#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCC8	6833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	17428453	17428453	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr11:17428453C>A	ENST00000389817.3	-	25	3212	c.3144G>T	c.(3142-3144)agG>agT	p.R1048S	ABCC8_ENST00000302539.4_Missense_Mutation_p.R1049S			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	1048	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	GGGAGCAGTTCCTGGCTGCAG	0.637																																					p.R1048S		.											.	ABCC8	91	0			c.G3144T						.						52.0	57.0	55.0					11																	17428453		2200	4293	6493	SO:0001583	missense	6833	exon25			GCAGTTCCTGGCT	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.3144G>T	11.37:g.17428453C>A	ENSP00000374467:p.Arg1048Ser	123.0	0.0		87.0	17.0	NM_000352	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	ENST00000389817.3	37	CCDS31437.1	.	.	.	.	.	.	.	.	.	.	C	7.954	0.745426	0.15710	.	.	ENSG00000006071	ENST00000389817;ENST00000302539	D;D	0.94457	-3.43;-3.43	5.73	2.75	0.32379	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.559684	0.20470	N	0.091704	D	0.84875	0.5569	N	0.16567	0.415	0.49483	D	0.999796	B	0.02656	0.0	B	0.09377	0.004	T	0.72107	-0.4390	10	0.07644	T	0.81	.	5.9956	0.19491	0.0:0.6241:0.1367:0.2392	.	1048	Q09428	ABCC8_HUMAN	S	1048;1049	ENSP00000374467:R1048S;ENSP00000303960:R1049S	ENSP00000303960:R1049S	R	-	3	2	ABCC8	17385029	0.990000	0.36364	0.999000	0.59377	0.780000	0.44128	0.711000	0.25764	0.390000	0.25115	-0.176000	0.13171	AGG	.		0.637	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	NM_000352	
ARAP3	64411	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	141051870	141051870	+	Splice_Site	SNP	T	T	A			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr5:141051870T>A	ENST00000239440.4	-	10	1451		c.e10-2		ARAP3_ENST00000513878.1_Splice_Site|ARAP3_ENST00000508305.1_Splice_Site	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3						cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						GCTGTGAAGCTGAGGGGTGGA	0.647																																					.		.											.	ARAP3	291	0			c.1386-2A>T						.						25.0	29.0	28.0					5																	141051870		2194	4269	6463	SO:0001630	splice_region_variant	64411	exon11			TGAAGCTGAGGGG	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.1386-2A>T	5.37:g.141051870T>A		144.0	0.0		152.0	8.0	NM_022481	B4DIT1|D3DQE3	Splice_Site	SNP	ENST00000239440.4	37	CCDS4266.1	.	.	.	.	.	.	.	.	.	.	T	16.71	3.197553	0.58126	.	.	ENSG00000120318	ENST00000508305;ENST00000239440;ENST00000513878;ENST00000504448	.	.	.	3.9	3.9	0.45041	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8395	0.52346	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ARAP3	141032054	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	7.788000	0.85771	1.619000	0.50296	0.383000	0.25322	.	.		0.647	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	NM_022481	Intron
ARID1A	8289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	27099008	27099008	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr1:27099008C>T	ENST00000324856.7	+	13	3795	c.3424C>T	c.(3424-3426)Cag>Tag	p.Q1142*	ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q759*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q1142*|ARID1A_ENST00000540690.1_5'Flank	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1142					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.Q1142*(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		AGGATCTATGCAGGGGCCCCA	0.527			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.Q1142X		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	584	1	Substitution - Nonsense(1)	liver(1)	c.C3424T						.						77.0	75.0	76.0					1																	27099008		2203	4300	6503	SO:0001587	stop_gained	8289	exon13			TCTATGCAGGGGC	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.3424C>T	1.37:g.27099008C>T	ENSP00000320485:p.Gln1142*	211.0	0.0		189.0	79.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	42|42	9.328846|9.328846	0.99138|0.99138	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000430799|ENST00000324856;ENST00000457599;ENST00000374152	.|.	.|.	.|.	5.16|5.16	5.16|5.16	0.70880|0.70880	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.74786|.	0.3762|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.73180|.	-0.4064|.	4|.	.|0.40728	.|T	.|0.16	-6.7363|-6.7363	18.8418|18.8418	0.92188|0.92188	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	V|X	39|1142;1142;759	.|.	.|ENSP00000320485:Q1142X	A|Q	+|+	2|1	0|0	ARID1A|ARID1A	26971595|26971595	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.320000|7.320000	0.79064|0.79064	2.690000|2.690000	0.91761|0.91761	0.655000|0.655000	0.94253|0.94253	GCA|CAG	.		0.527	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
CAPN14	440854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	31414909	31414909	+	Silent	SNP	G	G	T			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr2:31414909G>T	ENST00000403897.3	-	11	1311	c.1170C>A	c.(1168-1170)ggC>ggA	p.G390G	CAPN14_ENST00000444918.2_Silent_p.G390G	NM_001145122.1	NP_001138594.1	A8MX76	CAN14_HUMAN	calpain 14	390	Domain III.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)|skin(1)|stomach(2)	7						GGGATCTCCTGCCCTCCTCGG	0.622																																					p.G390G		.											.	.	.	0			c.C1170A						.						28.0	35.0	33.0					2																	31414909		692	1591	2283	SO:0001819	synonymous_variant	440854	exon11			TCTCCTGCCCTCC	AC015980	CCDS46254.1	2p23.1-p21	2013-01-10			ENSG00000214711	ENSG00000214711		"""EF-hand domain containing"""	16664	protein-coding gene	gene with protein product		610229				11675017	Standard	NM_001145122		Approved		uc010yms.2	A8MX76	OTTHUMG00000152039	ENST00000403897.3:c.1170C>A	2.37:g.31414909G>T		171.0	0.0		114.0	22.0	NM_001145122	B3KRU9	Silent	SNP	ENST00000403897.3	37	CCDS46254.1																																																																																			.		0.622	CAPN14-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325010.1	NM_001145122	
CAPNS1	826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	36637097	36637097	+	Splice_Site	SNP	G	G	C			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr19:36637097G>C	ENST00000246533.3	+	9	1202		c.e9-1		CAPNS1_ENST00000587718.1_Splice_Site|CAPNS1_ENST00000589146.1_Splice_Site|CAPNS1_ENST00000588780.1_Splice_Site|CAPNS1_ENST00000588815.1_Splice_Site|AD001527.7_ENST00000604228.1_RNA|CAPNS1_ENST00000590874.1_Splice_Site	NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	P04632	CPNS1_HUMAN	calpain, small subunit 1						extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			ATCCATCTTAGGGTTCCACCT	0.522																																					.	Esophageal Squamous(129;1541 1691 5780 18353 34150)	.											.	CAPNS1	90	0			c.605-1G>C						.						209.0	201.0	204.0					19																	36637097		2203	4300	6503	SO:0001630	splice_region_variant	826	exon9			ATCTTAGGGTTCC	X04106	CCDS12489.1	19q13.1	2013-01-10		2001-08-10	ENSG00000126247	ENSG00000126247	3.4.22.52	"""EF-hand domain containing"""	1481	protein-coding gene	gene with protein product		114170		CAPN4		3024120, 3016651	Standard	NM_001003962		Approved	CANP, CANPS, 30K, CDPS	uc002odj.3	P04632		ENST00000246533.3:c.605-1G>C	19.37:g.36637097G>C		88.0	0.0		57.0	7.0	NM_001749	A8K0P1|Q8WTX3|Q96EW0	Splice_Site	SNP	ENST00000246533.3	37	CCDS12489.1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.278835	0.59758	.	.	ENSG00000126247	ENST00000246533	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8777	0.86056	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CAPNS1	41328937	1.000000	0.71417	0.976000	0.42696	0.092000	0.18411	8.985000	0.93487	2.646000	0.89796	0.561000	0.74099	.	.		0.522	CAPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457411.2		Intron
CCDC64B	146439	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	3085397	3085397	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr16:3085397C>T	ENST00000572449.1	-	2	163	c.101G>A	c.(100-102)cGg>cAg	p.R34Q	CCDC64B_ENST00000389347.4_Missense_Mutation_p.R34Q|CCDC64B_ENST00000573514.1_5'Flank|RP11-473M20.5_ENST00000382225.3_RNA			A1A5D9	BICR2_HUMAN	coiled-coil domain containing 64B	34										breast(1)|endometrium(2)|large_intestine(1)	4						GAATGAGTCCCGCCGCTCCAG	0.682																																					p.R34Q		.											.	.	.	0			c.G101A						.						11.0	14.0	13.0					16																	3085397		1864	4084	5948	SO:0001583	missense	146439	exon1			GAGTCCCGCCGCT	BC128602	CCDS45393.1	16p13.3	2008-07-04				ENSG00000162069			33584	protein-coding gene	gene with protein product							Standard	NM_001103175		Approved		uc002ctf.4	A1A5D9		ENST00000572449.1:c.101G>A	16.37:g.3085397C>T	ENSP00000459043:p.Arg34Gln	97.0	0.0		87.0	37.0	NM_001103175	Q658L9	Missense_Mutation	SNP	ENST00000572449.1	37	CCDS45393.1	.	.	.	.	.	.	.	.	.	.	c	22.3	4.265203	0.80358	.	.	ENSG00000162069	ENST00000389347	T	0.30981	1.51	5.08	4.12	0.48240	.	0.241759	0.26991	N	0.021474	T	0.29620	0.0739	N	0.19112	0.55	0.27577	N	0.949695	D	0.69078	0.997	P	0.55391	0.775	T	0.04946	-1.0916	10	0.34782	T	0.22	-34.7454	10.5633	0.45159	0.0:0.9061:0.0:0.0939	.	34	A1A5D9	BICR2_HUMAN	Q	34	ENSP00000373998:R34Q	ENSP00000373998:R34Q	R	-	2	0	CCDC64B	3025398	0.031000	0.19500	0.746000	0.31095	0.962000	0.63368	1.921000	0.40035	2.361000	0.80049	0.457000	0.33378	CGG	.		0.682	CCDC64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436991.1		
CCDC80	151887	ucsc.edu;bcgsc.ca	37	3	112328903	112328903	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr3:112328903C>T	ENST00000206423.3	-	6	3300	c.2347G>A	c.(2347-2349)Gtg>Atg	p.V783M	CCDC80_ENST00000439685.2_Missense_Mutation_p.V783M	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	783					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						GCAGAGATCACCAGCAACCTC	0.488																																					p.V783M		.											.	CCDC80	92	0			c.G2347A						.						123.0	108.0	113.0					3																	112328903		2203	4300	6503	SO:0001583	missense	151887	exon6			AGATCACCAGCAA	AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.2347G>A	3.37:g.112328903C>T	ENSP00000206423:p.Val783Met	76.0	0.0		44.0	4.0	NM_199511	D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	ENST00000206423.3	37	CCDS2968.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.0|21.0	4.082225|4.082225	0.76528|0.76528	.|.	.|.	ENSG00000091986|ENSG00000091986	ENST00000461431|ENST00000206423;ENST00000439685;ENST00000444594;ENST00000479368	.|T;T;T	.|0.58210	.|0.35;0.35;0.35	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	.|0.125306	.|0.53938	.|D	.|0.000043	T|T	0.74869|0.74869	0.3773|0.3773	M|M	0.77616|0.77616	2.38|2.38	0.54753|0.54753	D|D	0.999984|0.999984	.|D;D;D	.|0.71674	.|0.997;0.998;0.998	.|D;D;D	.|0.72625	.|0.963;0.978;0.978	T|T	0.76812|0.76812	-0.2821|-0.2821	5|10	.|0.87932	.|D	.|0	-28.0868|-28.0868	19.982|19.982	0.97329|0.97329	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|794;783;783	.|Q76M96-2;A3KC71;Q76M96	.|.;.;CCD80_HUMAN	D|M	180|783;783;411;61	.|ENSP00000206423:V783M;ENSP00000411814:V783M;ENSP00000418188:V61M	.|ENSP00000206423:V783M	G|V	-|-	2|1	0|0	CCDC80|CCDC80	113811593|113811593	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.724000|5.724000	0.68500|0.68500	2.798000|2.798000	0.96311|0.96311	0.650000|0.650000	0.86243|0.86243	GGT|GTG	.		0.488	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354219.1	NM_199511	
CCDC88A	55704	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	55589549	55589549	+	Silent	SNP	T	T	C			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr2:55589549T>C	ENST00000436346.1	-	7	1363	c.522A>G	c.(520-522)caA>caG	p.Q174Q	CCDC88A_ENST00000413716.2_Silent_p.Q174Q|CCDC88A_ENST00000336838.6_Silent_p.Q174Q|CCDC88A_ENST00000263630.8_Silent_p.Q174Q	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	174					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						CTTCCATCCATTGCAGGTCAA	0.338																																					p.Q174Q		.											.	CCDC88A	94	0			c.A522G						.						104.0	98.0	100.0					2																	55589549		2203	4300	6503	SO:0001819	synonymous_variant	55704	exon7			CATCCATTGCAGG	AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.522A>G	2.37:g.55589549T>C		331.0	1.0		268.0	47.0	NM_018084	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Silent	SNP	ENST00000436346.1	37																																																																																				.		0.338	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571	
CD1B	910	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158299817	158299817	+	Silent	SNP	G	G	T			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr1:158299817G>T	ENST00000368168.3	-	3	539	c.432C>A	c.(430-432)gtC>gtA	p.V144V		NM_001764.2	NP_001755.1	P29016	CD1B_HUMAN	CD1b molecule	144					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	cell surface (GO:0009986)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				breast(2)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	30	all_hematologic(112;0.0378)					AAGCATTCTTGACACTCAGGA	0.483																																					p.V144V		.											.	CD1B	92	0			c.C432A						.						163.0	163.0	163.0					1																	158299817		2203	4300	6503	SO:0001819	synonymous_variant	910	exon3			ATTCTTGACACTC	M28826	CCDS1176.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158485	ENSG00000158485		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1635	protein-coding gene	gene with protein product		188360	"""CD1B antigen, b polypeptide"", ""CD1b antigen"""	CD1		2447586	Standard	NM_001764		Approved		uc001frx.3	P29016	OTTHUMG00000017513	ENST00000368168.3:c.432C>A	1.37:g.158299817G>T		238.0	0.0		263.0	86.0	NM_001764	Q5TDK9|Q5TDL0|Q9UMM2	Silent	SNP	ENST00000368168.3	37	CCDS1176.1	.	.	.	.	.	.	.	.	.	.	G	1.957	-0.439910	0.04636	.	.	ENSG00000158485	ENST00000451207	.	.	.	4.28	-2.56	0.06268	.	.	.	.	.	T	0.08268	0.0206	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.36335	-0.9752	4	.	.	.	0.1558	4.4297	0.11522	0.3817:0.3069:0.3114:0.0	.	.	.	.	K	112	.	.	Q	-	1	0	CD1B	156566441	0.005000	0.15991	0.000000	0.03702	0.000000	0.00434	-0.021000	0.12504	-0.349000	0.08274	-0.793000	0.03317	CAA	.		0.483	CD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046350.2	NM_001764	
CSMD1	64478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	3267015	3267015	+	Silent	SNP	C	C	T			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr8:3267015C>T	ENST00000520002.1	-	14	2232	c.1677G>A	c.(1675-1677)gaG>gaA	p.E559E	CSMD1_ENST00000542608.1_Silent_p.E558E|CSMD1_ENST00000400186.3_Silent_p.E559E|CSMD1_ENST00000602557.1_Silent_p.E559E|CSMD1_ENST00000539096.1_Silent_p.E558E|CSMD1_ENST00000537824.1_Silent_p.E558E|CSMD1_ENST00000602723.1_Silent_p.E559E			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	559	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CCCCCACCAGCTCAAAGGCCG	0.562																																					p.E558E		.											.	CSMD1	86	0			c.G1674A						.						43.0	43.0	43.0					8																	3267015		1919	4134	6053	SO:0001819	synonymous_variant	64478	exon13			CACCAGCTCAAAG			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.1677G>A	8.37:g.3267015C>T		146.0	0.0		112.0	55.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	C	8.640	0.895798	0.17686	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.26	3.1	0.35709	.	.	.	.	.	T	0.58566	0.2131	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54964	-0.8214	4	.	.	.	.	8.8761	0.35345	0.0:0.658:0.0:0.342	.	.	.	.	T	39	.	.	A	-	1	0	CSMD1	3254423	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	1.133000	0.31430	1.204000	0.43247	0.573000	0.79308	GCT	.		0.562	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CTCF	10664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67660509	67660509	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr16:67660509G>A	ENST00000264010.4	+	8	1853	c.1409G>A	c.(1408-1410)cGt>cAt	p.R470H	CTCF_ENST00000401394.1_Missense_Mutation_p.R142H	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	470					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		AAGAAATGCCGTTACTGTGAT	0.453																																					p.R470H	Colon(175;1200 1966 6945 23069 27405)	.											.	CTCF	91	0			c.G1409A						.						115.0	92.0	100.0					16																	67660509		2198	4300	6498	SO:0001583	missense	10664	exon8			AATGCCGTTACTG	U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.1409G>A	16.37:g.67660509G>A	ENSP00000264010:p.Arg470His	130.0	0.0		98.0	31.0	NM_006565	B5MC38|Q53XI7|Q59EL8	Missense_Mutation	SNP	ENST00000264010.4	37	CCDS10841.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.653330	0.88056	.	.	ENSG00000102974	ENST00000264010;ENST00000401394	T;T	0.42131	0.98;0.98	5.2	4.23	0.50019	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000008	T	0.28366	0.0701	N	0.16790	0.44	0.80722	D	1	D	0.52996	0.957	B	0.39258	0.295	T	0.19321	-1.0309	10	0.66056	D	0.02	-2.7963	16.0322	0.80585	0.0:0.1347:0.8653:0.0	.	470	P49711	CTCF_HUMAN	H	470;142	ENSP00000264010:R470H;ENSP00000384707:R142H	ENSP00000264010:R470H	R	+	2	0	CTCF	66218010	1.000000	0.71417	0.979000	0.43373	0.994000	0.84299	9.813000	0.99286	1.303000	0.44873	0.561000	0.74099	CGT	.		0.453	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268870.2	NM_006565	
DCHS1	8642	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6648374	6648374	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr11:6648374G>A	ENST00000299441.3	-	14	6307	c.5896C>T	c.(5896-5898)Cgc>Tgc	p.R1966C		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1966	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGACGTAGGCGCAGAGGACTG	0.617																																					p.R1966C		.											.	DCHS1	73	0			c.C5896T						.						78.0	72.0	74.0					11																	6648374		2200	4295	6495	SO:0001583	missense	8642	exon14			GTAGGCGCAGAGG	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.5896C>T	11.37:g.6648374G>A	ENSP00000299441:p.Arg1966Cys	149.0	0.0		123.0	30.0	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.890705	0.52014	.	.	ENSG00000166341	ENST00000299441	T	0.61158	0.13	5.18	3.09	0.35607	Cadherin (1);Cadherin-like (1);	0.000000	0.45361	D	0.000380	T	0.32255	0.0823	N	0.08118	0	0.40003	D	0.975191	B	0.31054	0.306	B	0.18871	0.023	T	0.32107	-0.9919	10	0.56958	D	0.05	.	10.4541	0.44539	0.0:0.0:0.4392:0.5608	.	1966	Q96JQ0	PCD16_HUMAN	C	1966	ENSP00000299441:R1966C	ENSP00000299441:R1966C	R	-	1	0	DCHS1	6604950	0.037000	0.19845	1.000000	0.80357	0.897000	0.52465	0.460000	0.21924	1.324000	0.45282	0.462000	0.41574	CGC	.		0.617	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
DHX16	8449	ucsc.edu;bcgsc.ca	37	6	30624171	30624171	+	Silent	SNP	G	G	A			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr6:30624171G>A	ENST00000376442.3	-	15	2622	c.2427C>T	c.(2425-2427)acC>acT	p.T809T	DHX16_ENST00000376437.5_Silent_p.T328T	NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	809					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			kidney(2)|ovary(2)	4						GACTCACCGTGGTGAGCTCCC	0.592																																					p.T809T		.											.	DHX16	228	0			c.C2427T						.						59.0	60.0	60.0					6																	30624171		2203	4300	6503	SO:0001819	synonymous_variant	8449	exon15			CACCGTGGTGAGC	AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.2427C>T	6.37:g.30624171G>A		63.0	0.0		45.0	4.0	NM_003587	O60322|Q5JP45|Q969X7|Q96QC1	Silent	SNP	ENST00000376442.3	37	CCDS4685.1																																																																																			.		0.592	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587	
DHX9	1660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	182848473	182848473	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr1:182848473G>A	ENST00000367549.3	+	21	2550	c.2440G>A	c.(2440-2442)Ggc>Agc	p.G814S	DHX9_ENST00000485081.1_3'UTR	NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	814					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						AGGAGGAATTGGCCAATTTCT	0.423																																					p.G814S	Colon(69;210 1162 3697 13559 39565)	.											.	DHX9	92	0			c.G2440A						.						135.0	122.0	126.0					1																	182848473		1873	4108	5981	SO:0001583	missense	1660	exon21			GGAATTGGCCAAT	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.2440G>A	1.37:g.182848473G>A	ENSP00000356520:p.Gly814Ser	147.0	0.0		148.0	29.0	NM_001357	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	37	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	G	34	5.319258	0.95682	.	.	ENSG00000135829	ENST00000367549	T	0.02472	4.28	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.05456	0.0144	N	0.25890	0.77	0.80722	D	1	P;D	0.61080	0.879;0.989	P;P	0.52031	0.688;0.677	T	0.60969	-0.7157	10	0.16420	T	0.52	.	19.691	0.96000	0.0:0.0:1.0:0.0	.	93;814	B3KU66;Q08211	.;DHX9_HUMAN	S	814	ENSP00000356520:G814S	ENSP00000356520:G814S	G	+	1	0	DHX9	181115096	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.364000	0.79526	2.671000	0.90904	0.585000	0.79938	GGC	.		0.423	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
ELL2	22936	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	95224587	95224587	+	Silent	SNP	C	C	T			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr5:95224587C>T	ENST00000237853.4	-	12	2260	c.1911G>A	c.(1909-1911)gaG>gaA	p.E637E	ELL2_ENST00000431061.2_Silent_p.E387E	NM_012081.5	NP_036213.2	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	637					regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|transcription elongation from RNA polymerase II promoter (GO:0006368)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	24		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		AGGACCATGACTCTGCTTGCT	0.358																																					p.E637E		.											.	ELL2	90	0			c.G1911A						.						64.0	59.0	61.0					5																	95224587		2203	4300	6503	SO:0001819	synonymous_variant	22936	exon12			CCATGACTCTGCT	U88629	CCDS4080.1	5q15	2010-11-29			ENSG00000118985	ENSG00000118985			17064	protein-coding gene	gene with protein product		601874				9108030	Standard	NM_012081		Approved		uc003klr.4	O00472	OTTHUMG00000122085	ENST00000237853.4:c.1911G>A	5.37:g.95224587C>T		125.0	0.0		81.0	14.0	NM_012081	B4DNK7	Silent	SNP	ENST00000237853.4	37	CCDS4080.1																																																																																			.		0.358	ELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242846.1	NM_012081	
EME1	146956	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	48452910	48452910	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr17:48452910A>G	ENST00000338165.4	+	2	423	c.341A>G	c.(340-342)gAc>gGc	p.D114G	EME1_ENST00000511648.2_Missense_Mutation_p.D114G|MRPL27_ENST00000225969.4_5'Flank|MRPL27_ENST00000507088.1_5'Flank|EME1_ENST00000393271.2_Missense_Mutation_p.D114G|MRPL27_ENST00000442592.3_5'Flank|MRPL27_ENST00000503633.1_5'Flank	NM_152463.2	NP_689676.2	Q96AY2	EME1_HUMAN	essential meiotic structure-specific endonuclease 1	114					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	19	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)			AGCCCTGAGGACTCTAGCTCC	0.433								Direct reversal of damage;Homologous recombination																													p.D114G		.											.	EME1	227	0			c.A341G						.						75.0	81.0	79.0					17																	48452910		2203	4300	6503	SO:0001583	missense	146956	exon2			CTGAGGACTCTAG	BC016470	CCDS11565.1, CCDS54141.1	17q21.33	2013-07-03	2013-07-03			ENSG00000154920			24965	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog A (S. cerevisiae)"""	610885	"""essential meiotic endonuclease 1 homolog 1 (S. pombe)"""			12721304	Standard	NM_001166131		Approved	FLJ31364, MMS4L, SLX2A	uc010dbp.2	Q96AY2		ENST00000338165.4:c.341A>G	17.37:g.48452910A>G	ENSP00000339897:p.Asp114Gly	181.0	1.0		121.0	55.0	NM_152463	Q96N62	Missense_Mutation	SNP	ENST00000338165.4	37	CCDS11565.1	.	.	.	.	.	.	.	.	.	.	A	2.981	-0.210211	0.06140	.	.	ENSG00000154920	ENST00000338165;ENST00000393271;ENST00000511648	T;T;T	0.10288	2.89;2.89;2.89	4.7	1.18	0.20946	.	1.548680	0.03824	N	0.267994	T	0.07007	0.0178	L	0.27053	0.805	0.09310	N	1	B;B	0.33583	0.418;0.294	B;B	0.30855	0.121;0.057	T	0.28870	-1.0030	10	0.26408	T	0.33	-0.6144	0.643	0.00813	0.4708:0.1758:0.1846:0.1688	.	114;114	Q96AY2-2;Q96AY2	.;EME1_HUMAN	G	114	ENSP00000339897:D114G;ENSP00000376952:D114G;ENSP00000421700:D114G	ENSP00000339897:D114G	D	+	2	0	EME1	45807909	0.000000	0.05858	0.007000	0.13788	0.278000	0.26855	-0.137000	0.10389	0.003000	0.14656	-0.313000	0.08912	GAC	.		0.433	EME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367118.3	NM_152463	
FANCM	57697	ucsc.edu;bcgsc.ca	37	14	45650690	45650690	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr14:45650690T>C	ENST00000267430.5	+	15	4365	c.4280T>C	c.(4279-4281)gTt>gCt	p.V1427A	FANCM_ENST00000542564.2_Missense_Mutation_p.V1401A|FANCM_ENST00000555013.1_3'UTR	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1427					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						CGAAGAAAAGTTAAAAGAGCA	0.279								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.V1427A		.											.	FANCM	569	0			c.T4280C						.						64.0	72.0	69.0					14																	45650690		2201	4297	6498	SO:0001583	missense	57697	exon15	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GAAAAGTTAAAAG	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.4280T>C	14.37:g.45650690T>C	ENSP00000267430:p.Val1427Ala	85.0	0.0		44.0	4.0	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	37	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	T	4.665	0.123695	0.08931	.	.	ENSG00000187790	ENST00000267430;ENST00000542564;ENST00000556250	T;T;T	0.15952	2.97;2.97;2.38	4.84	-2.42	0.06542	.	0.699813	0.14883	N	0.292874	T	0.05410	0.0143	N	0.08118	0	0.20926	N	0.999823	B;B	0.14438	0.01;0.01	B;B	0.09377	0.004;0.004	T	0.38394	-0.9663	10	0.11485	T	0.65	.	3.5769	0.07938	0.0759:0.2416:0.3071:0.3754	.	1401;1427	B2RTQ9;Q8IYD8	.;FANCM_HUMAN	A	1427;1401;943	ENSP00000267430:V1427A;ENSP00000442493:V1401A;ENSP00000452033:V943A	ENSP00000267430:V1427A	V	+	2	0	FANCM	44720440	0.948000	0.32251	0.171000	0.22900	0.500000	0.33767	-0.057000	0.11768	-0.761000	0.04670	-0.691000	0.03719	GTT	.		0.279	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
FLG2	388698	hgsc.bcm.edu;broad.mit.edu	37	1	152327767	152327767	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr1:152327767delC	ENST00000388718.5	-	3	2567	c.2495delG	c.(2494-2496)ggcfs	p.G832fs	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	832	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGTCCAAAGCCAGAGGATTG	0.512																																					p.G832fs		.											.	FLG2	151	0			c.2495delG						.						314.0	303.0	307.0					1																	152327767		2203	4300	6503	SO:0001589	frameshift_variant	388698	exon3			CCAAAGCCAGAGG	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2495delG	1.37:g.152327767delC	ENSP00000373370:p.Gly832fs	166.0	0.0		208.0	18.0	NM_001014342	Q9H4U1	Frame_Shift_Del	DEL	ENST00000388718.5	37	CCDS30861.1																																																																																			.		0.512	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
FOLH1	2346	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	49229931	49229931	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr11:49229931C>G	ENST00000256999.2	-	1	291	c.31G>C	c.(31-33)Gct>Cct	p.A11P	FOLH1_ENST00000356696.3_Missense_Mutation_p.A11P|FOLH1_ENST00000340334.7_5'UTR|FOLH1_ENST00000533034.1_5'Flank|FOLH1_ENST00000343844.4_5'UTR	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	11					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GTGGCCACAGCCGAGTCGGTT	0.716																																					p.A11P		.											.	FOLH1	579	0			c.G31C						.						8.0	11.0	10.0					11																	49229931		2162	4235	6397	SO:0001583	missense	2346	exon1			CCACAGCCGAGTC	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.31G>C	11.37:g.49229931C>G	ENSP00000256999:p.Ala11Pro	45.0	0.0		42.0	21.0	NM_004476	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	ENST00000256999.2	37	CCDS7946.1	.	.	.	.	.	.	.	.	.	.	C	13.38	2.220849	0.39201	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000389724	T;T	0.38887	1.11;1.14	4.19	-1.61	0.08399	.	1.118390	0.07122	U	0.844044	T	0.19565	0.0470	N	0.08118	0	0.09310	N	0.999999	B;B	0.31153	0.232;0.31	B;B	0.28139	0.086;0.057	T	0.18335	-1.0340	10	0.35671	T	0.21	.	5.1131	0.14819	0.3404:0.5124:0.0:0.1472	.	11;11	Q04609-8;Q04609	.;FOLH1_HUMAN	P	11	ENSP00000256999:A11P;ENSP00000349129:A11P	ENSP00000256999:A11P	A	-	1	0	FOLH1	49186507	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.292000	0.19011	-0.199000	0.10317	0.591000	0.81541	GCT	.		0.716	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476	
DDX42	11325	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	61898837	61898837	+	IGR	SNP	T	T	C			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr17:61898837T>C	ENST00000578681.1	+	0	4337				FTSJ3_ENST00000427159.2_Missense_Mutation_p.Q588R	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42						protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						GGCTTCATCTTGGTACAGGGG	0.547																																					p.Q588R		.											.	FTSJ3	91	0			c.A1763G						.						79.0	81.0	80.0					17																	61898837		2203	4300	6503	SO:0001628	intergenic_variant	117246	exon16			TCATCTTGGTACA	BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3			17.37:g.61898837T>C		72.0	0.0		78.0	13.0	NM_017647	A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	ENST00000578681.1	37	CCDS32704.1	.	.	.	.	.	.	.	.	.	.	T	4.695	0.129276	0.08981	.	.	ENSG00000108592	ENST00000427159	T	0.30182	1.54	5.17	-8.58	0.00897	.	1.210430	0.05840	N	0.619246	T	0.10035	0.0246	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19647	-1.0299	10	0.18276	T	0.48	3.4868	0.8566	0.01184	0.1861:0.2774:0.2277:0.3088	.	588	Q8IY81	RRMJ3_HUMAN	R	588	ENSP00000396673:Q588R	ENSP00000396673:Q588R	Q	-	2	0	FTSJ3	59252569	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.612000	0.05616	-2.768000	0.00366	-2.866000	0.00100	CAA	.		0.547	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444368.1	NM_007372	
GABPA	2551	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	27141414	27141414	+	Silent	SNP	G	G	A	rs563533466		TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr21:27141414G>A	ENST00000354828.3	+	10	1763	c.1236G>A	c.(1234-1236)gcG>gcA	p.A412A	GABPA_ENST00000400075.3_Silent_p.A412A	NM_001197297.1	NP_001184226.1	Q06546	GABPA_HUMAN	GA binding protein transcription factor, alpha subunit 60kDa	412					cell differentiation (GO:0030154)|in utero embryonic development (GO:0001701)|negative regulation of megakaryocyte differentiation (GO:0045653)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	24						ACAGTGCAGCGGAGTTGAACC	0.438													G|||	1	0.000199681	0.0	0.0	5008	,	,		16103	0.0		0.001	False		,,,				2504	0.0				p.A412A		.											.	GABPA	227	0			c.G1236A						.						87.0	90.0	89.0					21																	27141414		2203	4300	6503	SO:0001819	synonymous_variant	2551	exon10			TGCAGCGGAGTTG		CCDS13575.1	21q21-q22.1	2008-07-31	2002-08-29		ENSG00000154727	ENSG00000154727			4071	protein-coding gene	gene with protein product	"""human nuclear respiratory factor-2 subunit alpha"", ""nuclear respiratory factor 2 alpha subunit"""	600609	"""GA-binding protein transcription factor, alpha subunit (60kD)"""			8441384	Standard	NM_002040		Approved	E4TF1A, NFT2, NRF2, E4TF1-60, NRF2A	uc002yly.4	Q06546	OTTHUMG00000078443	ENST00000354828.3:c.1236G>A	21.37:g.27141414G>A		334.0	0.0		225.0	89.0	NM_001197297	Q12939	Silent	SNP	ENST00000354828.3	37	CCDS13575.1																																																																																			.		0.438	GABPA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171365.1	NM_002040	
GALNT6	11226	broad.mit.edu;bcgsc.ca	37	12	51758083	51758083	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr12:51758083T>C	ENST00000543196.2	-	5	1076	c.871A>G	c.(871-873)Aca>Gca	p.T291A	GALNT6_ENST00000356317.3_Missense_Mutation_p.T291A			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	291					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						ACCACCACTGTCTTGTCCTCA	0.607																																					p.T291A		.											.	GALNT6	92	0			c.A871G						.						71.0	68.0	69.0					12																	51758083		2203	4300	6503	SO:0001583	missense	11226	exon6			CCACTGTCTTGTC	Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.871A>G	12.37:g.51758083T>C	ENSP00000444171:p.Thr291Ala	198.0	1.0		130.0	6.0	NM_007210	Q8IYH4|Q9H6G2|Q9UIV5	Missense_Mutation	SNP	ENST00000543196.2	37	CCDS8813.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.494838	0.85069	.	.	ENSG00000139629	ENST00000543196;ENST00000356317;ENST00000546163	T;T	0.56103	0.48;0.48	4.59	4.59	0.56863	Glycosyl transferase, family 2 (1);	0.047768	0.85682	D	0.000000	T	0.61451	0.2348	M	0.71871	2.18	0.58432	D	0.999995	P	0.42584	0.784	P	0.48454	0.578	T	0.66559	-0.5893	10	0.62326	D	0.03	.	13.8986	0.63787	0.0:0.0:0.0:1.0	.	291	Q8NCL4	GALT6_HUMAN	A	291;291;272	ENSP00000444171:T291A;ENSP00000348668:T291A	ENSP00000348668:T291A	T	-	1	0	GALNT6	50044350	1.000000	0.71417	0.992000	0.48379	0.985000	0.73830	3.346000	0.52190	2.288000	0.76882	0.533000	0.62120	ACA	.		0.607	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210	
GPR98	84059	ucsc.edu;bcgsc.ca	37	5	90124798	90124798	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr5:90124798A>G	ENST00000405460.2	+	77	16502	c.16406A>G	c.(16405-16407)tAt>tGt	p.Y5469C	GPR98_ENST00000425867.2_Missense_Mutation_p.Y1130C	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	5469					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GTGGAACTATATGAAGCTACT	0.333																																					p.Y5469C		.											.	GPR98	103	0			c.A16406G						.						84.0	81.0	82.0					5																	90124798		1833	4100	5933	SO:0001583	missense	84059	exon77			AACTATATGAAGC	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.16406A>G	5.37:g.90124798A>G	ENSP00000384582:p.Tyr5469Cys	49.0	0.0		39.0	4.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	A	19.61	3.860429	0.71834	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.27720	1.65;1.65	5.71	5.71	0.89125	.	0.054422	0.85682	D	0.000000	T	0.55673	0.1935	M	0.73598	2.24	0.58432	D	0.999999	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.71184	0.922;0.972;0.965	T	0.56739	-0.7929	9	.	.	.	.	15.9886	0.80183	1.0:0.0:0.0:0.0	.	1130;5469;1130	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	C	5469;5469;1130	ENSP00000384582:Y5469C;ENSP00000392618:Y1130C	.	Y	+	2	0	GPR98	90160554	1.000000	0.71417	0.994000	0.49952	0.817000	0.46193	7.438000	0.80431	2.173000	0.68751	0.533000	0.62120	TAT	.		0.333	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
HKDC1	80201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	71008284	71008284	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr10:71008284C>T	ENST00000354624.5	+	10	1503	c.1370C>T	c.(1369-1371)aCc>aTc	p.T457I	HKDC1_ENST00000488706.1_3'UTR|HKDC1_ENST00000395086.2_Missense_Mutation_p.T457I	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	457	Hexokinase type-2 1.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						GCCATGGTGACCGCGGTGGCC	0.642																																					p.T457I		.											.	HKDC1	95	0			c.C1370T						.						39.0	40.0	40.0					10																	71008284		2203	4300	6503	SO:0001583	missense	80201	exon10			TGGTGACCGCGGT		CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.1370C>T	10.37:g.71008284C>T	ENSP00000346643:p.Thr457Ile	110.0	0.0		115.0	52.0	NM_025130	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	ENST00000354624.5	37	CCDS7288.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958283	0.92726	.	.	ENSG00000156510	ENST00000354624;ENST00000395087;ENST00000395086	T;T	0.12255	2.7;2.7	4.97	4.97	0.65823	Hexokinase, C-terminal (1);	0.052599	0.64402	D	0.000001	T	0.48223	0.1488	M	0.91818	3.245	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.60414	-0.7268	10	0.87932	D	0	-15.1498	18.3972	0.90502	0.0:1.0:0.0:0.0	.	457	Q2TB90	HKDC1_HUMAN	I	457	ENSP00000346643:T457I;ENSP00000378521:T457I	ENSP00000346643:T457I	T	+	2	0	HKDC1	70678290	1.000000	0.71417	0.954000	0.39281	0.946000	0.59487	7.615000	0.83006	2.583000	0.87209	0.462000	0.41574	ACC	.		0.642	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048389.1	NM_025130	
HNF1A	6927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	121431424	121431424	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr12:121431424T>A	ENST00000257555.6	+	3	854	c.628T>A	c.(628-630)Tcc>Acc	p.S210T	HNF1A_ENST00000543427.1_Missense_Mutation_p.S93T|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000544413.1_Missense_Mutation_p.S210T|HNF1A_ENST00000402929.1_Missense_Mutation_p.S210T|HNF1A_ENST00000400024.2_Missense_Mutation_p.S210T|HNF1A_ENST00000541395.1_Missense_Mutation_p.S210T			P20823	HNF1A_HUMAN	HNF1 homeobox A	210					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.W206fs*10(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GGGCCCAGCATCCCAGCAGAT	0.592									Hepatic Adenoma, Familial Clustering of																												p.S210T		.											.	HNF1A	1745	1	Deletion - Frameshift(1)	liver(1)	c.T628A						.						99.0	92.0	94.0					12																	121431424		2203	4300	6503	SO:0001583	missense	6927	exon3	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	CCAGCATCCCAGC	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.628T>A	12.37:g.121431424T>A	ENSP00000257555:p.Ser210Thr	131.0	0.0		109.0	21.0	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	ENST00000257555.6	37	CCDS9209.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.497127	0.85069	.	.	ENSG00000135100	ENST00000257555;ENST00000535125;ENST00000543536;ENST00000544680;ENST00000537424;ENST00000543027;ENST00000543427;ENST00000545458;ENST00000541395;ENST00000340577;ENST00000344370;ENST00000544413	D;D;D;D	0.96168	-3.93;-3.93;-3.93;-3.93	4.55	4.55	0.56014	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.64402	D	0.000007	D	0.97021	0.9027	M	0.72118	2.19	0.58432	D	0.999993	D;D;D;D	0.71674	0.994;0.981;0.998;0.995	D;P;D;D	0.72338	0.942;0.88;0.977;0.966	D	0.97421	1.0009	10	0.72032	D	0.01	-27.0714	13.1155	0.59297	0.0:0.0:0.0:1.0	.	210;210;210;210	F5H0K0;P20823;E7EUQ4;E7EMR0	.;HNF1A_HUMAN;.;.	T	210;210;210;210;210;210;93;210;210;210;210;210	ENSP00000257555:S210T;ENSP00000439721:S93T;ENSP00000443112:S210T;ENSP00000438804:S210T	ENSP00000257555:S210T	S	+	1	0	HNF1A	119915807	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	7.564000	0.82326	1.701000	0.51217	0.423000	0.28283	TCC	.		0.592	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
HPS3	84343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	148868468	148868468	+	Splice_Site	SNP	G	G	A			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr3:148868468G>A	ENST00000296051.2	+	6	1385		c.e6+1		HPS3_ENST00000460120.1_Splice_Site	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3						organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			CACCCTGAAGGTAAGAACTGG	0.498									Hermansky-Pudlak syndrome																												.		.											.	HPS3	158	0			c.1245+1G>A						.						115.0	105.0	108.0					3																	148868468		2203	4300	6503	SO:0001630	splice_region_variant	84343	exon6	Familial Cancer Database	HPS, HPS1-8	CTGAAGGTAAGAA	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.1245+1G>A	3.37:g.148868468G>A		131.0	0.0		110.0	18.0	NM_032383	A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Splice_Site	SNP	ENST00000296051.2	37	CCDS3140.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.542860	0.86022	.	.	ENSG00000163755	ENST00000296051;ENST00000460120	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2421	0.93888	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HPS3	150351158	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	8.266000	0.89871	2.621000	0.88768	0.650000	0.86243	.	.		0.498	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356151.1	NM_032383	Intron
ITGB4	3691	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	73723530	73723530	+	Missense_Mutation	SNP	G	G	A	rs569235037		TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr17:73723530G>A	ENST00000200181.3	+	4	395	c.208G>A	c.(208-210)Gcg>Acg	p.A70T	ITGB4_ENST00000450894.3_Missense_Mutation_p.A70T|ITGB4_ENST00000584558.1_3'UTR|ITGB4_ENST00000339591.3_Missense_Mutation_p.A70T|ITGB4_ENST00000449880.2_Missense_Mutation_p.A70T|ITGB4_ENST00000579662.1_Missense_Mutation_p.A70T	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	70	PSI.				amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCTGCTGGCCGCGGGCTGCCA	0.682													G|||	1	0.000199681	0.0	0.0014	5008	,	,		14709	0.0		0.0	False		,,,				2504	0.0				p.A70T		.											.	ITGB4	227	0			c.G208A						.						22.0	26.0	25.0					17																	73723530		2201	4298	6499	SO:0001583	missense	3691	exon4			CTGGCCGCGGGCT		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.208G>A	17.37:g.73723530G>A	ENSP00000200181:p.Ala70Thr	155.0	0.0		132.0	36.0	NM_001005731	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	ENST00000200181.3	37	CCDS11727.1	.	.	.	.	.	.	.	.	.	.	G	5.370	0.253508	0.10185	.	.	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	D;D;D	0.92595	-3.07;-3.07;-3.07	5.46	0.956	0.19608	Integrin beta subunit, N-terminal (2);	0.865281	0.10275	N	0.694280	D	0.85062	0.5611	L	0.49640	1.575	0.09310	N	1	P;B;P;P	0.47409	0.455;0.172;0.895;0.484	B;B;B;B	0.35114	0.145;0.049;0.196;0.081	T	0.73285	-0.4031	10	0.14252	T	0.57	.	8.3329	0.32197	0.0765:0.0:0.421:0.5024	.	70;70;70;70	P16144-5;P16144-3;A0AVL6;P16144	.;.;.;ITB4_HUMAN	T	70	ENSP00000200181:A70T;ENSP00000344079:A70T;ENSP00000400217:A70T	ENSP00000200181:A70T	A	+	1	0	ITGB4	71235125	0.000000	0.05858	0.011000	0.14972	0.136000	0.21042	0.510000	0.22723	0.662000	0.31006	-0.152000	0.13540	GCG	G|1.000;A|0.000		0.682	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1		
KPNA7	402569	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	98792911	98792911	+	Missense_Mutation	SNP	G	G	T	rs183241291		TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr7:98792911G>T	ENST00000327442.6	-	4	374	c.335C>A	c.(334-336)gCg>gAg	p.A112E		NM_001145715.1	NP_001139187.1	A9QM74	IMA8_HUMAN	karyopherin alpha 7 (importin alpha 8)	112					cytokine-mediated signaling pathway (GO:0019221)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(3)|endometrium(2)|kidney(1)|prostate(1)|skin(1)	8						AATGAGGCCCGCTTCAATGAC	0.542																																					p.A112E		.											.	KPNA7	158	0			c.C335A						.						42.0	41.0	41.0					7																	98792911		692	1591	2283	SO:0001583	missense	402569	exon4			AGGCCCGCTTCAA		CCDS47651.1	7q22.1	2013-02-14			ENSG00000185467	ENSG00000185467		"""Importins"", ""Armadillo repeat containing"""	21839	protein-coding gene	gene with protein product		614107					Standard	NM_001145715		Approved		uc010lft.2	A9QM74	OTTHUMG00000154412	ENST00000327442.6:c.335C>A	7.37:g.98792911G>T	ENSP00000330878:p.Ala112Glu	62.0	0.0		67.0	24.0	NM_001145715	A4D277	Missense_Mutation	SNP	ENST00000327442.6	37	CCDS47651.1	.	.	.	.	.	.	.	.	.	.	G	12.81	2.049418	0.36181	.	.	ENSG00000185467	ENST00000327442	T	0.71579	-0.58	5.58	3.75	0.43078	Armadillo-like helical (1);Armadillo-type fold (1);	0.526336	0.21765	N	0.069449	D	0.83505	0.5269	M	0.88704	2.975	0.09310	N	0.999997	D	0.76494	0.999	D	0.65773	0.938	T	0.75065	-0.3449	10	0.72032	D	0.01	-22.6159	9.6797	0.40063	0.2335:0.0:0.7665:0.0	.	112	A9QM74	IMA8_HUMAN	E	112	ENSP00000330878:A112E	ENSP00000330878:A112E	A	-	2	0	KPNA7	98630847	0.775000	0.28604	0.002000	0.10522	0.024000	0.10985	3.321000	0.51999	1.364000	0.46038	0.561000	0.74099	GCG	G|0.999;A|0.000		0.542	KPNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335118.1	NM_001145715	
KRTAP5-3	387266	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	1629410	1629410	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr11:1629410G>T	ENST00000399685.1	-	1	283	c.206C>A	c.(205-207)tCt>tAt	p.S69Y		NM_001012708.2	NP_001012726.1	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	69	11 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	8		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		GCCCCCACAAGAGCCACAGAC	0.667																																					p.S69Y		.											.	KRTAP5-3	92	0			c.C206A						.						53.0	72.0	66.0					11																	1629410		2193	4294	6487	SO:0001583	missense	387266	exon1			CCACAAGAGCCAC	AB126072	CCDS41591.1	11p15.5	2008-02-05			ENSG00000196224	ENSG00000196224		"""Keratin associated proteins"""	23598	protein-coding gene	gene with protein product						15144888	Standard	NM_001012708		Approved	KRTAP5.3, KRTAP5-9	uc001ltw.1	Q6L8H2	OTTHUMG00000057559	ENST00000399685.1:c.206C>A	11.37:g.1629410G>T	ENSP00000382592:p.Ser69Tyr	237.0	0.0		239.0	34.0	NM_001012708	Q6PL44|Q701N3	Missense_Mutation	SNP	ENST00000399685.1	37	CCDS41591.1	.	.	.	.	.	.	.	.	.	.	G	3.802	-0.041479	0.07452	.	.	ENSG00000196224	ENST00000399685	T	0.01647	4.71	3.39	3.39	0.38822	.	.	.	.	.	T	0.07458	0.0188	H	0.94542	3.55	0.20074	N	0.999933	B	0.28713	0.22	B	0.33121	0.158	T	0.02821	-1.1106	9	0.59425	D	0.04	.	12.6532	0.56774	0.0:0.0:1.0:0.0	.	69	Q6L8H2	KRA53_HUMAN	Y	69	ENSP00000382592:S69Y	ENSP00000382592:S69Y	S	-	2	0	KRTAP5-3	1585986	0.000000	0.05858	0.978000	0.43139	0.001000	0.01503	-0.220000	0.09215	1.616000	0.50265	0.289000	0.19496	TCT	.		0.667	KRTAP5-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127924.1		
LHFP	10186	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	40175212	40175212	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr13:40175212G>A	ENST00000379589.3	-	2	604	c.142C>T	c.(142-144)Cgg>Tgg	p.R48W	LHFP_ENST00000495922.1_5'Flank	NM_005780.2	NP_005771.1	Q9Y693	LHFP_HUMAN	lipoma HMGIC fusion partner	48						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)		HMGA2/LHFP(2)	breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(6)|prostate(2)	13		Lung NSC(96;3.55e-06)|Breast(139;0.00408)|Ovarian(182;0.0107)|Prostate(109;0.0118)|Lung SC(185;0.0719)|Hepatocellular(188;0.114)		OV - Ovarian serous cystadenocarcinoma(117;6.48e-46)|Epithelial(112;8.43e-42)|all cancers(112;1.42e-36)|GBM - Glioblastoma multiforme(144;0.00187)|BRCA - Breast invasive adenocarcinoma(63;0.00886)|KIRC - Kidney renal clear cell carcinoma(186;0.048)|Kidney(163;0.0601)|LUSC - Lung squamous cell carcinoma(192;0.105)		GAGCACCTCCGGAAGGTACCG	0.572			T	HMGA2	lipoma																																p.R48W		.		Dom	yes		13	13q12	10186	lipoma HMGIC fusion partner		M	.	LHFP	683	0			c.C142T						.						184.0	170.0	175.0					13																	40175212		2203	4300	6503	SO:0001583	missense	10186	exon2			ACCTCCGGAAGGT	AF098807	CCDS9369.1	13q12	2008-07-18			ENSG00000183722	ENSG00000183722			6586	protein-coding gene	gene with protein product		606710				10329012	Standard	NM_005780		Approved	MGC22429	uc001uxf.3	Q9Y693	OTTHUMG00000016767	ENST00000379589.3:c.142C>T	13.37:g.40175212G>A	ENSP00000368908:p.Arg48Trp	181.0	0.0		134.0	23.0	NM_005780	B2R7M2|Q53FC0|Q96SH5	Missense_Mutation	SNP	ENST00000379589.3	37	CCDS9369.1	.	.	.	.	.	.	.	.	.	.	G	32	5.128127	0.94473	.	.	ENSG00000183722	ENST00000379589	T	0.72942	-0.7	5.38	5.38	0.77491	.	0.000000	0.64402	D	0.000004	D	0.85999	0.5828	M	0.84433	2.695	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87111	0.2185	9	.	.	.	.	18.101	0.89505	0.0:0.0:1.0:0.0	.	48	Q9Y693	LHFP_HUMAN	W	48	ENSP00000368908:R48W	.	R	-	1	2	LHFP	39073212	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.373000	0.97168	2.522000	0.85027	0.655000	0.94253	CGG	.		0.572	LHFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044619.1	NM_005780	
LIG3	3980	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	33310396	33310396	+	Silent	SNP	C	C	T			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr17:33310396C>T	ENST00000378526.4	+	2	505	c.372C>T	c.(370-372)ccC>ccT	p.P124P	LIG3_ENST00000586407.1_Intron|LIG3_ENST00000262327.5_Silent_p.P124P	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	124					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	AAGTGGTGCCCAATCCCTTCT	0.493								Other BER factors																													p.P124P		.											.	LIG3	728	0			c.C372T						.						73.0	68.0	70.0					17																	33310396		2203	4300	6503	SO:0001819	synonymous_variant	3980	exon2			GGTGCCCAATCCC		CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.372C>T	17.37:g.33310396C>T		131.0	0.0		81.0	14.0	NM_013975	Q16714|Q6NVK3	Silent	SNP	ENST00000378526.4	37	CCDS11284.2																																																																																			.		0.493	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250330.3	NM_013975	
MAL	4118	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	95713853	95713853	+	Silent	SNP	G	G	A			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr2:95713853G>A	ENST00000309988.4	+	2	352	c.243G>A	c.(241-243)gaG>gaA	p.E81E	MAL_ENST00000353004.3_Silent_p.E81E|MAL_ENST00000349807.3_Intron|MAL_ENST00000354078.3_Intron	NM_002371.3	NP_002362.1	P21145	MAL_HUMAN	mal, T-cell differentiation protein	81	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|central nervous system development (GO:0007417)|membrane raft polarization (GO:0001766)|myelination (GO:0042552)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	channel activity (GO:0015267)|lipid binding (GO:0008289)|peptidase activator activity involved in apoptotic process (GO:0016505)|structural constituent of myelin sheath (GO:0019911)	p.E81E(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|prostate(2)	10				STAD - Stomach adenocarcinoma(1183;0.18)		ACGGTGGAGAGACTTCCTGGG	0.602																																					p.E81E		.											.	MAL	514	1	Substitution - coding silent(1)	lung(1)	c.G243A						.						90.0	84.0	86.0					2																	95713853		2203	4300	6503	SO:0001819	synonymous_variant	4118	exon2			TGGAGAGACTTCC		CCDS2006.1, CCDS2007.1, CCDS2008.1, CCDS2009.1	2q11.1	2008-07-29			ENSG00000172005	ENSG00000172005			6817	protein-coding gene	gene with protein product		188860					Standard	NM_002371		Approved		uc002stx.2	P21145	OTTHUMG00000132011	ENST00000309988.4:c.243G>A	2.37:g.95713853G>A		267.0	0.0		179.0	64.0	NM_022438	Q6FH77	Silent	SNP	ENST00000309988.4	37	CCDS2006.1																																																																																			.		0.602	MAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254982.3	NM_002371	
MIR520D	574482	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	54223426	54223426	+	RNA	SNP	A	A	G			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr19:54223426A>G	ENST00000385002.1	+	0	77				MIR517B_ENST00000385102.1_RNA|RNU6-803P_ENST00000516034.1_RNA|MIR520G_ENST00000385064.1_RNA	NR_030204.1				microRNA 520d																		TTGGTGGGTTACGGTTTGAGA	0.443																																					.		.											.	.	.	0			.						.						115.0	107.0	110.0					19																	54223426		1568	3582	5150			574482	.			TGGGTTACGGTTT			19q13.42	2011-09-12		2008-12-18	ENSG00000207735	ENSG00000207735		"""ncRNAs / Micro RNAs"""	32114	non-coding RNA	RNA, micro				MIRN520D			Standard	NR_030204		Approved	hsa-mir-520d	uc021vah.1				19.37:g.54223426A>G		82.0	0.0		62.0	7.0	.		RNA	SNP	ENST00000385002.1	37																																																																																				.		0.443	MIR520D-201	KNOWN	basic	miRNA	miRNA		NR_030204	
MRVI1	10335	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	10602112	10602112	+	Silent	SNP	G	G	A			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr11:10602112G>A	ENST00000436272.1	-	19	2382	c.2304C>T	c.(2302-2304)acC>acT	p.T768T	MRVI1_ENST00000531107.1_Silent_p.T787T|MRVI1_ENST00000424001.1_Silent_p.T480T|LYVE1_ENST00000531706.1_Intron|MRVI1-AS1_ENST00000529829.1_RNA|MRVI1-AS1_ENST00000529979.1_RNA|MRVI1_ENST00000423302.2_Silent_p.T795T|MRVI1_ENST00000545852.1_Silent_p.T480T|MRVI1_ENST00000421747.1_Silent_p.T786T|MRVI1_ENST00000527509.2_Silent_p.T704T|MRVI1_ENST00000547195.1_Silent_p.T704T|MRVI1_ENST00000534266.2_Silent_p.T480T|MRVI1_ENST00000541483.1_Silent_p.T589T|MRVI1_ENST00000552103.1_Silent_p.T704T|MRVI1_ENST00000558540.1_Silent_p.T480T			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	768	Glu-rich.				blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		GAAGTTCTTTGGTCTTCTTTA	0.498																																					p.T795T		.											.	MRVI1	25	0			c.C2385T						.						116.0	116.0	116.0					11																	10602112		1872	4118	5990	SO:0001819	synonymous_variant	10335	exon20			TTCTTTGGTCTTC	AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.2304C>T	11.37:g.10602112G>A		87.0	0.0		59.0	5.0	NM_130385	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Silent	SNP	ENST00000436272.1	37																																																																																				.		0.498	MRVI1-203	KNOWN	basic	protein_coding	protein_coding		NM_001098579	
MSN	4478	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	64955217	64955217	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chrX:64955217G>A	ENST00000360270.5	+	8	1056	c.884G>A	c.(883-885)cGc>cAc	p.R295H		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	295	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)		MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						ATGCGCCGTCGCAAGCCTGAT	0.567			T	ALK	ALCL																																p.R295H		.		Dom	yes		X	Xq11.2-q12	4478	moesin		L	.	MSN	1086	0			c.G884A						.						63.0	43.0	50.0					X																	64955217		2203	4300	6503	SO:0001583	missense	4478	exon8			GCCGTCGCAAGCC	M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.884G>A	X.37:g.64955217G>A	ENSP00000353408:p.Arg295His	287.0	0.0		223.0	9.0	NM_002444		Missense_Mutation	SNP	ENST00000360270.5	37	CCDS14382.1	.	.	.	.	.	.	.	.	.	.	G	35	5.426694	0.96131	.	.	ENSG00000147065	ENST00000360270	D	0.83755	-1.76	5.45	5.45	0.79879	FERM, C-terminal PH-like domain (1);FERM domain (1);	0.000000	0.85682	D	0.000000	D	0.93439	0.7907	M	0.93978	3.48	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95055	0.8190	10	0.87932	D	0	.	16.7763	0.85551	0.0:0.0:1.0:0.0	.	295	P26038	MOES_HUMAN	H	295	ENSP00000353408:R295H	ENSP00000353408:R295H	R	+	2	0	MSN	64871942	1.000000	0.71417	0.978000	0.43139	0.972000	0.66771	9.727000	0.98787	2.278000	0.76064	0.594000	0.82650	CGC	.		0.567	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056981.1	NM_002444	
MUC17	140453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100686943	100686943	+	Silent	SNP	G	G	A	rs201108444	byFrequency	TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr7:100686943G>A	ENST00000306151.4	+	3	12310	c.12246G>A	c.(12244-12246)acG>acA	p.T4082T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4082					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCTCCTCCACGACTGTGAACC	0.572													G|||	3	0.000599042	0.0023	0.0	5008	,	,		18996	0.0		0.0	False		,,,				2504	0.0				p.T4082T		.											.	MUC17	95	0			c.G12246A						.	G		5,4401	9.9+/-24.2	0,5,2198	223.0	189.0	201.0		12246	-1.1	0.0	7		201	0,8600		0,0,4300	yes	coding-synonymous	MUC17	NM_001040105.1		0,5,6498	AA,AG,GG		0.0,0.1135,0.0384		4082/4494	100686943	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	140453	exon3			CTCCACGACTGTG	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.12246G>A	7.37:g.100686943G>A		245.0	0.0		191.0	40.0	NM_001040105	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1																																																																																			.		0.572	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
NIPBL	25836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	37007558	37007558	+	Silent	SNP	A	A	C			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr5:37007558A>C	ENST00000282516.8	+	18	4720	c.4221A>C	c.(4219-4221)acA>acC	p.T1407T	NIPBL_ENST00000448238.2_Silent_p.T1407T	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1407					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			AACTTCTTACAGACACAACAA	0.303																																					p.T1407T		.											.	NIPBL	293	0			c.A4221C						.						54.0	53.0	53.0					5																	37007558		2199	4295	6494	SO:0001819	synonymous_variant	25836	exon18			TCTTACAGACACA	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.4221A>C	5.37:g.37007558A>C		162.0	0.0		118.0	51.0	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Silent	SNP	ENST00000282516.8	37	CCDS3920.1																																																																																			.		0.303	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
NIPBL	25836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	37007562	37007562	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr5:37007562A>G	ENST00000282516.8	+	18	4724	c.4225A>G	c.(4225-4227)Aca>Gca	p.T1409A	NIPBL_ENST00000448238.2_Missense_Mutation_p.T1409A	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1409					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TCTTACAGACACAACAATTCT	0.313																																					p.T1409A		.											.	NIPBL	293	0			c.A4225G						.						51.0	50.0	51.0					5																	37007562		2199	4295	6494	SO:0001583	missense	25836	exon18			ACAGACACAACAA	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.4225A>G	5.37:g.37007562A>G	ENSP00000282516:p.Thr1409Ala	158.0	0.0		117.0	51.0	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	37	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.304292	0.81136	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.94046	-3.33;-3.34	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.95414	0.8511	L	0.56396	1.775	0.80722	D	1	D;D	0.69078	0.994;0.997	D;D	0.69479	0.942;0.964	D	0.95076	0.8209	10	0.44086	T	0.13	.	15.2464	0.73509	1.0:0.0:0.0:0.0	.	1409;1409	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	A	1409	ENSP00000282516:T1409A;ENSP00000406266:T1409A	ENSP00000282516:T1409A	T	+	1	0	NIPBL	37043319	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.962000	0.93254	2.019000	0.59389	0.528000	0.53228	ACA	.		0.313	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
OR2J3	442186	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	29080097	29080097	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr6:29080097T>G	ENST00000377169.1	+	1	430	c.430T>G	c.(430-432)Tgc>Ggc	p.C144G		NM_001005216.2	NP_001005216.2	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J, member 3	144						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24						CCCTCGTTTCTGCCACCTGCT	0.522																																					p.C144G		.											.	OR2J3	90	0			c.T430G						.						366.0	390.0	381.0					6																	29080097		1385	2633	4018	SO:0001583	missense	442186	exon1			CGTTTCTGCCACC		CCDS43433.1	6p22.2-p21.31	2012-08-09			ENSG00000204701	ENSG00000204701		"""GPCR / Class A : Olfactory receptors"""	8261	protein-coding gene	gene with protein product		615016					Standard	NM_001005216		Approved	OR6-6	uc011dll.2	O76001	OTTHUMG00000031092	ENST00000377169.1:c.430T>G	6.37:g.29080097T>G	ENSP00000366374:p.Cys144Gly	450.0	1.0		331.0	132.0	NM_001005216	B0UY52|B9EH11|Q5SUJ7|Q6IF25|Q96R15|Q9GZK5|Q9GZL4|Q9GZL5	Missense_Mutation	SNP	ENST00000377169.1	37	CCDS43433.1	.	.	.	.	.	.	.	.	.	.	T	15.19	2.760854	0.49468	.	.	ENSG00000204701	ENST00000377169	T	0.00224	8.51	2.78	2.78	0.32641	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00468	0.0015	H	0.96604	3.85	0.41765	D	0.989732	D	0.89917	1.0	D	0.97110	1.0	T	0.44590	-0.9318	9	0.87932	D	0	.	10.804	0.46507	0.0:0.0:0.0:1.0	.	144	O76001	OR2J3_HUMAN	G	144	ENSP00000366374:C144G	ENSP00000366374:C144G	C	+	1	0	OR2J3	29188076	0.986000	0.35501	0.831000	0.32960	0.837000	0.47467	2.864000	0.48404	1.268000	0.44264	0.358000	0.22013	TGC	.		0.522	OR2J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076132.2		
OR12D3	81797	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	29342651	29342651	+	Silent	SNP	C	C	T			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr6:29342651C>T	ENST00000396806.3	-	1	417	c.414G>A	c.(412-414)gtG>gtA	p.V138V	OR5V1_ENST00000377154.1_Intron	NM_030959.2	NP_112221.1	Q9UGF7	O12D3_HUMAN	olfactory receptor, family 12, subfamily D, member 3	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)	23						ACAGAATACACACCTGGGGGT	0.498																																					p.V138V		.											.	OR12D3	133	0			c.G414A						.						56.0	57.0	57.0					6																	29342651		1510	2708	4218	SO:0001819	synonymous_variant	81797	exon1			AATACACACCTGG		CCDS4658.1	6p22.1	2013-09-24			ENSG00000112462	ENSG00000112462		"""GPCR / Class A : Olfactory receptors"""	13963	protein-coding gene	gene with protein product							Standard	NM_030959		Approved	hs6M1-27	uc003nme.3	Q9UGF7	OTTHUMG00000031051	ENST00000396806.3:c.414G>A	6.37:g.29342651C>T		90.0	0.0		81.0	34.0	NM_030959	A2BDZ1|Q5SQI8|Q6IF23	Silent	SNP	ENST00000396806.3	37	CCDS4658.1																																																																																			.		0.498	OR12D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076056.3		
P4HTM	54681	broad.mit.edu;bcgsc.ca	37	3	49038898	49038898	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr3:49038898A>G	ENST00000383729.4	+	3	835	c.464A>G	c.(463-465)gAg>gGg	p.E155G	P4HTM_ENST00000343546.4_Missense_Mutation_p.E155G	NM_177939.2	NP_808808.1	Q9NXG6	P4HTM_HUMAN	prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)	155						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)			NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21					Vitamin C(DB00126)	ACTGATGAAGAGTGTCGGCTC	0.572																																					p.E155G		.											.	P4HTM	205	0			c.A464G						.						53.0	48.0	50.0					3																	49038898		2203	4300	6503	SO:0001583	missense	54681	exon3			ATGAAGAGTGTCG		CCDS2781.2, CCDS43089.1	3p21.31	2009-01-14			ENSG00000178467	ENSG00000178467			28858	protein-coding gene	gene with protein product	"""Prolyl hydroxlase domain-containing 4"", ""hypoxia inducible factor prolyl 4 hydroxylase"""	614584				12163023, 17726031	Standard	XR_245139		Approved	P4H-TM, PHD4, PH4, HIFPH4, FLJ20262, EGLN4, PH-4	uc003cvh.3	Q9NXG6	OTTHUMG00000074057	ENST00000383729.4:c.464A>G	3.37:g.49038898A>G	ENSP00000373235:p.Glu155Gly	132.0	1.0		99.0	6.0	NM_177938	Q6PAG6|Q8TCJ9|Q8WV55|Q96F22|Q9BW77	Missense_Mutation	SNP	ENST00000383729.4	37	CCDS43089.1	.	.	.	.	.	.	.	.	.	.	A	31	5.101964	0.94245	.	.	ENSG00000178467	ENST00000383729;ENST00000343546	D	0.86627	-2.15	5.93	5.93	0.95920	EF-hand-like domain (1);Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	D	0.92750	0.7695	M	0.67700	2.07	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.975;0.998;0.946	D	0.93378	0.6741	10	0.87932	D	0	-30.9466	16.3797	0.83452	1.0:0.0:0.0:0.0	.	155;155;155	Q9NXG6-2;Q9NXG6-3;Q9NXG6	.;.;P4HTM_HUMAN	G	155	ENSP00000373235:E155G	ENSP00000341422:E155G	E	+	2	0	P4HTM	49013902	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	8.962000	0.93254	2.271000	0.75665	0.533000	0.62120	GAG	.		0.572	P4HTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157211.1	NM_177938	
PCDHB12	56124	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	140589809	140589809	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr5:140589809G>A	ENST00000239450.2	+	1	1519	c.1330G>A	c.(1330-1332)Gtc>Atc	p.V444I	PCDHB12_ENST00000541609.1_Missense_Mutation_p.V107I	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	444	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTCTCCGACGTCAATGACAA	0.597																																					p.V444I		.											.	PCDHB12	93	0			c.G1330A						.						107.0	101.0	103.0					5																	140589809		2203	4300	6503	SO:0001583	missense	56124	exon1			TCCGACGTCAATG	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.1330G>A	5.37:g.140589809G>A	ENSP00000239450:p.Val444Ile	135.0	0.0		165.0	9.0	NM_018932	B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	37	CCDS4254.1	.	.	.	.	.	.	.	.	.	.	G	2.818	-0.245539	0.05906	.	.	ENSG00000120328	ENST00000541609;ENST00000239450;ENST00000507840	T;T	0.01258	5.09;5.09	3.83	0.945	0.19543	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.00875	0.0029	N	0.17564	0.495	0.25830	N	0.984187	B	0.32101	0.356	B	0.26094	0.066	T	0.43245	-0.9403	9	0.06099	T	0.92	.	8.266	0.31815	0.2798:0.0:0.7202:0.0	.	444	Q9Y5F1	PCDBC_HUMAN	I	107;444;64	ENSP00000440199:V107I;ENSP00000239450:V444I	ENSP00000239450:V444I	V	+	1	0	PCDHB12	140569993	0.981000	0.34729	0.803000	0.32268	0.037000	0.13140	1.824000	0.39072	-0.048000	0.13401	-0.343000	0.07986	GTC	.		0.597	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932	
PCDHGA5	56110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140744161	140744161	+	Silent	SNP	C	C	T			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr5:140744161C>T	ENST00000518069.1	+	1	264	c.264C>T	c.(262-264)ggC>ggT	p.G88G	PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	88	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCACCGCGGGCAGGATAGACC	0.567																																					p.G88G		.											.	PCDHGA5	35	0			c.C264T						.						53.0	62.0	59.0					5																	140744161		2193	4297	6490	SO:0001819	synonymous_variant	56110	exon1			CGCGGGCAGGATA	AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.264C>T	5.37:g.140744161C>T		111.0	0.0		161.0	57.0	NM_032054	Q2M3F5|Q9Y5D2	Silent	SNP	ENST00000518069.1	37	CCDS54925.1																																																																																			.		0.567	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918	
PHPT1	29085	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	139744952	139744958	+	Intron	DEL	CAGCAGA	CAGCAGA	-			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	CAGCAGA	CAGCAGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr9:139744952_139744958delCAGCAGA	ENST00000247665.10	+	3	622				MAMDC4_ENST00000445819.1_5'Flank|MAMDC4_ENST00000317446.2_5'Flank|PHPT1_ENST00000371661.1_Splice_Site_p.IS95fs|PHPT1_ENST00000492540.1_3'UTR|PHPT1_ENST00000545326.1_Splice_Site_p.IS95fs	NM_014172.4	NP_054891.2	Q9NRX4	PHP14_HUMAN	phosphohistidine phosphatase 1						negative regulation of ATP citrate synthase activity (GO:2000984)|negative regulation of lyase activity (GO:0051350)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-histidine dephosphorylation (GO:0035971)|positive regulation of cell motility (GO:2000147)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|protein dephosphorylation (GO:0006470)|regulation of actin cytoskeleton reorganization (GO:2000249)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	calcium channel inhibitor activity (GO:0019855)|ion channel binding (GO:0044325)|phosphohistidine phosphatase activity (GO:0008969)|phosphoprotein phosphatase activity (GO:0004721)			NS(1)|large_intestine(1)|lung(1)	3	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		CAAAAACCACCAGCAGATGAGACCCAC	0.638																																					p.96_96del		.											.	PHPT1	90	0			c.286_286del						.																																			SO:0001627	intron_variant	29085	exon3			AACCACCAGCAGA	AF131857	CCDS7009.1, CCDS48060.1	9q34.3	2008-02-05			ENSG00000054148	ENSG00000054148	3.1.3.-		30033	protein-coding gene	gene with protein product	"""phosphohistidine phosphatase 14kDa"", "" sex-regulated protein janus-a"""	610167				11042152, 8619474	Standard	NM_014172		Approved	PHP14, HSPC141, CGI-202, DKFZp564M173, bA216L13.10	uc004cjq.4	Q9NRX4	OTTHUMG00000020950	ENST00000247665.10:c.286-249CAGCAGA>-	9.37:g.139744952_139744958delCAGCAGA		98.0	0.0		48.0	10.0	NM_001135861	B1AMX0|B1AMX1|Q9H0Y3	Frame_Shift_Del	DEL	ENST00000247665.10	37	CCDS7009.1																																																																																			.		0.638	PHPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055150.1	NM_014172	
PPARA	5465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	46611213	46611213	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr22:46611213G>T	ENST00000396000.2	+	4	617	c.352G>T	c.(352-354)Gcg>Tcg	p.A118S	PPARA_ENST00000434345.2_Missense_Mutation_p.A118S|PPARA_ENST00000407236.1_Missense_Mutation_p.A118S|PPARA_ENST00000262735.5_Missense_Mutation_p.A118S|PPARA_ENST00000402126.1_Missense_Mutation_p.A118S			Q07869	PPARA_HUMAN	peroxisome proliferator-activated receptor alpha	118					behavioral response to nicotine (GO:0035095)|cellular lipid metabolic process (GO:0044255)|circadian regulation of gene expression (GO:0032922)|enamel mineralization (GO:0070166)|epidermis development (GO:0008544)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|negative regulation of appetite (GO:0032099)|negative regulation of blood pressure (GO:0045776)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of glycolytic process (GO:0045820)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular ketone metabolic process by positive regulation of transcription from RNA polymerase II promoter (GO:0072366)|regulation of circadian rhythm (GO:0042752)|regulation of glycolytic by positive regulation of transcription from RNA polymerase II promoter (GO:0072363)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|lipid binding (GO:0008289)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	15		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00522)	Bezafibrate(DB01393)|Clofibrate(DB00636)|Fenofibrate(DB01039)|Gemfibrozil(DB01241)|Indomethacin(DB00328)	CGGAGTCCACGCGTGTGAAGG	0.547																																					p.A118S		.											.	PPARA	611	0			c.G352T						.						76.0	64.0	68.0					22																	46611213		2203	4300	6503	SO:0001583	missense	5465	exon4			GTCCACGCGTGTG	L02932	CCDS33669.1	22q12-q13.1	2013-01-16	2006-10-17		ENSG00000186951	ENSG00000186951		"""Nuclear hormone receptors"""	9232	protein-coding gene	gene with protein product		170998	"""peroxisome proliferative activated receptor, alpha"""	PPAR		7684926, 10591208	Standard	XM_005261655		Approved	hPPAR, NR1C1	uc003bgx.1	Q07869	OTTHUMG00000150443	ENST00000396000.2:c.352G>T	22.37:g.46611213G>T	ENSP00000379322:p.Ala118Ser	119.0	0.0		80.0	27.0	NM_001001928	B0G0X3|Q16241|Q6I9S0|Q92486|Q92689|Q9Y3N1	Missense_Mutation	SNP	ENST00000396000.2	37	CCDS33669.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.305739	0.81247	.	.	ENSG00000186951	ENST00000396000;ENST00000262735;ENST00000420804;ENST00000407236;ENST00000402126;ENST00000434345	D;D;D;D;D;D	0.97089	-4.24;-4.24;-4.24;-4.24;-4.24;-4.24	5.15	5.15	0.70609	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (6);	0.000000	0.85682	D	0.000000	D	0.95589	0.8566	N	0.04820	-0.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93943	0.7225	10	0.15952	T	0.53	.	17.9572	0.89073	0.0:0.0:1.0:0.0	.	118;118	F1D8S4;Q07869	.;PPARA_HUMAN	S	118	ENSP00000379322:A118S;ENSP00000262735:A118S;ENSP00000414752:A118S;ENSP00000385523:A118S;ENSP00000385246:A118S;ENSP00000408149:A118S	ENSP00000262735:A118S	A	+	1	0	PPARA	44989877	1.000000	0.71417	0.141000	0.22245	0.909000	0.53808	9.522000	0.98032	2.546000	0.85860	0.591000	0.81541	GCG	.		0.547	PPARA-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318129.3	NM_001001928	
PTK2	5747	ucsc.edu;bcgsc.ca	37	8	141774380	141774380	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr8:141774380T>C	ENST00000522684.1	-	15	1416	c.1187A>G	c.(1186-1188)gAt>gGt	p.D396G	PTK2_ENST00000520151.1_Missense_Mutation_p.D24G|PTK2_ENST00000519465.1_Missense_Mutation_p.D24G|PTK2_ENST00000521059.1_Missense_Mutation_p.D396G|PTK2_ENST00000395218.2_Missense_Mutation_p.D396G|PTK2_ENST00000538769.1_Missense_Mutation_p.D57G|PTK2_ENST00000340930.3_Missense_Mutation_p.D396G|PTK2_ENST00000535192.1_Missense_Mutation_p.D396G|PTK2_ENST00000517887.1_Missense_Mutation_p.D440G|PTK2_ENST00000519419.1_Missense_Mutation_p.D440G	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	396					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			CTCAGCATAATCATCTGTTTC	0.373																																					p.D418G		.											.	PTK2	1517	0			c.A1253G						.						149.0	145.0	147.0					8																	141774380		2203	4300	6503	SO:0001583	missense	5747	exon15			GCATAATCATCTG	L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.1187A>G	8.37:g.141774380T>C	ENSP00000429911:p.Asp396Gly	44.0	0.0		43.0	4.0	NM_005607	B4E2N6|F5H4S4|Q14291|Q9UD85	Missense_Mutation	SNP	ENST00000522684.1	37	CCDS6381.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.78|14.78	2.636196|2.636196	0.47049|0.47049	.|.	.|.	ENSG00000169398|ENSG00000169398	ENST00000522684;ENST00000535192;ENST00000519465;ENST00000517887;ENST00000521059;ENST00000395214;ENST00000395218;ENST00000354438;ENST00000395221;ENST00000523539;ENST00000340930;ENST00000538769;ENST00000519419;ENST00000521986;ENST00000342207;ENST00000519024|ENST00000519654	T;T;T;T;T;T;T;T;T;T;T;T|.	0.78364|.	-1.16;-1.14;-1.04;-1.17;-1.16;-1.15;-1.09;-1.15;-1.09;-1.17;-1.08;-1.09|.	5.23|5.23	5.23|5.23	0.72850|0.72850	Protein kinase-like domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.77032|.	0.4071|.	M|M	0.81802|0.81802	2.56|2.56	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D;P|.	0.89917|.	1.0;0.996;1.0;1.0;0.999;0.992;0.999;0.999;0.467|.	D;D;D;D;D;D;D;D;P|.	0.97110|.	0.995;0.989;1.0;0.992;0.998;0.977;1.0;0.98;0.691|.	T|.	0.79019|.	-0.1974|.	10|.	0.66056|.	D|.	0.02|.	.|.	15.4214|15.4214	0.75015|0.75015	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	396;91;309;396;418;396;341;57;24|.	B4E2N6;B4DH13;Q59GN8;Q05397;Q658W2;Q8IYN9;Q59GM6;Q8N9D7;E9PEI4|.	.;.;.;FAK1_HUMAN;.;.;.;.;.|.	G|W	396;396;24;440;396;340;396;309;91;61;396;57;440;94;214;24|406	ENSP00000429911:D396G;ENSP00000438009:D396G;ENSP00000429170:D24G;ENSP00000429082:D440G;ENSP00000429474:D396G;ENSP00000378644:D396G;ENSP00000428492:D61G;ENSP00000341189:D396G;ENSP00000445742:D57G;ENSP00000429129:D440G;ENSP00000430603:D94G;ENSP00000428232:D24G|.	ENSP00000341189:D396G|.	D|X	-|-	2|3	0|0	PTK2|PTK2	141843562|141843562	1.000000|1.000000	0.71417|0.71417	0.406000|0.406000	0.26421|0.26421	0.810000|0.810000	0.45777|0.45777	7.117000|7.117000	0.77129|0.77129	2.099000|2.099000	0.63709|0.63709	0.402000|0.402000	0.26972|0.26972	GAT|TGA	.		0.373	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378054.5	NM_005607	
PTPN14	5784	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	214542934	214542934	+	Missense_Mutation	SNP	G	G	T	rs61749333	byFrequency	TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr1:214542934G>T	ENST00000366956.5	-	17	3331	c.3137C>A	c.(3136-3138)aCg>aAg	p.T1046K	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	1046	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		AACAGAATCCGTTCGAAACTT	0.502																																					p.T1046K	Colon(92;557 1424 24372 34121 40073)	.											.	PTPN14	290	0			c.C3137A						.						264.0	240.0	248.0					1																	214542934		2203	4300	6503	SO:0001583	missense	5784	exon17			GAATCCGTTCGAA	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.3137C>A	1.37:g.214542934G>T	ENSP00000355923:p.Thr1046Lys	299.0	0.0		323.0	18.0	NM_005401	Q5VSI0	Missense_Mutation	SNP	ENST00000366956.5	37	CCDS1514.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.888274	0.91814	.	.	ENSG00000152104	ENST00000366956	D	0.82893	-1.66	5.51	5.51	0.81932	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	D	0.84982	0.5593	N	0.25485	0.75	0.80722	D	1	D	0.76494	0.999	D	0.70227	0.968	T	0.80350	-0.1419	10	0.13470	T	0.59	.	19.4235	0.94732	0.0:0.0:1.0:0.0	.	1046	Q15678	PTN14_HUMAN	K	1046	ENSP00000355923:T1046K	ENSP00000355923:T1046K	T	-	2	0	PTPN14	212609557	1.000000	0.71417	0.997000	0.53966	0.970000	0.65996	9.751000	0.98889	2.564000	0.86499	0.650000	0.86243	ACG	G|0.999;C|0.001		0.502	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
RNF214	257160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	117150670	117150670	+	Missense_Mutation	SNP	G	G	A	rs377377564		TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr11:117150670G>A	ENST00000531452.1	+	7	1052	c.1006G>A	c.(1006-1008)Gaa>Aaa	p.E336K	RNF214_ENST00000531287.1_Missense_Mutation_p.E181K|RNF214_ENST00000300650.4_Missense_Mutation_p.E336K|RNF214_ENST00000530849.1_Missense_Mutation_p.E181K	NM_001077239.1|NM_001278249.1	NP_001070707.1|NP_001265178.1	Q8ND24	RN214_HUMAN	ring finger protein 214	336							zinc ion binding (GO:0008270)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.88e-05)|Epithelial(105;0.000397)|all cancers(92;0.00258)		TCAGGATGGCGAAATAAATAG	0.423													G|||	1	0.000199681	0.0	0.0	5008	,	,		17895	0.0		0.0	False		,,,				2504	0.001				p.E336K		.											.	RNF214	90	0			c.G1006A						.	G	LYS/GLU,LYS/GLU	0,3784		0,0,1892	106.0	104.0	105.0		1006,1006	5.0	1.0	11		105	2,8220		0,2,4109	no	missense,missense	RNF214	NM_001077239.1,NM_207343.2	56,56	0,2,6001	AA,AG,GG		0.0243,0.0,0.0167	probably-damaging,probably-damaging	336/704,336/704	117150670	2,12004	1892	4111	6003	SO:0001583	missense	257160	exon7			GATGGCGAAATAA	AL834448	CCDS41720.1, CCDS60976.1	11q23.3	2014-02-12	2007-02-16		ENSG00000167257	ENSG00000167257		"""RING-type (C3HC4) zinc fingers"""	25335	protein-coding gene	gene with protein product							Standard	NM_001077239		Approved	DKFZp547C195	uc001pqt.4	Q8ND24	OTTHUMG00000167069	ENST00000531452.1:c.1006G>A	11.37:g.117150670G>A	ENSP00000431643:p.Glu336Lys	81.0	0.0		61.0	21.0	NM_207343	B2RUW0|B4DTD1	Missense_Mutation	SNP	ENST00000531452.1	37	CCDS41720.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.476885	0.63849	0.0	2.43E-4	ENSG00000167257	ENST00000531287;ENST00000531452;ENST00000530849;ENST00000300650	T;T;D;T	0.94758	2.57;1.17;-3.51;1.17	5.0	5.0	0.66597	.	0.172631	0.49916	D	0.000128	D	0.95993	0.8695	L	0.60455	1.87	0.47737	D	0.999509	D;D	0.89917	0.995;1.0	D;D	0.79108	0.97;0.992	D	0.93911	0.7197	10	0.13108	T	0.6	-5.6583	17.648	0.88154	0.0:0.0:1.0:0.0	.	181;336	B4DTD1;Q8ND24	.;RN214_HUMAN	K	181;336;181;336	ENSP00000435361:E181K;ENSP00000431643:E336K;ENSP00000432903:E181K;ENSP00000300650:E336K	ENSP00000300650:E336K	E	+	1	0	RNF214	116655880	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.740000	0.62087	2.476000	0.83614	0.462000	0.41574	GAA	.		0.423	RNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392884.1	NM_001077239	
RPS6KA3	6197	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	20227476	20227476	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chrX:20227476T>A	ENST00000379565.3	-	3	380	c.173A>T	c.(172-174)gAa>gTa	p.E58V	RPS6KA3_ENST00000540702.1_Missense_Mutation_p.E30V|RPS6KA3_ENST00000544447.1_Missense_Mutation_p.E30V|RPS6KA3_ENST00000379548.4_Missense_Mutation_p.E29V	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	58					axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	TTCATGTCCTTCCTTTACATG	0.393																																					p.E58V		.											.	RPS6KA3	1504	0			c.A173T						.						217.0	165.0	183.0					X																	20227476		2203	4300	6503	SO:0001583	missense	6197	exon3			TGTCCTTCCTTTA	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.173A>T	X.37:g.20227476T>A	ENSP00000368884:p.Glu58Val	177.0	0.0		102.0	33.0	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	ENST00000379565.3	37	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	T	17.15	3.316031	0.60524	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702;ENST00000457145;ENST00000438357	T;T;T;T;T;T	0.73152	-0.61;-0.58;-0.59;-0.58;-0.72;3.2	4.83	4.83	0.62350	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.81297	0.4793	M	0.67397	2.05	0.80722	D	1	B;B;D;B	0.62365	0.03;0.029;0.991;0.0	B;B;D;B	0.72982	0.016;0.036;0.979;0.002	T	0.82426	-0.0463	10	0.54805	T	0.06	.	12.7122	0.57096	0.0:0.0:0.0:1.0	.	30;29;30;58	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	V	58;30;29;30;29;30	ENSP00000368884:E58V;ENSP00000440220:E30V;ENSP00000368865:E29V;ENSP00000444837:E30V;ENSP00000407655:E29V;ENSP00000388512:E30V	ENSP00000368865:E29V	E	-	2	0	RPS6KA3	20137397	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.775000	0.85489	1.708000	0.51301	0.417000	0.27973	GAA	.		0.393	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
SAMD5	389432	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	147830139	147830139	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr6:147830139C>A	ENST00000367474.1	+	1	77	c.75C>A	c.(73-75)aaC>aaA	p.N25K		NM_001030060.2	NP_001025231.1	Q5TGI4	SAMD5_HUMAN	sterile alpha motif domain containing 5	25	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.												Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;9.55e-10)|GBM - Glioblastoma multiforme(68;0.112)		TCGTGGATAACGGCTACGATG	0.657																																					p.N25K		.											.	SAMD5	68	0			c.C75A						.						54.0	50.0	52.0					6																	147830139		2203	4300	6503	SO:0001583	missense	389432	exon1			GGATAACGGCTAC	AL354880	CCDS34548.1	6q24.3	2013-01-10			ENSG00000203727	ENSG00000203727		"""Sterile alpha motif (SAM) domain containing"""	21180	protein-coding gene	gene with protein product							Standard	NM_001030060		Approved	dJ875H10.1	uc003qmc.2	Q5TGI4	OTTHUMG00000015767	ENST00000367474.1:c.75C>A	6.37:g.147830139C>A	ENSP00000356444:p.Asn25Lys	223.0	0.0		211.0	63.0	NM_001030060		Missense_Mutation	SNP	ENST00000367474.1	37	CCDS34548.1	.	.	.	.	.	.	.	.	.	.	C	18.95	3.731009	0.69074	.	.	ENSG00000203727	ENST00000367474	T	0.45276	0.9	4.1	1.78	0.24846	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.56934	0.2019	M	0.91612	3.225	0.37125	D	0.901002	D	0.89917	1.0	D	0.91635	0.999	T	0.62562	-0.6828	10	0.66056	D	0.02	-10.4178	7.6911	0.28569	0.0:0.6513:0.0:0.3487	.	25	Q5TGI4	SAMD5_HUMAN	K	25	ENSP00000356444:N25K	ENSP00000356444:N25K	N	+	3	2	SAMD5	147871832	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	0.518000	0.22847	0.663000	0.31027	0.460000	0.39030	AAC	.		0.657	SAMD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042610.1	NM_001030060	
STEAP3	55240	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	120012401	120012401	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr2:120012401delT	ENST00000354888.5	+	5	1666	c.1162delT	c.(1162-1164)tggfs	p.W388fs	STEAP3_ENST00000393110.2_Frame_Shift_Del_p.W398fs|STEAP3_ENST00000450943.2_Frame_Shift_Del_p.W388fs|STEAP3_ENST00000393108.2_Frame_Shift_Del_p.W388fs|STEAP3_ENST00000393107.2_Frame_Shift_Del_p.W388fs|STEAP3_ENST00000393106.2_Frame_Shift_Del_p.W388fs|STEAP3_ENST00000425223.2_Frame_Shift_Del_p.W388fs|STEAP3_ENST00000409811.1_Frame_Shift_Del_p.W388fs	NM_182915.2	NP_878919.2	Q658P3	STEA3_HUMAN	STEAP family member 3, metalloreductase	388	Ferric oxidoreductase.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cellular iron ion homeostasis (GO:0006879)|copper ion import (GO:0015677)|exosomal secretion (GO:1990182)|ferric iron import into cell (GO:0097461)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|protein secretion (GO:0009306)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	17						CTCGCTCAACTGGAGGGAGTT	0.592																																					p.W398fs		.											.	STEAP3	91	0			c.1192delT						.						92.0	79.0	84.0					2																	120012401		2203	4300	6503	SO:0001589	frameshift_variant	55240	exon5			CTCAACTGGAGGG	AY029585	CCDS2125.1, CCDS42738.1	2q14.2	2011-09-30	2011-09-30		ENSG00000115107	ENSG00000115107			24592	protein-coding gene	gene with protein product		609671				12606722	Standard	NM_182915		Approved	TSAP6, dudlin-2, STMP3	uc002tlr.3	Q658P3	OTTHUMG00000131402	ENST00000354888.5:c.1162delT	2.37:g.120012401delT	ENSP00000346961:p.Trp388fs	170.0	0.0		104.0	39.0	NM_182915	A8K6E3|Q4VBR2|Q4ZG36|Q53SQ8|Q7Z389|Q86SF6|Q8NEW6|Q8TDP3|Q8TF03|Q9NVB5	Frame_Shift_Del	DEL	ENST00000354888.5	37	CCDS2125.1																																																																																			.		0.592	STEAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254193.1	NM_018234	
THSD7A	221981	broad.mit.edu;bcgsc.ca	37	7	11486897	11486897	+	Silent	SNP	T	T	C			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr7:11486897T>C	ENST00000423059.4	-	12	3011	c.2760A>G	c.(2758-2760)ggA>ggG	p.G920G	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	920	TSP type-1 9. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		CACCACAGTCTCCATTGCATG	0.498										HNSCC(18;0.044)																											p.G920G		.											.	THSD7A	71	0			c.A2760G						.						83.0	77.0	79.0					7																	11486897		1950	4157	6107	SO:0001819	synonymous_variant	221981	exon12			ACAGTCTCCATTG		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.2760A>G	7.37:g.11486897T>C		146.0	0.0		106.0	6.0	NM_015204		Silent	SNP	ENST00000423059.4	37	CCDS47543.1																																																																																			.		0.498	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
TMEM95	339168	broad.mit.edu;bcgsc.ca	37	17	7259754	7259754	+	Silent	SNP	C	C	T			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr17:7259754C>T	ENST00000576060.1	+	6	480	c.453C>T	c.(451-453)atC>atT	p.I151I	TMEM95_ENST00000330767.4_Silent_p.I159I|RP11-542C16.1_ENST00000572417.1_RNA|TMEM95_ENST00000389982.4_Missense_Mutation_p.L149F			Q3KNT9	TMM95_HUMAN	transmembrane protein 95	151						integral component of membrane (GO:0016021)				large_intestine(1)|lung(2)	3		Prostate(122;0.173)				TCCTCTCCATCTTCGGAGCTT	0.562											OREG0024137	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I159I		.											.	TMEM95	90	0			c.C477T						.						208.0	208.0	208.0					17																	7259754		2203	4300	6503	SO:0001819	synonymous_variant	339168	exon6			CTCCATCTTCGGA		CCDS32546.1	17p13.1	2005-12-15			ENSG00000182896	ENSG00000182896			27898	protein-coding gene	gene with protein product						12975309	Standard	NM_198154		Approved	MGC129793, UNQ9390	uc002ggf.1	Q3KNT9	OTTHUMG00000132899	ENST00000576060.1:c.453C>T	17.37:g.7259754C>T		139.0	0.0	640	95.0	5.0	NM_198154	B7WPI7|Q6UXT3|Q8IW68	Silent	SNP	ENST00000576060.1	37		.	.	.	.	.	.	.	.	.	.	C	15.01	2.706243	0.48412	.	.	ENSG00000182896	ENST00000389982	.	.	.	5.34	2.16	0.27623	.	0.311323	0.17891	N	0.158523	T	0.47488	0.1448	.	.	.	0.40921	D	0.984315	B	0.29646	0.253	B	0.29663	0.105	T	0.49103	-0.8974	8	0.87932	D	0	.	7.9918	0.30246	0.0:0.6139:0.3008:0.0853	.	149	Q3KNT9-3	.	F	149	.	ENSP00000374632:L149F	L	+	1	0	TMEM95	7200478	0.917000	0.31117	0.323000	0.25347	0.382000	0.30200	0.374000	0.20501	0.607000	0.29982	0.561000	0.74099	CTT	.		0.562	TMEM95-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440555.2	NM_198154	
TTC28	23331	ucsc.edu;bcgsc.ca	37	22	28379795	28379795	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr22:28379795A>G	ENST00000397906.2	-	23	6001	c.5860T>C	c.(5860-5862)Tcc>Ccc	p.S1954P	TTC28-AS1_ENST00000434221.1_RNA|TTC28-AS1_ENST00000424161.1_RNA|TTC28-AS1_ENST00000435348.1_RNA|TTC28-AS1_ENST00000452612.1_RNA|TTC28-AS1_ENST00000430853.1_RNA|TTC28-AS1_ENST00000454741.1_RNA|TTC28-AS1_ENST00000417497.1_RNA|TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000419253.1_RNA|TTC28-AS1_ENST00000425112.1_RNA|TTC28-AS1_ENST00000430525.1_RNA|TTC28-AS1_ENST00000454996.1_RNA	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	1954	Ser-rich.				mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						GACTCGAGGGAGGAGGAGCTG	0.542																																					p.S1954P		.											.	.	.	0			c.T5860C						.						52.0	59.0	57.0					22																	28379795		692	1591	2283	SO:0001583	missense	23331	exon23			CGAGGGAGGAGGA	AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.5860T>C	22.37:g.28379795A>G	ENSP00000381003:p.Ser1954Pro	40.0	0.0		43.0	4.0	NM_001145418	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	ENST00000397906.2	37	CCDS46678.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.653130	0.88056	.	.	ENSG00000100154	ENST00000397906;ENST00000431039	D	0.93019	-3.15	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	D	0.94105	0.8110	L	0.47190	1.495	0.80722	D	1	D	0.71674	0.998	P	0.59115	0.852	D	0.94689	0.7872	10	0.87932	D	0	-19.224	13.8164	0.63295	1.0:0.0:0.0:0.0	.	1954	Q96AY4	TTC28_HUMAN	P	1954;233	ENSP00000381003:S1954P	ENSP00000381003:S1954P	S	-	1	0	TTC28	26709795	1.000000	0.71417	0.995000	0.50966	0.953000	0.61014	9.049000	0.93837	1.929000	0.55896	0.533000	0.62120	TCC	.		0.542	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000320930.2	XM_929318	
WDR45B	56270	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	80576976	80576976	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr17:80576976G>C	ENST00000392325.4	-	7	841	c.647C>G	c.(646-648)tCa>tGa	p.S216*	WDR45B_ENST00000571835.1_5'UTR	NM_019613.3	NP_062559.2	Q5MNZ6	WIPI3_HUMAN	WD repeat domain 45B	216																	ATGCCCTGATGAAGTATCAAA	0.393																																					p.S216X		.											.	.	.	0			c.C647G						.						87.0	82.0	83.0					17																	80576976		2203	4300	6503	SO:0001587	stop_gained	56270	exon7			CCTGATGAAGTAT	AF091083	CCDS11815.2	17q25.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000141580	ENSG00000141580		"""WD repeat domain containing"""	25072	protein-coding gene	gene with protein product		609226	"""WDR45-like"""	WDR45L		12477932	Standard	NM_019613		Approved	WIPI3	uc002kfq.3	Q5MNZ6	OTTHUMG00000150146	ENST00000392325.4:c.647C>G	17.37:g.80576976G>C	ENSP00000376139:p.Ser216*	113.0	0.0		76.0	17.0	NM_019613	O95328|Q2MCP6|Q6IBN2	Nonsense_Mutation	SNP	ENST00000392325.4	37	CCDS11815.2	.	.	.	.	.	.	.	.	.	.	G	39	7.360346	0.98235	.	.	ENSG00000141580	ENST00000392325;ENST00000539012	.	.	.	5.38	5.38	0.77491	.	0.121344	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-12.7597	19.4833	0.95018	0.0:0.0:1.0:0.0	.	.	.	.	X	216;188	.	ENSP00000376139:S216X	S	-	2	0	WDR45L	78170265	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.392000	0.79840	2.684000	0.91462	0.591000	0.81541	TCA	.		0.393	WDR45B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316536.1	NM_019613	
WFDC5	149708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	20	43743715	43743715	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr20:43743715G>A	ENST00000307971.4	-	1	88	c.10C>T	c.(10-12)Cag>Tag	p.Q4*	WFDC5_ENST00000372789.4_Nonsense_Mutation_p.Q4*			Q8TCV5	WFDC5_HUMAN	WAP four-disulfide core domain 5	4						extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)				AGAAGGCTCTGGGTCCTCATA	0.607																																					p.Q4X	NSCLC(199;98 2227 9943 13455 41914)	.											.	WFDC5	91	0			c.C10T						.						39.0	46.0	43.0					20																	43743715		2203	4300	6503	SO:0001587	stop_gained	149708	exon1			GGCTCTGGGTCCT	AY038181	CCDS33475.1	20q13.11	2013-01-21			ENSG00000175121	ENSG00000175121		"""WAP four-disulfide core domain containing"""	20477	protein-coding gene	gene with protein product		605161				12206714, 10680116	Standard	NM_145652		Approved	WAP1, dJ211D12.5	uc002xne.2	Q8TCV5	OTTHUMG00000046411	ENST00000307971.4:c.10C>T	20.37:g.43743715G>A	ENSP00000312381:p.Gln4*	42.0	0.0		36.0	7.0	NM_145652	Q5H981|Q6UWE4	Nonsense_Mutation	SNP	ENST00000307971.4	37		.	.	.	.	.	.	.	.	.	.	G	13.37	2.217248	0.39201	.	.	ENSG00000175121	ENST00000372789;ENST00000307971	.	.	.	5.61	-3.78	0.04333	.	2.576260	0.01580	N	0.021050	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-0.2248	2.0509	0.03571	0.412:0.1162:0.3427:0.1291	.	.	.	.	X	4	.	ENSP00000312381:Q4X	Q	-	1	0	WFDC5	43177129	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.339000	0.07832	-1.088000	0.03077	-0.282000	0.10007	CAG	.		0.607	WFDC5-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000107192.1		
YWHAE	7531	broad.mit.edu;bcgsc.ca	37	17	1265253	1265253	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr17:1265253T>C	ENST00000264335.8	-	3	581	c.314A>G	c.(313-315)gAc>gGc	p.D105G	YWHAE_ENST00000573026.1_Intron|YWHAE_ENST00000571732.1_Missense_Mutation_p.D83G|YWHAE_ENST00000575977.1_Intron	NM_006761.4	NP_006752.1	P62258	1433E_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon	105					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cerebral cortex development (GO:0021987)|G2/M transition of mitotic cell cycle (GO:0000086)|hippo signaling (GO:0035329)|hippocampus development (GO:0021766)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|mitotic cell cycle (GO:0000278)|negative regulation of peptidyl-serine dephosphorylation (GO:1902309)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|substantia nigra development (GO:0021762)|viral process (GO:0016032)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|membrane (GO:0016020)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|ion channel binding (GO:0044325)|MHC class II protein complex binding (GO:0023026)|phosphoprotein binding (GO:0051219)|phosphoserine binding (GO:0050815)|poly(A) RNA binding (GO:0044822)|potassium channel regulator activity (GO:0015459)|protein heterodimerization activity (GO:0046982)			kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(18;0.203)	UCEC - Uterine corpus endometrioid carcinoma (25;0.0887)		GAGGTGTTTGTCCAGTACATC	0.328			T	"""FAM22a, FAM22B"""	edometrial stromal sarcoma		Miller-Dieker lissencephaly syndrome																														p.D105G		.		Dom	yes		17	17p13.3	7531	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide (14-3-3 epsilon)"""	yes	M	.	YWHAE	659	0			c.A314G						.						34.0	33.0	33.0					17																	1265253		2203	4298	6501	SO:0001583	missense	7531	exon3			TGTTTGTCCAGTA	U54778	CCDS11001.1	17p13.3	2013-12-03	2013-12-03		ENSG00000108953	ENSG00000108953			12851	protein-coding gene	gene with protein product	"""14-3-3 epsilon"""	605066	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide"""			9371399	Standard	NM_006761		Approved	FLJ45465	uc002fsj.3	P62258	OTTHUMG00000134316	ENST00000264335.8:c.314A>G	17.37:g.1265253T>C	ENSP00000264335:p.Asp105Gly	95.0	0.0		78.0	6.0	NM_006761	B3KY71|D3DTH5|P29360|P42655|Q4VJB6|Q53XZ5|Q63631|Q7M4R4	Missense_Mutation	SNP	ENST00000264335.8	37	CCDS11001.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.643071	0.87859	.	.	ENSG00000108953	ENST00000264335;ENST00000414131	T	0.52983	0.64	5.18	5.18	0.71444	14-3-3 domain (4);	0.059350	0.64402	U	0.000004	T	0.71651	0.3365	M	0.93462	3.42	0.80722	D	1	P	0.45672	0.864	P	0.55667	0.781	T	0.79361	-0.1835	10	0.87932	D	0	-2.9742	13.0625	0.59015	0.0:0.0:0.0:1.0	.	105	P62258	1433E_HUMAN	G	105;83	ENSP00000264335:D105G	ENSP00000264335:D105G	D	-	2	0	YWHAE	1212003	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	1.961000	0.56991	0.456000	0.33151	GAC	.		0.328	YWHAE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259354.3	NM_006761	
ZNF583	147949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	56934521	56934521	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr19:56934521T>G	ENST00000333201.9	+	5	704	c.494T>G	c.(493-495)tTc>tGc	p.F165C	ZNF583_ENST00000585612.1_3'UTR|ZNF583_ENST00000291598.7_Missense_Mutation_p.F165C	NM_001159861.1|NM_152478.2	NP_001153333.1|NP_689691.2	Q96ND8	ZN583_HUMAN	zinc finger protein 583	165					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		TGGCAAACATTCCACCAGGAT	0.333																																					p.F165C		.											.	ZNF583	91	0			c.T494G						.						74.0	81.0	78.0					19																	56934521		2202	4300	6502	SO:0001583	missense	147949	exon5			AAACATTCCACCA	AK055592	CCDS12943.1	19q13.43	2013-09-20			ENSG00000198440	ENSG00000198440		"""Zinc fingers, C2H2-type"", ""-"""	26427	protein-coding gene	gene with protein product							Standard	NM_152478		Approved	FLJ31030	uc010ygl.1	Q96ND8	OTTHUMG00000168874	ENST00000333201.9:c.494T>G	19.37:g.56934521T>G	ENSP00000388502:p.Phe165Cys	39.0	0.0		42.0	17.0	NM_001159861	O14850|Q2NKK3	Missense_Mutation	SNP	ENST00000333201.9	37	CCDS12943.1	.	.	.	.	.	.	.	.	.	.	T	12.92	2.083349	0.36758	.	.	ENSG00000198440	ENST00000291598;ENST00000333201	T;T	0.13778	2.56;2.56	4.43	2.26	0.28386	.	0.680740	0.12861	N	0.433120	T	0.31888	0.0811	M	0.82716	2.605	0.09310	N	1	D	0.69078	0.997	P	0.60345	0.873	T	0.07309	-1.0779	9	.	.	.	.	6.6063	0.22727	0.0:0.0895:0.1588:0.7517	.	165	Q96ND8	ZN583_HUMAN	C	165	ENSP00000291598:F165C;ENSP00000388502:F165C	.	F	+	2	0	ZNF583	61626333	0.032000	0.19561	0.002000	0.10522	0.024000	0.10985	1.826000	0.39092	0.804000	0.34136	0.379000	0.24179	TTC	.		0.333	ZNF583-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401453.1	NM_152478	
FAM186A	121006	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	50746361	50746362	+	Missense_Mutation	DNP	TT	TT	GG	rs567893686|rs71459098	byFrequency	TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	TT	TT	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr12:50746361_50746362TT>GG	ENST00000327337.5	-	4	4252_4253	c.4253_4254AA>CC	c.(4252-4254)gAA>gCC	p.E1418A	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_Missense_Mutation_p.E1418A	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1418																	GGATCCCCAATTCCTGAGCCTG	0.639																																					p.E1418A	NSCLC(138;1796 1887 12511 19463 37884)	.											.	.	.	0			.						.																																			SO:0001583	missense	121006	.			CCCCAATTCCTGA		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4253_4254delinsGG	12.37:g.50746361_50746362delinsGG	ENSP00000329995:p.Glu1418Ala	230.0	2.0		168.0	65.0	.		Missense_Mutation	DNP	ENST00000327337.5	37	CCDS44878.1																																																																																			.		0.639	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
ADAM28	10863	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	24170902	24170903	+	Splice_Site	DNP	GG	GG	TT			TCGA-DD-A39W-01A-11D-A20W-10	TCGA-DD-A39W-11A-11D-A20W-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	394130eb-5ab8-4437-8d73-d17f4db7ac24	a7177a22-2989-4bc0-a618-67ca2b279962	g.chr8:24170902_24170903GG>TT	ENST00000265769.4	+	6	495_496	c.385_386GG>TT	c.(385-387)GGc>TTc	p.G129F	RP11-624C23.1_ENST00000523578.1_RNA|ADAM28_ENST00000540823.1_Intron|ADAM28_ENST00000397649.3_5'UTR|RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000523700.1_RNA|ADAM28_ENST00000437154.2_Splice_Site_p.G129F|RP11-624C23.1_ENST00000518988.1_RNA	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	129					spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		TTTTTTCAGGGGCTACTTCAGT	0.391																																					p.G129F	NSCLC(193;488 2149 22258 34798 40734)	.											.	.	.	0			.						.																																			SO:0001630	splice_region_variant	10863	.			TTCAGGGGCTACT	AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	Exception_encountered	8.37:g.24170902_24170903delinsTT		153.0	0.0		123.0	10.0	.	B2RMV5|Q9Y339|Q9Y3S0	Missense_Mutation	DNP	ENST00000265769.4	37	CCDS34865.1																																																																																			.		0.391	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375441.2	NM_021778	Missense_Mutation
