#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADAM12	8038	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	127760154	127760154	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr10:127760154C>T	ENST00000368679.4	-	12	1533	c.1224G>A	c.(1222-1224)atG>atA	p.M408I	ADAM12_ENST00000368676.4_Missense_Mutation_p.M408I|ADAM12_ENST00000467145.1_5'Flank	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	408	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		GGCACACCCCCATTCCTTTCT	0.542																																					p.M408I		.											.	ADAM12	716	0			c.G1224A						.						80.0	78.0	79.0					10																	127760154		2203	4300	6503	SO:0001583	missense	8038	exon12			CACCCCCATTCCT	AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.1224G>A	10.37:g.127760154C>T	ENSP00000357668:p.Met408Ile	180.0	1.0		176.0	88.0	NM_021641	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	ENST00000368679.4	37	CCDS7653.1	.	.	.	.	.	.	.	.	.	.	C	15.23	2.772765	0.49680	.	.	ENSG00000148848	ENST00000368679;ENST00000368676	T;T	0.62788	-0.0;-0.0	5.13	5.13	0.70059	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.064498	0.64402	D	0.000008	T	0.55257	0.1909	L	0.27053	0.805	0.50039	D	0.999848	B;B;B;B;B	0.28178	0.202;0.168;0.168;0.168;0.12	B;B;B;B;B	0.32980	0.156;0.097;0.097;0.097;0.053	T	0.54899	-0.8224	10	0.48119	T	0.1	.	18.7902	0.91971	0.0:1.0:0.0:0.0	.	405;405;408;405;408	A8K6G4;O43184-3;O43184-2;O43184-4;O43184	.;.;.;.;ADA12_HUMAN	I	408	ENSP00000357668:M408I;ENSP00000357665:M408I	ENSP00000357665:M408I	M	-	3	0	ADAM12	127750144	1.000000	0.71417	0.997000	0.53966	0.915000	0.54546	4.512000	0.60469	2.665000	0.90641	0.563000	0.77884	ATG	.		0.542	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1		
ADAM29	11086	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	175896738	175896738	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr4:175896738A>C	ENST00000359240.3	+	5	732	c.62A>C	c.(61-63)cAg>cCg	p.Q21P	ADAM29_ENST00000514159.1_Missense_Mutation_p.Q21P|ADAM29_ENST00000404450.4_Missense_Mutation_p.Q21P|ADAM29_ENST00000445694.1_Missense_Mutation_p.Q21P|RP13-577H12.2_ENST00000507525.1_RNA	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	21					spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		GGACACATCCAGGATGAGCAC	0.507																																					p.Q21P	Ovarian(140;1727 1835 21805 25838 41440)	.											.	ADAM29	729	0			c.A62C						.						104.0	104.0	104.0					4																	175896738		2203	4300	6503	SO:0001583	missense	11086	exon4			ACATCCAGGATGA	AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.62A>C	4.37:g.175896738A>C	ENSP00000352177:p.Gln21Pro	138.0	0.0		142.0	55.0	NM_001130703	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	ENST00000359240.3	37	CCDS3823.1	.	.	.	.	.	.	.	.	.	.	A	5.858	0.342574	0.11069	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000502940;ENST00000502305;ENST00000404450;ENST00000514159	T;T;T;T;T;T	0.55052	4.54;4.54;0.86;0.54;4.54;4.54	4.36	-1.37	0.09056	.	.	.	.	.	T	0.38506	0.1043	L	0.50333	1.59	0.09310	N	1	B	0.28026	0.198	B	0.22601	0.04	T	0.20739	-1.0266	8	.	.	.	.	4.9876	0.14198	0.7315:0.0:0.1179:0.1506	.	21	Q9UKF5	ADA29_HUMAN	P	21	ENSP00000352177:Q21P;ENSP00000414544:Q21P;ENSP00000427674:Q21P;ENSP00000422537:Q21P;ENSP00000384229:Q21P;ENSP00000423517:Q21P	.	Q	+	2	0	ADAM29	176133313	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	0.137000	0.15995	-0.285000	0.09089	0.519000	0.50382	CAG	.		0.507	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
ALG1	56052	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	5127503	5127503	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr16:5127503G>A	ENST00000262374.5	+	5	628	c.597G>A	c.(595-597)atG>atA	p.M199I	ALG1_ENST00000588623.1_Missense_Mutation_p.M88I|ALG1_ENST00000544428.1_Missense_Mutation_p.M88I	NM_019109.4	NP_061982.3	Q9BT22	ALG1_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase	199					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipopolysaccharide biosynthetic process (GO:0009103)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitobiosyldiphosphodolichol beta-mannosyltransferase activity (GO:0004578)|mannosyltransferase activity (GO:0000030)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(90;0.0164)				CCAATGCTATGCGAGAAGACC	0.587																																					p.M199I		.											.	ALG1	92	0			c.G597A						.						111.0	102.0	105.0					16																	5127503		2197	4300	6497	SO:0001583	missense	56052	exon5			TGCTATGCGAGAA	AB019038	CCDS10528.1	16p13.3	2013-02-22	2013-02-22		ENSG00000033011	ENSG00000033011	2.4.1.142	"""Glycosyltransferase group 1 domain containing"""	18294	protein-coding gene	gene with protein product		605907	"""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase)"", ""asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)"""			10704531	Standard	NM_019109		Approved	HMT-1, HMAT1	uc002cym.3	Q9BT22	OTTHUMG00000129529	ENST00000262374.5:c.597G>A	16.37:g.5127503G>A	ENSP00000262374:p.Met199Ile	104.0	0.0		99.0	35.0	NM_019109	B4DP08|Q6UVZ9|Q8N5Y4|Q9P2Y2	Missense_Mutation	SNP	ENST00000262374.5	37	CCDS10528.1	.	.	.	.	.	.	.	.	.	.	G	18.04	3.534990	0.64972	.	.	ENSG00000033011	ENST00000262374;ENST00000544428	D;D	0.83992	-1.79;-1.79	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.93716	0.7992	H	0.95114	3.625	0.80722	D	1	D;D	0.89917	0.996;1.0	P;D	0.87578	0.905;0.998	D	0.94924	0.8076	10	0.72032	D	0.01	-39.8765	15.5247	0.75894	0.0:0.0:1.0:0.0	.	88;199	B4DP08;Q9BT22	.;ALG1_HUMAN	I	199;88	ENSP00000262374:M199I;ENSP00000440019:M88I	ENSP00000262374:M199I	M	+	3	0	ALG1	5067504	1.000000	0.71417	0.998000	0.56505	0.036000	0.12997	7.942000	0.87708	2.750000	0.94351	0.561000	0.74099	ATG	.		0.587	ALG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251716.2	NM_019109	
ASB6	140459	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	132400301	132400301	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr9:132400301T>G	ENST00000277458.4	-	6	1199	c.1034A>C	c.(1033-1035)aAc>aCc	p.N345T	ASB6_ENST00000277459.4_3'UTR|ASB6_ENST00000450050.2_Missense_Mutation_p.N266T|RP11-483H20.4_ENST00000455074.1_RNA	NM_017873.3	NP_060343.1	Q9NWX5	ASB6_HUMAN	ankyrin repeat and SOCS box containing 6	345					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				NS(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	15		Ovarian(14;0.00556)				GATATCGAAGTTTTCGGGCAG	0.597																																					p.N345T		.											.	ASB6	226	0			c.A1034C						.						83.0	79.0	80.0					9																	132400301		2203	4300	6503	SO:0001583	missense	140459	exon6			TCGAAGTTTTCGG		CCDS6924.1, CCDS6925.1, CCDS75919.1	9q34.13	2013-01-10	2011-01-25		ENSG00000148331	ENSG00000148331		"""Ankyrin repeat domain containing"""	17181	protein-coding gene	gene with protein product		615051	"""ankyrin repeat and SOCS box-containing 6"""				Standard	NM_017873		Approved		uc004byf.2	Q9NWX5	OTTHUMG00000020787	ENST00000277458.4:c.1034A>C	9.37:g.132400301T>G	ENSP00000277458:p.Asn345Thr	53.0	0.0		67.0	31.0	NM_017873	Q5SZB7|Q9BV15	Missense_Mutation	SNP	ENST00000277458.4	37	CCDS6924.1	.	.	.	.	.	.	.	.	.	.	T	12.97	2.098473	0.37048	.	.	ENSG00000148331	ENST00000277458;ENST00000450050	T;T	0.70631	-0.5;0.78	5.06	2.73	0.32206	.	0.350115	0.34362	N	0.004026	T	0.52645	0.1747	N	0.24115	0.695	0.38297	D	0.942871	B;B;B	0.26002	0.005;0.139;0.139	B;B;B	0.22386	0.01;0.039;0.027	T	0.48317	-0.9046	10	0.42905	T	0.14	-41.8137	8.6356	0.33945	0.0:0.157:0.0:0.843	.	266;345;345	B4DRC4;A8K9U2;Q9NWX5	.;.;ASB6_HUMAN	T	345;266	ENSP00000277458:N345T;ENSP00000416172:N266T	ENSP00000277458:N345T	N	-	2	0	ASB6	131440122	1.000000	0.71417	0.840000	0.33206	0.782000	0.44232	2.791000	0.47829	0.411000	0.25702	0.379000	0.24179	AAC	.		0.597	ASB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054594.1	NM_017873	
ATXN7	6314	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	63982027	63982027	+	Silent	SNP	G	G	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr3:63982027G>A	ENST00000295900.6	+	12	3079	c.2529G>A	c.(2527-2529)tcG>tcA	p.S843S	ATXN7_ENST00000538065.1_Silent_p.S843S|ATXN7_ENST00000487717.1_Silent_p.S843S|ATXN7_ENST00000398590.3_Silent_p.S843S|ATXN7_ENST00000484332.1_Silent_p.S698S	NM_000333.3	NP_000324.1	O15265	ATX7_HUMAN	ataxin 7	843	Poly-Ser.|Ser-rich.				cell death (GO:0008219)|chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|nucleus organization (GO:0006997)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|stomach(1)|urinary_tract(3)	35		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		CACCCAGCTCGAGCAGCATCA	0.512																																					p.S843S		.											.	ATXN7	90	0			c.G2529A						.						77.0	83.0	81.0					3																	63982027		2115	4250	6365	SO:0001819	synonymous_variant	6314	exon12			CAGCTCGAGCAGC	AJ000517	CCDS43102.1, CCDS46861.1, CCDS46861.2, CCDS54603.1	3p21.1-p12	2014-09-17	2004-08-12	2004-08-12	ENSG00000163635	ENSG00000163635		"""Ataxins"""	10560	protein-coding gene	gene with protein product		607640	"""spinocerebellar ataxia 7 (olivopontocerebellar atrophy with retinal degeneration)"""	SCA7		7647798, 10598805	Standard	NM_000333		Approved	OPCA3, ADCAII	uc021wzy.1	O15265	OTTHUMG00000158763	ENST00000295900.6:c.2529G>A	3.37:g.63982027G>A		262.0	0.0		235.0	11.0	NM_000333	B4E207|E9PHP9|O75328|O75329|Q9Y6P8	Silent	SNP	ENST00000295900.6	37	CCDS43102.1																																																																																			.		0.512	ATXN7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352070.1	NM_000333	
BAZ1A	11177	broad.mit.edu;bcgsc.ca	37	14	35231375	35231375	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr14:35231375T>G	ENST00000382422.2	-	23	4158	c.3831A>C	c.(3829-3831)aaA>aaC	p.K1277N	BAZ1A_ENST00000358716.4_Missense_Mutation_p.K1245N|BAZ1A_ENST00000360310.1_Missense_Mutation_p.K1277N			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	1277					chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		AAGAGCTAAGTTTCCCTCTTG	0.398																																					p.K1277N		.											.	BAZ1A	291	0			c.A3831C						.						161.0	142.0	148.0					14																	35231375		2203	4300	6503	SO:0001583	missense	11177	exon24			GCTAAGTTTCCCT	AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.3831A>C	14.37:g.35231375T>G	ENSP00000371859:p.Lys1277Asn	181.0	1.0		211.0	11.0	NM_013448	Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Missense_Mutation	SNP	ENST00000382422.2	37	CCDS9651.1	.	.	.	.	.	.	.	.	.	.	.	13.15	2.150754	0.37923	.	.	ENSG00000198604	ENST00000358716;ENST00000382422;ENST00000360310;ENST00000543083	T;T;T	0.50548	0.74;0.74;0.74	5.92	5.92	0.95590	.	0.358348	0.30723	N	0.009011	T	0.31670	0.0804	N	0.19112	0.55	0.29027	N	0.885915	B;B	0.24043	0.096;0.058	B;B	0.27715	0.082;0.016	T	0.20773	-1.0265	10	0.10902	T	0.67	.	12.162	0.54109	0.0:0.068:0.0:0.932	.	1245;1277	Q9NRL2-2;Q9NRL2	.;BAZ1A_HUMAN	N	1245;1277;1277;929	ENSP00000351555:K1245N;ENSP00000371859:K1277N;ENSP00000353458:K1277N	ENSP00000351555:K1245N	K	-	3	2	BAZ1A	34301126	1.000000	0.71417	0.968000	0.41197	0.872000	0.50106	2.172000	0.42463	2.267000	0.75376	0.383000	0.25322	AAA	.		0.398	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276646.1		
CACNA1H	8912	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	1251935	1251935	+	Silent	SNP	G	G	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr16:1251935G>A	ENST00000348261.5	+	9	1733	c.1485G>A	c.(1483-1485)gtG>gtA	p.V495V	CACNA1H_ENST00000565831.1_Silent_p.V495V|CACNA1H_ENST00000358590.4_Silent_p.V495V	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	495					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	CCAGTGCTGTGCAAGGCCAGG	0.677																																					p.V495V		.											.	CACNA1H	67	0			c.G1485A						.						4.0	6.0	5.0					16																	1251935		1866	3739	5605	SO:0001819	synonymous_variant	8912	exon9			TGCTGTGCAAGGC	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.1485G>A	16.37:g.1251935G>A		45.0	0.0		40.0	20.0	NM_021098	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Silent	SNP	ENST00000348261.5	37	CCDS45375.1																																																																																			.		0.677	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
CCR10	2826	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	40831634	40831634	+	Silent	SNP	G	G	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr17:40831634G>A	ENST00000332438.4	-	2	1045	c.1026C>T	c.(1024-1026)cgC>cgT	p.R342R	CTD-3193K9.4_ENST00000593139.1_RNA|CNTNAP1_ENST00000264638.4_5'Flank|CCR10_ENST00000591765.1_Silent_p.R120R|PLEKHH3_ENST00000293349.6_5'Flank|PLEKHH3_ENST00000591022.1_5'Flank|PLEKHH3_ENST00000412503.1_5'Flank	NM_016602.2	NP_057686.2	P46092	CCR10_HUMAN	chemokine (C-C motif) receptor 10	342					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|G-protein coupled receptor activity (GO:0004930)			lung(1)|ovary(1)|skin(1)	3		Breast(137;0.000153)		BRCA - Breast invasive adenocarcinoma(366;0.14)		ggcggggccggcgggggcagc	0.701																																					p.R342R		.											.	CCR10	522	0			c.C1026T						.						11.0	14.0	13.0					17																	40831634		2169	4234	6403	SO:0001819	synonymous_variant	2826	exon2			GGGCCGGCGGGGG	AF215981	CCDS11435.1	17q21.1-q21.3	2012-08-08	2004-11-12	2004-11-12	ENSG00000184451	ENSG00000184451		"""GPCR / Class A : Chemokine receptors : C-C motif"""	4474	protein-coding gene	gene with protein product		600240	"""G protein-coupled receptor 2"""	GPR2		7851889	Standard	NM_016602		Approved		uc002iax.4	P46092	OTTHUMG00000132301	ENST00000332438.4:c.1026C>T	17.37:g.40831634G>A		31.0	0.0		43.0	20.0	NM_016602	Q4V749|Q6T7X2|Q9NZG2	Silent	SNP	ENST00000332438.4	37	CCDS11435.1																																																																																			.		0.701	CCR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255406.1	NM_016602	
CHRNA4	1137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	61990961	61990961	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr20:61990961G>A	ENST00000370263.4	-	2	388	c.167C>T	c.(166-168)gCc>gTc	p.A56V	CHRNA4_ENST00000463705.1_Intron|RP11-261N11.8_ENST00000370257.1_RNA	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	56					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	CGAGATGTTGGCCACGGGTCG	0.637																																					p.A56V		.											.	CHRNA4	91	0			c.C167T						.						125.0	106.0	113.0					20																	61990961		2198	4293	6491	SO:0001583	missense	1137	exon2			ATGTTGGCCACGG		CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.167C>T	20.37:g.61990961G>A	ENSP00000359285:p.Ala56Val	110.0	0.0		109.0	37.0	NM_000744	Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	ENST00000370263.4	37	CCDS13517.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.878939	0.51801	.	.	ENSG00000101204	ENST00000370263	T	0.35789	1.29	4.26	4.26	0.50523	Neurotransmitter-gated ion-channel ligand-binding (3);	0.131051	0.49916	D	0.000130	T	0.24431	0.0592	N	0.20766	0.605	0.44736	D	0.997739	B	0.30824	0.296	B	0.25140	0.058	T	0.05500	-1.0881	10	0.29301	T	0.29	.	16.68	0.85289	0.0:0.0:1.0:0.0	.	56	P43681	ACHA4_HUMAN	V	56	ENSP00000359285:A56V	ENSP00000359285:A56V	A	-	2	0	CHRNA4	61461405	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	2.933000	0.48948	1.929000	0.55896	0.491000	0.48974	GCC	.		0.637	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080508.3		
CPAMD8	27151	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	17115174	17115174	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr19:17115174delG	ENST00000443236.1	-	8	754	c.723delC	c.(721-723)cccfs	p.P241fs	CPAMD8_ENST00000388925.4_Frame_Shift_Del_p.P194fs	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	194						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						GGTCGGACAAGGGGAAGCTCA	0.512																																					p.P241fs		.											.	CPAMD8	141	0			c.723delC						.						90.0	91.0	90.0					19																	17115174		2003	4171	6174	SO:0001589	frameshift_variant	27151	exon8			GGACAAGGGGAAG	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.723delC	19.37:g.17115174delG	ENSP00000402505:p.Pro241fs	115.0	0.0		106.0	26.0	NM_015692	Q8NC09|Q9ULD7	Frame_Shift_Del	DEL	ENST00000443236.1	37	CCDS42519.1																																																																																			.		0.512	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692	
CPAMD8	27151	hgsc.bcm.edu;bcgsc.ca	37	19	17115180	17115180	+	Silent	SNP	G	G	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr19:17115180G>A	ENST00000443236.1	-	8	748	c.717C>T	c.(715-717)agC>agT	p.S239S	CPAMD8_ENST00000388925.4_Silent_p.S192S	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	192						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						ACAAGGGGAAGCTCATGTTGG	0.517																																					p.S239S		.											.	CPAMD8	141	0			c.C717T						.						88.0	90.0	90.0					19																	17115180		2015	4170	6185	SO:0001819	synonymous_variant	27151	exon8			GGGGAAGCTCATG	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.717C>T	19.37:g.17115180G>A		103.0	0.0		99.0	27.0	NM_015692	Q8NC09|Q9ULD7	Silent	SNP	ENST00000443236.1	37	CCDS42519.1	.	.	.	.	.	.	.	.	.	.	G	0.242	-1.012692	0.02095	.	.	ENSG00000160111	ENST00000443236	.	.	.	2.73	1.31	0.21738	.	.	.	.	.	T	0.51635	0.1686	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46386	-0.9195	4	.	.	.	.	5.1812	0.15161	0.462:0.0:0.538:0.0	.	.	.	.	V	250	.	.	A	-	2	0	CPAMD8	16976180	0.993000	0.37304	0.993000	0.49108	0.025000	0.11179	0.228000	0.17814	1.269000	0.44280	0.491000	0.48974	GCT	.		0.517	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692	
CSRP3	8048	hgsc.bcm.edu;broad.mit.edu	37	11	19204231	19204231	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr11:19204231C>A	ENST00000533783.1	-	7	811	c.571G>T	c.(571-573)Gaa>Taa	p.E191*	CSRP3_ENST00000265968.3_Nonsense_Mutation_p.E191*	NM_003476.4	NP_003467.1	P50461	CSRP3_HUMAN	cysteine and glycine-rich protein 3 (cardiac LIM protein)	191					cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue development (GO:0048738)|cardiac myofibril assembly (GO:0055003)|cellular calcium ion homeostasis (GO:0006874)|detection of muscle stretch (GO:0035995)|protein localization to organelle (GO:0033365)|regulation of the force of heart contraction (GO:0002026)|skeletal muscle tissue development (GO:0007519)	cytoskeleton (GO:0005856)|nucleus (GO:0005634)|Z disc (GO:0030018)	actinin binding (GO:0042805)|structural constituent of muscle (GO:0008307)|telethonin binding (GO:0031433)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(2)	10						TCTTTCTTTTCCACTTGTTGT	0.448																																					p.E191X		.											.	CSRP3	90	0			c.G571T						.						140.0	139.0	139.0					11																	19204231		2199	4293	6492	SO:0001587	stop_gained	8048	exon7			TCTTTTCCACTTG	U20324	CCDS7848.1	11p15.1	2014-09-17				ENSG00000129170			2472	protein-coding gene	gene with protein product		600824				7490106	Standard	NM_003476		Approved	CLP, MLP, CMD1M	uc001mpk.3	P50461		ENST00000533783.1:c.571G>T	11.37:g.19204231C>A	ENSP00000431813:p.Glu191*	166.0	0.0		164.0	8.0	NM_003476	Q9P131	Nonsense_Mutation	SNP	ENST00000533783.1	37	CCDS7848.1	.	.	.	.	.	.	.	.	.	.	C	38	6.962264	0.97967	.	.	ENSG00000129170	ENST00000265968;ENST00000533783	.	.	.	6.06	6.06	0.98353	.	0.217961	0.47852	D	0.000215	.	.	.	.	.	.	0.53688	D	0.99997	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-10.7291	20.2159	0.98296	0.0:1.0:0.0:0.0	.	.	.	.	X	191	.	ENSP00000265968:E191X	E	-	1	0	CSRP3	19160807	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	3.919000	0.56439	2.882000	0.98803	0.655000	0.94253	GAA	.		0.448	CSRP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394484.1	NM_003476	
CTC1	80169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	8141349	8141349	+	Splice_Site	SNP	C	C	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr17:8141349C>T	ENST00000315684.8	-	4	654	c.647G>A	c.(646-648)aGa>aAa	p.R216K	CTC1_ENST00000581671.1_5'UTR	NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN	CTS telomere maintenance complex component 1	216					bone marrow development (GO:0048539)|cellular response to DNA damage stimulus (GO:0006974)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organism growth (GO:0035264)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|replicative senescence (GO:0090399)|spleen development (GO:0048536)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)|thymus development (GO:0048538)	nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						GGGAAATTACCTGAGCCTGAG	0.542																																					p.R216K		.											.	CTC1	93	0			c.G647A						.						56.0	58.0	58.0					17																	8141349		1982	4146	6128	SO:0001630	splice_region_variant	80169	exon4			AATTACCTGAGCC	AL831955	CCDS42259.1	17p13.1	2011-02-21	2011-02-21	2011-02-21	ENSG00000178971	ENSG00000178971			26169	protein-coding gene	gene with protein product	"""conserved telomere maintenance component 1"", ""alpha accessory factor 132"", ""conserved telomere capping protein 1"""	613129	"""tmp494178"", ""chromosome 17 open reading frame 68"""	C17orf68		19854130, 19854131	Standard	NM_025099		Approved	FLJ22170, AAF132	uc002gkq.4	Q2NKJ3		ENST00000315684.8:c.647+1G>A	17.37:g.8141349C>T		76.0	0.0		83.0	24.0	NM_025099	B3KR66|C9JEX5|Q1PCD1|Q2TBE3|Q8N3S6|Q9H6L0	Missense_Mutation	SNP	ENST00000315684.8	37	CCDS42259.1	.	.	.	.	.	.	.	.	.	.	C	13.11	2.138662	0.37728	.	.	ENSG00000178971	ENST00000315684;ENST00000449476	D;D	0.84370	-1.84;-1.84	5.27	4.29	0.51040	.	0.166754	0.42548	D	0.000700	D	0.83991	0.5374	M	0.70595	2.14	0.30941	N	0.725828	P	0.39181	0.663	B	0.40165	0.321	D	0.83658	0.0159	9	.	.	.	-5.416	11.7458	0.51819	0.0:0.8232:0.1768:0.0	.	216	Q2NKJ3	CTC1_HUMAN	K	216	ENSP00000313759:R216K;ENSP00000396018:R216K	.	R	-	2	0	CTC1	8082074	1.000000	0.71417	1.000000	0.80357	0.222000	0.24845	2.793000	0.47845	1.445000	0.47624	0.561000	0.74099	AGA	.		0.542	CTC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442012.1	NM_025099	Missense_Mutation
CTSE	1510	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	206325312	206325312	+	Silent	SNP	A	A	C			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr1:206325312A>C	ENST00000358184.2	+	5	655	c.537A>C	c.(535-537)gcA>gcC	p.A179A	CTSE_ENST00000468617.1_3'UTR|CTSE_ENST00000361052.3_Silent_p.A184A|CTSE_ENST00000432969.2_Silent_p.A104A|CTSE_ENST00000360218.2_Silent_p.A179A	NM_001910.3	NP_001901.1	P14091	CATE_HUMAN	cathepsin E	184					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|digestion (GO:0007586)|protein autoprocessing (GO:0016540)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(3)	16			BRCA - Breast invasive adenocarcinoma(75;0.0754)			TTGTGGATGCAGAGTTTGATG	0.537																																					p.A179A		.											.	CTSE	91	0			c.A537C						.						166.0	149.0	155.0					1																	206325312		2203	4300	6503	SO:0001819	synonymous_variant	1510	exon5			GGATGCAGAGTTT	BC042537	CCDS73012.1, CCDS73013.1	1q32.1	2008-02-05			ENSG00000196188	ENSG00000196188	3.4.23.5	"""Cathepsins"""	2530	protein-coding gene	gene with protein product		116890				2369841, 2674141	Standard	NM_001910		Approved		uc001hdu.3	P14091	OTTHUMG00000036121	ENST00000358184.2:c.537A>C	1.37:g.206325312A>C		253.0	0.0		288.0	111.0	NM_001910	Q5TZ01|Q5TZ02|Q9NY58|Q9UCE3|Q9UCE4	Silent	SNP	ENST00000358184.2	37	CCDS1462.1																																																																																			.		0.537	CTSE-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000087998.1	NM_001910	
CUL4A	8451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	13	113898777	113898777	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr13:113898777G>T	ENST00000375440.4	+	12	1366	c.1282G>T	c.(1282-1284)Gag>Tag	p.E428*	CUL4A_ENST00000375441.3_Nonsense_Mutation_p.E328*|CUL4A_ENST00000326335.4_Nonsense_Mutation_p.E328*|CUL4A_ENST00000451881.1_Nonsense_Mutation_p.E328*	NM_001008895.1	NP_001008895.1	Q13619	CUL4A_HUMAN	cullin 4A	428					cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|regulation of nucleotide-excision repair (GO:2000819)|regulation of protein metabolic process (GO:0051246)|somatic stem cell maintenance (GO:0035019)|viral process (GO:0016032)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|skin(1)	17	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)			CACAGACGAGGAGCTGGAGCG	0.433																																					p.E428X		.											.	CUL4A	651	0			c.G1282T						.						76.0	63.0	67.0					13																	113898777		2203	4300	6503	SO:0001587	stop_gained	8451	exon12			GACGAGGAGCTGG	U58090	CCDS9533.1, CCDS41908.1, CCDS73604.1	13q34	2011-05-24			ENSG00000139842	ENSG00000139842			2554	protein-coding gene	gene with protein product		603137				8681378	Standard	NM_001008895		Approved		uc021rmv.1	Q13619	OTTHUMG00000017384	ENST00000375440.4:c.1282G>T	13.37:g.113898777G>T	ENSP00000364589:p.Glu428*	201.0	0.0		243.0	97.0	NM_001008895	A2A2W2|O75834|Q589T6|Q5TC62|Q6UP08|Q9UP17	Nonsense_Mutation	SNP	ENST00000375440.4	37	CCDS41908.1	.	.	.	.	.	.	.	.	.	.	G	44	11.096330	0.99515	.	.	ENSG00000139842	ENST00000375441;ENST00000451881;ENST00000326335;ENST00000375440	.	.	.	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-49.07	18.1481	0.89665	0.0:0.0:1.0:0.0	.	.	.	.	X	328;328;328;428	.	ENSP00000322132:E328X	E	+	1	0	CUL4A	112946778	1.000000	0.71417	0.974000	0.42286	0.962000	0.63368	9.634000	0.98435	2.368000	0.80403	0.484000	0.47621	GAG	.		0.433	CUL4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045888.3	NM_003589	
CWC25	54883	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	36977155	36977155	+	Splice_Site	SNP	T	T	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr17:36977155T>A	ENST00000225428.5	-	2	487	c.190A>T	c.(190-192)Aag>Tag	p.K64*	CWC25_ENST00000536127.1_5'UTR	NM_017748.3	NP_060218.1	Q9NXE8	CWC25_HUMAN	CWC25 spliceosome-associated protein homolog (S. cerevisiae)	64										central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	14						CTCACTTACTTGACGGCCCCA	0.557																																					p.K64X		.											.	.	.	0			c.A190T						.						144.0	140.0	141.0					17																	36977155		2107	4239	6346	SO:0001630	splice_region_variant	54883	exon2			CTTACTTGACGGC	AK000298	CCDS45663.1	17q12	2010-01-26	2010-01-26	2010-01-26		ENSG00000273559			25989	protein-coding gene	gene with protein product			"""coiled-coil domain containing 49"""	CCDC49		19941820	Standard	NM_017748		Approved	FLJ20291	uc002hqu.4	Q9NXE8		ENST00000225428.5:c.191+1A>T	17.37:g.36977155T>A		122.0	0.0		146.0	51.0	NM_017748	A0JLM3|Q68DK5	Nonsense_Mutation	SNP	ENST00000225428.5	37	CCDS45663.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.571373	0.86542	.	.	ENSG00000108296	ENST00000225428	.	.	.	5.2	5.2	0.72013	.	0.147994	0.64402	D	0.000015	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9563	0.64150	0.0:0.0:0.0:1.0	.	.	.	.	X	64	.	ENSP00000225428:K64X	K	-	1	0	CWC25	34230681	1.000000	0.71417	1.000000	0.80357	0.281000	0.26958	4.651000	0.61447	1.974000	0.57490	0.529000	0.55759	AAG	.		0.557	CWC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442186.6	NM_017748	Nonsense_Mutation
CYP2A6	1548	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	41354235	41354235	+	Silent	SNP	G	G	C			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr19:41354235G>C	ENST00000301141.5	-	4	563	c.543C>G	c.(541-543)gtC>gtG	p.V181V	CTC-490E21.12_ENST00000601627.1_Intron	NM_000762.5	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 6	181					coumarin catabolic process (GO:0046226)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)	coumarin 7-hydroxylase activity (GO:0008389)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)	37			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	TGGAGCTGATGACATTGGAGA	0.532																																					p.V181V		.											.	CYP2A6	92	0			c.C543G						.						135.0	125.0	128.0					19																	41354235		2203	4298	6501	SO:0001819	synonymous_variant	1548	exon4			GCTGATGACATTG	AF182275	CCDS12568.1	19q13.2	2013-11-11	2003-01-14		ENSG00000255974	ENSG00000255974		"""Cytochrome P450s"""	2610	protein-coding gene	gene with protein product		122720	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6"""	CYP2A3		7668294, 2748347	Standard	NM_000762		Approved	CPA6, CYP2A	uc002opl.4	P11509	OTTHUMG00000182713	ENST00000301141.5:c.543C>G	19.37:g.41354235G>C		284.0	0.0		354.0	138.0	NM_000762	A7YAE5|B2R7F6|P00190|P10890|Q16803|Q4VAT9|Q4VAU0|Q4VAU1|Q9H1Z7|Q9UCU0|Q9UK48	Silent	SNP	ENST00000301141.5	37	CCDS12568.1																																																																																			.		0.532	CYP2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463259.1	NM_000762	
DCHS2	54798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	155157679	155157679	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr4:155157679C>A	ENST00000357232.4	-	25	6759	c.6760G>T	c.(6760-6762)Gag>Tag	p.E2254*		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2254	Cadherin 20. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E2254Q(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TGTCCCTTCTCATTTCCAGAG	0.403																																					p.E2254X		.											.	DCHS2	94	1	Substitution - Missense(1)	large_intestine(1)	c.G6760T						.						98.0	102.0	101.0					4																	155157679		2203	4300	6503	SO:0001587	stop_gained	54798	exon25			CCTTCTCATTTCC	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.6760G>T	4.37:g.155157679C>A	ENSP00000349768:p.Glu2254*	92.0	0.0		73.0	27.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Nonsense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	C	45	11.837165	0.99608	.	.	ENSG00000197410	ENST00000357232	.	.	.	5.64	5.64	0.86602	.	0.079447	0.51477	D	0.000083	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	19.7012	0.96054	0.0:1.0:0.0:0.0	.	.	.	.	X	2254	.	ENSP00000349768:E2254X	E	-	1	0	DCHS2	155377129	1.000000	0.71417	0.974000	0.42286	0.717000	0.41224	2.582000	0.46085	2.637000	0.89404	0.563000	0.77884	GAG	.		0.403	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
DYSF	8291	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	71755439	71755439	+	Missense_Mutation	SNP	G	G	T	rs144202114	byFrequency	TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr2:71755439G>T	ENST00000258104.3	+	13	1469	c.1192G>T	c.(1192-1194)Gtg>Ttg	p.V398L	DYSF_ENST00000409744.1_Missense_Mutation_p.V399L|DYSF_ENST00000409582.3_Missense_Mutation_p.V429L|DYSF_ENST00000429174.2_Missense_Mutation_p.V398L|DYSF_ENST00000410020.3_Missense_Mutation_p.V430L|DYSF_ENST00000409366.1_Missense_Mutation_p.V399L|DYSF_ENST00000394120.2_Missense_Mutation_p.V399L|DYSF_ENST00000409651.1_Missense_Mutation_p.V430L|DYSF_ENST00000410041.1_Missense_Mutation_p.V430L|DYSF_ENST00000413539.2_Missense_Mutation_p.V429L|DYSF_ENST00000409762.1_Missense_Mutation_p.V429L	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	398	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.V398M(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						GGACGATGCCGTGATGGACAA	0.542																																					p.V430L		.											.	DYSF	158	1	Substitution - Missense(1)	prostate(1)	c.G1288T						.						120.0	87.0	98.0					2																	71755439		2203	4300	6503	SO:0001583	missense	8291	exon14			GATGCCGTGATGG	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.1192G>T	2.37:g.71755439G>T	ENSP00000258104:p.Val398Leu	107.0	0.0		106.0	43.0	NM_001130982	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	G	11.76	1.733747	0.30684	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.81739	-1.52;-1.51;-1.51;-1.53;-1.52;-1.51;-1.52;-1.52;-1.53;-1.51;-1.51	4.82	4.82	0.62117	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.221133	0.39083	N	0.001466	T	0.60287	0.2257	N	0.03154	-0.405	0.36451	D	0.866098	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.21688	0.047;0.047;0.017;0.009;0.004;0.004;0.004;0.004;0.047;0.05;0.059;0.009;0.017;0.021	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.27380	0.047;0.047;0.047;0.047;0.032;0.021;0.032;0.013;0.047;0.036;0.064;0.047;0.047;0.079	T	0.60737	-0.7204	10	0.07175	T	0.84	-24.9596	15.7634	0.78103	0.0:0.0:1.0:0.0	.	430;430;399;399;430;399;429;398;429;429;398;398;399;398	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	L	429;429;429;398;398;430;399;399;399;430;430	ENSP00000407046:V429L;ENSP00000387137:V429L;ENSP00000386547:V429L;ENSP00000398305:V398L;ENSP00000258104:V398L;ENSP00000386683:V430L;ENSP00000377678:V399L;ENSP00000386285:V399L;ENSP00000386512:V399L;ENSP00000386881:V430L;ENSP00000386617:V430L	ENSP00000258104:V398L	V	+	1	0	DYSF	71608947	0.999000	0.42202	0.990000	0.47175	0.841000	0.47740	2.940000	0.49003	2.407000	0.81776	0.462000	0.41574	GTG	G|0.996;A|0.004		0.542	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
DNAH6	1768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	84777070	84777070	+	Silent	SNP	T	T	C			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr2:84777070T>C	ENST00000237449.6	+	8	1382	c.1374T>C	c.(1372-1374)aaT>aaC	p.N458N	DNAH6_ENST00000398278.2_Silent_p.N458N|DNAH6_ENST00000389394.3_Silent_p.N458N			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	458	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TAACGGTAAATGCTGTTAATT	0.348																																					p.N458N		.											.	DNAH6	69	0			c.T1374C						.						98.0	88.0	92.0					2																	84777070		2203	4300	6503	SO:0001819	synonymous_variant	1768	exon9			GGTAAATGCTGTT	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.1374T>C	2.37:g.84777070T>C		107.0	0.0		111.0	18.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	ENST00000237449.6	37	CCDS46348.1																																																																																			.		0.348	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
ELN	2006	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	73477959	73477959	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr7:73477959G>A	ENST00000252034.7	+	29	2326	c.1927G>A	c.(1927-1929)Gga>Aga	p.G643R	ELN_ENST00000320492.7_Missense_Mutation_p.G562R|ELN_ENST00000458204.1_Missense_Mutation_p.G633R|ELN_ENST00000357036.5_Missense_Mutation_p.G648R|ELN_ENST00000380584.4_Missense_Mutation_p.G595R|ELN_ENST00000429192.1_Missense_Mutation_p.G629R|CTB-51J22.1_ENST00000435932.1_RNA|ELN_ENST00000414324.1_Missense_Mutation_p.G619R|ELN_ENST00000445912.1_Missense_Mutation_p.G643R|ELN_ENST00000358929.4_Missense_Mutation_p.G711R|ELN_ENST00000380553.4_Missense_Mutation_p.G507R|ELN_ENST00000380575.4_Missense_Mutation_p.G614R|ELN_ENST00000380562.4_Missense_Mutation_p.G649R|ELN_ENST00000380576.5_Missense_Mutation_p.G624R|ELN_ENST00000320399.6_Missense_Mutation_p.G676R	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	0	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				AGGCCTAGTGGGAGCCGCTGG	0.612			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																														p.G648R		.		Dom	yes		7	7q11.23	2006	elastin	yes	L	.	ELN	95	0			c.G1942A						.						113.0	105.0	108.0					7																	73477959		2203	4300	6503	SO:0001583	missense	2006	exon29			CTAGTGGGAGCCG		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.1927G>A	7.37:g.73477959G>A	ENSP00000252034:p.Gly643Arg	345.0	0.0		479.0	27.0	NM_001081754	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	ENST00000252034.7	37	CCDS5562.2	.	.	.	.	.	.	.	.	.	.	G	11.50	1.657390	0.29425	.	.	ENSG00000049540	ENST00000445912;ENST00000252034;ENST00000358929;ENST00000320492;ENST00000414324;ENST00000380562;ENST00000380575;ENST00000380584;ENST00000458204;ENST00000357036;ENST00000429192;ENST00000442462;ENST00000380553;ENST00000380576;ENST00000320399	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.62941	0.04;0.09;0.49;0.3;0.14;0.11;0.15;0.11;0.17;0.17;0.19;-0.01;0.14;0.17	2.4	2.4	0.29515	.	.	.	.	.	T	0.70666	0.3250	.	.	.	0.09310	N	0.999999	D;D;D;D;D;D;D;D;D;D;D;D;D	0.69078	0.997;0.997;0.997;0.997;0.997;0.997;0.997;0.997;0.997;0.997;0.997;0.997;0.997	P;P;P;P;P;P;P;P;P;P;P;P;P	0.61658	0.892;0.892;0.892;0.892;0.892;0.892;0.892;0.892;0.892;0.892;0.892;0.892;0.892	T	0.57688	-0.7768	8	0.72032	D	0.01	.	8.48	0.33036	0.0:0.0:1.0:0.0	.	643;562;619;633;649;614;629;648;624;507;554;595;643	E7ENM0;G5E950;G3V0G6;E7EN65;P15502-1;P15502-7;P15502-12;P15502-5;P15502-13;P15502-11;B3KRT8;P15502-8;P15502-2	.;.;.;.;.;.;.;.;.;.;.;.;.	R	643;643;711;562;619;649;614;595;633;648;629;582;507;624;676	ENSP00000389857:G643R;ENSP00000252034:G643R;ENSP00000351807:G711R;ENSP00000315607:G562R;ENSP00000392575:G619R;ENSP00000369936:G649R;ENSP00000369949:G614R;ENSP00000369958:G595R;ENSP00000403162:G633R;ENSP00000349540:G648R;ENSP00000391129:G629R;ENSP00000369926:G507R;ENSP00000369950:G624R;ENSP00000313565:G676R	ENSP00000252034:G643R	G	+	1	0	ELN	73115895	0.307000	0.24500	0.200000	0.23457	0.008000	0.06430	2.223000	0.42936	1.667000	0.50832	0.460000	0.39030	GGA	.		0.612	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501	
ENOPH1	58478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	83378171	83378171	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr4:83378171T>G	ENST00000273920.3	+	5	894	c.626T>G	c.(625-627)tTt>tGt	p.F209C	ENOPH1_ENST00000509635.1_Missense_Mutation_p.F121C	NM_021204.3	NP_067027.1			enolase-phosphatase 1											central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|skin(1)	13						AACATTTTGTTTCTGACAGAT	0.388																																					p.F209C		.											.	ENOPH1	22	0			c.T626G						.						147.0	144.0	145.0					4																	83378171		2203	4300	6503	SO:0001583	missense	58478	exon5			TTTTGTTTCTGAC		CCDS3594.1, CCDS75154.1	4q21.3	2013-05-29			ENSG00000145293	ENSG00000145293	3.1.3.77		24599	protein-coding gene	gene with protein product	"""Enolase-phosphatase E1"", ""acireductone synthase"""					15843022	Standard	XM_005263168		Approved	MASA, E1, mtnC	uc003hmv.3	Q9UHY7	OTTHUMG00000130295	ENST00000273920.3:c.626T>G	4.37:g.83378171T>G	ENSP00000273920:p.Phe209Cys	168.0	0.0		176.0	55.0	NM_021204		Missense_Mutation	SNP	ENST00000273920.3	37	CCDS3594.1	.	.	.	.	.	.	.	.	.	.	t	22.4	4.283949	0.80803	.	.	ENSG00000145293	ENST00000273920;ENST00000509635	T;T	0.09630	2.96;2.96	5.37	5.37	0.77165	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (2);2,3-diketo-5-methylthio-1-phosphopentane phosphatase (1);	0.000000	0.85682	D	0.000000	T	0.47544	0.1451	H	0.95917	3.74	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65340	-0.6192	10	0.87932	D	0	-16.7356	15.6667	0.77236	0.0:0.0:0.0:1.0	.	209	Q9UHY7	ENOPH_HUMAN	C	209;121	ENSP00000273920:F209C;ENSP00000422005:F121C	ENSP00000273920:F209C	F	+	2	0	ENOPH1	83597195	1.000000	0.71417	1.000000	0.80357	0.776000	0.43924	7.828000	0.86729	2.158000	0.67659	0.477000	0.44152	TTT	.		0.388	ENOPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252638.2	NM_021204	
ESCO1	114799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	19144186	19144186	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr18:19144186G>T	ENST00000269214.5	-	7	2736	c.1799C>A	c.(1798-1800)aCt>aAt	p.T600N		NM_052911.2	NP_443143.2	Q5FWF5	ESCO1_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 1	600					mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)|sister chromatid cohesion (GO:0007062)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|transferase activity, transferring acyl groups (GO:0016746)			breast(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(10)|prostate(3)|upper_aerodigestive_tract(1)	35						TTTTTCATCAGTTTTCTCTGC	0.323																																					p.T600N		.											.	ESCO1	90	0			c.C1799A						.						117.0	108.0	111.0					18																	19144186		2203	4297	6500	SO:0001583	missense	114799	exon7			TCATCAGTTTTCT	AL832041	CCDS32800.1	18q11.2	2013-05-02	2013-05-02		ENSG00000141446	ENSG00000141446			24645	protein-coding gene	gene with protein product		609674	"""establishment of cohesion 1 homolog 1 (S. cerevisiae)"""			11572484, 14576321, 15958495	Standard	NM_052911		Approved	ESO1, EFO1, KIAA1911	uc002kth.1	Q5FWF5		ENST00000269214.5:c.1799C>A	18.37:g.19144186G>T	ENSP00000269214:p.Thr600Asn	180.0	0.0		141.0	35.0	NM_052911	B0YJ11|B0YJ12|Q69YG4|Q69YS3|Q6IMD7|Q8N3Z5|Q8NBG2|Q96PX7	Missense_Mutation	SNP	ENST00000269214.5	37	CCDS32800.1	.	.	.	.	.	.	.	.	.	.	G	8.885	0.952685	0.18431	.	.	ENSG00000141446	ENST00000269214;ENST00000383276	T;T	0.57907	0.37;1.96	4.92	-1.32	0.09201	.	0.728086	0.12879	N	0.431624	T	0.26159	0.0638	N	0.19112	0.55	0.22050	N	0.9994	B	0.21520	0.057	B	0.14023	0.01	T	0.12477	-1.0546	10	0.17832	T	0.49	-1.6325	1.2834	0.02046	0.2734:0.1076:0.3938:0.2252	.	600	Q5FWF5	ESCO1_HUMAN	N	600	ENSP00000269214:T600N;ENSP00000372763:T600N	ENSP00000269214:T600N	T	-	2	0	ESCO1	17398184	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	0.360000	0.20250	-0.031000	0.13781	-0.211000	0.12701	ACT	.		0.323	ESCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443942.1	NM_052911	
FAM192A	80011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	57206205	57206205	+	Silent	SNP	C	C	T	rs180702754	byFrequency	TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr16:57206205C>T	ENST00000309137.8	-	4	564	c.306G>A	c.(304-306)aaG>aaA	p.K102K	FAM192A_ENST00000389447.5_Silent_p.K102K|FAM192A_ENST00000567439.1_Silent_p.K102K|FAM192A_ENST00000564108.1_Silent_p.K102K|FAM192A_ENST00000569266.1_Silent_p.K102K|FAM192A_ENST00000566077.1_Silent_p.K25K	NM_024946.2	NP_079222.1	Q9GZU8	F192A_HUMAN	family with sequence similarity 192, member A	102						nucleus (GO:0005634)				endometrium(2)|large_intestine(3)|lung(4)|prostate(2)	11						CTCTTCGTTGCTTTTCTATTA	0.378													C|||	4	0.000798722	0.0	0.0014	5008	,	,		19644	0.0		0.001	False		,,,				2504	0.002				p.K102K		.											.	FAM192A	90	0			c.G306A						.	C		0,3698		0,0,1849	172.0	141.0	150.0		306	-1.3	1.0	16		150	19,8165		0,19,4073	no	coding-synonymous	FAM192A	NM_024946.2		0,19,5922	TT,TC,CC		0.2322,0.0,0.1599		102/255	57206205	19,11863	1849	4092	5941	SO:0001819	synonymous_variant	80011	exon4			TCGTTGCTTTTCT		CCDS42168.1	16q13	2009-08-19	2009-08-19	2009-08-19		ENSG00000172775			29856	protein-coding gene	gene with protein product	"""NEFA interacting nuclear protein NIP30"""		"""chromosome 16 open reading frame 94"""	C16orf94		12477932	Standard	NM_024946		Approved	NIP30	uc021tiy.1	Q9GZU8		ENST00000309137.8:c.306G>A	16.37:g.57206205C>T		211.0	0.0		191.0	52.0	NM_024946		Silent	SNP	ENST00000309137.8	37	CCDS42168.1																																																																																			C|0.999;T|0.001		0.378	FAM192A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433022.2	NM_024946	
FAM69B	138311	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	139617874	139617874	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr9:139617874A>C	ENST00000371692.4	+	5	1040	c.944A>C	c.(943-945)gAc>gCc	p.D315A	SNHG7_ENST00000416970.1_RNA|SNHG7_ENST00000362567.2_RNA|SNHG7_ENST00000447221.1_RNA|SNHG7_ENST00000414282.1_RNA|SNHG7_ENST00000436596.1_RNA|FAM69B_ENST00000371691.1_Missense_Mutation_p.D228A	NM_152421.3	NP_689634.2	Q5VUD6	FA69B_HUMAN	family with sequence similarity 69, member B	315						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|large_intestine(2)|lung(1)|prostate(1)	8	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.03e-05)|Epithelial(140;0.00013)		AAGATGGCCGACCTGCAGCAG	0.657																																					p.D315A		.											.	FAM69B	90	0			c.A944C						.						34.0	33.0	33.0					9																	139617874		2203	4300	6503	SO:0001583	missense	138311	exon5			TGGCCGACCTGCA		CCDS7004.1	9q34.3	2012-08-03			ENSG00000165716	ENSG00000165716			28290	protein-coding gene	gene with protein product		614543				21334309	Standard	NM_152421		Approved	MGC20262, C9orf136	uc004cik.3	Q5VUD6	OTTHUMG00000020940	ENST00000371692.4:c.944A>C	9.37:g.139617874A>C	ENSP00000360757:p.Asp315Ala	47.0	0.0		38.0	8.0	NM_152421	Q5VUD7|Q8N5N0|Q8WYU5	Missense_Mutation	SNP	ENST00000371692.4	37	CCDS7004.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.891032	0.91889	.	.	ENSG00000165716	ENST00000371692;ENST00000371691	T;T	0.68025	-0.3;-0.28	5.29	5.29	0.74685	.	0.195156	0.53938	D	0.000053	T	0.75072	0.3800	M	0.75615	2.305	0.58432	D	0.999998	P	0.50819	0.939	P	0.51324	0.666	T	0.79415	-0.1813	10	0.87932	D	0	-55.3285	14.3785	0.66895	1.0:0.0:0.0:0.0	.	315	Q5VUD6	FA69B_HUMAN	A	315;228	ENSP00000360757:D315A;ENSP00000360756:D228A	ENSP00000360756:D228A	D	+	2	0	FAM69B	138737695	1.000000	0.71417	0.996000	0.52242	0.965000	0.64279	8.253000	0.89842	1.992000	0.58205	0.459000	0.35465	GAC	.		0.657	FAM69B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055102.1	NM_152421	
FCHO2	115548	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	72347203	72347204	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr5:72347203_72347204insA	ENST00000430046.2	+	12	1083_1084	c.967_968insA	c.(967-969)tacfs	p.Y323fs	FCHO2_ENST00000512348.1_Frame_Shift_Ins_p.Y290fs|FCHO2_ENST00000341845.6_Frame_Shift_Ins_p.Y323fs	NM_001146032.1|NM_138782.2	NP_001139504.1|NP_620137.2	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2	323					clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|membrane invagination (GO:0010324)|protein localization to plasma membrane (GO:0072659)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	17		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		TGAAGAAGGCTACAGTATTAAA	0.297																																					p.Y323_S324delinsX		.											.	FCHO2	23	0			c.967_968insA						.																																			SO:0001589	frameshift_variant	115548	exon12			GAAGGCTACAGTA	AL831971	CCDS47230.1, CCDS54868.1	5q13.2	2005-08-15			ENSG00000157107	ENSG00000157107			25180	protein-coding gene	gene with protein product		613438				15254787	Standard	NM_138782		Approved		uc003kcl.3	Q0JRZ9	OTTHUMG00000162413	ENST00000430046.2:c.968dupA	5.37:g.72347204_72347204dupA	ENSP00000393776:p.Tyr323fs	116.0	0.0		82.0	16.0	NM_138782	A8K6W7|B2RNQ9|B4DHK0|E9PG79|Q0JTJ3|Q96CF5	Nonsense_Mutation	INS	ENST00000430046.2	37	CCDS47230.1																																																																																			.		0.297	FCHO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368795.3	XM_291142	
FKBP15	23307	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	115938874	115938876	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	CAC	CAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr9:115938874_115938876delCAC	ENST00000238256.3	-	21	2281_2283	c.2164_2166delGTG	c.(2164-2166)gtgdel	p.V722del		NM_015258.1	NP_056073.1	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	722					endocytosis (GO:0006897)|negative regulation of phosphatase activity (GO:0010923)|protein folding (GO:0006457)	actin filament (GO:0005884)|axon (GO:0030424)|endosome (GO:0005768)|growth cone (GO:0030426)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(9)|ovary(3)|urinary_tract(1)	26						CCAGGGATGTCACCTTGAGTTCC	0.468																																					p.722_722del		.											.	FKBP15	25	0			c.2164_2166del						.																																			SO:0001651	inframe_deletion	23307	exon21			GGATGTCACCTTG	AB014574	CCDS48007.1	9q33.1	2014-05-09	2006-10-31	2006-10-31	ENSG00000119321	ENSG00000119321		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23397	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 76"", ""WASP and FKBP-like protein"""		"""KIAA0674"""	KIAA0674		16756961, 20376207	Standard	NM_015258		Approved	PPP1R76, FKBP133, WAFL	uc004bgs.2	Q5T1M5	OTTHUMG00000020518	ENST00000238256.3:c.2164_2166delGTG	9.37:g.115938874_115938876delCAC	ENSP00000238256:p.Val722del	315.0	0.0		319.0	101.0	NM_015258	Q05DK8|Q5T1M2|Q6DD85|Q9Y4D0	In_Frame_Del	DEL	ENST00000238256.3	37	CCDS48007.1																																																																																			.		0.468	FKBP15-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015258	
FNDC7	163479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	109261510	109261510	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr1:109261510T>G	ENST00000370017.3	+	4	714	c.437T>G	c.(436-438)aTt>aGt	p.I146S	FNDC7_ENST00000271311.2_Missense_Mutation_p.I147S	NM_001144937.1	NP_001138409.1	Q5VTL7	FNDC7_HUMAN	fibronectin type III domain containing 7	146	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|skin(4)|stomach(1)|urinary_tract(1)	20		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)		TCCGTGTCCATTATGCGAGCC	0.448																																					p.I146S		.											.	FNDC7	92	0			c.T437G						.						69.0	60.0	63.0					1																	109261510		692	1591	2283	SO:0001583	missense	163479	exon4			TGTCCATTATGCG		CCDS44185.1	1p13.3	2013-02-11			ENSG00000143107	ENSG00000143107		"""Fibronectin type III domain containing"""	26668	protein-coding gene	gene with protein product						12477932	Standard	NM_001144937		Approved	FLJ35838	uc001dvx.3	Q5VTL7	OTTHUMG00000011120	ENST00000370017.3:c.437T>G	1.37:g.109261510T>G	ENSP00000359034:p.Ile146Ser	227.0	0.0		197.0	75.0	NM_001144937	A1L468|E9PAZ5|Q6PF16|Q8NA51	Missense_Mutation	SNP	ENST00000370017.3	37	CCDS44185.1	.	.	.	.	.	.	.	.	.	.	T	17.98	3.519831	0.64634	.	.	ENSG00000143107	ENST00000370017;ENST00000271311	T;T	0.57436	0.4;0.4	5.69	5.69	0.88448	.	0.316835	0.36740	N	0.002439	T	0.41396	0.1157	L	0.46157	1.445	0.30260	N	0.793223	B	0.32653	0.379	B	0.41466	0.358	T	0.49273	-0.8957	10	0.52906	T	0.07	-8.9213	15.9414	0.79756	0.0:0.0:0.0:1.0	.	146	E9PAZ5	.	S	146;147	ENSP00000359034:I146S;ENSP00000271311:I147S	ENSP00000271311:I147S	I	+	2	0	FNDC7	109063033	0.998000	0.40836	0.992000	0.48379	0.744000	0.42396	5.400000	0.66320	2.168000	0.68352	0.533000	0.62120	ATT	.		0.448	FNDC7-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030589.4	NM_173532	
FOXJ2	55810	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	8205442	8205442	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr12:8205442C>G	ENST00000162391.3	+	11	2866	c.1721C>G	c.(1720-1722)aCt>aGt	p.T574S	FOXJ2_ENST00000539192.1_3'UTR	NM_018416.2	NP_060886.1	Q9P0K8	FOXJ2_HUMAN	forkhead box J2	574					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	16				Kidney(36;0.0944)		GACTTGATCACTTAGTGCATC	0.562																																					p.T574S		.											.	FOXJ2	230	0			c.C1721G						.						78.0	56.0	63.0					12																	8205442		2203	4300	6503	SO:0001583	missense	55810	exon11			TGATCACTTAGTG	AF155132	CCDS8587.1	12p13.31	2006-12-15				ENSG00000065970		"""Forkhead boxes"""	24818	protein-coding gene	gene with protein product						10777590, 10966786	Standard	NM_018416		Approved	FHX	uc001qtu.3	Q9P0K8		ENST00000162391.3:c.1721C>G	12.37:g.8205442C>G	ENSP00000162391:p.Thr574Ser	62.0	0.0		69.0	28.0	NM_018416	A0AVK4|B2RMP3|Q96PS9|Q9NSN5	Missense_Mutation	SNP	ENST00000162391.3	37	CCDS8587.1	.	.	.	.	.	.	.	.	.	.	C	31	5.103169	0.94245	.	.	ENSG00000065970	ENST00000162391	D	0.94758	-3.51	5.85	5.85	0.93711	.	0.648102	0.13574	N	0.377784	D	0.92996	0.7771	L	0.44542	1.39	0.80722	D	1	P	0.42692	0.787	B	0.41236	0.351	D	0.92897	0.6336	10	0.87932	D	0	.	17.6545	0.88174	0.0:1.0:0.0:0.0	.	574	Q9P0K8	FOXJ2_HUMAN	S	574	ENSP00000162391:T574S	ENSP00000162391:T574S	T	+	2	0	FOXJ2	8096709	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.953000	0.56699	2.772000	0.95346	0.650000	0.86243	ACT	.		0.562	FOXJ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400088.1	NM_018416	
FURIN	5045	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	91423938	91423938	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr15:91423938C>T	ENST00000268171.3	+	14	1853	c.1574C>T	c.(1573-1575)gCa>gTa	p.A525V		NM_002569.2	NP_002560.1	P09958	FURIN_HUMAN	furin (paired basic amino acid cleaving enzyme)	525					cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of low-density lipoprotein particle receptor catabolic process (GO:0032804)|negative regulation of transforming growth factor beta1 production (GO:0032911)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-translational protein modification (GO:0043687)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)|regulation of protein catabolic process (GO:0042176)|secretion by cell (GO:0032940)|signal peptide processing (GO:0006465)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|nerve growth factor binding (GO:0048406)|peptidase activity (GO:0008233)|peptide binding (GO:0042277)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(4)|endometrium(4)|large_intestine(3)|liver(2)|lung(13)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	36	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			GACTACTCCGCAGATGGGTTT	0.582																																					p.A525V		.											.	FURIN	1083	0			c.C1574T						.						73.0	66.0	68.0					15																	91423938		2198	4298	6496	SO:0001583	missense	5045	exon14			ACTCCGCAGATGG	X17094	CCDS10364.1	15q26.1	2007-01-24	2002-12-04	2002-12-06	ENSG00000140564	ENSG00000140564			8568	protein-coding gene	gene with protein product		136950	"""paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein)"""	PCSK3, FUR, PACE		2251280, 1741956	Standard	NM_002569		Approved	SPC1	uc002bpu.1	P09958	OTTHUMG00000149831	ENST00000268171.3:c.1574C>T	15.37:g.91423938C>T	ENSP00000268171:p.Ala525Val	137.0	0.0		114.0	41.0	NM_002569	Q14336|Q6LBS3|Q9UCZ5	Missense_Mutation	SNP	ENST00000268171.3	37	CCDS10364.1	.	.	.	.	.	.	.	.	.	.	C	18.72	3.684826	0.68157	.	.	ENSG00000140564	ENST00000268171	T	0.63744	-0.06	3.76	3.76	0.43208	Proprotein convertase, P (1);Galactose-binding domain-like (1);	0.058661	0.64402	D	0.000002	T	0.53899	0.1825	L	0.52266	1.64	0.58432	D	0.999996	P	0.39181	0.663	B	0.34301	0.179	T	0.57329	-0.7830	10	0.29301	T	0.29	-13.8803	16.1871	0.81960	0.0:1.0:0.0:0.0	.	525	P09958	FURIN_HUMAN	V	525	ENSP00000268171:A525V	ENSP00000268171:A525V	A	+	2	0	FURIN	89224942	0.998000	0.40836	0.969000	0.41365	0.935000	0.57460	4.612000	0.61169	2.119000	0.64992	0.555000	0.69702	GCA	.		0.582	FURIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313492.1	NM_002569	
TRIAP1	51499	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	120884359	120884359	+	5'Flank	SNP	C	C	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr12:120884359C>T	ENST00000546954.1	-	0	0				TRIAP1_ENST00000302432.3_5'Flank|AL021546.6_ENST00000551806.1_Intron|GATC_ENST00000551765.1_Missense_Mutation_p.P26S	NM_016399.2	NP_057483.1	O43715	TRIA1_HUMAN	TP53 regulated inhibitor of apoptosis 1						cellular response to UV (GO:0034644)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of membrane lipid distribution (GO:0097035)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	p53 binding (GO:0002039)					all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CAAGGCGGATCCTCAGGTAAA	0.687																																					p.P26S		.											.	GATC	22	0			c.C76T						.						37.0	43.0	41.0					12																	120884359		2203	4297	6500	SO:0001631	upstream_gene_variant	283459	exon1			GCGGATCCTCAGG		CCDS9198.1	12q24.31	2012-10-15			ENSG00000170855	ENSG00000170855			26937	protein-coding gene	gene with protein product	"""p53-inducible cell-survival factor"", ""mitochondrial distribution and morphology 35 homolog (S. cerevisiae)"""	614943				11042152, 15735003	Standard	NM_016399		Approved	P53CSV, WF-1, HSPC132, p53CSV, MDM35	uc001tyg.3	O43715	OTTHUMG00000047787		12.37:g.120884359C>T	Exception_encountered	54.0	0.0		58.0	6.0	NM_176818	B2R4Z7|Q5RKS5|Q6LCA7	Missense_Mutation	SNP	ENST00000546954.1	37	CCDS9198.1	.	.	.	.	.	.	.	.	.	.	C	13.31	2.199237	0.38806	.	.	ENSG00000257218	ENST00000551765	T	0.49139	0.79	4.76	-0.362	0.12560	.	0.499402	0.21544	N	0.072857	T	0.31295	0.0792	L	0.50333	1.59	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.16364	-1.0405	10	0.37606	T	0.19	-0.0727	0.2962	0.00266	0.2779:0.3055:0.1566:0.26	.	26	O43716	GATC_HUMAN	S	26	ENSP00000446872:P26S	ENSP00000448397:P26S	P	+	1	0	AL021546.1	119368742	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	-1.025000	0.03600	-0.159000	0.11021	0.644000	0.83932	CCT	.		0.687	TRIAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108980.3	NM_016399	
GBP5	115362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	89735097	89735097	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr1:89735097G>C	ENST00000370459.3	-	2	269	c.142C>G	c.(142-144)Cgc>Ggc	p.R48G	GBP5_ENST00000343435.5_Missense_Mutation_p.R48G|RP4-620F22.2_ENST00000437128.1_RNA			Q96PP8	GBP5_HUMAN	guanylate binding protein 5	48	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|endometrium(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)	24				all cancers(265;0.00784)|Epithelial(280;0.0286)		TTGCCAGTGCGATAGAGGCCC	0.498																																					p.R48G		.											.	GBP5	91	0			c.C142G						.						264.0	223.0	237.0					1																	89735097		2203	4300	6503	SO:0001583	missense	115362	exon3			CAGTGCGATAGAG	AF430642	CCDS722.1	1p22.2	2008-02-05			ENSG00000154451	ENSG00000154451			19895	protein-coding gene	gene with protein product		611467					Standard	NM_052942		Approved		uc001dnd.3	Q96PP8	OTTHUMG00000010006	ENST00000370459.3:c.142C>G	1.37:g.89735097G>C	ENSP00000359488:p.Arg48Gly	344.0	0.0		378.0	150.0	NM_052942	B2RCE1|Q86TM5	Missense_Mutation	SNP	ENST00000370459.3	37	CCDS722.1	.	.	.	.	.	.	.	.	.	.	G	17.59	3.427887	0.62733	.	.	ENSG00000154451	ENST00000343435;ENST00000370459;ENST00000443807	T;T;T	0.58358	0.34;0.34;0.34	5.0	5.0	0.66597	Guanylate-binding protein, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.63698	0.2533	M	0.86268	2.805	0.41544	D	0.988535	D	0.53619	0.961	P	0.53809	0.735	T	0.70766	-0.4783	10	0.87932	D	0	-4.7548	16.1665	0.81759	0.0:0.0:1.0:0.0	.	48	Q96PP8	GBP5_HUMAN	G	48	ENSP00000340396:R48G;ENSP00000359488:R48G;ENSP00000403010:R48G	ENSP00000340396:R48G	R	-	1	0	GBP5	89507685	1.000000	0.71417	1.000000	0.80357	0.037000	0.13140	6.780000	0.75063	2.762000	0.94881	0.655000	0.94253	CGC	.		0.498	GBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027700.1	NM_052942	
GFM2	84340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	74026206	74026206	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr5:74026206C>G	ENST00000296805.3	-	17	2062	c.1605G>C	c.(1603-1605)atG>atC	p.M535I	GFM2_ENST00000345239.2_Missense_Mutation_p.M488I|GFM2_ENST00000515125.1_Intron|GFM2_ENST00000509430.1_Missense_Mutation_p.M535I	NM_032380.3	NP_115756.2			G elongation factor, mitochondrial 2											breast(2)|endometrium(2)|large_intestine(4)|lung(5)|prostate(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)		GTAACTCCCCCATACCACACA	0.383																																					p.M535I		.											.	GFM2	90	0			c.G1605C						.						100.0	93.0	95.0					5																	74026206		2203	4300	6503	SO:0001583	missense	84340	exon17			CTCCCCCATACCA	AF111808	CCDS4023.1, CCDS4024.1, CCDS47232.1	5q13	2008-02-05			ENSG00000164347	ENSG00000164347			29682	protein-coding gene	gene with protein product		606544				11735030	Standard	NM_001281302		Approved	EFG2, FLJ21661	uc003kdh.1	Q969S9	OTTHUMG00000102058	ENST00000296805.3:c.1605G>C	5.37:g.74026206C>G	ENSP00000296805:p.Met535Ile	139.0	0.0		133.0	53.0	NM_032380		Missense_Mutation	SNP	ENST00000296805.3	37	CCDS4023.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.882003	0.91740	.	.	ENSG00000164347	ENST00000296805;ENST00000345239;ENST00000509430	T;T;T	0.76709	-1.04;-1.04;-1.04	5.64	5.64	0.86602	Elongation factor G/III/V (1);	0.000000	0.85682	D	0.000000	D	0.89262	0.6665	M	0.82056	2.57	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.85130	0.997;0.996;0.994	D	0.89986	0.4104	10	0.87932	D	0	-23.315	19.7116	0.96098	0.0:1.0:0.0:0.0	.	535;488;535	Q969S9-3;Q969S9-2;Q969S9	.;.;RRF2M_HUMAN	I	535;488;535	ENSP00000296805:M535I;ENSP00000296804:M488I;ENSP00000427004:M535I	ENSP00000296805:M535I	M	-	3	0	GFM2	74061962	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.595000	0.82710	2.673000	0.90976	0.555000	0.69702	ATG	.		0.383	GFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219860.2	NM_032380	
GLI3	2737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	42005030	42005030	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr7:42005030T>G	ENST00000395925.3	-	15	3725	c.3641A>C	c.(3640-3642)cAg>cCg	p.Q1214P	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	1214					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						CCCGAGGGTCTGATAGCCCCC	0.652									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.Q1214P		.											.	GLI3	1149	0			c.A3641C						.						48.0	57.0	54.0					7																	42005030		2203	4300	6503	SO:0001583	missense	2737	exon15	Familial Cancer Database	;	AGGGTCTGATAGC		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.3641A>C	7.37:g.42005030T>G	ENSP00000379258:p.Gln1214Pro	76.0	0.0		85.0	24.0	NM_000168	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	T	10.92	1.486905	0.26686	.	.	ENSG00000106571	ENST00000395925	T	0.14391	2.51	5.64	-3.29	0.05017	.	0.803221	0.11869	N	0.521607	T	0.06234	0.0161	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21381	-1.0247	10	0.38643	T	0.18	.	19.6624	0.95878	0.0:0.0:0.7125:0.2875	.	1214	P10071	GLI3_HUMAN	P	1214	ENSP00000379258:Q1214P	ENSP00000379258:Q1214P	Q	-	2	0	GLI3	41971555	0.007000	0.16637	0.000000	0.03702	0.044000	0.14063	0.897000	0.28390	-0.859000	0.04105	0.496000	0.49642	CAG	.		0.652	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
HNF1A	6927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	121426820	121426820	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr12:121426820C>T	ENST00000257555.6	+	2	737	c.511C>T	c.(511-513)Cga>Tga	p.R171*	HNF1A_ENST00000543427.1_Nonsense_Mutation_p.R54*|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000544413.1_Nonsense_Mutation_p.R171*|HNF1A_ENST00000402929.1_Nonsense_Mutation_p.R171*|HNF1A_ENST00000541395.1_Nonsense_Mutation_p.R171*|HNF1A_ENST00000400024.2_Nonsense_Mutation_p.R171*			P20823	HNF1A_HUMAN	HNF1 homeobox A	171					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CCGCAAGCAGCGAGAGGTGGC	0.617									Hepatic Adenoma, Familial Clustering of																												p.R171X		.											.	HNF1A	1745	0			c.C511T	GRCh37	CM971451	HNF1A	M		.						115.0	99.0	104.0					12																	121426820		2203	4300	6503	SO:0001587	stop_gained	6927	exon2	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	AAGCAGCGAGAGG	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.511C>T	12.37:g.121426820C>T	ENSP00000257555:p.Arg171*	81.0	0.0		81.0	30.0	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Nonsense_Mutation	SNP	ENST00000257555.6	37	CCDS9209.1	.	.	.	.	.	.	.	.	.	.	C	35	5.547882	0.96488	.	.	ENSG00000135100	ENST00000257555;ENST00000535125;ENST00000543536;ENST00000544680;ENST00000537424;ENST00000543027;ENST00000543427;ENST00000545458;ENST00000541395;ENST00000340577;ENST00000344370;ENST00000544413	.	.	.	4.91	4.91	0.64330	.	0.000000	0.53938	D	0.000049	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.1481	17.081	0.86598	0.0:1.0:0.0:0.0	.	.	.	.	X	171;171;171;171;171;171;54;171;171;171;171;171	.	ENSP00000257555:R171X	R	+	1	2	HNF1A	119911203	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.527000	0.35975	2.265000	0.75225	0.530000	0.56133	CGA	.		0.617	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
HNF1A	6927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	121431506	121431506	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr12:121431506A>G	ENST00000257555.6	+	3	936	c.710A>G	c.(709-711)aAt>aGt	p.N237S	HNF1A_ENST00000543427.1_Missense_Mutation_p.N120S|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000544413.1_Missense_Mutation_p.N237S|HNF1A_ENST00000402929.1_Missense_Mutation_p.N237S|HNF1A_ENST00000541395.1_Missense_Mutation_p.N237S|HNF1A_ENST00000400024.2_Missense_Mutation_p.N237S			P20823	HNF1A_HUMAN	HNF1 homeobox A	237			N -> S (in a hepatic multiple adenoma sample; somatic mutation). {ECO:0000269|PubMed:12355088}.		glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.N237S(4)|p.?(1)|p.N237fs*2(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GAGGAGTGCAATAGGTACAAC	0.587									Hepatic Adenoma, Familial Clustering of																												p.N237S		.											HNF1A,NS,other,0	HNF1A	1745	6	Substitution - Missense(4)|Unknown(1)|Insertion - Frameshift(1)	liver(6)	c.A710G						.						80.0	82.0	81.0					12																	121431506		2203	4300	6503	SO:0001583	missense	6927	exon3	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	AGTGCAATAGGTA	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.710A>G	12.37:g.121431506A>G	ENSP00000257555:p.Asn237Ser	60.0	0.0		70.0	28.0	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	ENST00000257555.6	37	CCDS9209.1	.	.	.	.	.	.	.	.	.	.	A	15.39	2.818815	0.50633	.	.	ENSG00000135100	ENST00000257555;ENST00000535125;ENST00000543536;ENST00000544680;ENST00000537424;ENST00000543427;ENST00000545458;ENST00000541395;ENST00000340577;ENST00000344370;ENST00000544413	D;D;D;D	0.95853	-3.83;-3.83;-3.83;-3.83	4.45	4.45	0.53987	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.075184	0.53938	D	0.000051	D	0.95166	0.8433	M	0.70595	2.14	0.80722	D	1	B;B;B;P	0.37864	0.304;0.353;0.353;0.61	B;B;B;B	0.43155	0.12;0.283;0.19;0.41	D	0.95388	0.8479	10	0.87932	D	0	-16.729	12.937	0.58320	1.0:0.0:0.0:0.0	.	237;237;237;237	F5H0K0;P20823;E7EUQ4;E7EMR0	.;HNF1A_HUMAN;.;.	S	237;237;237;237;237;120;237;237;237;237;237	ENSP00000257555:N237S;ENSP00000439721:N120S;ENSP00000443112:N237S;ENSP00000438804:N237S	ENSP00000257555:N237S	N	+	2	0	HNF1A	119915889	1.000000	0.71417	0.982000	0.44146	0.547000	0.35210	8.726000	0.91474	1.662000	0.50781	0.423000	0.28283	AAT	.		0.587	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
HTR7	3363	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	92509305	92509305	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr10:92509305C>A	ENST00000336152.3	-	2	612	c.586G>T	c.(586-588)Ggg>Tgg	p.G196W	HTR7_ENST00000371721.3_Missense_Mutation_p.G196W|HTR7_ENST00000371719.2_Missense_Mutation_p.G196W|HTR7_ENST00000277874.6_Missense_Mutation_p.G196W	NM_019859.3	NP_062873.1	P34969	5HT7R_HUMAN	5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled	196					blood circulation (GO:0008015)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30					Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Eletriptan(DB00216)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Methysergide(DB00247)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	ATGCATTTCCCATTCTGCCTC	0.483																																					p.G196W		.											.	HTR7	91	0			c.G586T						.						118.0	120.0	119.0					10																	92509305		2203	4300	6503	SO:0001583	missense	3363	exon2			ATTTCCCATTCTG	BC047526	CCDS7408.1, CCDS7409.1, CCDS7410.1	10q21-q24	2012-08-08	2012-02-03		ENSG00000148680	ENSG00000148680		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5302	protein-coding gene	gene with protein product		182137	"""5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled)"""			8226867	Standard	NM_000872		Approved	5-HT7	uc001kha.3	P34969	OTTHUMG00000018732	ENST00000336152.3:c.586G>T	10.37:g.92509305C>A	ENSP00000337949:p.Gly196Trp	92.0	0.0		137.0	52.0	NM_019860	B5BUP6|P78336|P78372|P78516|Q5VX01|Q5VX02|Q5VX03	Missense_Mutation	SNP	ENST00000336152.3	37	CCDS7408.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.947014	0.73672	.	.	ENSG00000148680	ENST00000336152;ENST00000277874;ENST00000371719;ENST00000371721	T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64	5.44	5.44	0.79542	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.86377	0.5918	M	0.85197	2.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.86957	0.2089	10	0.56958	D	0.05	.	19.4432	0.94831	0.0:1.0:0.0:0.0	.	196;196	P34969;P34969-2	5HT7R_HUMAN;.	W	196	ENSP00000337949:G196W;ENSP00000277874:G196W;ENSP00000360784:G196W;ENSP00000360786:G196W	ENSP00000277874:G196W	G	-	1	0	HTR7	92499285	1.000000	0.71417	0.999000	0.59377	0.613000	0.37349	5.932000	0.70121	2.833000	0.97629	0.650000	0.86243	GGG	.		0.483	HTR7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049343.1	NM_000872	
HTT	3064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	3190808	3190808	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr4:3190808A>G	ENST00000355072.5	+	40	5501	c.5356A>G	c.(5356-5358)Atc>Gtc	p.I1786V		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1786					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		TCTGATCCACATCTTCAAGTC	0.463																																					p.I1786V		.											.	HTT	281	0			c.A5356G						.						184.0	172.0	176.0					4																	3190808		1973	4175	6148	SO:0001583	missense	3064	exon40			ATCCACATCTTCA	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.5356A>G	4.37:g.3190808A>G	ENSP00000347184:p.Ile1786Val	255.0	0.0		288.0	112.0	NM_002111	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	A	13.00	2.106501	0.37145	.	.	ENSG00000197386	ENST00000355072	T	0.05319	3.46	5.29	4.1	0.47936	.	0.065772	0.64402	D	0.000010	T	0.07279	0.0184	L	0.42686	1.345	0.45962	D	0.998788	B	0.13145	0.007	B	0.17098	0.017	T	0.15896	-1.0421	10	0.44086	T	0.13	.	11.3035	0.49320	0.9278:0.0:0.0722:0.0	.	1786	P42858	HD_HUMAN	V	1786	ENSP00000347184:I1786V	ENSP00000347184:I1786V	I	+	1	0	HTT	3160606	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.307000	0.59123	0.944000	0.37579	0.533000	0.62120	ATC	.		0.463	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
HYAL3	8372	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	50332788	50332788	+	Silent	SNP	G	G	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr3:50332788G>A	ENST00000336307.1	-	2	518	c.246C>T	c.(244-246)ccC>ccT	p.P82P	IFRD2_ENST00000429673.2_5'Flank|IFRD2_ENST00000417626.2_5'Flank|HYAL3_ENST00000359051.3_Silent_p.P82P|HYAL3_ENST00000450982.1_Silent_p.P82P|HYAL3_ENST00000415204.1_Intron|HYAL3_ENST00000513170.1_Intron|IFRD2_ENST00000436390.1_5'Flank|IFRD2_ENST00000336089.4_5'Flank	NM_001200029.1|NM_003549.3	NP_001186958.1|NP_003540.2	O43820	HYAL3_HUMAN	hyaluronoglucosaminidase 3	82					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV-B (GO:0071493)|hyaluronan catabolic process (GO:0030214)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)|response to virus (GO:0009615)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|lysosome (GO:0005764)	hyaluronoglucuronidase activity (GO:0033906)|hyalurononglucosaminidase activity (GO:0004415)			central_nervous_system(1)|endometrium(2)|kidney(1)|lung(5)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GTCCAAAGTAGGGATAGAGGC	0.577																																					p.P82P		.											.	HYAL3	279	0			c.C246T						.						145.0	134.0	138.0					3																	50332788		2203	4300	6503	SO:0001819	synonymous_variant	8372	exon2			AAAGTAGGGATAG	AF040710	CCDS2815.1, CCDS56259.1, CCDS56260.1, CCDS56257.1	3p21.3	2004-03-12			ENSG00000186792	ENSG00000186792			5322	protein-coding gene	gene with protein product		604038				10493834	Standard	NM_003549		Approved	LUCA-3, LUCA14, Minna14	uc021wyn.1	O43820	OTTHUMG00000156936	ENST00000336307.1:c.246C>T	3.37:g.50332788G>A		86.0	0.0		61.0	18.0	NM_001200030	O60540|Q8NFK2|Q8NFK3|Q8NFK4|Q96E56|Q9BRW9	Silent	SNP	ENST00000336307.1	37	CCDS2815.1																																																																																			.		0.577	HYAL3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000346664.1	NM_003549	
IDS	3423	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	148582537	148582537	+	Silent	SNP	C	C	T	rs201892132		TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chrX:148582537C>T	ENST00000340855.6	-	4	659	c.450G>A	c.(448-450)ccG>ccA	p.P150P	IDS_ENST00000490775.1_5'UTR|IDS_ENST00000370443.4_Silent_p.P150P|IDS_ENST00000370441.4_Silent_p.P150P|IDS_ENST00000422081.2_5'UTR|IDS_ENST00000541269.1_5'UTR|IDS_ENST00000427113.2_5'Flank	NM_000202.5|NM_001166550.1	NP_000193.1|NP_001160022.1	P22304	IDS_HUMAN	iduronate 2-sulfatase	150					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	lysosomal lumen (GO:0043202)	iduronate-2-sulfatase activity (GO:0004423)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(5)|large_intestine(2)|lung(8)|prostate(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					ACCAGCTATACGGAGAATCAT	0.383																																					p.P150P		.											.	IDS	130	0			c.G450A						.	C	,,	0,3835		0,0,1632,571	134.0	122.0	126.0		450,180,450	-2.1	1.0	X		126	1,6727		0,1,2427,1872	no	coding-synonymous,coding-synonymous,coding-synonymous	IDS	NM_000202.5,NM_001166550.1,NM_006123.4	,,	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	,,	150/551,60/461,150/344	148582537	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	3423	exon4			GCTATACGGAGAA	M58342	CCDS14685.1, CCDS14686.1	Xq27.3-q28	2012-10-02	2008-08-01		ENSG00000010404	ENSG00000010404	3.1.6.13		5389	protein-coding gene	gene with protein product	"""Hunter syndrome"""	300823		SIDS			Standard	NM_006123		Approved		uc011mxe.2	P22304	OTTHUMG00000022615	ENST00000340855.6:c.450G>A	X.37:g.148582537C>T		95.0	0.0		99.0	41.0	NM_006123	D3DWT4|Q14604|Q9BRM3	Silent	SNP	ENST00000340855.6	37	CCDS14685.1																																																																																			.		0.383	IDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058677.3		
ITFG2	55846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	2933099	2933099	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr12:2933099G>T	ENST00000228799.2	+	11	1369	c.1230G>T	c.(1228-1230)gaG>gaT	p.E410D	ITFG2_ENST00000419778.2_Missense_Mutation_p.E233D|ITFG2_ENST00000542548.1_Missense_Mutation_p.E298D	NM_018463.3	NP_060933.3	Q969R8	ITFG2_HUMAN	integrin alpha FG-GAP repeat containing 2	410					germinal center B cell differentiation (GO:0002314)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(13)|upper_aerodigestive_tract(2)	19			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			TGCTGCAGGAGCTGGGCGTGG	0.607																																					p.E410D		.											.	ITFG2	90	0			c.G1230T						.						68.0	70.0	70.0					12																	2933099		2203	4300	6503	SO:0001583	missense	55846	exon11			GCAGGAGCTGGGC	AF220048	CCDS8513.1	12p13.33	2006-11-29		2006-07-25	ENSG00000111203	ENSG00000111203			30879	protein-coding gene	gene with protein product						12477932	Standard	NM_018463		Approved	MDS028	uc001qlb.2	Q969R8	OTTHUMG00000130617	ENST00000228799.2:c.1230G>T	12.37:g.2933099G>T	ENSP00000228799:p.Glu410Asp	83.0	0.0		85.0	33.0	NM_018463	A8K4Z5|D3DUQ2|Q6PKU5|Q96SX6	Missense_Mutation	SNP	ENST00000228799.2	37	CCDS8513.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.52|14.52	2.560129|2.560129	0.45590|0.45590	.|.	.|.	ENSG00000111203|ENSG00000111203	ENST00000228799;ENST00000419778;ENST00000542548|ENST00000540662	T;T;T|.	0.09350|.	2.99;2.99;2.99|.	5.33|5.33	4.43|4.43	0.53597|0.53597	.|.	0.401000|.	0.27802|.	N|.	0.017788|.	T|T	0.70806|0.70806	0.3266|0.3266	M|M	0.67953|0.67953	2.075|2.075	0.44834|0.44834	D|D	0.997845|0.997845	P|.	0.38922|.	0.651|.	B|.	0.33521|.	0.165|.	T|T	0.70385|0.70385	-0.4886|-0.4886	10|5	0.62326|.	D|.	0.03|.	-3.4622|-3.4622	13.4961|13.4961	0.61426|0.61426	0.0772:0.0:0.9228:0.0|0.0772:0.0:0.9228:0.0	.|.	410|.	Q969R8|.	ITFG2_HUMAN|.	D|I	410;233;298|31	ENSP00000228799:E410D;ENSP00000401103:E233D;ENSP00000437870:E298D|.	ENSP00000228799:E410D|.	E|S	+|+	3|2	2|0	ITFG2|ITFG2	2803360|2803360	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	2.236000|2.236000	0.43052|0.43052	2.492000|2.492000	0.84095|0.84095	0.561000|0.561000	0.74099|0.74099	GAG|AGC	.		0.607	ITFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253091.1	NM_018463	
ITGA9	3680	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	37695227	37695227	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr3:37695227G>A	ENST00000264741.5	+	17	2118	c.1862G>A	c.(1861-1863)cGt>cAt	p.R621H		NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	621					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.R621L(1)		breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		AGGAATTGCCGTTCAGAGGAC	0.498																																					p.R621H		.											.	ITGA9	715	1	Substitution - Missense(1)	central_nervous_system(1)	c.G1862A						.						141.0	140.0	140.0					3																	37695227		2203	4300	6503	SO:0001583	missense	3680	exon17			ATTGCCGTTCAGA	L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.1862G>A	3.37:g.37695227G>A	ENSP00000264741:p.Arg621His	179.0	0.0		164.0	61.0	NM_002207	Q14638	Missense_Mutation	SNP	ENST00000264741.5	37	CCDS2669.1	.	.	.	.	.	.	.	.	.	.	G	9.966	1.224044	0.22457	.	.	ENSG00000144668	ENST00000264741	T	0.46063	0.88	5.85	-2.75	0.05914	Integrin alpha-2 (1);	0.660409	0.16331	N	0.219124	T	0.36690	0.0976	L	0.36672	1.1	0.09310	N	0.999999	P	0.38800	0.648	P	0.44477	0.451	T	0.39440	-0.9614	10	0.52906	T	0.07	.	13.4039	0.60900	0.5528:0.0:0.4472:0.0	.	621	Q13797	ITA9_HUMAN	H	621	ENSP00000264741:R621H	ENSP00000264741:R621H	R	+	2	0	ITGA9	37670231	0.024000	0.19004	0.005000	0.12908	0.098000	0.18820	0.106000	0.15354	-0.632000	0.05553	-1.969000	0.00466	CGT	.		0.498	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253361.1	NM_002207	
ITK	3702	broad.mit.edu;bcgsc.ca	37	5	156675955	156675955	+	Silent	SNP	T	T	C			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr5:156675955T>C	ENST00000422843.3	+	16	1881	c.1729T>C	c.(1729-1731)Ttg>Ctg	p.L577L	ITK_ENST00000519749.1_3'UTR	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	577	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	CGGATTTCGGTTGTACAAGCC	0.498			T	SYK	peripheral T-cell lymphoma																																p.L577L	Esophageal Squamous(70;1378 1469 8785 19883)	.		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	.	ITK	1427	0			c.T1729C						.						131.0	109.0	116.0					5																	156675955		2203	4300	6503	SO:0001819	synonymous_variant	3702	exon16			TTTCGGTTGTACA	D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.1729T>C	5.37:g.156675955T>C		68.0	1.0		85.0	6.0	NM_005546	B2R752|Q32ML7	Silent	SNP	ENST00000422843.3	37	CCDS4336.1																																																																																			.		0.498	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2		
KDM7A	80853	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	139798778	139798778	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr7:139798778C>T	ENST00000397560.2	-	14	1916	c.1819G>A	c.(1819-1821)Gaa>Aaa	p.E607K	JHDM1D_ENST00000006967.5_Missense_Mutation_p.E607K	NM_030647.1	NP_085150.1	Q6ZMT4	KDM7A_HUMAN		607					histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|midbrain development (GO:0030901)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)	22	Melanoma(164;0.0142)					TTATCCTCTTCATTTTCACTA	0.373																																					p.E607K		.											.	JHDM1D	91	0			c.G1819A						.						165.0	148.0	154.0					7																	139798778		1828	4086	5914	SO:0001583	missense	80853	exon14			CCTCTTCATTTTC																												ENST00000397560.2:c.1819G>A	7.37:g.139798778C>T	ENSP00000380692:p.Glu607Lys	341.0	2.0		444.0	107.0	NM_030647	A4D1S9|C9JJH9|C9JQU2|Q6MZL8|Q9C0E5	Missense_Mutation	SNP	ENST00000397560.2	37	CCDS43658.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.289941	0.80914	.	.	ENSG00000006459	ENST00000397560;ENST00000006967	T;T	0.48836	0.8;0.8	5.99	5.99	0.97316	.	0.232454	0.44902	D	0.000406	T	0.46795	0.1411	L	0.56769	1.78	0.51233	D	0.999911	B	0.30406	0.278	B	0.24974	0.057	T	0.33369	-0.9871	10	0.21540	T	0.41	-25.1513	20.4488	0.99124	0.0:1.0:0.0:0.0	.	607	Q6ZMT4	KDM7_HUMAN	K	607	ENSP00000380692:E607K;ENSP00000006967:E607K	ENSP00000006967:E607K	E	-	1	0	JHDM1D	139445247	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.527000	0.53517	2.843000	0.97960	0.655000	0.94253	GAA	.		0.373	JHDM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348460.1		
KALRN	8997	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	123987858	123987858	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr3:123987858C>T	ENST00000240874.3	+	5	876	c.719C>T	c.(718-720)gCc>gTc	p.A240V	KALRN_ENST00000360013.3_Missense_Mutation_p.A240V|KALRN_ENST00000460856.1_Missense_Mutation_p.A240V	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	240					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						GTGCTGAAGGCCCCTGTGGAG	0.627																																					p.A240V		.											.	KALRN	738	0			c.C719T						.						24.0	23.0	24.0					3																	123987858		2202	4300	6502	SO:0001583	missense	8997	exon5			TGAAGGCCCCTGT	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.719C>T	3.37:g.123987858C>T	ENSP00000240874:p.Ala240Val	195.0	0.0		230.0	17.0	NM_003947	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000240874.3	37	CCDS3027.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.9|24.9	4.580939|4.580939	0.86748|0.86748	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013|ENST00000448253;ENST00000354186	T;T;T|.	0.67698|.	-0.28;-0.28;-0.28|.	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77471|0.77471	0.4135|0.4135	M|M	0.76170|0.76170	2.325|2.325	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.998;0.993;0.999|.	D;D;D|.	0.77004|.	0.975;0.978;0.989|.	T|T	0.75986|0.75986	-0.3124|-0.3124	10|5	0.28530|.	T|.	0.3|.	.|.	19.5125|19.5125	0.95148|0.95148	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	240;240;240|.	C9IZQ6;O60229;O60229-2|.	.;KALRN_HUMAN;.|.	V|S	240|268;218	ENSP00000418611:A240V;ENSP00000240874:A240V;ENSP00000353109:A240V|.	ENSP00000240874:A240V|.	A|P	+|+	2|1	0|0	KALRN|KALRN	125470548|125470548	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	5.685000|5.685000	0.68204|0.68204	2.840000|2.840000	0.97914|0.97914	0.655000|0.655000	0.94253|0.94253	GCC|CCC	.		0.627	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947	
KPNB1	3837	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	45757446	45757446	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr17:45757446C>T	ENST00000290158.4	+	20	2821	c.2414C>T	c.(2413-2415)gCt>gTt	p.A805V	KPNB1_ENST00000537679.1_Missense_Mutation_p.A589V|KPNB1_ENST00000535458.2_Missense_Mutation_p.A660V|KPNB1_ENST00000540627.1_Missense_Mutation_p.A660V|RP11-138C9.1_ENST00000578482.1_RNA	NM_001276453.1|NM_002265.4	NP_001263382.1|NP_002256.2	Q14974	IMB1_HUMAN	karyopherin (importin) beta 1	805					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|protein import into nucleus (GO:0006606)|protein import into nucleus, translocation (GO:0000060)|ribosomal protein import into nucleus (GO:0006610)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(1)|ovary(1)|pancreas(1)|skin(1)	4						GACCACATTGCTGGAGATGAG	0.448																																					p.I805I		.											.	KPNB1	229	0			c.T2414T						.						230.0	234.0	233.0					17																	45757446		2203	4300	6503	SO:0001583	missense	3837	exon20			ACATTGCTGGAGA	L39793	CCDS11513.1, CCDS62228.1	17q21.32	2013-02-14			ENSG00000108424	ENSG00000108424		"""Importins"", ""Armadillo repeat containing"""	6400	protein-coding gene	gene with protein product	"""importin 1"""	602738				7615630, 7627554	Standard	NM_002265		Approved	NTF97, IPOB, MGC2155, MGC2156, MGC2157, IMB1, Impnb, IPO1	uc002ilt.2	Q14974	OTTHUMG00000036957	ENST00000290158.4:c.2414C>T	17.37:g.45757446C>T	ENSP00000290158:p.Ala805Val	110.0	0.0		111.0	8.0	NM_002265	B7ZAV6|D3DTT3|Q14637|Q53XN2|Q96J27	Silent	SNP	ENST00000290158.4	37	CCDS11513.1	.	.	.	.	.	.	.	.	.	.	C	17.53	3.412134	0.62511	.	.	ENSG00000108424	ENST00000535458;ENST00000290158;ENST00000540627;ENST00000537679	T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34	5.28	5.28	0.74379	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.72407	0.3456	M	0.67700	2.07	0.40882	D	0.984005	D;P	0.58970	0.984;0.926	P;B	0.48627	0.584;0.304	T	0.74902	-0.3506	9	0.40728	T	0.16	-20.4515	18.9028	0.92449	0.0:1.0:0.0:0.0	.	589;805	F5H4R7;Q14974	.;IMB1_HUMAN	V	660;805;660;589	ENSP00000438253:A660V;ENSP00000290158:A805V;ENSP00000438964:A660V;ENSP00000445006:A589V	ENSP00000290158:A805V	A	+	2	0	KPNB1	43112445	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.588000	0.82629	2.470000	0.83445	0.563000	0.77884	GCT	.		0.448	KPNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089755.2	NM_002265	
LARGE	9215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	33670561	33670561	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr22:33670561T>A	ENST00000354992.2	-	16	2694	c.2123A>T	c.(2122-2124)cAt>cTt	p.H708L	LARGE_ENST00000402320.1_Missense_Mutation_p.H656L|LARGE_ENST00000437602.2_Missense_Mutation_p.H659L|LARGE_ENST00000337431.2_Missense_Mutation_p.H656L|LARGE_ENST00000452586.2_Missense_Mutation_p.H507L|LARGE_ENST00000397394.2_Missense_Mutation_p.H708L	NM_004737.4	NP_004728.1	O95461	LARGE_HUMAN	like-glycosyltransferase	708					glycoprotein biosynthetic process (GO:0009101)|glycosphingolipid biosynthetic process (GO:0006688)|muscle cell cellular homeostasis (GO:0046716)|N-acetylglucosamine metabolic process (GO:0006044)|protein glycosylation (GO:0006486)	integral component of Golgi membrane (GO:0030173)	acetylglucosaminyltransferase activity (GO:0008375)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(1;0.219)				GCTGGGGGCATGAGGCATGTG	0.537											OREG0026497	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H708L	Colon(70;397 1175 4573 19089 45288)	.											.	LARGE	92	0			c.A2123T						.						147.0	120.0	129.0					22																	33670561		2203	4300	6503	SO:0001583	missense	9215	exon16			GGGGCATGAGGCA	AJ007583	CCDS13912.1	22q12.3	2013-02-22			ENSG00000133424	ENSG00000133424		"""Glycosyltransferase family 8 domain containing"""	6511	protein-coding gene	gene with protein product		603590				9892679, 10591208, 12966029	Standard	NM_004737		Approved	KIAA0609	uc003ane.4	O95461	OTTHUMG00000150914	ENST00000354992.2:c.2123A>T	22.37:g.33670561T>A	ENSP00000347088:p.His708Leu	146.0	0.0	841	149.0	53.0	NM_004737	B0QXZ7|O60348|Q17R80|Q9UGD1|Q9UGE7|Q9UGG3|Q9UGZ8|Q9UH22	Missense_Mutation	SNP	ENST00000354992.2	37	CCDS13912.1	.	.	.	.	.	.	.	.	.	.	T	31	5.059072	0.93846	.	.	ENSG00000133424	ENST00000354992;ENST00000337431;ENST00000397394;ENST00000402320;ENST00000452586;ENST00000437602	T;T;T;T;T;T	0.41758	2.08;0.99;2.08;0.99;2.08;0.99	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.70988	0.3287	M	0.88181	2.935	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;1.0;0.999	D;D;D;D	0.97110	1.0;0.96;1.0;0.978	T	0.75508	-0.3293	10	0.54805	T	0.06	-7.4884	16.8061	0.85666	0.0:0.0:0.0:1.0	.	659;507;656;708	B7Z2I9;E9PH73;O95461-2;O95461	.;.;.;LARGE_HUMAN	L	708;656;708;656;507;659	ENSP00000347088:H708L;ENSP00000336636:H656L;ENSP00000380549:H708L;ENSP00000385223:H656L;ENSP00000407917:H507L;ENSP00000388544:H659L	ENSP00000336636:H656L	H	-	2	0	LARGE	32000561	1.000000	0.71417	0.983000	0.44433	0.984000	0.73092	7.554000	0.82212	2.367000	0.80283	0.528000	0.53228	CAT	.		0.537	LARGE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320515.2	NM_133642	
LCNL1	401562	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	139878137	139878137	+	Silent	SNP	G	G	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr9:139878137G>T	ENST00000408973.2	+	1	693	c.99G>T	c.(97-99)ctG>ctT	p.L33L		NM_207510.3	NP_997393.3	Q6ZST4	LCNL1_HUMAN	lipocalin-like 1	33																	ATGGTGACCTGGCCCTCAAGT	0.572																																					p.L33L		.											.	.	.	0			c.G99T						.						114.0	122.0	119.0					9																	139878137		2066	4190	6256	SO:0001819	synonymous_variant	401562	exon1			TGACCTGGCCCTC		CCDS43908.1	9q34.3	2014-01-22			ENSG00000214402	ENSG00000214402		"""Lipocalins"""	34436	protein-coding gene	gene with protein product							Standard	NM_207510		Approved	FLJ45224	uc004ckh.1	Q6ZST4	OTTHUMG00000159546	ENST00000408973.2:c.99G>T	9.37:g.139878137G>T		158.0	1.0		159.0	54.0	NM_207510		Silent	SNP	ENST00000408973.2	37	CCDS43908.1																																																																																			.		0.572	LCNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356128.1	NM_207510	
LTBP1	4052	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	33172789	33172789	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr2:33172789A>G	ENST00000404816.2	+	1	751	c.398A>G	c.(397-399)aAa>aGa	p.K133R	LTBP1_ENST00000354476.3_Missense_Mutation_p.K133R|Y_RNA_ENST00000384224.1_RNA			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	133					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CCGTTCACCAAACAAGGCAGG	0.731																																					p.K133R		.											.	LTBP1	230	0			c.A398G						.						8.0	8.0	8.0					2																	33172789		1560	2936	4496	SO:0001583	missense	4052	exon1			TCACCAAACAAGG		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.398A>G	2.37:g.33172789A>G	ENSP00000386043:p.Lys133Arg	56.0	0.0		70.0	19.0	NM_206943	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	37	CCDS33177.2	.	.	.	.	.	.	.	.	.	.	A	2.223	-0.377905	0.05000	.	.	ENSG00000049323	ENST00000404816;ENST00000354476	T;T	0.81247	-1.47;-1.45	3.86	-1.58	0.08479	.	.	.	.	.	T	0.57873	0.2083	N	0.24115	0.695	0.22226	N	0.999277	B	0.13594	0.008	B	0.09377	0.004	T	0.46091	-0.9216	9	0.02654	T	1	.	4.302	0.10928	0.5491:0.1676:0.2833:0.0	.	133	Q14766-4	.	R	133	ENSP00000386043:K133R;ENSP00000346467:K133R	ENSP00000346467:K133R	K	+	2	0	LTBP1	33026293	0.069000	0.21087	0.177000	0.23020	0.983000	0.72400	-0.075000	0.11431	-0.376000	0.07943	-0.411000	0.06167	AAA	.		0.731	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
LUZP2	338645	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	25100161	25100161	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr11:25100161C>A	ENST00000336930.6	+	12	1064	c.998C>A	c.(997-999)aCc>aAc	p.T333N	LUZP2_ENST00000533227.1_Missense_Mutation_p.T247N			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2	333						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						AAACCATTGACCAGCTTTGAA	0.348																																					p.T333N		.											.	LUZP2	92	0			c.C998A						.						84.0	88.0	87.0					11																	25100161		2203	4300	6503	SO:0001583	missense	338645	exon12			CATTGACCAGCTT	AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.998C>A	11.37:g.25100161C>A	ENSP00000336817:p.Thr333Asn	70.0	1.0		71.0	23.0	NM_001009909	A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Missense_Mutation	SNP	ENST00000336930.6	37	CCDS31446.1	.	.	.	.	.	.	.	.	.	.	C	3.063	-0.192755	0.06259	.	.	ENSG00000187398	ENST00000336930;ENST00000533227	T;T	0.45668	0.89;0.89	5.23	0.0848	0.14439	.	0.769546	0.11668	N	0.541122	T	0.22003	0.0530	N	0.14661	0.345	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.09377	0.004;0.004	T	0.23904	-1.0175	10	0.20046	T	0.44	-0.1079	8.0412	0.30523	0.568:0.2973:0.1347:0.0	.	247;333	E9PN53;Q86TE4	.;LUZP2_HUMAN	N	333;247	ENSP00000336817:T333N;ENSP00000432952:T247N	ENSP00000336817:T333N	T	+	2	0	LUZP2	25056737	0.034000	0.19679	0.164000	0.22755	0.177000	0.22998	0.174000	0.16743	0.234000	0.21139	-0.293000	0.09583	ACC	.		0.348	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387861.1	NM_001009909	
MAN2B2	23324	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	6595009	6595009	+	Missense_Mutation	SNP	G	G	A	rs552037144		TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr4:6595009G>A	ENST00000285599.3	+	6	826	c.790G>A	c.(790-792)Gag>Aag	p.E264K	MAN2B2_ENST00000504248.1_Missense_Mutation_p.E264K	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	264					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						CCTCTATGCCGAGGCCCTGGT	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		20493	0.0		0.0	False		,,,				2504	0.001				p.E264K		.											.	MAN2B2	92	0			c.G790A						.						112.0	91.0	99.0					4																	6595009		2203	4300	6503	SO:0001583	missense	23324	exon6			TATGCCGAGGCCC	BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.790G>A	4.37:g.6595009G>A	ENSP00000285599:p.Glu264Lys	125.0	0.0		112.0	7.0	NM_015274	Q66MP2|Q86T67	Missense_Mutation	SNP	ENST00000285599.3	37	CCDS33951.1	.	.	.	.	.	.	.	.	.	.	G	7.956	0.745897	0.15710	.	.	ENSG00000013288	ENST00000285599;ENST00000504248	T;T	0.24908	1.83;1.83	4.59	-2.69	0.06022	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.892334	0.09864	N	0.745779	T	0.10723	0.0262	N	0.11789	0.175	0.09310	N	1	B;B;B	0.26363	0.012;0.012;0.147	B;B;B	0.15484	0.008;0.005;0.013	T	0.34204	-0.9838	10	0.18710	T	0.47	-2.6284	7.4724	0.27357	0.2368:0.2782:0.4849:0.0	.	264;264;264	E9PCD7;Q9Y2E5;Q9Y2E5-2	.;MA2B2_HUMAN;.	K	264	ENSP00000285599:E264K;ENSP00000423129:E264K	ENSP00000285599:E264K	E	+	1	0	MAN2B2	6645910	0.000000	0.05858	0.000000	0.03702	0.197000	0.23852	-0.595000	0.05727	-0.559000	0.06110	0.549000	0.68633	GAG	.		0.622	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359106.2	NM_015274	
MGAM	8972	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	141726934	141726934	+	Silent	SNP	G	G	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr7:141726934G>T	ENST00000549489.2	+	9	1097	c.1002G>T	c.(1000-1002)gcG>gcT	p.A334A	MGAM_ENST00000475668.2_Silent_p.A334A	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	334	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TTCAGCCTGCGCCAGCCATCA	0.383																																					p.A334A		.											.	MGAM	70	0			c.G1002T						.						132.0	122.0	125.0					7																	141726934		1877	4118	5995	SO:0001819	synonymous_variant	8972	exon9			GCCTGCGCCAGCC	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.1002G>T	7.37:g.141726934G>T		101.0	0.0		183.0	55.0	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000549489.2	37	CCDS47727.1																																																																																			.		0.383	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
MICAL3	57553	broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	18300440	18300440	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr22:18300440G>C	ENST00000441493.2	-	26	5339	c.4987C>G	c.(4987-4989)Ctg>Gtg	p.L1663V	MICAL3_ENST00000580469.1_5'Flank	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1663					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		TCATGCTTCAGGGTGGGCTCC	0.692																																					p.L1663V		.											.	MICAL3	68	0			c.C4987G						.						19.0	23.0	22.0					22																	18300440		1897	4095	5992	SO:0001583	missense	57553	exon26			GCTTCAGGGTGGG	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.4987C>G	22.37:g.18300440G>C	ENSP00000416015:p.Leu1663Val	58.0	0.0		55.0	19.0	NM_015241	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	37	CCDS46659.1	.	.	.	.	.	.	.	.	.	.	G	9.751	1.167536	0.21621	.	.	ENSG00000093100	ENST00000441493	T	0.63255	-0.03	5.18	1.95	0.26073	.	0.664065	0.14187	N	0.335604	T	0.42698	0.1214	L	0.27053	0.805	0.80722	D	1	P	0.35433	0.501	B	0.29785	0.107	T	0.08659	-1.0711	10	0.23891	T	0.37	.	9.297	0.37822	0.2917:0.0:0.7083:0.0	.	1663	Q7RTP6	MICA3_HUMAN	V	1663	ENSP00000416015:L1663V	ENSP00000416015:L1663V	L	-	1	2	XXbac-B461K10.4	16680440	.	.	0.079000	0.20413	0.648000	0.38561	.	.	0.207000	0.20607	-0.291000	0.09656	CTG	.		0.692	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	49425236	49425236	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr12:49425236delC	ENST00000301067.7	-	39	13251	c.13252delG	c.(13252-13254)gaafs	p.E4418fs		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	4418					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TCCCGAGGTTCCTGCTTGATG	0.602																																					p.E4418fs		.											.	MLL2	612	0			c.13252delG						.						35.0	36.0	35.0					12																	49425236		2018	4180	6198	SO:0001589	frameshift_variant	8085	exon39			GAGGTTCCTGCTT	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.13252delG	12.37:g.49425236delC	ENSP00000301067:p.Glu4418fs	137.0	0.0		99.0	34.0	NM_003482	O14687	Frame_Shift_Del	DEL	ENST00000301067.7	37	CCDS44873.1																																																																																			.		0.602	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
KMT2E	55904	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	104747073	104747073	+	Missense_Mutation	SNP	A	A	G	rs200234811		TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr7:104747073A>G	ENST00000311117.3	+	20	3246	c.2701A>G	c.(2701-2703)Acc>Gcc	p.T901A	KMT2E_ENST00000334914.7_5'UTR|KMT2E_ENST00000334877.4_Missense_Mutation_p.T901A|KMT2E_ENST00000257745.4_Missense_Mutation_p.T901A|CTB-152G17.6_ENST00000607968.1_RNA	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	901					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										ACCAACTCACACCGATATTAC	0.408																																					p.T901A		.											.	MLL5	93	0			c.A2701G						.						160.0	161.0	160.0					7																	104747073		2203	4300	6503	SO:0001583	missense	55904	exon19			ACTCACACCGATA	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.2701A>G	7.37:g.104747073A>G	ENSP00000312379:p.Thr901Ala	166.0	1.0		208.0	59.0	NM_018682	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	37	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	A	10.44	1.352214	0.24512	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745	D;D;D	0.90900	-2.75;-2.41;-2.75	5.34	-1.4	0.08968	.	0.451386	0.23000	N	0.053098	T	0.79551	0.4465	N	0.14661	0.345	0.27152	N	0.961385	B	0.02656	0.0	B	0.01281	0.0	T	0.67011	-0.5778	10	0.41790	T	0.15	.	11.0302	0.47767	0.5138:0.0:0.4862:0.0	.	901	Q8IZD2	MLL5_HUMAN	A	901;901;901;821;901	ENSP00000312379:T901A;ENSP00000335599:T901A;ENSP00000257745:T901A	ENSP00000257745:T901A	T	+	1	0	MLL5	104534309	0.882000	0.30256	0.388000	0.26195	0.989000	0.77384	0.417000	0.21214	-0.189000	0.10482	0.477000	0.44152	ACC	.		0.408	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
NDST1	3340	ucsc.edu;bcgsc.ca;mdanderson.org	37	5	149927947	149927947	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr5:149927947C>A	ENST00000261797.6	+	12	2815	c.2313C>A	c.(2311-2313)aaC>aaA	p.N771K	NDST1_ENST00000523767.1_Intron	NM_001543.4	NP_001534.1	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1	771	Heparan sulfate N-sulfotransferase 1.				carbohydrate metabolic process (GO:0005975)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|midbrain development (GO:0030901)|polysaccharide biosynthetic process (GO:0000271)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	34		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATCACGCCAACCAGGTAGCTG	0.622																																					p.N771K		.											.	NDST1	136	0			c.C2313A						.						55.0	41.0	46.0					5																	149927947		2203	4300	6503	SO:0001583	missense	3340	exon12			CGCCAACCAGGTA	U18918	CCDS34277.1, CCDS75358.1	5q33.1	2008-02-05				ENSG00000070614		"""Sulfotransferases, membrane-bound"""	7680	protein-coding gene	gene with protein product		600853		HSST		7601448, 9230113	Standard	NM_001543		Approved	NST1	uc003lsk.4	P52848		ENST00000261797.6:c.2313C>A	5.37:g.149927947C>A	ENSP00000261797:p.Asn771Lys	33.0	1.0		33.0	12.0	NM_001543	Q96E57	Missense_Mutation	SNP	ENST00000261797.6	37	CCDS34277.1	.	.	.	.	.	.	.	.	.	.	C	15.09	2.730836	0.48939	.	.	ENSG00000070614	ENST00000261797	T	0.54279	0.58	4.91	4.91	0.64330	Sulfotransferase domain (1);	0.128598	0.64402	D	0.000001	T	0.42404	0.1201	N	0.17082	0.46	0.80722	D	1	B	0.23490	0.086	B	0.31442	0.13	T	0.26360	-1.0105	10	0.29301	T	0.29	.	18.4857	0.90828	0.0:1.0:0.0:0.0	.	771	P52848	NDST1_HUMAN	K	771	ENSP00000261797:N771K	ENSP00000261797:N771K	N	+	3	2	NDST1	149908140	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.573000	0.36472	2.434000	0.82447	0.655000	0.94253	AAC	.		0.622	NDST1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374314.2	NM_001543	
NLRP10	338322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	7981809	7981809	+	Silent	SNP	G	G	A	rs56052845		TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr11:7981809G>A	ENST00000328600.2	-	2	1511	c.1350C>T	c.(1348-1350)aaC>aaT	p.N450N		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	450	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		ATTGGTAGTCGTTACTACTCA	0.483																																					p.N450N		.											.	NLRP10	209	0			c.C1350T						.						101.0	112.0	108.0					11																	7981809		2201	4296	6497	SO:0001819	synonymous_variant	338322	exon2			GTAGTCGTTACTA	AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.1350C>T	11.37:g.7981809G>A		69.0	0.0		65.0	21.0	NM_176821	Q2M3C4|Q6JGT0	Silent	SNP	ENST00000328600.2	37	CCDS7784.1																																																																																			.		0.483	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385705.1	NM_176821	
OR8D4	338662	broad.mit.edu;bcgsc.ca	37	11	123777431	123777431	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr11:123777431T>C	ENST00000321355.2	+	1	323	c.293T>C	c.(292-294)aTg>aCg	p.M98T		NM_001005197.1	NP_001005197.1	Q8NGM9	OR8D4_HUMAN	olfactory receptor, family 8, subfamily D, member 4	98						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(1)|lung(16)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.93e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0409)		TCTGGATGCATGATTCAGCTG	0.428																																					p.M98T		.											.	OR8D4	69	0			c.T293C						.						250.0	251.0	250.0					11																	123777431		2202	4299	6501	SO:0001583	missense	338662	exon1			GATGCATGATTCA	AB065761	CCDS31698.1	11q24.1	2012-08-09			ENSG00000181518	ENSG00000181518		"""GPCR / Class A : Olfactory receptors"""	14840	protein-coding gene	gene with protein product							Standard	NM_001005197		Approved		uc010saa.2	Q8NGM9	OTTHUMG00000165960	ENST00000321355.2:c.293T>C	11.37:g.123777431T>C	ENSP00000325381:p.Met98Thr	145.0	1.0		125.0	7.0	NM_001005197	Q6IFE9	Missense_Mutation	SNP	ENST00000321355.2	37	CCDS31698.1	.	.	.	.	.	.	.	.	.	.	T	16.27	3.075397	0.55646	.	.	ENSG00000181518	ENST00000321355	T	0.02015	4.5	5.81	4.7	0.59300	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000019	T	0.07143	0.0181	M	0.67953	2.075	0.28885	N	0.894186	D	0.59357	0.985	P	0.57009	0.811	T	0.02603	-1.1135	10	0.87932	D	0	.	8.0977	0.30837	0.0:0.1445:0.0:0.8555	.	98	Q8NGM9	OR8D4_HUMAN	T	98	ENSP00000325381:M98T	ENSP00000325381:M98T	M	+	2	0	OR8D4	123282641	0.000000	0.05858	1.000000	0.80357	0.950000	0.60333	0.991000	0.29654	2.214000	0.71695	0.533000	0.62120	ATG	.		0.428	OR8D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387262.1	NM_001005197	
OR8G5	219865	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	11	124135110	124135110	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr11:124135110C>A	ENST00000524943.2	+	1	388	c.388C>A	c.(388-390)Cct>Act	p.P130T	OR8G1_ENST00000341493.2_RNA	NM_001005198.1	NP_001005198.1	Q8NG78	OR8G5_HUMAN	olfactory receptor, family 8, subfamily G, member 5	130						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)						Breast(109;0.0157)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0523)		CATCTCCTACCCTGAATGCAT	0.468																																					p.P130T	Ovarian(169;523 1969 8640 31295 51256)	.											.	.	.	0			c.C388A						.						157.0	140.0	146.0					11																	124135110		2160	4274	6434	SO:0001583	missense	219865	exon1			TCCTACCCTGAAT	BK004516	CCDS66256.1	11q24.1	2014-04-17		2004-03-10	ENSG00000255298	ENSG00000255298		"""GPCR / Class A : Olfactory receptors"""	19622	protein-coding gene	gene with protein product				OR8G5P, OR8G6			Standard	NM_001005198		Approved			Q8NG78	OTTHUMG00000186059	ENST00000524943.2:c.388C>A	11.37:g.124135110C>A	ENSP00000477014:p.Pro130Thr	321.0	0.0		283.0	116.0	NM_001005198	B2RND3|Q6IEU6	Missense_Mutation	SNP	ENST00000524943.2	37																																																																																				.		0.468	OR8G5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000387283.2	NM_001005198	
PCDH10	57575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	134075516	134075516	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr4:134075516A>C	ENST00000264360.5	+	2	3512	c.2686A>C	c.(2686-2688)Aac>Cac	p.N896H		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	896					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		TCGCCGAGTTAACAGGTATGG	0.348																																					p.N896H		.											.	PCDH10	92	0			c.A2686C						.						79.0	77.0	78.0					4																	134075516		2203	4300	6503	SO:0001583	missense	57575	exon2			CGAGTTAACAGGT	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.2686A>C	4.37:g.134075516A>C	ENSP00000264360:p.Asn896His	183.0	0.0		174.0	59.0	NM_032961	Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	A	18.46	3.629686	0.67015	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.54071	0.59	5.95	5.95	0.96441	.	0.142346	0.32328	N	0.006241	T	0.50480	0.1618	N	0.24115	0.695	0.58432	D	0.999996	D	0.56521	0.976	P	0.51016	0.656	T	0.51513	-0.8696	10	0.45353	T	0.12	.	16.0852	0.81042	1.0:0.0:0.0:0.0	.	896	Q9P2E7	PCD10_HUMAN	H	896	ENSP00000264360:N896H	ENSP00000264360:N896H	N	+	1	0	PCDH10	134294966	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.962000	0.93254	2.279000	0.76181	0.533000	0.62120	AAC	.		0.348	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
PCDHA5	56143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140203294	140203294	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr5:140203294G>A	ENST00000529859.1	+	1	1934	c.1934G>A	c.(1933-1935)cGc>cAc	p.R645H	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000378126.3_Missense_Mutation_p.R645H|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.R645H|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	645	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGCGCCACCGCCTTCTGGTG	0.662																																					p.R645H		.											.	PCDHA5	137	0			c.G1934A						.						54.0	60.0	58.0					5																	140203294		2203	4300	6503	SO:0001583	missense	56143	exon1			GCCACCGCCTTCT	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1934G>A	5.37:g.140203294G>A	ENSP00000436557:p.Arg645His	208.0	0.0		275.0	97.0	NM_018908	O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	37	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	G	10.44	1.350140	0.24512	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.51817	0.69;0.69;0.69	4.01	0.66	0.17868	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.38957	0.1060	M	0.69463	2.115	0.09310	N	1	B;B;B	0.33739	0.422;0.102;0.024	B;B;B	0.21546	0.035;0.033;0.031	T	0.30149	-0.9988	9	0.62326	D	0.03	.	6.565	0.22507	0.2566:0.1793:0.5641:0.0	.	645;645;645	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	H	645	ENSP00000433416:R645H;ENSP00000436557:R645H;ENSP00000367366:R645H	ENSP00000367366:R645H	R	+	2	0	PCDHA5	140183478	0.000000	0.05858	0.288000	0.24862	0.883000	0.51084	-0.114000	0.10757	0.308000	0.22923	-0.683000	0.03753	CGC	.		0.662	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908	
PLEKHS1	79949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	115528632	115528632	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr10:115528632A>G	ENST00000369310.3	+	5	962	c.400A>G	c.(400-402)Aca>Gca	p.T134A	PLEKHS1_ENST00000369309.1_5'Flank|PLEKHS1_ENST00000369312.4_Missense_Mutation_p.T52A|PLEKHS1_ENST00000361048.1_Missense_Mutation_p.T140A	NM_182601.1	NP_872407.1	Q5SXH7	PKHS1_HUMAN	pleckstrin homology domain containing, family S member 1	134																	TATAAAAGCAACACAGCAGAA	0.413																																					p.T140A		.											.	.	.	0			c.A418G						.						126.0	117.0	120.0					10																	115528632		2203	4300	6503	SO:0001583	missense	79949	exon6			AAAGCAACACAGC	AK027190	CCDS7583.1, CCDS53580.1, CCDS53581.1	10q26.11	2013-01-11	2012-05-31	2012-05-31	ENSG00000148735	ENSG00000148735		"""Pleckstrin homology (PH) domain containing"""	26285	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 81"""	C10orf81		12477932	Standard	NM_024889		Approved	FLJ23537, bA211N11.2	uc001lat.2	Q5SXH7	OTTHUMG00000019074	ENST00000369310.3:c.400A>G	10.37:g.115528632A>G	ENSP00000358316:p.Thr134Ala	72.0	0.0		50.0	13.0	NM_024889	A8KA02|B3KX00|B6EDE1|Q5SXH8|Q5SXI0|Q6ZQR5|Q8NE42|Q9H5D9	Missense_Mutation	SNP	ENST00000369310.3	37	CCDS53580.1	.	.	.	.	.	.	.	.	.	.	A	1.606	-0.525172	0.04141	.	.	ENSG00000148735	ENST00000361048;ENST00000369312;ENST00000369310	T;T;T	0.28895	1.59;1.59;1.59	5.61	-9.39	0.00619	.	1.163900	0.05889	N	0.627810	T	0.08626	0.0214	N	0.04768	-0.165	0.09310	N	1	B;B;B	0.16396	0.017;0.001;0.001	B;B;B	0.15484	0.013;0.003;0.006	T	0.19811	-1.0294	10	0.02654	T	1	-33.799	3.4913	0.07638	0.3361:0.3667:0.2092:0.088	.	134;134;140	Q5SXH7-5;Q5SXH7-2;Q5SXH7-4	.;.;.	A	140;52;134	ENSP00000354332:T140A;ENSP00000358318:T52A;ENSP00000358316:T134A	ENSP00000354332:T140A	T	+	1	0	C10orf81	115518622	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.080000	0.03407	-1.835000	0.01191	-2.085000	0.00377	ACA	.		0.413	PLEKHS1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050432.1	NM_024889	
PLTP	5360	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	44531198	44531198	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr20:44531198G>C	ENST00000477313.1	-	10	1582	c.988C>G	c.(988-990)Ctg>Gtg	p.L330V	PLTP_ENST00000420868.2_Missense_Mutation_p.L235V|PLTP_ENST00000354050.4_Missense_Mutation_p.L278V|PLTP_ENST00000372420.1_Missense_Mutation_p.L242V|PLTP_ENST00000372431.3_Missense_Mutation_p.L330V|PLTP_ENST00000542937.1_Missense_Mutation_p.L350V			P55058	PLTP_HUMAN	phospholipid transfer protein	330					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|sperm motility (GO:0030317)|vitamin E biosynthetic process (GO:0010189)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)			endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)	21		Myeloproliferative disorder(115;0.0122)				GGTGGGGCCAGGACCCGCAGC	0.637																																					p.L330V		.											.	PLTP	91	0			c.C988G						.						37.0	33.0	34.0					20																	44531198		2203	4300	6503	SO:0001583	missense	5360	exon11			GGGCCAGGACCCG	L26232	CCDS13386.1, CCDS13387.1, CCDS56196.1, CCDS56197.1	20q13.12	2011-08-16			ENSG00000100979	ENSG00000100979		"""BPI fold containing"""	9093	protein-coding gene	gene with protein product	"""BPI fold containing family E"""	172425					Standard	NM_006227		Approved	BPIFE	uc002xqn.2	P55058	OTTHUMG00000033047	ENST00000477313.1:c.988C>G	20.37:g.44531198G>C	ENSP00000417138:p.Leu330Val	203.0	0.0		164.0	64.0	NM_006227	A8K006|B4DDD5|B4DRB4|E1P5N8|E7EV16|Q8WTT1|Q9BR07|Q9BSH8	Missense_Mutation	SNP	ENST00000477313.1	37	CCDS13386.1	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.496238	0.01009	.	.	ENSG00000100979	ENST00000372420;ENST00000372431;ENST00000354050;ENST00000477313;ENST00000542937;ENST00000420868	T;T;T;T;T;T	0.09911	2.93;2.93;2.93;2.93;2.93;2.93	5.28	-10.3	0.00346	Lipid-binding serum glycoprotein, C-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	1.693330	0.02942	N	0.140624	T	0.06645	0.0170	L	0.44542	1.39	0.09310	N	1	B;B;B;B;B;B;B	0.09022	0.002;0.002;0.001;0.001;0.002;0.001;0.002	B;B;B;B;B;B;B	0.14023	0.007;0.007;0.007;0.006;0.003;0.006;0.01	T	0.30765	-0.9967	10	0.27082	T	0.32	1.4431	0.9765	0.01426	0.2809:0.1821:0.3216:0.2154	.	235;235;242;330;278;330;350	E7EV16;B4DRB4;B4DDD5;Q53H91;P55058-2;P55058;B3KUE5	.;.;.;.;.;PLTP_HUMAN;.	V	242;330;278;330;350;235	ENSP00000361497:L242V;ENSP00000361508:L330V;ENSP00000335290:L278V;ENSP00000417138:L330V;ENSP00000440296:L350V;ENSP00000411671:L235V	ENSP00000335290:L278V	L	-	1	2	PLTP	43964605	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.279000	0.08479	-1.656000	0.01495	-1.047000	0.02352	CTG	.		0.637	PLTP-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354633.1	NM_006227	
POLA1	5422	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	24744103	24744103	+	Silent	SNP	G	G	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chrX:24744103G>T	ENST00000379059.3	+	13	1320	c.1305G>T	c.(1303-1305)gtG>gtT	p.V435V	POLA1_ENST00000379068.3_Silent_p.V441V	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	435					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	CCCAGCCAGTGGAAAAGAACT	0.313																																					p.V435V		.											.	POLA1	229	0			c.G1305T						.						62.0	62.0	62.0					X																	24744103		2203	4300	6503	SO:0001819	synonymous_variant	5422	exon13			GCCAGTGGAAAAG		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.1305G>T	X.37:g.24744103G>T		414.0	0.0		444.0	185.0	NM_016937	Q86UQ7	Silent	SNP	ENST00000379059.3	37	CCDS14214.1																																																																																			.		0.313	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937	
POLK	51426	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	74872759	74872759	+	Splice_Site	SNP	G	G	C			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr5:74872759G>C	ENST00000241436.4	+	6	866		c.e6+1		POLK_ENST00000508526.1_Splice_Site|POLK_ENST00000380481.3_Splice_Site|POLK_ENST00000506928.1_Splice_Site|POLK_ENST00000352007.5_Splice_Site|POLK_ENST00000515295.1_Splice_Site|POLK_ENST00000504026.1_Splice_Site	NM_016218.2	NP_057302.1	Q9UBT6	POLK_HUMAN	polymerase (DNA directed) kappa						DNA repair (GO:0006281)|nucleotide-excision repair, DNA gap filling (GO:0006297)	nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			endometrium(1)|kidney(4)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	27		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)		GTAGAAAATGGTAAGCAACTT	0.328								DNA polymerases (catalytic subunits)																													.		.											.	POLK	229	0			c.694+1G>C						.						46.0	46.0	46.0					5																	74872759		2203	4299	6502	SO:0001630	splice_region_variant	51426	exon6			AAAATGGTAAGCA	AB027564	CCDS4030.1	5q13	2012-05-18			ENSG00000122008	ENSG00000122008		"""DNA polymerases"""	9183	protein-coding gene	gene with protein product	"""polymerase (DNA-directed) kappa"", ""DINB protein"", ""DNA polymerase kappa"""	605650		DINB1		10887153, 10518552	Standard	NM_016218		Approved	POLQ, DINP	uc003kdw.3	Q9UBT6	OTTHUMG00000102107	ENST00000241436.4:c.694+1G>C	5.37:g.74872759G>C		84.0	0.0		64.0	24.0	NM_016218	B2RBD2|Q5Q9G5|Q5Q9G6|Q5Q9G7|Q5Q9G8|Q86VJ8|Q8IZY0|Q8IZY1|Q8NB30|Q96L01|Q96Q86|Q96Q87|Q9UHC5	Splice_Site	SNP	ENST00000241436.4	37	CCDS4030.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.631977	0.67015	.	.	ENSG00000122008	ENST00000241436;ENST00000352007;ENST00000515295;ENST00000504026;ENST00000508526;ENST00000380481	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.035	0.89298	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	POLK	74908515	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	4.950000	0.63603	2.695000	0.91970	0.563000	0.77884	.	.		0.328	POLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219945.3	NM_016218	Intron
PPAP2C	8612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	288028	288028	+	Missense_Mutation	SNP	C	C	T	rs148329482	byFrequency	TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr19:288028C>T	ENST00000269812.3	-	2	245	c.196G>A	c.(196-198)Gtc>Atc	p.V66I	PPAP2C_ENST00000434325.2_Missense_Mutation_p.V10I|PPAP2C_ENST00000327790.3_Missense_Mutation_p.V87I	NM_003712.2|NM_177526.1	NP_003703.1|NP_803545.1	O43688	LPP2_HUMAN	phosphatidic acid phosphatase type 2C	66					dephosphorylation (GO:0016311)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(1)|skin(1)	5		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACAAGGATGACGGTGGCCGTG	0.642													.|||	6	0.00119808	0.0	0.0	5008	,	,		12700	0.0		0.006	False		,,,				2504	0.0				p.V87I		.											.	PPAP2C	90	0			c.G259A						.	C	ILE/VAL,ILE/VAL,ILE/VAL	1,4405	824.9+/-416.5	0,1,2202	113.0	99.0	104.0		196,28,259	-3.8	0.0	19	dbSNP_134	104	0,8600		0,0,4300	yes	missense,missense,missense	PPAP2C	NM_003712.2,NM_177526.1,NM_177543.1	29,29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign,benign	66/289,10/233,87/310	288028	1,13005	2203	4300	6503	SO:0001583	missense	8612	exon2			GGATGACGGTGGC	AF035959	CCDS12023.1, CCDS12024.1, CCDS45889.1	19p13	2009-05-27				ENSG00000141934	3.1.3.4		9230	protein-coding gene	gene with protein product		607126				9570154, 9607309	Standard	NM_177543		Approved	PAP-2c, LPP2	uc002loh.3	O43688		ENST00000269812.3:c.196G>A	19.37:g.288028C>T	ENSP00000269812:p.Val66Ile	169.0	0.0		162.0	66.0	NM_177543	A6NLV0|E9PAY8	Missense_Mutation	SNP	ENST00000269812.3	37	CCDS12023.1	6	0.0027472527472527475	0	0.0	0	0.0	0	0.0	6	0.0079155672823219	T	0.525	-0.860463	0.02610	2.27E-4	0.0	ENSG00000141934	ENST00000269812;ENST00000327790;ENST00000434325	T;T;T	0.74632	-0.86;-0.83;1.61	4.44	-3.8	0.04307	.	0.415488	0.22661	N	0.057186	T	0.38214	0.1032	N	0.17631	0.505	0.09310	N	1	B;B	0.17038	0.0;0.02	B;B	0.13407	0.001;0.009	T	0.44236	-0.9341	10	0.02654	T	1	-8.3324	7.8963	0.29708	0.0:0.6408:0.1073:0.2519	.	66;87	O43688;O43688-2	LPP2_HUMAN;.	I	66;87;10	ENSP00000269812:V66I;ENSP00000329697:V87I;ENSP00000388565:V10I	ENSP00000269812:V66I	V	-	1	0	PPAP2C	239028	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.062000	0.03468	-0.363000	0.08101	-1.796000	0.00623	GTC	C|0.999;T|0.001		0.642	PPAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451777.2		
PRELID2	153768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	145176020	145176020	+	Silent	SNP	T	T	G			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr5:145176020T>G	ENST00000334744.4	-	6	547	c.495A>C	c.(493-495)cgA>cgC	p.R165R	PRELID2_ENST00000394450.2_Silent_p.R124R|PRELID2_ENST00000511435.1_Silent_p.R153R|PRELID2_ENST00000510594.1_5'UTR|PRELID2_ENST00000505416.1_Silent_p.R153R|PRELID2_ENST00000358004.2_Silent_p.R153R	NM_182960.2	NP_892005.1	Q8N945	PRLD2_HUMAN	PRELI domain containing 2	165	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.				phospholipid transport (GO:0015914)	mitochondrial intermembrane space (GO:0005758)	phosphatidic acid transporter activity (GO:1990050)			endometrium(2)|large_intestine(1)|lung(2)|prostate(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGGCTCCCTGTCGTAAGAATG	0.378																																					p.R165R		.											.	PRELID2	90	0			c.A495C						.						121.0	130.0	127.0					5																	145176020		2203	4300	6503	SO:0001819	synonymous_variant	153768	exon6			TCCCTGTCGTAAG	AK095695	CCDS34261.1, CCDS34262.1, CCDS43377.1	5q32	2012-04-23			ENSG00000186314	ENSG00000186314			28306	protein-coding gene	gene with protein product						12477932	Standard	NM_182960		Approved	MGC21644, FLJ38376	uc003lnq.1	Q8N945	OTTHUMG00000163384	ENST00000334744.4:c.495A>C	5.37:g.145176020T>G		62.0	0.0		45.0	20.0	NM_182960	G5EA01|Q96EQ3	Silent	SNP	ENST00000334744.4	37	CCDS34262.1																																																																																			.		0.378	PRELID2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000372970.1	NM_182960	
PTPRG	5793	broad.mit.edu;bcgsc.ca	37	3	62240818	62240818	+	Silent	SNP	T	T	C			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr3:62240818T>C	ENST00000474889.1	+	16	2864	c.2487T>C	c.(2485-2487)ccT>ccC	p.P829P	PTPRG_ENST00000295874.10_Silent_p.P800P	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	829					brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		AAGCCATTCCTGTCAAACAGT	0.368																																					p.P829P		.											.	PTPRG	419	0			c.T2487C						.						136.0	131.0	133.0					3																	62240818		2203	4300	6503	SO:0001819	synonymous_variant	5793	exon16			CATTCCTGTCAAA	L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.2487T>C	3.37:g.62240818T>C		118.0	0.0		107.0	8.0	NM_002841	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Silent	SNP	ENST00000474889.1	37	CCDS2895.1																																																																																			.		0.368	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841	
RALY	22913	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	32664559	32664559	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr20:32664559C>T	ENST00000246194.3	+	7	1098	c.596C>T	c.(595-597)tCc>tTc	p.S199F	RALY_ENST00000375114.3_Missense_Mutation_p.S183F|RALY_ENST00000493399.1_3'UTR	NM_016732.2	NP_057951.1	Q9UKM9	RALY_HUMAN	RALY heterogeneous nuclear ribonucleoprotein	199					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						CAGATCAAGTCCAATATCGAT	0.592																																					p.S199F		.											.	RALY	91	0			c.C596T						.						75.0	59.0	65.0					20																	32664559		2203	4300	6503	SO:0001583	missense	22913	exon7			TCAAGTCCAATAT	AF148457	CCDS13229.1, CCDS13230.1	20q11.21-q11.23	2013-08-06	2013-08-06		ENSG00000125970	ENSG00000125970		"""RNA binding motif (RRM) containing"""	15921	protein-coding gene	gene with protein product		614663	"""RNA-binding protein (autoantigenic, hnRNP-associated with lethal yellow)"", ""RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse))"""			10500250, 23614458	Standard	NM_016732		Approved	P542, HNRPCL2	uc002xab.3	Q9UKM9	OTTHUMG00000032283	ENST00000246194.3:c.596C>T	20.37:g.32664559C>T	ENSP00000246194:p.Ser199Phe	91.0	0.0		88.0	38.0	NM_016732	Q14621|Q2M365|Q5QPL8|Q9BQX6|Q9UJE3	Missense_Mutation	SNP	ENST00000246194.3	37	CCDS13230.1	.	.	.	.	.	.	.	.	.	.	C	12.71	2.018308	0.35606	.	.	ENSG00000125970	ENST00000375114;ENST00000246194;ENST00000333552;ENST00000442805	T;T;T;T	0.32988	1.43;1.43;1.48;1.43	5.44	3.36	0.38483	.	0.200152	0.43747	D	0.000533	T	0.38585	0.1046	L	0.43152	1.355	0.37959	D	0.93291	D;D	0.57899	0.959;0.981	P;P	0.53649	0.731;0.597	T	0.44360	-0.9333	10	0.44086	T	0.13	-13.9162	15.4309	0.75099	0.263:0.737:0.0:0.0	.	183;199	Q9UKM9-2;Q9UKM9	.;RALY_HUMAN	F	183;199;133;183	ENSP00000364255:S183F;ENSP00000246194:S199F;ENSP00000327522:S133F;ENSP00000415973:S183F	ENSP00000246194:S199F	S	+	2	0	RALY	32128220	0.997000	0.39634	1.000000	0.80357	0.003000	0.03518	0.847000	0.27696	1.505000	0.48720	-0.302000	0.09304	TCC	.		0.592	RALY-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078753.1		
ROR1	4919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	64644486	64644486	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr1:64644486G>A	ENST00000371079.1	+	9	3137	c.2762G>A	c.(2761-2763)gGa>gAa	p.G921E	ROR1_ENST00000545203.1_Missense_Mutation_p.G372E	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	921					peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						TCTTTACTAGGAGACGCCAAT	0.398																																					p.G921E		.											.	ROR1	1536	0			c.G2762A						.						96.0	94.0	95.0					1																	64644486		2203	4299	6502	SO:0001583	missense	4919	exon9			TACTAGGAGACGC	M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.2762G>A	1.37:g.64644486G>A	ENSP00000360120:p.Gly921Glu	236.0	0.0		197.0	83.0	NM_005012	Q5VVX6|Q66K77|Q92776	Missense_Mutation	SNP	ENST00000371079.1	37	CCDS626.1	.	.	.	.	.	.	.	.	.	.	G	8.495	0.862849	0.17178	.	.	ENSG00000185483	ENST00000371079;ENST00000544776;ENST00000545203	T;T	0.78595	-0.89;-1.19	5.45	4.52	0.55395	.	0.000000	0.42420	D	0.000716	T	0.50292	0.1607	L	0.27053	0.805	0.41397	D	0.987651	B	0.06786	0.001	B	0.04013	0.001	T	0.55835	-0.8078	10	0.56958	D	0.05	.	9.817	0.40858	0.0728:0.1411:0.7862:0.0	.	921	Q01973	ROR1_HUMAN	E	921;924;372	ENSP00000360120:G921E;ENSP00000441637:G372E	ENSP00000360120:G921E	G	+	2	0	ROR1	64417074	1.000000	0.71417	1.000000	0.80357	0.407000	0.30961	2.920000	0.48844	1.392000	0.46585	0.655000	0.94253	GGA	.		0.398	ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025002.1	NM_005012	
RP1L1	94137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	10469481	10469481	+	Silent	SNP	C	C	T	rs367955605		TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr8:10469481C>T	ENST00000382483.3	-	4	2350	c.2127G>A	c.(2125-2127)tcG>tcA	p.S709S		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	709					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TCCTGGTGCTCGATGAGCTTC	0.622																																					p.S709S		.											.	RP1L1	139	0			c.G2127A						.						48.0	58.0	55.0					8																	10469481		2062	4193	6255	SO:0001819	synonymous_variant	94137	exon4			GGTGCTCGATGAG	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.2127G>A	8.37:g.10469481C>T		90.0	0.0		113.0	45.0	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	37	CCDS43708.1																																																																																			.		0.622	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
RPS6KA4	8986	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64128041	64128041	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr11:64128041C>A	ENST00000334205.4	+	4	504	c.439C>A	c.(439-441)Ctg>Atg	p.L147M	RPS6KA4_ENST00000528057.1_Missense_Mutation_p.L147M|RPS6KA4_ENST00000294261.4_Missense_Mutation_p.L147M	NM_003942.2	NP_003933.1	O75676	KS6A4_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 4	147	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|negative regulation of cytokine production (GO:0001818)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|mitogen-activated protein kinase p38 binding (GO:0048273)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)			breast(1)|endometrium(3)|lung(7)|ovary(1)|prostate(1)	13						TGAGATCGTGCTGGCCCTGGA	0.607																																					p.L147M		.											.	RPS6KA4	1036	0			c.C439A						.						74.0	51.0	59.0					11																	64128041		2200	4297	6497	SO:0001583	missense	8986	exon4			ATCGTGCTGGCCC	AJ010119	CCDS8073.1, CCDS73313.1	11q11-q13	2011-04-05	2002-08-29		ENSG00000162302	ENSG00000162302			10433	protein-coding gene	gene with protein product		603606	"""ribosomal protein S6 kinase, 90kD, polypeptide 4"""			9792677, 9687510	Standard	XM_005274379		Approved	RSK-B, MSK2	uc001oae.3	O75676	OTTHUMG00000046094	ENST00000334205.4:c.439C>A	11.37:g.64128041C>A	ENSP00000333896:p.Leu147Met	102.0	0.0		94.0	42.0	NM_001006944	A8K7Z8|O75585|Q53ES8	Missense_Mutation	SNP	ENST00000334205.4	37	CCDS8073.1	.	.	.	.	.	.	.	.	.	.	c	14.48	2.547112	0.45383	.	.	ENSG00000162302	ENST00000528057;ENST00000334205;ENST00000294261;ENST00000530504	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	3.32	3.32	0.38043	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000018	T	0.72622	0.3483	M	0.72479	2.2	0.37355	D	0.910983	P;D;D;D	0.89917	0.706;1.0;0.994;0.992	P;D;D;D	0.97110	0.465;1.0;0.959;0.931	T	0.75039	-0.3458	10	0.46703	T	0.11	.	6.6173	0.22784	0.0:0.8698:0.0:0.1302	.	147;147;147;147	G3XAA9;E9PJN1;O75676;O75676-2	.;.;KS6A4_HUMAN;.	M	147;147;147;131	ENSP00000435580:L147M;ENSP00000333896:L147M;ENSP00000294261:L147M;ENSP00000432945:L131M	ENSP00000294261:L147M	L	+	1	2	RPS6KA4	63884617	0.769000	0.28531	1.000000	0.80357	0.893000	0.52053	0.318000	0.19504	2.165000	0.68154	0.313000	0.20887	CTG	.		0.607	RPS6KA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106246.2	NM_003942	
SECISBP2L	9728	hgsc.bcm.edu;broad.mit.edu	37	15	49284998	49284999	+	In_Frame_Ins	INS	-	-	TGGGGGTGTGTCAAATGGAAGTTG			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr15:49284998_49284999insTGGGGGTGTGTCAAATGGAAGTTG	ENST00000559471.1	-	18	3011_3012	c.2748_2749insCAACTTCCATTTGACACACCCCCA	c.(2746-2751)ccaatt>ccaCAACTTCCATTTGACACACCCCCAatt	p.915_916insPQLPFDTP	SECISBP2L_ENST00000261847.3_In_Frame_Ins_p.870_871insPQLPFDTP	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	915							poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						TGCTTACCAATTGGGGGTGTGT	0.446																																					p.I917delinsQLPFDTPPI		.											.	SECISBP2L	136	0			c.2749_2750insCAACTTCCATTTGACACACCCCCA						.																																			SO:0001652	inframe_insertion	9728	exon18			TACCAATTGGGGG	BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.2748_2749insCAACTTCCATTTGACACACCCCCA	15.37:g.49284998_49284999insTGGGGGTGTGTCAAATGGAAGTTG	ENSP00000453854:p.Pro915_Pro916insProGlnLeuProPheAspThrPro	190.0	0.0		157.0	14.0	NM_001193489	Q8N767	In_Frame_Ins	INS	ENST00000559471.1	37	CCDS53942.1																																																																																			.		0.446	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1	NM_014701	
SH2B1	25970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	28877909	28877909	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr16:28877909C>T	ENST00000322610.8	+	4	933	c.494C>T	c.(493-495)tCa>tTa	p.S165L	SH2B1_ENST00000563674.1_Intron|SH2B1_ENST00000545570.1_Intron|SH2B1_ENST00000538342.1_Intron|SH2B1_ENST00000359285.5_Missense_Mutation_p.S165L|SH2B1_ENST00000337120.5_Missense_Mutation_p.S165L|SH2B1_ENST00000395532.4_Missense_Mutation_p.S165L			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1	165	Interaction with JAK2 (low-affinity binding; independent of JAK2 phosphorylation). {ECO:0000250}.|Interaction with RAC1. {ECO:0000250}.|Required for NGF signaling. {ECO:0000250}.				blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						GTCCGAGGCTCAGTCCGTGGC	0.637																																					p.S165L		.											.	SH2B1	92	0			c.C494T						.						91.0	85.0	87.0					16																	28877909		2197	4300	6497	SO:0001583	missense	25970	exon2			GAGGCTCAGTCCG	AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2		ENST00000322610.8:c.494C>T	16.37:g.28877909C>T	ENSP00000321221:p.Ser165Leu	51.0	0.0		57.0	22.0	NM_001145796	A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Missense_Mutation	SNP	ENST00000322610.8	37	CCDS53996.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.156884	0.57259	.	.	ENSG00000178188	ENST00000322610;ENST00000359285;ENST00000395532;ENST00000337120	T;T;T;T	0.58652	0.32;0.34;0.34;0.34	3.95	3.95	0.45737	.	0.538636	0.16187	N	0.225577	T	0.45013	0.1321	N	0.14661	0.345	0.22096	N	0.99937	D;P;P	0.56968	0.978;0.936;0.895	P;B;B	0.50537	0.643;0.445;0.354	T	0.19063	-1.0317	10	0.18276	T	0.48	-12.4079	10.2838	0.43556	0.0:0.6579:0.3421:0.0	.	165;165;165	Q9NRF2-2;Q9NRF2-3;Q9NRF2	.;.;SH2B1_HUMAN	L	165	ENSP00000321221:S165L;ENSP00000352232:S165L;ENSP00000378903:S165L;ENSP00000337163:S165L	ENSP00000321221:S165L	S	+	2	0	SH2B1	28785410	0.771000	0.28555	0.962000	0.40283	0.976000	0.68499	4.347000	0.59373	2.055000	0.61198	0.455000	0.32223	TCA	.		0.637	SH2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432666.1	NM_015503	
SETD1A	9739	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	30976057	30976057	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr16:30976057G>A	ENST00000262519.8	+	7	1680	c.994G>A	c.(994-996)Gca>Aca	p.A332T		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	332	Ser-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						CGCCACCACTGCAGCCACTGc	0.592																																					p.A332T		.											.	SETD1A	93	0			c.G994A						.						178.0	129.0	145.0					16																	30976057		2197	4300	6497	SO:0001583	missense	9739	exon7			ACCACTGCAGCCA	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.994G>A	16.37:g.30976057G>A	ENSP00000262519:p.Ala332Thr	154.0	1.0		160.0	54.0	NM_014712	A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	ENST00000262519.8	37	CCDS32435.1	.	.	.	.	.	.	.	.	.	.	G	3.451	-0.111931	0.06881	.	.	ENSG00000099381	ENST00000262519	D	0.94000	-3.33	5.11	-0.341	0.12639	.	0.779034	0.11790	N	0.529243	T	0.81187	0.4770	N	0.08118	0	0.09310	N	0.999992	B	0.02656	0.0	B	0.01281	0.0	T	0.68930	-0.5279	10	0.32370	T	0.25	.	3.3075	0.07005	0.4078:0.0:0.3051:0.2871	.	332	O15047	SET1A_HUMAN	T	332	ENSP00000262519:A332T	ENSP00000262519:A332T	A	+	1	0	SETD1A	30883558	0.001000	0.12720	0.972000	0.41901	0.194000	0.23727	0.340000	0.19892	0.332000	0.23536	-0.266000	0.10368	GCA	.		0.592	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712	
TACR3	6870	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	104640561	104640561	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr4:104640561G>A	ENST00000304883.2	-	1	412	c.272C>T	c.(271-273)gCg>gTg	p.A91V		NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	91					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		CACACCATACGCCAGGGACCA	0.617																																					p.A91V		.											.	TACR3	525	0			c.C272T						.						93.0	89.0	90.0					4																	104640561		2203	4300	6503	SO:0001583	missense	6870	exon1			CCATACGCCAGGG	M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.272C>T	4.37:g.104640561G>A	ENSP00000303325:p.Ala91Val	137.0	1.0		167.0	46.0	NM_001059	Q0P510	Missense_Mutation	SNP	ENST00000304883.2	37	CCDS3664.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.206345	0.79127	.	.	ENSG00000169836	ENST00000304883	T	0.33438	1.41	4.74	4.74	0.60224	.	0.059633	0.64402	D	0.000003	T	0.32224	0.0822	L	0.54965	1.715	0.58432	D	0.999999	D	0.71674	0.998	P	0.47430	0.547	T	0.20207	-1.0282	10	0.02654	T	1	.	16.7228	0.85414	0.0:0.0:1.0:0.0	.	91	P29371	NK3R_HUMAN	V	91	ENSP00000303325:A91V	ENSP00000303325:A91V	A	-	2	0	TACR3	104860010	1.000000	0.71417	0.910000	0.35882	0.996000	0.88848	9.353000	0.97080	2.149000	0.67028	0.467000	0.42956	GCG	.		0.617	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	NM_001059	
TAF3	83860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	8006861	8006861	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr10:8006861C>T	ENST00000344293.5	+	3	1594	c.1388C>T	c.(1387-1389)tCa>tTa	p.S463L		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	463					maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						TCCGATAACTCATGGACAATG	0.468																																					p.S463L		.											.	TAF3	69	0			c.C1388T						.						95.0	93.0	94.0					10																	8006861		1943	4151	6094	SO:0001583	missense	83860	exon3			ATAACTCATGGAC	AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.1388C>T	10.37:g.8006861C>T	ENSP00000340271:p.Ser463Leu	108.0	0.0		109.0	39.0	NM_031923	Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Missense_Mutation	SNP	ENST00000344293.5	37	CCDS41487.1	.	.	.	.	.	.	.	.	.	.	C	18.06	3.538434	0.65085	.	.	ENSG00000165632	ENST00000344293	T	0.21734	1.99	5.62	5.62	0.85841	.	0.000000	0.56097	D	0.000033	T	0.50051	0.1593	M	0.79475	2.455	0.54753	D	0.999987	D	0.76494	0.999	D	0.78314	0.991	T	0.41448	-0.9508	10	0.40728	T	0.16	-13.8288	19.6582	0.95853	0.0:1.0:0.0:0.0	.	463	Q5VWG9	TAF3_HUMAN	L	463	ENSP00000340271:S463L	ENSP00000340271:S463L	S	+	2	0	TAF3	8046867	1.000000	0.71417	0.991000	0.47740	0.623000	0.37688	5.308000	0.65768	2.659000	0.90383	0.650000	0.86243	TCA	.		0.468	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046725.1	NM_031923	
TAF5	6877	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	105142994	105142994	+	Splice_Site	SNP	G	G	C			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr10:105142994G>C	ENST00000369839.3	+	7	1557		c.e7-1		TAF5_ENST00000351396.4_Splice_Site	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa						chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		GACCATTTTAGATCTTAGTCT	0.313																																					.		.											.	TAF5	92	0			c.1535-1G>C						.						46.0	47.0	47.0					10																	105142994		2203	4300	6503	SO:0001630	splice_region_variant	6877	exon7			ATTTTAGATCTTA	X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.1535-1G>C	10.37:g.105142994G>C		191.0	1.0		158.0	66.0	NM_006951	A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Splice_Site	SNP	ENST00000369839.3	37	CCDS7547.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.402888	0.83230	.	.	ENSG00000148835	ENST00000369839;ENST00000351396	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7964	0.96487	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TAF5	105132984	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.466000	0.97665	2.683000	0.91414	0.555000	0.69702	.	.		0.313	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050144.1		Intron
TCTN2	79867	broad.mit.edu;bcgsc.ca	37	12	124184293	124184293	+	Silent	SNP	T	T	C			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr12:124184293T>C	ENST00000303372.5	+	14	1676	c.1548T>C	c.(1546-1548)acT>acC	p.T516T	TCTN2_ENST00000426174.2_Silent_p.T515T	NM_001143850.2|NM_024809.4	NP_001137322.1|NP_079085.2	Q96GX1	TECT2_HUMAN	tectonic family member 2	516					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		TACAAGCGACTCACGTTGCAA	0.438																																					p.T516T		.											.	TCTN2	91	0			c.T1548C						.						150.0	129.0	136.0					12																	124184293		2203	4300	6503	SO:0001819	synonymous_variant	79867	exon14			AGCGACTCACGTT	AK056924	CCDS9253.1, CCDS45007.1	12q24.31	2011-04-12	2007-08-20	2007-08-20	ENSG00000168778	ENSG00000168778		"""Tectonic proteins"""	25774	protein-coding gene	gene with protein product	"""Meckel syndrome, type 8"""	613846	"""chromosome 12 open reading frame 38"""	C12orf38		21462283	Standard	NM_024809		Approved	FLJ12975, TECT2, MKS8	uc001ufp.3	Q96GX1	OTTHUMG00000168700	ENST00000303372.5:c.1548T>C	12.37:g.124184293T>C		109.0	0.0		105.0	7.0	NM_024809	A8K7Y8|B3KPW5|Q9H966	Silent	SNP	ENST00000303372.5	37	CCDS9253.1																																																																																			.		0.438	TCTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400652.1	NM_024809	
TFEB	7942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	41655675	41655675	+	Missense_Mutation	SNP	G	G	A	rs370711905		TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr6:41655675G>A	ENST00000230323.4	-	6	942	c.641C>T	c.(640-642)gCg>gTg	p.A214V	TFEB_ENST00000394283.1_Missense_Mutation_p.A214V|TFEB_ENST00000358871.2_Missense_Mutation_p.A228V|TFEB_ENST00000403298.4_Missense_Mutation_p.A214V|TFEB_ENST00000373033.1_Missense_Mutation_p.A214V|TFEB_ENST00000420312.1_Missense_Mutation_p.A129V	NM_001271945.1|NM_007162.2	NP_001258874.1|NP_009093.1	P19484	TFEB_HUMAN	transcription factor EB	214					autophagy (GO:0006914)|embryonic placenta development (GO:0001892)|humoral immune response (GO:0006959)|lysosome organization (GO:0007040)|positive regulation of autophagy (GO:0010508)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	11	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;7.61e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			GGTCAGGTCCGCAGGGCAGGA	0.632			T	ALPHA	renal (childhood epithelioid)																																p.A228V		.		Dom	yes		6	6p21	7942	transcription factor EB		"""E,M"""	TFEB,NS,carcinoma,+1	TFEB	659	0			c.C683T						.	G	VAL/ALA,VAL/ALA	0,4406		0,0,2203	76.0	73.0	74.0		641,641	5.2	0.1	6		74	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	TFEB	NM_001167827.1,NM_007162.2	64,64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	214/477,214/477	41655675	1,13005	2203	4300	6503	SO:0001583	missense	7942	exon5			AGGTCCGCAGGGC	M33782	CCDS4858.1, CCDS64424.1, CCDS64425.1	6p21	2013-05-21			ENSG00000112561	ENSG00000112561		"""Basic helix-loop-helix proteins"""	11753	protein-coding gene	gene with protein product		600744				2115126	Standard	NM_007162		Approved	TCFEB, bHLHe35	uc003oqu.2	P19484	OTTHUMG00000014684	ENST00000230323.4:c.641C>T	6.37:g.41655675G>A	ENSP00000230323:p.Ala214Val	215.0	1.0		205.0	78.0	NM_001167827	Q709B3|Q7Z6P9|Q9BRJ5|Q9UJD8	Missense_Mutation	SNP	ENST00000230323.4	37	CCDS4858.1	.	.	.	.	.	.	.	.	.	.	G	34	5.346256	0.95807	0.0	1.16E-4	ENSG00000112561	ENST00000406563;ENST00000343317;ENST00000230323;ENST00000358871;ENST00000403298;ENST00000420312;ENST00000373033;ENST00000394283;ENST00000419396;ENST00000416140;ENST00000419574	T;T;T;T;T;T;T;T;T;T;T	0.37752	1.69;1.62;1.65;1.64;1.65;1.73;1.65;1.29;1.29;1.19;1.18	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.51517	0.1679	M	0.68952	2.095	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	P;P;D;D	0.66497	0.881;0.881;0.943;0.944	T	0.56183	-0.8021	10	0.87932	D	0	-19.7958	18.4425	0.90671	0.0:0.0:1.0:0.0	.	300;228;214;129	B0QYS7;B0QYS6;P19484;P19484-2	.;.;TFEB_HUMAN;.	V	72;300;214;228;214;129;214;214;214;214;214	ENSP00000383998:A72V;ENSP00000343948:A300V;ENSP00000230323:A214V;ENSP00000351742:A228V;ENSP00000384203:A214V;ENSP00000412551:A129V;ENSP00000362124:A214V;ENSP00000377824:A214V;ENSP00000410391:A214V;ENSP00000406491:A214V;ENSP00000400276:A214V	ENSP00000230323:A214V	A	-	2	0	TFEB	41763653	1.000000	0.71417	0.081000	0.20488	0.876000	0.50452	9.813000	0.99286	2.445000	0.82738	0.555000	0.69702	GCG	.		0.632	TFEB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040522.3		
TMC2	117532	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	2582881	2582881	+	Silent	SNP	C	C	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr20:2582881C>T	ENST00000358864.1	+	11	1362	c.1347C>T	c.(1345-1347)taC>taT	p.Y449Y	TMC2_ENST00000496948.1_3'UTR	NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	449					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						ACCTCATTTACTTTGTGGTTA	0.403																																					p.Y449Y		.											.	TMC2	93	0			c.C1347T						.						180.0	155.0	163.0					20																	2582881		2203	4300	6503	SO:0001819	synonymous_variant	117532	exon11			CATTTACTTTGTG	AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.1347C>T	20.37:g.2582881C>T		252.0	0.0		236.0	73.0	NM_080751	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Silent	SNP	ENST00000358864.1	37	CCDS13029.2																																																																																			.		0.403	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077601.2		
TMEM219	124446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	29979380	29979380	+	Silent	SNP	C	C	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr16:29979380C>T	ENST00000566848.1	+	3	857	c.390C>T	c.(388-390)gcC>gcT	p.A130A	TMEM219_ENST00000561899.2_Silent_p.A130A|TMEM219_ENST00000414689.2_Silent_p.A130A|TMEM219_ENST00000279396.6_Silent_p.A130A			Q86XT9	TM219_HUMAN	transmembrane protein 219	130					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				large_intestine(1)|lung(1)|prostate(2)	4						TTATCACAGCCAGGGTGACCA	0.522																																					p.A130A		.											.	TMEM219	90	0			c.C390T						.						100.0	108.0	105.0					16																	29979380		1915	4114	6029	SO:0001819	synonymous_variant	124446	exon4			CACAGCCAGGGTG		CCDS42145.1	16p11.2	2008-08-08			ENSG00000149932	ENSG00000149932			25201	protein-coding gene	gene with protein product							Standard	NM_194280		Approved		uc010bzk.1	Q86XT9		ENST00000566848.1:c.390C>T	16.37:g.29979380C>T		109.0	0.0		116.0	49.0	NM_001083613	D5FK14|Q8WVV8	Silent	SNP	ENST00000566848.1	37	CCDS42145.1																																																																																			.		0.522	TMEM219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435307.1	NM_001083613	
TRIM67	440730	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	231337125	231337125	+	Missense_Mutation	SNP	C	C	T	rs370312974		TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr1:231337125C>T	ENST00000366653.5	+	5	1396	c.1396C>T	c.(1396-1398)Cgc>Tgc	p.R466C	TRIM67_ENST00000449018.3_Missense_Mutation_p.R404C|TRIM67_ENST00000444294.3_Missense_Mutation_p.R466C|TRIM67_ENST00000366652.2_Missense_Mutation_p.R466C			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	466	COS. {ECO:0000255|PROSITE- ProRule:PRU00586}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				TCTGATCAAGCGCGTCCAGGT	0.537																																					p.R466C		.											.	TRIM67	229	0			c.C1396T						.	C	CYS/ARG	0,3918		0,0,1959	36.0	38.0	37.0		1396	5.4	1.0	1		37	1,8301		0,1,4150	no	missense	TRIM67	NM_001004342.3	180	0,1,6109	TT,TC,CC		0.012,0.0,0.0082	probably-damaging	466/784	231337125	1,12219	1959	4151	6110	SO:0001583	missense	440730	exon5			ATCAAGCGCGTCC	AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.1396C>T	1.37:g.231337125C>T	ENSP00000355613:p.Arg466Cys	113.0	0.0		133.0	48.0	NM_001004342	Q5TER7|Q5TER8|Q7Z4K7	Missense_Mutation	SNP	ENST00000366653.5	37	CCDS44333.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.438407	0.83885	0.0	1.2E-4	ENSG00000119283	ENST00000444294;ENST00000366652;ENST00000449018;ENST00000366653	T;T;T;T	0.75477	-0.94;-0.83;-0.92;-0.94	5.41	5.41	0.78517	B-box, C-terminal (1);COS domain (1);	0.000000	0.85682	D	0.000000	D	0.85292	0.5663	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86755	0.1963	10	0.87932	D	0	.	14.0761	0.64891	0.1506:0.8493:0.0:0.0	.	466	Q6ZTA4	TRI67_HUMAN	C	466;466;404;466	ENSP00000412124:R466C;ENSP00000355612:R466C;ENSP00000400163:R404C;ENSP00000355613:R466C	ENSP00000355612:R466C	R	+	1	0	TRIM67	229403748	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	3.784000	0.55416	2.530000	0.85305	0.555000	0.69702	CGC	.		0.537	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092649.3	NM_001004342	
TRIP4	9325	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	64701814	64701814	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr15:64701814T>C	ENST00000261884.3	+	7	890	c.830T>C	c.(829-831)aTt>aCt	p.I277T	TRIP4_ENST00000559565.1_3'UTR	NM_016213.4	NP_057297.2	Q15650	TRIP4_HUMAN	thyroid hormone receptor interactor 4	277					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21						TTTCTCAGTATTCGAAGGACC	0.393																																					p.I277T		.											.	TRIP4	188	0			c.T830C						.						95.0	86.0	89.0					15																	64701814		2203	4300	6503	SO:0001583	missense	9325	exon7			TCAGTATTCGAAG	L40371	CCDS10194.1	15q22.1	2014-02-17			ENSG00000103671	ENSG00000103671		"""-"""	12310	protein-coding gene	gene with protein product	"""zinc finger, C2HC5-type"""	604501				7776974	Standard	NM_016213		Approved	HsT17391, ZC2HC5	uc002anm.3	Q15650	OTTHUMG00000133033	ENST00000261884.3:c.830T>C	15.37:g.64701814T>C	ENSP00000261884:p.Ile277Thr	127.0	0.0		149.0	11.0	NM_016213	B2RAS0|Q96ED7|Q9UKH0	Missense_Mutation	SNP	ENST00000261884.3	37	CCDS10194.1	.	.	.	.	.	.	.	.	.	.	T	15.26	2.779454	0.49891	.	.	ENSG00000103671	ENST00000261884	.	.	.	5.65	5.65	0.86999	.	0.133960	0.64402	D	0.000011	T	0.42698	0.1214	N	0.24115	0.695	0.53688	D	0.999973	B	0.32717	0.381	B	0.24006	0.05	T	0.36456	-0.9747	9	0.36615	T	0.2	-26.0985	15.884	0.79226	0.0:0.0:0.0:1.0	.	277	Q15650	TRIP4_HUMAN	T	277	.	ENSP00000261884:I277T	I	+	2	0	TRIP4	62488867	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	7.628000	0.83189	2.161000	0.67846	0.454000	0.30748	ATT	.		0.393	TRIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256635.2	NM_016213	
URB2	9816	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	229794870	229794870	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr1:229794870A>C	ENST00000258243.2	+	10	4537	c.4401A>C	c.(4399-4401)aaA>aaC	p.K1467N		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	1467						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						CAGCTGTGAAAAGTCTGCTGC	0.552																																					p.K1467N		.											.	URB2	174	0			c.A4401C						.						125.0	129.0	127.0					1																	229794870		2203	4300	6503	SO:0001583	missense	9816	exon10			TGTGAAAAGTCTG	D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.4401A>C	1.37:g.229794870A>C	ENSP00000258243:p.Lys1467Asn	87.0	0.0		85.0	5.0	NM_014777	Q5VYC9	Missense_Mutation	SNP	ENST00000258243.2	37	CCDS31052.1	.	.	.	.	.	.	.	.	.	.	A	14.59	2.580517	0.46006	.	.	ENSG00000135763	ENST00000258243;ENST00000434387	T;T	0.48201	0.82;0.82	5.29	-7.0	0.01599	Nucleolar 27S pre-rRNA processing, Urb2/Npa2, C-terminal (1);	0.046638	0.85682	D	0.000000	T	0.62478	0.2431	M	0.74258	2.255	0.37457	D	0.915054	D	0.89917	1.0	D	0.80764	0.994	T	0.71928	-0.4444	9	.	.	.	-18.0148	18.6368	0.91382	0.2498:0.0:0.7502:0.0	.	1467	Q14146	URB2_HUMAN	N	1467;83	ENSP00000258243:K1467N;ENSP00000395107:K83N	.	K	+	3	2	URB2	227861493	0.031000	0.19500	0.003000	0.11579	0.148000	0.21650	0.087000	0.14958	-1.359000	0.02174	-0.297000	0.09499	AAA	.		0.552	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	NM_014777	
VAMP1	6843	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	6575451	6575451	+	Silent	SNP	G	G	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr12:6575451G>A	ENST00000396308.3	-	2	214	c.69C>T	c.(67-69)ggC>ggT	p.G23G	VAMP1_ENST00000400911.3_Silent_p.G23G|VAMP1_ENST00000361716.3_Silent_p.G23G|VAMP1_ENST00000535180.1_Silent_p.G23G|VAMP1_ENST00000544432.1_Intron|TAPBPL_ENST00000545700.1_3'UTR	NM_014231.3|NM_199245.1	NP_055046.1|NP_954740.1	P23763	VAMP1_HUMAN	vesicle-associated membrane protein 1 (synaptobrevin 1)	23					neurotransmitter secretion (GO:0007269)|SNARE complex assembly (GO:0035493)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuron projection (GO:0043005)|synapse (GO:0045202)				endometrium(1)|large_intestine(1)|prostate(1)	3					Botulinum Toxin Type B(DB00042)	TAGGAGGAGGGCCAGGGGGAC	0.537																																					p.G23G		.											.	VAMP1	90	0			c.C69T						.						100.0	108.0	105.0					12																	6575451		2203	4300	6503	SO:0001819	synonymous_variant	6843	exon2			AGGAGGGCCAGGG		CCDS31731.1, CCDS41740.1, CCDS44809.1, CCDS73422.1	12p	2013-02-13			ENSG00000139190	ENSG00000139190		"""Vesicle-associated membrane proteins"""	12642	protein-coding gene	gene with protein product		185880		SYB1		1976629	Standard	XM_006719011		Approved	VAMP-1	uc001qok.3	P23763	OTTHUMG00000168269	ENST00000396308.3:c.69C>T	12.37:g.6575451G>A		101.0	1.0		118.0	48.0	NM_014231	A8MVP3|D3DUR3|O75468|Q15857|Q6FG94|Q8IVC9	Silent	SNP	ENST00000396308.3	37	CCDS41740.1																																																																																			.		0.537	VAMP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399078.1		
WT1	7490	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	32421555	32421555	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr11:32421555G>A	ENST00000379079.2	-	6	674	c.401C>T	c.(400-402)aCg>aTg	p.T134M	WT1_ENST00000530998.1_Missense_Mutation_p.T117M|WT1_ENST00000448076.3_Missense_Mutation_p.T346M|WT1_ENST00000332351.3_Missense_Mutation_p.T346M	NM_001198551.1	NP_001185480.1	P19544	WT1_HUMAN	Wilms tumor 1	278					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			GAGGATGGGCGTTGTGTGGTT	0.557			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																												p.T346M		.	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	WT1	6891	0			c.C1037T						.						303.0	252.0	270.0					11																	32421555		2202	4299	6501	SO:0001583	missense	7490	exon6	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	ATGGGCGTTGTGT		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000379079.2:c.401C>T	11.37:g.32421555G>A	ENSP00000368370:p.Thr134Met	269.0	0.0		261.0	11.0	NM_024424	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Missense_Mutation	SNP	ENST00000379079.2	37	CCDS55751.1	.	.	.	.	.	.	.	.	.	.	G	14.05	2.418840	0.42918	.	.	ENSG00000184937	ENST00000379079;ENST00000332351;ENST00000530998;ENST00000452863;ENST00000448076;ENST00000527775	D;D;D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89;-1.89;-1.89	5.98	5.98	0.97165	Wilm&apos (1);s tumour protein, N-terminal (1);	0.255135	0.30593	U	0.009287	D	0.86908	0.6046	L	0.46157	1.445	0.09310	N	1	P;P;P;P;P	0.48694	0.914;0.668;0.616;0.786;0.616	P;P;P;P;P	0.52109	0.493;0.69;0.562;0.627;0.562	T	0.81116	-0.1079	10	0.48119	T	0.1	.	16.6753	0.85277	0.0:0.1293:0.8707:0.0	.	334;278;351;117;134	P19544-8;P19544;P19544-7;B3KSA5;P19544-6	.;WT1_HUMAN;.;.;.	M	134;346;117;329;346;97	ENSP00000368370:T134M;ENSP00000331327:T346M;ENSP00000435307:T117M;ENSP00000415516:T329M;ENSP00000413452:T346M;ENSP00000435351:T97M	ENSP00000331327:T346M	T	-	2	0	WT1	32378131	0.946000	0.32159	0.011000	0.14972	0.059000	0.15707	4.759000	0.62227	2.835000	0.97688	0.650000	0.86243	ACG	.		0.557	WT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000095434.1	NM_000378	
ZDHHC17	23390	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	77158072	77158072	+	Missense_Mutation	SNP	A	A	G	rs562629778		TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr12:77158072A>G	ENST00000426126.2	+	1	705	c.56A>G	c.(55-57)gAt>gGt	p.D19G	ZDHHC17_ENST00000359019.4_Missense_Mutation_p.I4V|ZDHHC17_ENST00000334822.5_Missense_Mutation_p.D19G	NM_015336.2	NP_056151.2	Q8IUH5	ZDH17_HUMAN	zinc finger, DHHC-type containing 17	19					lipoprotein transport (GO:0042953)|magnesium ion transport (GO:0015693)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein palmitoylation (GO:0018345)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|large_intestine(3)|liver(2)|lung(14)	23						GATGAGTACGATACCGAAGCG	0.642													A|||	1	0.000199681	0.0	0.0	5008	,	,		12138	0.0		0.001	False		,,,				2504	0.0				p.D19G		.											.	.	.	0			c.A56G						.						41.0	49.0	46.0					12																	77158072		2016	4158	6174	SO:0001583	missense	23390	exon1			AGTACGATACCGA	AB023163	CCDS44946.1	12q21.2	2013-01-10				ENSG00000186908		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18412	protein-coding gene	gene with protein product		607799				9700202, 18794299	Standard	NM_015336		Approved	HIP14, HYPH, KIAA0946	uc001syk.1	Q8IUH5	OTTHUMG00000169917	ENST00000426126.2:c.56A>G	12.37:g.77158072A>G	ENSP00000403397:p.Asp19Gly	66.0	0.0		51.0	18.0	NM_015336	B4DR39|O75407|Q7Z2I0|Q86W89|Q86YK0|Q9P088|Q9UPZ8	Missense_Mutation	SNP	ENST00000426126.2	37	CCDS44946.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.00|16.00	2.998327|2.998327	0.54147|0.54147	.|.	.|.	ENSG00000186908|ENSG00000186908	ENST00000426126;ENST00000334822|ENST00000359019	T;T|T	0.34072|0.38240	1.38;1.38|1.15	4.24|4.24	4.24|4.24	0.50183|0.50183	.|.	0.473631|.	0.23146|.	N|.	0.051417|.	T|T	0.18087|0.18087	0.0434|0.0434	N|N	0.03608|0.03608	-0.345|-0.345	0.21719|0.21719	N|N	0.999577|0.999577	B|.	0.18741|.	0.03|.	B|.	0.15870|.	0.014|.	T|T	0.16958|0.16958	-1.0385|-1.0385	10|7	0.30854|0.22706	T|T	0.27|0.39	-0.9606|-0.9606	10.9418|10.9418	0.47278|0.47278	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	19|.	Q8IUH5|.	ZDH17_HUMAN|.	G|V	19|4	ENSP00000403397:D19G;ENSP00000334868:D19G|ENSP00000351913:I4V	ENSP00000334868:D19G|ENSP00000351913:I4V	D|I	+|+	2|1	0|0	ZDHHC17|ZDHHC17	75682203|75682203	0.996000|0.996000	0.38824|0.38824	0.868000|0.868000	0.34077|0.34077	0.988000|0.988000	0.76386|0.76386	4.273000|4.273000	0.58914|0.58914	1.773000|1.773000	0.52216|0.52216	0.454000|0.454000	0.30748|0.30748	GAT|ATA	.		0.642	ZDHHC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406555.1	NM_015336	
ZFAND4	93550	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	46111982	46111982	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr10:46111982C>G	ENST00000344646.5	-	10	2301	c.2086G>C	c.(2086-2088)Gaa>Caa	p.E696Q	ZFAND4_ENST00000374370.1_5'UTR|ZFAND4_ENST00000374371.2_3'UTR|ZFAND4_ENST00000374366.3_Missense_Mutation_p.E622Q	NM_001128324.2|NM_174890.2	NP_001121796.1|NP_777550.2	Q86XD8	ZFAN4_HUMAN	zinc finger, AN1-type domain 4	696							zinc ion binding (GO:0008270)										CCATGAGTTTCTGCATAACGA	0.403																																					p.E696Q		.											.	.	.	0			c.G2086C						.						175.0	152.0	160.0					10																	46111982		2203	4300	6503	SO:0001583	missense	93550	exon10			GAGTTTCTGCATA	AF311324	CCDS7214.1, CCDS60520.1	10q11.22	2013-01-09	2011-11-10	2011-11-10	ENSG00000172671	ENSG00000172671		"""Zinc fingers, AN1-type domain containing"""	23504	protein-coding gene	gene with protein product			"""AN1, ubiquitin-like, homolog (Xenopus laevis)"""	ANUBL1			Standard	XM_005271837		Approved	FLJ40185	uc001jcp.4	Q86XD8	OTTHUMG00000018085	ENST00000344646.5:c.2086G>C	10.37:g.46111982C>G	ENSP00000339484:p.Glu696Gln	224.0	0.0		228.0	71.0	NM_001128324	A8K8V4|B2RAX2|Q5VVY5	Missense_Mutation	SNP	ENST00000344646.5	37	CCDS7214.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.730709	0.89390	.	.	ENSG00000172671	ENST00000344646;ENST00000374366;ENST00000374370	T;T	0.53640	0.61;0.61	5.86	5.86	0.93980	Zinc finger, AN1-type (4);	0.255515	0.37053	N	0.002261	T	0.69780	0.3149	M	0.74647	2.275	0.80722	D	1	D	0.61697	0.99	D	0.74348	0.983	T	0.71699	-0.4514	10	0.87932	D	0	-23.9616	17.6957	0.88281	0.0:1.0:0.0:0.0	.	696	Q86XD8	ANUB1_HUMAN	Q	696;622;578	ENSP00000339484:E696Q;ENSP00000363486:E622Q	ENSP00000339484:E696Q	E	-	1	0	ANUBL1	45431988	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.452000	0.80683	2.776000	0.95493	0.655000	0.94253	GAA	.		0.403	ZFAND4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047790.1	NM_174890	
ZNF142	7701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	219513586	219513586	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr2:219513586C>A	ENST00000449707.1	-	6	1466	c.1045G>T	c.(1045-1047)Gat>Tat	p.D349Y	ZNF142_ENST00000411696.2_Missense_Mutation_p.D349Y	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	349					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CAAGCAAAATCACAGTGGGGG	0.562											OREG0015202	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D349Y	Colon(170;867 1942 8995 15834 18053)	.											.	ZNF142	137	0			c.G1045T						.						57.0	58.0	58.0					2																	219513586		2069	4192	6261	SO:0001583	missense	7701	exon6			CAAAATCACAGTG	U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.1045G>T	2.37:g.219513586C>A	ENSP00000408643:p.Asp349Tyr	97.0	0.0	2259	143.0	53.0	NM_001105537	Q92510	Missense_Mutation	SNP	ENST00000449707.1	37	CCDS42817.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.493677	0.84962	.	.	ENSG00000115568	ENST00000449707;ENST00000411696	T;T	0.14266	2.52;2.52	5.35	5.35	0.76521	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.045033	0.85682	D	0.000000	T	0.44498	0.1296	M	0.87381	2.88	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.67231	0.91;0.95	T	0.44636	-0.9315	10	0.62326	D	0.03	1.9246	19.6142	0.95626	0.0:1.0:0.0:0.0	.	349;186	P52746;A8MWU9	ZN142_HUMAN;.	Y	349	ENSP00000408643:D349Y;ENSP00000398798:D349Y	ENSP00000398798:D349Y	D	-	1	0	ZNF142	219221830	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.774000	0.68906	2.941000	0.99782	0.655000	0.94253	GAT	.		0.562	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1	NM_005081	
ZNF521	25925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	22807281	22807281	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr18:22807281G>T	ENST00000361524.3	-	4	749	c.601C>A	c.(601-603)Cca>Aca	p.P201T	ZNF521_ENST00000584787.1_5'UTR|ZNF521_ENST00000538137.2_Missense_Mutation_p.P201T|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	201					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CATTTATATGGCTTGTTGGAC	0.498			T	PAX5	ALL																																p.P201T		.		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	ZNF521	275	0			c.C601A						.						92.0	88.0	90.0					18																	22807281		2203	4300	6503	SO:0001583	missense	25925	exon4			TATATGGCTTGTT	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.601C>A	18.37:g.22807281G>T	ENSP00000354794:p.Pro201Thr	271.0	0.0		258.0	90.0	NM_015461	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.627694	0.28978	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.16897	2.31;2.31	5.98	5.98	0.97165	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.48447	0.1500	M	0.81112	2.525	0.50632	D	0.99988	D	0.89917	1.0	D	0.97110	1.0	T	0.42515	-0.9447	10	0.62326	D	0.03	-12.7935	20.4434	0.99119	0.0:0.0:1.0:0.0	.	201	Q96K83	ZN521_HUMAN	T	201;235;201	ENSP00000354794:P201T;ENSP00000382352:P201T	ENSP00000354794:P201T	P	-	1	0	ZNF521	21061279	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.838000	0.97847	0.655000	0.94253	CCA	.		0.498	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
ZNF611	81856	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53208756	53208756	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A2-01A-11D-A20W-10	TCGA-DD-A3A2-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b32c222-05fb-4c01-ab8a-be3e922002e7	cefe8443-c2b3-4fd4-a429-423b1e389d33	g.chr19:53208756C>G	ENST00000319783.1	-	7	1868	c.1552G>C	c.(1552-1554)Gtt>Ctt	p.V518L	ZNF611_ENST00000602046.1_5'Flank|ZNF611_ENST00000595798.1_Missense_Mutation_p.V449L|ZNF611_ENST00000602162.1_Missense_Mutation_p.V449L|ZNF611_ENST00000543227.1_Missense_Mutation_p.V518L|ZNF611_ENST00000453741.2_Missense_Mutation_p.V449L|ZNF611_ENST00000540744.1_Missense_Mutation_p.V518L	NM_030972.3	NP_112234.3	Q8N823	ZN611_HUMAN	zinc finger protein 611	518					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		CGACTGAAAACCTTTTCACAT	0.368																																					p.V518L		.											.	ZNF611	91	0			c.G1552C						.						120.0	119.0	119.0					19																	53208756		2203	4300	6503	SO:0001583	missense	81856	exon7			TGAAAACCTTTTC	AK091389	CCDS12855.1, CCDS54312.1	19q13.42	2013-01-08			ENSG00000213020	ENSG00000213020		"""Zinc fingers, C2H2-type"", ""-"""	28766	protein-coding gene	gene with protein product						12477932	Standard	NM_030972		Approved	MGC5384	uc010ydq.2	Q8N823	OTTHUMG00000154908	ENST00000319783.1:c.1552G>C	19.37:g.53208756C>G	ENSP00000322427:p.Val518Leu	143.0	0.0		138.0	60.0	NM_030972	B3KRD5|Q69YG9	Missense_Mutation	SNP	ENST00000319783.1	37	CCDS12855.1	.	.	.	.	.	.	.	.	.	.	.	12.08	1.829947	0.32329	.	.	ENSG00000213020	ENST00000543227;ENST00000540744;ENST00000453741;ENST00000319783	T;T;T;T	0.18657	2.2;2.2;2.2;2.2	1.51	-1.04	0.10068	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10423	0.0255	N	0.16166	0.38	0.09310	N	1	B	0.14012	0.009	B	0.17979	0.02	T	0.31364	-0.9946	9	0.87932	D	0	.	3.0195	0.06071	0.0:0.2713:0.2395:0.4892	.	518	Q8N823	ZN611_HUMAN	L	518;518;449;518	ENSP00000437616:V518L;ENSP00000439211:V518L;ENSP00000443505:V449L;ENSP00000322427:V518L	ENSP00000322427:V518L	V	-	1	0	ZNF611	57900568	0.000000	0.05858	0.001000	0.08648	0.016000	0.09150	-4.596000	0.00210	-0.051000	0.13334	0.205000	0.17691	GTT	.		0.368	ZNF611-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337612.1	NM_030972	
