	p.V494A		NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	494					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			AACAGATGAGACTCCATTTTT	0.348																																					p.V494A		.											.	ARFGEF1	294	0			c.T1481C						.						73.0	73.0	73.0					8																	68184028		2203	4300	6503	SO:0001583	missense	10565	exon10			GATGAGACTCCAT	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.1481T>C	8.37:g.68184028A>G	ENSP00000262215:p.Val494Ala	111.0	0.0		142.0	6.0	NM_006421	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	ENST00000262215.3	37	CCDS6199.1	.	.	.	.	.	.	.	.	.	.	a	20.7	4.027998	0.75390	.	.	ENSG00000066777	ENST00000262215	T	0.63580	-0.05	5.64	5.64	0.86602	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64800	0.2631	L	0.31420	0.93	0.80722	D	1	D	0.53619	0.961	P	0.56648	0.803	T	0.63976	-0.6515	10	0.36615	T	0.2	.	15.8614	0.79026	1.0:0.0:0.0:0.0	.	494	Q9Y6D6	BIG1_HUMAN	A	494	ENSP00000262215:V494A	ENSP00000262215:V494A	V	-	2	0	ARFGEF1	68346582	1.000000	0.71417	1.000000	0.80357	0.496000	0.33645	8.865000	0.92300	2.142000	0.66516	0.477000	0.44152	GTC	.		0.348	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421	
ARHGAP26	23092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	142435642	142435642	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr5:142435642A>T	ENST00000274498.4	+	16	1801	c.1423A>T	c.(1423-1425)Aaa>Taa	p.K475*	ARHGAP26_ENST00000378004.3_Nonsense_Mutation_p.K475*	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26	475	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AAGTTTCATCAAAGCAGCAAG	0.338																																					p.K475X		.											.	ARHGAP26	660	0			c.A1423T						.						161.0	156.0	158.0					5																	142435642		2203	4300	6503	SO:0001587	stop_gained	23092	exon16			TTCATCAAAGCAG	AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.1423A>T	5.37:g.142435642A>T	ENSP00000274498:p.Lys475*	59.0	0.0		51.0	8.0	NM_015071	O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	Nonsense_Mutation	SNP	ENST00000274498.4	37	CCDS4277.1	.	.	.	.	.	.	.	.	.	.	A	44	10.908573	0.99487	.	.	ENSG00000145819	ENST00000274498;ENST00000378004;ENST00000418668	.	.	.	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	16.2666	0.82588	1.0:0.0:0.0:0.0	.	.	.	.	X	475;475;48	.	ENSP00000274498:K475X	K	+	1	0	ARHGAP26	142415835	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.136000	0.89610	2.320000	0.78422	0.528000	0.53228	AAA	.		0.338	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132744.3	NM_015071	
ATP2B3	492	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	152835147	152835147	+	Intron	SNP	C	C	T	rs147874519	byFrequency	TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chrX:152835147C>T	ENST00000349466.2	+	20	3668				ATP2B3_ENST00000393842.1_Silent_p.D1129D|ATP2B3_ENST00000263519.4_Intron|ATP2B3_ENST00000370186.1_Silent_p.D1129D|ATP2B3_ENST00000359149.3_Silent_p.D1143D|ATP2B3_ENST00000370181.2_Silent_p.D1129D			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3						blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.D1143D(1)|p.D1129D(1)		NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGCTTCATGACGTAACCAATC	0.517																																					p.D1143D		.											.	ATP2B3	109	2	Substitution - coding silent(2)	NS(2)	c.C3429T						.		,	0,3835		0,0,0,1632,571	301.0	243.0	262.0		,3429	5.2	1.0	X	dbSNP_134	262	3,6725		0,2,1,2426,1871	no	intron,coding-synonymous	ATP2B3	NM_001001344.2,NM_021949.3	,	0,2,1,4058,2442	TT,TC,T,CC,C		0.0446,0.0,0.0284	,	,1143/1174	152835147	3,10560	2203	4300	6503	SO:0001627	intron_variant	492	exon20			TCATGACGTAACC	U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.3342+4586C>T	X.37:g.152835147C>T		135.0	0.0		191.0	41.0	NM_021949	B7WNR8|B7WNY5|Q12995|Q16858	Silent	SNP	ENST00000349466.2	37	CCDS35440.1																																																																																			C|1.000;T|0.000		0.517	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	NM_021949	
ATP6V0D2	245972	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	87165053	87165053	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr8:87165053G>T	ENST00000285393.3	+	8	1042	c.900G>T	c.(898-900)atG>atT	p.M300I	CTD-3118D11.2_ENST00000522679.1_RNA|CTD-3118D11.2_ENST00000524253.1_RNA	NM_152565.1	NP_689778.1	Q8N8Y2	VA0D2_HUMAN	ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2	300					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	hydrogen ion transmembrane transporter activity (GO:0015078)			breast(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(9)|prostate(1)	27						AGGTACAAATGAATGTGCTGG	0.358																																					p.M300I		.											.	ATP6V0D2	90	0			c.G900T						.						158.0	146.0	151.0					8																	87165053		2203	4300	6503	SO:0001583	missense	245972	exon8			ACAAATGAATGTG	AY079172	CCDS6241.1	8q21.3	2014-01-28	2006-01-20	2002-05-24	ENSG00000147614	ENSG00000147614		"""ATPases / V-type"""	18266	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 38kD, V0 subunit d isoform 2"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 2"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit D2"""			12384298	Standard	NM_152565		Approved	FLJ38708, VMA6, ATP6D2	uc003ydp.1	Q8N8Y2	OTTHUMG00000163637	ENST00000285393.3:c.900G>T	8.37:g.87165053G>T	ENSP00000285393:p.Met300Ile	84.0	0.0		64.0	21.0	NM_152565		Missense_Mutation	SNP	ENST00000285393.3	37	CCDS6241.1	.	.	.	.	.	.	.	.	.	.	G	12.15	1.852908	0.32699	.	.	ENSG00000147614	ENST00000285393	T	0.28454	1.61	6.06	5.16	0.70880	.	0.181318	0.51477	N	0.000092	T	0.20495	0.0493	N	0.16656	0.425	0.41711	D	0.989459	B	0.02656	0.0	B	0.08055	0.003	T	0.03433	-1.1037	10	0.33940	T	0.23	-3.548	13.4993	0.61445	0.0786:0.0:0.9214:0.0	.	300	Q8N8Y2	VA0D2_HUMAN	I	300	ENSP00000285393:M300I	ENSP00000285393:M300I	M	+	3	0	ATP6V0D2	87234169	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	5.454000	0.66651	1.481000	0.48307	-0.355000	0.07637	ATG	.		0.358	ATP6V0D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374651.1	NM_152565	
BDNF	627	ucsc.edu;mdanderson.org	37	11	27681097	27681097	+	5'UTR	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr11:27681097T>C	ENST00000525528.1	-	0	108				BDNF-AS_ENST00000530686.1_RNA|BDNF-AS_ENST00000501176.2_RNA|BDNF-AS_ENST00000499568.2_RNA|BDNF-AS_ENST00000532965.1_RNA|BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000395981.3_Intron|BDNF-AS_ENST00000502161.2_RNA|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000532997.1_Intron|BDNF_ENST00000530861.1_Intron|BDNF_ENST00000395980.2_Intron|BDNF_ENST00000356660.4_Intron|BDNF_ENST00000533246.1_Intron|BDNF_ENST00000525950.1_Intron|BDNF_ENST00000420794.1_Intron|BDNF_ENST00000395983.3_Intron|BDNF_ENST00000314915.6_Intron|BDNF_ENST00000395978.3_Intron|BDNF_ENST00000418212.1_Intron|BDNF_ENST00000395986.2_Intron|BDNF_ENST00000533131.1_Intron|BDNF_ENST00000439476.2_5'UTR|BDNF_ENST00000438929.1_Intron|BDNF-AS_ENST00000500662.2_RNA|BDNF_ENST00000584049.1_Intron	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor						axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						CTAAAACCCTTCACTCCTTGG	0.388																																					.		.											.	BDNF	514	0			.						.																																			SO:0001623	5_prime_UTR_variant	627	.			AACCCTTCACTCC	AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.-986A>G	11.37:g.27681097T>C		237.0	0.0		259.0	78.0	.	A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	RNA	SNP	ENST00000525528.1	37	CCDS7866.1																																																																																			.		0.388	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388135.1	NM_170735	
BRF1	2972	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105693005	105693005	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr14:105693005T>C	ENST00000546474.1	-	8	15840	c.881A>G	c.(880-882)tAc>tGc	p.Y294C	BRF1_ENST00000379937.2_Missense_Mutation_p.Y267C|BRF1_ENST00000392557.4_Missense_Mutation_p.Y90C|BRF1_ENST00000379932.4_Missense_Mutation_p.Y90C|BRF1_ENST00000446501.2_Missense_Mutation_p.Y56C|BRF1_ENST00000327359.3_Missense_Mutation_p.Y179C|BRF1_ENST00000551787.1_Missense_Mutation_p.Y90C|BRF1_ENST00000440513.3_Missense_Mutation_p.Y179C	NM_001242787.1|NM_001519.3	NP_001229716.1|NP_001510.2	Q92994	TF3B_HUMAN	BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit	294					gene expression (GO:0010467)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|tRNA transcription (GO:0009304)	nucleoplasm (GO:0005654)|transcription factor TFIIIB complex (GO:0000126)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		CCCAGCTGTGTACGAGGGGGG	0.587																																					p.Y294C		.											.	BRF1	155	0			c.A881G						.						61.0	64.0	63.0					14																	105693005		2203	4300	6503	SO:0001583	missense	2972	exon8			GCTGTGTACGAGG	U28838	CCDS10001.1, CCDS42001.1, CCDS55949.1, CCDS55950.1, CCDS55951.1, CCDS55952.1, CCDS55953.1	14q32.33	2014-04-02	2013-05-29	2001-12-07	ENSG00000185024	ENSG00000185024		"""General transcription factors"""	11551	protein-coding gene	gene with protein product		604902	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 2"", ""BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)"""	TAF3B2, TAF3C, GTF3B		7624363, 8943358	Standard	NM_145685		Approved	TFIIIB90, BRF, hBRF	uc001yqp.2	Q92994	OTTHUMG00000029884	ENST00000546474.1:c.881A>G	14.37:g.105693005T>C	ENSP00000448323:p.Tyr294Cys	88.0	1.0		102.0	29.0	NM_001519	B3KU36|B4DIG5|B7Z2N3|F5H5Z7|F8WA46|Q13223|Q3SYD9|Q5PR24|Q6IQ02|Q96KX3|Q9HCW6|Q9HCW7|Q9HCW8	Missense_Mutation	SNP	ENST00000546474.1	37	CCDS10001.1	.	.	.	.	.	.	.	.	.	.	T	14.50	2.553963	0.45487	.	.	ENSG00000185024	ENST00000392557;ENST00000379937;ENST00000546474;ENST00000446501;ENST00000551787;ENST00000379932;ENST00000327359;ENST00000440513;ENST00000547562;ENST00000549655;ENST00000552127	.	.	.	5.07	3.88	0.44766	.	0.101566	0.64402	D	0.000002	T	0.64962	0.2646	L	0.55990	1.75	0.45046	D	0.998068	D;D;D	0.71674	0.995;0.998;0.996	P;D;P	0.63703	0.879;0.917;0.827	T	0.67189	-0.5733	9	0.87932	D	0	.	7.1138	0.25405	0.3476:0.0:0.0:0.6524	.	179;267;294	F5H5Z7;Q92994-5;Q92994	.;.;TF3B_HUMAN	C	90;267;294;56;90;90;179;179;14;90;90	.	ENSP00000329029:Y179C	Y	-	2	0	BRF1	104764050	1.000000	0.71417	0.977000	0.42913	0.123000	0.20343	3.899000	0.56288	1.922000	0.55676	0.454000	0.30748	TAC	.		0.587	BRF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074548.4	NM_001519	
C11orf87	399947	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	109294862	109294862	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr11:109294862C>A	ENST00000327419.6	+	2	906	c.503C>A	c.(502-504)cCg>cAg	p.P168Q	RP11-708B6.2_ENST00000532992.1_RNA|RP11-708B6.2_ENST00000532929.1_RNA	NM_207645.3	NP_997528.2	Q6NUJ2	CK087_HUMAN	chromosome 11 open reading frame 87	168						integral component of membrane (GO:0016021)		p.P168L(1)		breast(2)|endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	17						CCGCCTCCACCGCCAGCCTCC	0.652																																					p.P168Q		.											.	C11orf87	92	1	Substitution - Missense(1)	large_intestine(1)	c.C503A						.						40.0	42.0	41.0					11																	109294862		2201	4298	6499	SO:0001583	missense	399947	exon2			CTCCACCGCCAGC	AB096240, BC035798	CCDS31672.1	11q22.3	2013-12-13	2013-12-13	2013-12-13	ENSG00000185742	ENSG00000185742			33788	protein-coding gene	gene with protein product	"""neuronal integral membrane protein 1"""					12477932	Standard	NM_207645		Approved	LOH11CR1A, LOC399947, NEURIM1	uc010rwb.2	Q6NUJ2		ENST00000327419.6:c.503C>A	11.37:g.109294862C>A	ENSP00000331581:p.Pro168Gln	71.0	0.0		64.0	19.0	NM_207645	B4E169	Missense_Mutation	SNP	ENST00000327419.6	37	CCDS31672.1	.	.	.	.	.	.	.	.	.	.	C	7.918	0.737911	0.15574	.	.	ENSG00000185742	ENST00000327419	.	.	.	3.42	0.388	0.16264	.	.	.	.	.	T	0.12050	0.0293	N	0.08118	0	0.23249	N	0.998049	B	0.30146	0.27	B	0.22386	0.039	T	0.19031	-1.0318	8	0.40728	T	0.16	-5.3732	3.1802	0.06582	0.186:0.4978:0.0:0.3162	.	168	Q6NUJ2	CK087_HUMAN	Q	168	.	ENSP00000331581:P168Q	P	+	2	0	C11orf87	108800072	0.000000	0.05858	0.934000	0.37439	0.983000	0.72400	0.007000	0.13174	0.095000	0.17434	-0.123000	0.14984	CCG	.		0.652	C11orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390403.1	NM_207645	
LRRC74A	145497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	77311222	77311222	+	Silent	SNP	G	G	A	rs374431496		TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr14:77311222G>A	ENST00000393774.3	+	7	829	c.705G>A	c.(703-705)ggG>ggA	p.G235G	C14orf166B_ENST00000450042.2_3'UTR	NM_194287.2	NP_919263.2														breast(1)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(1)	18			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		ATGTAGGAGGGGAGCACCTGG	0.478																																					p.G235G	Ovarian(165;1056 1958 32571 36789 48728)	.											.	.	.	0			c.G705A						.	G		0,4406		0,0,2203	50.0	50.0	50.0		705	-7.4	0.0	14		50	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	C14orf166B	NM_194287.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		235/489	77311222	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	145497	exon7			AGGAGGGGAGCAC																												ENST00000393774.3:c.705G>A	14.37:g.77311222G>A		67.0	0.0		51.0	17.0	NM_194287		Silent	SNP	ENST00000393774.3	37	CCDS9853.2																																																																																			.		0.478	C14orf166B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316592.1		
C2CD4C	126567	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	407975	407975	+	Silent	SNP	G	G	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:407975G>A	ENST00000332235.6	-	2	560	c.387C>T	c.(385-387)gaC>gaT	p.D129D		NM_001136263.1	NP_001129735.1	Q8TF44	C2C4C_HUMAN	C2 calcium-dependent domain containing 4C	129										large_intestine(1)|pancreas(1)	2						GGGCCTGGGGGTCGGCGTCAG	0.687																																					p.D129D		.											.	C2CD4C	46	0			c.C387T						.						8.0	12.0	11.0					19																	407975		685	1576	2261	SO:0001819	synonymous_variant	126567	exon2			CTGGGGGTCGGCG	AB075837	CCDS45890.1	19p13.3	2009-09-28	2009-09-28	2009-09-28		ENSG00000183186			29417	protein-coding gene	gene with protein product	"""nuclear localized factor 3"""	610336	"""KIAA1957"", ""family with sequence similarity 148, member C"""	KIAA1957, FAM148C		11853319	Standard	NM_001136263		Approved	NLF3	uc002loo.3	Q8TF44		ENST00000332235.6:c.387C>T	19.37:g.407975G>A		121.0	0.0		125.0	27.0	NM_001136263	Q8N3H7	Silent	SNP	ENST00000332235.6	37	CCDS45890.1																																																																																			.		0.687	C2CD4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451789.2	XM_065166	
CAMTA1	23261	ucsc.edu;bcgsc.ca	37	1	6880251	6880251	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr1:6880251A>G	ENST00000303635.7	+	2	263	c.56A>G	c.(55-57)cAa>cGa	p.Q19R	CAMTA1_ENST00000557126.1_Missense_Mutation_p.Q19R|CAMTA1_ENST00000476163.1_Intron|CAMTA1_ENST00000467404.2_Intron|CAMTA1_ENST00000439411.2_Missense_Mutation_p.Q19R|CAMTA1_ENST00000473578.1_Missense_Mutation_p.Q19R	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	19					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		agcgtttcccaaagtgtattc	0.398			T	WWTR1	epitheliod hemangioendothelioma																																p.Q19R		.		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	CAMTA1	520	0			c.A56G						.						83.0	77.0	79.0					1																	6880251		2203	4300	6503	SO:0001583	missense	23261	exon2			TTTCCCAAAGTGT	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.56A>G	1.37:g.6880251A>G	ENSP00000306522:p.Gln19Arg	70.0	0.0		47.0	5.0	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	ENST00000303635.7	37	CCDS30576.1	.	.	.	.	.	.	.	.	.	.	A	15.20	2.763787	0.49574	.	.	ENSG00000171735	ENST00000303635;ENST00000473578;ENST00000557126;ENST00000439411	T;T	0.22539	1.95;1.96	4.56	4.56	0.56223	.	0.126422	0.31335	N	0.007826	T	0.20129	0.0484	N	0.08118	0	0.24394	N	0.994739	P	0.45126	0.851	P	0.55391	0.775	T	0.05533	-1.0879	10	0.66056	D	0.02	-8.231	10.6057	0.45392	1.0:0.0:0.0:0.0	.	19	Q9Y6Y1	CMTA1_HUMAN	R	19	ENSP00000306522:Q19R;ENSP00000402561:Q19R	ENSP00000306522:Q19R	Q	+	2	0	CAMTA1	6802838	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.552000	0.53705	2.280000	0.76307	0.460000	0.39030	CAA	.		0.398	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
CDH11	1009	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	65038624	65038624	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr16:65038624C>T	ENST00000268603.4	-	3	764	c.149G>A	c.(148-150)cGc>cAc	p.R50H	CDH11_ENST00000394156.3_Missense_Mutation_p.R50H|CDH11_ENST00000569624.1_5'UTR|CDH11_ENST00000566827.1_Intron	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	50					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R50L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		ACGCTTGGAGCGCTGTAGCAC	0.642			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																											p.R50H		.		Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	.	CDH11	852	1	Substitution - Missense(1)	lung(1)	c.G149A						.						55.0	44.0	48.0					16																	65038624		2202	4300	6502	SO:0001583	missense	1009	exon3			TTGGAGCGCTGTA	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.149G>A	16.37:g.65038624C>T	ENSP00000268603:p.Arg50His	109.0	0.0		95.0	19.0	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	ENST00000268603.4	37	CCDS10803.1	.	.	.	.	.	.	.	.	.	.	C	36	5.617948	0.96649	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000536902	T;T	0.00585	6.39;6.39	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.02533	0.0077	L	0.58810	1.83	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.59193	-0.7500	10	0.87932	D	0	.	18.6407	0.91394	0.0:1.0:0.0:0.0	.	50;50	P55287-2;P55287	.;CAD11_HUMAN	H	50	ENSP00000268603:R50H;ENSP00000377711:R50H	ENSP00000268603:R50H	R	-	2	0	CDH11	63596125	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.250000	0.78287	2.662000	0.90505	0.591000	0.81541	CGC	.		0.642	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	
CDH11	1009	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	65038770	65038770	+	Start_Codon_SNP	SNP	C	C	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr16:65038770C>A	ENST00000268603.4	-	3	618	c.3G>T	c.(1-3)atG>atT	p.M1I	CDH11_ENST00000394156.3_Start_Codon_SNP_p.M1I|CDH11_ENST00000569624.1_5'UTR|CDH11_ENST00000566827.1_Intron	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	1					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		AGTTCTCCTTCATTTTTGGTT	0.617			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																											p.M1I		.		Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	.	CDH11	852	0			c.G3T						.						16.0	22.0	20.0					16																	65038770		2155	4232	6387	SO:0001582	initiator_codon_variant	1009	exon3			CTCCTTCATTTTT	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.3G>T	16.37:g.65038770C>A	ENSP00000268603:p.Met1Ile	178.0	0.0		133.0	31.0	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	ENST00000268603.4	37	CCDS10803.1	.	.	.	.	.	.	.	.	.	.	C	14.23	2.474059	0.43942	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000536902	T;T	0.55413	0.59;0.52	5.47	5.47	0.80525	.	0.157945	0.56097	D	0.000026	T	0.49695	0.1572	.	.	.	0.80722	D	1	B;B	0.33807	0.426;0.028	B;B	0.32090	0.14;0.007	T	0.54470	-0.8289	9	0.87932	D	0	.	18.3184	0.90229	0.0:1.0:0.0:0.0	.	1;1	P55287-2;P55287	.;CAD11_HUMAN	I	1	ENSP00000268603:M1I;ENSP00000377711:M1I	ENSP00000268603:M1I	M	-	3	0	CDH11	63596271	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.374000	0.59543	2.572000	0.86782	0.591000	0.81541	ATG	.		0.617	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	Missense_Mutation
CEP170	9859	broad.mit.edu;bcgsc.ca	37	1	243291604	243291604	+	Splice_Site	SNP	T	T	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr1:243291604T>A	ENST00000366542.1	-	19	4465		c.e19-2		CEP170_ENST00000490813.1_Splice_Site|CEP170_ENST00000366544.1_Splice_Site|CEP170_ENST00000481987.1_Splice_Site|CEP170_ENST00000468254.1_Splice_Site|CEP170_ENST00000366543.1_Splice_Site	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa							centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)				NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			AGAAATCTCCTGCAGGGAAAG	0.299																																					.		.											.	CEP170	93	0			c.4042-2A>T						.						17.0	17.0	17.0					1																	243291604		1776	4014	5790	SO:0001630	splice_region_variant	9859	exon19			ATCTCCTGCAGGG	AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.4414-2A>T	1.37:g.243291604T>A		420.0	1.0		270.0	34.0	NM_001042405	O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Splice_Site	SNP	ENST00000366542.1	37	CCDS44339.1	.	.	.	.	.	.	.	.	.	.	T	12.16	1.854904	0.32791	.	.	ENSG00000143702	ENST00000366542;ENST00000366544;ENST00000366543;ENST00000481987;ENST00000336415;ENST00000532008;ENST00000490813	.	.	.	4.58	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1307	0.59380	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CEP170	241358227	1.000000	0.71417	0.999000	0.59377	0.439000	0.31926	4.694000	0.61760	1.708000	0.51301	0.254000	0.18369	.	.		0.299	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096178.2	NM_014812	Intron
CEP170	9859	broad.mit.edu;bcgsc.ca	37	1	243328135	243328135	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr1:243328135C>T	ENST00000366542.1	-	13	3178	c.3127G>A	c.(3127-3129)Gat>Aat	p.D1043N	RP11-261C10.4_ENST00000437499.1_RNA|CEP170_ENST00000490813.1_5'Flank|CEP170_ENST00000366544.1_Missense_Mutation_p.D945N|RP11-261C10.4_ENST00000422938.1_RNA|CEP170_ENST00000366543.1_Missense_Mutation_p.D945N	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	1043	Targeting to microtubules.					centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)				NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			GTTTCTTGATCAGATGACATA	0.423																																					p.D1043N		.											.	CEP170	93	0			c.G3127A						.						37.0	36.0	36.0					1																	243328135		1797	4056	5853	SO:0001583	missense	9859	exon13			CTTGATCAGATGA	AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.3127G>A	1.37:g.243328135C>T	ENSP00000355500:p.Asp1043Asn	446.0	1.0		328.0	26.0	NM_014812	O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Missense_Mutation	SNP	ENST00000366542.1	37	CCDS44339.1	.	.	.	.	.	.	.	.	.	.	C	18.20	3.570563	0.65765	.	.	ENSG00000143702	ENST00000366542;ENST00000366544;ENST00000366543;ENST00000532008	T;T;T	0.61742	0.3;0.27;0.08	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.70771	0.3262	L	0.49350	1.555	0.80722	D	1	D;D;D;D	0.76494	0.999;0.998;0.998;0.998	D;D;D;D	0.87578	0.998;0.991;0.991;0.993	T	0.67047	-0.5769	10	0.29301	T	0.29	-14.2362	17.6292	0.88102	0.0:1.0:0.0:0.0	.	1006;945;945;1043	B1ARM6;Q5SW79-3;Q5SW79-2;Q5SW79	.;.;.;CE170_HUMAN	N	1043;945;945;4	ENSP00000355500:D1043N;ENSP00000355502:D945N;ENSP00000355501:D945N	ENSP00000355500:D1043N	D	-	1	0	CEP170	241394758	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.243000	0.78219	2.390000	0.81377	0.555000	0.69702	GAT	.		0.423	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096178.2	NM_014812	
CEP192	55125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	13049219	13049219	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr18:13049219A>T	ENST00000325971.8	+	14	2234	c.641A>T	c.(640-642)gAt>gTt	p.D214V	CEP192_ENST00000430049.2_Missense_Mutation_p.D335V|CEP192_ENST00000506447.1_Missense_Mutation_p.D810V			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	214					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GATACTTGGGATTTATCTTTG	0.383																																					p.D810V		.											.	CEP192	27	0			c.A2429T						.						103.0	101.0	102.0					18																	13049219		2203	4300	6503	SO:0001583	missense	55125	exon16			CTTGGGATTTATC	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.641A>T	18.37:g.13049219A>T	ENSP00000317156:p.Asp214Val	72.0	0.0		80.0	11.0	NM_032142	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	37		.	.	.	.	.	.	.	.	.	.	A	19.16	3.774142	0.69992	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.07908	3.15;3.17;3.17	5.27	5.27	0.74061	.	0.000000	0.49305	D	0.000160	T	0.25419	0.0618	M	0.62723	1.935	0.52501	D	0.999957	D;D;D	0.76494	0.99;0.996;0.999	P;D;D	0.71656	0.901;0.931;0.974	T	0.00485	-1.1711	10	0.41790	T	0.15	-12.6436	15.4964	0.75653	1.0:0.0:0.0:0.0	.	335;810;214	C9JT09;E9PF99;Q8TEP8	.;.;CE192_HUMAN	V	810;214;214;335	ENSP00000427550:D810V;ENSP00000317156:D214V;ENSP00000389190:D335V	ENSP00000317156:D214V	D	+	2	0	CEP192	13039219	0.999000	0.42202	1.000000	0.80357	0.900000	0.52787	3.468000	0.53086	2.131000	0.65755	0.528000	0.53228	GAT	.		0.383	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142	
CFTR	1080	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	117243675	117243675	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr7:117243675T>A	ENST00000003084.6	+	17	2879	c.2747T>A	c.(2746-2748)tTt>tAt	p.F916Y	AC000111.6_ENST00000456270.1_RNA|CFTR_ENST00000454343.1_Missense_Mutation_p.F855Y	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	916	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	TATTATGTGTTTTACATTTAC	0.408									Cystic Fibrosis																												p.F916Y		.											.	CFTR	518	0			c.T2747A						.						219.0	186.0	197.0					7																	117243675		2203	4300	6503	SO:0001583	missense	1080	exon17	Familial Cancer Database	CF	ATGTGTTTTACAT	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.2747T>A	7.37:g.117243675T>A	ENSP00000003084:p.Phe916Tyr	243.0	0.0		118.0	11.0	NM_000492	Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	ENST00000003084.6	37	CCDS5773.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.416019	0.83449	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	D;D;D	0.94576	-3.46;-3.46;-3.46	5.82	5.82	0.92795	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.294147	0.42682	D	0.000666	D	0.95143	0.8426	M	0.72118	2.19	0.42193	D	0.991737	P	0.34412	0.453	B	0.42959	0.403	D	0.95242	0.8352	10	0.72032	D	0.01	-7.0964	16.179	0.81887	0.0:0.0:0.0:1.0	.	916	P13569	CFTR_HUMAN	Y	916;855;886	ENSP00000003084:F916Y;ENSP00000403677:F855Y;ENSP00000389119:F886Y	ENSP00000003084:F916Y	F	+	2	0	CFTR	117030911	1.000000	0.71417	0.943000	0.38184	0.506000	0.33950	7.990000	0.88215	2.232000	0.73038	0.477000	0.44152	TTT	.		0.408	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3	NM_000492	
CHRNB2	1141	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	154543762	154543762	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr1:154543762T>C	ENST00000368476.3	+	5	727	c.463T>C	c.(463-465)Tgc>Cgc	p.C155R		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	155					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	CAAGAGCGCATGCAAGATTGA	0.527																																					p.C155R		.											.	CHRNB2	90	0			c.T463C						.						120.0	105.0	110.0					1																	154543762		2203	4300	6503	SO:0001583	missense	1141	exon5			AGCGCATGCAAGA	U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.463T>C	1.37:g.154543762T>C	ENSP00000357461:p.Cys155Arg	101.0	0.0		88.0	11.0	NM_000748	Q9UEH9	Missense_Mutation	SNP	ENST00000368476.3	37	CCDS1070.1	.	.	.	.	.	.	.	.	.	.	T	19.55	3.848971	0.71603	.	.	ENSG00000160716	ENST00000368476	D	0.98105	-4.72	4.38	4.38	0.52667	Neurotransmitter-gated ion-channel ligand-binding (3);Neurotransmitter-gated ion-channel, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99278	0.9748	H	0.99197	4.465	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98492	1.0610	10	0.87932	D	0	.	13.4192	0.60987	0.0:0.0:0.0:1.0	.	155	P17787	ACHB2_HUMAN	R	155	ENSP00000357461:C155R	ENSP00000357461:C155R	C	+	1	0	CHRNB2	152810386	1.000000	0.71417	0.946000	0.38457	0.984000	0.73092	7.832000	0.86757	1.815000	0.52974	0.460000	0.39030	TGC	.		0.527	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090697.1	NM_000748	
CHRNB3	1142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	42587427	42587427	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr8:42587427C>T	ENST00000289957.2	+	5	1105	c.977C>T	c.(976-978)tCc>tTc	p.S326F		NM_000749.3	NP_000740.1	Q05901	ACHB3_HUMAN	cholinergic receptor, nicotinic, beta 3 (neuronal)	326					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|drug binding (GO:0008144)			endometrium(4)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)	AGATCTTCTTCCACGTACCAC	0.453																																					p.S326F		.											.	CHRNB3	91	0			c.C977T						.						297.0	248.0	265.0					8																	42587427		2203	4300	6503	SO:0001583	missense	1142	exon5			CTTCTTCCACGTA	U62438	CCDS6134.1	8p11.21	2012-02-11	2012-02-07		ENSG00000147432	ENSG00000147432		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 3 (neuronal)"""	118508	"""cholinergic receptor, nicotinic, beta polypeptide 3"""			1505988	Standard	NM_000749		Approved		uc003xpi.1	Q05901	OTTHUMG00000165262	ENST00000289957.2:c.977C>T	8.37:g.42587427C>T	ENSP00000289957:p.Ser326Phe	300.0	0.0		438.0	176.0	NM_000749	Q15827	Missense_Mutation	SNP	ENST00000289957.2	37	CCDS6134.1	.	.	.	.	.	.	.	.	.	.	c	14.61	2.587081	0.46110	.	.	ENSG00000147432	ENST00000289957	T	0.71934	-0.61	5.85	5.85	0.93711	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.055024	0.64402	D	0.000001	D	0.83418	0.5250	M	0.79011	2.435	0.28985	N	0.888397	P	0.51057	0.941	D	0.65140	0.932	T	0.80348	-0.1420	10	0.87932	D	0	.	15.3155	0.74074	0.0:0.9317:0.0:0.0683	.	326	Q05901	ACHB3_HUMAN	F	326	ENSP00000289957:S326F	ENSP00000289957:S326F	S	+	2	0	CHRNB3	42706584	0.839000	0.29477	0.108000	0.21378	0.117000	0.20001	6.067000	0.71193	2.778000	0.95560	0.650000	0.86243	TCC	.		0.453	CHRNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383055.1		
CNGB3	54714	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	87755800	87755800	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr8:87755800T>A	ENST00000320005.5	-	1	103	c.56A>T	c.(55-57)gAg>gTg	p.E19V	RP11-386D6.1_ENST00000519041.1_RNA|CNGB3_ENST00000519777.1_5'UTR	NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	19					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						TTGTTCATTCTCATTGTTCTC	0.433																																					p.E19V		.											.	CNGB3	93	0			c.A56T						.						316.0	263.0	281.0					8																	87755800		2203	4300	6503	SO:0001583	missense	54714	exon1			TCATTCTCATTGT	AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.56A>T	8.37:g.87755800T>A	ENSP00000316605:p.Glu19Val	397.0	0.0		285.0	120.0	NM_019098	C9JA51|Q9NRE9	Missense_Mutation	SNP	ENST00000320005.5	37	CCDS6244.1	.	.	.	.	.	.	.	.	.	.	T	17.28	3.349232	0.61183	.	.	ENSG00000170289	ENST00000320005	T	0.31247	1.5	5.96	4.79	0.61399	.	0.741096	0.11364	N	0.571597	T	0.33644	0.0870	L	0.40543	1.245	0.09310	N	0.999992	D	0.58620	0.983	P	0.49140	0.601	T	0.13495	-1.0507	10	0.62326	D	0.03	.	9.1158	0.36758	0.0:0.0893:0.0:0.9107	.	19	Q9NQW8	CNGB3_HUMAN	V	19	ENSP00000316605:E19V	ENSP00000316605:E19V	E	-	2	0	CNGB3	87824916	0.024000	0.19004	0.048000	0.18961	0.022000	0.10575	1.538000	0.36094	1.042000	0.40150	-0.417000	0.06048	GAG	.		0.433	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375107.1	NM_019098	
CNN3	1266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	95364951	95364951	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr1:95364951C>T	ENST00000370206.4	-	6	1007	c.624G>A	c.(622-624)atG>atA	p.M208I	CNN3_ENST00000394202.4_Missense_Mutation_p.M162I|CNN3_ENST00000487539.1_5'UTR|CNN3_ENST00000538964.1_Missense_Mutation_p.M208I|CNN3_ENST00000545882.1_Missense_Mutation_p.M167I	NM_001839.3	NP_001830.1	Q15417	CNN3_HUMAN	calponin 3, acidic	208					actomyosin structure organization (GO:0031032)|epithelial cell differentiation (GO:0030855)	focal adhesion (GO:0005925)				breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(1)|stomach(1)|urinary_tract(2)	18		all_lung(203;0.00206)|Lung NSC(277;0.00948)		all cancers(265;0.0325)|Epithelial(280;0.0861)		TATTAGTGCCCATCTGCAGAC	0.408																																					p.M208I		.											.	CNN3	90	0			c.G624A						.						131.0	123.0	126.0					1																	95364951		2203	4300	6503	SO:0001583	missense	1266	exon6			AGTGCCCATCTGC	BC025372	CCDS30775.1, CCDS65592.1, CCDS65593.1	1p22-p21	2010-07-08			ENSG00000117519	ENSG00000117519			2157	protein-coding gene	gene with protein product		602374				8526917	Standard	NM_001839		Approved		uc001dqz.4	Q15417	OTTHUMG00000010783	ENST00000370206.4:c.624G>A	1.37:g.95364951C>T	ENSP00000359225:p.Met208Ile	128.0	0.0		67.0	15.0	NM_001839	B4DFK6|B4DP09|F8WA86|Q6FHA7	Missense_Mutation	SNP	ENST00000370206.4	37	CCDS30775.1	.	.	.	.	.	.	.	.	.	.	C	31	5.069592	0.93950	.	.	ENSG00000117519	ENST00000370206;ENST00000538964;ENST00000394202;ENST00000545882;ENST00000415017	T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.81069	0.4746	M	0.93978	3.48	0.80722	D	1	D;D	0.71674	0.998;0.963	D;D	0.69824	0.944;0.966	D	0.84795	0.0781	10	0.72032	D	0.01	-15.6579	20.2279	0.98344	0.0:1.0:0.0:0.0	.	162;208	F8WA86;Q15417	.;CNN3_HUMAN	I	208;208;162;167;167	ENSP00000359225:M208I;ENSP00000437665:M208I;ENSP00000377752:M162I;ENSP00000440081:M167I;ENSP00000401452:M167I	ENSP00000359225:M208I	M	-	3	0	CNN3	95137539	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.487000	0.81328	2.778000	0.95560	0.655000	0.94253	ATG	.		0.408	CNN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029702.2	NM_001839	
CNTNAP5	129684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	125555776	125555776	+	Silent	SNP	A	A	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr2:125555776A>T	ENST00000431078.1	+	19	3457	c.3093A>T	c.(3091-3093)acA>acT	p.T1031T		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	1031	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CTATTTACACAGATTCAGCTC	0.438																																					p.T1031T		.											.	CNTNAP5	524	0			c.A3093T						.						148.0	142.0	144.0					2																	125555776		1946	4150	6096	SO:0001819	synonymous_variant	129684	exon19			TTACACAGATTCA	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.3093A>T	2.37:g.125555776A>T		243.0	0.0		199.0	53.0	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Silent	SNP	ENST00000431078.1	37	CCDS46401.1																																																																																			.		0.438	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
COL16A1	1307	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	32158742	32158742	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr1:32158742T>A	ENST00000373672.3	-	13	1538	c.1022A>T	c.(1021-1023)gAg>gTg	p.E341V	COL16A1_ENST00000271069.6_Missense_Mutation_p.E341V|COL16A1_ENST00000373668.3_Missense_Mutation_p.E341V	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	341	Nonhelical region 10 (NC10).				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CAGGCCCCGCTCACCTTTCCC	0.632																																					p.E341V	Colon(143;498 1786 21362 25193 36625)	.											.	COL16A1	98	0			c.A1022T						.						35.0	37.0	37.0					1																	32158742		1928	4122	6050	SO:0001583	missense	1307	exon13			CCCCGCTCACCTT	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.1022A>T	1.37:g.32158742T>A	ENSP00000362776:p.Glu341Val	125.0	0.0		113.0	18.0	NM_001856	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	ENST00000373672.3	37	CCDS41297.1	.	.	.	.	.	.	.	.	.	.	T	14.31	2.497511	0.44455	.	.	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000373668;ENST00000373667	D;D;D;D	0.94232	-3.38;-3.38;-3.38;-3.38	4.92	4.92	0.64577	.	0.150748	0.41938	D	0.000790	D	0.93223	0.7841	M	0.62266	1.93	0.38037	D	0.93533	P;P;P	0.49185	0.92;0.7;0.801	B;B;P	0.48704	0.341;0.383;0.587	D	0.94418	0.7638	10	0.62326	D	0.03	.	12.3899	0.55352	0.0:0.0:0.0:1.0	.	341;341;341	A6NCT7;Q07092;Q07092-2	.;COGA1_HUMAN;.	V	341;341;341;60	ENSP00000362776:E341V;ENSP00000271069:E341V;ENSP00000362772:E341V;ENSP00000362771:E60V	ENSP00000271069:E341V	E	-	2	0	COL16A1	31931329	1.000000	0.71417	0.965000	0.40720	0.658000	0.38924	4.988000	0.63863	1.996000	0.58369	0.379000	0.24179	GAG	.		0.632	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
COL1A2	1278	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	94057038	94057038	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr7:94057038C>A	ENST00000297268.6	+	49	3838	c.3367C>A	c.(3367-3369)Cgc>Agc	p.R1123S		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	1123				Missing (in Ref. 17; CAA23761). {ECO:0000305}.	blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TGACCAGCCTCGCTCAGCACC	0.552										HNSCC(75;0.22)																											p.R1123S		.											.	COL1A2	521	0			c.C3367A						.						98.0	97.0	98.0					7																	94057038		2203	4300	6503	SO:0001583	missense	1278	exon49			CAGCCTCGCTCAG	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.3367C>A	7.37:g.94057038C>A	ENSP00000297268:p.Arg1123Ser	123.0	0.0		87.0	26.0	NM_000089	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	37	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	C	13.13	2.145829	0.37923	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.89196	-2.48	5.71	5.71	0.89125	.	0.000000	0.56097	D	0.000040	D	0.87204	0.6119	N	0.11427	0.14	0.32726	N	0.509689	D	0.60160	0.987	D	0.67725	0.953	D	0.84882	0.0831	10	0.17369	T	0.5	.	15.7376	0.77859	0.0:1.0:0.0:0.0	.	1123	P08123	CO1A2_HUMAN	S	1123;1124	ENSP00000297268:R1123S	ENSP00000297268:R1123S	R	+	1	0	COL1A2	93894974	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.549000	0.53681	2.873000	0.98535	0.561000	0.74099	CGC	.		0.552	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
CSMD1	64478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	2799992	2799992	+	Splice_Site	SNP	A	A	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr8:2799992A>C	ENST00000520002.1	-	70	11094		c.e70+1		CSMD1_ENST00000537824.1_Splice_Site|CSMD1_ENST00000602557.1_Splice_Site|CSMD1_ENST00000542608.1_Splice_Site|CSMD1_ENST00000602723.1_Splice_Site|CSMD1_ENST00000400186.3_Splice_Site			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1							integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TTTCTGCAGTACCTGTGTTTG	0.428																																					.		.											.	CSMD1	86	0			c.10535+2T>G						.						48.0	47.0	47.0					8																	2799992		1888	4123	6011	SO:0001630	splice_region_variant	64478	exon70			TGCAGTACCTGTG			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.10538+1T>G	8.37:g.2799992A>C		51.0	0.0		41.0	23.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Splice_Site	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	A	28.0	4.884016	0.91814	.	.	ENSG00000183117	ENST00000335551;ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8993	0.79359	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CSMD1	2787399	1.000000	0.71417	0.997000	0.53966	0.962000	0.63368	9.023000	0.93683	2.150000	0.67090	0.523000	0.50628	.	.		0.428	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	Intron
CSMD1	64478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	3443701	3443701	+	Silent	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr8:3443701T>C	ENST00000520002.1	-	10	1737	c.1182A>G	c.(1180-1182)acA>acG	p.T394T	CSMD1_ENST00000537824.1_Silent_p.T393T|CSMD1_ENST00000602557.1_Silent_p.T394T|CSMD1_ENST00000542608.1_Silent_p.T393T|CSMD1_ENST00000539096.1_Silent_p.T393T|CSMD1_ENST00000602723.1_Silent_p.T394T|CSMD1_ENST00000400186.3_Silent_p.T394T			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	394	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CGAGCGTCTCTGTAACTCTCT	0.478																																					p.T393T		.											.	CSMD1	86	0			c.A1179G						.						47.0	46.0	46.0					8																	3443701		1928	4135	6063	SO:0001819	synonymous_variant	64478	exon9			CGTCTCTGTAACT			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.1182A>G	8.37:g.3443701T>C		79.0	0.0		75.0	21.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37																																																																																				.		0.478	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CRISPLD1	83690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	75932132	75932132	+	Silent	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr8:75932132A>G	ENST00000262207.4	+	11	1623	c.1155A>G	c.(1153-1155)acA>acG	p.T385T	CRISPLD1_ENST00000523524.1_Silent_p.T197T|CRISPLD1_ENST00000517786.1_Silent_p.T199T	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	385					face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)		p.V386fs*5(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			ATTCCTTCACAGTCTCTAAAG	0.323																																					p.T385T		.											.	CRISPLD1	91	1	Insertion - Frameshift(1)	prostate(1)	c.A1155G						.						150.0	145.0	147.0					8																	75932132		2203	4300	6503	SO:0001819	synonymous_variant	83690	exon11			CTTCACAGTCTCT	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.1155A>G	8.37:g.75932132A>G		211.0	0.0		165.0	56.0	NM_031461	B2RA60|B7Z929	Silent	SNP	ENST00000262207.4	37	CCDS6219.1																																																																																			.		0.323	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461	
CSMD2	114784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	34498286	34498286	+	Silent	SNP	T	T	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr1:34498286T>G	ENST00000373381.4	-	3	602	c.426A>C	c.(424-426)ccA>ccC	p.P142P		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	102	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CAATGGTGGCTGGCAGCTGAA	0.527																																					p.P102P		.											.	CSMD2	103	0			c.A306C						.						79.0	62.0	68.0					1																	34498286		2203	4300	6503	SO:0001819	synonymous_variant	114784	exon3			GGTGGCTGGCAGC	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.426A>C	1.37:g.34498286T>G		83.0	0.0		93.0	12.0	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	37																																																																																				.		0.527	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
CTTNBP2	83992	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	117432446	117432446	+	Missense_Mutation	SNP	T	T	G	rs377098745		TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr7:117432446T>G	ENST00000160373.3	-	4	895	c.804A>C	c.(802-804)caA>caC	p.Q268H	CTTNBP2_ENST00000487820.1_5'Flank	NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	268					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		CCCTTTTCAGTTGCTCAATCA	0.483																																					p.Q268H		.											.	CTTNBP2	94	0			c.A804C						.						172.0	139.0	150.0					7																	117432446		2203	4300	6503	SO:0001583	missense	83992	exon4			TTTCAGTTGCTCA		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.804A>C	7.37:g.117432446T>G	ENSP00000160373:p.Gln268His	276.0	1.0		267.0	41.0	NM_033427	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	37	CCDS5774.1	.	.	.	.	.	.	.	.	.	.	T	16.65	3.183068	0.57800	.	.	ENSG00000077063	ENST00000160373	T	0.66280	-0.2	5.62	-7.81	0.01210	.	0.168745	0.53938	D	0.000060	T	0.77322	0.4113	M	0.86178	2.8	0.39143	D	0.962086	D	0.65815	0.995	D	0.78314	0.991	D	0.83429	0.0037	10	0.87932	D	0	4.8757	19.5747	0.95438	0.0:0.6576:0.0:0.3424	.	268	Q8WZ74	CTTB2_HUMAN	H	268	ENSP00000160373:Q268H	ENSP00000160373:Q268H	Q	-	3	2	CTTNBP2	117219682	0.019000	0.18553	0.738000	0.30950	0.970000	0.65996	-0.890000	0.04140	-1.534000	0.01743	-0.263000	0.10527	CAA	.		0.483	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
CTTNBP2	83992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	117432538	117432538	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr7:117432538G>A	ENST00000160373.3	-	4	803	c.712C>T	c.(712-714)Cgg>Tgg	p.R238W	CTTNBP2_ENST00000487820.1_5'Flank	NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	238					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		AGCTGTTCCCGCTCAGTGTCA	0.453																																					p.R238W		.											.	CTTNBP2	94	0			c.C712T						.						130.0	106.0	114.0					7																	117432538		2203	4300	6503	SO:0001583	missense	83992	exon4			GTTCCCGCTCAGT		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.712C>T	7.37:g.117432538G>A	ENSP00000160373:p.Arg238Trp	232.0	0.0		232.0	28.0	NM_033427	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	37	CCDS5774.1	.	.	.	.	.	.	.	.	.	.	G	14.00	2.405680	0.42715	.	.	ENSG00000077063	ENST00000160373	T	0.77098	-1.07	5.77	1.35	0.21983	.	0.000000	0.85682	D	0.000000	D	0.89223	0.6654	M	0.90650	3.135	0.53688	D	0.999979	D	0.89917	1.0	D	0.97110	1.0	D	0.91072	0.4893	10	0.72032	D	0.01	-16.092	15.4882	0.75584	0.0:0.0:0.5666:0.4333	.	238	Q8WZ74	CTTB2_HUMAN	W	238	ENSP00000160373:R238W	ENSP00000160373:R238W	R	-	1	2	CTTNBP2	117219774	0.995000	0.38212	0.033000	0.17914	0.401000	0.30781	2.190000	0.42630	0.362000	0.24319	0.650000	0.86243	CGG	.		0.453	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
CYTH1	9267	broad.mit.edu;bcgsc.ca	37	17	76698670	76698670	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr17:76698670T>C	ENST00000446868.3	-	4	257	c.187A>G	c.(187-189)Aac>Gac	p.N63D	CYTH1_ENST00000591455.1_Missense_Mutation_p.N63D|CYTH1_ENST00000589296.1_Intron|CYTH1_ENST00000589297.1_Missense_Mutation_p.N4D|CYTH1_ENST00000585509.1_Missense_Mutation_p.N4D|CYTH1_ENST00000361101.4_Missense_Mutation_p.N63D			Q15438	CYH1_HUMAN	cytohesin 1	63					establishment of epithelial cell polarity (GO:0090162)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|lipid binding (GO:0008289)			endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	19						ACCTGTTTGTTCCTCTGCATG	0.388																																					p.N63D		.											.	CYTH1	228	0			c.A187G						.						160.0	153.0	156.0					17																	76698670		2203	4300	6503	SO:0001583	missense	9267	exon4			GTTTGTTCCTCTG	M85169	CCDS32754.1, CCDS42392.2	17q25	2014-05-02	2008-08-14	2008-08-14	ENSG00000108669	ENSG00000108669		"""Pleckstrin homology (PH) domain containing"""	9501	protein-coding gene	gene with protein product		182115	"""pleckstrin homology, Sec7 and coiled-coil domains 1"""	PSCD1		1511013, 8449036, 21628335, 20018626	Standard	XM_006722180		Approved	B2-1, D17S811E, cytohesin-1	uc002jvw.3	Q15438	OTTHUMG00000150253	ENST00000446868.3:c.187A>G	17.37:g.76698670T>C	ENSP00000389095:p.Asn63Asp	136.0	0.0		146.0	6.0	NM_017456	A6NFW7|B7Z1T4|Q9P123|Q9P124	Missense_Mutation	SNP	ENST00000446868.3	37		.	.	.	.	.	.	.	.	.	.	T	15.35	2.806874	0.50421	.	.	ENSG00000108669	ENST00000446868;ENST00000361101;ENST00000539525;ENST00000537048;ENST00000262763;ENST00000434577;ENST00000416418	T;T	0.54675	0.56;0.56	5.47	5.47	0.80525	SEC7-like (4);	0.169904	0.64402	D	0.000007	T	0.39809	0.1092	N	0.20401	0.57	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.16129	-1.0413	10	0.35671	T	0.21	.	15.8381	0.78814	0.0:0.0:0.0:1.0	.	63;63	Q15438;Q15438-2	CYH1_HUMAN;.	D	63;63;4;4;63;74;65	ENSP00000389095:N63D;ENSP00000354398:N63D	ENSP00000262763:N63D	N	-	1	0	CYTH1	74210265	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.872000	0.87187	2.191000	0.70037	0.533000	0.62120	AAC	.		0.388	CYTH1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317099.1	NM_004762	
DAB2IP	153090	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	124535287	124535287	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr9:124535287C>G	ENST00000408936.3	+	12	2662	c.2480C>G	c.(2479-2481)tCc>tGc	p.S827C	DAB2IP_ENST00000309989.1_Missense_Mutation_p.S703C|DAB2IP_ENST00000259371.2_Missense_Mutation_p.S799C			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	827	Necessary for interaction with AKT1.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						GCACCGCTCTCCTTCCAGAAC	0.706																																					p.S799C		.											.	DAB2IP	91	0			c.C2396G						.						29.0	29.0	29.0					9																	124535287		2158	4217	6375	SO:0001583	missense	153090	exon12			CGCTCTCCTTCCA	AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	ENST00000408936.3:c.2480C>G	9.37:g.124535287C>G	ENSP00000386183:p.Ser827Cys	148.0	0.0		98.0	28.0	NM_032552	A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Missense_Mutation	SNP	ENST00000408936.3	37		.	.	.	.	.	.	.	.	.	.	C	21.7	4.184906	0.78677	.	.	ENSG00000136848	ENST00000259371;ENST00000408936;ENST00000373782;ENST00000309989	T;T;T;T	0.31247	1.5;1.5;1.5;1.5	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	T	0.59018	0.2163	M	0.81942	2.565	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.997;1.0	T	0.66011	-0.6029	10	0.87932	D	0	.	16.9563	0.86260	0.0:1.0:0.0:0.0	.	827;799	Q5VWQ8;G3XA90	DAB2P_HUMAN;.	C	799;827;736;703	ENSP00000259371:S799C;ENSP00000386183:S827C;ENSP00000362887:S736C;ENSP00000310827:S703C	ENSP00000259371:S799C	S	+	2	0	DAB2IP	123575108	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.409000	0.80053	2.317000	0.78254	0.462000	0.41574	TCC	.		0.706	DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317857.1	NM_032552	
DCC	1630	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	51025767	51025767	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr18:51025767C>T	ENST00000442544.2	+	27	4614	c.3998C>T	c.(3997-3999)aCa>aTa	p.T1333I	RP11-671P2.1_ENST00000582064.1_RNA|DCC_ENST00000581580.1_Missense_Mutation_p.T966I	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1333					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		ACCATCCCCACAGCTTGTGTT	0.532																																					p.T1333I		.											.	DCC	225	0			c.C3998T						.						238.0	181.0	200.0					18																	51025767		2203	4300	6503	SO:0001583	missense	1630	exon27			TCCCCACAGCTTG	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.3998C>T	18.37:g.51025767C>T	ENSP00000389140:p.Thr1333Ile	171.0	0.0		84.0	9.0	NM_005215		Missense_Mutation	SNP	ENST00000442544.2	37	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	C	14.65	2.599054	0.46318	.	.	ENSG00000187323	ENST00000442544	T	0.49432	0.78	6.17	6.17	0.99709	Neogenin, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.68897	0.3051	M	0.65498	2.005	0.53005	D	0.999961	D	0.67145	0.996	D	0.70227	0.968	T	0.68198	-0.5472	10	0.72032	D	0.01	-6.4138	19.6509	0.95805	0.0:1.0:0.0:0.0	.	1333	P43146	DCC_HUMAN	I	1333	ENSP00000389140:T1333I	ENSP00000389140:T1333I	T	+	2	0	DCC	49279765	1.000000	0.71417	0.969000	0.41365	0.971000	0.66376	6.259000	0.72494	2.941000	0.99782	0.655000	0.94253	ACA	.		0.532	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
DCLRE1B	64858	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	114454510	114454510	+	Silent	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr1:114454510A>G	ENST00000369563.3	+	4	1742	c.1296A>G	c.(1294-1296)tcA>tcG	p.S432S	DCLRE1B_ENST00000466480.1_Intron	NM_022836.3	NP_073747.1	Q9H816	DCR1B_HUMAN	DNA cross-link repair 1B	432					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|protection from non-homologous end joining at telomere (GO:0031848)|telomere maintenance (GO:0000723)|telomeric 3' overhang formation (GO:0031860)|telomeric loop formation (GO:0031627)	centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)			breast(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(6)|stomach(1)	18	Lung SC(450;0.184)	all_cancers(81;1.46e-05)|all_epithelial(167;2.42e-05)|all_lung(203;0.000353)|Lung NSC(69;0.000518)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGGGATTTTCAGTGCACTTAA	0.463								Other identified genes with known or suspected DNA repair function																													p.S432S		.											.	DCLRE1B	227	0			c.A1296G						.						171.0	189.0	183.0					1																	114454510		2203	4300	6503	SO:0001819	synonymous_variant	64858	exon4			ATTTTCAGTGCAC	BC029687	CCDS866.1	1p11.1	2010-06-24	2010-06-24		ENSG00000118655	ENSG00000118655			17641	protein-coding gene	gene with protein product	"""APOLLO"", ""PSO2 homolog (S. cerevisiae)"""	609683	"""DNA cross-link repair 1B (PSO2 homolog, S. cerevisiae)"""				Standard	NM_022836		Approved	SNM1B, FLJ12810, FLJ13998	uc001eeg.3	Q9H816	OTTHUMG00000011937	ENST00000369563.3:c.1296A>G	1.37:g.114454510A>G		117.0	0.0		102.0	18.0	NM_022836	Q9H9E5	Silent	SNP	ENST00000369563.3	37	CCDS866.1																																																																																			.		0.463	DCLRE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033020.2	NM_022836	
DDR2	4921	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	162688873	162688873	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr1:162688873T>C	ENST00000367922.3	+	4	458	c.20T>C	c.(19-21)aTg>aCg	p.M7T	DDR2_ENST00000367921.3_Missense_Mutation_p.M7T	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	7					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	ATTCCCAGAATGCTCTTGGTG	0.448																																					p.M7T	NSCLC(161;314 2006 8283 19651 23192)	.											.	DDR2	1464	0			c.T20C						.						205.0	178.0	187.0					1																	162688873		2203	4300	6503	SO:0001583	missense	4921	exon4			CCAGAATGCTCTT	AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.20T>C	1.37:g.162688873T>C	ENSP00000356899:p.Met7Thr	118.0	0.0		64.0	15.0	NM_001014796	Q7Z730	Missense_Mutation	SNP	ENST00000367922.3	37	CCDS1241.1	.	.	.	.	.	.	.	.	.	.	T	11.35	1.611739	0.28712	.	.	ENSG00000162733	ENST00000446985;ENST00000415555;ENST00000542391;ENST00000367922;ENST00000367921	D;D;D;D	0.97688	-4.22;-4.49;-1.67;-1.67	4.25	3.12	0.35913	.	1.126930	0.06488	N	0.734009	D	0.91307	0.7259	L	0.36672	1.1	0.25662	N	0.985988	B	0.02656	0.0	B	0.06405	0.002	D	0.84515	0.0624	9	0.62326	D	0.03	.	6.3202	0.21213	0.0:0.1125:0.0:0.8875	.	7	Q16832	DDR2_HUMAN	T	7	ENSP00000400309:M7T;ENSP00000391310:M7T;ENSP00000356899:M7T;ENSP00000356898:M7T	ENSP00000356898:M7T	M	+	2	0	DDR2	160955497	1.000000	0.71417	0.993000	0.49108	0.970000	0.65996	1.360000	0.34125	0.796000	0.33947	0.383000	0.25322	ATG	.		0.448	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083213.2	NM_006182	
DIAPH3	81624	broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	60413570	60413570	+	Missense_Mutation	SNP	G	G	A	rs372502709		TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr13:60413570G>A	ENST00000400324.4	-	23	2970	c.2750C>T	c.(2749-2751)aCg>aTg	p.T917M	DIAPH3_ENST00000400320.1_Missense_Mutation_p.T871M|DIAPH3_ENST00000465066.1_5'UTR|DIAPH3_ENST00000400319.1_Missense_Mutation_p.T847M|DIAPH3_ENST00000377908.2_Missense_Mutation_p.T906M|DIAPH3_ENST00000267215.4_Missense_Mutation_p.T917M|DIAPH3_ENST00000400330.1_Missense_Mutation_p.T917M	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	917	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		CTTTTCCAGCGTTTCTACAGA	0.388																																					p.T917M		.											.	DIAPH3	516	0			c.C2750T						.	G	MET/THR,MET/THR	0,3650		0,0,1825	74.0	68.0	70.0		2750,1961	-6.2	0.8	13		70	2,8166		0,2,4082	no	missense,missense	DIAPH3	NM_001042517.1,NM_030932.3	81,81	0,2,5907	AA,AG,GG		0.0245,0.0,0.0169	benign,benign	917/1194,654/850	60413570	2,11816	1825	4084	5909	SO:0001583	missense	81624	exon23			TCCAGCGTTTCTA	AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.2750C>T	13.37:g.60413570G>A	ENSP00000383178:p.Thr917Met	63.0	0.0		15.0	3.0	NM_001042517	A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Missense_Mutation	SNP	ENST00000400324.4	37	CCDS41898.1	.	.	.	.	.	.	.	.	.	.	G	8.049	0.765544	0.15914	0.0	2.45E-4	ENSG00000139734	ENST00000400324;ENST00000400330;ENST00000400327;ENST00000413168;ENST00000400329;ENST00000377908;ENST00000400319;ENST00000400320;ENST00000267215;ENST00000267214;ENST00000453990	T;T;T;T;T;T	0.18016	2.24;2.24;2.24;2.24;2.24;2.24	5.19	-6.22	0.02058	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.350989	0.32287	N	0.006302	T	0.09335	0.0230	L	0.41356	1.27	0.09310	N	0.999993	B;B	0.14438	0.01;0.01	B;B	0.16722	0.016;0.005	T	0.09707	-1.0662	10	0.44086	T	0.13	.	4.3785	0.11283	0.5374:0.0734:0.2513:0.1379	.	654;917	Q9NSV4-1;Q9NSV4	.;DIAP3_HUMAN	M	917;917;906;871;847;906;847;871;917;654;917	ENSP00000383178:T917M;ENSP00000383184:T917M;ENSP00000367141:T906M;ENSP00000383173:T847M;ENSP00000383174:T871M;ENSP00000267215:T917M	ENSP00000267214:T654M	T	-	2	0	DIAPH3	59311571	0.997000	0.39634	0.757000	0.31301	0.918000	0.54935	0.370000	0.20433	-1.372000	0.02137	-1.936000	0.00505	ACG	.		0.388	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045166.3	NM_001042517	
DMBT1	1755	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	124377713	124377713	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr10:124377713C>A	ENST00000338354.3	+	38	4791	c.4685C>A	c.(4684-4686)gCc>gAc	p.A1562D	DMBT1_ENST00000368956.2_Missense_Mutation_p.A934D|DMBT1_ENST00000344338.3_Missense_Mutation_p.A1552D|DMBT1_ENST00000330163.4_Missense_Mutation_p.A934D|DMBT1_ENST00000368955.3_Missense_Mutation_p.A1552D|DMBT1_ENST00000359586.6_Missense_Mutation_p.A413D|DMBT1_ENST00000368909.3_Missense_Mutation_p.A1562D			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	1562	SRCR 12. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CCAGGAAATGCCCAGTTTGGC	0.612																																					p.A1562D	Ovarian(182;93 2026 18125 22222 38972)	.											.	DMBT1	494	0			c.C4685A						.						160.0	164.0	163.0					10																	124377713		1960	4163	6123	SO:0001583	missense	1755	exon38			GAAATGCCCAGTT		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.4685C>A	10.37:g.124377713C>A	ENSP00000342210:p.Ala1562Asp	100.0	0.0		66.0	20.0	NM_007329	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37		.	.	.	.	.	.	.	.	.	.	C	16.99	3.272970	0.59649	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000359586	T;T;T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06	4.12	3.21	0.36854	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	1.760730	0.04550	U	0.389673	D	0.82719	0.5098	M	0.86028	2.79	0.37016	D	0.895959	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;0.999	D;D;D;D;D;D	0.91635	0.967;0.988;0.999;0.991;0.951;0.97	T	0.69495	-0.5130	10	0.72032	D	0.01	.	12.2281	0.54472	0.0:0.9153:0.0:0.0847	.	413;811;1691;934;1552;1562	F8WEF7;Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;DMBT1_HUMAN	D	1562;1691;1562;1562;1562;1562;934;1552;934;934;1562;1552;934;413	ENSP00000342210:A1562D;ENSP00000343175:A1552D;ENSP00000327747:A934D;ENSP00000357905:A1562D;ENSP00000357951:A1552D;ENSP00000357952:A934D;ENSP00000352593:A413D	ENSP00000331522:A934D	A	+	2	0	DMBT1	124367703	0.981000	0.34729	0.061000	0.19648	0.427000	0.31564	2.975000	0.49281	0.862000	0.35528	0.549000	0.68633	GCC	.		0.612	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
DNAAF3	352909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55670500	55670500	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:55670500T>C	ENST00000524407.2	-	12	1589	c.1556A>G	c.(1555-1557)gAg>gGg	p.E519G	TNNI3_ENST00000588882.1_5'Flank|CTD-2587H24.4_ENST00000587871.1_Intron|DNAAF3_ENST00000527223.2_Missense_Mutation_p.E586G|TNNI3_ENST00000590463.1_5'Flank|TNNI3_ENST00000344887.5_5'Flank|DNAAF3_ENST00000455045.1_Missense_Mutation_p.E465G|CTD-2587H24.5_ENST00000591665.1_RNA|DNAAF3_ENST00000391720.4_Missense_Mutation_p.E566G|DNAAF3_ENST00000587789.2_5'UTR			Q8N9W5	DAAF3_HUMAN	dynein, axonemal, assembly factor 3	519					axonemal dynein complex assembly (GO:0070286)|motile cilium assembly (GO:0044458)	cytoplasm (GO:0005737)											AGCCAGAACCTCTGAGAGTGA	0.617																																					p.E586G		.											.	.	.	0			c.A1757G						.						25.0	27.0	27.0					19																	55670500		1857	4113	5970	SO:0001583	missense	352909	exon12			AGAACCTCTGAGA	AK097388	CCDS12918.2, CCDS58679.1, CCDS58680.1, CCDS59422.1	19q13.42	2012-10-05	2012-03-09	2012-03-09	ENSG00000167646	ENSG00000167646			30492	protein-coding gene	gene with protein product		614566	"""chromosome 19 open reading frame 51"", ""ciliary dyskinesia, primary 2"""	C19orf51, CILD2		22387996	Standard	NM_001256714		Approved	FLJ40069, FLJ36139, PF22, PCD	uc002qjl.2	Q8N9W5	OTTHUMG00000128547	ENST00000524407.2:c.1556A>G	19.37:g.55670500T>C	ENSP00000432046:p.Glu519Gly	168.0	0.0		133.0	31.0	NM_001256714	A8MUY0|E3W9A1|E9PAX5|Q6P4F6|Q8N9W0|Q96AR2	Missense_Mutation	SNP	ENST00000524407.2	37	CCDS59422.1	.	.	.	.	.	.	.	.	.	.	t	12.02	1.813756	0.32053	.	.	ENSG00000167646	ENST00000301249;ENST00000455045;ENST00000391720	T;T	0.20069	2.13;2.1	3.77	2.71	0.32032	.	0.416306	0.17608	N	0.168190	T	0.16171	0.0389	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.33612	0.419;0.253;0.16;0.16	B;B;B;B	0.36244	0.22;0.128;0.128;0.128	T	0.15235	-1.0444	10	0.72032	D	0.01	-6.6568	8.6882	0.34251	0.0:0.0:0.1928:0.8072	.	586;465;539;519	E9PAX5;E3W9A1;Q8N9W5-3;Q8N9W5	.;.;.;CS051_HUMAN	G	586;465;566	ENSP00000394343:E465G;ENSP00000375600:E566G	ENSP00000301249:E586G	E	-	2	0	C19orf51	60362312	0.000000	0.05858	0.001000	0.08648	0.030000	0.12068	-0.064000	0.11636	0.776000	0.33473	0.454000	0.30748	GAG	.		0.617	DNAAF3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250388.5	NM_178837	
DNAH12	201625	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	57431862	57431862	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr3:57431862A>C	ENST00000351747.2	-	27	4186	c.4006T>G	c.(4006-4008)Ttt>Gtt	p.F1336V		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	1336	AAA 1. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						TCAAAAACAAACACAACCAAC	0.408																																					p.F1336V		.											.	DNAH12	47	0			c.T4006G						.						140.0	122.0	127.0					3																	57431862		692	1591	2283	SO:0001583	missense	201625	exon27			AAACAAACACAAC	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.4006T>G	3.37:g.57431862A>C	ENSP00000295937:p.Phe1336Val	214.0	1.0		182.0	43.0	NM_178504	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	ENST00000351747.2	37		.	.	.	.	.	.	.	.	.	.	A	20.2	3.951694	0.73787	.	.	ENSG00000174844	ENST00000351747;ENST00000495027	T;T	0.13778	2.56;2.56	5.81	5.81	0.92471	ATPase, AAA+ type, core (1);	.	.	.	.	T	0.41650	0.1168	M	0.81614	2.55	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.38542	-0.9656	9	0.87932	D	0	.	16.1616	0.81721	1.0:0.0:0.0:0.0	.	1336	Q6ZR08	DYH12_HUMAN	V	1336;1359	ENSP00000295937:F1336V;ENSP00000418137:F1359V	ENSP00000295937:F1336V	F	-	1	0	DNAH12	57406902	1.000000	0.71417	0.994000	0.49952	0.943000	0.58893	9.180000	0.94867	2.218000	0.71995	0.377000	0.23210	TTT	.		0.408	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
DSCR3	10311	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	38597864	38597864	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr21:38597864A>T	ENST00000309117.6	-	8	1112	c.875T>A	c.(874-876)cTg>cAg	p.L292Q	DSCR3_ENST00000288304.5_Missense_Mutation_p.L248Q|DSCR3_ENST00000476950.1_Missense_Mutation_p.L265Q|DSCR3_ENST00000399001.1_Missense_Mutation_p.L167Q|DSCR3_ENST00000398998.1_Missense_Mutation_p.L244Q|DSCR3_ENST00000399000.3_5'UTR|AP001432.14_ENST00000440629.1_lincRNA|DSCR3_ENST00000539844.1_Missense_Mutation_p.L215Q	NM_006052.1	NP_006043.1	O14972	DSCR3_HUMAN	Down syndrome critical region gene 3	292						nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	9						GCAGAGCTTCAGCGGGAAGTT	0.527																																					p.L292Q		.											.	DSCR3	90	0			c.T875A						.						82.0	75.0	78.0					21																	38597864		2203	4300	6503	SO:0001583	missense	10311	exon8			AGCTTCAGCGGGA	D87343	CCDS33553.1	21q22.2	2008-05-22			ENSG00000157538	ENSG00000157538			3044	protein-coding gene	gene with protein product		605298				9399594	Standard	NM_006052		Approved	DCRA	uc002ywf.1	O14972	OTTHUMG00000086659	ENST00000309117.6:c.875T>A	21.37:g.38597864A>T	ENSP00000311399:p.Leu292Gln	120.0	0.0		106.0	20.0	NM_006052	B2R6T8|B7Z6B1|D3DSH4|Q2TAY6	Missense_Mutation	SNP	ENST00000309117.6	37	CCDS33553.1	.	.	.	.	.	.	.	.	.	.	A	27.7	4.854712	0.91355	.	.	ENSG00000157538	ENST00000309117;ENST00000288304;ENST00000539844;ENST00000399001;ENST00000476950;ENST00000398998	.	.	.	4.99	4.99	0.66335	.	0.000000	0.64402	D	0.000002	T	0.77089	0.4079	M	0.70275	2.135	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;0.995;1.0	D;D;D;D	0.69142	0.931;0.962;0.947;0.927	T	0.80469	-0.1369	9	0.87932	D	0	-6.6983	14.973	0.71249	1.0:0.0:0.0:0.0	.	167;215;265;292	A8MY26;B7Z606;B7Z6B1;O14972	.;.;.;DSCR3_HUMAN	Q	292;248;215;167;265;244	.	ENSP00000288304:L248Q	L	-	2	0	DSCR3	37519734	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	8.338000	0.90038	2.001000	0.58596	0.533000	0.62120	CTG	.		0.527	DSCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194807.1		
DUOX2	50506	broad.mit.edu;bcgsc.ca	37	15	45393403	45393403	+	Splice_Site	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr15:45393403C>T	ENST00000603300.1	-	22	3123	c.2921G>A	c.(2920-2922)cGc>cAc	p.R974H	DUOX2_ENST00000389039.6_Splice_Site_p.R974H	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	974	Interaction with TXNDC11. {ECO:0000250}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		TCCTGCTCACCGCTCCCCAGG	0.527																																					p.R974H		.											.	DUOX2	95	0			c.G2921A						.						38.0	39.0	38.0					15																	45393403		2198	4298	6496	SO:0001630	splice_region_variant	50506	exon22			GCTCACCGCTCCC	AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.2921+1G>A	15.37:g.45393403C>T		133.0	1.0		105.0	7.0	NM_014080	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	ENST00000603300.1	37	CCDS10117.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.859751	0.51376	.	.	ENSG00000140279	ENST00000389039	.	.	.	4.91	3.98	0.46160	.	1.659270	0.02386	N	0.079251	T	0.59418	0.2192	L	0.47716	1.5	0.38484	D	0.947805	B	0.06786	0.001	B	0.06405	0.002	T	0.26087	-1.0113	8	.	.	.	-1.3347	10.8131	0.46559	0.1885:0.8115:0.0:0.0	.	974	Q9NRD8	DUOX2_HUMAN	H	974	.	.	R	-	2	0	DUOX2	43180695	0.982000	0.34865	0.590000	0.28732	0.045000	0.14185	3.306000	0.51881	1.409000	0.46915	0.609000	0.83330	CGC	.		0.527	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_014080	Missense_Mutation
EPB41L4A	64097	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	111600669	111600669	+	Missense_Mutation	SNP	C	C	A	rs370791654		TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr5:111600669C>A	ENST00000261486.5	-	6	754	c.478G>T	c.(478-480)Gta>Tta	p.V160L		NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A	160	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		TACTCAGATACATATCCTGCA	0.338																																					p.V160L		.											.	EPB41L4A	91	0			c.G478T						.						167.0	153.0	157.0					5																	111600669		1826	4095	5921	SO:0001583	missense	64097	exon6			CAGATACATATCC	AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000261486.5:c.478G>T	5.37:g.111600669C>A	ENSP00000261486:p.Val160Leu	75.0	0.0		85.0	13.0	NM_022140	A4FUI6	Missense_Mutation	SNP	ENST00000261486.5	37	CCDS43350.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.368726	0.82463	.	.	ENSG00000129595	ENST00000261486	T	0.68903	-0.36	5.46	5.46	0.80206	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.64402	D	0.000001	T	0.71409	0.3336	N	0.17723	0.515	0.40048	D	0.975742	D	0.89917	1.0	D	0.85130	0.997	T	0.71724	-0.4506	10	0.34782	T	0.22	.	18.0769	0.89430	0.0:1.0:0.0:0.0	.	160	Q9HCS5	E41LA_HUMAN	L	160	ENSP00000261486:V160L	ENSP00000261486:V160L	V	-	1	0	EPB41L4A	111628568	0.999000	0.42202	0.840000	0.33206	0.687000	0.40016	4.437000	0.59955	2.568000	0.86640	0.650000	0.86243	GTA	.		0.338	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370969.1		
ERCC1	2067	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	45924624	45924624	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:45924624T>C	ENST00000300853.3	-	3	724	c.133A>G	c.(133-135)Agc>Ggc	p.S45G	ERCC1_ENST00000423698.2_Intron|ERCC1_ENST00000013807.5_Missense_Mutation_p.S45G|ERCC1_ENST00000591636.1_Missense_Mutation_p.S45G|ERCC1_ENST00000340192.7_Missense_Mutation_p.S45G|ERCC1_ENST00000589165.1_Missense_Mutation_p.S45G	NM_001983.3	NP_001974.1	P07992	ERCC1_HUMAN	excision repair cross-complementation group 1	45					cell proliferation (GO:0008283)|chromosome organization (GO:0051276)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|male gonad development (GO:0008584)|mitotic recombination (GO:0006312)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|oogenesis (GO:0048477)|post-embryonic hemopoiesis (GO:0035166)|pyrimidine dimer repair by nucleotide-excision repair (GO:0000720)|replicative cell aging (GO:0001302)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to sucrose (GO:0009744)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)|syncytium formation (GO:0006949)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	cytoplasm (GO:0005737)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|single-stranded DNA binding (GO:0003697)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|skin(1)	15		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0247)		GTGGGAAGGCTCTGTGTAGAT	0.622								Nucleotide excision repair (NER)																													p.S45G		.											.	ERCC1	659	0			c.A133G						.						67.0	64.0	65.0					19																	45924624		2203	4300	6503	SO:0001583	missense	2067	exon3			GAAGGCTCTGTGT		CCDS12662.1, CCDS12663.1, CCDS54279.1	19q13.32	2014-03-07	2014-03-07			ENSG00000012061			3433	protein-coding gene	gene with protein product		126380	"""excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)"""			6462228	Standard	NM_001983		Approved	RAD10	uc002pbs.2	P07992		ENST00000300853.3:c.133A>G	19.37:g.45924624T>C	ENSP00000300853:p.Ser45Gly	74.0	0.0		74.0	10.0	NM_001983	B2RC01|B3KRR0|Q7Z7F5|Q96S40	Missense_Mutation	SNP	ENST00000300853.3	37	CCDS12662.1	.	.	.	.	.	.	.	.	.	.	T	11.47	1.649248	0.29336	.	.	ENSG00000012061	ENST00000300853;ENST00000340192;ENST00000013807	T;T;T	0.48522	0.84;0.83;0.81	4.25	3.21	0.36854	.	0.868449	0.10211	N	0.702162	T	0.31420	0.0796	N	0.24115	0.695	0.09310	N	1	B;B;B	0.26318	0.146;0.049;0.02	B;B;B	0.22152	0.038;0.016;0.016	T	0.19712	-1.0297	10	0.34782	T	0.22	-6.0974	6.72	0.23325	0.0:0.1103:0.0:0.8897	.	45;45;45	Q7Z7F5;Q96S40;P07992	.;.;ERCC1_HUMAN	G	45	ENSP00000300853:S45G;ENSP00000345203:S45G;ENSP00000013807:S45G	ENSP00000013807:S45G	S	-	1	0	ERCC1	50616464	0.519000	0.26242	0.009000	0.14445	0.068000	0.16541	1.701000	0.37825	0.753000	0.32945	0.402000	0.26972	AGC	.		0.622	ERCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459542.1	NM_001983	
EXO5	64789	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	40980542	40980542	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr1:40980542A>G	ENST00000372703.1	+	2	1400	c.326A>G	c.(325-327)gAg>gGg	p.E109G	EXO5_ENST00000296380.4_Missense_Mutation_p.E109G|RP11-656D10.5_ENST00000453437.1_RNA|RP11-656D10.6_ENST00000437060.1_RNA|EXO5_ENST00000358527.2_Missense_Mutation_p.E109G			Q9H790	EXO5_HUMAN	exonuclease 5	109					DNA catabolic process, exonucleolytic (GO:0000738)|interstrand cross-link repair (GO:0036297)	cytosol (GO:0005829)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|single-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008310)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)										TTGGCACCTGAGAAGGCAGCT	0.463																																					p.E109G		.											.	.	.	0			c.A326G						.						93.0	92.0	92.0					1																	40980542		2203	4300	6503	SO:0001583	missense	64789	exon3			CACCTGAGAAGGC	AK024797	CCDS453.1	1p34.2	2012-11-02	2012-10-30	2012-10-30	ENSG00000164002	ENSG00000164002			26115	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 176"", ""defects in morphology 1 homolog (S. cerevisiae)"""	C1orf176, DEM1		23095756	Standard	NM_022774		Approved	FLJ21144	uc001cfp.3	Q9H790	OTTHUMG00000007305	ENST00000372703.1:c.326A>G	1.37:g.40980542A>G	ENSP00000361788:p.Glu109Gly	73.0	0.0		58.0	6.0	NM_022774	D3DPV4|Q5SWM7|Q5SWM8|Q5SWM9|Q5SWN0|Q5SWN1|Q8WTW9	Missense_Mutation	SNP	ENST00000372703.1	37	CCDS453.1	.	.	.	.	.	.	.	.	.	.	A	15.68	2.904593	0.52333	.	.	ENSG00000164002	ENST00000358527;ENST00000372703;ENST00000420209;ENST00000296380;ENST00000418186;ENST00000415550;ENST00000443729;ENST00000419161	T;T;T;T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48;1.48;1.48;1.48	4.56	4.56	0.56223	.	0.102804	0.37393	N	0.002104	T	0.30572	0.0769	M	0.66297	2.02	0.35806	D	0.82347	B	0.30634	0.288	B	0.30105	0.111	T	0.36016	-0.9765	10	0.31617	T	0.26	.	10.6033	0.45379	1.0:0.0:0.0:0.0	.	109	Q9H790	EXO5_HUMAN	G	109	ENSP00000351328:E109G;ENSP00000361788:E109G;ENSP00000398437:E109G;ENSP00000296380:E109G;ENSP00000391240:E109G;ENSP00000413565:E109G;ENSP00000409715:E109G;ENSP00000392115:E109G	ENSP00000296380:E109G	E	+	2	0	DEM1	40753129	1.000000	0.71417	0.804000	0.32291	0.568000	0.35870	2.913000	0.48790	2.275000	0.75901	0.528000	0.53228	GAG	.		0.463	EXO5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019087.1	NM_022774	
EXOC3	11336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	464493	464493	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr5:464493A>G	ENST00000512944.1	+	10	1931	c.1742A>G	c.(1741-1743)aAc>aGc	p.N581S	EXOC3_ENST00000315013.5_Missense_Mutation_p.N581S|CTD-2228K2.5_ENST00000510714.1_5'Flank	NM_007277.4	NP_009208.2	O60645	EXOC3_HUMAN	exocyst complex component 3	592					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|secretory granule membrane (GO:0030667)				breast(2)|cervix(1)|endometrium(4)|large_intestine(1)|lung(13)|ovary(1)|urinary_tract(1)	23		Ovarian(839;0.0563)	Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			GACTATTTCAACGATTTTGCC	0.443																																					p.N581S		.											.	EXOC3	90	0			c.A1742G						.						147.0	149.0	149.0					5																	464493		1961	4130	6091	SO:0001583	missense	11336	exon10			ATTTCAACGATTT	BC034427	CCDS54830.1	5p15.33	2013-01-22	2005-11-01	2005-11-01	ENSG00000180104	ENSG00000180104			30378	protein-coding gene	gene with protein product		608186	"""SEC6-like 1 (S. cerevisiae)"""	SEC6L1		8619474	Standard	XM_005248238		Approved	Sec6p	uc003jba.3	O60645	OTTHUMG00000162205	ENST00000512944.1:c.1742A>G	5.37:g.464493A>G	ENSP00000425587:p.Asn581Ser	85.0	0.0		74.0	7.0	NM_007277	Q6P2E8|Q8TEN6|Q8WUW0|Q96DI4	Missense_Mutation	SNP	ENST00000512944.1	37	CCDS54830.1	.	.	.	.	.	.	.	.	.	.	A	15.15	2.748380	0.49257	.	.	ENSG00000180104	ENST00000512944;ENST00000315013;ENST00000340158	T;T	0.06608	3.28;3.28	4.92	3.75	0.43078	.	0.046651	0.85682	N	0.000000	T	0.05456	0.0144	L	0.45137	1.4	0.58432	D	0.999999	B	0.02656	0.0	B	0.12156	0.007	T	0.21484	-1.0244	10	0.07813	T	0.8	-28.488	9.0643	0.36453	0.911:0.0:0.089:0.0	.	592	O60645	EXOC3_HUMAN	S	581;581;476	ENSP00000425587:N581S;ENSP00000323377:N581S	ENSP00000323377:N581S	N	+	2	0	EXOC3	517493	1.000000	0.71417	0.845000	0.33349	0.611000	0.37282	4.533000	0.60615	0.829000	0.34733	0.533000	0.62120	AAC	.		0.443	EXOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367882.1	NM_007277	
FNDC7	163479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	109273448	109273448	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr1:109273448C>T	ENST00000370017.3	+	9	2054	c.1777C>T	c.(1777-1779)Ctc>Ttc	p.L593F	FNDC7_ENST00000271311.2_Missense_Mutation_p.L594F	NM_001144937.1	NP_001138409.1	Q5VTL7	FNDC7_HUMAN	fibronectin type III domain containing 7	593	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|skin(4)|stomach(1)|urinary_tract(1)	20		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)		AAACCACTGCCTCCTAGGATG	0.468																																					p.L593F		.											.	FNDC7	92	0			c.C1777T						.						166.0	132.0	144.0					1																	109273448		2203	4300	6503	SO:0001583	missense	163479	exon9			CACTGCCTCCTAG		CCDS44185.1	1p13.3	2013-02-11			ENSG00000143107	ENSG00000143107		"""Fibronectin type III domain containing"""	26668	protein-coding gene	gene with protein product						12477932	Standard	NM_001144937		Approved	FLJ35838	uc001dvx.3	Q5VTL7	OTTHUMG00000011120	ENST00000370017.3:c.1777C>T	1.37:g.109273448C>T	ENSP00000359034:p.Leu593Phe	106.0	0.0		98.0	18.0	NM_001144937	A1L468|E9PAZ5|Q6PF16|Q8NA51	Missense_Mutation	SNP	ENST00000370017.3	37	CCDS44185.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.1|20.1	3.935704|3.935704	0.73442|0.73442	.|.	.|.	ENSG00000143107|ENSG00000143107	ENST00000370017;ENST00000271311|ENST00000445274	D;D|.	0.99051|.	-5.37;-5.37|.	6.05|6.05	3.97|3.97	0.46021|0.46021	Fibronectin, type III (3);|.	0.195956|.	0.46442|.	D|.	0.000290|.	T|T	0.63105|0.63105	0.2483|0.2483	M|M	0.63843|0.63843	1.955|1.955	0.46279|0.46279	D|D	0.998968|0.998968	D;D|.	0.58620|.	0.983;0.969|.	P;P|.	0.59595|.	0.86;0.73|.	T|T	0.64685|0.64685	-0.6349|-0.6349	10|5	0.44086|.	T|.	0.13|.	-16.7176|-16.7176	16.7121|16.7121	0.85388|0.85388	0.2468:0.7532:0.0:0.0|0.2468:0.7532:0.0:0.0	.|.	594;593|.	Q5VTL7;E9PAZ5|.	FNDC7_HUMAN;.|.	F|L	593;594|368	ENSP00000359034:L593F;ENSP00000271311:L594F|.	ENSP00000271311:L594F|.	L|P	+|+	1|2	0|0	FNDC7|FNDC7	109074971|109074971	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.941000|0.941000	0.58515|0.58515	5.661000|5.661000	0.68025|0.68025	1.530000|1.530000	0.49136|0.49136	0.655000|0.655000	0.94253|0.94253	CTC|CCT	.		0.468	FNDC7-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030589.4	NM_173532	
FOLR4	390243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	94040391	94040391	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr11:94040391G>A	ENST00000440961.2	+	3	432	c.388G>A	c.(388-390)Gag>Aag	p.E130K		NM_001199206.1	NP_001186135.1	A6ND01	JUNO_HUMAN	folate receptor 4, delta (putative)	137					cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14						GGAGGACTGTGAGGAGTGGTG	0.567																																					p.E137K		.											.	FOLR4	23	0			c.G409A						.						102.0	110.0	108.0					11																	94040391		2195	4292	6487	SO:0001583	missense	390243	exon3			GACTGTGAGGAGT			11q14	2014-07-23	2012-12-07		ENSG00000183560	ENSG00000183560			32565	protein-coding gene	gene with protein product		615737	"""folate receptor 4 (delta) homolog (mouse)"""			11111049, 24739963	Standard	NM_001199206		Approved	Folbp3, JUNO	uc021qou.1	A6ND01		ENST00000440961.2:c.388G>A	11.37:g.94040391G>A	ENSP00000416935:p.Glu130Lys	162.0	0.0		112.0	12.0	NM_001199206		Missense_Mutation	SNP	ENST00000440961.2	37		.	.	.	.	.	.	.	.	.	.	G	17.51	3.406533	0.62399	.	.	ENSG00000183560	ENST00000440961	T	0.76316	-1.01	4.67	1.75	0.24633	.	0.501919	0.22175	N	0.063598	T	0.74854	0.3771	M	0.77313	2.365	0.09310	N	1	P	0.40553	0.721	B	0.42030	0.373	T	0.66356	-0.5944	10	0.49607	T	0.09	-13.7692	5.5608	0.17142	0.1814:0.0:0.6554:0.1633	.	130	A6ND01-2	.	K	130	ENSP00000416935:E130K	ENSP00000416935:E130K	E	+	1	0	FOLR4	93680039	0.985000	0.35326	0.877000	0.34402	0.990000	0.78478	2.373000	0.44266	0.681000	0.31386	0.491000	0.48974	GAG	.		0.567	FOLR4-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000396420.1	NM_001080486	
FOXL1	2300	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	86612389	86612389	+	Silent	SNP	G	G	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr16:86612389G>C	ENST00000320241.3	+	1	275	c.60G>C	c.(58-60)ctG>ctC	p.L20L		NM_005250.2	NP_005241.1	Q12952	FOXL1_HUMAN	forkhead box L1	20					heart development (GO:0007507)|multicellular organismal development (GO:0007275)|organ morphogenesis (GO:0009887)|Peyer's patch morphogenesis (GO:0061146)|proteoglycan biosynthetic process (GO:0030166)|regulation of Wnt signaling pathway (GO:0030111)|transcription, DNA-templated (GO:0006351)|visceral mesoderm-endoderm interaction involved in midgut development (GO:0007495)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(2)|prostate(3)|skin(1)|urinary_tract(1)	15						TGCTGTATCTGTACGGTCCCG	0.706																																					p.L20L	NSCLC(163;308 2020 10889 11476 18208)	.											.	FOXL1	227	0			c.G60C						.						35.0	39.0	38.0					16																	86612389		2195	4295	6490	SO:0001819	synonymous_variant	2300	exon1			GTATCTGTACGGT	AF315075	CCDS10959.1	16q24	2014-07-15			ENSG00000176678	ENSG00000176678		"""Forkhead boxes"""	3817	protein-coding gene	gene with protein product		603252		FKHL11		7957066	Standard	NM_005250		Approved	FREAC7, FKH6	uc002fjr.3	Q12952	OTTHUMG00000137653	ENST00000320241.3:c.60G>C	16.37:g.86612389G>C		115.0	0.0		96.0	11.0	NM_005250	Q17RR1|Q9H242	Silent	SNP	ENST00000320241.3	37	CCDS10959.1																																																																																			.		0.706	FOXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269105.2	NM_005250	
FOXRED2	80020	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	36892113	36892113	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr22:36892113C>A	ENST00000397224.4	-	7	1618	c.1525G>T	c.(1525-1527)Gac>Tac	p.D509Y	FOXRED2_ENST00000366463.3_Missense_Mutation_p.D61Y|FOXRED2_ENST00000397223.4_Missense_Mutation_p.D509Y|FOXRED2_ENST00000216187.6_Missense_Mutation_p.D509Y	NM_001102371.1	NP_001095841.1	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing 2	509					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum lumen (GO:0005788)	flavin adenine dinucleotide binding (GO:0050660)|glycoprotein binding (GO:0001948)|oxidoreductase activity (GO:0016491)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						AAGAAGACGTCCTTGTCGGGG	0.527																																					p.D509Y		.											.	FOXRED2	92	0			c.G1525T						.						104.0	102.0	103.0					22																	36892113		2203	4300	6503	SO:0001583	missense	80020	exon7			AGACGTCCTTGTC	BC027716	CCDS13929.1	22q12.3	2006-07-05			ENSG00000100350	ENSG00000100350			26264	protein-coding gene	gene with protein product		613777				12477932	Standard	NM_024955		Approved	FLJ23322	uc003app.4	Q8IWF2	OTTHUMG00000044614	ENST00000397224.4:c.1525G>T	22.37:g.36892113C>A	ENSP00000380401:p.Asp509Tyr	166.0	1.0		126.0	16.0	NM_001102371	B2RDI4|Q8N378|Q96BD1|Q9H5L5|Q9H6M8	Missense_Mutation	SNP	ENST00000397224.4	37	CCDS13929.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.717630	0.89205	.	.	ENSG00000100350	ENST00000397224;ENST00000216187;ENST00000366463;ENST00000397223	T;T;T;T	0.74421	1.32;1.32;-0.84;1.32	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.88596	0.6479	M	0.87547	2.89	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90288	0.4320	10	0.87932	D	0	-45.4929	19.1661	0.93559	0.0:1.0:0.0:0.0	.	509	Q8IWF2	FXRD2_HUMAN	Y	509;509;61;509	ENSP00000380401:D509Y;ENSP00000216187:D509Y;ENSP00000382543:D61Y;ENSP00000380400:D509Y	ENSP00000216187:D509Y	D	-	1	0	FOXRED2	35222059	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	4.021000	0.57196	2.527000	0.85204	0.650000	0.86243	GAC	.		0.527	FOXRED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104098.2	NM_024955	
FPR1	2357	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	52249985	52249985	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:52249985C>A	ENST00000595042.1	-	3	404	c.263G>T	c.(262-264)gGa>gTa	p.G88V	FPR1_ENST00000304748.4_Missense_Mutation_p.G88V	NM_001193306.1	NP_001180235.1	P21462	FPR1_HUMAN	formyl peptide receptor 1	88					activation of MAPK activity (GO:0000187)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|nitric oxide mediated signal transduction (GO:0007263)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)|receptor activity (GO:0004872)			endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(3)	20		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00106)|OV - Ovarian serous cystadenocarcinoma(262;0.018)	Nedocromil(DB00716)	CCAATGTCCTCCCATGGCCTT	0.507																																					p.G88V		.											.	FPR1	524	0			c.G263T						.						137.0	105.0	116.0					19																	52249985		2203	4300	6503	SO:0001583	missense	2357	exon3			TGTCCTCCCATGG	M60627	CCDS12839.1	19q13.41	2014-09-17				ENSG00000171051		"""GPCR / Class A : Formyl peptide receptors"""	3826	protein-coding gene	gene with protein product		136537				2161213, 12595898	Standard	NM_001193306		Approved	FPR, FMLP	uc002pxq.3	P21462		ENST00000595042.1:c.263G>T	19.37:g.52249985C>A	ENSP00000471493:p.Gly88Val	204.0	0.0		183.0	35.0	NM_001193306	Q14939|Q7Z6A4|Q86U52|Q9NS48	Missense_Mutation	SNP	ENST00000595042.1	37	CCDS12839.1	.	.	.	.	.	.	.	.	.	.	.	7.804	0.714234	0.15306	.	.	ENSG00000171051	ENST00000304748	T	0.37058	1.22	3.72	2.68	0.31781	GPCR, rhodopsin-like superfamily (1);	0.745223	0.12330	N	0.478436	T	0.44244	0.1284	L	0.58810	1.83	0.40445	D	0.980084	P	0.37276	0.589	P	0.50896	0.653	T	0.26916	-1.0089	10	0.27785	T	0.31	.	6.5403	0.22377	0.0:0.7644:0.0:0.2356	.	88	P21462	FPR1_HUMAN	V	88	ENSP00000302707:G88V	ENSP00000302707:G88V	G	-	2	0	FPR1	56941797	0.000000	0.05858	0.002000	0.10522	0.031000	0.12232	-0.015000	0.12634	0.844000	0.35094	0.563000	0.77884	GGA	.		0.507	FPR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466905.1	NM_002029	
GALR1	2587	broad.mit.edu;mdanderson.org	37	18	74962595	74962595	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr18:74962595G>A	ENST00000299727.3	+	1	91	c.91G>A	c.(91-93)Gtg>Atg	p.V31M		NM_001480.3	NP_001471.2	P47211	GALR1_HUMAN	galanin receptor 1	31					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|digestion (GO:0007586)|negative regulation of adenylate cyclase activity (GO:0007194)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galanin receptor activity (GO:0004966)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		CGGCATCGGCGTGGAGAACTT	0.716																																					p.V31M		.											.	GALR1	522	0			c.G91A						.						15.0	15.0	15.0					18																	74962595		2198	4298	6496	SO:0001583	missense	2587	exon1			ATCGGCGTGGAGA	U90658	CCDS12012.1	18q23	2012-08-08			ENSG00000166573	ENSG00000166573		"""GPCR / Class A : Galanin receptors"""	4132	protein-coding gene	gene with protein product		600377		GALNR1, GALNR		7524088	Standard	NM_001480		Approved		uc002lms.4	P47211	OTTHUMG00000132875	ENST00000299727.3:c.91G>A	18.37:g.74962595G>A	ENSP00000299727:p.Val31Met	44.0	0.0		40.0	7.0	NM_001480	Q4VBL7	Missense_Mutation	SNP	ENST00000299727.3	37	CCDS12012.1	.	.	.	.	.	.	.	.	.	.	G	16.66	3.185559	0.57909	.	.	ENSG00000166573	ENST00000299727	T	0.38077	1.16	4.76	3.66	0.41972	.	0.164731	0.38436	N	0.001692	T	0.26846	0.0657	L	0.40543	1.245	0.33326	D	0.567984	P	0.50156	0.932	B	0.42386	0.386	T	0.40534	-0.9558	10	0.49607	T	0.09	.	5.8926	0.18921	0.3057:0.0:0.6943:0.0	.	31	P47211	GALR1_HUMAN	M	31	ENSP00000299727:V31M	ENSP00000299727:V31M	V	+	1	0	GALR1	73091583	1.000000	0.71417	0.999000	0.59377	0.645000	0.38454	1.850000	0.39328	2.192000	0.70111	0.585000	0.79938	GTG	.		0.716	GALR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256362.1		
GDF2	2658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	48413759	48413759	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr10:48413759G>A	ENST00000249598.1	-	2	1268	c.1109C>T	c.(1108-1110)cCg>cTg	p.P370L		NM_016204.1	NP_057288.1	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	370					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to BMP stimulus (GO:0071773)|growth (GO:0040007)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of DNA replication (GO:0008156)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	28						GTGTTTCGTCGGCGTCACATC	0.587																																					p.P370L		.											.	GDF2	229	0			c.C1109T						.						128.0	105.0	113.0					10																	48413759		2203	4300	6503	SO:0001583	missense	2658	exon2			TTCGTCGGCGTCA	AF156891	CCDS73118.1	10q11.22	2014-05-06			ENSG00000128802	ENSG00000263761		"""Endogenous ligands"""	4217	protein-coding gene	gene with protein product		605120				10849432	Standard	NM_016204		Approved	BMP-9, BMP9	uc001jfa.1	Q9UK05	OTTHUMG00000188320	ENST00000249598.1:c.1109C>T	10.37:g.48413759G>A	ENSP00000249598:p.Pro370Leu	162.0	0.0		141.0	18.0	NM_016204	Q5VSQ9|Q9Y571	Missense_Mutation	SNP	ENST00000249598.1	37	CCDS7219.1	.	.	.	.	.	.	.	.	.	.	G	19.05	3.752802	0.69648	.	.	ENSG00000128802	ENST00000249598	D	0.88046	-2.33	5.62	5.62	0.85841	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.94115	0.8113	M	0.83012	2.62	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94522	0.7728	10	0.87932	D	0	.	18.6283	0.91349	0.0:0.0:1.0:0.0	.	370	Q9UK05	GDF2_HUMAN	L	370	ENSP00000249598:P370L	ENSP00000249598:P370L	P	-	2	0	GDF2	48033765	1.000000	0.71417	0.336000	0.25522	0.329000	0.28539	9.710000	0.98732	2.652000	0.90054	0.585000	0.79938	CCG	.		0.587	GDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047891.1	NM_016204	
GLG1	2734	ucsc.edu;bcgsc.ca	37	16	74496078	74496078	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr16:74496078A>G	ENST00000422840.2	-	22	2949	c.2950T>C	c.(2950-2952)Tgt>Cgt	p.C984R	GLG1_ENST00000205061.5_Missense_Mutation_p.C984R|Y_RNA_ENST00000384794.1_RNA|GLG1_ENST00000447066.2_Missense_Mutation_p.C973R	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	984					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						TGGTCTTCACAGTCTGAAGAC	0.498																																					p.C984R		.											.	GLG1	136	0			c.T2950C						.						64.0	62.0	63.0					16																	74496078		2198	4300	6498	SO:0001583	missense	2734	exon22			CTTCACAGTCTGA		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.2950T>C	16.37:g.74496078A>G	ENSP00000405984:p.Cys984Arg	55.0	0.0		40.0	4.0	NM_001145667	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	ENST00000422840.2	37	CCDS45527.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.969041	0.74131	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.79851	0.4517	M	0.76838	2.35	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	T	0.82625	-0.0365	9	0.87932	D	0	-19.3496	15.8829	0.79216	1.0:0.0:0.0:0.0	.	114;984;984;973	Q6ZMF1;Q92896;Q92896-2;B7Z8Y4	.;GSLG1_HUMAN;.;.	R	984;973;984	.	ENSP00000205061:C984R	C	-	1	0	GLG1	73053579	1.000000	0.71417	1.000000	0.80357	0.582000	0.36321	9.339000	0.96797	2.155000	0.67459	0.482000	0.46254	TGT	.		0.498	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201	
GLTSCR2	29997	broad.mit.edu;bcgsc.ca	37	19	48257974	48257974	+	Silent	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:48257974A>G	ENST00000246802.5	+	8	917	c.879A>G	c.(877-879)acA>acG	p.T293T	CTD-2571L23.6_ENST00000602048.1_RNA|GLTSCR2_ENST00000598681.1_3'UTR|SNORD23_ENST00000408876.1_RNA	NM_015710.4	NP_056525.2	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2	293						intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	15		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		AGGAGTCCACATTCCAGGAGC	0.726																																					p.T293T	Colon(58;613 1041 9473 10089 15241)	.											.	GLTSCR2	514	0			c.A879G						.						8.0	11.0	10.0					19																	48257974		2047	3971	6018	SO:0001819	synonymous_variant	29997	exon8			GTCCACATTCCAG	AF182076	CCDS12705.1	19q13.3	2014-01-20				ENSG00000105373			4333	protein-coding gene	gene with protein product		605691				10708517, 16971513, 17657248	Standard	NM_015710		Approved	PICT-1	uc002phm.2	Q9NZM5		ENST00000246802.5:c.879A>G	19.37:g.48257974A>G		94.0	0.0		97.0	7.0	NM_015710	Q9BTC6|Q9HAX6|Q9NPP1|Q9NPR4|Q9UFI2	Silent	SNP	ENST00000246802.5	37	CCDS12705.1																																																																																			.		0.726	GLTSCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464870.1	NM_015710	
GOLGA3	2802	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	133384623	133384623	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr12:133384623C>A	ENST00000450791.2	-	4	1215	c.1032G>T	c.(1030-1032)atG>atT	p.M344I	GOLGA3_ENST00000456883.2_Missense_Mutation_p.M344I|GOLGA3_ENST00000537452.1_Missense_Mutation_p.M344I|GOLGA3_ENST00000545875.1_Missense_Mutation_p.M344I|GOLGA3_ENST00000204726.3_Missense_Mutation_p.M344I			Q08378	GOGA3_HUMAN	golgin A3	344					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GGCCGTTGACCATATAGGGGG	0.612																																					p.M344I		.											.	GOLGA3	95	0			c.G1032T						.						90.0	77.0	81.0					12																	133384623		2203	4300	6503	SO:0001583	missense	2802	exon5			GTTGACCATATAG	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.1032G>T	12.37:g.133384623C>A	ENSP00000410378:p.Met344Ile	124.0	0.0		103.0	30.0	NM_001172557	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	ENST00000450791.2	37	CCDS9281.1	.	.	.	.	.	.	.	.	.	.	c	1.100	-0.661288	0.03454	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58	5.73	4.83	0.62350	.	0.618093	0.17067	N	0.188325	T	0.19846	0.0477	L	0.36672	1.1	0.33105	D	0.539808	B;B;B	0.10296	0.003;0.001;0.002	B;B;B	0.11329	0.006;0.006;0.003	T	0.17623	-1.0363	10	0.21014	T	0.42	.	3.9634	0.09421	0.2206:0.6184:0.0:0.161	.	344;344;344	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	I	344	ENSP00000204726:M344I;ENSP00000410378:M344I;ENSP00000409303:M344I;ENSP00000442143:M344I;ENSP00000442603:M344I	ENSP00000204726:M344I	M	-	3	0	GOLGA3	131894696	0.964000	0.33143	0.048000	0.18961	0.006000	0.05464	0.276000	0.18716	2.707000	0.92482	0.645000	0.84053	ATG	.		0.612	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	NM_005895	
GPATCH8	23131	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	42475028	42475028	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr17:42475028C>A	ENST00000591680.1	-	8	4447	c.4417G>T	c.(4417-4419)Gca>Tca	p.A1473S	GPATCH8_ENST00000434000.1_Missense_Mutation_p.A1395S	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	1473	Poly-Ala.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		GCAGCTGCTGCAGCAGGCCGT	0.612																																					p.A1473S		.											.	GPATCH8	94	0			c.G4417T						.						70.0	61.0	64.0					17																	42475028		2203	4300	6503	SO:0001583	missense	23131	exon8			CTGCTGCAGCAGG	AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.4417G>T	17.37:g.42475028C>A	ENSP00000467556:p.Ala1473Ser	225.0	1.0		152.0	30.0	NM_001002909	B9EGP9|O60300|Q8TB99	Missense_Mutation	SNP	ENST00000591680.1	37	CCDS32666.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.701840	0.48307	.	.	ENSG00000186566	ENST00000335500;ENST00000434000	T	0.17528	2.27	5.34	4.37	0.52481	.	0.000000	0.85682	D	0.000000	T	0.15955	0.0384	L	0.50333	1.59	0.49483	D	0.999795	P	0.42908	0.793	B	0.38842	0.283	T	0.02860	-1.1101	10	0.34782	T	0.22	-6.5306	10.7232	0.46052	0.0:0.8437:0.0:0.1563	.	1473	Q9UKJ3	GPTC8_HUMAN	S	1473;1395	ENSP00000395016:A1395S	ENSP00000335486:A1473S	A	-	1	0	GPATCH8	39830554	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	4.511000	0.60462	1.265000	0.44215	0.313000	0.20887	GCA	.		0.612	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457797.1	NM_001002909	
GPR158	57512	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	25861801	25861801	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr10:25861801T>A	ENST00000376351.3	+	7	2097	c.1738T>A	c.(1738-1740)Tac>Aac	p.Y580N		NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	580					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						CCGCTGGGACTACATGACAGC	0.423																																					p.Y580N		.											.	GPR158	141	0			c.T1738A						.						132.0	104.0	114.0					10																	25861801		2203	4300	6503	SO:0001583	missense	57512	exon7			TGGGACTACATGA	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.1738T>A	10.37:g.25861801T>A	ENSP00000365529:p.Tyr580Asn	201.0	0.0		102.0	17.0	NM_020752	Q6QR81|Q9ULT3	Missense_Mutation	SNP	ENST00000376351.3	37	CCDS31166.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.625518	0.87560	.	.	ENSG00000151025	ENST00000376351	D	0.88354	-2.37	5.67	5.67	0.87782	GPCR, family 3, C-terminal (2);	0.098369	0.44483	D	0.000447	D	0.94909	0.8354	M	0.85542	2.76	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95517	0.8591	10	0.72032	D	0.01	.	15.9002	0.79369	0.0:0.0:0.0:1.0	.	580	Q5T848	GP158_HUMAN	N	580	ENSP00000365529:Y580N	ENSP00000365529:Y580N	Y	+	1	0	GPR158	25901807	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.040000	0.89188	2.161000	0.67846	0.455000	0.32223	TAC	.		0.423	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110	
GRAMD3	65983	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	125821443	125821443	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr5:125821443A>G	ENST00000285689.3	+	11	1497	c.1036A>G	c.(1036-1038)Att>Gtt	p.I346V	GRAMD3_ENST00000544396.1_Missense_Mutation_p.I242V|GRAMD3_ENST00000542322.1_Missense_Mutation_p.I354V|RP11-517I3.1_ENST00000515808.1_RNA|GRAMD3_ENST00000515200.1_Missense_Mutation_p.I324V|GRAMD3_ENST00000543198.1_Missense_Mutation_p.I324V|RP11-517I3.1_ENST00000512500.1_RNA|GRAMD3_ENST00000502348.1_Missense_Mutation_p.I237V|GRAMD3_ENST00000513040.1_Missense_Mutation_p.I361V|GRAMD3_ENST00000511134.1_Missense_Mutation_p.I330V	NM_023927.2	NP_076416.2	Q96HH9	GRAM3_HUMAN	GRAM domain containing 3	346						cytoplasmic microtubule (GO:0005881)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)		GCTTCACCATATTCTTATATT	0.348																																					p.I361V		.											.	GRAMD3	90	0			c.A1081G						.						121.0	110.0	114.0					5																	125821443		2203	4300	6503	SO:0001583	missense	65983	exon11			CACCATATTCTTA	BC008590	CCDS4136.1, CCDS54891.1, CCDS54892.1, CCDS54893.1, CCDS54894.1	5q23.2	2014-02-12	2005-11-03		ENSG00000155324	ENSG00000155324			24911	protein-coding gene	gene with protein product	"""HCV NS3 transactivated protein 2"""					12477932	Standard	NM_023927		Approved	NS3TP2, FLJ21313	uc011cwt.2	Q96HH9	OTTHUMG00000128943	ENST00000285689.3:c.1036A>G	5.37:g.125821443A>G	ENSP00000285689:p.Ile346Val	52.0	0.0		39.0	6.0	NM_001146319	B7Z1F2|B7Z3R1|B7Z6D8|B7Z8T2|D3DSZ3|Q9H753	Missense_Mutation	SNP	ENST00000285689.3	37	CCDS4136.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.38|10.38	1.334276|1.334276	0.24253|0.24253	.|.	.|.	ENSG00000155324|ENSG00000155324	ENST00000543367|ENST00000513040;ENST00000285689;ENST00000515200;ENST00000542322;ENST00000544396;ENST00000543198;ENST00000502348;ENST00000511134	.|T;T;T;T;T;T;T;T	.|0.34472	.|1.36;1.38;1.43;1.38;1.47;1.45;1.47;1.42	5.94|5.94	3.53|3.53	0.40419|0.40419	.|.	0.227191|0.227191	0.45126|0.45126	D|N	0.000396|0.000396	T|T	0.31918|0.31918	0.0812|0.0812	M|M	0.65975|0.65975	2.015|2.015	0.33672|0.33672	D|D	0.611053|0.611053	.|B;B;B;B;B	.|0.28900	.|0.151;0.028;0.145;0.227;0.151	.|B;B;B;B;B	.|0.27887	.|0.036;0.015;0.026;0.084;0.036	T|T	0.35943|0.35943	-0.9768|-0.9768	7|10	0.42905|0.22109	T|T	0.14|0.4	.|.	7.5781|7.5781	0.27948|0.27948	0.7867:0.1415:0.0719:0.0|0.7867:0.1415:0.0719:0.0	.|.	.|330;242;354;361;346	.|B7Z8T2;B7Z1F2;B7Z3R1;B7Z6D8;Q96HH9	.|.;.;.;.;GRAM3_HUMAN	M|V	281|361;346;324;354;242;324;237;330	.|ENSP00000426120:I361V;ENSP00000285689:I346V;ENSP00000426143:I324V;ENSP00000441876:I354V;ENSP00000444049:I242V;ENSP00000442902:I324V;ENSP00000427596:I237V;ENSP00000426088:I330V	ENSP00000445954:I281M|ENSP00000285689:I346V	I|I	+|+	3|1	3|0	GRAMD3|GRAMD3	125849342|125849342	0.662000|0.662000	0.27439|0.27439	0.997000|0.997000	0.53966|0.53966	0.256000|0.256000	0.26092|0.26092	0.989000|0.989000	0.29629|0.29629	0.487000|0.487000	0.27698|0.27698	-0.379000|-0.379000	0.06801|0.06801	ATA|ATT	.		0.348	GRAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250922.2	NM_023927	
GRM4	2914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	34029743	34029743	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr6:34029743T>A	ENST00000538487.2	-	4	1242	c.799A>T	c.(799-801)Aag>Tag	p.K267*	GRM4_ENST00000535756.1_Nonsense_Mutation_p.K134*|GRM4_ENST00000609222.1_Nonsense_Mutation_p.K134*|GRM4_ENST00000374181.4_Nonsense_Mutation_p.K267*|GRM4_ENST00000545715.1_5'UTR|GRM4_ENST00000544773.2_Nonsense_Mutation_p.K98*|GRM4_ENST00000455714.2_Nonsense_Mutation_p.K127*|GRM4_ENST00000374177.3_Nonsense_Mutation_p.K198*	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	267					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CGGATGATCTTGTCGAACTCG	0.637																																					p.K267X		.											.	GRM4	525	0			c.A799T						.						138.0	118.0	125.0					6																	34029743		2203	4300	6503	SO:0001587	stop_gained	2914	exon4			TGATCTTGTCGAA	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.799A>T	6.37:g.34029743T>A	ENSP00000440556:p.Lys267*	214.0	0.0		170.0	55.0	NM_001256811	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Nonsense_Mutation	SNP	ENST00000538487.2	37	CCDS4787.1	.	.	.	.	.	.	.	.	.	.	T	37	6.533798	0.97641	.	.	ENSG00000124493	ENST00000374181;ENST00000374177;ENST00000535756;ENST00000544773;ENST00000538487;ENST00000455714	.	.	.	4.01	4.01	0.46588	.	0.145987	0.45126	D	0.000398	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.9967	0.58650	0.0:0.0:0.0:1.0	.	.	.	.	X	267;198;134;98;267;127	.	ENSP00000363292:K198X	K	-	1	0	GRM4	34137721	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	7.790000	0.85794	1.799000	0.52666	0.433000	0.28618	AAG	.		0.637	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2		
HNF1A	6927	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	121432040	121432040	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr12:121432040C>G	ENST00000257555.6	+	4	1013	c.787C>G	c.(787-789)Cgt>Ggt	p.R263G	HNF1A_ENST00000543427.1_Missense_Mutation_p.R146G|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000544413.1_Missense_Mutation_p.R263G|HNF1A_ENST00000402929.1_Missense_Mutation_p.R263G|HNF1A_ENST00000400024.2_Missense_Mutation_p.R263G|HNF1A_ENST00000541395.1_Missense_Mutation_p.R263G			P20823	HNF1A_HUMAN	HNF1 homeobox A	263	Interaction with DNA.		R -> C (in MODY3; expected to interfere with DNA binding). {ECO:0000269|PubMed:9287053}.		glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.R263C(2)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CACGGAGGTGCGTGTCTACAA	0.647									Hepatic Adenoma, Familial Clustering of																												p.R263G		.											HNF1A,NS,other,0	HNF1A	1745	2	Substitution - Missense(2)	liver(2)	c.C787G	GRCh37	CM971458	HNF1A	M		.						41.0	40.0	40.0					12																	121432040		2203	4300	6503	SO:0001583	missense	6927	exon4	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	GAGGTGCGTGTCT	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.787C>G	12.37:g.121432040C>G	ENSP00000257555:p.Arg263Gly	111.0	0.0		61.0	5.0	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	ENST00000257555.6	37	CCDS9209.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.316878	0.81469	.	.	ENSG00000135100	ENST00000257555;ENST00000543536;ENST00000544680;ENST00000537424;ENST00000543427;ENST00000545458;ENST00000541395;ENST00000340577;ENST00000344370;ENST00000544413	D;D;D;D	0.96041	-3.89;-3.89;-3.89;-3.89	4.84	4.84	0.62591	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.64402	D	0.000003	D	0.96747	0.8938	L	0.60455	1.87	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;0.997	D;D;D;D	0.81914	0.994;0.995;0.988;0.983	D	0.97136	0.9821	10	0.87932	D	0	-10.9955	13.6154	0.62105	0.1555:0.8445:0.0:0.0	.	263;263;263;263	F5H0K0;P20823;E7EUQ4;E7EMR0	.;HNF1A_HUMAN;.;.	G	263;263;263;263;146;263;263;263;263;263	ENSP00000257555:R263G;ENSP00000439721:R146G;ENSP00000443112:R263G;ENSP00000438804:R263G	ENSP00000257555:R263G	R	+	1	0	HNF1A	119916423	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.985000	0.49362	2.245000	0.73994	0.409000	0.27619	CGT	.		0.647	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
HNRNPCL1	343069	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	12907411	12907411	+	Silent	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr1:12907411T>C	ENST00000317869.6	-	2	957	c.732A>G	c.(730-732)gcA>gcG	p.A244A		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	244						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						CAGAGTCTTCTGCACCCCCCT	0.488																																					p.A244A		.											.	HNRNPCL1	68	0			c.A732G						.						103.0	105.0	104.0					1																	12907411		2202	4298	6500	SO:0001819	synonymous_variant	343069	exon2			GTCTTCTGCACCC	BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.732A>G	1.37:g.12907411T>C		316.0	1.0		198.0	15.0	NM_001013631	B2RP44	Silent	SNP	ENST00000317869.6	37	CCDS30591.1																																																																																			.		0.488	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005462.1	NM_001013631	
HNRNPD	3184	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	83278019	83278020	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr4:83278019_83278020insC	ENST00000313899.7	-	6	1059_1060	c.782_783insG	c.(781-783)gaafs	p.E261fs	HNRNPD_ENST00000541060.1_Frame_Shift_Ins_p.E107fs|HNRNPD_ENST00000352301.4_Frame_Shift_Ins_p.E242fs|HNRNPD_ENST00000543098.1_Frame_Shift_Ins_p.E209fs|HNRNPD_ENST00000353341.4_Frame_Shift_Ins_p.E261fs|HNRNPD_ENST00000508119.1_5'UTR	NM_031370.2	NP_112738.1	Q14103	HNRPD_HUMAN	heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)	261	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				circadian regulation of translation (GO:0097167)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|regulation of circadian rhythm (GO:0042752)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(1)	7						GCTGATATTGTTCCTTCGACAT	0.366																																					p.E261fs		.											.	HNRNPD	22	0			c.783_784insG						.																																			SO:0001589	frameshift_variant	3184	exon6			ATATTGTTCCTTC	AF026126	CCDS3590.1, CCDS3591.1, CCDS3592.1	4q21	2013-02-12	2002-08-29	2008-04-18	ENSG00000138668	ENSG00000138668		"""RNA binding motif (RRM) containing"""	5036	protein-coding gene	gene with protein product		601324	"""heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA-binding protein 1, 37kD)"""	AUF1, HNRPD		9615222	Standard	NM_001003810		Approved		uc003hmm.1	Q14103	OTTHUMG00000130290	ENST00000313899.7:c.782_783insG	4.37:g.83278019_83278020insC	ENSP00000313199:p.Glu261fs	175.0	0.0		132.0	23.0	NM_002138	A8K9J2|P07029|Q01858|Q14100|Q14101|Q14102|Q4W5A1|Q9UCE8|Q9UCE9	Frame_Shift_Ins	INS	ENST00000313899.7	37	CCDS3592.1																																																																																			.		0.366	HNRNPD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252630.2	NM_031370	
HSPA12A	259217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	118458224	118458224	+	Silent	SNP	C	C	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr10:118458224C>A	ENST00000369209.3	-	5	572	c.468G>T	c.(466-468)acG>acT	p.T156T		NM_025015.2	NP_079291.2	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	156						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32				all cancers(201;0.0158)		CATTTGCTGCCGTCAGGTCTG	0.493																																					p.T156T		.											.	HSPA12A	206	0			c.G468T						.						142.0	135.0	137.0					10																	118458224		1949	4157	6106	SO:0001819	synonymous_variant	259217	exon5			TGCTGCCGTCAGG	AB007877	CCDS41569.1	10q25.3	2011-09-02	2002-08-29		ENSG00000165868	ENSG00000165868		"""Heat shock proteins / HSP70"""	19022	protein-coding gene	gene with protein product		610701	"""heat shock 70kD protein 12A"""			12552099	Standard	NM_025015		Approved	FLJ13874, KIAA0417	uc001lct.3	O43301	OTTHUMG00000019107	ENST00000369209.3:c.468G>T	10.37:g.118458224C>A		124.0	0.0		89.0	28.0	NM_025015		Silent	SNP	ENST00000369209.3	37	CCDS41569.1																																																																																			.		0.493	HSPA12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050530.1	NM_025015	
HSPA4	3308	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	132400692	132400692	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr5:132400692C>T	ENST00000304858.2	+	2	417	c.128C>T	c.(127-129)cCt>cTt	p.P43L		NM_002154.3	NP_002145.3	P34932	HSP74_HUMAN	heat shock 70kDa protein 4	43					chaperone-mediated protein complex assembly (GO:0051131)|protein import into mitochondrial outer membrane (GO:0045040)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|stomach(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCTTTTGGTCCTAAGAATCGT	0.348																																					p.P43L	Colon(114;1299 1588 6063 12302 48757)	.											.	HSPA4	226	0			c.C128T						.						189.0	190.0	189.0					5																	132400692		2203	4300	6503	SO:0001583	missense	3308	exon2			TTGGTCCTAAGAA	AB023420	CCDS4166.1	5q31.1	2011-09-07	2002-08-29		ENSG00000170606	ENSG00000170606		"""Heat shock proteins / HSP70"""	5237	protein-coding gene	gene with protein product	"""hsp70 RY"""	601113	"""heat shock 70kD protein 4"""			8335910	Standard	NM_002154		Approved	HS24/P52, HSPH2	uc003kyj.3	P34932	OTTHUMG00000129012	ENST00000304858.2:c.128C>T	5.37:g.132400692C>T	ENSP00000302961:p.Pro43Leu	183.0	0.0		209.0	32.0	NM_002154	O95756|Q2TAL4|Q9BUK9	Missense_Mutation	SNP	ENST00000304858.2	37	CCDS4166.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.542968	0.65198	.	.	ENSG00000170606	ENST00000304858;ENST00000321956;ENST00000537974	T	0.01034	5.42	5.69	5.69	0.88448	.	0.160713	0.56097	D	0.000029	T	0.02012	0.0063	L	0.61218	1.895	0.80722	D	1	B	0.23442	0.085	B	0.22152	0.038	T	0.60707	-0.7210	10	0.35671	T	0.21	-3.324	19.8209	0.96592	0.0:1.0:0.0:0.0	.	43	P34932	HSP74_HUMAN	L	43	ENSP00000302961:P43L	ENSP00000302961:P43L	P	+	2	0	HSPA4	132428591	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.473000	0.81007	2.688000	0.91661	0.650000	0.86243	CCT	.		0.348	HSPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251011.1	NM_002154, NM_198431	
INTS1	26173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	1529320	1529320	+	Splice_Site	SNP	T	T	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr7:1529320T>A	ENST00000404767.3	-	17	2251		c.e17-2		INTS1_ENST00000389470.4_Splice_Site	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1						inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		GGCTGGTACCTGGAAGGCAGG	0.677																																					.		.											.	.	.	0			c.2166-2A>T						.						27.0	30.0	29.0					7																	1529320		2032	4159	6191	SO:0001630	splice_region_variant	26173	exon18			GGTACCTGGAAGG	AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.2166-2A>T	7.37:g.1529320T>A		79.0	0.0		65.0	9.0	NM_001080453	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Splice_Site	SNP	ENST00000404767.3	37	CCDS47526.1	.	.	.	.	.	.	.	.	.	.	T	15.13	2.740938	0.49151	.	.	ENSG00000164880	ENST00000404767;ENST00000389470	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4533	0.75294	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	INTS1	1495846	1.000000	0.71417	0.937000	0.37676	0.268000	0.26511	7.512000	0.81728	2.051000	0.60960	0.529000	0.55759	.	.		0.677	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323683.1		Intron
IWS1	55677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	128247424	128247424	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr2:128247424G>A	ENST00000295321.4	-	11	2402	c.2143C>T	c.(2143-2145)Cga>Tga	p.R715*	AC010976.2_ENST00000599001.1_RNA|AC010976.2_ENST00000595561.1_RNA|AC010976.2_ENST00000596439.1_RNA|AC010976.2_ENST00000454503.2_RNA|AC010976.2_ENST00000598065.1_RNA	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	715	Interaction with SUPT6H and ALYREF.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		ATTCTTCGTCGTTGAGGCATC	0.413																																					p.R715X		.											.	IWS1	91	0			c.C2143T						.						401.0	344.0	363.0					2																	128247424		2203	4300	6503	SO:0001587	stop_gained	55677	exon11			TTCGTCGTTGAGG	AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.2143C>T	2.37:g.128247424G>A	ENSP00000295321:p.Arg715*	348.0	0.0		267.0	41.0	NM_017969	Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Nonsense_Mutation	SNP	ENST00000295321.4	37	CCDS2146.1	.	.	.	.	.	.	.	.	.	.	G	39	7.512099	0.98329	.	.	ENSG00000163166	ENST00000295321;ENST00000433551	.	.	.	5.03	3.16	0.36331	.	0.133236	0.50627	D	0.000119	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.7877	13.711	0.62667	0.0:0.0:0.7186:0.2814	.	.	.	.	X	715;668	.	ENSP00000295321:R715X	R	-	1	2	IWS1	127963894	1.000000	0.71417	0.989000	0.46669	0.943000	0.58893	2.581000	0.46077	0.480000	0.27534	0.563000	0.77884	CGA	.		0.413	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254384.2	NM_017969	
KDM7A	80853	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	139791731	139791731	+	Silent	SNP	C	C	T	rs376853003		TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr7:139791731C>T	ENST00000397560.2	-	19	2701	c.2604G>A	c.(2602-2604)gcG>gcA	p.A868A	Y_RNA_ENST00000515919.1_RNA	NM_030647.1	NP_085150.1	Q6ZMT4	KDM7A_HUMAN		868					histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|midbrain development (GO:0030901)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)	22	Melanoma(164;0.0142)					TTATCTGGCACGCCCCCGAAG	0.493																																					p.A868A		.											.	JHDM1D	91	0			c.G2604A						.	C		0,3824		0,0,1912	110.0	106.0	107.0		2604	-11.2	0.0	7		107	1,8249		0,1,4124	no	coding-synonymous	JHDM1D	NM_030647.1		0,1,6036	TT,TC,CC		0.0121,0.0,0.0083		868/942	139791731	1,12073	1912	4125	6037	SO:0001819	synonymous_variant	80853	exon19			CTGGCACGCCCCC																												ENST00000397560.2:c.2604G>A	7.37:g.139791731C>T		201.0	0.0		181.0	9.0	NM_030647	A4D1S9|C9JJH9|C9JQU2|Q6MZL8|Q9C0E5	Silent	SNP	ENST00000397560.2	37	CCDS43658.1																																																																																			.		0.493	JHDM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348460.1		
KCNA7	3743	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49574011	49574011	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:49574011C>A	ENST00000221444.1	-	2	1035	c.680G>T	c.(679-681)cGc>cTc	p.R227L		NM_031886.2	NP_114092.2	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 7	227					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|skin(2)	11		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	Dalfampridine(DB06637)	GACCAGGAGGCGTACCAGCAG	0.527																																					p.R227L	Colon(74;686 1235 3793 23366 48562)	.											.	KCNA7	90	0			c.G680T						.						146.0	106.0	119.0					19																	49574011		2203	4300	6503	SO:0001583	missense	3743	exon2			AGGAGGCGTACCA	AF315818	CCDS12755.1	19q13.3	2012-07-05				ENSG00000104848		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6226	protein-coding gene	gene with protein product		176268				16382104	Standard	NM_031886		Approved	Kv1.7, HAK6	uc002pmg.3	Q96RP8		ENST00000221444.1:c.680G>T	19.37:g.49574011C>A	ENSP00000221444:p.Arg227Leu	83.0	0.0		67.0	20.0	NM_031886	A1KYX7|Q9BYS4	Missense_Mutation	SNP	ENST00000221444.1	37	CCDS12755.1	.	.	.	.	.	.	.	.	.	.	C	17.28	3.349632	0.61183	.	.	ENSG00000104848	ENST00000221444	D	0.98684	-5.07	4.49	4.49	0.54785	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99530	0.9832	H	0.98818	4.34	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.97677	1.0170	10	0.87932	D	0	.	16.3041	0.82841	0.0:1.0:0.0:0.0	.	227	Q96RP8	KCNA7_HUMAN	L	227	ENSP00000221444:R227L	ENSP00000221444:R227L	R	-	2	0	KCNA7	54265823	1.000000	0.71417	0.954000	0.39281	0.149000	0.21700	7.811000	0.86092	2.234000	0.73211	0.313000	0.20887	CGC	.		0.527	KCNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466263.1	NM_031886	
KCNQ4	9132	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	41304173	41304173	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr1:41304173C>T	ENST00000347132.5	+	14	2148	c.2066C>T	c.(2065-2067)tCg>tTg	p.S689L	KCNQ4_ENST00000509682.2_Missense_Mutation_p.S635L|KCNQ4_ENST00000506017.1_3'UTR	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4	689					inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	ATCTCCCGCTCGGTCAGCACC	0.662																																					p.S689L		.											.	KCNQ4	90	0			c.C2066T						.						98.0	84.0	89.0					1																	41304173		2203	4300	6503	SO:0001583	missense	9132	exon14			CCCGCTCGGTCAG	AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.2066C>T	1.37:g.41304173C>T	ENSP00000262916:p.Ser689Leu	321.0	2.0		313.0	32.0	NM_004700	O96025	Missense_Mutation	SNP	ENST00000347132.5	37	CCDS456.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.072991	0.76415	.	.	ENSG00000117013	ENST00000347132;ENST00000509682	D;D	0.99264	-5.65;-5.45	4.91	4.91	0.64330	.	0.401853	0.21143	N	0.079449	D	0.96327	0.8802	N	0.14661	0.345	0.58432	D	0.999997	P;P	0.49185	0.764;0.92	B;B	0.35182	0.138;0.197	D	0.97246	0.9894	10	0.87932	D	0	-9.4824	15.5802	0.76428	0.0:1.0:0.0:0.0	.	635;689	P56696-2;P56696	.;KCNQ4_HUMAN	L	689;635	ENSP00000262916:S689L;ENSP00000423756:S635L	ENSP00000262916:S689L	S	+	2	0	KCNQ4	41076760	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.697000	0.68295	2.279000	0.76181	0.455000	0.32223	TCG	.		0.662	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000020812.1	NM_004700	
KDR	3791	broad.mit.edu;ucsc.edu;mdanderson.org	37	4	55946222	55946222	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr4:55946222G>T	ENST00000263923.4	-	30	4252	c.3957C>A	c.(3955-3957)taC>taA	p.Y1319*	RP11-530I17.1_ENST00000511222.1_RNA	NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	1319					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CCTCACTGGAGTACACGGTGG	0.537			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																											p.Y1319X		.		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	.	KDR	2298	0			c.C3957A						.						215.0	200.0	205.0					4																	55946222		2203	4300	6503	SO:0001587	stop_gained	3791	exon30			ACTGGAGTACACG	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.3957C>A	4.37:g.55946222G>T	ENSP00000263923:p.Tyr1319*	206.0	1.0		162.0	51.0	NM_002253	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Nonsense_Mutation	SNP	ENST00000263923.4	37	CCDS3497.1	.	.	.	.	.	.	.	.	.	.	G	44	10.885455	0.99483	.	.	ENSG00000128052	ENST00000263923	.	.	.	5.62	5.62	0.85841	.	0.193402	0.47093	D	0.000241	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.5601	0.39364	0.1936:0.0:0.8064:0.0	.	.	.	.	X	1319	.	ENSP00000263923:Y1319X	Y	-	3	2	KDR	55640979	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	1.715000	0.37971	2.660000	0.90430	0.650000	0.86243	TAC	.		0.537	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		
KIAA0922	23240	broad.mit.edu;bcgsc.ca	37	4	154557488	154557488	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr4:154557488G>A	ENST00000409663.3	+	35	4642	c.4590G>A	c.(4588-4590)atG>atA	p.M1530I	KIAA0922_ENST00000440693.1_Missense_Mutation_p.M1447I|KIAA0922_ENST00000409959.3_Missense_Mutation_p.M1531I	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	1530						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				TGTCTCCAATGTCTGGACTTT	0.443																																					p.M1531I		.											.	KIAA0922	92	0			c.G4593A						.						95.0	102.0	100.0					4																	154557488		2203	4300	6503	SO:0001583	missense	23240	exon35			TCCAATGTCTGGA	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.4590G>A	4.37:g.154557488G>A	ENSP00000386574:p.Met1530Ile	123.0	0.0		105.0	6.0	NM_001131007	B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	ENST00000409663.3	37	CCDS3783.2	.	.	.	.	.	.	.	.	.	.	G	20.8	4.055904	0.76074	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.27402	1.94;1.67;1.94;1.69	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.39517	0.1081	L	0.59436	1.845	0.80722	D	1	P;P;P	0.49090	0.831;0.919;0.867	P;B;B	0.45610	0.487;0.393;0.22	T	0.04115	-1.0976	10	0.27785	T	0.31	-28.9188	20.3311	0.98718	0.0:0.0:1.0:0.0	.	1447;1531;1530	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	I	1530;1447;1531;1308	ENSP00000386574:M1530I;ENSP00000409663:M1447I;ENSP00000386787:M1531I;ENSP00000240487:M1308I	ENSP00000240487:M1308I	M	+	3	0	KIAA0922	154776938	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.172000	0.77604	2.797000	0.96272	0.655000	0.94253	ATG	.		0.443	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196	
KIAA1328	57536	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	34646878	34646878	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr18:34646878A>G	ENST00000280020.5	+	7	624	c.602A>G	c.(601-603)cAg>cGg	p.Q201R	KIAA1328_ENST00000586135.1_5'UTR|KIAA1328_ENST00000586501.1_5'UTR|KIAA1328_ENST00000591619.1_Missense_Mutation_p.Q197R|KIAA1328_ENST00000435985.2_5'UTR|KIAA1328_ENST00000543923.1_Missense_Mutation_p.Q93R	NM_020776.1	NP_065827.1	Q86T90	K1328_HUMAN	KIAA1328	201										central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	14				COAD - Colon adenocarcinoma(74;0.195)		AGCACTCTCCAGTGTTCATCT	0.413																																					p.Q201R		.											.	KIAA1328	90	0			c.A602G						.						65.0	61.0	62.0					18																	34646878		1873	4103	5976	SO:0001583	missense	57536	exon7			CTCTCCAGTGTTC	AB037749	CCDS45855.1	18q12.2	2011-12-12			ENSG00000150477	ENSG00000150477			29248	protein-coding gene	gene with protein product						10718198	Standard	XM_005258317		Approved		uc002kzz.3	Q86T90		ENST00000280020.5:c.602A>G	18.37:g.34646878A>G	ENSP00000280020:p.Gln201Arg	166.0	0.0		142.0	33.0	NM_020776	Q05DL0|Q49AG6|Q9P2L8	Missense_Mutation	SNP	ENST00000280020.5	37	CCDS45855.1	.	.	.	.	.	.	.	.	.	.	A	8.462	0.855430	0.17106	.	.	ENSG00000150477	ENST00000543923;ENST00000280020;ENST00000383055	T;T	0.41065	1.01;2.32	6.17	-12.3	0.00002	.	0.832930	0.10897	N	0.622016	T	0.21145	0.0509	N	0.20986	0.625	0.09310	N	0.999991	B;B	0.14438	0.01;0.002	B;B	0.11329	0.006;0.004	T	0.36625	-0.9740	10	0.09590	T	0.72	.	16.9504	0.86244	0.7855:0.1442:0.0702:0.0	.	201;201	A8K8C3;Q86T90	.;K1328_HUMAN	R	93;201;201	ENSP00000441359:Q93R;ENSP00000280020:Q201R	ENSP00000280020:Q201R	Q	+	2	0	KIAA1328	32900876	0.000000	0.05858	0.000000	0.03702	0.792000	0.44763	-0.845000	0.04340	-2.876000	0.00321	-0.408000	0.06270	CAG	.		0.413	KIAA1328-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440455.1	NM_020776	
KIF11	3832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	94369152	94369152	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr10:94369152T>C	ENST00000260731.3	+	6	674	c.584T>C	c.(583-585)aTa>aCa	p.I195T		NM_004523.3	NP_004514.2	P52732	KIF11_HUMAN	kinesin family member 11	195	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|chromosome segregation (GO:0007059)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|spindle assembly involved in mitosis (GO:0090307)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)			breast(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AGAGGAGTGATAATTAAAGGT	0.388																																					p.I195T	Colon(47;212 1003 2764 4062 8431)	.											.	KIF11	227	0			c.T584C						.						174.0	188.0	183.0					10																	94369152		2203	4300	6503	SO:0001583	missense	3832	exon6			GAGTGATAATTAA	X85137	CCDS7422.1	10q24.1	2008-03-03	2003-01-09	2003-01-10	ENSG00000138160	ENSG00000138160		"""Kinesins"""	6388	protein-coding gene	gene with protein product		148760	"""kinesin-like 1"""	KNSL1		1505978, 8548803	Standard	NM_004523		Approved	Eg5, HKSP, TRIP5	uc001kic.3	P52732	OTTHUMG00000018761	ENST00000260731.3:c.584T>C	10.37:g.94369152T>C	ENSP00000260731:p.Ile195Thr	91.0	0.0		60.0	9.0	NM_004523	A0AV49|B2RMV3|Q15716|Q5VWX0	Missense_Mutation	SNP	ENST00000260731.3	37	CCDS7422.1	.	.	.	.	.	.	.	.	.	.	T	19.75	3.886183	0.72410	.	.	ENSG00000138160	ENST00000260731	T	0.64991	-0.13	5.54	5.54	0.83059	Kinesin, motor domain (4);	0.107041	0.64402	D	0.000006	T	0.56307	0.1976	N	0.17631	0.505	0.58432	D	0.999995	P	0.39022	0.655	P	0.45377	0.478	T	0.59674	-0.7410	10	0.48119	T	0.1	.	15.8422	0.78857	0.0:0.0:0.0:1.0	.	195	P52732	KIF11_HUMAN	T	195	ENSP00000260731:I195T	ENSP00000260731:I195T	I	+	2	0	KIF11	94359132	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.796000	0.62496	2.323000	0.78572	0.528000	0.53228	ATA	.		0.388	KIF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049401.1	NM_004523	
KIF22	3835	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	29811026	29811026	+	Silent	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr16:29811026C>T	ENST00000160827.4	+	7	1108	c.1068C>T	c.(1066-1068)gtC>gtT	p.V356V	KIF22_ENST00000563263.1_3'UTR|KIF22_ENST00000400750.2_5'UTR|KIF22_ENST00000400751.5_Silent_p.V288V|KIF22_ENST00000569382.2_Silent_p.V288V|KIF22_ENST00000561482.1_Silent_p.V288V	NM_001256269.1|NM_007317.2	NP_001243198.1|NP_015556.1	Q14807	KIF22_HUMAN	kinesin family member 22	356	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA repair (GO:0006281)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)			endometrium(1)|large_intestine(1)|lung(11)|skin(1)	14						TAGACACAGTCTCCGCACTCA	0.562																																					p.V356V		.											.	KIF22	68	0			c.C1068T						.						58.0	42.0	47.0					16																	29811026		2197	4296	6493	SO:0001819	synonymous_variant	3835	exon7			CACAGTCTCCGCA	D38751	CCDS10653.1, CCDS58444.1	16p11.2	2008-03-03	2003-01-09	2003-01-10	ENSG00000079616	ENSG00000079616		"""Kinesins"""	6391	protein-coding gene	gene with protein product		603213	"""kinesin-like 4"""	KNSL4		8599929, 11416179	Standard	NM_007317		Approved	Kid, OBP-1, OBP-2	uc002dts.4	Q14807	OTTHUMG00000097771	ENST00000160827.4:c.1068C>T	16.37:g.29811026C>T		225.0	0.0		124.0	22.0	NM_007317	B2R5M0|B7Z265|O60845|O94814|Q53F58|Q9BT46	Silent	SNP	ENST00000160827.4	37	CCDS10653.1																																																																																			.		0.562	KIF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215012.2		
KIF26A	26153	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	104642658	104642658	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr14:104642658G>T	ENST00000423312.2	+	12	3533	c.3533G>T	c.(3532-3534)gGg>gTg	p.G1178V	KIF26A_ENST00000315264.7_Missense_Mutation_p.G1039V	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1178					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		CCGTGCCCTGGGGAAGTGGCT	0.721																																					p.G1178V		.											.	KIF26A	24	0			c.G3533T						.						8.0	10.0	9.0					14																	104642658		1708	3820	5528	SO:0001583	missense	26153	exon12			GCCCTGGGGAAGT	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.3533G>T	14.37:g.104642658G>T	ENSP00000388241:p.Gly1178Val	83.0	0.0		107.0	34.0	NM_015656	Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	SNP	ENST00000423312.2	37	CCDS45171.1	.	.	.	.	.	.	.	.	.	.	G	0.517	-0.863862	0.02590	.	.	ENSG00000066735	ENST00000423312;ENST00000315264	T;T	0.78481	-1.18;-1.17	3.52	-1.71	0.08133	.	.	.	.	.	T	0.67748	0.2926	M	0.64404	1.975	0.09310	N	1	B	0.22003	0.063	B	0.14578	0.011	T	0.57004	-0.7885	9	0.48119	T	0.1	.	2.8448	0.05540	0.1081:0.4273:0.2229:0.2418	.	1178	Q9ULI4	KI26A_HUMAN	V	1178;1039	ENSP00000388241:G1178V;ENSP00000325452:G1039V	ENSP00000325452:G1039V	G	+	2	0	KIF26A	103712411	0.000000	0.05858	0.001000	0.08648	0.029000	0.11900	-0.682000	0.05185	-0.127000	0.11661	-0.657000	0.03884	GGG	.		0.721	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
KLC3	147700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	45853937	45853937	+	Silent	SNP	G	G	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:45853937G>A	ENST00000391946.2	+	11	1413	c.1311G>A	c.(1309-1311)gaG>gaA	p.E437E	ERCC2_ENST00000391945.4_3'UTR|KLC3_ENST00000470402.1_Silent_p.E451E|KLC3_ENST00000585434.1_Silent_p.E436E	NM_177417.2	NP_803136.2	Q6P597	KLC3_HUMAN	kinesin light chain 3	437					axon cargo transport (GO:0008088)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|motile cilium (GO:0031514)|neuron projection (GO:0043005)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGATCCGTGAGTCTATCAGGC	0.682																																					p.E437E		.											.	KLC3	91	0			c.G1311A						.						21.0	26.0	24.0					19																	45853937		1938	4126	6064	SO:0001819	synonymous_variant	147700	exon11			CCGTGAGTCTATC	AK092481	CCDS12660.2	19q13	2013-01-10			ENSG00000104892	ENSG00000104892		"""Tetratricopeptide (TTC) repeat domain containing"""	20717	protein-coding gene	gene with protein product		601334					Standard	XM_005258536		Approved	KLC2L, KNS2B, KLCt	uc002pbf.1	Q6P597	OTTHUMG00000143722	ENST00000391946.2:c.1311G>A	19.37:g.45853937G>A		184.0	0.0		159.0	37.0	NM_177417	A0AVM3|A2RUT6|Q6GMU2|Q8NAL1|Q8WWJ9	Silent	SNP	ENST00000391946.2	37	CCDS12660.2																																																																																			.		0.682	KLC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289776.1	NM_145275	
LAMA1	284217	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	7023225	7023225	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr18:7023225G>T	ENST00000389658.3	-	19	2732	c.2639C>A	c.(2638-2640)gCc>gAc	p.A880D		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	880	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				TTCACAGTGGGCGCCATCTGT	0.602																																					p.A880D		.											.	LAMA1	149	0			c.C2639A						.						94.0	70.0	78.0					18																	7023225		2203	4300	6503	SO:0001583	missense	284217	exon19			CAGTGGGCGCCAT	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.2639C>A	18.37:g.7023225G>T	ENSP00000374309:p.Ala880Asp	122.0	0.0		119.0	10.0	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	G	5.205	0.223300	0.09863	.	.	ENSG00000101680	ENST00000389658	T	0.61158	0.13	5.47	4.56	0.56223	EGF-like, laminin (4);	0.881961	0.09731	N	0.763140	T	0.39545	0.1082	N	0.04260	-0.245	0.09310	N	1	P	0.40970	0.734	P	0.46049	0.502	T	0.12041	-1.0563	10	0.32370	T	0.25	.	5.852	0.18697	0.0736:0.3403:0.4635:0.1226	.	880	P25391	LAMA1_HUMAN	D	880	ENSP00000374309:A880D	ENSP00000374309:A880D	A	-	2	0	LAMA1	7013225	0.000000	0.05858	0.952000	0.39060	0.605000	0.37080	0.226000	0.17776	2.578000	0.87016	0.643000	0.83706	GCC	.		0.602	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
LAMTOR3	8649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	100808468	100808468	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr4:100808468C>A	ENST00000499666.2	-	4	280	c.88G>T	c.(88-90)Gta>Tta	p.V30L	LAMTOR3_ENST00000515100.1_5'UTR|LAMTOR3_ENST00000226522.8_Missense_Mutation_p.V30L	NM_001243736.1|NM_021970.3	NP_001230665.1|NP_068805.1	Q9UHA4	LTOR3_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 3	30					cellular protein localization (GO:0034613)|cellular response to amino acid stimulus (GO:0071230)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Ragulator complex (GO:0071986)				endometrium(1)|large_intestine(1)|lung(1)	3						ATAACAGGTACTCCATCTCTA	0.289																																					p.V30L		.											.	LAMTOR3	658	0			c.G88T						.						54.0	50.0	51.0					4																	100808468		2202	4296	6498	SO:0001583	missense	8649	exon4			CAGGTACTCCATC	AF201947	CCDS3652.1, CCDS58920.1	4q24-q26	2012-02-28	2011-02-15	2011-02-15	ENSG00000109270	ENSG00000109270			15606	protein-coding gene	gene with protein product	"""MEK partner 1"""	603296	"""mitogen-activated protein kinase kinase 1 interacting protein 1"", ""MAPK scaffold protein 1"""	MAP2K1IP1, MAPKSP1		9733512, 15016825	Standard	NM_021970		Approved	MP1, MAPBP, Ragulator3	uc003hvg.2	Q9UHA4	OTTHUMG00000131050	ENST00000499666.2:c.88G>T	4.37:g.100808468C>A	ENSP00000424183:p.Val30Leu	214.0	0.0		143.0	42.0	NM_021970	B2R4A1|J3KMX4|Q9H364	Missense_Mutation	SNP	ENST00000499666.2	37	CCDS3652.1	.	.	.	.	.	.	.	.	.	.	C	18.20	3.571581	0.65765	.	.	ENSG00000109270	ENST00000499666;ENST00000226522	.	.	.	4.72	4.72	0.59763	.	0.122073	0.56097	D	0.000040	T	0.72843	0.3511	M	0.87827	2.91	0.80722	D	1	B;B	0.28208	0.203;0.008	B;B	0.26864	0.074;0.009	T	0.76990	-0.2754	9	0.87932	D	0	.	18.0646	0.89387	0.0:1.0:0.0:0.0	.	30;30	Q53FH6;Q9UHA4	.;LTOR3_HUMAN	L	30	.	ENSP00000226522:V30L	V	-	1	0	LAMTOR3	101027491	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.137000	0.77295	2.343000	0.79666	0.467000	0.42956	GTA	.		0.289	LAMTOR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253698.2	NM_021970	
LHX5	64211	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	12	113901064	113901064	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr12:113901064G>T	ENST00000261731.3	-	5	1713	c.1140C>A	c.(1138-1140)agC>agA	p.S380R		NM_022363.2	NP_071758.1	Q9H2C1	LHX5_HUMAN	LIM homeobox 5	380					cell proliferation in forebrain (GO:0021846)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|forebrain neuron differentiation (GO:0021879)|hippocampus development (GO:0021766)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	10						CGCTGGTGCCGCTCATTGGGA	0.751																																					p.S380R		.											.	LHX5	90	0			c.C1140A						.						3.0	6.0	5.0					12																	113901064		1712	3364	5076	SO:0001583	missense	64211	exon5			GGTGCCGCTCATT	AF291181	CCDS9171.1	12q24.13	2014-01-15			ENSG00000089116	ENSG00000089116		"""Homeoboxes / LIM class"""	14216	protein-coding gene	gene with protein product		605992					Standard	NM_022363		Approved		uc001tvj.1	Q9H2C1	OTTHUMG00000169552	ENST00000261731.3:c.1140C>A	12.37:g.113901064G>T	ENSP00000261731:p.Ser380Arg	20.0	0.0		34.0	14.0	NM_022363	Q32MA4	Missense_Mutation	SNP	ENST00000261731.3	37	CCDS9171.1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.462281	0.43736	.	.	ENSG00000089116	ENST00000261731	D	0.90900	-2.75	4.08	2.23	0.28157	.	0.269330	0.24856	N	0.035041	T	0.81823	0.4904	L	0.40543	1.245	0.45261	D	0.998267	P	0.45715	0.865	B	0.35971	0.215	T	0.74604	-0.3610	10	0.29301	T	0.29	.	7.7318	0.28791	0.2635:0.0:0.7365:0.0	.	380	Q9H2C1	LHX5_HUMAN	R	380	ENSP00000261731:S380R	ENSP00000261731:S380R	S	-	3	2	LHX5	112385447	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.399000	0.44495	0.324000	0.23333	-0.258000	0.10820	AGC	.		0.751	LHX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404788.3	NM_022363	
LMTK2	22853	broad.mit.edu;bcgsc.ca	37	7	97822981	97822981	+	Silent	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr7:97822981T>C	ENST00000297293.5	+	11	3497	c.3204T>C	c.(3202-3204)ccT>ccC	p.P1068P		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	1068					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					GCGGTCTGCCTCCCAACCCGG	0.627																																					p.P1068P		.											.	LMTK2	1381	0			c.T3204C						.						34.0	33.0	33.0					7																	97822981		2203	4300	6503	SO:0001819	synonymous_variant	22853	exon11			TCTGCCTCCCAAC	AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.3204T>C	7.37:g.97822981T>C		62.0	0.0		61.0	5.0	NM_014916	A4D272|Q75MG7|Q9UPS3	Silent	SNP	ENST00000297293.5	37	CCDS5654.1																																																																																			.		0.627	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334560.1	NM_014916	
LRRC71	149499	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	156901780	156901780	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr1:156901780A>G	ENST00000337428.7	+	13	1556	c.1402A>G	c.(1402-1404)Atg>Gtg	p.M468V	LRRC71_ENST00000490146.1_3'UTR|ARHGEF11_ENST00000487682.1_5'Flank	NM_144702.2	NP_653303.2	Q8N4P6	LRC71_HUMAN	leucine rich repeat containing 71	468										endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|stomach(1)	12						GAAAGTTTTCATGCCTGGGAA	0.552																																					p.M468V		.											.	LRRC71	91	0			c.A1402G						.						78.0	83.0	81.0					1																	156901780		2046	4181	6227	SO:0001583	missense	149499	exon13			GTTTTCATGCCTG	BC033790	CCDS44249.1	1q23.1	2011-02-14	2011-02-14	2011-02-14	ENSG00000160838	ENSG00000160838			26556	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 92"""	C1orf92		14702039	Standard	NM_144702		Approved	FLJ32884	uc001fqm.2	Q8N4P6	OTTHUMG00000041298	ENST00000337428.7:c.1402A>G	1.37:g.156901780A>G	ENSP00000336661:p.Met468Val	210.0	0.0		187.0	16.0	NM_144702	Q96M24	Missense_Mutation	SNP	ENST00000337428.7	37	CCDS44249.1	.	.	.	.	.	.	.	.	.	.	A	9.998	1.232562	0.22626	.	.	ENSG00000160838	ENST00000337428	T	0.17854	2.25	5.68	-1.36	0.09085	.	0.216602	0.32819	N	0.005616	T	0.03348	0.0097	L	0.27053	0.805	0.23483	N	0.997586	B;B	0.24920	0.01;0.114	B;B	0.27262	0.004;0.078	T	0.37384	-0.9708	10	0.48119	T	0.1	-32.5944	6.0254	0.19652	0.2605:0.2118:0.0:0.5277	.	468;254	Q8N4P6;Q8N4P6-2	LRC71_HUMAN;.	V	468	ENSP00000336661:M468V	ENSP00000336661:M468V	M	+	1	0	LRRC71	155168404	0.997000	0.39634	0.999000	0.59377	0.949000	0.60115	0.329000	0.19698	0.046000	0.15833	-0.490000	0.04691	ATG	.		0.552	LRRC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098961.1	NM_144702	
LRWD1	222229	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	102113247	102113247	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr7:102113247C>T	ENST00000292616.5	+	14	1951	c.1799C>T	c.(1798-1800)aCa>aTa	p.T600I	MIR4467_ENST00000578629.1_RNA	NM_152892.1	NP_690852.1	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain containing 1	600					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|DNA replication initiation (GO:0006270)|establishment of protein localization to chromatin (GO:0071169)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|telomeric heterochromatin (GO:0031933)	chromatin binding (GO:0003682)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|stomach(2)	20						CAGGCCCCCACACAGGTACTG	0.667																																					p.T600I		.											.	LRWD1	69	0			c.C1799T						.						25.0	27.0	27.0					7																	102113247		2203	4299	6502	SO:0001583	missense	222229	exon14			CCCCCACACAGGT	AL133057	CCDS34715.1	7q22.1	2013-01-10			ENSG00000161036	ENSG00000161036		"""WD repeat domain containing"""	21769	protein-coding gene	gene with protein product	"""origin recognition complex associated"", ""centromere protein 33"""	615167				20932478, 20850016, 20180869	Standard	NM_152892		Approved	DKFZp434K1815, ORCA, CENP-33	uc003uzn.3	Q9UFC0	OTTHUMG00000157718	ENST00000292616.5:c.1799C>T	7.37:g.102113247C>T	ENSP00000292616:p.Thr600Ile	110.0	0.0		141.0	6.0	NM_152892	A8K4K2|B2R9G2|Q8N0T9|Q8WV43|Q96GJ2	Missense_Mutation	SNP	ENST00000292616.5	37	CCDS34715.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.550|8.550	0.875249|0.875249	0.17395|0.17395	.|.	.|.	ENSG00000161036|ENSG00000161036	ENST00000488689;ENST00000468175|ENST00000292616	.|T	.|0.62498	.|0.02	4.85|4.85	1.8|1.8	0.24995|0.24995	.|.	.|0.144056	.|0.64402	.|D	.|0.000006	T|T	0.66703|0.66703	0.2816|0.2816	M|M	0.61703|0.61703	1.905|1.905	0.20489|0.20489	N|N	0.999896|0.999896	.|D	.|0.60160	.|0.987	.|P	.|0.55871	.|0.786	T|T	0.57871|0.57871	-0.7736|-0.7736	5|10	.|0.62326	.|D	.|0.03	-6.3954|-6.3954	8.4157|8.4157	0.32670|0.32670	0.0:0.6243:0.2923:0.0835|0.0:0.6243:0.2923:0.0835	.|.	.|600	.|Q9UFC0	.|LRWD1_HUMAN	Y|I	211;186|600	.|ENSP00000292616:T600I	.|ENSP00000292616:T600I	H|T	+|+	1|2	0|0	LRWD1|LRWD1	101900252|101900252	0.000000|0.000000	0.05858|0.05858	0.033000|0.033000	0.17914|0.17914	0.113000|0.113000	0.19764|0.19764	0.329000|0.329000	0.19698|0.19698	0.730000|0.730000	0.32425|0.32425	0.561000|0.561000	0.74099|0.74099	CAC|ACA	.		0.667	LRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349493.1	NM_152892	
LYPD3	27076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	43969676	43969676	+	Silent	SNP	T	T	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:43969676T>A	ENST00000244333.3	-	1	136	c.48A>T	c.(46-48)gcA>gcT	p.A16A		NM_014400.2	NP_055215.2	O95274	LYPD3_HUMAN	LY6/PLAUR domain containing 3	16					cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|pancreas(1)|upper_aerodigestive_tract(2)	11		Prostate(69;0.0153)				GCAGCCAGCCTGCAGTCCAGA	0.692																																					p.A16A		.											.	LYPD3	91	0			c.A48T						.						94.0	82.0	86.0					19																	43969676		2203	4300	6503	SO:0001819	synonymous_variant	27076	exon1			CCAGCCTGCAGTC	AF082889	CCDS12620.1	19q13.31	2008-02-05				ENSG00000124466			24880	protein-coding gene	gene with protein product		609484				11179665, 11245483	Standard	NM_014400		Approved	C4.4A	uc002owl.1	O95274		ENST00000244333.3:c.48A>T	19.37:g.43969676T>A		64.0	0.0		56.0	12.0	NM_014400	Q9UJ74	Silent	SNP	ENST00000244333.3	37	CCDS12620.1																																																																																			.		0.692	LYPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463177.1	NM_014400	
MAGEC2	51438	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	141291370	141291370	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chrX:141291370G>A	ENST00000247452.3	-	3	751	c.404C>T	c.(403-405)tCc>tTc	p.S135F		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	135	Interaction with TRIM28.				cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					TGTGAAAGAGGACTCACTGTC	0.522										HNSCC(46;0.14)																											p.S135F		.											.	MAGEC2	193	0			c.C404T						.						103.0	102.0	102.0					X																	141291370		2203	4300	6503	SO:0001583	missense	51438	exon3			AAAGAGGACTCAC	AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.404C>T	X.37:g.141291370G>A	ENSP00000354660:p.Ser135Phe	38.0	0.0		35.0	16.0	NM_016249	Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Missense_Mutation	SNP	ENST00000247452.3	37	CCDS14678.1	.	.	.	.	.	.	.	.	.	.	-	4.658	0.122303	0.08931	.	.	ENSG00000046774	ENST00000247452	T	0.02863	4.13	1.13	1.13	0.20643	.	.	.	.	.	T	0.03564	0.0102	L	0.53617	1.68	0.09310	N	1	B	0.14012	0.009	B	0.15484	0.013	T	0.35748	-0.9776	9	0.54805	T	0.06	.	5.306	0.15803	0.0:0.0:1.0:0.0	.	135	Q9UBF1	MAGC2_HUMAN	F	135	ENSP00000354660:S135F	ENSP00000354660:S135F	S	-	2	0	MAGEC2	141119036	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	0.273000	0.18662	0.861000	0.35504	0.458000	0.33432	TCC	.		0.522	MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058611.1	NM_016249	
MAP1B	4131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	71491475	71491475	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr5:71491475T>C	ENST00000296755.7	+	5	2591	c.2293T>C	c.(2293-2295)Tct>Cct	p.S765P		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	765	Lys-rich (highly basic, contains many KKEE and KKEI/V repeats).				axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		GAAGGAAGAGTCTGTCAAGAA	0.443																																					p.S765P	Melanoma(17;367 822 11631 31730 47712)	.											.	MAP1B	155	0			c.T2293C						.						78.0	85.0	83.0					5																	71491475		2203	4300	6503	SO:0001583	missense	4131	exon5			GAAGAGTCTGTCA	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.2293T>C	5.37:g.71491475T>C	ENSP00000296755:p.Ser765Pro	116.0	0.0		82.0	12.0	NM_005909	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	37	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.552924	0.00138	.	.	ENSG00000131711	ENST00000296755	T	0.25579	1.79	5.63	-9.33	0.00639	.	0.731439	0.13093	N	0.414380	T	0.07818	0.0196	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.12967	-1.0527	10	0.21014	T	0.42	2.3708	5.3613	0.16089	0.0741:0.185:0.2202:0.5208	.	639;765	A2BDK6;P46821	.;MAP1B_HUMAN	P	765	ENSP00000296755:S765P	ENSP00000296755:S765P	S	+	1	0	MAP1B	71527231	0.000000	0.05858	0.000000	0.03702	0.354000	0.29330	-4.608000	0.00209	-2.962000	0.00289	-1.139000	0.01908	TCT	.		0.443	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
MAP7D3	79649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	135314089	135314089	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chrX:135314089C>G	ENST00000316077.9	-	8	1247	c.1027G>C	c.(1027-1029)Gtg>Ctg	p.V343L	MAP7D3_ENST00000495432.1_5'Flank|MAP7D3_ENST00000370661.1_Missense_Mutation_p.V308L|MAP7D3_ENST00000370663.5_Missense_Mutation_p.V325L	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	343					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					GACACGTCCACGCTCACCACA	0.567																																					p.V343L		.											.	MAP7D3	110	0			c.G1027C						.						103.0	107.0	106.0					X																	135314089		2186	4252	6438	SO:0001583	missense	79649	exon8			CGTCCACGCTCAC	AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.1027G>C	X.37:g.135314089C>G	ENSP00000318086:p.Val343Leu	114.0	0.0		101.0	55.0	NM_024597	A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Missense_Mutation	SNP	ENST00000316077.9	37	CCDS44004.1	.	.	.	.	.	.	.	.	.	.	C	9.134	1.012172	0.19277	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	T;T;T;T	0.07800	3.16;3.16;3.16;3.16	4.19	0.94	0.19513	.	.	.	.	.	T	0.04634	0.0126	L	0.27053	0.805	0.09310	N	1	B;B;B;B	0.28439	0.212;0.068;0.212;0.032	B;B;B;B	0.22386	0.039;0.02;0.039;0.034	T	0.42085	-0.9472	9	0.27785	T	0.31	-0.1196	2.2736	0.04096	0.1892:0.3311:0.3653:0.1144	.	325;302;343;308	B4DWD2;Q8IWC1-2;Q8IWC1;Q8IWC1-3	.;.;MA7D3_HUMAN;.	L	308;343;325;302	ENSP00000359695:V308L;ENSP00000318086:V343L;ENSP00000359697:V325L;ENSP00000359694:V302L	ENSP00000318086:V343L	V	-	1	0	MAP7D3	135141755	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-5.194000	0.00142	0.291000	0.22468	-0.229000	0.12294	GTG	.		0.567	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058487.2		
MAPK9	5601	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	179674507	179674507	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr5:179674507T>G	ENST00000452135.2	-	7	918	c.620A>C	c.(619-621)gAt>gCt	p.D207A	MAPK9_ENST00000455781.1_Intron|MAPK9_ENST00000347470.4_Intron|MAPK9_ENST00000343111.6_Intron|MAPK9_ENST00000524170.1_5'UTR|MAPK9_ENST00000397072.3_3'UTR|MAPK9_ENST00000425491.2_Missense_Mutation_p.D207A|MAPK9_ENST00000539014.1_3'UTR|MAPK9_ENST00000393360.3_Missense_Mutation_p.D207A			P45984	MK09_HUMAN	mitogen-activated protein kinase 9	207	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to growth factor stimulus (GO:0071363)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV (GO:0034644)|central nervous system development (GO:0007417)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neuron projection development (GO:0031175)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell morphogenesis involved in differentiation (GO:0010770)|positive regulation of chemokine production (GO:0032722)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of prostaglandin secretion (GO:0032308)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|protein targeting to mitochondrion (GO:0006626)|regulation of JNK cascade (GO:0046328)|regulation of protein ubiquitination (GO:0031396)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|release of cytochrome c from mitochondria (GO:0001836)|response to amine (GO:0014075)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|JUN kinase activity (GO:0004705)|transcription factor binding (GO:0008134)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(89;6.54e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0236)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGACCAGATATCAACTGAAAA	0.428																																					p.D207A		.											.	MAPK9	1402	0			c.A620C						.						69.0	63.0	65.0					5																	179674507		2203	4300	6503	SO:0001583	missense	5601	exon7			CAGATATCAACTG	U09759	CCDS4453.1, CCDS4454.1, CCDS43409.1, CCDS43410.1, CCDS47356.1	5q35	2011-06-09			ENSG00000050748	ENSG00000050748	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6886	protein-coding gene	gene with protein product	"""Jun kinase"""	602896		PRKM9		8001819	Standard	NM_002752		Approved	JNK2, p54a, SAPK	uc003mls.4	P45984	OTTHUMG00000130934	ENST00000452135.2:c.620A>C	5.37:g.179674507T>G	ENSP00000394560:p.Asp207Ala	64.0	0.0		48.0	5.0	NM_002752	A8K0S3|B5BU66|B5M0B4|D3DWQ8|D3DWQ9|Q15708|Q15710|Q15711|Q8N5C5	Missense_Mutation	SNP	ENST00000452135.2	37	CCDS4453.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.513712	0.85389	.	.	ENSG00000050748	ENST00000452135;ENST00000393360;ENST00000425491	D;D;D	0.97575	-4.44;-4.44;-4.44	5.52	5.52	0.82312	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.055791	0.64402	D	0.000001	D	0.99174	0.9714	H	0.98918	4.37	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98826	1.0749	10	0.87932	D	0	-25.1422	15.6962	0.77502	0.0:0.0:0.0:1.0	.	207;207;207	P45984-5;P45984-2;P45984	.;.;MK09_HUMAN	A	207	ENSP00000394560:D207A;ENSP00000377028:D207A;ENSP00000397422:D207A	ENSP00000377028:D207A	D	-	2	0	MAPK9	179607113	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.930000	0.87610	2.105000	0.64084	0.529000	0.55759	GAT	.		0.428	MAPK9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253530.3		
MATN4	8785	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	43933399	43933399	+	Missense_Mutation	SNP	C	C	T	rs114313957	byFrequency	TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr20:43933399C>T	ENST00000372754.1	-	2	120	c.112G>A	c.(112-114)Gtg>Atg	p.V38M	MATN4_ENST00000342716.4_Missense_Mutation_p.V38M|RBPJL_ENST00000343694.3_5'Flank|RBPJL_ENST00000372741.3_5'Flank|RBPJL_ENST00000372743.1_5'Flank|MATN4_ENST00000372756.1_Missense_Mutation_p.V38M|MATN4_ENST00000353917.5_Missense_Mutation_p.V38M|MATN4_ENST00000360607.6_Missense_Mutation_p.V38M|MATN4_ENST00000372751.4_Intron|MATN4_ENST00000537548.1_Missense_Mutation_p.V38M			O95460	MATN4_HUMAN	matrilin 4	38	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				CTGTCAATCACGAACACCAGA	0.642																																					p.V38M		.											.	MATN4	90	0			c.G112A						.						25.0	22.0	23.0					20																	43933399		2198	4284	6482	SO:0001583	missense	8785	exon3			CAATCACGAACAC	AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.112G>A	20.37:g.43933399C>T	ENSP00000361840:p.Val38Met	88.0	0.0		116.0	28.0	NM_030592	A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Missense_Mutation	SNP	ENST00000372754.1	37		.	.	.	.	.	.	.	.	.	.	C	13.12	2.141067	0.37825	.	.	ENSG00000124159	ENST00000372754;ENST00000372756;ENST00000353917;ENST00000360607;ENST00000342716;ENST00000537548;ENST00000255132	D;D;D;D;D;D	0.87729	-2.29;-2.29;-2.29;-2.29;-2.29;-2.29	4.2	2.1	0.27182	.	0.567187	0.14655	N	0.306376	D	0.82912	0.5140	M	0.67700	2.07	0.80722	D	1	B;B;B	0.28512	0.032;0.097;0.214	B;B;B	0.28139	0.023;0.086;0.086	T	0.79588	-0.1741	10	0.54805	T	0.06	.	4.952	0.14019	0.0:0.6284:0.1751:0.1964	.	38;38;38	A6NNA4;O95460-4;O95460-2	.;.;.	M	38	ENSP00000361840:V38M;ENSP00000361842:V38M;ENSP00000243983:V38M;ENSP00000353819:V38M;ENSP00000343164:V38M;ENSP00000440328:V38M	ENSP00000255132:V38M	V	-	1	0	MATN4	43366813	0.999000	0.42202	0.988000	0.46212	0.975000	0.68041	1.406000	0.34646	0.943000	0.37553	0.462000	0.41574	GTG	C|0.987;G|0.013		0.642	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000080335.1		
MEGF6	1953	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	3425655	3425655	+	Silent	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr1:3425655C>T	ENST00000356575.4	-	12	1738	c.1512G>A	c.(1510-1512)acG>acA	p.T504T	MEGF6_ENST00000294599.4_Silent_p.T399T	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	504						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		TCTCTGTGAGCGTGTGTTCGC	0.672																																					p.T504T	Ovarian(73;978 3658)	.											.	MEGF6	90	0			c.G1512A						.						15.0	18.0	17.0					1																	3425655		1958	4117	6075	SO:0001819	synonymous_variant	1953	exon12			TGTGAGCGTGTGT	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.1512G>A	1.37:g.3425655C>T		114.0	0.0		138.0	41.0	NM_001409	Q4AC86|Q5VV39	Silent	SNP	ENST00000356575.4	37	CCDS41237.1																																																																																			.		0.672	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354866.1	NM_001409	
MFSD4	148808	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	205568282	205568282	+	Silent	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr1:205568282T>C	ENST00000367147.4	+	9	1485	c.1392T>C	c.(1390-1392)taT>taC	p.Y464Y	MFSD4_ENST00000539267.1_Nonstop_Mutation_p.*441Q|MFSD4_ENST00000478555.1_3'UTR|MFSD4_ENST00000536357.1_Silent_p.Y377Y	NM_181644.4	NP_857595.3	Q8N468	MFSD4_HUMAN	major facilitator superfamily domain containing 4	464					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			AGGGCAGCTATAGTTTCCTGG	0.483																																					p.Y464Y		.											.	MFSD4	92	0			c.T1392C						.						438.0	386.0	404.0					1																	205568282		2203	4300	6503	SO:0001819	synonymous_variant	148808	exon9			CAGCTATAGTTTC	BC036549	CCDS1455.1	1q32.1	2008-02-05			ENSG00000174514	ENSG00000174514			25433	protein-coding gene	gene with protein product							Standard	NM_181644		Approved	DKFZp761N1114, FLJ34577, UNQ3064, FLJ25004	uc001hcv.4	Q8N468	OTTHUMG00000037197	ENST00000367147.4:c.1392T>C	1.37:g.205568282T>C		369.0	0.0		317.0	73.0	NM_181644	B7Z8X3|Q6UY25|Q8NAY0|Q8TCP4	Silent	SNP	ENST00000367147.4	37	CCDS1455.1	.	.	.	.	.	.	.	.	.	.	T	13.37	2.215492	0.39102	.	.	ENSG00000174514	ENST00000539267	.	.	.	5.64	-3.36	0.04913	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-15.5828	15.7076	0.77598	0.0:0.817:0.0:0.183	.	.	.	.	Q	441	.	.	X	+	1	0	MFSD4	203834905	1.000000	0.71417	0.985000	0.45067	0.992000	0.81027	0.873000	0.28052	-0.496000	0.06650	-0.376000	0.06991	TAG	.		0.483	MFSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090391.1	NM_181644	
MGLL	11343	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	127413989	127413989	+	Silent	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr3:127413989C>T	ENST00000434178.2	-	7	1511	c.615G>A	c.(613-615)ctG>ctA	p.L205L	MGLL_ENST00000453507.2_Silent_p.L185L|MGLL_ENST00000265052.5_Silent_p.L215L|MGLL_ENST00000398101.3_Silent_p.L179L|MGLL_ENST00000476682.1_5'UTR|MGLL_ENST00000398104.1_Silent_p.L205L			Q99685	MGLL_HUMAN	monoglyceride lipase	205					acylglycerol acyl-chain remodeling (GO:0036155)|acylglycerol catabolic process (GO:0046464)|arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|fatty acid biosynthetic process (GO:0006633)|glycerophospholipid biosynthetic process (GO:0046474)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|long term synaptic depression (GO:0060292)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|regulation of endocannabinoid signaling pathway (GO:2000124)|regulation of inflammatory response (GO:0050727)|regulation of sensory perception of pain (GO:0051930)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acylglycerol lipase activity (GO:0047372)|lipid binding (GO:0008289)|lysophospholipase activity (GO:0004622)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6						AGCACACCTTCAGCCCTGCCC	0.612																																					p.L215L		.											.	MGLL	90	0			c.G645A						.						49.0	54.0	52.0					3																	127413989		2067	4195	6262	SO:0001819	synonymous_variant	11343	exon7			CACCTTCAGCCCT	BC000551	CCDS43148.1, CCDS46902.1, CCDS58852.1	3p13-q13.33	2014-03-14			ENSG00000074416	ENSG00000074416	3.1.1.23		17038	protein-coding gene	gene with protein product		609699				9495531	Standard	NM_007283		Approved	HU-K5, MGL	uc003ejx.4	Q99685	OTTHUMG00000159641	ENST00000434178.2:c.615G>A	3.37:g.127413989C>T		232.0	0.0		165.0	36.0	NM_007283	B3KRC2|B7Z9D1|Q6IBG9|Q96AA5	Silent	SNP	ENST00000434178.2	37	CCDS43148.1																																																																																			.		0.612	MGLL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356637.2	NM_007283	
MIPEP	4285	broad.mit.edu;bcgsc.ca	37	13	24384001	24384001	+	Silent	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr13:24384001A>G	ENST00000382172.3	-	15	1814	c.1716T>C	c.(1714-1716)gaT>gaC	p.D572D		NM_005932.3	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase	572					protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(12)|prostate(2)|skin(1)	27		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		GAAGTTGCATATCAGCTGCAG	0.338																																					p.D572D		.											.	MIPEP	90	0			c.T1716C						.						107.0	111.0	109.0					13																	24384001		2203	4300	6503	SO:0001819	synonymous_variant	4285	exon15			TTGCATATCAGCT		CCDS9303.1	13q12	2011-01-17			ENSG00000027001	ENSG00000027001	3.4.24.59		7104	protein-coding gene	gene with protein product		602241				9073519	Standard	NM_005932		Approved	MIP	uc001uox.4	Q99797	OTTHUMG00000016573	ENST00000382172.3:c.1716T>C	13.37:g.24384001A>G		57.0	0.0		66.0	6.0	NM_005932	Q5JV15|Q5T9Q9|Q96G65	Silent	SNP	ENST00000382172.3	37	CCDS9303.1																																																																																			.		0.338	MIPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044169.1		
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	151970873	151970873	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr7:151970873C>A	ENST00000262189.6	-	7	1147	c.929G>T	c.(928-930)tGt>tTt	p.C310F	KMT2C_ENST00000355193.2_Missense_Mutation_p.C310F	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	310					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.C310S(2)									TCCTGCAGCACAAGGATAATG	0.448																																					p.C310F		.											.	MLL3	1398	2	Substitution - Missense(2)	endometrium(2)	c.G929T						.						215.0	200.0	205.0					7																	151970873		2203	4300	6503	SO:0001583	missense	58508	exon7			GCAGCACAAGGAT	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.929G>T	7.37:g.151970873C>A	ENSP00000262189:p.Cys310Phe	472.0	0.0		394.0	18.0	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.366743	0.61513	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.94330	-3.4;-3.4	4.87	4.87	0.63330	Zinc finger, PHD-type (1);	0.000000	0.48767	D	0.000161	D	0.97907	0.9312	H	0.96460	3.825	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.99379	1.0922	10	0.87932	D	0	.	18.3752	0.90433	0.0:1.0:0.0:0.0	.	310	Q8NEZ4	MLL3_HUMAN	F	310	ENSP00000262189:C310F;ENSP00000347325:C310F	ENSP00000262189:C310F	C	-	2	0	MLL3	151601806	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.752000	0.85141	2.423000	0.82170	0.650000	0.86243	TGT	.		0.448	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MMAA	166785	broad.mit.edu;bcgsc.ca	37	4	146575235	146575235	+	Silent	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr4:146575235A>G	ENST00000281317.5	+	6	2119	c.909A>G	c.(907-909)caA>caG	p.Q303Q	MMAA_ENST00000541599.1_Silent_p.Q22Q	NM_172250.2	NP_758454.1	Q8IVH4	MMAA_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblA type	303					cellular lipid metabolic process (GO:0044255)|cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)	17	all_hematologic(180;0.151)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAAGGATACAAGCGGAATATG	0.428																																					p.Q303Q		.											.	MMAA	91	0			c.A909G						.						187.0	175.0	179.0					4																	146575235		2203	4300	6503	SO:0001819	synonymous_variant	166785	exon6			GATACAAGCGGAA	AF524841	CCDS3766.1	4q31.1	2011-05-12	2005-07-11			ENSG00000151611			18871	protein-coding gene	gene with protein product		607481	"""methylmalonic aciduria (cobalamin deficiency) type A"""			12438653	Standard	NM_172250		Approved	cblA	uc003ikh.4	Q8IVH4		ENST00000281317.5:c.909A>G	4.37:g.146575235A>G		121.0	0.0		110.0	6.0	NM_172250	B3KX40|Q495G7	Silent	SNP	ENST00000281317.5	37	CCDS3766.1																																																																																			.		0.428	MMAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364668.2		
MRGPRX1	259249	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	18955787	18955787	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr11:18955787G>A	ENST00000302797.3	-	1	769	c.545C>T	c.(544-546)gCg>gTg	p.A182V	MRGPRX1_ENST00000526914.1_5'UTR|RP11-583F24.8_ENST00000528646.1_RNA	NM_147199.3	NP_671732.3	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	182					acute-phase response (GO:0006953)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|pancreas(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						AATCAGCCACGCGACTGTGAT	0.522																																					p.A182V		.											.	MRGPRX1	92	0			c.C545T						.						134.0	113.0	120.0					11																	18955787		2194	4286	6480	SO:0001583	missense	259249	exon1			AGCCACGCGACTG		CCDS7846.1	11p15.1	2013-10-10			ENSG00000170255	ENSG00000170255		"""GPCR / Class A : Orphans"""	17962	protein-coding gene	gene with protein product		607227				11551509	Standard	NM_147199		Approved	MRGX1	uc001mpg.3	Q96LB2	OTTHUMG00000162655	ENST00000302797.3:c.545C>T	11.37:g.18955787G>A	ENSP00000305766:p.Ala182Val	92.0	1.0		79.0	11.0	NM_147199	Q4V9L2|Q8TDD8|Q8TDD9	Missense_Mutation	SNP	ENST00000302797.3	37	CCDS7846.1	.	.	.	.	.	.	.	.	.	.	.	10.32	1.318205	0.23994	.	.	ENSG00000170255	ENST00000302797	T	0.33865	1.39	2.28	1.23	0.21249	GPCR, rhodopsin-like superfamily (1);	1.195960	0.05934	N	0.635713	T	0.22781	0.0550	N	0.26162	0.8	0.09310	N	1	P	0.39940	0.696	B	0.37198	0.243	T	0.15665	-1.0429	10	0.15499	T	0.54	.	6.0716	0.19893	0.2089:0.0:0.7911:0.0	.	182	Q96LB2	MRGX1_HUMAN	V	182	ENSP00000305766:A182V	ENSP00000305766:A182V	A	-	2	0	MRGPRX1	18912363	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.892000	0.01610	0.409000	0.25649	0.491000	0.48974	GCG	.		0.522	MRGPRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369913.1	NM_147199	
MTFR2	113115	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	136562631	136562631	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr6:136562631C>G	ENST00000420702.1	-	5	854	c.465G>C	c.(463-465)caG>caC	p.Q155H	MTFR2_ENST00000451457.2_Missense_Mutation_p.Q155H	NM_001099286.1	NP_001092756.1	Q6P444	MTFR2_HUMAN	mitochondrial fission regulator 2	155					aerobic respiration (GO:0009060)|mitochondrial fission (GO:0000266)|mitochondrion organization (GO:0007005)	mitochondrion (GO:0005739)											TTGCTGCAATCTGAGAGCGAA	0.358																																					p.Q155H		.											.	.	.	0			c.G465C						.						98.0	91.0	94.0					6																	136562631		2203	4300	6503	SO:0001583	missense	113115	exon5			TGCAATCTGAGAG	BC011716	CCDS5176.1	6q23.2	2012-11-30	2012-11-29	2012-11-29	ENSG00000146410	ENSG00000146410			21115	protein-coding gene	gene with protein product			"""DUF729 domain containing 1"", ""family with sequence similarity 54, member A"""	DUFD1, FAM54A			Standard	NM_138419		Approved		uc003qgt.1	Q6P444	OTTHUMG00000015643	ENST00000420702.1:c.465G>C	6.37:g.136562631C>G	ENSP00000395232:p.Gln155His	155.0	0.0		149.0	10.0	NM_138419	A8K8D8|E1P585|Q5JWR7|Q6ZUE8|Q7L3U6|Q9BZ39	Missense_Mutation	SNP	ENST00000420702.1	37	CCDS5176.1	.	.	.	.	.	.	.	.	.	.	C	18.19	3.568702	0.65651	.	.	ENSG00000146410	ENST00000451457;ENST00000420702;ENST00000418509	T;T;T	0.70282	-0.47;-0.47;-0.47	5.59	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.80691	0.4671	M	0.87547	2.89	0.49051	D	0.999746	D	0.89917	1.0	D	0.97110	1.0	D	0.84097	0.0393	10	0.87932	D	0	-12.3202	9.8347	0.40963	0.0:0.8405:0.0:0.1595	.	155	Q6P444	FA54A_HUMAN	H	155;155;112	ENSP00000407010:Q155H;ENSP00000395232:Q155H;ENSP00000410861:Q112H	ENSP00000410861:Q112H	Q	-	3	2	FAM54A	136604324	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.406000	0.34646	1.367000	0.46095	0.462000	0.41574	CAG	.		0.358	MTFR2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042378.2	NM_138419	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	9011461	9011461	+	Silent	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:9011461A>G	ENST00000397910.4	-	36	38975	c.38772T>C	c.(38770-38772)gaT>gaC	p.D12924D		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12926	SEA 6. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGCAGATGGCATCCATTCCAG	0.542																																					p.D12924D		.											ENSG00000232861,NS,carcinoma,-2	MUC16	566	0			c.T38772C						.						149.0	133.0	138.0					19																	9011461		1933	4133	6066	SO:0001819	synonymous_variant	94025	exon36			GATGGCATCCATT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.38772T>C	19.37:g.9011461A>G		241.0	0.0		154.0	12.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																			.		0.542	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MYH2	4620	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	10432947	10432947	+	Silent	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr17:10432947C>T	ENST00000245503.5	-	24	3435	c.3051G>A	c.(3049-3051)caG>caA	p.Q1017Q	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000532183.2_Intron|RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000397183.2_Silent_p.Q1017Q	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1017					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CCTCCTCTGCCTGCAGGTCAT	0.478																																					p.Q1017Q		.											.	MYH2	194	0			c.G3051A						.						169.0	162.0	165.0					17																	10432947		2203	4297	6500	SO:0001819	synonymous_variant	4620	exon24			CTCTGCCTGCAGG		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.3051G>A	17.37:g.10432947C>T		335.0	0.0		362.0	166.0	NM_017534	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	ENST00000245503.5	37	CCDS11156.1																																																																																			.		0.478	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534	
MYO3B	140469	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	171259467	171259467	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr2:171259467C>G	ENST00000408978.4	+	19	2382	c.2239C>G	c.(2239-2241)Cag>Gag	p.Q747E	MYO3B_ENST00000334231.6_Missense_Mutation_p.Q756E|MYO3B_ENST00000409044.3_Missense_Mutation_p.Q747E|MYO3B_ENST00000602629.1_3'UTR	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	747	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						TGAGCAAATCCAGTACTATTT	0.413																																					p.Q747E		.											.	MYO3B	530	0			c.C2239G						.						125.0	114.0	117.0					2																	171259467		1872	4107	5979	SO:0001583	missense	140469	exon19			CAAATCCAGTACT		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.2239C>G	2.37:g.171259467C>G	ENSP00000386213:p.Gln747Glu	126.0	0.0		102.0	16.0	NM_001083615	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Missense_Mutation	SNP	ENST00000408978.4	37	CCDS42773.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.879044	0.91740	.	.	ENSG00000071909	ENST00000409044;ENST00000408978;ENST00000317915;ENST00000484338;ENST00000334231	T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18	6.02	6.02	0.97574	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.93446	0.7909	H	0.98629	4.285	0.80722	D	1	D;D;D	0.76494	0.982;0.999;0.997	D;D;D	0.72075	0.91;0.975;0.976	D	0.95115	0.8241	10	0.87932	D	0	.	20.5407	0.99260	0.0:1.0:0.0:0.0	.	747;747;747	Q8WXR4-5;Q8WXR4-4;Q8WXR4	.;.;MYO3B_HUMAN	E	747;747;746;756;756	ENSP00000386497:Q747E;ENSP00000386213:Q747E;ENSP00000446237:Q756E;ENSP00000335100:Q756E	ENSP00000314213:Q746E	Q	+	1	0	MYO3B	170967713	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.788000	0.85771	2.865000	0.98341	0.655000	0.94253	CAG	.		0.413	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1		
MYO1B	4430	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	192160940	192160940	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr2:192160940T>G	ENST00000392318.3	+	3	486	c.239T>G	c.(238-240)cTg>cGg	p.L80R	MYO1B_ENST00000339514.4_Missense_Mutation_p.L80R|MYO1B_ENST00000392316.1_Missense_Mutation_p.L80R|MYO1B_ENST00000304164.4_Missense_Mutation_p.L80R	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	80	Myosin motor.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			TTTTATGAACTGAGCCCTCAC	0.378																																					p.L80R		.											.	MYO1B	238	0			c.T239G						.						94.0	88.0	90.0					2																	192160940		2203	4300	6503	SO:0001583	missense	4430	exon3			ATGAACTGAGCCC	L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.239T>G	2.37:g.192160940T>G	ENSP00000376132:p.Leu80Arg	101.0	1.0		82.0	21.0	NM_012223	O43794|Q7Z6L5	Missense_Mutation	SNP	ENST00000392318.3	37	CCDS46477.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.723450	0.89298	.	.	ENSG00000128641	ENST00000418908;ENST00000339514;ENST00000439452;ENST00000392318;ENST00000304164;ENST00000438652;ENST00000451437;ENST00000420448;ENST00000392316	D;D;D;D;D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41;-2.41;-2.41;-2.41;-2.41	5.72	5.72	0.89469	Myosin head, motor domain (2);	0.091134	0.46145	D	0.000307	D	0.93976	0.8071	M	0.75615	2.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.989	D	0.94080	0.7343	10	0.52906	T	0.07	.	15.9799	0.80102	0.0:0.0:0.0:1.0	.	80;80	O43795;O43795-2	MYO1B_HUMAN;.	R	80	ENSP00000401324:L80R;ENSP00000341903:L80R;ENSP00000376132:L80R;ENSP00000306382:L80R;ENSP00000399459:L80R;ENSP00000388140:L80R;ENSP00000387610:L80R;ENSP00000376130:L80R	ENSP00000306382:L80R	L	+	2	0	MYO1B	191869185	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.839000	0.86812	2.184000	0.69523	0.472000	0.43445	CTG	.		0.378	MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334774.1	NM_012223	
NDC80	10403	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	2610833	2610833	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr18:2610833G>A	ENST00000261597.4	+	16	1946	c.1764G>A	c.(1762-1764)atG>atA	p.M588I		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	588	Interaction with NEK2 and ZWINT.|Interaction with the C-terminus of CDCA1 and the SPBC24-SPBC25 subcomplex.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						TGTTAGAGATGGTTGCTACAC	0.373																																					p.M588I		.											.	NDC80	91	0			c.G1764A						.						169.0	149.0	156.0					18																	2610833		2203	4300	6503	SO:0001583	missense	10403	exon16			AGAGATGGTTGCT	AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.1764G>A	18.37:g.2610833G>A	ENSP00000261597:p.Met588Ile	213.0	0.0		174.0	22.0	NM_006101	Q6PJX2	Missense_Mutation	SNP	ENST00000261597.4	37	CCDS11827.1	.	.	.	.	.	.	.	.	.	.	G	10.71	1.425834	0.25726	.	.	ENSG00000080986	ENST00000261597	T	0.46451	0.87	5.43	4.5	0.54988	.	0.264830	0.45606	D	0.000348	T	0.31702	0.0805	L	0.44542	1.39	0.30725	N	0.74784	B	0.20164	0.042	B	0.13407	0.009	T	0.15752	-1.0426	10	0.32370	T	0.25	-6.95	8.2722	0.31851	0.0842:0.1595:0.7563:0.0	.	588	O14777	NDC80_HUMAN	I	588	ENSP00000261597:M588I	ENSP00000261597:M588I	M	+	3	0	NDC80	2600833	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	1.917000	0.39996	2.547000	0.85894	0.650000	0.86243	ATG	.		0.373	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254327.1	NM_006101	
NOS3	4846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150708074	150708074	+	Splice_Site	SNP	G	G	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr7:150708074G>C	ENST00000297494.3	+	23	3341	c.2984G>C	c.(2983-2985)gGg>gCg	p.G995A	ATG9B_ENST00000494791.1_5'Flank|NOS3_ENST00000461406.1_Splice_Site_p.G789A|NOS3_ENST00000477227.1_3'UTR	NM_000603.4	NP_000594.2	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TTCATCCGGGGGTAAGTGAGA	0.622																																					p.G995A		.											.	NOS3	1011	0			c.G2984C						.						36.0	34.0	35.0					7																	150708074		2203	4300	6503	SO:0001630	splice_region_variant	4846	exon23			TCCGGGGGTAAGT		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000297494.3:c.2984+1G>C	7.37:g.150708074G>C		78.0	0.0		48.0	10.0	NM_000603	Q495E5	Missense_Mutation	SNP	ENST00000297494.3	37	CCDS5912.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.60|14.60	2.583779|2.583779	0.46006|0.46006	.|.	.|.	ENSG00000164867|ENSG00000164867	ENST00000297494;ENST00000461406|ENST00000475017	T;T|.	0.32023|.	1.47;1.47|.	4.61|4.61	4.61|4.61	0.57282|0.57282	Riboflavin synthase-like beta-barrel (1);Ferredoxin reductase-type FAD-binding domain (1);|.	0.000000|.	0.56097|.	D|.	0.000031|.	T|T	0.33933|0.33933	0.0880|0.0880	N|N	0.03154|0.03154	-0.405|-0.405	0.80722|0.80722	D|D	1|1	B;B|.	0.19200|.	0.034;0.0|.	B;B|.	0.22601|.	0.04;0.002|.	T|T	0.24799|0.24799	-1.0150|-1.0150	10|5	0.35671|.	T|.	0.21|.	-5.9629|-5.9629	14.9693|14.9693	0.71220|0.71220	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	789;995|.	E7ESA7;P29474|.	.;NOS3_HUMAN|.	A|L	995;789|289	ENSP00000297494:G995A;ENSP00000417143:G789A|.	ENSP00000297494:G995A|.	G|V	+|+	2|1	0|0	NOS3|NOS3	150339007|150339007	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.720000|0.720000	0.41350|0.41350	5.241000|5.241000	0.65384|0.65384	2.377000|2.377000	0.81083|0.81083	0.491000|0.491000	0.48974|0.48974	GGG|GTC	.		0.622	NOS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350750.2	NM_000603	Missense_Mutation
NRXN3	9369	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	79269978	79269978	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr14:79269978G>A	ENST00000554719.1	+	6	1432	c.941G>A	c.(940-942)aGc>aAc	p.S314N	NRXN3_ENST00000335750.5_Missense_Mutation_p.S314N	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	0					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		TCCATCCTGAGCTATGATGGT	0.493																																					p.S314N		.											.	NRXN3	587	0			c.G941A						.						178.0	134.0	149.0					14																	79269978		2203	4300	6503	SO:0001583	missense	9369	exon6			TCCTGAGCTATGA	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.941G>A	14.37:g.79269978G>A	ENSP00000451648:p.Ser314Asn	130.0	0.0		107.0	27.0	NM_004796	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000554719.1	37	CCDS9870.1	.	.	.	.	.	.	.	.	.	.	G	19.46	3.831635	0.71258	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750	T;T	0.80304	-1.36;-1.36	5.91	5.91	0.95273	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.207171	0.51477	D	0.000086	D	0.90147	0.6921	.	.	.	0.43338	D	0.995381	D;D	0.76494	0.996;0.999	D;D	0.73380	0.978;0.98	D	0.89074	0.3471	8	.	.	.	.	20.2985	0.98592	0.0:0.0:1.0:0.0	.	687;314	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	N	687;685;314;314	ENSP00000451648:S314N;ENSP00000338349:S314N	.	S	+	2	0	NRXN3	78339731	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	6.265000	0.72534	2.793000	0.96121	0.655000	0.94253	AGC	.		0.493	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250	
NSRP1	84081	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	28511699	28511699	+	Silent	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr17:28511699A>G	ENST00000247026.5	+	7	747	c.684A>G	c.(682-684)ccA>ccG	p.P228P	NSRP1_ENST00000540900.3_3'UTR	NM_001261467.1|NM_032141.3	NP_001248396.1|NP_115517.1	Q9H0G5	NSRP1_HUMAN	nuclear speckle splicing regulatory protein 1	228					developmental process (GO:0032502)|mRNA processing (GO:0006397)|nucleocytoplasmic transport (GO:0006913)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	14						ACAGAATACCACAAGAGAAAT	0.368																																					p.P228P		.											.	NSRP1	91	0			c.A684G						.						60.0	59.0	59.0					17																	28511699		2203	4300	6503	SO:0001819	synonymous_variant	84081	exon7			AATACCACAAGAG	AL136806	CCDS11255.1, CCDS74025.1	17q11.2	2011-05-24	2011-05-24	2011-05-24	ENSG00000126653	ENSG00000126653			25305	protein-coding gene	gene with protein product			"""coiled-coil domain containing 55"""	CCDC55		11230166	Standard	NM_032141		Approved	DKFZP434K1421, NSrp70	uc002heu.4	Q9H0G5	OTTHUMG00000132754	ENST00000247026.5:c.684A>G	17.37:g.28511699A>G		145.0	0.0		280.0	15.0	NM_032141	Q6FI71	Silent	SNP	ENST00000247026.5	37	CCDS11255.1																																																																																			.		0.368	NSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256121.2	NM_032141	
NUP210	23225	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	13383318	13383318	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr3:13383318T>A	ENST00000254508.5	-	23	3240	c.3158A>T	c.(3157-3159)cAg>cTg	p.Q1053L	NUP210_ENST00000485755.1_5'Flank	NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1053					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					TAGACTGGTCTGGCCGATGGC	0.522																																					p.Q1053L		.											.	NUP210	256	0			c.A3158T						.						151.0	126.0	134.0					3																	13383318		2203	4300	6503	SO:0001583	missense	23225	exon23			CTGGTCTGGCCGA	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.3158A>T	3.37:g.13383318T>A	ENSP00000254508:p.Gln1053Leu	217.0	0.0		193.0	57.0	NM_024923	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	37	CCDS33704.1	.	.	.	.	.	.	.	.	.	.	T	17.82	3.482924	0.63962	.	.	ENSG00000132182	ENST00000254508	T	0.04917	3.53	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.19406	0.0466	M	0.72894	2.215	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.13602	-1.0503	10	0.02654	T	1	-17.7609	14.8389	0.70209	0.0:0.0:0.0:1.0	.	1053	Q8TEM1	PO210_HUMAN	L	1053	ENSP00000254508:Q1053L	ENSP00000254508:Q1053L	Q	-	2	0	NUP210	13358318	1.000000	0.71417	1.000000	0.80357	0.023000	0.10783	7.073000	0.76784	2.147000	0.66899	0.455000	0.32223	CAG	.		0.522	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	NM_024923	
OR5D18	219438	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	55587762	55587762	+	Silent	SNP	T	T	C	rs116682108	byFrequency	TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr11:55587762T>C	ENST00000333976.4	+	1	677	c.657T>C	c.(655-657)taT>taC	p.Y219Y		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	219						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				TCACATCTTATGCGTTCATTG	0.483													N|||	15	0.00299521	0.0106	0.0014	5008	,	,		20417	0.0		0.0	False		,,,				2504	0.0				p.Y219Y		.											.	OR5D18	71	0			c.T657C						.	T		38,4362		0,38,2162	189.0	156.0	167.0		657	-2.3	0.0	11	dbSNP_132	167	2,8590		0,2,4294	no	coding-synonymous	OR5D18	NM_001001952.1		0,40,6456	CC,CT,TT		0.0233,0.8636,0.3079		219/314	55587762	40,12952	2200	4296	6496	SO:0001819	synonymous_variant	219438	exon1			ATCTTATGCGTTC	AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.657T>C	11.37:g.55587762T>C		219.0	0.0		166.0	24.0	NM_001001952	Q6IF67|Q6IFD3|Q96RB3	Silent	SNP	ENST00000333976.4	37	CCDS31510.1																																																																																			T|0.997;C|0.003		0.483	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1	NM_001001952	
OSBPL7	114881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	45885990	45885990	+	Silent	SNP	G	G	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr17:45885990G>A	ENST00000007414.3	-	22	2525	c.2334C>T	c.(2332-2334)gcC>gcT	p.A778A	OSBPL7_ENST00000392507.3_Silent_p.A778A	NM_145798.2	NP_665741.1	Q9BZF2	OSBL7_HUMAN	oxysterol binding protein-like 7	778					cellular response to cholesterol (GO:0071397)|lipid transport (GO:0006869)|positive regulation of proteasomal protein catabolic process (GO:1901800)	autophagic vacuole (GO:0005776)|cytosol (GO:0005829)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			autonomic_ganglia(1)|endometrium(6)|kidney(2)|large_intestine(5)|liver(2)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32						TTCTCTTCTGGGCCTCAGCGG	0.597																																					p.A778A		.											.	OSBPL7	68	0			c.C2334T						.						258.0	230.0	240.0					17																	45885990		2203	4300	6503	SO:0001819	synonymous_variant	114881	exon22			CTTCTGGGCCTCA	AF392446	CCDS11515.1	17q21	2013-01-10				ENSG00000006025		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16387	protein-coding gene	gene with protein product		606735				14593528, 11735225	Standard	NM_145798		Approved	ORP7, MGC71150	uc002ilx.1	Q9BZF2		ENST00000007414.3:c.2334C>T	17.37:g.45885990G>A		305.0	0.0		237.0	33.0	NM_145798	D3DTT6|Q6PIV6	Silent	SNP	ENST00000007414.3	37	CCDS11515.1																																																																																			.		0.597	OSBPL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441367.1	NM_017731	
PARD3	56288	broad.mit.edu;bcgsc.ca	37	10	34690758	34690758	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr10:34690758G>C	ENST00000374789.3	-	6	1127	c.802C>G	c.(802-804)Ctg>Gtg	p.L268V	PARD3_ENST00000374773.1_Missense_Mutation_p.L268V|PARD3_ENST00000544292.1_5'UTR|PARD3_ENST00000346874.4_Missense_Mutation_p.L268V|PARD3_ENST00000374776.1_Missense_Mutation_p.L268V|PARD3_ENST00000545693.1_Missense_Mutation_p.L268V|PARD3_ENST00000374788.3_Missense_Mutation_p.L268V|PARD3_ENST00000350537.4_Missense_Mutation_p.L268V|PARD3_ENST00000374794.3_Missense_Mutation_p.L224V|PARD3_ENST00000545260.1_Missense_Mutation_p.L224V|PARD3_ENST00000340077.5_Missense_Mutation_p.L268V|PARD3_ENST00000374790.3_Missense_Mutation_p.L224V	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	268					apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				ACTTACTCCAGAGAAAAGTTG	0.428																																					p.L268V		.											.	PARD3	92	0			c.C802G						.						202.0	176.0	185.0					10																	34690758		2203	4300	6503	SO:0001583	missense	56288	exon6			ACTCCAGAGAAAA	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.802C>G	10.37:g.34690758G>C	ENSP00000363921:p.Leu268Val	78.0	0.0		50.0	5.0	NM_001184788	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Missense_Mutation	SNP	ENST00000374789.3	37	CCDS7178.1	.	.	.	.	.	.	.	.	.	.	G	17.94	3.512260	0.64522	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000350537;ENST00000374790;ENST00000374776;ENST00000340077;ENST00000374773	T;T;T;T;T;T;T;T;T;T;T	0.43688	0.94;2.56;0.94;0.94;0.94;2.56;0.94;2.54;0.94;0.94;0.94	5.93	5.93	0.95920	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.54224	0.1845	L	0.46614	1.455	0.80722	D	1	D;D;D;D;D;D;D;P;P;D;D;B;B	0.71674	0.985;0.992;0.998;0.985;0.998;0.994;0.985;0.931;0.781;0.974;0.987;0.22;0.203	P;D;D;P;D;D;P;P;B;P;P;B;B	0.85130	0.891;0.984;0.997;0.891;0.997;0.918;0.891;0.688;0.358;0.78;0.797;0.141;0.09	T	0.48151	-0.9060	10	0.34782	T	0.22	.	10.3833	0.44125	0.1457:0.0:0.8543:0.0	.	224;224;268;268;268;268;268;268;224;268;268;268;268	Q8TEW0-5;Q8TEW0-3;Q8TEW0-7;Q8TEW0-6;F5H5T0;Q8TEW0-4;Q8TEW0-2;Q8TEW0;Q5VWV2;Q6IQ47;Q8TEW0-8;Q8TEW0-9;Q8TEW0-10	.;.;.;.;.;.;.;PARD3_HUMAN;.;.;.;.;.	V	268;224;268;268;268;224;268;224;268;268;268	ENSP00000443147:L268V;ENSP00000440857:L224V;ENSP00000363921:L268V;ENSP00000363920:L268V;ENSP00000340591:L268V;ENSP00000363926:L224V;ENSP00000311986:L268V;ENSP00000363922:L224V;ENSP00000363908:L268V;ENSP00000341844:L268V;ENSP00000363905:L268V	ENSP00000341844:L268V	L	-	1	2	PARD3	34730764	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.127000	0.57944	2.812000	0.96745	0.555000	0.69702	CTG	.		0.428	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1	NM_019619	
PCDH11Y	83259	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	Y	4966401	4966401	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chrY:4966401G>C	ENST00000333703.4	+	5	1262	c.749G>C	c.(748-750)aGa>aCa	p.R250T	PCDH11Y_ENST00000215473.6_Missense_Mutation_p.R261T|PCDH11Y_ENST00000362095.5_Missense_Mutation_p.R261T	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	261	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R250K(2)|p.R261K(1)		autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						TTTCCTCAAAGATCCAGTACT	0.393																																					p.R261T		.											.	.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G782C						.																																			SO:0001583	missense	83259	exon2			CTCAAAGATCCAG	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.749G>C	Y.37:g.4966401G>C	ENSP00000330552:p.Arg250Thr	284.0	0.0		162.0	21.0	NM_032972	Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	ENST00000333703.4	37	CCDS14776.1																																																																																			.		0.393	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084979.2	NM_032973	
PCDH15	65217	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	55568668	55568668	+	Silent	SNP	A	A	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr10:55568668A>T	ENST00000395445.1	-	36	5536	c.5142T>A	c.(5140-5142)gcT>gcA	p.A1714A	PCDH15_ENST00000395438.1_3'UTR|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395446.1_Silent_p.A910A|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000409834.1_3'UTR|PCDH15_ENST00000395440.1_Silent_p.A648A|PCDH15_ENST00000395442.1_Silent_p.A579A	NM_001142769.1	NP_001136241.1	Q96QU1	PCD15_HUMAN	protocadherin-related 15	0					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GGATATCTTGAGCTTCAGGGT	0.468										HNSCC(58;0.16)																											.		.											.	PCDH15	193	0			.						.						106.0	84.0	91.0					10																	55568668		1568	3578	5146	SO:0001819	synonymous_variant	65217	.			ATCTTGAGCTTCA	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000395445.1:c.5142T>A	10.37:g.55568668A>T		261.0	0.0		212.0	51.0	.	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000395445.1	37																																																																																				.		0.468	PCDH15-007	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000291335.1	NM_033056	
PCDH19	57526	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	99551540	99551540	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chrX:99551540G>T	ENST00000373034.4	-	6	4857	c.3182C>A	c.(3181-3183)gCg>gAg	p.A1061E	PCDH19_ENST00000420881.2_Missense_Mutation_p.A1013E|PCDH19_ENST00000255531.7_Missense_Mutation_p.A1014E|PCDH19_ENST00000464981.1_5'Flank	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	1061					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						AGGGCTAATCGCCTCACAGCC	0.607																																					p.A1061E		.											.	PCDH19	110	0			c.C3182A						.						53.0	56.0	55.0					X																	99551540		2137	4232	6369	SO:0001583	missense	57526	exon6			CTAATCGCCTCAC	AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.3182C>A	X.37:g.99551540G>T	ENSP00000362125:p.Ala1061Glu	65.0	0.0		46.0	22.0	NM_001184880	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	ENST00000373034.4	37	CCDS55462.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.007882	0.54361	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.55234	0.53;0.73;0.53	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.66277	0.2773	L	0.51422	1.61	0.80722	D	1	D;B;B	0.76494	0.999;0.388;0.269	D;B;B	0.81914	0.995;0.299;0.157	T	0.58836	-0.7566	10	0.12430	T	0.62	.	18.9069	0.92466	0.0:0.0:1.0:0.0	.	1061;1014;1013	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	E	1013;1061;1014	ENSP00000400327:A1013E;ENSP00000362125:A1061E;ENSP00000255531:A1014E	ENSP00000255531:A1014E	A	-	2	0	PCDH19	99438196	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.087000	0.94110	2.413000	0.81919	0.600000	0.82982	GCG	.		0.607	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	NM_020766	
PCDHGB7	56099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140798233	140798233	+	Silent	SNP	G	G	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr5:140798233G>A	ENST00000398594.2	+	1	807	c.807G>A	c.(805-807)caG>caA	p.Q269Q	PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA10_ENST00000398610.2_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	269	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCACTGACCAGGACGAGGGCA	0.522																																					p.Q269Q		.											.	PCDHGB7	29	0			c.G807A						.						56.0	58.0	57.0					5																	140798233		2053	4195	6248	SO:0001819	synonymous_variant	56099	exon1			TGACCAGGACGAG	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.807G>A	5.37:g.140798233G>A		37.0	0.0		41.0	5.0	NM_018927	Q9UN63	Silent	SNP	ENST00000398594.2	37	CCDS47293.1																																																																																			.		0.522	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927	
PDCD1LG2	80380	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	5549465	5549465	+	Silent	SNP	C	C	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr9:5549465C>A	ENST00000397747.3	+	4	740	c.492C>A	c.(490-492)acC>acA	p.T164T	PDCD1LG2_ENST00000397745.2_Intron	NM_025239.3	NP_079515.2	Q9BQ51	PD1L2_HUMAN	programmed cell death 1 ligand 2	164	Ig-like C2-type.				immune response (GO:0006955)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				large_intestine(2)|lung(4)|prostate(2)	8	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000767)|Lung(218;0.112)		CTGCCAACACCAGCCACTCCA	0.547																																					p.T164T		.											.	PDCD1LG2	227	0			c.C492A						.						59.0	60.0	60.0					9																	5549465		2203	4300	6503	SO:0001819	synonymous_variant	80380	exon4			CAACACCAGCCAC	AF344424	CCDS6465.1	9p24.2	2014-01-30			ENSG00000197646	ENSG00000197646		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	18731	protein-coding gene	gene with protein product	"""B7 dendritic cell molecule"""	605723				11224527	Standard	NM_025239		Approved	PD-L2, Btdc, PDL2, bA574F11.2, CD273, B7-DC	uc003zjg.4	Q9BQ51	OTTHUMG00000019504	ENST00000397747.3:c.492C>A	9.37:g.5549465C>A		164.0	1.0		74.0	22.0	NM_025239	Q14CN8|Q5T7Z6|Q6JXL8|Q6JXL9	Silent	SNP	ENST00000397747.3	37	CCDS6465.1																																																																																			.		0.547	PDCD1LG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051634.1	NM_025239	
PDCD6	10016	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	306821	306821	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr5:306821G>C	ENST00000264933.4	+	4	413	c.313G>C	c.(313-315)Gac>Cac	p.D105H	PDCD6_ENST00000507528.1_Missense_Mutation_p.D105H|AHRR_ENST00000505113.1_Intron|PDCD6_ENST00000505221.1_Intron|PDCD6_ENST00000511482.1_3'UTR|AHRR_ENST00000316418.5_Intron|AHRR_ENST00000512529.1_Intron	NM_001267556.1|NM_001267558.1|NM_013232.3	NP_001254485.1|NP_001254487.1|NP_037364.1	O75340	PDCD6_HUMAN	programmed cell death 6	105	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)			breast(2)|endometrium(1)|large_intestine(4)|lung(1)	8			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)			GTACGACCGGGACAACTCCGG	0.542																																					p.D105H		.											.	PDCD6	290	0			c.G313C						.						148.0	120.0	129.0					5																	306821		2203	4300	6503	SO:0001583	missense	10016	exon4			GACCGGGACAACT	AF035606	CCDS3854.1, CCDS58940.1, CCDS58941.1, CCDS75222.1, CCDS75223.1	5p15.33	2013-01-10			ENSG00000249915	ENSG00000249915		"""EF-hand domain containing"""	8765	protein-coding gene	gene with protein product	"""apoptosis-linked gene-2"""	601057				8560270	Standard	NM_013232		Approved	ALG-2, PEF1B	uc003jat.1	O75340	OTTHUMG00000090283	ENST00000264933.4:c.313G>C	5.37:g.306821G>C	ENSP00000264933:p.Asp105His	184.0	0.0		220.0	30.0	NM_013232	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Missense_Mutation	SNP	ENST00000264933.4	37	CCDS3854.1	.	.	.	.	.	.	.	.	.	.	g	18.39	3.612557	0.66672	.	.	ENSG00000249915	ENST00000264933;ENST00000507528	T;T	0.46063	0.88;0.88	5.53	5.53	0.82687	EF-hand-like domain (1);	.	.	.	.	T	0.80166	0.4573	H	0.99261	4.49	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.88520	0.3095	9	0.87932	D	0	.	16.9576	0.86263	0.0:0.0:1.0:0.0	.	105;105	Q2YDC2;O75340	.;PDCD6_HUMAN	H	105	ENSP00000264933:D105H;ENSP00000423815:D105H	ENSP00000264933:D105H	D	+	1	0	PDCD6	359821	1.000000	0.71417	1.000000	0.80357	0.178000	0.23041	8.839000	0.92120	2.599000	0.87857	0.650000	0.86243	GAC	.		0.542	PDCD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206609.2	NM_013232	
PHF20	51230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	34515736	34515736	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr20:34515736G>T	ENST00000374012.3	+	14	2168	c.2039G>T	c.(2038-2040)tGc>tTc	p.C680F	PHF20_ENST00000439301.1_3'UTR|RNU6-937P_ENST00000384325.1_RNA			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	680					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					CATGGGGTCTGCATGGGATTA	0.438																																					p.C680F		.											.	PHF20	515	0			c.G2039T						.						149.0	146.0	147.0					20																	34515736		2203	4300	6503	SO:0001583	missense	51230	exon14			GGGTCTGCATGGG	AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.2039G>T	20.37:g.34515736G>T	ENSP00000363124:p.Cys680Phe	120.0	0.0		139.0	50.0	NM_016436	A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Missense_Mutation	SNP	ENST00000374012.3	37	CCDS13268.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875229	0.91664	.	.	ENSG00000025293	ENST00000374012	D	0.99252	-5.63	5.91	5.91	0.95273	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.99746	0.9899	H	0.98965	4.385	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97171	0.9844	10	0.87932	D	0	.	20.2985	0.98592	0.0:0.0:1.0:0.0	.	680	Q9BVI0	PHF20_HUMAN	F	680	ENSP00000363124:C680F	ENSP00000363124:C680F	C	+	2	0	PHF20	33979150	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.296000	0.96104	2.793000	0.96121	0.655000	0.94253	TGC	.		0.438	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078949.2	NM_016436	
PMP2	5375	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	82357106	82357106	+	Silent	SNP	G	G	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr8:82357106G>C	ENST00000256103.2	-	2	328	c.192C>G	c.(190-192)tcC>tcG	p.S64S	RP11-157I4.4_ENST00000524085.2_RNA|PMP2_ENST00000519260.1_Intron	NM_002677.3	NP_002668.1	P02689	MYP2_HUMAN	peripheral myelin protein 2	64					membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	cholesterol binding (GO:0015485)|fatty acid binding (GO:0005504)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6			Epithelial(68;0.186)			CTAGCTTGAAGGAGATTTCTG	0.393																																					p.S64S		.											.	PMP2	90	0			c.C192G						.						138.0	137.0	137.0					8																	82357106		2203	4300	6503	SO:0001819	synonymous_variant	5375	exon2			CTTGAAGGAGATT	X62167	CCDS6229.1	8q21.3-q22.1	2013-03-01			ENSG00000147588	ENSG00000147588		"""Fatty acid binding protein family"""	9117	protein-coding gene	gene with protein product		170715				1720307, 8288226	Standard	NM_002677		Approved	MP2, FABP8, M-FABP	uc003ycb.1	P02689	OTTHUMG00000164600	ENST00000256103.2:c.192C>G	8.37:g.82357106G>C		117.0	0.0		104.0	13.0	NM_002677	Q6FHL4	Silent	SNP	ENST00000256103.2	37	CCDS6229.1																																																																																			.		0.393	PMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379365.1	NM_002677	
POLQ	10721	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	121179064	121179064	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr3:121179064C>A	ENST00000264233.5	-	25	7113	c.6985G>T	c.(6985-6987)Gct>Tct	p.A2329S		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	2329					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		GAGTAGTCAGCAGCCAGTATT	0.398								DNA polymerases (catalytic subunits)																													p.A2329S	Pancreas(152;907 1925 26081 31236 36904)	.											.	POLQ	664	0			c.G6985T						.						75.0	71.0	72.0					3																	121179064		2203	4300	6503	SO:0001583	missense	10721	exon25			AGTCAGCAGCCAG	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.6985G>T	3.37:g.121179064C>A	ENSP00000264233:p.Ala2329Ser	159.0	0.0		155.0	24.0	NM_199420	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	37	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.047027	0.93740	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	D	0.97352	-4.35	5.6	5.6	0.85130	DNA-directed DNA polymerase, family A, palm domain (2);	0.111909	0.64402	D	0.000011	D	0.98501	0.9500	M	0.79693	2.465	0.44908	D	0.997926	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	D	0.99338	1.0911	10	0.72032	D	0.01	.	19.6126	0.95616	0.0:1.0:0.0:0.0	.	2329;1501	O75417;O75417-2	DPOLQ_HUMAN;.	S	1952;2329;2465	ENSP00000264233:A2329S	ENSP00000264233:A2329S	A	-	1	0	POLQ	122661754	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	7.172000	0.77604	2.630000	0.89119	0.591000	0.81541	GCT	.		0.398	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
PRSS35	167681	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	84233541	84233541	+	Silent	SNP	C	C	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr6:84233541C>A	ENST00000369700.3	+	2	558	c.381C>A	c.(379-381)acC>acA	p.T127T	PRSS35_ENST00000536636.1_Silent_p.T127T	NM_153362.2	NP_699193.2	Q8N3Z0	PRS35_HUMAN	protease, serine, 35	127	Peptidase S1.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(2)|large_intestine(12)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	32		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		TGTATGGCACCGACAGCAGGT	0.463																																					p.T127T		.											.	PRSS35	91	0			c.C381A						.						94.0	88.0	90.0					6																	84233541		2203	4300	6503	SO:0001819	synonymous_variant	167681	exon2			TGGCACCGACAGC	BC037170	CCDS4999.1	6q14.2	2010-05-12	2004-07-09	2004-07-09	ENSG00000146250	ENSG00000146250		"""Serine peptidases / Serine peptidases"""	21387	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 158"""	C6orf158			Standard	NM_153362		Approved	MGC46520, dJ223E3.1	uc003pjz.3	Q8N3Z0	OTTHUMG00000015113	ENST00000369700.3:c.381C>A	6.37:g.84233541C>A		210.0	0.0		157.0	10.0	NM_153362	A8K7B3|Q9BQP6	Silent	SNP	ENST00000369700.3	37	CCDS4999.1																																																																																			.		0.463	PRSS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041352.1	NM_153362	
PRSS3	5646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	33796749	33796749	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr9:33796749G>A	ENST00000361005.5	+	2	320	c.320G>A	c.(319-321)gGc>gAc	p.G107D	PRSS3_ENST00000429677.3_Missense_Mutation_p.G43D|PRSS3_ENST00000379405.3_Missense_Mutation_p.G50D|PRSS3_ENST00000342836.4_Missense_Mutation_p.G64D|RP11-133O22.6_ENST00000454429.2_RNA	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	107	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			TTCTGCGGTGGCTCCCTCATC	0.572																																					p.G107D		.											.	PRSS3	90	0			c.G320A						.						125.0	128.0	127.0					9																	33796749		2203	4300	6503	SO:0001583	missense	5646	exon2			GCGGTGGCTCCCT		CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.320G>A	9.37:g.33796749G>A	ENSP00000354280:p.Gly107Asp	229.0	0.0		174.0	21.0	NM_007343	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Missense_Mutation	SNP	ENST00000361005.5	37	CCDS47958.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.816339	0.50527	.	.	ENSG00000010438	ENST00000361005;ENST00000457896;ENST00000342836;ENST00000429677;ENST00000379405	T;D;D;T;D	0.98280	-1.46;-1.53;-4.84;-1.46;-4.84	3.21	3.21	0.36854	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.99149	0.9706	H	0.98068	4.14	0.58432	D	0.999999	D;D;D	0.60575	0.958;0.988;0.958	P;P;P	0.59948	0.866;0.842;0.866	D	0.98834	1.0752	10	0.72032	D	0.01	.	12.3047	0.54895	0.0:0.0:1.0:0.0	.	50;107;64	P35030-3;P35030;P35030-4	.;TRY3_HUMAN;.	D	107;62;64;43;50	ENSP00000354280:G107D;ENSP00000401249:G62D;ENSP00000340889:G64D;ENSP00000401828:G43D;ENSP00000368715:G50D	ENSP00000340889:G64D	G	+	2	0	PRSS3	33786749	1.000000	0.71417	0.928000	0.36995	0.040000	0.13550	8.524000	0.90579	1.538000	0.49270	0.306000	0.20318	GGC	.		0.572	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052121.1	NM_002771	
PSMC4	5704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	40485836	40485836	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:40485836C>G	ENST00000157812.2	+	7	984	c.786C>G	c.(784-786)atC>atG	p.I262M	PSMC4_ENST00000455878.2_Missense_Mutation_p.I231M	NM_006503.3|NM_153001.2	NP_006494.1|NP_694546.1	P43686	PRS6B_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 4	262					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|blastocyst development (GO:0001824)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|inclusion body (GO:0016234)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CTGCCATCATCTTCATAGACG	0.572																																					p.I262M	Colon(105;1478 1543 4034 6132 38638)	.											.	PSMC4	91	0			c.C786G						.						71.0	69.0	69.0					19																	40485836		2203	4300	6503	SO:0001583	missense	5704	exon7			CATCATCTTCATA	U27515	CCDS12547.1, CCDS46076.1	19q13.11-q13.13	2010-04-21			ENSG00000013275	ENSG00000013275		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9551	protein-coding gene	gene with protein product	"""protease 26S subunit 6"", ""Tat-binding protein 7"", ""MB67 interacting protein"""	602707		MIP224		9473509, 8603043	Standard	NM_006503		Approved	TBP7, S6, MGC8570, MGC13687, MGC23214, TBP-7	uc002omq.4	P43686		ENST00000157812.2:c.786C>G	19.37:g.40485836C>G	ENSP00000157812:p.Ile262Met	188.0	0.0		161.0	34.0	NM_006503	Q96FV5|Q9UBM3|Q9UEX3	Missense_Mutation	SNP	ENST00000157812.2	37	CCDS12547.1	.	.	.	.	.	.	.	.	.	.	c	11.95	1.792327	0.31685	.	.	ENSG00000013275	ENST00000157812;ENST00000455878	D;D	0.95949	-3.86;-3.86	6.06	2.25	0.28309	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.046718	0.85682	D	0.000000	D	0.97068	0.9042	M	0.88241	2.94	0.54753	D	0.999985	P;D	0.63046	0.596;0.992	P;D	0.80764	0.498;0.994	D	0.95386	0.8477	10	0.66056	D	0.02	-9.3148	4.3152	0.10990	0.2766:0.5069:0.1348:0.0817	.	231;262	P43686-2;P43686	.;PRS6B_HUMAN	M	262;231	ENSP00000157812:I262M;ENSP00000413869:I231M	ENSP00000157812:I262M	I	+	3	3	PSMC4	45177676	1.000000	0.71417	1.000000	0.80357	0.027000	0.11550	3.832000	0.55783	0.849000	0.35215	-0.176000	0.13171	ATC	.		0.572	PSMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462485.1	NM_006503	
PTAR1	375743	ucsc.edu;bcgsc.ca	37	9	72347125	72347125	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr9:72347125T>C	ENST00000340434.4	-	5	575	c.572A>G	c.(571-573)tAc>tGc	p.Y191C	PTAR1_ENST00000377200.5_Missense_Mutation_p.Y112C	NM_001099666.1	NP_001093136.1	Q7Z6K3	PTAR1_HUMAN	protein prenyltransferase alpha subunit repeat containing 1	191					protein prenylation (GO:0018342)		protein prenyltransferase activity (GO:0008318)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)	5						GTTGCTTGGGTATCTCCCTGC	0.483																																					p.Y191C		.											.	PTAR1	69	0			c.A572G						.						126.0	118.0	120.0					9																	72347125		1973	4154	6127	SO:0001583	missense	375743	exon5			CTTGGGTATCTCC	BC053622	CCDS47978.1	9q21.13	2008-10-01			ENSG00000188647	ENSG00000188647		"""Prenyltransferase alpha subunit repeat containing"""	30449	protein-coding gene	gene with protein product						12477932	Standard	NM_001099666		Approved		uc004ahj.4	Q7Z6K3	OTTHUMG00000019982	ENST00000340434.4:c.572A>G	9.37:g.72347125T>C	ENSP00000344299:p.Tyr191Cys	101.0	0.0		45.0	4.0	NM_001099666	Q5T7V5|Q5T7V6	Missense_Mutation	SNP	ENST00000340434.4	37	CCDS47978.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.635223	0.87760	.	.	ENSG00000188647	ENST00000377200;ENST00000340434	T;T	0.44482	0.92;0.92	6.03	6.03	0.97812	Protein prenyltransferase (1);	0.000000	0.85682	D	0.000000	T	0.60586	0.2280	L	0.52364	1.645	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.61749	-0.6999	10	0.66056	D	0.02	.	16.5582	0.84512	0.0:0.0:0.0:1.0	.	191	Q7Z6K3	PTAR1_HUMAN	C	112;191	ENSP00000366405:Y112C;ENSP00000344299:Y191C	ENSP00000344299:Y191C	Y	-	2	0	PTAR1	71536945	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.012000	0.88631	2.308000	0.77769	0.533000	0.62120	TAC	.		0.483	PTAR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052582.4	NM_001099666	
PTPRH	5794	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55715293	55715293	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:55715293T>C	ENST00000376350.3	-	5	765	c.743A>G	c.(742-744)gAt>gGt	p.D248G	PTPRH_ENST00000263434.5_Intron|PTPRH_ENST00000588559.1_5'UTR	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	248	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		TCTGCCACCATCTCCAGTGCA	0.567																																					p.D248G		.											.	PTPRH	138	0			c.A743G						.						205.0	169.0	181.0					19																	55715293		2203	4300	6503	SO:0001583	missense	5794	exon5			CCACCATCTCCAG		CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.743A>G	19.37:g.55715293T>C	ENSP00000365528:p.Asp248Gly	165.0	1.0		148.0	31.0	NM_002842	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	ENST00000376350.3	37	CCDS33110.1	.	.	.	.	.	.	.	.	.	.	T	11.65	1.701247	0.30142	.	.	ENSG00000080031	ENST00000376350	T	0.57752	0.38	3.56	1.14	0.20703	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.41581	0.1165	M	0.67953	2.075	0.09310	N	0.999993	B;B	0.33103	0.397;0.046	B;B	0.29077	0.098;0.089	T	0.23511	-1.0186	9	0.22109	T	0.4	.	3.331	0.07084	0.0:0.1337:0.2392:0.6272	.	70;248	Q9HD43-2;Q9HD43	.;PTPRH_HUMAN	G	248	ENSP00000365528:D248G	ENSP00000365528:D248G	D	-	2	0	PTPRH	60407105	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.782000	0.04643	0.494000	0.27859	0.496000	0.49642	GAT	.		0.567	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452649.1		
RANBP2	5903	ucsc.edu;bcgsc.ca	37	2	109380631	109380631	+	Silent	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr2:109380631A>G	ENST00000283195.6	+	20	3762	c.3636A>G	c.(3634-3636)aaA>aaG	p.K1212K		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1212	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						AAGAATGGAAAGAACGTGGGA	0.373																																					p.K1212K		.											.	RANBP2	675	0			c.A3636G						.						72.0	75.0	74.0					2																	109380631		2203	4300	6503	SO:0001819	synonymous_variant	5903	exon20			ATGGAAAGAACGT	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.3636A>G	2.37:g.109380631A>G		72.0	0.0		35.0	4.0	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Silent	SNP	ENST00000283195.6	37	CCDS2079.1																																																																																			.		0.373	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
RBM14	10432	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66384504	66384504	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr11:66384504G>T	ENST00000310137.4	+	1	452	c.313G>T	c.(313-315)Gtc>Ttc	p.V105F	RNU4-39P_ENST00000362455.1_RNA|RBM14-RBM4_ENST00000500635.2_Missense_Mutation_p.V105F|RBM4_ENST00000514361.3_Missense_Mutation_p.V105F|RBM14_ENST00000409372.1_Missense_Mutation_p.V105F|RBM14-RBM4_ENST00000511114.1_3'UTR|RBM14-RBM4_ENST00000412278.2_Missense_Mutation_p.V105F|RBM14_ENST00000443702.1_Missense_Mutation_p.V105F|RBM14_ENST00000393979.3_Missense_Mutation_p.V105F|RBM14_ENST00000409738.4_Missense_Mutation_p.V105F|RBM4_ENST00000503028.2_5'UTR	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	105	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)		RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						CCGCGGACGCGTCATCGAGTG	0.662																																					p.V105F		.											.	RBM14	92	0			c.G313T						.						43.0	51.0	48.0					11																	66384504		2159	4218	6377	SO:0001583	missense	10432	exon1			GGACGCGTCATCG	AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.313G>T	11.37:g.66384504G>T	ENSP00000311747:p.Val105Phe	73.0	0.0		76.0	9.0	NM_001198837	B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Missense_Mutation	SNP	ENST00000310137.4	37	CCDS8147.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.989364	0.93106	.	.	ENSG00000239306;ENSG00000239306;ENSG00000239306;ENSG00000239306;ENSG00000239306;ENSG00000248643;ENSG00000248643	ENST00000310137;ENST00000393979;ENST00000409372;ENST00000443702;ENST00000409738;ENST00000412278;ENST00000500635	T;T;T;T;T;T;T	0.79554	-1.28;-1.28;2.05;2.05;2.05;2.05;2.05	5.18	4.25	0.50352	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.256789	0.32563	N	0.005936	D	0.90995	0.7168	M	0.91768	3.24	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.992;1.0	D	0.92334	0.5876	10	0.87932	D	0	-11.3981	12.6918	0.56978	0.0:0.0:0.8335:0.1665	.	105;105;105;105	B0LM41;Q96PK6-2;Q2PYN1;Q96PK6	.;.;.;RBM14_HUMAN	F	105	ENSP00000311747:V105F;ENSP00000377548:V105F;ENSP00000386518:V105F;ENSP00000414650:V105F;ENSP00000386995:V105F;ENSP00000388552:V105F;ENSP00000421279:V105F	ENSP00000311747:V105F	V	+	1	0	RBM14;RBM14-RBM4	66141080	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.213000	0.77950	1.157000	0.42530	0.555000	0.69702	GTC	.		0.662	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277128.1	NM_006328	
SCN5A	6331	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38645542	38645542	+	Silent	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr3:38645542C>T	ENST00000333535.4	-	12	1700	c.1551G>A	c.(1549-1551)agG>agA	p.R517R	SCN5A_ENST00000455624.2_Silent_p.R517R|SCN5A_ENST00000413689.1_Silent_p.R517R|SCN5A_ENST00000423572.2_Silent_p.R517R|SCN5A_ENST00000425664.1_Silent_p.R517R|SCN5A_ENST00000451551.2_Silent_p.R517R|SCN5A_ENST00000449557.2_Silent_p.R517R|SCN5A_ENST00000443581.1_Silent_p.R517R|SCN5A_ENST00000450102.2_Silent_p.R517R|SCN5A_ENST00000414099.2_Silent_p.R517R			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	517					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	TCATAGAAGTCCTGCTGAGGC	0.537																																					p.R517R		.											.	SCN5A	98	0			c.G1551A						.						27.0	28.0	28.0					3																	38645542		2040	4209	6249	SO:0001819	synonymous_variant	6331	exon12			AGAAGTCCTGCTG	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.1551G>A	3.37:g.38645542C>T		101.0	0.0		107.0	16.0	NM_001160160	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Silent	SNP	ENST00000333535.4	37	CCDS46796.1																																																																																			.		0.537	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
SCN11A	11280	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	38991632	38991632	+	Silent	SNP	T	T	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr3:38991632T>A	ENST00000302328.3	-	1	420	c.222A>T	c.(220-222)atA>atT	p.I74I	SCN11A_ENST00000450244.1_Silent_p.I74I|SCN11A_ENST00000456224.3_Silent_p.I74I|SCN11A_ENST00000444237.2_Silent_p.I74I	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	74					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GAGGCTTTCCTATGAGCTCAC	0.562																																					p.I74I		.											.	SCN11A	99	0			c.A222T						.						100.0	102.0	101.0					3																	38991632		2203	4300	6503	SO:0001819	synonymous_variant	11280	exon1			CTTTCCTATGAGC	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.222A>T	3.37:g.38991632T>A		170.0	0.0		152.0	26.0	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Silent	SNP	ENST00000302328.3	37	CCDS33737.1																																																																																			.		0.562	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
SEMA6B	10501	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	4550257	4550257	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:4550257C>T	ENST00000586582.1	-	12	1459	c.1149G>A	c.(1147-1149)atG>atA	p.M383I	SEMA6B_ENST00000586965.1_Missense_Mutation_p.M383I|SEMA6B_ENST00000301293.3_Missense_Mutation_p.M383I	NM_032108.3	NP_115484.2	Q9H3T3	SEM6B_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B	383	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		CATTGTACTGCATCCCGGGGG	0.622																																					p.M383I		.											.	SEMA6B	91	0			c.G1149A						.						61.0	53.0	56.0					19																	4550257		2203	4300	6503	SO:0001583	missense	10501	exon12			GTACTGCATCCCG	AB022433	CCDS12131.1	19p13.3	2008-07-22				ENSG00000167680		"""Semaphorins"""	10739	protein-coding gene	gene with protein product	"""Sema VIb"", ""semaphorin Z"", ""semaphorin VIB"""	608873		SEMAN		9361278	Standard	NM_032108		Approved	semaZ, SEMA-VIB, SEM-SEMA-Y	uc010dud.2	Q9H3T3		ENST00000586582.1:c.1149G>A	19.37:g.4550257C>T	ENSP00000467290:p.Met383Ile	138.0	0.0		107.0	26.0	NM_032108	A5PKU4|F6IB19|Q9NRK9	Missense_Mutation	SNP	ENST00000586582.1	37	CCDS12131.1	.	.	.	.	.	.	.	.	.	.	.	6.001	0.368594	0.11352	.	.	ENSG00000167680	ENST00000301293;ENST00000301292	T	0.10382	2.88	2.6	1.5	0.22942	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.264529	0.37095	U	0.002241	T	0.08403	0.0209	L	0.39147	1.195	0.22446	N	0.9991	B;B	0.19445	0.036;0.008	B;B	0.29524	0.103;0.065	T	0.34825	-0.9813	10	0.20519	T	0.43	.	6.3431	0.21335	0.209:0.5869:0.2041:0.0	.	383;383	B4DT36;Q9H3T3	.;SEM6B_HUMAN	I	383	ENSP00000301293:M383I	ENSP00000301292:M383I	M	-	3	0	SEMA6B	4501257	0.000000	0.05858	0.925000	0.36789	0.541000	0.35023	-0.102000	0.10956	0.640000	0.30582	0.478000	0.44815	ATG	.		0.622	SEMA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458656.2	NM_032108	
SLC12A1	6557	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	48500027	48500027	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr15:48500027T>A	ENST00000558405.1	+	1	125	c.111T>A	c.(109-111)gaT>gaA	p.D37E	SLC12A1_ENST00000396577.3_Missense_Mutation_p.D37E|SLC12A1_ENST00000330289.6_Missense_Mutation_p.D37E|SLC12A1_ENST00000561031.1_Missense_Mutation_p.D37E|SLC12A1_ENST00000380993.3_Missense_Mutation_p.D37E			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	37					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	CAGCTGCAGATGACAATACTG	0.433																																					p.D37E		.											.	SLC12A1	24	0			c.T111A						.						76.0	72.0	73.0					15																	48500027		2198	4297	6495	SO:0001583	missense	6557	exon2			TGCAGATGACAAT		CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.111T>A	15.37:g.48500027T>A	ENSP00000453409:p.Asp37Glu	120.0	0.0		83.0	25.0	NM_001184832	A8JYA2|E9PDW4	Missense_Mutation	SNP	ENST00000558405.1	37	CCDS10129.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.422|3.422	-0.117977|-0.117977	0.06838|0.06838	.|.	.|.	ENSG00000074803|ENSG00000074803	ENST00000380993;ENST00000396577;ENST00000330289|ENST00000546071	D;D;D|.	0.91180|.	-1.89;-1.89;-2.8|.	5.45|5.45	-4.87|-4.87	0.03123|0.03123	.|.	1.652850|.	0.03156|.	N|.	0.168601|.	T|T	0.19248|0.19248	0.0462|0.0462	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B|.	0.14012|.	0.0;0.009|.	B;B|.	0.12156|.	0.001;0.007|.	T|T	0.39292|0.39292	-0.9621|-0.9621	10|6	0.24483|0.56958	T|D	0.36|0.05	.|.	9.3696|9.3696	0.38246|0.38246	0.0:0.4299:0.2772:0.2929|0.0:0.4299:0.2772:0.2929	.|.	37;37|.	Q8IUN5;Q13621|.	.;S12A1_HUMAN|.	E|K	37|11	ENSP00000370381:D37E;ENSP00000379822:D37E;ENSP00000331550:D37E|.	ENSP00000331550:D37E|ENSP00000441148:M11K	D|M	+|+	3|2	2|0	SLC12A1|SLC12A1	46287319|46287319	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.009000|0.009000	0.06853|0.06853	-0.804000|-0.804000	0.04535|0.04535	-0.488000|-0.488000	0.06726|0.06726	0.460000|0.460000	0.39030|0.39030	GAT|ATG	.		0.433	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417131.1		
SHC4	399694	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	49135766	49135766	+	Silent	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr15:49135766C>T	ENST00000332408.4	-	10	1751	c.1323G>A	c.(1321-1323)ggG>ggA	p.G441G	SHC4_ENST00000396535.3_Silent_p.G198G|SHC4_ENST00000537958.1_Silent_p.G155G	NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	441	CH1.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		GGGACTGCACCCCTCTTGGAT	0.388																																					p.G441G		.											.	SHC4	95	0			c.G1323A						.						122.0	111.0	114.0					15																	49135766		2197	4295	6492	SO:0001819	synonymous_variant	399694	exon10			CTGCACCCCTCTT	AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.1323G>A	15.37:g.49135766C>T		183.0	0.0		186.0	57.0	NM_203349	Q6UXQ3|Q8IYW3	Silent	SNP	ENST00000332408.4	37	CCDS10130.1																																																																																			.		0.388	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254371.1	NM_203349	
SLC13A4	26266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	135377154	135377154	+	Silent	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr7:135377154A>G	ENST00000354042.4	-	11	1826	c.1137T>C	c.(1135-1137)acT>acC	p.T379T	C7orf73_ENST00000422968.1_3'UTR	NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	379					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						AGAAAAATCCAGTCACCATTT	0.418																																					p.T379T		.											.	SLC13A4	90	0			c.T1137C						.						57.0	64.0	61.0					7																	135377154		2203	4300	6503	SO:0001819	synonymous_variant	26266	exon11			AAATCCAGTCACC	AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.1137T>C	7.37:g.135377154A>G		86.0	0.0		81.0	17.0	NM_012450	A4D1Q4|Q8N631	Silent	SNP	ENST00000354042.4	37	CCDS5840.1																																																																																			.		0.418	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340558.1	NM_012450	
SLC16A6	9120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	66267772	66267772	+	Missense_Mutation	SNP	T	T	C	rs139961659		TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr17:66267772T>C	ENST00000327268.4	-	6	693	c.529A>G	c.(529-531)Att>Gtt	p.I177V	ARSG_ENST00000448504.2_Intron|SLC16A6_ENST00000580666.1_Missense_Mutation_p.I177V	NM_001174166.1	NP_001167637.1	O15403	MOT7_HUMAN	solute carrier family 16, member 6	177					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)			large_intestine(3)|lung(8)|prostate(1)|skin(1)|urinary_tract(2)	15	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)	CTCCAGCCAATGCGCTCCTTC	0.473																																					p.I177V		.											.	SLC16A6	90	0			c.A529G						.	T	VAL/ILE,VAL/ILE,	1,4405	2.1+/-5.4	0,1,2202	44.0	43.0	44.0		529,529,	0.9	0.0	17	dbSNP_134	44	0,8600		0,0,4300	no	missense,missense,intron	SLC16A6,ARSG	NM_001174166.1,NM_004694.4,NM_014960.3	29,29,	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	benign,benign,	177/524,177/524,	66267772	1,13005	2203	4300	6503	SO:0001583	missense	9120	exon6			AGCCAATGCGCTC	U79745	CCDS11675.1	17q24.2	2013-07-18	2013-07-18		ENSG00000108932	ENSG00000108932		"""Solute carriers"""	10927	protein-coding gene	gene with protein product		603880	"""solute carrier family 16 (monocarboxylic acid transporters), member 6"", ""solute carrier family 16, member 6 (monocarboxylic acid transporter 7)"""			9425115	Standard	NM_004694		Approved	MCT6, MCT7	uc002jgz.2	O15403	OTTHUMG00000179812	ENST00000327268.4:c.529A>G	17.37:g.66267772T>C	ENSP00000319991:p.Ile177Val	93.0	0.0		95.0	19.0	NM_001174166	Q6P1X3	Missense_Mutation	SNP	ENST00000327268.4	37	CCDS11675.1	.	.	.	.	.	.	.	.	.	.	T	8.162	0.789772	0.16258	2.27E-4	0.0	ENSG00000108932	ENST00000327268	T	0.36699	1.24	4.33	0.903	0.19296	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.248067	0.40469	N	0.001095	T	0.30947	0.0781	L	0.55834	1.745	0.26325	N	0.9776	B	0.20459	0.045	B	0.26693	0.072	T	0.26258	-1.0108	10	0.52906	T	0.07	.	7.6143	0.28148	0.0:0.2577:0.0:0.7423	.	177	O15403	MOT7_HUMAN	V	177	ENSP00000319991:I177V	ENSP00000319991:I177V	I	-	1	0	SLC16A6	63779367	0.998000	0.40836	0.002000	0.10522	0.871000	0.50021	3.060000	0.49955	-0.043000	0.13513	0.397000	0.26171	ATT	T|1.000;C|0.000		0.473	SLC16A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448323.1	NM_004694	
SLC6A20	54716	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	45823619	45823619	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr3:45823619C>T	ENST00000358525.4	-	2	333	c.218G>A	c.(217-219)aGc>aAc	p.S73N	SLC6A20_ENST00000456124.2_Missense_Mutation_p.S73N|SLC6A20_ENST00000353278.4_Missense_Mutation_p.S73N	NM_020208.3	NP_064593.1	Q9NP91	S6A20_HUMAN	solute carrier family 6 (proline IMINO transporter), member 20	73					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|glycine transport (GO:0015816)|ion transport (GO:0006811)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|large_intestine(6)|ovary(2)|skin(2)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)		GGCGCCGATGCTGCCCTGCCG	0.637																																					p.S73N		.											.	SLC6A20	92	0			c.G218A						.						73.0	54.0	61.0					3																	45823619		2203	4300	6503	SO:0001583	missense	54716	exon2			CCGATGCTGCCCT	AF075260	CCDS2730.1, CCDS43077.1	3p21.6	2013-05-22			ENSG00000163817	ENSG00000163817		"""Solute carriers"""	30927	protein-coding gene	gene with protein product		605616				9932288, 11352561	Standard	NM_022405		Approved	XT3, Xtrp3	uc011bai.2	Q9NP91	OTTHUMG00000133446	ENST00000358525.4:c.218G>A	3.37:g.45823619C>T	ENSP00000346298:p.Ser73Asn	151.0	1.0		108.0	33.0	NM_022405	A1A4F2|O75590|Q8TF10|Q9NPQ2|Q9NQ77	Missense_Mutation	SNP	ENST00000358525.4	37	CCDS43077.1	.	.	.	.	.	.	.	.	.	.	c	33	5.203598	0.95033	.	.	ENSG00000163817	ENST00000353278;ENST00000358525;ENST00000456124	T;T;T	0.76578	-1.03;-1.03;-1.03	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.88753	0.6522	M	0.79343	2.45	0.50467	D	0.999879	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.89632	0.3856	10	0.72032	D	0.01	.	19.2009	0.93711	0.0:1.0:0.0:0.0	.	73;73	Q9NP91-2;Q9NP91	.;S6A20_HUMAN	N	73	ENSP00000296133:S73N;ENSP00000346298:S73N;ENSP00000404310:S73N	ENSP00000296133:S73N	S	-	2	0	SLC6A20	45798623	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	7.758000	0.85224	2.550000	0.86006	0.556000	0.70494	AGC	.		0.637	SLC6A20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257318.3	NM_020208	
SNAP25	6616	ucsc.edu;bcgsc.ca	37	20	10273575	10273575	+	Intron	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr20:10273575A>G	ENST00000254976.2	+	5	374				SNAP25-AS1_ENST00000453544.1_RNA|SNAP25-AS1_ENST00000421143.2_RNA|SNAP25_ENST00000304886.2_Missense_Mutation_p.D70G	NM_130811.2	NP_570824.1	P60880	SNP25_HUMAN	synaptosomal-associated protein, 25kDa						energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long-term synaptic potentiation (GO:0060291)|neurotransmitter secretion (GO:0007269)|neurotransmitter uptake (GO:0001504)|regulation of establishment of protein localization (GO:0070201)|regulation of insulin secretion (GO:0050796)|regulation of neuron projection development (GO:0010975)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|SNARE complex (GO:0031201)|synaptobrevin 2-SNAP-25-syntaxin-1a-complexin I complex (GO:0070032)|trans-Golgi network (GO:0005802)	calcium-dependent protein binding (GO:0048306)			endometrium(1)|large_intestine(2)|lung(8)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	18					Botulinum Toxin Type A(DB00083)	ATCAACCAAGACATGAAGGAG	0.423																																					p.D70G		.											.	SNAP25	92	0			c.A209G						.						116.0	111.0	113.0					20																	10273575		2203	4300	6503	SO:0001627	intron_variant	6616	exon5			ACCAAGACATGAA		CCDS13109.1, CCDS13110.1	20p12-p11.2	2008-08-01	2002-08-29		ENSG00000132639	ENSG00000132639			11132	protein-coding gene	gene with protein product	"""resistance to inhibitors of cholinesterase 4 homolog"""	600322	"""synaptosomal-associated protein, 25kD"""	SNAP		8661740, 10692432	Standard	NM_003081		Approved	SNAP-25, RIC-4, RIC4, SEC9, bA416N4.2, dJ1068F16.2	uc002wnr.2	P60880	OTTHUMG00000031863	ENST00000254976.2:c.164-234A>G	20.37:g.10273575A>G		61.0	0.0		39.0	4.0	NM_003081	B2RAU4|D3DW16|D3DW17|P13795|P36974|P70557|P70558|Q53EM2|Q5U0B5|Q8IXK3|Q96FM2|Q9BR45	Missense_Mutation	SNP	ENST00000254976.2	37	CCDS13110.1	.	.	.	.	.	.	.	.	.	.	A	19.25	3.791226	0.70452	.	.	ENSG00000132639	ENST00000304886	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	T	0.80844	0.4701	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82794	-0.0281	7	0.66056	D	0.02	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	70	P60880-2	.	G	70	.	ENSP00000307341:D70G	D	+	2	0	SNAP25	10221575	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.367000	0.80283	0.528000	0.53228	GAC	.		0.423	SNAP25-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077976.3	NM_130811	
SNTB1	6641	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	121644855	121644855	+	Silent	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr8:121644855C>T	ENST00000395601.3	-	4	1239	c.825G>A	c.(823-825)acG>acA	p.T275T	SNTB1_ENST00000517992.1_Silent_p.T275T|SNTB1_ENST00000519177.1_5'UTR	NM_021021.3	NP_066301.1	Q13884	SNTB1_HUMAN	syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)	275	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				muscle contraction (GO:0006936)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|protein complex (GO:0043234)|synapse (GO:0045202)		p.T275T(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(6)	24	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			TTAGGATCACCGTGTGCTTAG	0.532																																					p.T275T		.											.	SNTB1	228	1	Substitution - coding silent(1)	large_intestine(1)	c.G825A						.						112.0	102.0	105.0					8																	121644855		2203	4300	6503	SO:0001819	synonymous_variant	6641	exon3			GATCACCGTGTGC	AF028828	CCDS6334.1	8q23-q24	2013-01-10	2002-08-29		ENSG00000172164	ENSG00000172164		"""Pleckstrin homology (PH) domain containing"""	11168	protein-coding gene	gene with protein product	"""tax interaction protein 43"""	600026	"""syntrophin, beta 1 (dystrophin-associated protein A1, 59kD, basic component 1)"""	SNT2B1		8183929, 9482110	Standard	NM_021021		Approved	59-DAP, A1B, BSYN2, TIP-43, SNT2	uc010mdg.3	Q13884	OTTHUMG00000165041	ENST00000395601.3:c.825G>A	8.37:g.121644855C>T		131.0	0.0		96.0	5.0	NM_021021	A8K9E0|O14912|Q4KMG8	Silent	SNP	ENST00000395601.3	37	CCDS6334.1																																																																																			.		0.532	SNTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381535.1	NM_021021	
SORCS1	114815	broad.mit.edu;bcgsc.ca	37	10	108389095	108389095	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr10:108389095C>T	ENST00000263054.6	-	19	2534	c.2527G>A	c.(2527-2529)Gtg>Atg	p.V843M	SORCS1_ENST00000344440.6_Missense_Mutation_p.V843M|SORCS1_ENST00000369698.1_Missense_Mutation_p.V378M	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	843	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		ACGTAAGACACCGCGATACCA	0.502																																					p.V843M		.											.	SORCS1	153	0			c.G2527A						.						170.0	119.0	136.0					10																	108389095		2203	4300	6503	SO:0001583	missense	114815	exon19			AAGACACCGCGAT	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2527G>A	10.37:g.108389095C>T	ENSP00000263054:p.Val843Met	113.0	1.0		89.0	7.0	NM_001206572	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447115	0.63178	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.69175	-0.38;-0.38;-0.38	5.82	4.92	0.64577	PKD/Chitinase domain (1);PKD domain (4);	0.069182	0.56097	D	0.000021	T	0.78566	0.4303	M	0.64997	1.995	0.42590	D	0.993242	D;D;D;D;D	0.60160	0.987;0.983;0.983;0.987;0.983	D;D;D;D;D	0.70716	0.97;0.949;0.949;0.97;0.949	T	0.79006	-0.1979	9	.	.	.	-14.1201	14.9747	0.71261	0.0:0.9317:0.0:0.0683	.	843;843;843;843;843	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	M	378;843;843	ENSP00000358712:V378M;ENSP00000263054:V843M;ENSP00000345964:V843M	.	V	-	1	0	SORCS1	108379085	0.509000	0.26163	0.995000	0.50966	0.775000	0.43874	1.075000	0.30716	1.480000	0.48289	0.655000	0.94253	GTG	.		0.502	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
SSTR3	6753	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	37602722	37602722	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr22:37602722A>T	ENST00000328544.3	-	2	1654	c.1121T>A	c.(1120-1122)gTc>gAc	p.V374D	SSTR3_ENST00000402501.1_Missense_Mutation_p.V374D	NM_001051.3	NP_001042.1	P32745	SSR3_HUMAN	somatostatin receptor 3	374					cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of cell proliferation (GO:0008285)|response to starvation (GO:0042594)|somatostatin signaling pathway (GO:0038170)|spermatogenesis (GO:0007283)	ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	14					Pasireotide(DB06663)	GATCTGGCTGACCCGGCCGTT	0.677																																					p.V374D		.											.	SSTR3	522	0			c.T1121A						.						45.0	42.0	43.0					22																	37602722		2203	4300	6503	SO:0001583	missense	6753	exon2			TGGCTGACCCGGC		CCDS13944.1	22q13.1	2012-08-08			ENSG00000183473	ENSG00000278195		"""GPCR / Class A : Somatostatin receptors"""	11332	protein-coding gene	gene with protein product		182453				8449518	Standard	XM_006724311		Approved		uc003arb.3	P32745	OTTHUMG00000150537	ENST00000328544.3:c.1121T>A	22.37:g.37602722A>T	ENSP00000330138:p.Val374Asp	89.0	0.0		58.0	16.0	NM_001051	A8K550|Q53ZR7	Missense_Mutation	SNP	ENST00000328544.3	37	CCDS13944.1	.	.	.	.	.	.	.	.	.	.	A	14.82	2.648189	0.47258	.	.	ENSG00000183473	ENST00000328544;ENST00000402501	T;T	0.72505	-0.66;-0.66	5.33	5.33	0.75918	.	1.359230	0.05115	N	0.489532	T	0.70684	0.3252	L	0.54323	1.7	0.50813	D	0.99989	P	0.48407	0.91	B	0.43575	0.424	T	0.58515	-0.7623	10	0.24483	T	0.36	.	11.6877	0.51497	1.0:0.0:0.0:0.0	.	374	P32745	SSR3_HUMAN	D	374	ENSP00000330138:V374D;ENSP00000384904:V374D	ENSP00000330138:V374D	V	-	2	0	SSTR3	35932668	1.000000	0.71417	0.795000	0.32087	0.863000	0.49368	3.695000	0.54749	2.008000	0.58898	0.482000	0.46254	GTC	.		0.677	SSTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318802.1		
SYT8	90019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	1858034	1858034	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr11:1858034T>A	ENST00000381968.3	+	7	903	c.775T>A	c.(775-777)Tca>Aca	p.S259T	SYT8_ENST00000535046.1_3'UTR|TNNI2_ENST00000381911.1_5'Flank|TNNI2_ENST00000381906.1_5'Flank|SYT8_ENST00000341958.3_Missense_Mutation_p.S245T|TNNI2_ENST00000252898.7_5'Flank	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	259	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CGTGCCCAGCTCAGGCCGGCT	0.672																																					p.S259T		.											.	SYT8	91	0			c.T775A						.						36.0	38.0	37.0					11																	1858034		2200	4298	6498	SO:0001583	missense	90019	exon7			CCCAGCTCAGGCC	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.775T>A	11.37:g.1858034T>A	ENSP00000371394:p.Ser259Thr	107.0	0.0		94.0	11.0	NM_138567	A6NFJ4|Q9NSV9	Missense_Mutation	SNP	ENST00000381968.3	37	CCDS7726.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	9.247|9.247	1.039737|1.039737	0.19669|0.19669	.|.	.|.	ENSG00000149043|ENSG00000149043	ENST00000381978|ENST00000381968;ENST00000341958	.|T;T	.|0.07567	.|3.18;3.18	2.97|2.97	1.68|1.68	0.24146|0.24146	.|C2 membrane targeting protein (1);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	.|.	.|.	.|.	.|.	T|T	0.04452|0.04452	0.0122|0.0122	N|N	0.16708|0.16708	0.43|0.43	0.18873|0.18873	N|N	0.999988|0.999988	.|B;B	.|0.26483	.|0.15;0.15	.|B;B	.|0.17722	.|0.019;0.019	T|T	0.36065|0.36065	-0.9763|-0.9763	5|9	.|0.44086	.|T	.|0.13	.|.	3.5396|3.5396	0.07806|0.07806	0.4358:0.0:0.1724:0.3917|0.4358:0.0:0.1724:0.3917	.|.	.|259;245	.|Q8NBV8;A6NCR4	.|SYT8_HUMAN;.	H|T	257|259;245	.|ENSP00000371394:S259T;ENSP00000343691:S245T	.|ENSP00000343691:S245T	L|S	+|+	2|1	0|0	SYT8|SYT8	1814610|1814610	0.001000|0.001000	0.12720|0.12720	0.879000|0.879000	0.34478|0.34478	0.447000|0.447000	0.32167|0.32167	0.421000|0.421000	0.21280|0.21280	1.368000|1.368000	0.46115|0.46115	0.260000|0.260000	0.18958|0.18958	CTC|TCA	.		0.672	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4		
STK33	65975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	8496345	8496345	+	Silent	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr11:8496345T>C	ENST00000447869.1	-	1	1026	c.108A>G	c.(106-108)ccA>ccG	p.P36P	STK33_ENST00000358872.3_Intron|STK33_ENST00000315204.1_Silent_p.P36P|STK33_ENST00000396673.1_Silent_p.P36P|STK33_ENST00000396672.1_Silent_p.P36P|STK33_ENST00000534493.1_5'UTR			Q9BYT3	STK33_HUMAN	serine/threonine kinase 33	36					protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|skin(3)	23				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		CCACCAAAACTGGAGGAACCC	0.368																																					p.P36P		.											.	STK33	337	0			c.A108G						.						135.0	138.0	137.0					11																	8496345		2201	4296	6497	SO:0001819	synonymous_variant	65975	exon3			CAAAACTGGAGGA	AJ303380	CCDS7789.1, CCDS73253.1, CCDS73254.1	11p15.3	2010-03-10			ENSG00000130413	ENSG00000130413			14568	protein-coding gene	gene with protein product		607670				11738831	Standard	NM_030906		Approved		uc001mgj.1	Q9BYT3	OTTHUMG00000140275	ENST00000447869.1:c.108A>G	11.37:g.8496345T>C		140.0	0.0		92.0	21.0	NM_030906	Q658S6|Q8NEF5	Silent	SNP	ENST00000447869.1	37	CCDS7789.1																																																																																			.		0.368	STK33-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276819.2	NM_030906	
TDRD1	56165	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	115986999	115986999	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr10:115986999T>G	ENST00000251864.2	+	23	3497	c.3344T>G	c.(3343-3345)cTa>cGa	p.L1115R	TDRD1_ENST00000422662.1_Intron|TDRD1_ENST00000369281.2_Missense_Mutation_p.L1001R|TDRD1_ENST00000369282.1_Intron|TDRD1_ENST00000369280.1_Intron	NM_198795.1	NP_942090.1	Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	1115					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		GCTGATAAGCTAGTGACATTT	0.368																																					p.L1115R		.											.	TDRD1	90	0			c.T3344G						.						165.0	155.0	159.0					10																	115986999		2203	4300	6503	SO:0001583	missense	56165	exon23			ATAAGCTAGTGAC	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000251864.2:c.3344T>G	10.37:g.115986999T>G	ENSP00000251864:p.Leu1115Arg	237.0	1.0		192.0	66.0	NM_198795	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	ENST00000251864.2	37	CCDS7588.1	.	.	.	.	.	.	.	.	.	.	T	15.86	2.958050	0.53400	.	.	ENSG00000095627	ENST00000251864;ENST00000369281	T;T	0.34472	2.25;1.36	6.07	6.07	0.98685	.	0.097961	0.41938	D	0.000790	T	0.58935	0.2157	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.999	T	0.61821	-0.6984	10	0.87932	D	0	-10.0195	14.3686	0.66823	0.0:0.0:0.0:1.0	.	1115;1001;1115;1001	Q9BXT4;B7WPM2;Q9BXT4-3;Q9BXT4-2	TDRD1_HUMAN;.;.;.	R	1115;1001	ENSP00000251864:L1115R;ENSP00000358287:L1001R	ENSP00000251864:L1115R	L	+	2	0	TDRD1	115976989	1.000000	0.71417	1.000000	0.80357	0.190000	0.23558	4.454000	0.60068	2.330000	0.79161	0.528000	0.53228	CTA	.		0.368	TDRD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
TET2	54790	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	106155167	106155168	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr4:106155167_106155168insT	ENST00000540549.1	+	3	928_929	c.68_69insT	c.(67-72)cccattfs	p.I24fs	TET2_ENST00000305737.2_Frame_Shift_Ins_p.I24fs|TET2_ENST00000394764.1_Frame_Shift_Ins_p.I24fs|TET2_ENST00000413648.2_Frame_Shift_Ins_p.I24fs|TET2_ENST00000380013.4_Frame_Shift_Ins_p.I24fs|TET2_ENST00000513237.1_Frame_Shift_Ins_p.I45fs|TET2_ENST00000545826.1_Frame_Shift_Ins_p.I24fs			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	24					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		CCATCACCTCCCATTTGCCAGA	0.52			"""Mis N, F"""		MDS																																p.P23fs		.		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	.	TET2	4618	0			c.68_69insT						.																																			SO:0001589	frameshift_variant	54790	exon3			CACCTCCCATTTG	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	Exception_encountered	4.37:g.106155167_106155168insT	ENSP00000442788:p.Ile24fs	89.0	0.0		47.0	11.0	NM_017628	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Frame_Shift_Ins	INS	ENST00000540549.1	37	CCDS47120.1																																																																																			.		0.520	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	NM_017628	
TET2	54790	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	106155168	106155169	+	Frame_Shift_Ins	INS	-	-	CA			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr4:106155168_106155169insCA	ENST00000540549.1	+	3	929_930	c.69_70insCA	c.(70-72)attfs	p.I24fs	TET2_ENST00000305737.2_Frame_Shift_Ins_p.I24fs|TET2_ENST00000394764.1_Frame_Shift_Ins_p.I24fs|TET2_ENST00000413648.2_Frame_Shift_Ins_p.I24fs|TET2_ENST00000380013.4_Frame_Shift_Ins_p.I24fs|TET2_ENST00000513237.1_Frame_Shift_Ins_p.I45fs|TET2_ENST00000545826.1_Frame_Shift_Ins_p.I24fs			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	24					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		CATCACCTCCCATTTGCCAGAC	0.515			"""Mis N, F"""		MDS																																p.P23fs		.		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	.	TET2	4618	0			c.69_70insCA						.																																			SO:0001589	frameshift_variant	54790	exon3			ACCTCCCATTTGC	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	Exception_encountered	4.37:g.106155168_106155169insCA	ENSP00000442788:p.Ile24fs	92.0	0.0		48.0	11.0	NM_017628	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Frame_Shift_Ins	INS	ENST00000540549.1	37	CCDS47120.1																																																																																			.		0.515	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	NM_017628	
TMC6	11322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	76113656	76113656	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr17:76113656C>A	ENST00000590602.1	-	17	2250	c.2091G>T	c.(2089-2091)tgG>tgT	p.W697C	TMC6_ENST00000322914.3_Missense_Mutation_p.W697C|TMC6_ENST00000591436.1_Missense_Mutation_p.W276C|TMC6_ENST00000392467.3_Missense_Mutation_p.W697C|TMC6_ENST00000592076.1_Intron|TMC6_ENST00000322933.4_Missense_Mutation_p.W276C|TMC6_ENST00000306591.7_Intron			Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	697					ion transport (GO:0006811)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	14			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			GGTGGCGCACCCACACCCTGC	0.667																																					p.W697C		.											.	TMC6	90	0			c.G2091T						.						12.0	13.0	13.0					17																	76113656		2186	4266	6452	SO:0001583	missense	11322	exon17			GCGCACCCACACC	AY057379	CCDS32748.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000141524	ENSG00000141524			18021	protein-coding gene	gene with protein product		605828	"""epidermodysplasia verruciformis 1"""	EVER1		12426567	Standard	NM_007267		Approved	LAK-4P, EVIN1	uc002juk.2	Q7Z403	OTTHUMG00000177466	ENST00000590602.1:c.2091G>T	17.37:g.76113656C>A	ENSP00000465261:p.Trp697Cys	86.0	0.0		67.0	20.0	NM_001127198	O43284|Q45VJ2|Q8IU98|Q8IUI7|Q8IWU8|Q8TEQ7|Q9HAG5	Missense_Mutation	SNP	ENST00000590602.1	37	CCDS32748.1	.	.	.	.	.	.	.	.	.	.	C	14.24	2.476388	0.44044	.	.	ENSG00000141524	ENST00000322914;ENST00000392467;ENST00000322933	T;T;T	0.71934	-0.3;-0.3;-0.61	3.69	3.69	0.42338	.	0.204709	0.45606	D	0.000343	T	0.82042	0.4951	M	0.79693	2.465	0.80722	D	1	P;D	0.76494	0.801;0.999	P;D	0.69654	0.447;0.965	D	0.84070	0.0379	10	0.66056	D	0.02	-12.8777	11.0062	0.47635	0.1865:0.8135:0.0:0.0	.	697;276	Q7Z403;Q7Z403-3	TMC6_HUMAN;.	C	697;697;276	ENSP00000313408:W697C;ENSP00000376260:W697C;ENSP00000313479:W276C	ENSP00000313408:W697C	W	-	3	0	TMC6	73625251	1.000000	0.71417	1.000000	0.80357	0.178000	0.23041	5.227000	0.65305	1.894000	0.54839	0.555000	0.69702	TGG	.		0.667	TMC6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437146.1		
TMEM185A	84548	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	148693147	148693147	+	Splice_Site	SNP	C	C	A	rs376945268		TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chrX:148693147C>A	ENST00000316916.8	-	2	343		c.e2-1		TMEM185A_ENST00000507237.1_Splice_Site|TMEM185A_ENST00000536359.1_Intron	NM_032508.2	NP_115897.1	Q8NFB2	T185A_HUMAN	transmembrane protein 185A							dendrite (GO:0030425)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(3)|lung(10)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					GAGGAATTTACTAGGAGAAAA	0.423																																					.		.											.	TMEM185A	131	0			c.39-1G>T						.	C	,	1,3834		0,1,1631,571	122.0	123.0	123.0		,	5.1	1.0	X		123	0,6727		0,0,2428,1871	no	intron,splice-3	TMEM185A	NM_001174092.1,NM_032508.2	,	0,1,4059,2442	AA,AC,CC,C		0.0,0.0261,0.0095	,	,	148693147	1,10561	2203	4299	6502	SO:0001630	splice_region_variant	84548	exon3			AATTTACTAGGAG	AF353675	CCDS14689.1, CCDS55523.1, CCDS76041.1	Xq28	2014-01-28	2007-02-05	2007-02-05	ENSG00000155984	ENSG00000269556			17125	protein-coding gene	gene with protein product		300031	"""chromosome X open reading frame 13"", ""family with sequence similarity 11, member A"""	CXorf13, FAM11A		12404111	Standard	NM_032508		Approved		uc022cgl.1	Q8NFB2	OTTHUMG00000022625	ENST00000316916.8:c.39-1G>T	X.37:g.148693147C>A		60.0	0.0		56.0	32.0	NM_032508	B3KTZ3|Q3SYH1|Q96CW3|Q96KE8	Splice_Site	SNP	ENST00000316916.8	37	CCDS14689.1	.	.	.	.	.	.	.	.	.	.	C	17.63	3.437393	0.62955	2.61E-4	0.0	ENSG00000155984	ENST00000316916;ENST00000507237	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6197	0.84927	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMEM185A	148500948	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.249000	0.78278	2.126000	0.65437	0.600000	0.82982	.	.		0.423	TMEM185A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058710.4	NM_032508	Intron
TMEM260	54916	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	57083958	57083958	+	Silent	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr14:57083958A>G	ENST00000261556.6	+	9	1121	c.999A>G	c.(997-999)tcA>tcG	p.S333S	TMEM260_ENST00000536419.1_5'UTR|TMEM260_ENST00000538838.1_Silent_p.S333S|TMEM260_ENST00000553335.1_3'UTR	NM_017799.3	NP_060269.3	Q9NX78	TM260_HUMAN	transmembrane protein 260	333						integral component of membrane (GO:0016021)											GCATTTATTCATTGTTCTTTG	0.294																																					p.S333S		.											.	.	.	0			c.A999G						.						135.0	130.0	132.0					14																	57083958		2202	4299	6501	SO:0001819	synonymous_variant	0	exon9			TTATTCATTGTTC	AK000399	CCDS9727.2	14q22.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000070269	ENSG00000070269			20185	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 101"""	C14orf101			Standard	XR_245695		Approved	FLJ20392	uc001xcm.3	Q9NX78	OTTHUMG00000152337	ENST00000261556.6:c.999A>G	14.37:g.57083958A>G		90.0	0.0		95.0	10.0	NM_017799	A8KAN4|B3KPF5|Q86XE1	Silent	SNP	ENST00000261556.6	37	CCDS9727.2																																																																																			.		0.294	TMEM260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276924.1	NM_017799	
TNNT3	7140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	1955638	1955638	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr11:1955638C>T	ENST00000397301.1	+	13	484	c.476C>T	c.(475-477)tCt>tTt	p.S159F	TNNT3_ENST00000278317.6_Missense_Mutation_p.S148F|TNNT3_ENST00000381549.3_Missense_Mutation_p.S140F|TNNT3_ENST00000446240.1_Missense_Mutation_p.S129F|TNNT3_ENST00000381579.3_Missense_Mutation_p.S140F|TNNT3_ENST00000381589.3_Missense_Mutation_p.S146F|TNNT3_ENST00000360603.3_Missense_Mutation_p.S142F|TNNT3_ENST00000381548.3_Missense_Mutation_p.S150F|TNNT3_ENST00000397304.2_Missense_Mutation_p.S129F|TNNT3_ENST00000493234.1_3'UTR|TNNT3_ENST00000381561.4_Missense_Mutation_p.S151F|TNNT3_ENST00000381558.1_Missense_Mutation_p.S140F			P45378	TNNT3_HUMAN	troponin T type 3 (skeletal, fast)	159					ATP catabolic process (GO:0006200)|muscle filament sliding (GO:0030049)|regulation of ATPase activity (GO:0043462)|regulation of striated muscle contraction (GO:0006942)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|troponin complex (GO:0005861)	calcium-dependent protein binding (GO:0048306)|tropomyosin binding (GO:0005523)|troponin C binding (GO:0030172)|troponin I binding (GO:0031013)			breast(2)|endometrium(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(4)|stomach(1)	19		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00253)|Lung(200;0.0333)|LUSC - Lung squamous cell carcinoma(625;0.0826)		AAAGCTCTGTCTTCCATGGGA	0.592																																					p.S148F		.											.	TNNT3	91	0			c.C443T						.						104.0	95.0	98.0					11																	1955638		2202	4298	6500	SO:0001583	missense	7140	exon12			CTCTGTCTTCCAT	M21984	CCDS7727.1, CCDS41594.1, CCDS41595.1, CCDS41596.1	11p15.5	2014-09-17	2005-09-12		ENSG00000130595	ENSG00000130595			11950	protein-coding gene	gene with protein product	"""troponin-T3, skeletal, fast"""	600692	"""troponin T3, skeletal, fast"""			8172653	Standard	NM_001042782		Approved	AMCD2B, DA2B, FSSV, DKFZp779M2348	uc001lup.4	P45378	OTTHUMG00000012475	ENST00000397301.1:c.476C>T	11.37:g.1955638C>T	ENSP00000380468:p.Ser159Phe	82.0	0.0		92.0	14.0	NM_006757	A8MQ76|A8MSW1|B3KPX3|B7WP64|B7ZL26|B7ZVV9|Q12975|Q12976|Q12977|Q12978|Q17RG9|Q6FH29|Q6N056|Q86TH6	Missense_Mutation	SNP	ENST00000397301.1	37		.	.	.	.	.	.	.	.	.	.	.	23.9	4.472056	0.84533	.	.	ENSG00000130595	ENST00000278317;ENST00000544980;ENST00000397309;ENST00000381561;ENST00000381548;ENST00000360603;ENST00000381549;ENST00000381589;ENST00000381579;ENST00000381557;ENST00000453458;ENST00000381563;ENST00000344578;ENST00000381558;ENST00000397301;ENST00000397304;ENST00000446240	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.98996	-1.57;-1.57;-1.57;-1.57;-1.57;-1.57;-1.57;-1.57;-5.31;-1.57;-1.57;-1.57;-1.57;-1.57;-1.57	4.66	4.66	0.58398	.	0.115083	0.64402	D	0.000013	D	0.99351	0.9772	M	0.87971	2.92	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.85130	0.992;0.992;0.992;0.994;0.997	D	0.98903	1.0777	10	0.87932	D	0	-24.9044	17.9291	0.88992	0.0:1.0:0.0:0.0	.	148;140;146;140;159	P45378-2;P45378-7;P45378-6;P45378-4;P45378	.;.;.;.;TNNT3_HUMAN	F	148;44;160;151;150;142;140;146;140;134;129;151;135;140;159;129;129	ENSP00000278317:S148F;ENSP00000370973:S151F;ENSP00000370960:S150F;ENSP00000353815:S142F;ENSP00000370961:S140F;ENSP00000371001:S146F;ENSP00000370991:S140F;ENSP00000370969:S134F;ENSP00000415614:S129F;ENSP00000370975:S151F;ENSP00000344870:S135F;ENSP00000370970:S140F;ENSP00000380468:S159F;ENSP00000380471:S129F;ENSP00000413203:S129F	ENSP00000278317:S148F	S	+	2	0	TNNT3	1912214	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	5.663000	0.68038	2.314000	0.78098	0.313000	0.20887	TCT	.		0.592	TNNT3-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000142920.3	NM_006757	
TNPO2	30000	ucsc.edu;bcgsc.ca	37	19	12831732	12831732	+	Silent	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:12831732T>C	ENST00000592287.1	-	2	168	c.60A>G	c.(58-60)tcA>tcG	p.S20S	TNPO2_ENST00000588216.1_Silent_p.S20S|TNPO2_ENST00000589956.1_5'UTR|TNPO2_ENST00000356861.5_Silent_p.S20S|TNPO2_ENST00000425528.1_Silent_p.S20S|TNPO2_ENST00000441499.1_Silent_p.S20S|TNPO2_ENST00000450764.2_Silent_p.S20S	NM_001136196.1	NP_001129668.1	O14787	TNPO2_HUMAN	transportin 2	20					intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						TGGGCGACTGTGAGTCTTTGA	0.647																																					p.S20S		.											.	TNPO2	227	0			c.A60G						.						23.0	27.0	26.0					19																	12831732		2195	4295	6490	SO:0001819	synonymous_variant	30000	exon2			CGACTGTGAGTCT	AF019039	CCDS45991.1, CCDS45992.1	19p13.13	2009-01-12	2009-01-12			ENSG00000105576		"""Importins"""	19998	protein-coding gene	gene with protein product	"""importin 3"", ""karyopherin beta 2b"""	603002				9298975, 12384575	Standard	NM_013433		Approved	IPO3, KPNB2B, FLJ12155, TRN2	uc002muo.3	O14787		ENST00000592287.1:c.60A>G	19.37:g.12831732T>C		58.0	0.0		38.0	4.0	NM_013433	O14655|Q6IN77	Silent	SNP	ENST00000592287.1	37	CCDS45991.1																																																																																			.		0.647	TNPO2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450785.1	NM_013433	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7577534	7577534	+	Missense_Mutation	SNP	C	C	A	rs28934571		TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr17:7577534C>A	ENST00000269305.4	-	7	936	c.747G>T	c.(745-747)agG>agT	p.R249S	TP53_ENST00000359597.4_Missense_Mutation_p.R249S|TP53_ENST00000445888.2_Missense_Mutation_p.R249S|TP53_ENST00000413465.2_Missense_Mutation_p.R249S|TP53_ENST00000455263.2_Missense_Mutation_p.R249S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R249S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	249	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in a sporadic cancer; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934571). {ECO:0000269|PubMed:1694291, ECO:0000269|PubMed:16959974}.|R -> T (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R249S(348)|p.0?(8)|p.R249R(5)|p.?(5)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.R249_P250delRP(1)|p.R249_P250insR(1)|p.R249_P250>SS(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*14(1)|p.R249_T256delRPILTIIT(1)|p.P250fs*14(1)|p.R249_I251delRPI(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGAGGATGGGCCTCCGGTTCA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R249S	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,mouth,carcinoma,0	TP53	70225	378	Substitution - Missense(348)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Substitution - coding silent(5)|Insertion - Frameshift(1)|Insertion - In frame(1)|Deletion - Frameshift(1)|Complex - compound substitution(1)	liver(240)|lung(44)|upper_aerodigestive_tract(12)|breast(12)|central_nervous_system(10)|stomach(7)|ovary(6)|prostate(6)|cervix(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(5)|biliary_tract(5)|urinary_tract(5)|bone(4)|endometrium(3)|oesophagus(3)|skin(2)|peritoneum(1)|kidney(1)|salivary_gland(1)|pancreas(1)	c.G747T						.						155.0	113.0	127.0					17																	7577534		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GATGGGCCTCCGG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.747G>T	17.37:g.7577534C>A	ENSP00000269305:p.Arg249Ser	211.0	0.0		203.0	103.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344264	0.61073	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99865	-7.29;-7.29;-7.29;-7.29;-7.29;-7.29;-7.29	4.62	-0.0929	0.13654	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99792	0.9912	M	0.92367	3.3	0.50039	D	0.999848	D;D;D;D;D	0.89917	0.996;0.996;0.997;0.99;1.0	D;D;D;D;D	0.79108	0.968;0.966;0.981;0.955;0.992	D	0.98720	1.0708	10	0.72032	D	0.01	-3.0658	3.2479	0.06803	0.1392:0.5551:0.1362:0.1695	rs28934571	249;249;249;249;249	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	S	249;249;249;249;249;249;238;117	ENSP00000410739:R249S;ENSP00000352610:R249S;ENSP00000269305:R249S;ENSP00000398846:R249S;ENSP00000391127:R249S;ENSP00000391478:R249S;ENSP00000425104:R117S	ENSP00000269305:R249S	R	-	3	2	TP53	7518259	0.011000	0.17503	0.998000	0.56505	0.783000	0.44284	-1.379000	0.02554	0.253000	0.21552	0.462000	0.41574	AGG	C|1.000;|0.000		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TRIM4	89122	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	99490170	99490171	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr7:99490170_99490171insT	ENST00000355947.2	-	7	1247_1248	c.1118_1119insA	c.(1117-1119)aacfs	p.N373fs	TRIM4_ENST00000349062.2_Frame_Shift_Ins_p.N347fs	NM_033017.3	NP_148977.2	Q9C037	TRIM4_HUMAN	tripartite motif containing 4	373	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein trimerization (GO:0070206)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)	17	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)	Ovarian(593;0.238)				AGGTGAAAACGTTTTTTCCCAG	0.46																																					p.N373fs		.											.	TRIM4	227	0			c.1119_1120insA						.																																			SO:0001589	frameshift_variant	89122	exon7			GAAAACGTTTTTT	AF220023	CCDS5678.1, CCDS5679.1	7q22-q31.1	2013-01-09	2011-01-25		ENSG00000146833	ENSG00000146833		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16275	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM4"", ""tripartite motif protein 4"""		"""tripartite motif-containing 4"""			11331580	Standard	NM_033017		Approved	RNF87	uc003use.3	Q9C037	OTTHUMG00000156648	ENST00000355947.2:c.1119dupA	7.37:g.99490176_99490176dupT	ENSP00000348216:p.Asn373fs	139.0	0.0		137.0	16.0	NM_033017	A4D298|Q75MK1|Q96F06|Q9C036	Frame_Shift_Ins	INS	ENST00000355947.2	37	CCDS5679.1																																																																																			.		0.460	TRIM4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345050.1	NM_033017	
TRIM24	8805	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	138239638	138239638	+	Missense_Mutation	SNP	G	G	A	rs201288398		TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr7:138239638G>A	ENST00000343526.4	+	9	1672	c.1457G>A	c.(1456-1458)cGg>cAg	p.R486Q	TRIM24_ENST00000415680.2_Intron|TRIM24_ENST00000497516.1_Intron			O15164	TIF1A_HUMAN	tripartite motif containing 24	486					calcium ion homeostasis (GO:0055074)|cellular response to estrogen stimulus (GO:0071391)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of protein stability (GO:0031647)|regulation of signal transduction by p53 class mediator (GO:1901796)|regulation of vitamin D receptor signaling pathway (GO:0070562)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nuclear euchromatin (GO:0005719)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|ligase activity (GO:0016874)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	40						CAGGTGCAACGGAGGCCAGCA	0.517																																					p.R486Q	Pancreas(179;936 2074 16128 47811 50326)|Colon(136;168 1735 9344 12243 52014)	.											.	TRIM24	1030	0			c.G1457A						.						95.0	99.0	98.0					7																	138239638		2203	4300	6503	SO:0001583	missense	8805	exon9			TGCAACGGAGGCC	AF009353	CCDS5847.1, CCDS47720.1	7q32-q34	2013-01-28	2011-01-25	2005-06-02	ENSG00000122779	ENSG00000122779		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	11812	protein-coding gene	gene with protein product		603406	"""transcriptional intermediary factor 1"", ""tripartite motif-containing 24"""	TIF1		9115274, 9191165	Standard	NM_003852		Approved	hTIF1, Tif1a, RNF82, TIF1A	uc003vuc.3	O15164	OTTHUMG00000155820	ENST00000343526.4:c.1457G>A	7.37:g.138239638G>A	ENSP00000340507:p.Arg486Gln	244.0	0.0		129.0	11.0	NM_015905	A4D1R7|A4D1R8|O95854	Missense_Mutation	SNP	ENST00000343526.4	37	CCDS5847.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.256006	0.39896	.	.	ENSG00000122779	ENST00000343526;ENST00000536822	T	0.75154	-0.91	5.54	5.54	0.83059	.	0.269417	0.35585	N	0.003110	T	0.76666	0.4019	N	0.25144	0.715	0.80722	D	1	D	0.69078	0.997	D	0.70227	0.968	T	0.70132	-0.4956	10	0.10902	T	0.67	-17.1036	19.0694	0.93126	0.0:0.0:1.0:0.0	.	486	O15164	TIF1A_HUMAN	Q	486;397	ENSP00000340507:R486Q	ENSP00000340507:R486Q	R	+	2	0	TRIM24	137890178	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.022000	0.64078	2.602000	0.87976	0.557000	0.71058	CGG	G|0.999;T|0.001		0.517	TRIM24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341814.1	NM_015905	
TRIM58	25893	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	248039390	248039390	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr1:248039390G>A	ENST00000366481.3	+	6	1108	c.1060G>A	c.(1060-1062)Gaa>Aaa	p.E354K	OR2W3_ENST00000537741.1_Intron	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	354	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TCTGGTGGGAGAAGGAGCAGA	0.572																																					p.E354K		.											.	TRIM58	96	0			c.G1060A						.						110.0	100.0	103.0					1																	248039390		2203	4300	6503	SO:0001583	missense	25893	exon6			GTGGGAGAAGGAG	AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.1060G>A	1.37:g.248039390G>A	ENSP00000355437:p.Glu354Lys	206.0	0.0		193.0	11.0	NM_015431	Q6B0H9	Missense_Mutation	SNP	ENST00000366481.3	37	CCDS1636.1	.	.	.	.	.	.	.	.	.	.	G	9.325	1.058964	0.19987	.	.	ENSG00000162722	ENST00000366481	T	0.61040	0.14	4.05	3.12	0.35913	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.828799	0.10839	N	0.628397	T	0.43255	0.1239	L	0.28054	0.825	0.80722	D	1	B	0.06786	0.001	B	0.12837	0.008	T	0.18618	-1.0331	10	0.23891	T	0.37	.	10.462	0.44585	0.0976:0.0:0.9024:0.0	.	354	Q8NG06	TRI58_HUMAN	K	354	ENSP00000355437:E354K	ENSP00000355437:E354K	E	+	1	0	TRIM58	246106013	1.000000	0.71417	0.089000	0.20774	0.062000	0.15995	5.895000	0.69814	1.288000	0.44600	0.650000	0.86243	GAA	.		0.572	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096860.1	NM_015431	
U2AF1L4	199746	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36236067	36236067	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:36236067C>T	ENST00000412391.2	-	2	104	c.91G>A	c.(91-93)Gac>Aac	p.D31N	U2AF1L4_ENST00000378975.3_Missense_Mutation_p.D31N|IGFLR1_ENST00000588992.1_5'Flank|U2AF1L4_ENST00000588100.1_5'UTR|AC002398.11_ENST00000585365.1_RNA|PSENEN_ENST00000591949.1_5'Flank|AD000671.6_ENST00000589807.1_Missense_Mutation_p.D31N|U2AF1L4_ENST00000292879.5_Missense_Mutation_p.D31N|IGFLR1_ENST00000246532.1_5'Flank|AC002398.11_ENST00000591091.1_RNA|IGFLR1_ENST00000344990.3_5'Flank|PSENEN_ENST00000587708.2_5'UTR|PSENEN_ENST00000222266.2_5'Flank|IGFLR1_ENST00000592537.1_5'Flank|AC002398.9_ENST00000591613.2_5'Flank			Q8WU68	U2AF4_HUMAN	U2 small nuclear RNA auxiliary factor 1-like 4	31					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GAGCACCGGTCCCCGTGCCGG	0.622																																					p.D31N		.											.	U2AF1L4	90	0			c.G91A						.						37.0	44.0	42.0					19																	36236067		2203	4300	6503	SO:0001583	missense	199746	exon2			ACCGGTCCCCGTG	BC021186, AY569437	CCDS12473.1, CCDS42551.1	19q13.13	2013-02-12	2006-04-12	2006-04-12		ENSG00000161265		"""RNA binding motif (RRM) containing"""	23020	protein-coding gene	gene with protein product		601080	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 3"", ""U2 small nuclear RNA auxiliary factor 1-like 3"""	U2AF1L3		8586425, 11739736	Standard	NM_001040425		Approved	MGC33901, U2af26	uc002obf.3	Q8WU68		ENST00000412391.2:c.91G>A	19.37:g.36236067C>T	ENSP00000397645:p.Asp31Asn	78.0	0.0		56.0	19.0	NM_144987	A6NKI8|Q56UU3	Missense_Mutation	SNP	ENST00000412391.2	37		.	.	.	.	.	.	.	.	.	.	C	18.77	3.695790	0.68386	.	.	ENSG00000161265	ENST00000292879;ENST00000378975;ENST00000412391	T;T;T	0.48201	0.82;0.82;0.82	5.19	3.09	0.35607	.	0.673695	0.14230	N	0.332819	T	0.57814	0.2079	.	.	.	0.80722	D	1	P;P	0.49862	0.929;0.918	P;P	0.55303	0.729;0.773	T	0.56195	-0.8019	9	0.56958	D	0.05	-2.2858	9.2691	0.37659	0.0:0.8267:0.0:0.1733	.	31;31	Q8WU68-2;Q8WU68-3	.;.	N	31	ENSP00000292879:D31N;ENSP00000368258:D31N;ENSP00000397645:D31N	ENSP00000292879:D31N	D	-	1	0	U2AF1L4	40927907	1.000000	0.71417	1.000000	0.80357	0.085000	0.17905	3.562000	0.53777	0.780000	0.33566	0.643000	0.83706	GAC	.		0.622	U2AF1L4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144987	
UBE3A	7337	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	25616256	25616256	+	Silent	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr15:25616256A>G	ENST00000397954.2	-	4	1073	c.1074T>C	c.(1072-1074)agT>agC	p.S358S	UBE3A_ENST00000438097.1_Silent_p.S335S|UBE3A_ENST00000566215.1_Silent_p.S335S|UBE3A_ENST00000232165.3_Silent_p.S355S|UBE3A_ENST00000428984.2_Silent_p.S335S|SNHG14_ENST00000554726.1_RNA			Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A	358					androgen receptor signaling pathway (GO:0030521)|brain development (GO:0007420)|ovarian follicle development (GO:0001541)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|sperm entry (GO:0035037)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	38		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		CTAGATTTCGACTGTTAAATT	0.383																																					p.S358S		.											.	UBE3A	660	0			c.T1074C						.						110.0	106.0	108.0					15																	25616256		2203	4300	6503	SO:0001819	synonymous_variant	7337	exon7			ATTTCGACTGTTA	AF002224	CCDS32177.1, CCDS45191.1, CCDS45192.1	15q11.2	2014-09-17	2008-07-31		ENSG00000114062	ENSG00000114062	6.3.2.19		12496	protein-coding gene	gene with protein product	"""Angelman syndrome"""	601623	"""human papilloma virus E6-associated protein"""	EPVE6AP, HPVE6A		8221889	Standard	NM_130838		Approved	AS, ANCR, E6-AP, FLJ26981	uc001zas.3	Q05086		ENST00000397954.2:c.1074T>C	15.37:g.25616256A>G		132.0	1.0		125.0	19.0	NM_000462	A8K8Z9|P78355|Q93066|Q9UEP4|Q9UEP5|Q9UEP6|Q9UEP7|Q9UEP8|Q9UEP9	Silent	SNP	ENST00000397954.2	37	CCDS45192.1																																																																																			.		0.383	UBE3A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000434203.1	NM_000462	
UBE2Q2	92912	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	76165791	76165791	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr15:76165791A>G	ENST00000267938.4	+	5	852	c.470A>G	c.(469-471)tAt>tGt	p.Y157C	UBE2Q2_ENST00000561851.1_Missense_Mutation_p.Y141C|UBE2Q2_ENST00000569423.1_Missense_Mutation_p.Y122C|UBE2Q2_ENST00000338677.4_Missense_Mutation_p.Y157C	NM_173469.2	NP_775740.1	Q8WVN8	UB2Q2_HUMAN	ubiquitin-conjugating enzyme E2Q family member 2	157	Glu-rich.				protein K48-linked ubiquitination (GO:0070936)	cytoplasm (GO:0005737)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	12						TTAGATCACTATGAGATGAAG	0.313																																					p.Y157C		.											.	UBE2Q2	70	0			c.A470G						.						71.0	71.0	71.0					15																	76165791		2197	4294	6491	SO:0001583	missense	92912	exon5			ATCACTATGAGAT	BC017708	CCDS10286.1, CCDS45309.1, CCDS66839.1	15q24.2	2010-05-12	2008-05-02		ENSG00000140367	ENSG00000140367		"""Ubiquitin-conjugating enzymes E2"""	19248	protein-coding gene	gene with protein product		612501	"""ubiquitin-conjugating enzyme E2Q (putative) 2"""			16300736	Standard	NM_001145335		Approved	DKFZp762C143	uc002bbg.2	Q8WVN8	OTTHUMG00000142839	ENST00000267938.4:c.470A>G	15.37:g.76165791A>G	ENSP00000267938:p.Tyr157Cys	183.0	0.0		130.0	20.0	NM_173469	B7Z3Q2|H3BRG2|Q8N4G6|Q96J08	Missense_Mutation	SNP	ENST00000267938.4	37	CCDS10286.1	.	.	.	.	.	.	.	.	.	.	A	14.70	2.614236	0.46631	.	.	ENSG00000140367	ENST00000338677;ENST00000267938;ENST00000426727	.	.	.	4.41	4.41	0.53225	.	0.192041	0.44902	D	0.000401	T	0.60663	0.2286	M	0.67953	2.075	0.53688	D	0.999973	B;B;B;B	0.17465	0.022;0.01;0.009;0.012	B;B;B;B	0.17979	0.02;0.019;0.01;0.014	T	0.61997	-0.6947	9	0.51188	T	0.08	.	13.5368	0.61652	1.0:0.0:0.0:0.0	.	141;157;141;157	E9PHD0;C9JX13;B7Z3Q2;Q8WVN8	.;.;.;UB2Q2_HUMAN	C	157;157;141	.	ENSP00000267938:Y157C	Y	+	2	0	UBE2Q2	73952846	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.158000	0.94723	1.933000	0.56026	0.519000	0.50382	TAT	.		0.313	UBE2Q2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286475.1	NM_173469	
UCHL3	7347	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	76140947	76140947	+	Silent	SNP	G	G	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr13:76140947G>A	ENST00000377595.3	+	4	330	c.300G>A	c.(298-300)ctG>ctA	p.L100L	RP11-29G8.3_ENST00000563635.1_RNA	NM_001270952.1|NM_006002.4	NP_001257881.1|NP_005993.1	P15374	UCHL3_HUMAN	ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)	100					protein catabolic process (GO:0030163)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			kidney(1)|large_intestine(2)|lung(3)|skin(1)	7				GBM - Glioblastoma multiforme(99;0.0125)		CAATTGGACTGATTCATGCTA	0.338																																					p.L100L		.											.	UCHL3	522	0			c.G300A						.						130.0	124.0	126.0					13																	76140947		2203	4300	6503	SO:0001819	synonymous_variant	7347	exon4			TGGACTGATTCAT	M30496	CCDS9453.1, CCDS73586.1	13q21.33	2008-02-05			ENSG00000118939	ENSG00000118939	3.2.1.15		12515	protein-coding gene	gene with protein product		603090				2530630	Standard	NM_001270952		Approved		uc001vjq.4	P15374	OTTHUMG00000017090	ENST00000377595.3:c.300G>A	13.37:g.76140947G>A		102.0	0.0		54.0	8.0	NM_006002	B2R970|Q5TBK8|Q6IBE9	Silent	SNP	ENST00000377595.3	37	CCDS9453.1																																																																																			.		0.338	UCHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045292.2	NM_006002	
UNC13C	440279	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	54306041	54306041	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr15:54306041A>G	ENST00000260323.11	+	1	941	c.941A>G	c.(940-942)cAt>cGt	p.H314R	UNC13C_ENST00000537900.1_Missense_Mutation_p.H314R|UNC13C_ENST00000545554.1_Missense_Mutation_p.H314R	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	314					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CACTTAGGTCATATGGGTAGC	0.398																																					p.H314R		.											.	UNC13C	51	0			c.A941G						.						116.0	113.0	114.0					15																	54306041		1883	4108	5991	SO:0001583	missense	440279	exon1			TAGGTCATATGGG	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.941A>G	15.37:g.54306041A>G	ENSP00000260323:p.His314Arg	83.0	0.0		51.0	7.0	NM_001080534	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	A	9.498	1.102480	0.20632	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.78816	-1.21;-1.21;-1.21	5.08	2.62	0.31277	.	.	.	.	.	T	0.49983	0.1589	N	0.08118	0	0.40910	D	0.984225	B	0.30763	0.294	B	0.27887	0.084	T	0.43782	-0.9370	9	0.06757	T	0.87	.	6.9632	0.24610	0.7719:0.149:0.0791:0.0	.	314	Q8NB66	UN13C_HUMAN	R	314	ENSP00000260323:H314R;ENSP00000438156:H314R;ENSP00000442569:H314R	ENSP00000260323:H314R	H	+	2	0	UNC13C	52093333	1.000000	0.71417	0.652000	0.29579	0.851000	0.48451	5.171000	0.64996	0.767000	0.33267	-0.274000	0.10170	CAT	.		0.398	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
UNC80	285175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	210699734	210699734	+	Splice_Site	SNP	A	A	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr2:210699734A>T	ENST00000439458.1	+	18	3121	c.3041A>T	c.(3040-3042)cAc>cTc	p.H1014L	UNC80_ENST00000272845.6_Splice_Site_p.H1009L	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1014					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						ACTCCAGAGCAGTAAGTAGCG	0.483																																					p.H1014L		.											.	UNC80	90	0			c.A3041T						.						172.0	153.0	159.0					2																	210699734		692	1591	2283	SO:0001630	splice_region_variant	285175	exon18			CAGAGCAGTAAGT	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.3041+1A>T	2.37:g.210699734A>T		62.0	0.0		19.0	6.0	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.983462	0.74474	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.32753	1.44;1.44	6.07	6.07	0.98685	.	0.250986	0.39834	N	0.001255	T	0.38081	0.1027	N	0.22421	0.69	0.80722	D	1	D	0.53462	0.96	D	0.64237	0.923	T	0.09271	-1.0682	10	0.12103	T	0.63	-15.2115	16.6406	0.85098	1.0:0.0:0.0:0.0	.	1014	Q8N2C7	UNC80_HUMAN	L	1014;1009	ENSP00000391088:H1014L;ENSP00000272845:H1009L	ENSP00000272845:H1009L	H	+	2	0	UNC80	210407979	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.027000	0.88791	2.326000	0.78906	0.533000	0.62120	CAC	.		0.483	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	Missense_Mutation
USP9X	8239	broad.mit.edu;bcgsc.ca	37	X	41012219	41012219	+	Silent	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chrX:41012219C>T	ENST00000324545.8	+	14	2415	c.1782C>T	c.(1780-1782)ccC>ccT	p.P594P	USP9X_ENST00000378308.2_Silent_p.P594P	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	594					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						AGCGAAGTCCCCATGTGTTTT	0.363																																					p.P594P	Ovarian(172;1807 2695 35459 49286)	.											.	USP9X	563	0			c.C1782T						.						157.0	147.0	150.0					X																	41012219		2158	4280	6438	SO:0001819	synonymous_variant	8239	exon14			AAGTCCCCATGTG	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.1782C>T	X.37:g.41012219C>T		55.0	0.0		67.0	5.0	NM_001039591	O75550|Q8WWT3|Q8WX12	Silent	SNP	ENST00000324545.8	37	CCDS43930.1																																																																																			.		0.363	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652	
VTA1	51534	broad.mit.edu;bcgsc.ca	37	6	142487370	142487370	+	Silent	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr6:142487370T>C	ENST00000367630.4	+	2	176	c.118T>C	c.(118-120)Tta>Cta	p.L40L	VTA1_ENST00000367621.1_Intron|VTA1_ENST00000452973.2_Intron	NM_016485.3	NP_057569.2	Q9NP79	VTA1_HUMAN	vesicle (multivesicular body) trafficking 1	40	Interaction with CHMP5.|Interaction with IST1.				endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(2)|large_intestine(1)|lung(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;1.34e-05)|GBM - Glioblastoma multiforme(68;0.00182)		TCTAGGTCGTTTATACGCAAT	0.274																																					p.L40L		.											.	VTA1	90	0			c.T118C						.						94.0	96.0	95.0					6																	142487370		2203	4300	6503	SO:0001819	synonymous_variant	51534	exon2			GGTCGTTTATACG	AF060225	CCDS5197.1, CCDS69214.1, CCDS75531.1	6q24.1	2013-08-05	2013-08-05	2007-04-03	ENSG00000009844	ENSG00000009844			20954	protein-coding gene	gene with protein product		610902	"""chromosome 6 open reading frame 55"", ""Vps20-associated 1 homolog (S. cerevisiae)"""	C6orf55		11489251, 15644320	Standard	NM_001286372		Approved	HSPC228, My012	uc003qiw.3	Q9NP79	OTTHUMG00000015707	ENST00000367630.4:c.118T>C	6.37:g.142487370T>C		154.0	0.0		126.0	7.0	NM_016485	B4DW55|E1P594|E7ETQ7|Q5TGM1|Q6IAE8|Q9H0R2|Q9H3K9|Q9P0Q0	Silent	SNP	ENST00000367630.4	37	CCDS5197.1																																																																																			.		0.274	VTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042483.2	NM_016485	
WBP11	51729	broad.mit.edu;bcgsc.ca	37	12	14953690	14953690	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr12:14953690T>C	ENST00000261167.2	-	3	325	c.92A>G	c.(91-93)aAg>aGg	p.K31R	C12orf60_ENST00000330828.2_5'Flank	NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	31	Required for nuclear import. {ECO:0000250}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						TCATACCTTCTTTAATTCTCT	0.308																																					p.K31R		.											.	WBP11	92	0			c.A92G						.						62.0	67.0	65.0					12																	14953690		2202	4296	6498	SO:0001583	missense	51729	exon3			ACCTTCTTTAATT	AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.92A>G	12.37:g.14953690T>C	ENSP00000261167:p.Lys31Arg	141.0	0.0		75.0	6.0	NM_016312	Q96AY8	Missense_Mutation	SNP	ENST00000261167.2	37	CCDS8666.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.546901	0.86022	.	.	ENSG00000084463	ENST00000261167;ENST00000537574;ENST00000535328	.	.	.	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.77698	0.4169	M	0.78916	2.43	0.58432	D	0.999996	D	0.69078	0.997	D	0.77004	0.989	T	0.80795	-0.1223	9	0.87932	D	0	-1.8228	12.098	0.53765	0.0:0.0:0.0:1.0	.	31	Q9Y2W2	WBP11_HUMAN	R	31	.	ENSP00000261167:K31R	K	-	2	0	WBP11	14844957	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.422000	0.80217	1.951000	0.56629	0.260000	0.18958	AAG	.		0.308	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400850.1	NM_016312	
WDR49	151790	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	167277892	167277892	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr3:167277892T>A	ENST00000308378.3	-	5	916	c.611A>T	c.(610-612)gAg>gTg	p.E204V	WDR49_ENST00000453925.2_Missense_Mutation_p.E257V|WDR49_ENST00000476376.1_Missense_Mutation_p.E29V|WDR49_ENST00000479765.1_Intron	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	204										breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						AAGCCGAGTCTCATTTGCATC	0.448																																					p.E204V		.											.	WDR49	155	0			c.A611T						.						189.0	172.0	178.0					3																	167277892		2203	4300	6503	SO:0001583	missense	151790	exon5			CGAGTCTCATTTG	AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.611A>T	3.37:g.167277892T>A	ENSP00000311343:p.Glu204Val	222.0	0.0		152.0	44.0	NM_178824	Q8N297	Missense_Mutation	SNP	ENST00000308378.3	37	CCDS3201.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.514|9.514	1.106465|1.106465	0.20632|0.20632	.|.	.|.	ENSG00000174776|ENSG00000174776	ENST00000308378;ENST00000476376;ENST00000453925;ENST00000466760|ENST00000472600	T;T;T;T|.	0.60424|.	1.51;1.22;2.09;0.19|.	4.94|4.94	3.77|3.77	0.43336|0.43336	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.	0.308110|.	0.34700|.	N|.	0.003745|.	T|.	0.50034|.	0.1592|.	L|L	0.52905|0.52905	1.665|1.665	0.26302|0.26302	N|N	0.977969|0.977969	P;P|.	0.50369|.	0.934;0.829|.	P;P|.	0.47346|.	0.541;0.544|.	T|.	0.38520|.	-0.9657|.	10|.	0.72032|.	D|.	0.01|.	.|.	11.3497|11.3497	0.49581|0.49581	0.0:0.0:0.1526:0.8474|0.0:0.0:0.1526:0.8474	.|.	257;204|.	E7EQK3;Q8IV35|.	.;WDR49_HUMAN|.	V|X	204;29;257;97|269	ENSP00000311343:E204V;ENSP00000420508:E29V;ENSP00000410863:E257V;ENSP00000418718:E97V|.	ENSP00000311343:E204V|.	E|R	-|-	2|1	0|2	WDR49|WDR49	168760586|168760586	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.483000|0.483000	0.33249|0.33249	2.697000|2.697000	0.47060|0.47060	0.839000|0.839000	0.34971|0.34971	-0.338000|-0.338000	0.08134|0.08134	GAG|AGA	.		0.448	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350592.3	NM_178824	
WWP2	11060	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	69959360	69959360	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr16:69959360C>T	ENST00000359154.2	+	11	1308	c.1207C>T	c.(1207-1209)Ccc>Tcc	p.P403S	WWP2_ENST00000448661.1_Missense_Mutation_p.P403S|WWP2_ENST00000568684.1_5'UTR|WWP2_ENST00000356003.2_Missense_Mutation_p.P403S|WWP2_ENST00000544162.1_3'UTR|WWP2_ENST00000542271.1_Missense_Mutation_p.P287S	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2	403					cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TGACCATGATCCCCTGGGCCC	0.522																																					p.P403S		.											.	WWP2	658	0			c.C1207T						.						354.0	351.0	352.0					16																	69959360		2198	4300	6498	SO:0001583	missense	11060	exon11			CATGATCCCCTGG	BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.1207C>T	16.37:g.69959360C>T	ENSP00000352069:p.Pro403Ser	129.0	0.0		157.0	40.0	NM_001270454	A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	Missense_Mutation	SNP	ENST00000359154.2	37	CCDS10885.1	.	.	.	.	.	.	.	.	.	.	C	35	5.547943	0.96488	.	.	ENSG00000198373	ENST00000359154;ENST00000448661;ENST00000356003;ENST00000544162;ENST00000542271	T;T;T;T	0.31247	1.52;1.52;1.52;1.5	5.65	5.65	0.86999	WW/Rsp5/WWP (2);	0.096147	0.64402	D	0.000001	T	0.33847	0.0877	M	0.63428	1.95	0.80722	D	1	B	0.33103	0.397	B	0.28709	0.093	T	0.07404	-1.0774	9	.	.	.	.	19.7358	0.96202	0.0:1.0:0.0:0.0	.	403	O00308	WWP2_HUMAN	S	403;403;403;290;287	ENSP00000352069:P403S;ENSP00000396871:P403S;ENSP00000348283:P403S;ENSP00000445616:P287S	.	P	+	1	0	WWP2	68516861	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.802000	0.85969	2.660000	0.90430	0.557000	0.71058	CCC	.		0.522	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268954.1	NM_007014	
XIRP2	129446	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	168099492	168099492	+	Missense_Mutation	SNP	C	C	G	rs112137897		TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr2:168099492C>G	ENST00000409195.1	+	9	1679	c.1590C>G	c.(1588-1590)aaC>aaG	p.N530K	XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.N308K|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.N530K	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	355					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GTCAAATGAACTCAGGGAGTT	0.338																																					p.N530K		.											.	XIRP2	104	0			c.C1590G						.						30.0	28.0	29.0					2																	168099492		1828	4084	5912	SO:0001583	missense	129446	exon9			AATGAACTCAGGG	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.1590C>G	2.37:g.168099492C>G	ENSP00000386840:p.Asn530Lys	77.0	0.0		43.0	5.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	C	2.940	-0.219144	0.06101	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02763	4.17;4.17;4.17	5.54	0.586	0.17434	.	0.175536	0.48767	D	0.000180	T	0.01835	0.0058	L	0.29908	0.895	0.09310	N	1	B;B;B	0.34329	0.181;0.449;0.449	B;B;B	0.32864	0.054;0.154;0.154	T	0.43988	-0.9357	10	0.42905	T	0.14	-7.3415	0.6739	0.00863	0.2433:0.3312:0.1124:0.3131	.	355;355;308	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	K	530;530;308	ENSP00000386840:N530K;ENSP00000295237:N530K;ENSP00000387255:N308K	ENSP00000295237:N530K	N	+	3	2	XIRP2	167807738	0.000000	0.05858	0.018000	0.16275	0.079000	0.17450	-0.273000	0.08548	0.035000	0.15519	-0.140000	0.14226	AAC	C|0.500;G|0.500		0.338	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
YTHDC2	64848	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	112899131	112899131	+	Missense_Mutation	SNP	T	T	C	rs559215760	byFrequency	TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr5:112899131T>C	ENST00000161863.4	+	19	2597	c.2384T>C	c.(2383-2385)aTg>aCg	p.M795T		NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	795					ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)			NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		GATTTTCTTATGAAAGCTCCT	0.313													T|||	2	0.000399361	0.0	0.0	5008	,	,		14416	0.002		0.0	False		,,,				2504	0.0				p.M795T		.											.	YTHDC2	92	0			c.T2384C						.						73.0	75.0	74.0					5																	112899131		2202	4300	6502	SO:0001583	missense	64848	exon19			TTCTTATGAAAGC	AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.2384T>C	5.37:g.112899131T>C	ENSP00000161863:p.Met795Thr	104.0	0.0		124.0	17.0	NM_022828	B2RP66	Missense_Mutation	SNP	ENST00000161863.4	37	CCDS4113.1	.	.	.	.	.	.	.	.	.	.	T	5.363	0.252250	0.10185	.	.	ENSG00000047188	ENST00000161863;ENST00000511372	T	0.02395	4.31	5.31	5.31	0.75309	.	0.143832	0.64402	D	0.000004	T	0.02156	0.0067	N	0.05124	-0.11	0.80722	D	1	B	0.10296	0.003	B	0.06405	0.002	T	0.59129	-0.7512	10	0.39692	T	0.17	.	15.2608	0.73621	0.0:0.0:0.0:1.0	.	795	Q9H6S0	YTDC2_HUMAN	T	795;705	ENSP00000161863:M795T	ENSP00000161863:M795T	M	+	2	0	YTHDC2	112927030	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.975000	0.56859	2.020000	0.59435	0.523000	0.50628	ATG	.		0.313	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250776.2	NM_022828	
ZC3H4	23211	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	47569634	47569634	+	Silent	SNP	C	C	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:47569634C>A	ENST00000253048.5	-	15	3928	c.3891G>T	c.(3889-3891)acG>acT	p.T1297T	ZC3H4_ENST00000594019.1_5'UTR	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	1297							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		AGGGGGAGGCCGTGGGGTCGA	0.627																																					p.T1297T		.											.	ZC3H4	74	0			c.G3891T						.						9.0	11.0	10.0					19																	47569634		1904	4069	5973	SO:0001819	synonymous_variant	23211	exon15			GGAGGCCGTGGGG	AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.3891G>T	19.37:g.47569634C>A		73.0	0.0		64.0	12.0	NM_015168	Q9Y420	Silent	SNP	ENST00000253048.5	37	CCDS42582.1																																																																																			.		0.627	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1		
ZCCHC12	170261	broad.mit.edu;bcgsc.ca	37	X	117960058	117960058	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chrX:117960058A>G	ENST00000310164.2	+	4	1358	c.851A>G	c.(850-852)gAc>gGc	p.D284G		NM_173798.2	NP_776159.1	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	284					BMP signaling pathway (GO:0030509)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	22						GAGTCTCAGGACCCTCCACTT	0.567																																					p.D284G		.											.	ZCCHC12	131	0			c.A851G						.						89.0	78.0	81.0					X																	117960058		2203	4300	6503	SO:0001583	missense	170261	exon4			CTCAGGACCCTCC	AK122676	CCDS14574.1	Xq24	2013-10-11			ENSG00000174460	ENSG00000174460		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	27273	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7A"""	300701				21739307, 19578717	Standard	NM_173798		Approved	FLJ16123, SIZN, SIZN1, PNMA7A	uc004equ.3	Q6PEW1	OTTHUMG00000022261	ENST00000310164.2:c.851A>G	X.37:g.117960058A>G	ENSP00000308921:p.Asp284Gly	98.0	0.0		136.0	6.0	NM_173798	B3KV48|Q6PID5|Q8N1C1	Missense_Mutation	SNP	ENST00000310164.2	37	CCDS14574.1	.	.	.	.	.	.	.	.	.	.	A	12.38	1.921871	0.33908	.	.	ENSG00000174460	ENST00000310164	T	0.35973	1.28	3.1	3.1	0.35709	.	.	.	.	.	T	0.36663	0.0975	M	0.68317	2.08	0.32157	N	0.583493	B	0.33612	0.419	B	0.38500	0.275	T	0.43909	-0.9362	9	0.31617	T	0.26	-15.3659	6.9982	0.24795	1.0:0.0:0.0:0.0	.	284	Q6PEW1	ZCH12_HUMAN	G	284	ENSP00000308921:D284G	ENSP00000308921:D284G	D	+	2	0	ZCCHC12	117844086	0.892000	0.30473	1.000000	0.80357	0.923000	0.55619	2.119000	0.41958	1.456000	0.47831	0.486000	0.48141	GAC	.		0.567	ZCCHC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058014.1	NM_173798	
ZHX1	11244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	124266621	124266621	+	Silent	SNP	T	T	C	rs373764646		TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr8:124266621T>C	ENST00000522655.1	-	3	2106	c.1566A>G	c.(1564-1566)tcA>tcG	p.S522S	ZHX1_ENST00000522595.1_5'Flank|ZHX1_ENST00000297857.2_Silent_p.S522S|ZHX1-C8ORF76_ENST00000357082.4_Intron|ZHX1_ENST00000395571.3_Silent_p.S522S			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	522	Required for interaction with NFYA.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			GATTACTCTTTGAATTTCTCT	0.388																																					p.S522S		.											.	ZHX1	91	0			c.A1566G						.						140.0	136.0	138.0					8																	124266621		2203	4300	6503	SO:0001819	synonymous_variant	11244	exon3			ACTCTTTGAATTT	AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.1566A>G	8.37:g.124266621T>C		100.0	0.0		54.0	20.0	NM_007222	Q8IWD8	Silent	SNP	ENST00000522655.1	37	CCDS6342.1	.	.	.	.	.	.	.	.	.	.	T	4.702	0.130447	0.08981	.	.	ENSG00000165156	ENST00000520474	.	.	.	5.19	-3.42	0.04825	.	.	.	.	.	T	0.39091	0.1065	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38672	-0.9650	4	.	.	.	-11.7049	2.1581	0.03818	0.103:0.1917:0.1954:0.51	.	.	.	.	R	207	.	.	Q	-	2	0	ZHX1	124335802	0.111000	0.22076	0.997000	0.53966	0.989000	0.77384	-0.744000	0.04839	-0.144000	0.11314	-0.388000	0.06559	CAA	.		0.388	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000381759.1		
ZNF14	7561	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	19822650	19822650	+	Silent	SNP	A	A	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:19822650A>G	ENST00000344099.3	-	4	1578	c.1440T>C	c.(1438-1440)tgT>tgC	p.C480C		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	480					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				AAACTTTTCCACACTGTTTAC	0.393																																					p.C480C		.											.	ZNF14	517	0			c.T1440C						.						82.0	77.0	78.0					19																	19822650		2203	4300	6503	SO:0001819	synonymous_variant	7561	exon4			TTTTCCACACTGT	AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.1440T>C	19.37:g.19822650A>G		69.0	0.0		48.0	10.0	NM_021030	B9EGA4|Q9ULZ5	Silent	SNP	ENST00000344099.3	37	CCDS12409.1																																																																																			.		0.393	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460775.1	NM_021030	
ZNF496	84838	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	247464447	247464447	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr1:247464447C>A	ENST00000294753.4	-	9	1602	c.1138G>T	c.(1138-1140)Gag>Tag	p.E380*	ZNF496_ENST00000366498.2_Nonsense_Mutation_p.E416*|ZNF496_ENST00000462139.1_5'UTR	NM_032752.1	NP_116141.1	Q96IT1	ZN496_HUMAN	zinc finger protein 496	380					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	36	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			CGCTGCTTCTCTGTGGGGCTC	0.632																																					p.E380X		.											.	ZNF496	91	0			c.G1138T						.						31.0	38.0	35.0					1																	247464447		2203	4296	6499	SO:0001587	stop_gained	84838	exon9			GCTTCTCTGTGGG	BC007263	CCDS1631.1	1q44	2013-01-09			ENSG00000162714	ENSG00000162714		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23713	protein-coding gene	gene with protein product		613911				12477932	Standard	NM_032752		Approved	ZKSCAN17, MGC15548, ZSCAN49	uc001ico.3	Q96IT1	OTTHUMG00000041164	ENST00000294753.4:c.1138G>T	1.37:g.247464447C>A	ENSP00000294753:p.Glu380*	190.0	0.0		154.0	47.0	NM_032752	Q8TBS2	Nonsense_Mutation	SNP	ENST00000294753.4	37	CCDS1631.1	.	.	.	.	.	.	.	.	.	.	C	37	6.432110	0.97564	.	.	ENSG00000162714	ENST00000294753;ENST00000366498	.	.	.	3.88	1.99	0.26369	.	0.757625	0.11666	N	0.541327	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-10.814	5.0192	0.14352	0.0:0.6497:0.0:0.3503	.	.	.	.	X	380;416	.	ENSP00000294753:E380X	E	-	1	0	ZNF496	245531070	0.001000	0.12720	0.022000	0.16811	0.021000	0.10359	1.225000	0.32551	0.983000	0.38602	0.591000	0.81541	GAG	.		0.632	ZNF496-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098655.2	NM_032752	
ZNF709	163051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	12575313	12575313	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:12575313G>A	ENST00000397732.3	-	4	1594	c.1423C>T	c.(1423-1425)Ccc>Tcc	p.P475S	CTD-3105H18.18_ENST00000598753.1_Intron|ZNF709_ENST00000428311.1_Missense_Mutation_p.P475S	NM_152601.3	NP_689814.1	Q8N972	ZN709_HUMAN	zinc finger protein 709	475					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|upper_aerodigestive_tract(3)	6						CATTCATAGGGTTTCTCTCCA	0.403																																					p.P475S	GBM(33;565 669 12371 29134 51667)	.											.	ZNF709	90	0			c.C1423T						.						90.0	96.0	94.0					19																	12575313		2203	4300	6503	SO:0001583	missense	163051	exon4			CATAGGGTTTCTC	AK095600	CCDS42504.1	19p13.2	2013-01-08			ENSG00000242852	ENSG00000242852		"""Zinc fingers, C2H2-type"", ""-"""	20629	protein-coding gene	gene with protein product							Standard	NM_152601		Approved	FLJ38281	uc002mtv.4	Q8N972	OTTHUMG00000156406	ENST00000397732.3:c.1423C>T	19.37:g.12575313G>A	ENSP00000380840:p.Pro475Ser	51.0	0.0		42.0	8.0	NM_152601	A8K4E6	Missense_Mutation	SNP	ENST00000397732.3	37	CCDS42504.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.449384	0.84101	.	.	ENSG00000242852;ENSG00000196826	ENST00000397732;ENST00000428311	T;T	0.16743	2.32;2.32	3.05	3.05	0.35203	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.33772	N	0.004580	T	0.32645	0.0836	L	0.53780	1.695	0.31497	N	0.665273	D	0.89917	1.0	D	0.80764	0.994	T	0.19516	-1.0303	10	0.66056	D	0.02	.	10.1848	0.42991	0.0:0.2053:0.7947:0.0	.	475	Q8N972	ZN709_HUMAN	S	475	ENSP00000380840:P475S;ENSP00000404127:P475S	ENSP00000404127:P475S	P	-	1	0	ZNF709;CTD-2192J16.17	12436313	0.554000	0.26522	0.121000	0.21740	0.998000	0.95712	2.607000	0.46300	2.032000	0.59987	0.591000	0.81541	CCC	.		0.403	ZNF709-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344088.1	NM_152601	
ZNF675	171392	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	23836584	23836584	+	Missense_Mutation	SNP	G	G	A	rs200866824		TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:23836584G>A	ENST00000359788.4	-	4	1319	c.1151C>T	c.(1150-1152)aCg>aTg	p.T384M	ZNF675_ENST00000596211.1_Intron|ZNF675_ENST00000600313.1_Intron|ZNF675_ENST00000601935.1_Intron	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675	384					bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				CCTATGTTCCGTAAGATTTGA	0.383																																					p.T384M		.											.	ZNF675	228	0			c.C1151T						.						69.0	68.0	68.0					19																	23836584		2203	4300	6503	SO:0001583	missense	171392	exon4			TGTTCCGTAAGAT		CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.1151C>T	19.37:g.23836584G>A	ENSP00000352836:p.Thr384Met	27.0	0.0		33.0	8.0	NM_138330	Q8N211	Missense_Mutation	SNP	ENST00000359788.4	37	CCDS32981.1	.	.	.	.	.	.	.	.	.	.	.	8.906	0.957488	0.18507	.	.	ENSG00000197372	ENST00000359788	T	0.08102	3.13	0.225	0.225	0.15325	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15565	0.0375	L	0.56340	1.77	0.09310	N	1	D	0.64830	0.994	P	0.56216	0.794	T	0.12091	-1.0561	9	0.87932	D	0	.	7.9744	0.30147	1.0E-4:0.0:0.9999:0.0	.	384	Q8TD23	ZN675_HUMAN	M	384	ENSP00000352836:T384M	ENSP00000352836:T384M	T	-	2	0	ZNF675	23628424	0.000000	0.05858	0.007000	0.13788	0.007000	0.05969	-1.245000	0.02899	0.300000	0.22699	0.305000	0.20034	ACG	G|0.999;C|0.001		0.383	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466433.1	NM_138330	
ZNF585B	92285	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	37676268	37676268	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:37676268C>G	ENST00000532828.2	-	5	2422	c.2171G>C	c.(2170-2172)gGg>gCg	p.G724A	ZNF585B_ENST00000312908.5_Missense_Mutation_p.G312A|CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000527838.1_3'UTR|ZNF585B_ENST00000531805.1_Missense_Mutation_p.G669A	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	724					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAAGGCCTTCCCACACTCAGC	0.473																																					p.G724A	Melanoma(93;882 1454 18863 28917 48427)	.											.	ZNF585B	91	0			c.G2171C						.						187.0	154.0	165.0					19																	37676268		2203	4300	6503	SO:0001583	missense	92285	exon5			GCCTTCCCACACT	AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.2171G>C	19.37:g.37676268C>G	ENSP00000433773:p.Gly724Ala	332.0	1.0		311.0	73.0	NM_152279	Q8IZD3|Q96JW6	Missense_Mutation	SNP	ENST00000532828.2	37	CCDS12500.1	.	.	.	.	.	.	.	.	.	.	C	10.65	1.410090	0.25465	.	.	ENSG00000245680	ENST00000531805;ENST00000532828;ENST00000312908	T;T;T	0.07021	3.23;3.23;3.23	2.65	2.65	0.31530	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38272	N	0.001749	T	0.22475	0.0542	L	0.58354	1.805	0.33037	D	0.530992	P;D	0.69078	0.666;0.997	B;D	0.77004	0.133;0.989	T	0.25502	-1.0130	10	0.72032	D	0.01	.	12.382	0.55311	0.0:1.0:0.0:0.0	.	669;724	E9PQH3;Q52M93	.;Z585B_HUMAN	A	669;724;312	ENSP00000436774:G669A;ENSP00000433773:G724A;ENSP00000442139:G312A	ENSP00000442139:G312A	G	-	2	0	ZNF585B	42368108	0.859000	0.29813	0.982000	0.44146	0.436000	0.31835	1.704000	0.37857	1.455000	0.47813	0.305000	0.20034	GGG	.		0.473	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388272.2	NM_152279	
ZNF878	729747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	12155914	12155914	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:12155914G>A	ENST00000547628.1	-	4	439	c.302C>T	c.(301-303)tCa>tTa	p.S101L	CTD-2006C1.2_ENST00000591898.1_RNA|ZNF878_ENST00000602107.1_Missense_Mutation_p.S148L|CTD-2006C1.2_ENST00000476474.1_RNA|CTD-2006C1.10_ENST00000547473.1_Intron|CTD-2006C1.2_ENST00000591838.1_RNA	NM_001080404.2	NP_001073873.2	C9JN71	ZN878_HUMAN	zinc finger protein 878	101					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|kidney(1)|lung(4)|urinary_tract(1)	8						GCTTTCATATGATTGTACTCC	0.433																																					p.S101L		.											.	.	.	0			c.C302T						.						66.0	62.0	63.0					19																	12155914		2018	4219	6237	SO:0001583	missense	729747	exon4			TCATATGATTGTA		CCDS45984.1, CCDS45984.2	19p13.2	2013-01-08				ENSG00000257446		"""Zinc fingers, C2H2-type"", ""-"""	37246	protein-coding gene	gene with protein product							Standard	NM_001080404		Approved		uc021upl.1	C9JN71		ENST00000547628.1:c.302C>T	19.37:g.12155914G>A	ENSP00000447931:p.Ser101Leu	142.0	0.0		124.0	31.0	NM_001080404		Missense_Mutation	SNP	ENST00000547628.1	37	CCDS45984.2	.	.	.	.	.	.	.	.	.	.	G	6.743	0.505917	0.12883	.	.	ENSG00000257446;ENSG00000232371	ENST00000547628;ENST00000440730	T	0.06687	3.27	1.3	1.3	0.21679	.	.	.	.	.	T	0.11922	0.0290	L	0.40543	1.245	0.09310	N	1	D	0.60575	0.988	P	0.53313	0.723	T	0.20140	-1.0284	9	0.44086	T	0.13	.	8.094	0.30818	0.0:0.0:1.0:0.0	.	101	C9JN71	ZN878_HUMAN	L	101;148	ENSP00000447931:S101L	ENSP00000447931:S101L	S	-	2	0	AC022415.4;ZNF878	12016914	0.000000	0.05858	0.003000	0.11579	0.025000	0.11179	0.400000	0.20932	0.675000	0.31264	0.313000	0.20887	TCA	.		0.433	ZNF878-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403723.1	NM_001080404	
ZNF749	388567	broad.mit.edu;bcgsc.ca	37	19	57955019	57955019	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3M9-01A-11D-A20W-10	TCGA-CC-A3M9-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a532b617-df73-4bc6-aa5f-40882defe2f0	0249fd94-5666-465e-9f4a-8c1f2bf0bbc6	g.chr19:57955019T>C	ENST00000334181.4	+	3	753	c.503T>C	c.(502-504)cTc>cCc	p.L168P	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	168					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		TCAGACCTTCTCCAGCAACAG	0.517																																					p.L168P		.											.	.	.	0			c.T503C						.						76.0	62.0	67.0					19																	57955019		2203	4300	6503	SO:0001583	missense	388567	exon3			ACCTTCTCCAGCA	AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.503T>C	19.37:g.57955019T>C	ENSP00000333980:p.Leu168Pro	131.0	1.0		130.0	6.0	NM_001023561		Missense_Mutation	SNP	ENST00000334181.4	37	CCDS33132.2	.	.	.	.	.	.	.	.	.	.	T	11.10	1.538699	0.27475	.	.	ENSG00000186230	ENST00000334181	T	0.01787	4.64	2.06	-1.86	0.07760	.	.	.	.	.	T	0.01800	0.0057	L	0.54323	1.7	0.09310	N	1	B	0.28400	0.21	B	0.25405	0.06	T	0.45760	-0.9239	9	0.22109	T	0.4	.	4.3798	0.11288	0.0:0.1313:0.3867:0.4819	.	168	O43361	ZN749_HUMAN	P	168	ENSP00000333980:L168P	ENSP00000333980:L168P	L	+	2	0	ZNF749	62646831	0.000000	0.05858	0.000000	0.03702	0.136000	0.21042	-0.453000	0.06778	-0.606000	0.05746	0.254000	0.18369	CTC	.		0.517	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317879.1	NM_001023561	
