#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
B4GALT5	9334	broad.mit.edu;bcgsc.ca	37	20	48256272	48256272	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr20:48256272T>C	ENST00000371711.4	-	7	1047	c.860A>G	c.(859-861)aAt>aGt	p.N287S		NM_004776.3	NP_004767.1	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5	287					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			AGGAAAGCCATTGATTTTCCG	0.478																																					p.N287S		.											.	B4GALT5	91	0			c.A860G						.						171.0	158.0	162.0					20																	48256272		2203	4300	6503	SO:0001583	missense	9334	exon7			AAGCCATTGATTT	AB004550	CCDS13420.1	20q13.1-q13.2	2013-02-19			ENSG00000158470	ENSG00000158470		"""Beta 4-glycosyltransferases"""	928	protein-coding gene	gene with protein product	"""beta4-GalT IV"""	604016				9597550, 9435216	Standard	NM_004776		Approved	beta4GalT-V	uc002xuu.4	O43286	OTTHUMG00000033086	ENST00000371711.4:c.860A>G	20.37:g.48256272T>C	ENSP00000360776:p.Asn287Ser	161.0	0.0		134.0	6.0	NM_004776	E1P625|Q2M394|Q9UJQ8	Missense_Mutation	SNP	ENST00000371711.4	37	CCDS13420.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.791094	0.90367	.	.	ENSG00000158470	ENST00000371711	T	0.37411	1.2	5.21	5.21	0.72293	.	0.041659	0.85682	D	0.000000	T	0.70378	0.3217	H	0.94620	3.56	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.80204	-0.1479	10	0.87932	D	0	-24.0121	15.0878	0.72167	0.0:0.0:0.0:1.0	.	287	O43286	B4GT5_HUMAN	S	287	ENSP00000360776:N287S	ENSP00000360776:N287S	N	-	2	0	B4GALT5	47689679	1.000000	0.71417	0.999000	0.59377	0.889000	0.51656	8.040000	0.89188	1.975000	0.57531	0.459000	0.35465	AAT	.		0.478	B4GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080543.3	NM_004776	
BIRC6	57448	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	32692803	32692803	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr2:32692803T>C	ENST00000421745.2	+	27	5701	c.5567T>C	c.(5566-5568)aTg>aCg	p.M1856T		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1856					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TGCAGATTCATGAAGGTAAAG	0.333																																					p.M1856T	Pancreas(94;175 1509 16028 18060 45422)	.											.	BIRC6	233	0			c.T5567C						.						53.0	49.0	50.0					2																	32692803		2203	4300	6503	SO:0001583	missense	57448	exon27			GATTCATGAAGGT	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.5567T>C	2.37:g.32692803T>C	ENSP00000393596:p.Met1856Thr	129.0	0.0		123.0	22.0	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	T	17.40	3.378901	0.61735	.	.	ENSG00000115760	ENST00000421745	T	0.75477	-0.94	5.61	5.61	0.85477	.	0.090659	0.64402	D	0.000001	T	0.69869	0.3159	L	0.50333	1.59	0.58432	D	0.999992	P	0.37864	0.61	B	0.34824	0.19	T	0.74250	-0.3726	10	0.87932	D	0	.	15.8638	0.79047	0.0:0.0:0.0:1.0	.	1856	Q9NR09	BIRC6_HUMAN	T	1856	ENSP00000393596:M1856T	ENSP00000393596:M1856T	M	+	2	0	BIRC6	32546307	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	7.717000	0.84732	2.162000	0.67917	0.456000	0.33151	ATG	.		0.333	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
BPTF	2186	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	65905845	65905845	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr17:65905845A>G	ENST00000321892.4	+	12	3399	c.3338A>G	c.(3337-3339)gAt>gGt	p.D1113G	BPTF_ENST00000335221.5_Missense_Mutation_p.D1113G|BPTF_ENST00000306378.6_Missense_Mutation_p.D987G|BPTF_ENST00000424123.3_Missense_Mutation_p.D974G			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1113					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			AATGAAATGGATATCTCAAAG	0.438																																					p.D1113G		.											.	BPTF	94	0			c.A3338G						.						70.0	68.0	69.0					17																	65905845		2203	4300	6503	SO:0001583	missense	2186	exon12			AAATGGATATCTC	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.3338A>G	17.37:g.65905845A>G	ENSP00000315454:p.Asp1113Gly	147.0	1.0		144.0	23.0	NM_004459	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	ENST00000321892.4	37		.	.	.	.	.	.	.	.	.	.	A	15.60	2.882040	0.51908	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892	T;T;T	0.65916	-0.18;-0.18;-0.18	6.07	6.07	0.98685	.	.	.	.	.	T	0.48409	0.1498	N	0.14661	0.345	0.25739	N	0.985186	P;B	0.38195	0.622;0.417	B;B	0.38500	0.275;0.153	T	0.48352	-0.9043	9	0.46703	T	0.11	-8.4304	13.0325	0.58851	1.0:0.0:0.0:0.0	.	987;1113	Q12830-2;Q12830-4	.;.	G	987;1113;1113	ENSP00000307208:D987G;ENSP00000334351:D1113G;ENSP00000315454:D1113G	ENSP00000307208:D987G	D	+	2	0	BPTF	63336307	1.000000	0.71417	0.975000	0.42487	0.841000	0.47740	3.009000	0.49552	2.326000	0.78906	0.533000	0.62120	GAT	.		0.438	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
BRCA2	675	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	32912486	32912486	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr13:32912486C>T	ENST00000380152.3	+	11	4227	c.3994C>T	c.(3994-3996)Cat>Tat	p.H1332Y	BRCA2_ENST00000544455.1_Missense_Mutation_p.H1332Y			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1332					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TAGAAATTCTCATAACTTAGA	0.308			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.H1332Y	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2	3153	0			c.C3994T						.						24.0	24.0	24.0					13																	32912486		2202	4289	6491	SO:0001583	missense	675	exon11	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	AATTCTCATAACT	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.3994C>T	13.37:g.32912486C>T	ENSP00000369497:p.His1332Tyr	160.0	0.0		124.0	26.0	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.113434	0.00032	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.00678	5.87;5.87	5.44	-0.395	0.12431	.	1.264310	0.05114	N	0.489382	T	0.00440	0.0014	N	0.10874	0.06	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45469	-0.9259	10	0.02654	T	1	.	0.2365	0.00187	0.2378:0.2012:0.1562:0.4049	.	1332	P51587	BRCA2_HUMAN	Y	1332	ENSP00000369497:H1332Y;ENSP00000439902:H1332Y	ENSP00000369497:H1332Y	H	+	1	0	BRCA2	31810486	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-0.239000	0.08965	0.374000	0.24650	-0.484000	0.04775	CAT	.		0.308	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
CADPS	8618	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	62484884	62484884	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr3:62484884C>T	ENST00000383710.4	-	18	3008	c.2659G>A	c.(2659-2661)Gaa>Aaa	p.E887K	CADPS_ENST00000283269.9_Missense_Mutation_p.E904K|CADPS_ENST00000357948.3_Missense_Mutation_p.E864K	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	887	Interaction with DRD2.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		ATGACTAGTTCAGCAAGACGT	0.448																																					p.E904K		.											.	CADPS	281	0			c.G2710A						.						162.0	138.0	146.0					3																	62484884		2203	4300	6503	SO:0001583	missense	8618	exon18			CTAGTTCAGCAAG	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.2659G>A	3.37:g.62484884C>T	ENSP00000373215:p.Glu887Lys	272.0	1.0		294.0	75.0	NM_183394	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	ENST00000383710.4	37	CCDS46858.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.992910	0.93167	.	.	ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269	T;T;T	0.56611	0.48;0.47;0.45	5.89	5.89	0.94794	Calcium-dependent secretion activator (1);	0.000000	0.85682	D	0.000000	T	0.75982	0.3924	M	0.80616	2.505	0.80722	D	1	P;D;D;D	0.63880	0.911;0.99;0.969;0.993	P;D;P;P	0.72982	0.674;0.979;0.735;0.864	T	0.77566	-0.2540	10	0.87932	D	0	.	20.2562	0.98421	0.0:1.0:0.0:0.0	.	864;904;887;887	Q9ULU8-2;Q9ULU8-3;Q9ULU8;Q9ULU8-4	.;.;CAPS1_HUMAN;.	K	887;887;864;904	ENSP00000373215:E887K;ENSP00000350632:E864K;ENSP00000283269:E904K	ENSP00000283269:E904K	E	-	1	0	CADPS	62459924	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.797000	0.96272	0.563000	0.77884	GAA	.		0.448	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
CCNL1	57018	ucsc.edu;bcgsc.ca	37	3	156866183	156866183	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr3:156866183G>T	ENST00000295926.3	-	11	1546	c.1428C>A	c.(1426-1428)agC>agA	p.S476R	CCNL1_ENST00000479052.1_5'Flank|CCNL1_ENST00000461804.1_Intron	NM_020307.2	NP_064703.1	Q9UK58	CCNL1_HUMAN	cyclin L1	476					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|nucleus (GO:0005634)				NS(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0295)|Lung(72;0.0308)			CCCGAGACTTGCTCTGAGATC	0.458																																					p.S476R		.											.	CCNL1	659	0			c.C1428A						.						268.0	246.0	253.0					3																	156866183		2203	4300	6503	SO:0001583	missense	57018	exon11			AGACTTGCTCTGA	AF180920	CCDS3178.1	3q25.31	2008-02-05			ENSG00000163660	ENSG00000163660			20569	protein-coding gene	gene with protein product		613384				11980906	Standard	NM_020307		Approved	ania-6a	uc003fbf.3	Q9UK58	OTTHUMG00000158713	ENST00000295926.3:c.1428C>A	3.37:g.156866183G>T	ENSP00000295926:p.Ser476Arg	213.0	2.0		177.0	31.0	NM_020307	B3KMY3|Q6NVY9|Q6UWS7|Q8NI48|Q96QT0|Q9NZF3	Missense_Mutation	SNP	ENST00000295926.3	37	CCDS3178.1	.	.	.	.	.	.	.	.	.	.	G	11.45	1.642703	0.29246	.	.	ENSG00000163660	ENST00000295926	D	0.97480	-4.4	5.02	5.02	0.67125	.	0.421653	0.30714	N	0.009030	D	0.93933	0.8058	L	0.33339	1.005	0.80722	D	1	P	0.48911	0.917	B	0.41135	0.348	D	0.92828	0.6278	10	0.14252	T	0.57	-10.7452	18.7083	0.91646	0.0:0.0:1.0:0.0	.	476	Q9UK58	CCNL1_HUMAN	R	476	ENSP00000295926:S476R	ENSP00000295926:S476R	S	-	3	2	CCNL1	158348877	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	4.524000	0.60552	2.462000	0.83206	0.557000	0.71058	AGC	.		0.458	CCNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351859.1	NM_020307	
CEP290	80184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	88508195	88508195	+	Splice_Site	SNP	A	A	C			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr12:88508195A>C	ENST00000552810.1	-	20	2396		c.e20+1		CEP290_ENST00000397838.3_Splice_Site|CEP290_ENST00000309041.7_Splice_Site	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa						cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						aaaataacTTACATTAACTAG	0.318																																					.		.											.	CEP290	96	0			c.2052+2T>G						.						146.0	129.0	134.0					12																	88508195		1475	3267	4742	SO:0001630	splice_region_variant	80184	exon21			TAACTTACATTAA	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.2052+1T>G	12.37:g.88508195A>C		201.0	0.0		109.0	31.0	NM_025114	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Splice_Site	SNP	ENST00000552810.1	37	CCDS55858.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.440396	0.83993	.	.	ENSG00000198707	ENST00000552810;ENST00000309041;ENST00000536998	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6245	0.84952	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CEP290	87032326	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.744000	0.85034	2.323000	0.78572	0.528000	0.53228	.	.		0.318	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	Intron
DNAH12	201625	broad.mit.edu;bcgsc.ca	37	3	57391597	57391597	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr3:57391597A>G	ENST00000351747.2	-	41	6482	c.6302T>C	c.(6301-6303)gTc>gCc	p.V2101A		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	2101	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						GCCCCGGATGACGCGTGAAAA	0.413																																					p.V2101A		.											.	DNAH12	47	0			c.T6302C						.						101.0	93.0	95.0					3																	57391597		692	1591	2283	SO:0001583	missense	201625	exon41			CGGATGACGCGTG	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.6302T>C	3.37:g.57391597A>G	ENSP00000295937:p.Val2101Ala	94.0	0.0		105.0	5.0	NM_178504	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	ENST00000351747.2	37		.	.	.	.	.	.	.	.	.	.	A	20.3	3.962211	0.74016	.	.	ENSG00000174844	ENST00000351747;ENST00000495027	T;T	0.41400	1.0;1.0	5.73	5.73	0.89815	.	.	.	.	.	T	0.76521	0.3999	H	0.96748	3.875	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.85133	0.0976	9	0.87932	D	0	.	16.0191	0.80468	1.0:0.0:0.0:0.0	.	2101	Q6ZR08	DYH12_HUMAN	A	2101;2120	ENSP00000295937:V2101A;ENSP00000418137:V2120A	ENSP00000295937:V2101A	V	-	2	0	DNAH12	57366637	1.000000	0.71417	0.992000	0.48379	0.805000	0.45488	9.051000	0.93849	2.174000	0.68829	0.528000	0.53228	GTC	.		0.413	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
DOCK6	57572	ucsc.edu;bcgsc.ca	37	19	11322782	11322782	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr19:11322782G>T	ENST00000294618.7	-	36	4548	c.4537C>A	c.(4537-4539)Ctg>Atg	p.L1513M	DOCK6_ENST00000319867.7_Missense_Mutation_p.L852M|CTC-510F12.2_ENST00000588634.1_RNA	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	1513					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GTCCCCACCAGGGACGAGAGA	0.612																																					p.L1513M		.											.	DOCK6	93	0			c.C4537A						.						43.0	43.0	43.0					19																	11322782		2056	4185	6241	SO:0001583	missense	57572	exon36			CCACCAGGGACGA		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.4537C>A	19.37:g.11322782G>T	ENSP00000294618:p.Leu1513Met	50.0	0.0		31.0	4.0	NM_020812	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	ENST00000294618.7	37	CCDS45975.1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.606089	0.46527	.	.	ENSG00000130158	ENST00000294618;ENST00000319867	T;T	0.02050	4.48;4.48	4.56	2.41	0.29592	.	0.000000	0.64402	D	0.000003	T	0.09555	0.0235	M	0.75777	2.31	0.58432	D	0.999995	D;D	0.89917	1.0;0.989	D;D	0.83275	0.996;0.912	T	0.00802	-1.1560	10	0.87932	D	0	-18.6475	7.8149	0.29254	0.2696:0.0:0.7304:0.0	.	852;1513	C9IZV6;Q96HP0	.;DOCK6_HUMAN	M	1513;852	ENSP00000294618:L1513M;ENSP00000321556:L852M	ENSP00000294618:L1513M	L	-	1	2	DOCK6	11183782	1.000000	0.71417	0.994000	0.49952	0.441000	0.31987	5.209000	0.65208	0.475000	0.27415	-0.136000	0.14681	CTG	.		0.612	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	
FAM182B	728882	broad.mit.edu;mdanderson.org	37	20	25755519	25755519	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr20:25755519T>G	ENST00000376403.1	-	3	815	c.437A>C	c.(436-438)cAt>cCt	p.H146P	FAM182B_ENST00000478164.1_Intron|FAM182B_ENST00000376404.2_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	146										lung(1)	1						GCGGCCACCATGCTGCCCGCT	0.706																																					.		.											.	.	.	0			.						.																																			SO:0001583	missense	728882	.			CCACCATGCTGCC			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.437A>C	20.37:g.25755519T>G	ENSP00000365585:p.His146Pro	66.0	0.0		57.0	8.0	.	Q4G0Q1	RNA	SNP	ENST00000376403.1	37		.	.	.	.	.	.	.	.	.	.	.	0.827	-0.746612	0.03065	.	.	ENSG00000175170	ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.39036	0.1063	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.39210	-0.9625	3	0.87932	D	0	.	.	.	.	.	.	.	.	P	146	.	ENSP00000365585:H146P	H	-	2	0	FAM182B	25703519	0.078000	0.21339	0.062000	0.19696	0.062000	0.15995	-0.905000	0.04075	0.056000	0.16144	0.055000	0.15244	CAT	.		0.706	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000078463.2	NR_026714	
FARSB	10056	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	223505623	223505623	+	Silent	SNP	T	T	A			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr2:223505623T>A	ENST00000281828.6	-	4	560	c.297A>T	c.(295-297)gtA>gtT	p.V99V	FARSB_ENST00000536361.1_5'UTR	NM_005687.3	NP_005678.3	Q9NSD9	SYFB_HUMAN	phenylalanyl-tRNA synthetase, beta subunit	99					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|RNA binding (GO:0003723)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	24		Renal(207;0.0183)		Epithelial(121;3.47e-10)|all cancers(144;1.86e-07)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.011)	L-Phenylalanine(DB00120)	CATCAGGCATTACCCGTTTAT	0.254																																					p.V99V		.											.	FARSB	91	0			c.A297T						.						37.0	39.0	39.0					2																	223505623		2201	4297	6498	SO:0001819	synonymous_variant	10056	exon4			AGGCATTACCCGT	AF042346	CCDS2454.1	2q36.2	2011-07-01	2007-02-23	2007-02-23	ENSG00000116120	ENSG00000116120	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	17800	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, beta, cytoplasmic"""	609690	"""phenylalanyl-tRNA synthetase-like, beta subunit"""	FARSLB		10049785	Standard	NM_005687		Approved	PheHB, FRSB	uc002vne.1	Q9NSD9	OTTHUMG00000133155	ENST00000281828.6:c.297A>T	2.37:g.223505623T>A		633.0	0.0		329.0	54.0	NM_005687	B4DFM0|O95708|Q4ZFX1|Q57ZJ5|Q9NZZ6	Silent	SNP	ENST00000281828.6	37	CCDS2454.1																																																																																			.		0.254	FARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256855.2	NM_005687	
FBF1	85302	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	73918105	73918105	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr17:73918105C>G	ENST00000586717.1	-	14	1678	c.1405G>C	c.(1405-1407)Ggg>Cgg	p.G469R	FBF1_ENST00000389570.4_Missense_Mutation_p.G469R|FBF1_ENST00000319129.5_Missense_Mutation_p.G468R			Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1	469					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	4						TGCTCAAGCCCTTGTGTGCTG	0.622																																					p.G468R		.											.	FBF1	205	0			c.G1402C						.						41.0	47.0	45.0					17																	73918105		2071	3986	6057	SO:0001583	missense	85302	exon14			CAAGCCCTTGTGT	AK074045	CCDS45779.1	17q25.3	2011-04-21			ENSG00000188878	ENSG00000188878			24674	protein-coding gene	gene with protein product	"""albatross"""					11347906	Standard	NM_001080542		Approved	FLJ00103, FBF-1, KIAA1863, ALB	uc002jqc.3	Q8TES7		ENST00000586717.1:c.1405G>C	17.37:g.73918105C>G	ENSP00000465132:p.Gly469Arg	120.0	0.0		108.0	20.0	NM_001080542	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000586717.1	37		.	.	.	.	.	.	.	.	.	.	C	10.75	1.437176	0.25900	.	.	ENSG00000188878	ENST00000337792;ENST00000389570;ENST00000319129;ENST00000427433	T;T	0.17370	2.28;2.28	5.45	3.43	0.39272	.	.	.	.	.	T	0.12817	0.0311	L	0.44542	1.39	0.09310	N	1	B;B;B	0.31548	0.328;0.029;0.102	B;B;B	0.29598	0.104;0.021;0.063	T	0.22626	-1.0211	9	0.11485	T	0.65	-8.5154	8.9107	0.35552	0.0:0.8223:0.0:0.1777	.	483;469;468	Q8TES7-6;Q8TES7;A6NLR5	.;FBF1_HUMAN;.	R	469;469;468;482	ENSP00000374221:G469R;ENSP00000324292:G468R	ENSP00000324292:G468R	G	-	1	0	FBF1	71429700	0.001000	0.12720	0.005000	0.12908	0.002000	0.02628	1.370000	0.34238	1.287000	0.44583	0.655000	0.94253	GGG	.		0.622	FBF1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000448945.2	NM_001080542	
FOXK1	221937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	4799104	4799104	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr7:4799104T>G	ENST00000328914.4	+	7	1574	c.1574T>G	c.(1573-1575)gTc>gGc	p.V525G	FOXK1_ENST00000446823.1_Missense_Mutation_p.V362G	NM_001037165.1	NP_001032242.1			forkhead box K1											breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		GTCACCATGGTCAGGGTGGTC	0.697																																					p.V525G		.											.	FOXK1	516	0			c.T1574G						.						37.0	29.0	32.0					7																	4799104		2192	4297	6489	SO:0001583	missense	221937	exon7			CCATGGTCAGGGT	BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.1574T>G	7.37:g.4799104T>G	ENSP00000328720:p.Val525Gly	29.0	0.0		74.0	10.0	NM_001037165		Missense_Mutation	SNP	ENST00000328914.4	37	CCDS34591.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.159664	0.78226	.	.	ENSG00000164916	ENST00000446823;ENST00000450194;ENST00000328914;ENST00000545598	D;D	0.96136	-3.54;-3.92	5.65	5.65	0.86999	.	0.061247	0.64402	D	0.000004	D	0.94686	0.8286	L	0.46157	1.445	0.80722	D	1	D;B	0.54047	0.964;0.449	P;B	0.49140	0.601;0.329	D	0.94630	0.7821	10	0.51188	T	0.08	.	15.3584	0.74448	0.0:0.0:0.0:1.0	.	525;362	P85037;P85037-2	FOXK1_HUMAN;.	G	362;281;525;408	ENSP00000394442:V362G;ENSP00000328720:V525G	ENSP00000328720:V525G	V	+	2	0	FOXK1	4765630	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	7.556000	0.82233	2.279000	0.76181	0.533000	0.62120	GTC	.		0.697	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323729.2		
GPN2	54707	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	1	27210697	27210697	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr1:27210697C>A	ENST00000374135.4	-	4	1014	c.814G>T	c.(814-816)Gaa>Taa	p.E272*	GPN2_ENST00000374133.3_Nonsense_Mutation_p.E93*|GPN2_ENST00000461282.1_5'Flank	NM_018066.3	NP_060536.3			GPN-loop GTPase 2											endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9						ATCATGGCTTCCAAGCTTCGC	0.547																																					p.E272X		.											.	GPN2	90	0			c.G814T						.						89.0	74.0	79.0					1																	27210697		2203	4300	6503	SO:0001587	stop_gained	54707	exon4			TGGCTTCCAAGCT	AK001211	CCDS289.1	1p36.11	2008-04-30	2008-04-30	2008-04-30	ENSG00000142751	ENSG00000142751		"""GPN-loop GTPases"""	25513	protein-coding gene	gene with protein product			"""ATP binding domain 1 family, member B"""	ATPBD1B		12975309	Standard	NM_018066		Approved	FLJ10349	uc001bnd.1	Q9H9Y4	OTTHUMG00000004227	ENST00000374135.4:c.814G>T	1.37:g.27210697C>A	ENSP00000363250:p.Glu272*	137.0	0.0		127.0	17.0	NM_018066		Nonsense_Mutation	SNP	ENST00000374135.4	37	CCDS289.1	.	.	.	.	.	.	.	.	.	.	C	37	6.442196	0.97572	.	.	ENSG00000142751	ENST00000374135;ENST00000374133	.	.	.	5.41	5.41	0.78517	.	0.113746	0.64402	D	0.000014	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	-26.9871	18.8009	0.92016	0.0:1.0:0.0:0.0	.	.	.	.	X	272;93	.	ENSP00000363248:E93X	E	-	1	0	GPN2	27083284	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	4.984000	0.63838	2.536000	0.85505	0.491000	0.48974	GAA	.		0.547	GPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012175.2	NM_018066	
GPR114	221188	broad.mit.edu;bcgsc.ca	37	16	57601900	57601900	+	Silent	SNP	C	C	T	rs201435952		TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr16:57601900C>T	ENST00000340339.4	+	9	1477	c.954C>T	c.(952-954)gcC>gcT	p.A318A	GPR114_ENST00000394361.4_3'UTR|GPR114_ENST00000349457.3_Silent_p.A318A	NM_153837.1	NP_722579.1	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114	318					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(5)|ovary(2)|stomach(1)|urinary_tract(1)	23						CGGCTCTGGCCGCTGCCCTGC	0.622													c|||	1	0.000199681	0.0	0.0	5008	,	,		22100	0.0		0.001	False		,,,				2504	0.0				p.A318A		.											.	GPR114	90	0			c.C954T						.						100.0	78.0	86.0					16																	57601900		2198	4300	6498	SO:0001819	synonymous_variant	221188	exon9			TCTGGCCGCTGCC	AY140956	CCDS10785.1	16q13	2014-08-08			ENSG00000159618	ENSG00000159618		"""-"", ""GPCR / Class B : Orphans"""	19010	protein-coding gene	gene with protein product						12435584	Standard	NM_153837		Approved	PGR27	uc002ely.3	Q8IZF4	OTTHUMG00000133461	ENST00000340339.4:c.954C>T	16.37:g.57601900C>T		122.0	0.0		86.0	5.0	NM_153837	B3KXZ5|Q6ZMH7|Q6ZML4|Q86SL8|Q8IZ14	Silent	SNP	ENST00000340339.4	37	CCDS10785.1																																																																																			C|0.999;T|0.000		0.622	GPR114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257336.3	NM_153837	
GPR142	350383	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	72367888	72367888	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr17:72367888G>A	ENST00000335666.4	+	4	586	c.538G>A	c.(538-540)Gcc>Acc	p.A180T		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	180						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A180T(1)		central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						GACCGCAGTGGCCCTGGCGCG	0.622																																					p.A180T		.											.	GPR142	93	1	Substitution - Missense(1)	lung(1)	c.G538A						.						45.0	40.0	42.0					17																	72367888		2203	4300	6503	SO:0001583	missense	350383	exon4			GCAGTGGCCCTGG	AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.538G>A	17.37:g.72367888G>A	ENSP00000335158:p.Ala180Thr	44.0	0.0		47.0	10.0	NM_181790	A4CYJ8|Q86SL3	Missense_Mutation	SNP	ENST00000335666.4	37	CCDS11698.1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.762461	0.31228	.	.	ENSG00000257008	ENST00000335666	T	0.38560	1.13	4.68	3.71	0.42584	GPCR, rhodopsin-like superfamily (1);	0.175229	0.49916	N	0.000129	T	0.44052	0.1275	L	0.50919	1.6	0.40575	D	0.981335	P;P	0.47484	0.896;0.476	P;B	0.47118	0.538;0.219	T	0.48614	-0.9020	10	0.56958	D	0.05	-3.3935	12.8413	0.57805	0.0831:0.0:0.9169:0.0	.	180;1142	Q7Z601;Q8NGB0	GP142_HUMAN;.	T	180	ENSP00000335158:A180T	ENSP00000335158:A180T	A	+	1	0	GPR142	69879483	1.000000	0.71417	0.892000	0.35008	0.219000	0.24729	3.189000	0.50965	1.283000	0.44513	0.558000	0.71614	GCC	.		0.622	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442545.1	NM_181790	
GPR68	8111	ucsc.edu;bcgsc.ca	37	14	91700519	91700519	+	Silent	SNP	G	G	T	rs374417261		TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr14:91700519G>T	ENST00000531499.2	-	2	1215	c.876C>A	c.(874-876)acC>acA	p.T292T	GPR68_ENST00000535815.1_Silent_p.T292T|GPR68_ENST00000529300.1_5'Flank|GPR68_ENST00000238699.3_Silent_p.T302T			Q15743	OGR1_HUMAN	G protein-coupled receptor 68	292					cellular response to pH (GO:0071467)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of osteoclast development (GO:2001206)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(2)|endometrium(1)|kidney(1)|lung(2)|skin(1)|urinary_tract(1)	8		all_cancers(154;0.0555)		COAD - Colon adenocarcinoma(157;0.21)		CCCGGTGGGTGGTCTCGCTGA	0.697																																					p.T292T		.											.	GPR68	91	0			c.C876A						.						13.0	17.0	16.0					14																	91700519		2159	4239	6398	SO:0001819	synonymous_variant	8111	exon2			GTGGGTGGTCTCG	U48405	CCDS9894.1, CCDS9894.2	14q31	2012-08-21				ENSG00000119714		"""GPCR / Class A : Orphans"""	4519	protein-coding gene	gene with protein product		601404				8661159	Standard	NM_001177676		Approved	OGR1	uc001xzg.3	Q15743		ENST00000531499.2:c.876C>A	14.37:g.91700519G>T		23.0	0.0		32.0	4.0	NM_001177676	Q13334|Q4VBB4|Q6IX34	Silent	SNP	ENST00000531499.2	37	CCDS9894.2																																																																																			.		0.697	GPR68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395245.2		
IL12RB2	3595	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	67795378	67795378	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr1:67795378G>C	ENST00000262345.1	+	6	1413	c.773G>C	c.(772-774)aGa>aCa	p.R258T	IL12RB2_ENST00000371000.1_Missense_Mutation_p.R258T|IL12RB2_ENST00000541374.1_Missense_Mutation_p.R258T|IL12RB2_ENST00000544434.1_Missense_Mutation_p.R258T	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	258	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						AATCGACTCAGATATCGGCCC	0.428																																					p.R258T		.											.	IL12RB2	92	0			c.G773C						.						127.0	121.0	123.0					1																	67795378		2203	4300	6503	SO:0001583	missense	3595	exon6			GACTCAGATATCG	U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.773G>C	1.37:g.67795378G>C	ENSP00000262345:p.Arg258Thr	150.0	0.0		142.0	23.0	NM_001559	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	ENST00000262345.1	37	CCDS638.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.31|14.31	2.495951|2.495951	0.44352|0.44352	.|.	.|.	ENSG00000081985|ENSG00000081985	ENST00000441640|ENST00000262345;ENST00000371000;ENST00000541374;ENST00000544434	.|T;T;T;T	.|0.56444	.|0.46;0.46;0.46;0.46	5.2|5.2	2.04|2.04	0.26737|0.26737	.|Fibronectin, type III (3);Immunoglobulin-like fold (1);	.|0.213014	.|0.49916	.|D	.|0.000125	T|T	0.52208|0.52208	0.1720|0.1720	M|M	0.78637|0.78637	2.42|2.42	0.37417|0.37417	D|D	0.913466|0.913466	.|P;D;P;D	.|0.60575	.|0.547;0.988;0.946;0.961	.|B;P;P;P	.|0.58721	.|0.276;0.844;0.754;0.617	T|T	0.56226|0.56226	-0.8014|-0.8014	5|10	.|0.56958	.|D	.|0.05	-11.6493|-11.6493	7.2644|7.2644	0.26222|0.26222	0.3292:0.0:0.6708:0.0|0.3292:0.0:0.6708:0.0	.|.	.|258;258;258;258	.|B4DGA4;F5H7L6;Q99665-2;Q99665	.|.;.;.;I12R2_HUMAN	H|T	125|258	.|ENSP00000262345:R258T;ENSP00000360039:R258T;ENSP00000445276:R258T;ENSP00000442443:R258T	.|ENSP00000262345:R258T	Q|R	+|+	3|2	2|0	IL12RB2|IL12RB2	67567966|67567966	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.290000|0.290000	0.27261|0.27261	1.499000|1.499000	0.35671|0.35671	0.587000|0.587000	0.29643|0.29643	0.561000|0.561000	0.74099|0.74099	CAG|AGA	.		0.428	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025202.2	NM_001559	
IPO5	3843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	98670928	98670928	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr13:98670928G>A	ENST00000490680.1	+	23	2871	c.2806G>A	c.(2806-2808)Ggt>Agt	p.G936S	IPO5_ENST00000261574.5_Missense_Mutation_p.G954S|IPO5_ENST00000539640.1_Missense_Mutation_p.G811S			O00410	IPO5_HUMAN	importin 5	936					cellular response to amino acid stimulus (GO:0071230)|negative regulation of catalytic activity (GO:0043086)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|ribosomal protein import into nucleus (GO:0006610)|viral process (GO:0016032)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	27						GGCACAGTACGGTGGAGATAA	0.443																																					p.G954S		.											.	IPO5	228	0			c.G2860A						.						183.0	130.0	148.0					13																	98670928		2203	4300	6503	SO:0001583	missense	3843	exon26			CAGTACGGTGGAG	U72761	CCDS31999.1	13q32.2	2012-05-02	2008-04-15	2008-04-15	ENSG00000065150	ENSG00000065150		"""Importins"""	6402	protein-coding gene	gene with protein product		602008	"""karyopherin (importin) beta 3"", ""RAN binding protein 5"""	KPNB3, RANBP5		9114010, 9271386, 17005651	Standard	NM_002271		Approved	IMB3, MGC2068, Pse1	uc001vne.3	O00410	OTTHUMG00000017244	ENST00000490680.1:c.2806G>A	13.37:g.98670928G>A	ENSP00000418393:p.Gly936Ser	151.0	0.0		184.0	38.0	NM_002271	B4DZA0|O15257|Q5T578|Q86XC7	Missense_Mutation	SNP	ENST00000490680.1	37		.	.	.	.	.	.	.	.	.	.	G	35	5.481160	0.96307	.	.	ENSG00000065150	ENST00000261574;ENST00000357602;ENST00000490680;ENST00000539640	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	5.82	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.78868	0.4351	M	0.77820	2.39	0.80722	D	1	D	0.76494	0.999	P	0.58331	0.837	T	0.81807	-0.0763	10	0.62326	D	0.03	-9.9941	14.6536	0.68817	0.0694:0.0:0.9306:0.0	.	954	O00410-3	.	S	954;936;936;811	ENSP00000261574:G954S;ENSP00000350219:G936S;ENSP00000418393:G936S;ENSP00000445126:G811S	ENSP00000261574:G954S	G	+	1	0	IPO5	97468929	1.000000	0.71417	0.805000	0.32314	0.995000	0.86356	9.581000	0.98210	1.469000	0.48083	0.650000	0.86243	GGT	.		0.443	IPO5-006	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000354655.1	NM_002271	
LIPN	643418	broad.mit.edu;bcgsc.ca	37	10	90522021	90522021	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr10:90522021T>C	ENST00000404459.1	+	2	185	c.185T>C	c.(184-186)gTc>gCc	p.V62A		NM_001102469.1	NP_001095939.1	Q5VXI9	LIPN_HUMAN	lipase, family member N	62					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|skin(1)	9		Colorectal(252;0.0161)		Colorectal(12;4.83e-05)|COAD - Colon adenocarcinoma(12;6.5e-05)		ATACTCCTTGTCAACAGAATT	0.453																																					p.V62A		.											.	.	.	0			c.T185C						.						73.0	70.0	71.0					10																	90522021		1910	4150	6060	SO:0001583	missense	643418	exon2			TCCTTGTCAACAG		CCDS44456.1	10q23.31	2013-09-20	2007-02-27	2007-02-27	ENSG00000204020	ENSG00000204020			23452	protein-coding gene	gene with protein product		613924	"""lipase-like, ab-hydrolase domain containing 4"""	LIPL4			Standard	NM_001102469		Approved	bA186O14.3	uc010qmw.2	Q5VXI9	OTTHUMG00000018694	ENST00000404459.1:c.185T>C	10.37:g.90522021T>C	ENSP00000383923:p.Val62Ala	102.0	0.0		91.0	5.0	NM_001102469	A7KIH9	Missense_Mutation	SNP	ENST00000404459.1	37	CCDS44456.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.424505	0.83667	.	.	ENSG00000204020	ENST00000404459	D	0.87491	-2.26	5.63	5.63	0.86233	Partial AB-hydrolase lipase domain (1);	0.354513	0.23698	N	0.045458	D	0.86460	0.5938	L	0.52206	1.635	0.29748	N	0.836575	P	0.34815	0.47	B	0.40602	0.334	D	0.85121	0.0969	10	0.56958	D	0.05	-6.0578	14.8255	0.70107	0.0:0.0:0.0:1.0	.	62	Q5VXI9	LIPN_HUMAN	A	62	ENSP00000383923:V62A	ENSP00000383923:V62A	V	+	2	0	LIPN	90512001	1.000000	0.71417	0.942000	0.38095	0.979000	0.70002	6.499000	0.73683	2.149000	0.67028	0.528000	0.53228	GTC	.		0.453	LIPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049254.2	XM_926751	
LONRF2	164832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	100906810	100906810	+	Silent	SNP	G	G	A			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr2:100906810G>A	ENST00000393437.3	-	10	2469	c.1830C>T	c.(1828-1830)gaC>gaT	p.D610D	LONRF2_ENST00000409647.1_Silent_p.D367D	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	610	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						TGCCAATCGCGTCTACAACAG	0.458																																					p.D610D		.											.	LONRF2	154	0			c.C1830T						.						146.0	131.0	136.0					2																	100906810		2203	4300	6503	SO:0001819	synonymous_variant	164832	exon10			AATCGCGTCTACA	AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.1830C>T	2.37:g.100906810G>A		170.0	0.0		165.0	29.0	NM_198461	B9A006|Q6ZSR4	Silent	SNP	ENST00000393437.3	37	CCDS2046.2																																																																																			.		0.458	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253161.2	NM_198461	
APEH	327	broad.mit.edu;bcgsc.ca	37	3	49722762	49722762	+	IGR	SNP	G	G	A	rs150169514	byFrequency	TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr3:49722762G>A	ENST00000296456.5	+	0	3220				MST1_ENST00000383728.3_3'UTR|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000449682.2_Missense_Mutation_p.R493C|MST1_ENST00000494828.2_5'Flank	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AGCTTGGAACGCCGCTGATCC	0.607													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17471	0.0		0.0	False		,,,				2504	0.0				p.R493C		.											.	MST1	278	0			c.C1477T						.	G	CYS/ARG	5,4395	6.2+/-15.9	0,5,2195	30.0	32.0	32.0		1477	2.1	0.0	3	dbSNP_134	32	0,8600		0,0,4300	no	missense	MST1	NM_020998.3	180	0,5,6495	AA,AG,GG		0.0,0.1136,0.0385	possibly-damaging	493/726	49722762	5,12995	2200	4300	6500	SO:0001628	intergenic_variant	4485	exon13			TGGAACGCCGCTG	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49722762G>A		144.0	1.0		142.0	30.0	NM_020998	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	G	10.88	1.476307	0.26511	0.001136	0.0	ENSG00000173531	ENST00000449682	D	0.93133	-3.17	4.16	2.11	0.27256	.	.	.	.	.	D	0.85504	0.5712	N	0.08118	0	0.09310	N	0.999999	P	0.44659	0.84	P	0.45138	0.471	T	0.77720	-0.2482	9	0.49607	T	0.09	.	6.3641	0.21445	0.0:0.2055:0.5828:0.2117	.	493	G3XAK1	.	C	493	ENSP00000414287:R493C	ENSP00000414287:R493C	R	-	1	0	MST1	49697766	0.001000	0.12720	0.002000	0.10522	0.040000	0.13550	0.901000	0.28445	1.017000	0.39495	0.563000	0.77884	CGT	G|1.000;A|0.000		0.607	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
MCM2	4171	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	127323594	127323594	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr3:127323594G>C	ENST00000265056.7	+	3	624	c.380G>C	c.(379-381)gGc>gCc	p.G127A		NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	127	Interaction with KAT7. {ECO:0000250}.				cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)			ovary(3)|skin(2)|stomach(1)	6						GCTGGCCGGGGCCTGGGCCGC	0.672																																					p.G127A		.											.	MCM2	230	0			c.G380C						.						14.0	17.0	16.0					3																	127323594		2198	4288	6486	SO:0001583	missense	4171	exon3			GCCGGGGCCTGGG	X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.380G>C	3.37:g.127323594G>C	ENSP00000265056:p.Gly127Ala	41.0	0.0		69.0	10.0	NM_004526	Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Missense_Mutation	SNP	ENST00000265056.7	37	CCDS3043.1	.	.	.	.	.	.	.	.	.	.	G	11.32	1.603157	0.28534	.	.	ENSG00000073111	ENST00000265056;ENST00000539922;ENST00000480910	T;T	0.19938	2.11;2.11	5.29	5.29	0.74685	.	0.152965	0.64402	D	0.000015	T	0.12902	0.0313	N	0.21583	0.68	0.50039	D	0.999841	B	0.02656	0.0	B	0.04013	0.001	T	0.08554	-1.0716	10	0.08381	T	0.77	-49.299	12.3051	0.54898	0.0772:0.0:0.9228:0.0	.	127	P49736	MCM2_HUMAN	A	127;31;118	ENSP00000265056:G127A;ENSP00000419802:G118A	ENSP00000265056:G127A	G	+	2	0	MCM2	128806284	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.971000	0.49248	2.466000	0.83321	0.591000	0.81541	GGC	.		0.672	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356612.1		
MYO18B	84700	ucsc.edu;bcgsc.ca	37	22	26176106	26176106	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr22:26176106T>C	ENST00000407587.2	+	9	2321	c.2152T>C	c.(2152-2154)Tcc>Ccc	p.S718P	MYO18B_ENST00000335473.7_Missense_Mutation_p.S718P|MYO18B_ENST00000536101.1_Missense_Mutation_p.S718P			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	718	Myosin motor.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CACCCGGTTCTCCATGGTGAT	0.642																																					p.S718P		.											.	MYO18B	142	0			c.T2152C						.						21.0	24.0	23.0					22																	26176106		2120	4237	6357	SO:0001583	missense	84700	exon9			CGGTTCTCCATGG	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.2152T>C	22.37:g.26176106T>C	ENSP00000386096:p.Ser718Pro	61.0	0.0		39.0	4.0	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	T	12.52	1.963339	0.34659	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.88277	-2.36;-2.36;-2.36	5.38	-7.5	0.01351	Myosin head, motor domain (3);	0.531595	0.19789	N	0.106025	T	0.81973	0.4936	L	0.54323	1.7	0.28574	N	0.910478	P;P;P;P	0.40376	0.715;0.583;0.664;0.528	B;B;B;B	0.42214	0.244;0.38;0.189;0.262	T	0.75342	-0.3351	10	0.59425	D	0.04	.	6.6688	0.23056	0.2549:0.0:0.177:0.5681	.	231;718;718;718	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	P	718	ENSP00000441229:S718P;ENSP00000334563:S718P;ENSP00000386096:S718P	ENSP00000334563:S718P	S	+	1	0	MYO18B	24506106	0.002000	0.14202	0.010000	0.14722	0.035000	0.12851	-1.108000	0.03313	-0.801000	0.04427	-0.168000	0.13345	TCC	.		0.642	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
PCDH18	54510	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	138451498	138451498	+	Missense_Mutation	SNP	C	C	T	rs200753356	byFrequency	TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr4:138451498C>T	ENST00000344876.4	-	1	2131	c.1745G>A	c.(1744-1746)cGt>cAt	p.R582H	PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000412923.2_Missense_Mutation_p.R582H|PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000507846.1_Missense_Mutation_p.R362H	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	582	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R582H(2)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					CGTATTATTACGCAATGCAGG	0.463													C|||	4	0.000798722	0.0	0.0029	5008	,	,		22925	0.0		0.0	False		,,,				2504	0.002				p.R582H		.											PCDH18,NS,NS,0	PCDH18	185	2	Substitution - Missense(2)	breast(1)|pancreas(1)	c.G1745A						.	C	HIS/ARG	0,4406		0,0,2203	207.0	193.0	197.0		1745	4.1	0.1	4		197	1,8599	1.2+/-3.3	0,1,4299	yes	missense	PCDH18	NM_019035.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	582/1136	138451498	1,13005	2203	4300	6503	SO:0001583	missense	54510	exon1			TTATTACGCAATG	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.1745G>A	4.37:g.138451498C>T	ENSP00000355082:p.Arg582His	278.0	0.0		325.0	55.0	NM_019035	A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	ENST00000344876.4	37	CCDS34064.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	3.828	-0.036444	0.07497	0.0	1.16E-4	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846	T;T;T	0.55413	0.61;0.62;0.52	5.93	4.05	0.47172	Cadherin (2);Cadherin-like (1);	0.321942	0.22435	N	0.060092	T	0.29093	0.0723	N	0.05199	-0.095	0.80722	D	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.0;0.002;0.001	T	0.04752	-1.0929	10	0.42905	T	0.14	.	7.9972	0.30275	0.0:0.5295:0.0:0.4705	.	362;582;582	D6RIG4;Q9HCL0-2;Q9HCL0	.;.;PCD18_HUMAN	H	582;582;362	ENSP00000355082:R582H;ENSP00000390688:R582H;ENSP00000425903:R362H	ENSP00000355082:R582H	R	-	2	0	PCDH18	138670948	1.000000	0.71417	0.067000	0.19924	0.245000	0.25701	1.744000	0.38268	0.679000	0.31345	0.563000	0.77884	CGT	C|0.999;T|0.000		0.463	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
PCDHA12	56137	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140255564	140255564	+	Silent	SNP	C	C	G			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr5:140255564C>G	ENST00000398631.2	+	1	507	c.507C>G	c.(505-507)acC>acG	p.T169T	PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA11_ENST00000398640.2_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	169	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCTTTTGACCTATGCGTTAA	0.388																																					p.T169T	Pancreas(113;759 1672 13322 24104 50104)	.											.	.	.	0			c.C507G						.						49.0	57.0	55.0					5																	140255564		2113	4258	6371	SO:0001819	synonymous_variant	56137	exon1			TTTGACCTATGCG	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.507C>G	5.37:g.140255564C>G		86.0	0.0		70.0	6.0	NM_018903	O75278|Q2M1N8	Silent	SNP	ENST00000398631.2	37	CCDS47285.1																																																																																			.		0.388	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903	
PDE4DIP	9659	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	144859947	144859947	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr1:144859947T>C	ENST00000369354.3	-	38	6326	c.6137A>G	c.(6136-6138)cAc>cGc	p.H2046R	PDE4DIP_ENST00000530740.1_Missense_Mutation_p.H2131R|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.H2046R|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.H1940R|RP4-791M13.4_ENST00000532137.1_RNA|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.H2182R			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	2046					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TGCCACCAGGTGGCTCAGGTC	0.547			T	PDGFRB	MPD																																p.H2046R		.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	663	0			c.A6137G						.						102.0	97.0	98.0					1																	144859947		2203	4297	6500	SO:0001583	missense	9659	exon38			ACCAGGTGGCTCA	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.6137A>G	1.37:g.144859947T>C	ENSP00000358360:p.His2046Arg	242.0	0.0		305.0	29.0	NM_014644	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	T	3.859	-0.030327	0.07543	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	T;T;T;T;T	0.01516	4.81;4.89;4.89;4.91;4.89	5.1	-1.38	0.09027	.	.	.	.	.	T	0.00666	0.0022	M	0.61703	1.905	0.18873	N	0.999982	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.42531	-0.9446	9	0.22109	T	0.4	.	5.581	0.17250	0.0:0.3664:0.1494:0.4842	.	1940;2046	Q5VU43-3;Q5VU43	.;MYOME_HUMAN	R	1940;2046;2046;2131;2182	ENSP00000327209:H1940R;ENSP00000358360:H2046R;ENSP00000358363:H2046R;ENSP00000435654:H2131R;ENSP00000358366:H2182R	ENSP00000327209:H1940R	H	-	2	0	PDE4DIP	143571304	0.963000	0.33076	0.914000	0.36105	0.085000	0.17905	0.421000	0.21280	0.067000	0.16545	0.528000	0.53228	CAC	.		0.547	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
POLD1	5424	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50912834	50912834	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr19:50912834C>T	ENST00000440232.2	+	17	2118	c.2065C>T	c.(2065-2067)Cgg>Tgg	p.R689W	POLD1_ENST00000599857.1_Missense_Mutation_p.R689W|POLD1_ENST00000595904.1_Missense_Mutation_p.R715W	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit	689					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|fatty acid homeostasis (GO:0055089)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)|response to UV (GO:0009411)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|delta DNA polymerase complex (GO:0043625)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		CCTGGATGGACGGCAGCTGGC	0.672								DNA polymerases (catalytic subunits)																													p.R689W		.											.	POLD1	840	0			c.C2065T						.						58.0	65.0	62.0					19																	50912834		2203	4299	6502	SO:0001583	missense	5424	exon17			GATGGACGGCAGC		CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822		"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD		1722322	Standard	NM_001256849		Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.2065C>T	19.37:g.50912834C>T	ENSP00000406046:p.Arg689Trp	138.0	0.0		154.0	27.0	NM_002691	Q8NER3|Q96H98	Missense_Mutation	SNP	ENST00000440232.2	37	CCDS12795.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.471484	0.84533	.	.	ENSG00000062822	ENST00000440232;ENST00000376930	T	0.19806	2.12	4.38	4.38	0.52667	DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.000000	0.85682	D	0.000000	T	0.64659	0.2618	H	0.99156	4.45	0.80722	D	1	D;D	0.60160	0.987;0.987	P;D	0.66979	0.887;0.948	T	0.81986	-0.0681	10	0.87932	D	0	-33.0089	16.0916	0.81094	0.0:1.0:0.0:0.0	.	715;689	E7EVW0;P28340	.;DPOD1_HUMAN	W	689;690	ENSP00000406046:R689W	ENSP00000366129:R690W	R	+	1	2	POLD1	55604646	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.126000	0.64721	2.190000	0.69967	0.561000	0.74099	CGG	.		0.672	POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464732.1		
RAPGEF2	9693	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	160225597	160225597	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr4:160225597G>C	ENST00000264431.4	+	2	583	c.164G>C	c.(163-165)gGg>gCg	p.G55A	RAPGEF2_ENST00000504604.1_3'UTR	NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	55					adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		AGTGATTCTGGGAGCAGCAGT	0.413																																					p.G55A		.											.	RAPGEF2	637	0			c.G164C						.						167.0	157.0	160.0					4																	160225597		1915	4127	6042	SO:0001583	missense	9693	exon2			ATTCTGGGAGCAG	AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.164G>C	4.37:g.160225597G>C	ENSP00000264431:p.Gly55Ala	423.0	0.0		389.0	51.0	NM_014247	D3DP27	Missense_Mutation	SNP	ENST00000264431.4	37	CCDS43277.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.781279	0.90282	.	.	ENSG00000109756	ENST00000505478;ENST00000510510;ENST00000264431;ENST00000514565	T	0.50548	0.74	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.70011	0.3175	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.69658	-0.5086	10	0.52906	T	0.07	.	19.8097	0.96542	0.0:0.0:1.0:0.0	.	55	Q9Y4G8	RPGF2_HUMAN	A	211;53;55;36	ENSP00000264431:G55A	ENSP00000264431:G55A	G	+	2	0	RAPGEF2	160445047	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.476000	0.97823	2.685000	0.91497	0.484000	0.47621	GGG	.		0.413	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364980.2	NM_014247	
RASSF5	83593	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	206730943	206730943	+	Intron	SNP	G	G	T			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr1:206730943G>T	ENST00000355294.4	+	2	636				RASSF5_ENST00000304534.8_Silent_p.L14L|RASSF5_ENST00000367117.3_Intron	NM_182663.2	NP_872604.1	Q8WWW0	RASF5_HUMAN	Ras association (RalGDS/AF-6) domain family member 5						apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein localization to nucleus (GO:1900180)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)	8	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			ACTGCAGCCTGGACGAGGAAC	0.542																																					p.L14L	GBM(162;656 1984 11916 22872 31529)	.											.	RASSF5	660	0			c.G42T						.						98.0	92.0	94.0					1																	206730943		2203	4300	6503	SO:0001627	intron_variant	83593	exon1			CAGCCTGGACGAG	BC004270	CCDS1463.1, CCDS1464.1, CCDS30998.1	1q31	2014-04-10	2008-02-22		ENSG00000136653	ENSG00000266094			17609	protein-coding gene	gene with protein product		607020				11978988, 11965544	Standard	NM_182663		Approved	Maxp1, NORE1, RAPL	uc001hed.3	Q8WWW0	OTTHUMG00000184616	ENST00000355294.4:c.579+19321G>T	1.37:g.206730943G>T		97.0	0.0		122.0	18.0	NM_182665	A8K1E6|Q5SY32|Q8WWV9|Q8WXF4|Q9BT99	Silent	SNP	ENST00000355294.4	37	CCDS30998.1																																																																																			.		0.542	RASSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088469.1	NM_031437	
SKAP1	8631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	46262096	46262096	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr17:46262096G>A	ENST00000336915.6	-	7	625	c.556C>T	c.(556-558)Cgc>Tgc	p.R186C	RP11-456D7.1_ENST00000582246.1_RNA|SKAP1_ENST00000584924.1_Missense_Mutation_p.R186C	NM_001075099.1|NM_003726.3	NP_001068567.1|NP_003717.3	Q86WV1	SKAP1_HUMAN	src kinase associated phosphoprotein 1	186	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of signal transduction (GO:0009967)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			large_intestine(1)|lung(10)|prostate(2)|skin(4)|urinary_tract(1)	18						TCATAGCTGCGCCTATCCTGG	0.522																																					p.R186C		.											.	SKAP1	90	0			c.C556T						.						210.0	193.0	199.0					17																	46262096		2203	4300	6503	SO:0001583	missense	8631	exon7			AGCTGCGCCTATC	Y11215	CCDS32674.1	17q21.32	2013-01-10	2006-09-28	2006-09-28		ENSG00000141293		"""Pleckstrin homology (PH) domain containing"""	15605	protein-coding gene	gene with protein product		604969	"""src family associated phosphoprotein 1"""	SCAP1		9195899	Standard	NM_003726		Approved	SKAP55	uc002ini.1	Q86WV1		ENST00000336915.6:c.556C>T	17.37:g.46262096G>A	ENSP00000338171:p.Arg186Cys	138.0	0.0		128.0	26.0	NM_003726	D3DTV1|O15268	Missense_Mutation	SNP	ENST00000336915.6	37	CCDS32674.1	.	.	.	.	.	.	.	.	.	.	G	13.74	2.326383	0.41197	.	.	ENSG00000141293	ENST00000336915	T	0.18502	2.21	5.55	5.55	0.83447	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.061153	0.64402	D	0.000002	T	0.54303	0.1850	M	0.93283	3.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.991	T	0.66416	-0.5929	10	0.87932	D	0	-54.9613	17.2809	0.87128	0.0:0.0:1.0:0.0	.	186;186	Q86WV1-2;Q86WV1	.;SKAP1_HUMAN	C	186	ENSP00000338171:R186C	ENSP00000338171:R186C	R	-	1	0	SKAP1	43617095	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.764000	0.74960	2.612000	0.88384	0.557000	0.71058	CGC	.		0.522	SKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443432.1	NM_003726	
SPTBN4	57731	ucsc.edu;bcgsc.ca;mdanderson.org	37	19	41056209	41056209	+	Silent	SNP	C	C	A			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr19:41056209C>A	ENST00000352632.3	+	22	4736	c.4650C>A	c.(4648-4650)gtC>gtA	p.V1550V	SPTBN4_ENST00000392025.1_Silent_p.V293V|SPTBN4_ENST00000598249.1_Silent_p.V1550V|SPTBN4_ENST00000595535.1_Silent_p.V1550V|SPTBN4_ENST00000392023.1_Silent_p.V226V|SPTBN4_ENST00000338932.3_Silent_p.V1550V			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1550					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TGCAGGCGGTCCAGCAGCACA	0.552																																					p.V1550V		.											.	SPTBN4	94	0			c.C4650A						.						39.0	40.0	40.0					19																	41056209		2203	4300	6503	SO:0001819	synonymous_variant	57731	exon22			GGCGGTCCAGCAG	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.4650C>A	19.37:g.41056209C>A		50.0	0.0		58.0	7.0	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Silent	SNP	ENST00000352632.3	37	CCDS12559.1																																																																																			.		0.552	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
SUPV3L1	6832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	70951452	70951452	+	Silent	SNP	A	A	G			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr10:70951452A>G	ENST00000359655.4	+	6	843	c.783A>G	c.(781-783)acA>acG	p.T261T	SUPV3L1_ENST00000483572.1_3'UTR	NM_003171.3	NP_003162.2	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 (S. cerevisiae)	261	Helicase ATP-binding.				ATP catabolic process (GO:0006200)|chromatin maintenance (GO:0070827)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA surveillance (GO:0035946)|mitochondrial ncRNA surveillance (GO:0035945)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA surveillance (GO:2000827)|mitochondrion morphogenesis (GO:0070584)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|RNA catabolic process (GO:0006401)	mitochondrial degradosome (GO:0045025)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3'-5' RNA helicase activity (GO:0034458)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						AGCGTGTGACAGTTCAGCCAA	0.378																																					p.T261T		.											.	SUPV3L1	227	0			c.A783G						.						219.0	181.0	194.0					10																	70951452		2203	4300	6503	SO:0001819	synonymous_variant	6832	exon6			TGTGACAGTTCAG	AF042169	CCDS7287.1	10q22.1	2008-08-01	2001-11-28		ENSG00000156502	ENSG00000156502			11471	protein-coding gene	gene with protein product		605122	"""suppressor of var1 (S.cerevisiae) 3-like 1"""			9925937, 16176273	Standard	XM_005270068		Approved	SUV3	uc001jpe.1	Q8IYB8	OTTHUMG00000018375	ENST00000359655.4:c.783A>G	10.37:g.70951452A>G		451.0	0.0		336.0	53.0	NM_003171	A8K301|O43630	Silent	SNP	ENST00000359655.4	37	CCDS7287.1																																																																																			.		0.378	SUPV3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048396.2	NM_003171	
TTLL11	158135	ucsc.edu;bcgsc.ca	37	9	124752033	124752033	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr9:124752033T>C	ENST00000373776.3	-	4	1167	c.980A>G	c.(979-981)gAc>gGc	p.D327G	TTLL11_ENST00000321582.5_Missense_Mutation_p.D327G|TTLL11_ENST00000474723.1_5'UTR	NM_194252.2	NP_919228.2	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11	327	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(3)|skin(1)	18						GGGGTCATCGTCTTTCACCAT	0.488																																					p.D327G		.											.	TTLL11	112	0			c.A980G						.						96.0	106.0	103.0					9																	124752033		2195	4294	6489	SO:0001583	missense	158135	exon4			TCATCGTCTTTCA	AF521886	CCDS6834.2, CCDS48012.1	9q34.11	2013-02-14	2005-07-28	2005-07-28	ENSG00000175764	ENSG00000175764		"""Tubulin tyrosine ligase-like family"""	18113	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 20"""	C9orf20		15890843	Standard	NM_001139442		Approved	bA244O19.1	uc011lyl.2	Q8NHH1	OTTHUMG00000020597	ENST00000373776.3:c.980A>G	9.37:g.124752033T>C	ENSP00000362881:p.Asp327Gly	53.0	0.0		49.0	5.0	NM_001139442		Missense_Mutation	SNP	ENST00000373776.3	37	CCDS6834.2	.	.	.	.	.	.	.	.	.	.	T	8.925	0.962067	0.18583	.	.	ENSG00000175764	ENST00000321582;ENST00000373776	T;T	0.05139	3.49;3.49	4.93	4.93	0.64822	.	2.068350	0.02737	N	0.115837	T	0.07279	0.0184	N	0.25144	0.715	0.47037	D	0.999298	B;B	0.25772	0.134;0.004	B;B	0.19946	0.027;0.003	T	0.30446	-0.9978	10	0.18710	T	0.47	.	13.7891	0.63128	0.0:0.0:0.0:1.0	.	327;327	F8W6M1;Q8NHH1	.;TTL11_HUMAN	G	327	ENSP00000321346:D327G;ENSP00000362881:D327G	ENSP00000321346:D327G	D	-	2	0	TTLL11	123791854	1.000000	0.71417	0.864000	0.33941	0.151000	0.21798	4.829000	0.62737	1.856000	0.53863	0.454000	0.30748	GAC	.		0.488	TTLL11-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053907.1	XM_088486	
XKR7	343702	hgsc.bcm.edu;mdanderson.org	37	20	30585125	30585125	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr20:30585125G>A	ENST00000562532.2	+	3	1779	c.1605G>A	c.(1603-1605)tgG>tgA	p.W535*		NM_001011718.1	NP_001011718.1	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related family, member 7	535						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			ACCCGGCCTGGGATGCTCATT	0.632																																					p.W535X		.											.	XKR7	137	0			c.G1605A						.						50.0	57.0	55.0					20																	30585125		2203	4300	6503	SO:0001587	stop_gained	343702	exon3			GGCCTGGGATGCT	AY534245	CCDS33459.1	20q11.21	2014-07-16	2006-01-12		ENSG00000260903	ENSG00000260903			23062	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 7"", ""chromosome 20 open reading frame 159"""	C20orf159			Standard	NM_001011718		Approved	dJ310O13.4	uc002wxe.3	Q5GH72	OTTHUMG00000032198	ENST00000562532.2:c.1605G>A	20.37:g.30585125G>A	ENSP00000477059:p.Trp535*	37.0	0.0		22.0	7.0	NM_001011718	Q9NUG5	Nonsense_Mutation	SNP	ENST00000562532.2	37	CCDS33459.1	.	.	.	.	.	.	.	.	.	.	G	37	6.445175	0.97572	.	.	ENSG00000101321	ENST00000217299	.	.	.	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.5108	16.7017	0.85351	0.0:0.0:1.0:0.0	.	.	.	.	X	535	.	ENSP00000217299:W535X	W	+	3	0	XKR7	30048786	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.657000	0.98554	2.518000	0.84900	0.561000	0.74099	TGG	.		0.632	XKR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078597.3	NM_001011718	
ZNF267	10308	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	31925948	31925948	+	Silent	SNP	T	T	C			TCGA-DD-A1EC-01A-21D-A12Z-10	TCGA-DD-A1EC-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b9bbd66-c9e2-4d37-ba06-3137ad936c06	f5663abe-78b9-4a8e-925d-e5a08d29c2ff	g.chr16:31925948T>C	ENST00000300870.10	+	4	587	c.378T>C	c.(376-378)aaT>aaC	p.N126N	ZNF267_ENST00000394846.3_3'UTR	NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	126					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						AAGGGCACAATGGATGTTATG	0.363																																					p.N126N		.											.	ZNF267	138	0			c.T378C						.						123.0	122.0	122.0					16																	31925948		2197	4300	6497	SO:0001819	synonymous_variant	10308	exon4			GCACAATGGATGT	X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.378T>C	16.37:g.31925948T>C		158.0	0.0		148.0	28.0	NM_003414	A0JNZ9|Q8NE41|Q9NRJ0	Silent	SNP	ENST00000300870.10	37	CCDS32440.1																																																																																			.		0.363	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432446.2	NM_003414	
