#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADAM12	8038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	127798378	127798378	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr10:127798378T>C	ENST00000368679.4	-	7	953	c.644A>G	c.(643-645)tAt>tGt	p.Y215C	ADAM12_ENST00000368676.4_Missense_Mutation_p.Y215C	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	215	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		CAGCTCCACATACTTAGTTGC	0.403																																					p.Y215C		.											.	ADAM12	716	0			c.A644G						.						171.0	147.0	155.0					10																	127798378		2203	4300	6503	SO:0001583	missense	8038	exon7			TCCACATACTTAG	AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.644A>G	10.37:g.127798378T>C	ENSP00000357668:p.Tyr215Cys	78.0	0.0		68.0	21.0	NM_021641	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	ENST00000368679.4	37	CCDS7653.1	.	.	.	.	.	.	.	.	.	.	T	18.70	3.679847	0.68042	.	.	ENSG00000148848	ENST00000368679;ENST00000368676;ENST00000448723	T;T;T	0.73152	-0.72;-0.72;-0.72	5.39	5.39	0.77823	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.64402	D	0.000001	D	0.88325	0.6406	H	0.94183	3.505	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.983;0.983;0.983;1.0	D	0.91227	0.5011	10	0.62326	D	0.03	.	15.5813	0.76445	0.0:0.0:0.0:1.0	.	212;215;212;215	O43184-3;O43184-2;O43184-4;O43184	.;.;.;ADA12_HUMAN	C	215;215;212	ENSP00000357668:Y215C;ENSP00000357665:Y215C;ENSP00000391268:Y212C	ENSP00000357665:Y215C	Y	-	2	0	ADAM12	127788368	1.000000	0.71417	0.980000	0.43619	0.476000	0.33039	7.459000	0.80802	2.267000	0.75376	0.528000	0.53228	TAT	.		0.403	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1		
ADAMTS17	170691	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	100594228	100594228	+	Silent	SNP	G	G	A	rs368641530		TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr15:100594228G>A	ENST00000268070.4	-	16	2274	c.2169C>T	c.(2167-2169)aaC>aaT	p.N723N		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	723	Spacer.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		TCCAGTCACTGTTGATGGACC	0.532																																					p.N723N		.											.	ADAMTS17	228	0			c.C2169T						.	G		0,4406		0,0,2203	141.0	145.0	144.0		2169	4.9	1.0	15		144	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ADAMTS17	NM_139057.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		723/1096	100594228	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	170691	exon16			GTCACTGTTGATG	AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.2169C>T	15.37:g.100594228G>A		101.0	0.0		301.0	143.0	NM_139057	Q2I7G4|Q6ZN75	Silent	SNP	ENST00000268070.4	37	CCDS10383.1																																																																																			.		0.532	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313595.1	NM_139057	
ADCY8	114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	131949435	131949435	+	Silent	SNP	G	G	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr8:131949435G>A	ENST00000286355.5	-	5	3457	c.1365C>T	c.(1363-1365)tgC>tgT	p.C455C	RP11-737F9.1_ENST00000523318.1_RNA|ADCY8_ENST00000377928.3_Silent_p.C455C	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	455					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			TAATACGAAGGCAGTGATGCT	0.522										HNSCC(32;0.087)																											p.C455C		.											.	ADCY8	157	0			c.C1365T						.						61.0	57.0	58.0					8																	131949435		2203	4300	6503	SO:0001819	synonymous_variant	114	exon5			ACGAAGGCAGTGA	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.1365C>T	8.37:g.131949435G>A		135.0	0.0		225.0	50.0	NM_001115		Silent	SNP	ENST00000286355.5	37	CCDS6363.1																																																																																			.		0.522	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
ANGPT4	51378	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	861812	861812	+	Splice_Site	SNP	A	A	C			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr20:861812A>C	ENST00000381922.3	-	5	1054		c.e5+1		ANGPT4_ENST00000546022.1_Splice_Site	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						GAGCCCCCTAACCTTCCTGGG	0.597																																					.	Pancreas(181;481 2077 3259 31286 49856)	.											.	ANGPT4	92	0			c.951+2T>G						.						53.0	44.0	47.0					20																	861812		2203	4300	6503	SO:0001630	splice_region_variant	51378	exon6			CCCCTAACCTTCC	AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.951+1T>G	20.37:g.861812A>C		118.0	0.0		144.0	51.0	NM_015985	B4E3J9|Q5TFF4|Q9H4Z4	Splice_Site	SNP	ENST00000381922.3	37	CCDS13009.1	.	.	.	.	.	.	.	.	.	.	A	17.54	3.414167	0.62511	.	.	ENSG00000101280	ENST00000381922;ENST00000546022	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5025	0.61465	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ANGPT4	809812	1.000000	0.71417	0.982000	0.44146	0.589000	0.36550	8.892000	0.92491	2.069000	0.61940	0.459000	0.35465	.	.		0.597	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077493.1	NM_015985	Intron
ANKFN1	162282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	54558126	54558126	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr17:54558126C>T	ENST00000318698.2	+	16	2082	c.2047C>T	c.(2047-2049)Ctc>Ttc	p.L683F	ANKFN1_ENST00000566473.2_Missense_Mutation_p.L683F	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	683										NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						CTTCTACGAGCTCCAGATGGC	0.423																																					p.L683F		.											.	ANKFN1	136	0			c.C2047T						.						200.0	194.0	196.0					17																	54558126		2203	4300	6503	SO:0001583	missense	162282	exon16			TACGAGCTCCAGA	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.2047C>T	17.37:g.54558126C>T	ENSP00000321627:p.Leu683Phe	71.0	0.0		129.0	22.0	NM_153228		Missense_Mutation	SNP	ENST00000318698.2	37	CCDS32686.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.182945	0.78677	.	.	ENSG00000153930	ENST00000318698	T	0.45668	0.89	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.68943	0.3056	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.72261	-0.4345	10	0.54805	T	0.06	-8.0775	19.1091	0.93310	0.0:1.0:0.0:0.0	.	683	Q8N957	ANKF1_HUMAN	F	683	ENSP00000321627:L683F	ENSP00000321627:L683F	L	+	1	0	ANKFN1	51913125	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.176000	0.77643	2.496000	0.84212	0.655000	0.94253	CTC	.		0.423	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338043.1	NM_153228	
APCDD1	147495	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	10468488	10468488	+	Silent	SNP	C	C	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr18:10468488C>T	ENST00000355285.5	+	2	435	c.81C>T	c.(79-81)ctC>ctT	p.L27L	APCDD1_ENST00000578882.1_Silent_p.L27L	NM_153000.4	NP_694545.1			adenomatosis polyposis coli down-regulated 1											NS(1)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				READ - Rectum adenocarcinoma(15;0.08)		GTTCTGCCCTCCTTCATCCAG	0.488																																					p.L27L		.											.	APCDD1	90	0			c.C81T						.						148.0	152.0	151.0					18																	10468488		2203	4300	6503	SO:0001819	synonymous_variant	147495	exon2			TGCCCTCCTTCAT	AB056722	CCDS11849.1	18p11.21	2006-07-07			ENSG00000154856	ENSG00000154856			15718	protein-coding gene	gene with protein product		607479				12384519	Standard	NM_153000		Approved	B7323	uc002kom.4	Q8J025	OTTHUMG00000131635	ENST00000355285.5:c.81C>T	18.37:g.10468488C>T		110.0	0.0		135.0	51.0	NM_153000		Silent	SNP	ENST00000355285.5	37	CCDS11849.1																																																																																			.		0.488	APCDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254529.2	NM_153000	
ARL5C	390790	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	37319108	37319108	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr17:37319108C>G	ENST00000269586.7	-	3	110	c.111G>C	c.(109-111)ttG>ttC	p.L37F	ARL5C_ENST00000583123.1_5'Flank|ARL5C_ENST00000444555.1_Missense_Mutation_p.L37F	NM_001143968.1	NP_001137440.1	A6NH57	ARL5C_HUMAN	ADP-ribosylation factor-like 5C	37					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)										CCTCATTGGTCAAGCTGGGGA	0.537																																					p.L37F		.											.	ARL5C	68	0			c.G111C						.						61.0	49.0	53.0					17																	37319108		692	1591	2283	SO:0001583	missense	390790	exon3			ATTGGTCAAGCTG		CCDS45664.1	17q12	2014-05-09	2005-11-08	2005-11-08	ENSG00000141748	ENSG00000141748		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	31111	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 12"""	ARL12			Standard	NM_001143968		Approved		uc010wea.2	A6NH57		ENST00000269586.7:c.111G>C	17.37:g.37319108C>G	ENSP00000269586:p.Leu37Phe	128.0	0.0		144.0	11.0	NM_001143968		Missense_Mutation	SNP	ENST00000269586.7	37	CCDS45664.1	.	.	.	.	.	.	.	.	.	.	C	10.48	1.361138	0.24684	.	.	ENSG00000141748	ENST00000444555;ENST00000269586	D;D	0.83837	-1.77;-1.77	4.28	3.29	0.37713	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000010	D	0.87128	0.6100	M	0.72576	2.205	0.54753	D	0.999983	D	0.59767	0.986	P	0.62491	0.903	D	0.86653	0.1899	10	0.87932	D	0	-6.2415	7.501	0.27518	0.1902:0.6257:0.1841:0.0	.	37	A6NH57	ARL5C_HUMAN	F	37	ENSP00000387615:L37F;ENSP00000269586:L37F	ENSP00000269586:L37F	L	-	3	2	ARL5C	34572634	0.967000	0.33354	0.763000	0.31416	0.045000	0.14185	-0.046000	0.11983	1.123000	0.41961	0.655000	0.94253	TTG	.		0.537	ARL5C-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444566.1	NM_001143968	
ASB10	136371	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	150878543	150878543	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr7:150878543C>T	ENST00000420175.2	-	3	611	c.587G>A	c.(586-588)tGt>tAt	p.C196Y	ASB10_ENST00000275838.1_Missense_Mutation_p.C196Y|ASB10_ENST00000422024.1_Missense_Mutation_p.C241Y|ASB10_ENST00000377867.3_Missense_Mutation_p.C181Y|ASB10_ENST00000434669.1_Missense_Mutation_p.C241Y			Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box containing 10	196					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|lung(7)|skin(2)	12			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAGCTCCGCACACCTATTGGG	0.642																																					p.C196Y		.											.	ASB10	226	0			c.G587A						.						20.0	19.0	19.0					7																	150878543		2192	4279	6471	SO:0001583	missense	136371	exon3			TCCGCACACCTAT	AK055536	CCDS5921.2, CCDS47749.1, CCDS47750.1, CCDS47749.2, CCDS47750.2	7q35	2014-02-04	2011-01-25		ENSG00000146926	ENSG00000146926		"""Ankyrin repeat domain containing"""	17185	protein-coding gene	gene with protein product		615054	"""ankyrin repeat and SOCS box-containing 10"", ""glaucoma 1, open angle, F (adult-onset)"""	GLC1F		22156576	Standard	NM_080871		Approved		uc003wjm.1	Q8WXI3	OTTHUMG00000157013	ENST00000420175.2:c.587G>A	7.37:g.150878543C>T	ENSP00000391137:p.Cys196Tyr	82.0	0.0		111.0	41.0	NM_001142459	A0AVH0|Q6ZUL6	Missense_Mutation	SNP	ENST00000420175.2	37	CCDS47750.2	.	.	.	.	.	.	.	.	.	.	C	17.54	3.414789	0.62511	.	.	ENSG00000146926	ENST00000275838;ENST00000377867;ENST00000422024;ENST00000434669;ENST00000420175	T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17	5.14	5.14	0.70334	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.78426	0.4281	M	0.69463	2.115	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.80598	-0.1311	10	0.87932	D	0	-5.1831	17.951	0.89053	0.0:1.0:0.0:0.0	.	181;196;241	Q8WXI3-3;Q8WXI3;D5MNW9	.;ASB10_HUMAN;.	Y	196;181;241;241;196	ENSP00000275838:C196Y;ENSP00000367098:C181Y;ENSP00000401369:C241Y;ENSP00000398247:C241Y;ENSP00000391137:C196Y	ENSP00000275838:C196Y	C	-	2	0	ASB10	150509476	1.000000	0.71417	0.995000	0.50966	0.344000	0.29017	7.326000	0.79133	2.549000	0.85964	0.655000	0.94253	TGT	.		0.642	ASB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347096.3	NM_080871	
ASTL	431705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	96803391	96803391	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr2:96803391C>T	ENST00000342380.2	-	2	103	c.104G>A	c.(103-105)gGt>gAt	p.G35D		NM_001002036.3	NP_001002036.3			astacin-like metallo-endopeptidase (M12 family)											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(2)	30						GAAGCTGGTACCACAGGCTCC	0.612																																					p.G35D		.											.	ASTL	90	0			c.G104A						.						101.0	92.0	95.0					2																	96803391		2203	4300	6503	SO:0001583	missense	431705	exon2			CTGGTACCACAGG	AJ537600	CCDS33249.1	2q11.1	2014-07-23	2006-10-10		ENSG00000188886	ENSG00000188886	3.4.24.21		31704	protein-coding gene	gene with protein product	"""sperm acrosomal SLLP1 binding"""	608860	"""astacin-like metalloendopeptidase (M12 family)"""			15087446	Standard	NM_001002036		Approved	ovastacin, SAS1B	uc010yui.2	Q6HA08	OTTHUMG00000155212	ENST00000342380.2:c.104G>A	2.37:g.96803391C>T	ENSP00000343674:p.Gly35Asp	66.0	0.0		80.0	11.0	NM_001002036		Missense_Mutation	SNP	ENST00000342380.2	37	CCDS33249.1	.	.	.	.	.	.	.	.	.	.	C	10.02	1.235015	0.22626	.	.	ENSG00000188886	ENST00000342380	T	0.63744	-0.06	4.51	-3.66	0.04489	.	0.851198	0.09622	N	0.777472	T	0.34978	0.0916	N	0.24115	0.695	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.21314	-1.0249	10	0.13470	T	0.59	-0.5391	1.1629	0.01809	0.1376:0.2796:0.1849:0.3979	.	35	Q6HA08	ASTL_HUMAN	D	35	ENSP00000343674:G35D	ENSP00000343674:G35D	G	-	2	0	ASTL	96167118	0.000000	0.05858	0.031000	0.17742	0.937000	0.57800	-2.120000	0.01323	-0.411000	0.07530	0.558000	0.71614	GGT	.		0.612	ASTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338801.1		
BORA	79866	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	73312100	73312100	+	Splice_Site	SNP	T	T	C			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr13:73312100T>C	ENST00000390667.5	+	5	404	c.307T>C	c.(307-309)Ttt>Ctt	p.F103L	BORA_ENST00000377815.3_Splice_Site_p.F33L|BORA_ENST00000464754.1_3'UTR	NM_024808.2	NP_079084.2	Q6PGQ7	BORA_HUMAN	bora, aurora kinase A activator	103					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of mitosis (GO:0007088)|regulation of mitotic spindle organization (GO:0060236)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)	protein kinase binding (GO:0019901)										ATTTTCCTAGTTTTTCACTAA	0.343																																					p.F103L		.											.	.	.	0			c.T307C						.						133.0	123.0	126.0					13																	73312100		1829	4085	5914	SO:0001630	splice_region_variant	79866	exon5			TCCTAGTTTTTCA	BC025367	CCDS9446.1, CCDS66560.1, CCDS9446.2, CCDS73583.1	13q22.1	2013-08-13	2011-08-09	2011-08-09	ENSG00000136122	ENSG00000136122			24724	protein-coding gene	gene with protein product		610510	"""chromosome 13 open reading frame 34"""	C13orf34		16890155, 18378770, 18566290, 19487276	Standard	NM_001286746		Approved	FLJ22624	uc001viv.1	Q6PGQ7	OTTHUMG00000017068	ENST00000390667.5:c.307-1T>C	13.37:g.73312100T>C		96.0	0.0		71.0	18.0	NM_024808	B4DQ30|Q5W0P3|Q5W0P4|Q86YC6|Q96IW9|Q9H640	Missense_Mutation	SNP	ENST00000390667.5	37	CCDS9446.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	32|32	5.118751|5.118751	0.94385|0.94385	.|.	.|.	ENSG00000136122|ENSG00000136122	ENST00000377815;ENST00000390667|ENST00000377814	T;T|.	0.62788|.	0.08;0.0|.	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	0.047164|.	0.85682|.	D|.	0.000000|.	T|T	0.77765|0.77765	0.4179|0.4179	M|M	0.81802|0.81802	2.56|2.56	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.76494|.	0.998;0.999;0.999;0.999|.	D;D;D;D|.	0.76071|.	0.987;0.986;0.987;0.986|.	T|T	0.79145|0.79145	-0.1924|-0.1924	9|5	.|.	.|.	.|.	-26.6439|-26.6439	16.1668|16.1668	0.81768|0.81768	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	33;103;163;103|.	B4DQ30;A8K631;B5LMG6;Q6PGQ7|.	.;.;.;BORA_HUMAN|.	L|A	33;103|80	ENSP00000367046:F33L;ENSP00000375082:F103L|.	.|.	F|V	+|+	1|2	0|0	BORA|BORA	72210101|72210101	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	6.725000|6.725000	0.74752|0.74752	2.210000|2.210000	0.71456|0.71456	0.533000|0.533000	0.62120|0.62120	TTT|GTT	.		0.343	BORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045245.3	NM_024808	Missense_Mutation
C11orf70	85016	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	101952001	101952001	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr11:101952001G>A	ENST00000434758.2	+	6	692	c.664G>A	c.(664-666)Gtt>Att	p.V222I	C11orf70_ENST00000526781.1_Missense_Mutation_p.V222I	NM_032930.2	NP_116319.2	Q9BRQ4	CK070_HUMAN	chromosome 11 open reading frame 70	222										breast(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|skin(2)	12	all_epithelial(12;0.0137)	Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.0137)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0335)		TGTCTTTAAAGTTTCAGCTTA	0.308																																					p.V222I		.											.	C11orf70	91	0			c.G664A						.						84.0	86.0	86.0					11																	101952001		2203	4295	6498	SO:0001583	missense	85016	exon6			TTTAAAGTTTCAG	AK094851	CCDS8313.1, CCDS8313.2, CCDS53698.1	11q22.1	2012-05-31			ENSG00000137691	ENSG00000137691			28188	protein-coding gene	gene with protein product							Standard	NM_032930		Approved	MGC13040	uc001pgp.3	Q9BRQ4	OTTHUMG00000167320	ENST00000434758.2:c.664G>A	11.37:g.101952001G>A	ENSP00000414390:p.Val222Ile	28.0	0.0		32.0	7.0	NM_032930	E9PJU1	Missense_Mutation	SNP	ENST00000434758.2	37	CCDS8313.2	.	.	.	.	.	.	.	.	.	.	G	23.2	4.387631	0.82902	.	.	ENSG00000137691	ENST00000434758;ENST00000526781;ENST00000423732	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.77598	0.4154	M	0.64630	1.985	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.74948	-0.3490	9	0.42905	T	0.14	-24.4378	18.8612	0.92273	0.0:0.0:1.0:0.0	.	222	Q9BRQ4	CK070_HUMAN	I	222;222;184	.	ENSP00000392150:V184I	V	+	1	0	C11orf70	101457211	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.693000	0.84214	2.873000	0.98535	0.563000	0.77884	GTT	.		0.308	C11orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394144.1	NM_032930	
C19orf35	374872	hgsc.bcm.edu;bcgsc.ca	37	19	2280897	2280897	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr19:2280897C>T	ENST00000342063.3	-	2	127	c.34G>A	c.(34-36)Gag>Aag	p.E12K		NM_198532.2	NP_940934.1	Q6ZS72	CS035_HUMAN	chromosome 19 open reading frame 35	12										large_intestine(1)|lung(5)|pancreas(1)|prostate(1)	8				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTGTCGGGCTCGGGGGGCTCT	0.687																																					p.E12K		.											.	C19orf35	91	0			c.G34A						.						20.0	23.0	22.0					19																	2280897		2202	4298	6500	SO:0001583	missense	374872	exon2			CGGGCTCGGGGGG	AK127680	CCDS12087.1	19p13.3	2012-10-26			ENSG00000188305	ENSG00000188305			24793	protein-coding gene	gene with protein product							Standard	NM_198532		Approved	FLJ45778	uc002lvn.2	Q6ZS72	OTTHUMG00000178460	ENST00000342063.3:c.34G>A	19.37:g.2280897C>T	ENSP00000345102:p.Glu12Lys	28.0	0.0		44.0	4.0	NM_198532		Missense_Mutation	SNP	ENST00000342063.3	37	CCDS12087.1	.	.	.	.	.	.	.	.	.	.	c	9.616	1.132482	0.21041	.	.	ENSG00000188305	ENST00000342063	T	0.14391	2.51	2.84	1.8	0.24995	.	.	.	.	.	T	0.07188	0.0182	N	0.22421	0.69	0.09310	N	1	P	0.36660	0.564	B	0.27262	0.078	T	0.26224	-1.0109	9	0.33141	T	0.24	.	7.3986	0.26950	0.0:0.8567:0.0:0.1433	.	12	Q6ZS72	CS035_HUMAN	K	12	ENSP00000345102:E12K	ENSP00000345102:E12K	E	-	1	0	C19orf35	2231897	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.140000	0.16056	1.589000	0.49982	0.556000	0.70494	GAG	C|1.000;T|0.000		0.687	C19orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442080.1	NM_198532	
C1QTNF3	114899	broad.mit.edu;bcgsc.ca	37	5	34024046	34024056	+	Frame_Shift_Del	DEL	CATAAGGTACA	CATAAGGTACA	-			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	CATAAGGTACA	CATAAGGTACA	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr5:34024046_34024056delCATAAGGTACA	ENST00000231338.7	-	5	626_636	c.539_549delTGTACCTTATG	c.(538-549)gtgtaccttatgfs	p.VYLM180fs	C1QTNF3_ENST00000382065.3_Frame_Shift_Del_p.VYLM253fs|C1QTNF3_ENST00000513065.1_5'UTR|RP11-1084J3.4_ENST00000382079.3_Frame_Shift_Del_p.VYLM164fs	NM_030945.3	NP_112207.1	Q9BXJ4	C1QT3_HUMAN	C1q and tumor necrosis factor related protein 3	180	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				cellular triglyceride homeostasis (GO:0035356)|fat cell differentiation (GO:0045444)|negative regulation of gene expression (GO:0010629)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of monocyte chemotactic protein-1 production (GO:0071638)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of adiponectin secretion (GO:0070165)|positive regulation of cytokine secretion (GO:0050715)|protein trimerization (GO:0070206)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|prostate(3)|stomach(1)|urinary_tract(1)	17	all_lung(31;0.0207)					TGCCATTGTGCATAAGGTACACATACACTTC	0.412																																					p.253_256del		.											.	C1QTNF3	90	0			c.758_768del						.																																			SO:0001589	frameshift_variant	114899	exon5			ATTGTGCATAAGG	AF329837	CCDS3904.1, CCDS34141.1	5p13	2009-05-20			ENSG00000082196	ENSG00000082196			14326	protein-coding gene	gene with protein product	"""cartonectin"""	612045				18421280	Standard	NM_030945		Approved	CTRP3, Cors, Corcs, 2310005P21Rik, Cors-26	uc003jio.3	Q9BXJ4	OTTHUMG00000090735	ENST00000231338.7:c.539_549delTGTACCTTATG	5.37:g.34024046_34024056delCATAAGGTACA	ENSP00000231338:p.Val180fs	177.0	0.0		209.0	9.0	NM_181435	Q0VAN4|Q542Y2|Q6MZN1|Q96KY1	Frame_Shift_Del	DEL	ENST00000231338.7	37	CCDS3904.1																																																																																			.		0.412	C1QTNF3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000207469.1	NM_030945	
CCDC88C	440193	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	91780183	91780183	+	Silent	SNP	C	C	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr14:91780183C>T	ENST00000389857.6	-	15	2063	c.1977G>A	c.(1975-1977)gaG>gaA	p.E659E		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	659					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				CCTCGACTTTCTCGGTGGCTG	0.632																																					p.E659E		.											.	CCDC88C	25	0			c.G1977A						.						27.0	29.0	29.0					14																	91780183		1950	4118	6068	SO:0001819	synonymous_variant	440193	exon15			GACTTTCTCGGTG		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.1977G>A	14.37:g.91780183C>T		62.0	1.0		49.0	17.0	NM_001080414	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Silent	SNP	ENST00000389857.6	37	CCDS45151.1																																																																																			.		0.632	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353	
CD101	9398	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	117554255	117554255	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr1:117554255G>C	ENST00000256652.4	+	3	566	c.508G>C	c.(508-510)Gca>Cca	p.A170P	CD101_ENST00000369470.1_Missense_Mutation_p.A170P	NM_001256106.1|NM_001256109.1|NM_001256111.1|NM_004258.4	NP_001243035.1|NP_001243038.1|NP_001243040.1|NP_004249.2	Q93033	IGSF2_HUMAN	CD101 molecule	170	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(14)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CACCTGTGAGGCATCCAAAGC	0.502																																					p.A170P		.											.	CD101	94	0			c.G508C						.						109.0	93.0	99.0					1																	117554255		2203	4300	6503	SO:0001583	missense	9398	exon3			TGTGAGGCATCCA	Z33642	CCDS891.1	1p13	2013-01-29	2009-10-27	2009-10-27	ENSG00000134256	ENSG00000134256		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5949	protein-coding gene	gene with protein product		604516	"""immunoglobulin superfamily, member 2"""	IGSF2		7722300	Standard	NM_004258		Approved	V7	uc010oxb.2	Q93033	OTTHUMG00000012029	ENST00000256652.4:c.508G>C	1.37:g.117554255G>C	ENSP00000256652:p.Ala170Pro	138.0	0.0		235.0	34.0	NM_001256109	Q15856	Missense_Mutation	SNP	ENST00000256652.4	37	CCDS891.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.097884	0.56075	.	.	ENSG00000134256	ENST00000256652;ENST00000369470	T;T	0.64803	-0.12;-0.12	5.33	3.42	0.39159	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.500066	0.19450	N	0.113957	T	0.56702	0.2003	M	0.76170	2.325	0.30716	N	0.748722	D	0.54397	0.966	P	0.52386	0.697	T	0.57365	-0.7824	10	0.72032	D	0.01	0.0208	8.897	0.35470	0.0804:0.0:0.7719:0.1477	.	170	Q93033	IGSF2_HUMAN	P	170	ENSP00000256652:A170P;ENSP00000358482:A170P	ENSP00000256652:A170P	A	+	1	0	CD101	117355778	1.000000	0.71417	0.019000	0.16419	0.323000	0.28346	6.423000	0.73361	0.609000	0.30018	0.650000	0.86243	GCA	.		0.502	CD101-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033274.1	NM_004258	
CD200	4345	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	112066565	112066565	+	Silent	SNP	T	T	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr3:112066565T>A	ENST00000315711.8	+	4	639	c.582T>A	c.(580-582)tcT>tcA	p.S194S	CD200_ENST00000473539.1_Silent_p.S219S|CD200_ENST00000383681.3_Silent_p.S120S	NM_005944.5	NP_005935.4	P41217	OX2G_HUMAN	CD200 molecule	194	Ig-like C2-type.				regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Acute lymphoblastic leukemia(4;1.7e-08)|all_hematologic(4;8.82e-05)				GGACCACGTCTGTTACCAGCA	0.547																																					p.S219S		.											.	CD200	90	0			c.T657A						.						125.0	122.0	123.0					3																	112066565		2203	4300	6503	SO:0001819	synonymous_variant	4345	exon5			CACGTCTGTTACC		CCDS2965.1, CCDS33818.1	3q13.2	2013-09-20	2006-03-28	2004-09-01	ENSG00000091972	ENSG00000091972		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7203	protein-coding gene	gene with protein product		155970	"""antigen identified by monoclonal antibody MRC OX-2"", ""CD200 antigen"""	MOX1, MOX2			Standard	XM_005247482		Approved	MRC, OX-2	uc003dyw.3	P41217	OTTHUMG00000159248	ENST00000315711.8:c.582T>A	3.37:g.112066565T>A		129.0	1.0		189.0	29.0	NM_001004196	B3KQI1|B4DLW9|D3DN65|Q6J2Q6|Q6PIQ4|Q8TB85|Q9H3J3	Silent	SNP	ENST00000315711.8	37	CCDS2965.1																																																																																			.		0.547	CD200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354078.1		
CDH3	1001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	68721498	68721498	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr16:68721498C>A	ENST00000264012.4	+	12	2198	c.1654C>A	c.(1654-1656)Cag>Aag	p.Q552K	CDH3_ENST00000581171.1_Missense_Mutation_p.Q497K|CDH3_ENST00000429102.2_Missense_Mutation_p.Q552K	NM_001793.4	NP_001784.2	P22223	CADH3_HUMAN	cadherin 3, type 1, P-cadherin (placental)	552	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|hair cycle process (GO:0022405)|homophilic cell adhesion (GO:0007156)|keratinization (GO:0031424)|negative regulation of catagen (GO:0051796)|negative regulation of transforming growth factor beta2 production (GO:0032912)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanosome transport (GO:1902910)|positive regulation of monophenol monooxygenase activity (GO:0032773)|regulation of hair cycle by canonical Wnt signaling pathway (GO:0060901)|response to drug (GO:0042493)|retina homeostasis (GO:0001895)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)|wound healing (GO:0042060)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(2)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(3)|skin(1)|urinary_tract(1)	25		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		TGAGCCCCGTCAGATCACCAT	0.572																																					p.Q552K		.											.	CDH3	950	2	Unknown(2)	breast(2)	c.C1654A						.						147.0	126.0	133.0					16																	68721498		2198	4300	6498	SO:0001583	missense	1001	exon12			CCCCGTCAGATCA	X63629	CCDS10868.1	16q22.1	2013-01-08	2001-12-04		ENSG00000062038	ENSG00000062038		"""Cadherins / Major cadherins"""	1762	protein-coding gene	gene with protein product		114021	"""cadherin 3, P-cadherin (placental)"""			1427864	Standard	NM_001793		Approved	CDHP, PCAD	uc002ewf.2	P22223	OTTHUMG00000137560	ENST00000264012.4:c.1654C>A	16.37:g.68721498C>A	ENSP00000264012:p.Gln552Lys	247.0	0.0		214.0	111.0	NM_001793	B2R6F4|Q05DI6	Missense_Mutation	SNP	ENST00000264012.4	37	CCDS10868.1	.	.	.	.	.	.	.	.	.	.	C	8.630	0.893409	0.17613	.	.	ENSG00000062038	ENST00000429102;ENST00000264012;ENST00000542274	T;T	0.60672	0.17;0.17	5.29	1.02	0.19986	Cadherin (1);Cadherin-like (2);	0.854162	0.09735	N	0.762654	T	0.40956	0.1138	L	0.31664	0.95	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.24190	-1.0167	10	0.35671	T	0.21	.	5.0474	0.14490	0.2286:0.4738:0.227:0.0706	.	552	P22223	CADH3_HUMAN	K	552;552;497	ENSP00000398485:Q552K;ENSP00000264012:Q552K	ENSP00000264012:Q552K	Q	+	1	0	CDH3	67278999	0.000000	0.05858	0.009000	0.14445	0.725000	0.41563	-0.241000	0.08940	-0.257000	0.09459	-1.255000	0.01485	CAG	.		0.572	CDH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268896.2	NM_001793	
CIDEC	63924	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	9911995	9911995	+	Silent	SNP	A	A	G			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr3:9911995A>G	ENST00000336832.2	-	4	358	c.219T>C	c.(217-219)acT>acC	p.T73T	CIDEC_ENST00000443115.1_Intron|CIDEC_ENST00000430427.1_Silent_p.T83T|CIDEC_ENST00000383817.1_Intron|CIDEC_ENST00000455015.1_5'UTR|CIDEC_ENST00000423850.1_5'UTR	NM_001199552.1|NM_001199623.1|NM_022094.3	NP_001186481.1|NP_001186552.1|NP_071377.2	Q96AQ7	CIDEC_HUMAN	cell death-inducing DFFA-like effector c	73	CIDE-N. {ECO:0000255|PROSITE- ProRule:PRU00447}.				apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|lipid particle organization (GO:0034389)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|lipid particle (GO:0005811)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)|skin(1)	8	Medulloblastoma(99;0.227)					CCAGCATCAGAGTGTCCCGGA	0.562																																					p.T86T		.											.	CIDEC	90	0			c.T258C						.						47.0	47.0	47.0					3																	9911995		2203	4300	6503	SO:0001819	synonymous_variant	63924	exon4			CATCAGAGTGTCC		CCDS2587.1, CCDS56239.1, CCDS74897.1	3p25	2004-07-26			ENSG00000187288	ENSG00000187288			24229	protein-coding gene	gene with protein product		612120				12429024	Standard	NM_001199623		Approved	CIDE-3, FLJ20871, Fsp27	uc021wsw.1	Q96AQ7	OTTHUMG00000128522	ENST00000336832.2:c.219T>C	3.37:g.9911995A>G		46.0	0.0		68.0	11.0	NM_001199623	C9JMN7|Q67DW9|Q9GZY9	Silent	SNP	ENST00000336832.2	37	CCDS2587.1																																																																																			.		0.562	CIDEC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250334.1	NM_022094	
CLCNKB	1188	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	16374904	16374904	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr1:16374904G>C	ENST00000375679.4	+	6	676	c.565G>C	c.(565-567)Ggg>Cgg	p.G189R	CLCNKB_ENST00000375667.3_5'Flank	NM_000085.4	NP_000076.2	P51801	CLCKB_HUMAN	chloride channel, voltage-sensitive Kb	189					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	21		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		CACGACCATCGGGGAGCCTGA	0.652																																					p.G189R		.											.	CLCNKB	91	0			c.G565C						.						46.0	49.0	48.0					1																	16374904		2203	4300	6503	SO:0001583	missense	1188	exon6			ACCATCGGGGAGC	AK098217	CCDS168.1, CCDS57974.1	1p36	2012-09-26	2012-02-23		ENSG00000184908	ENSG00000184908		"""Ion channels / Chloride channels : Voltage-sensitive"""	2027	protein-coding gene	gene with protein product		602023	"""chloride channel Kb"""				Standard	NM_000085		Approved	hClC-Kb		P51801	OTTHUMG00000009530	ENST00000375679.4:c.565G>C	1.37:g.16374904G>C	ENSP00000364831:p.Gly189Arg	519.0	1.0		595.0	67.0	NM_000085	B3KUY3|Q5T5Q7|Q5T5Q8	Missense_Mutation	SNP	ENST00000375679.4	37	CCDS168.1	.	.	.	.	.	.	.	.	.	.	g	14.32	2.501182	0.44455	.	.	ENSG00000184908	ENST00000375679;ENST00000331579	D	0.94000	-3.33	4.68	2.8	0.32819	Chloride channel, core (2);	0.305040	0.36134	N	0.002770	D	0.88926	0.6570	L	0.28054	0.825	0.80722	D	1	B	0.29988	0.264	B	0.39119	0.291	D	0.84230	0.0466	10	0.72032	D	0.01	.	7.9341	0.29920	0.2898:0.0:0.7102:0.0	.	189	P51801	CLCKB_HUMAN	R	189	ENSP00000364831:G189R	ENSP00000332055:G189R	G	+	1	0	CLCNKB	16247491	0.564000	0.26602	0.445000	0.26908	0.183000	0.23260	0.656000	0.24948	0.410000	0.25675	0.655000	0.94253	GGG	.		0.652	CLCNKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026331.1	NM_000085	
CNTN5	53942	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	99827704	99827704	+	Silent	SNP	C	C	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr11:99827704C>T	ENST00000524871.1	+	8	1130	c.840C>T	c.(838-840)gtC>gtT	p.V280V	CNTN5_ENST00000279463.3_Silent_p.V280V|CNTN5_ENST00000528682.1_Silent_p.V280V|CNTN5_ENST00000527185.1_Silent_p.V280V|CNTN5_ENST00000418526.2_Silent_p.V206V	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	280	Ig-like C2-type 2.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		ATGCTAGAGTCCTTAGTCCTC	0.418																																					p.V280V		.											.	CNTN5	366	0			c.C840T						.						46.0	46.0	46.0					11																	99827704		1956	4144	6100	SO:0001819	synonymous_variant	53942	exon7			TAGAGTCCTTAGT	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.840C>T	11.37:g.99827704C>T		197.0	1.0		225.0	86.0	NM_001243270	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Silent	SNP	ENST00000524871.1	37	CCDS53696.1																																																																																			.		0.418	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
COL3A1	1281	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	189873705	189873705	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr2:189873705G>A	ENST00000304636.3	+	48	3751	c.3581G>A	c.(3580-3582)gGt>gAt	p.G1194D	COL3A1_ENST00000317840.5_Missense_Mutation_p.G891D	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	1194	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	GGTGCCCCTGGTCCTTGCTGT	0.552																																					p.G1194D		.											.	COL3A1	581	0			c.G3581A						.						67.0	75.0	72.0					2																	189873705		2203	4300	6503	SO:0001583	missense	1281	exon48			CCCCTGGTCCTTG	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.3581G>A	2.37:g.189873705G>A	ENSP00000304408:p.Gly1194Asp	131.0	0.0		110.0	16.0	NM_000090	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.542311	0.85917	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	D;D	0.99429	-5.89;-5.89	5.54	5.54	0.83059	.	0.000000	0.52532	D	0.000068	D	0.99725	0.9893	H	0.96269	3.795	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97543	1.0087	10	0.59425	D	0.04	.	19.4783	0.94998	0.0:0.0:1.0:0.0	.	1194	P02461	CO3A1_HUMAN	D	1194;891	ENSP00000304408:G1194D;ENSP00000315243:G891D	ENSP00000304408:G1194D	G	+	2	0	COL3A1	189581950	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.917000	0.75782	2.601000	0.87937	0.655000	0.94253	GGT	.		0.552	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	
DNAJB14	79982	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	100844269	100844270	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr4:100844269_100844270insT	ENST00000442697.2	-	3	532_533	c.378_379insA	c.(376-381)aaagctfs	p.A127fs	DNAJB14_ENST00000471738.1_5'Flank	NM_001031723.2|NM_001278310.1	NP_001026893.1|NP_001265239.1	Q8TBM8	DJB14_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 14	127	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.					endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				kidney(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5				OV - Ovarian serous cystadenocarcinoma(123;4.59e-09)		TTTCTATAAGCTTTTTTCAAAT	0.322																																					p.A127fs		.											.	DNAJB14	226	0			c.379_380insA						.																																			SO:0001589	frameshift_variant	79982	exon3			TATAAGCTTTTTT	BC022248	CCDS34035.1, CCDS75171.1	4q23	2011-09-02			ENSG00000164031	ENSG00000164031		"""Heat shock proteins / DNAJ (HSP40)"""	25881	protein-coding gene	gene with protein product							Standard	NM_001031723		Approved	FLJ14281	uc003hvl.4	Q8TBM8	OTTHUMG00000131049	ENST00000442697.2:c.379dupA	4.37:g.100844275_100844275dupT	ENSP00000404381:p.Ala127fs	155.0	0.0		168.0	48.0	NM_001031723	Q6UXN1|Q7Z3P0|Q86TA7|Q86TM0|Q9GZU9	Frame_Shift_Ins	INS	ENST00000442697.2	37	CCDS34035.1																																																																																			.		0.322	DNAJB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253696.2	NM_001031723.2	
DPY19L1	23333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	35013135	35013135	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr7:35013135T>C	ENST00000310974.4	-	8	830	c.686A>G	c.(685-687)cAt>cGt	p.H229R	DPY19L1_ENST00000462134.2_5'UTR	NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	229						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						CCTGAGAATATGAGTCACTAG	0.303																																					p.H229R		.											.	DPY19L1	68	0			c.A686G						.						53.0	47.0	49.0					7																	35013135		1871	4119	5990	SO:0001583	missense	23333	exon8			AGAATATGAGTCA	AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.686A>G	7.37:g.35013135T>C	ENSP00000308695:p.His229Arg	113.0	0.0		132.0	37.0	NM_015283	O94954|Q4G151	Missense_Mutation	SNP	ENST00000310974.4	37	CCDS43567.1	.	.	.	.	.	.	.	.	.	.	T	12.86	2.064056	0.36373	.	.	ENSG00000173852	ENST00000310974;ENST00000446375	T;T	0.54071	0.59;0.59	4.8	3.65	0.41850	.	0.130194	0.53938	N	0.000058	T	0.39306	0.1073	L	0.40543	1.245	0.27765	N	0.94369	B	0.06786	0.001	B	0.08055	0.003	T	0.23368	-1.0190	10	0.25751	T	0.34	-9.4722	8.1742	0.31272	0.0:0.0968:0.0:0.9032	.	229	Q2PZI1	D19L1_HUMAN	R	229;28	ENSP00000308695:H229R;ENSP00000400510:H28R	ENSP00000308695:H229R	H	-	2	0	DPY19L1	34979660	1.000000	0.71417	1.000000	0.80357	0.685000	0.39939	3.340000	0.52143	0.711000	0.32018	0.260000	0.18958	CAT	.		0.303	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337506.1		
DPY19L1	23333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	35013143	35013143	+	Silent	SNP	T	T	C	rs199681894	byFrequency	TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr7:35013143T>C	ENST00000310974.4	-	8	822	c.678A>G	c.(676-678)ctA>ctG	p.L226L	DPY19L1_ENST00000462134.2_5'UTR	NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	226						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						TATGAGTCACTAGCAACATCT	0.313																																					p.L226L		.											.	DPY19L1	68	0			c.A678G						.						53.0	48.0	50.0					7																	35013143		1876	4135	6011	SO:0001819	synonymous_variant	23333	exon8			AGTCACTAGCAAC	AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.678A>G	7.37:g.35013143T>C		114.0	0.0		133.0	38.0	NM_015283	O94954|Q4G151	Silent	SNP	ENST00000310974.4	37	CCDS43567.1																																																																																			T|0.974;A|0.026		0.313	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337506.1		
DST	667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	56494239	56494239	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr6:56494239T>A	ENST00000361203.3	-	28	3658	c.3651A>T	c.(3649-3651)caA>caT	p.Q1217H	DST_ENST00000446842.2_Missense_Mutation_p.Q891H|DST_ENST00000370769.4_Missense_Mutation_p.Q1217H|DST_ENST00000312431.6_Missense_Mutation_p.Q1217H|DST_ENST00000421834.2_Missense_Mutation_p.Q1217H|DST_ENST00000518935.1_Missense_Mutation_p.Q891H|DST_ENST00000244364.6_Missense_Mutation_p.Q891H|DST_ENST00000370765.6_Missense_Mutation_p.Q891H|DST_ENST00000370788.2_Missense_Mutation_p.Q1217H|DST_ENST00000370754.5_Missense_Mutation_p.Q1395H			Q03001	DYST_HUMAN	dystonin	1217					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CAGATCTCCATTGCTAAAATA	0.303																																					p.Q891H		.											.	DST	523	0			c.A2673T						.						83.0	79.0	80.0					6																	56494239		2203	4300	6503	SO:0001583	missense	667	exon18			TCTCCATTGCTAA	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.3651A>T	6.37:g.56494239T>A	ENSP00000354508:p.Gln1217His	48.0	0.0		61.0	23.0	NM_001723	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	T	15.19	2.758896	0.49468	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000439203;ENST00000520645;ENST00000370765;ENST00000518935	T;T;T;T;T;T;T;T;T;T;T;T	0.76709	-1.04;-0.04;-0.04;0.09;0.91;-1.04;0.06;-0.06;-1.04;-1.04;-1.04;-1.04	5.7	4.53	0.55603	.	0.000000	0.51477	D	0.000096	T	0.62036	0.2395	L	0.45228	1.405	0.29745	N	0.836787	P;P;P;B;B;B;P;B	0.49961	0.93;0.93;0.93;0.001;0.178;0.185;0.93;0.009	P;P;P;B;B;B;P;B	0.50440	0.635;0.641;0.635;0.002;0.108;0.281;0.635;0.012	T	0.60801	-0.7191	9	0.23302	T	0.38	.	8.245	0.31682	0.1327:0.0:0.1391:0.7281	.	1217;1217;1395;891;891;891;1217;891	Q5TBT1;E7ERU2;E9PEB9;Q6P0N6;Q03001-3;Q03001-9;Q03001;Q03001-8	.;.;.;.;.;.;DYST_HUMAN;.	H	891;1395;1217;1217;891;1217;1217;1217;891;1257;891;891	ENSP00000244364:Q891H;ENSP00000359790:Q1395H;ENSP00000359805:Q1217H;ENSP00000400883:Q1217H;ENSP00000393645:Q891H;ENSP00000307959:Q1217H;ENSP00000359824:Q1217H;ENSP00000354508:Q1217H;ENSP00000404924:Q891H;ENSP00000431030:Q1257H;ENSP00000359801:Q891H;ENSP00000431003:Q891H	ENSP00000244364:Q891H	Q	-	3	2	DST	56602198	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.112000	0.50368	0.968000	0.38212	0.533000	0.62120	CAA	.		0.303	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
EBF3	253738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	131665456	131665456	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr10:131665456A>G	ENST00000355311.5	-	10	1060	c.988T>C	c.(988-990)Tac>Cac	p.Y330H	EBF3_ENST00000368648.3_Missense_Mutation_p.Y321H			Q9H4W6	COE3_HUMAN	early B-cell factor 3	330	IPT/TIG.				multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		TTGGATTTGTAGGAGAGGGTC	0.577																																					p.Y321H		.											.	EBF3	91	0			c.T961C						.						92.0	80.0	84.0					10																	131665456		2203	4300	6503	SO:0001583	missense	253738	exon10			ATTTGTAGGAGAG		CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.988T>C	10.37:g.131665456A>G	ENSP00000347463:p.Tyr330His	117.0	0.0		154.0	49.0	NM_001005463	A0AUY1|Q5T6H9|Q9H4W5	Missense_Mutation	SNP	ENST00000355311.5	37		.	.	.	.	.	.	.	.	.	.	A	21.6	4.178812	0.78564	.	.	ENSG00000108001	ENST00000355311;ENST00000368648	T;T	0.75938	-0.98;-0.98	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.80391	0.4614	L	0.41824	1.3	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.79475	-0.1788	10	0.37606	T	0.19	-18.3429	15.1986	0.73116	1.0:0.0:0.0:0.0	.	321	Q9H4W6-2	.	H	330;321	ENSP00000347463:Y330H;ENSP00000357637:Y321H	ENSP00000347463:Y330H	Y	-	1	0	EBF3	131555446	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.196000	0.94978	2.127000	0.65507	0.533000	0.62120	TAC	.		0.577	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463	
EMR2	30817	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14877174	14877174	+	Silent	SNP	G	G	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr19:14877174G>T	ENST00000315576.3	-	7	958	c.507C>A	c.(505-507)tcC>tcA	p.S169S	EMR2_ENST00000346057.1_Intron|EMR2_ENST00000392967.2_Silent_p.S169S|EMR2_ENST00000392965.3_Silent_p.S169S|EMR2_ENST00000596991.2_Silent_p.S169S|EMR2_ENST00000595839.1_Intron|EMR2_ENST00000601345.1_Silent_p.S169S|EMR2_ENST00000594076.1_Intron|EMR2_ENST00000353005.1_Intron|EMR2_ENST00000594294.1_Intron|EMR2_ENST00000353876.1_Intron|EMR2_ENST00000599423.1_5'Flank|EMR2_ENST00000392964.3_Intron	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	169	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						GGTTTTGTCCGGAGGTGCATT	0.627																																					p.S169S		.											.	EMR2	524	0			c.C507A						.						100.0	89.0	93.0					19																	14877174		2203	4300	6503	SO:0001819	synonymous_variant	30817	exon6			TTGTCCGGAGGTG	AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.507C>A	19.37:g.14877174G>T		184.0	1.0		166.0	39.0	NM_001271052	B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Silent	SNP	ENST00000315576.3	37	CCDS32935.1																																																																																			.		0.627	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466502.2		
FBXL20	84961	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	37421707	37421707	+	Splice_Site	SNP	C	C	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr17:37421707C>A	ENST00000264658.6	-	13	1194		c.e13-1		FBXL20_ENST00000583610.1_Splice_Site|FBXL20_ENST00000577399.1_Splice_Site|FBXL20_ENST00000394294.3_Splice_Site	NM_032875.2	NP_116264.2	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20						behavioral fear response (GO:0001662)	cytoplasm (GO:0005737)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22			LUAD - Lung adenocarcinoma(14;0.146)			TATCTGTTATCTGAAAGAAAT	0.328																																					.		.											.	FBXL20	659	0			c.838-1G>T						.						101.0	92.0	95.0					17																	37421707		2203	4300	6503	SO:0001630	splice_region_variant	84961	exon13			TGTTATCTGAAAG	BC007557	CCDS32640.1, CCDS54116.1	17q21.2	2011-06-09				ENSG00000108306		"""F-boxes / Leucine-rich repeats"""	24679	protein-coding gene	gene with protein product		609086				12477932	Standard	NM_032875		Approved	MGC15482, Fbl2, Fbl20	uc002hrt.3	Q96IG2		ENST00000264658.6:c.934-1G>T	17.37:g.37421707C>A		56.0	0.0		83.0	36.0	NM_001184906	A8K729|Q38J52	Splice_Site	SNP	ENST00000264658.6	37	CCDS32640.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.543465	0.86022	.	.	ENSG00000108306	ENST00000264658;ENST00000394294	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7207	0.91692	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FBXL20	34675233	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.677000	0.84024	2.530000	0.85305	0.563000	0.77884	.	.		0.328	FBXL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444315.2	NM_032875	Intron
FBXO28	23219	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	224345363	224345363	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr1:224345363A>T	ENST00000366862.5	+	5	1065	c.1022A>T	c.(1021-1023)aAt>aTt	p.N341I	FBXO28_ENST00000424254.2_3'UTR	NM_015176.3	NP_055991.1	Q9NVF7	FBX28_HUMAN	F-box protein 28	341										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(2)|skin(1)	10	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.0363)		TCCGGGCAGAATGAGGAGTCT	0.453																																					p.N341I		.											.	FBXO28	661	0			c.A1022T						.						93.0	99.0	97.0					1																	224345363		2203	4300	6503	SO:0001583	missense	23219	exon5			GGCAGAATGAGGA	AK001628	CCDS1539.1, CCDS44320.1	1q42.12	2011-08-12			ENSG00000143756	ENSG00000143756		"""F-boxes /  ""other"""""	29046	protein-coding gene	gene with protein product	"""centromere protein 30"""	609100				9455484	Standard	NM_015176		Approved	FLJ10766, KIAA0483, Fbx28, CENP-30	uc001hoh.3	Q9NVF7	OTTHUMG00000037495	ENST00000366862.5:c.1022A>T	1.37:g.224345363A>T	ENSP00000355827:p.Asn341Ile	156.0	0.0		244.0	11.0	NM_015176	E9PEM8|O75070	Missense_Mutation	SNP	ENST00000366862.5	37	CCDS1539.1	.	.	.	.	.	.	.	.	.	.	A	10.88	1.474774	0.26511	.	.	ENSG00000143756	ENST00000366862	.	.	.	5.97	-7.04	0.01578	.	0.777393	0.13127	N	0.411734	T	0.27933	0.0688	N	0.08118	0	0.25137	N	0.990525	B	0.19445	0.036	B	0.23018	0.043	T	0.02115	-1.1211	9	0.48119	T	0.1	-0.5652	20.0911	0.97820	0.3305:0.0:0.6695:0.0	.	341	Q9NVF7	FBX28_HUMAN	I	341	.	ENSP00000355827:N341I	N	+	2	0	FBXO28	222411986	0.030000	0.19436	0.008000	0.14137	0.966000	0.64601	0.228000	0.17814	-1.816000	0.01221	-0.256000	0.11100	AAT	.		0.453	FBXO28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091283.2	NM_015176	
FLYWCH2	114984	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2946481	2946481	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr16:2946481G>A	ENST00000396958.3	+	3	411	c.31G>A	c.(31-33)Ggt>Agt	p.G11S	FLYWCH2_ENST00000293981.6_Missense_Mutation_p.G11S|FLYWCH2_ENST00000572006.1_Missense_Mutation_p.G11S	NM_001142500.1|NM_138439.2	NP_001135972.1|NP_612448.1	Q96CP2	FWCH2_HUMAN	FLYWCH family member 2	11							poly(A) RNA binding (GO:0044822)	p.G11F(2)		central_nervous_system(1)|lung(3)|ovary(1)|skin(1)	6						CGAGCAGGAGGGTGAGAGTGT	0.657																																					p.G11S		.											.	FLYWCH2	22	2	Substitution - Missense(2)	lung(2)	c.G31A						.						44.0	54.0	51.0					16																	2946481		2198	4300	6498	SO:0001583	missense	114984	exon3			CAGGAGGGTGAGA	BC014089	CCDS10482.1	16p13.3	2014-02-12	2007-06-21		ENSG00000162076	ENSG00000162076			25178	protein-coding gene	gene with protein product						12477932	Standard	NM_138439		Approved		uc010uwk.2	Q96CP2	OTTHUMG00000128962	ENST00000396958.3:c.31G>A	16.37:g.2946481G>A	ENSP00000380159:p.Gly11Ser	48.0	0.0		55.0	11.0	NM_001142499		Missense_Mutation	SNP	ENST00000396958.3	37	CCDS10482.1	.	.	.	.	.	.	.	.	.	.	G	12.27	1.886527	0.33348	.	.	ENSG00000162076	ENST00000396958;ENST00000293981	.	.	.	3.36	2.41	0.29592	.	0.000000	0.35805	N	0.002962	T	0.22205	0.0535	L	0.34521	1.04	0.20307	N	0.999912	P	0.36909	0.573	B	0.32090	0.14	T	0.16630	-1.0396	9	0.72032	D	0.01	.	6.4655	0.21980	0.1344:0.0:0.8656:0.0	.	11	Q96CP2	FWCH2_HUMAN	S	11	.	ENSP00000293981:G11S	G	+	1	0	FLYWCH2	2886482	0.757000	0.28394	0.470000	0.27216	0.729000	0.41735	0.742000	0.26216	1.008000	0.39264	0.407000	0.27541	GGT	.		0.657	FLYWCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250944.1	NM_138439	
FZD2	2535	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	42635258	42635258	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr17:42635258G>T	ENST00000315323.3	+	1	334	c.202G>T	c.(202-204)Gac>Tac	p.D68Y		NM_001466.3	NP_001457.1	Q14332	FZD2_HUMAN	frizzled class receptor 2	68	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cell-cell signaling (GO:0007267)|cochlea morphogenesis (GO:0090103)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|inner ear receptor cell development (GO:0060119)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|sensory perception of smell (GO:0007608)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(8)	33		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		GAACCAGGAGGACGCAGGCCT	0.617																																					p.D68Y		.											.	FZD2	660	0			c.G202T						.						161.0	144.0	150.0					17																	42635258		2203	4300	6503	SO:0001583	missense	2535	exon1			CAGGAGGACGCAG	L37882	CCDS11484.1	17q21.1	2014-01-29	2014-01-29			ENSG00000180340		"""GPCR / Class F : Frizzled receptors"""	4040	protein-coding gene	gene with protein product		600667	"""frizzled (Drosophila) homolog 2"", ""frizzled homolog 2 (Drosophila)"", ""frizzled 2, seven transmembrane spanning receptor"", ""frizzled family receptor 2"""			7558010, 9813155	Standard	NM_001466		Approved		uc002igx.2	Q14332		ENST00000315323.3:c.202G>T	17.37:g.42635258G>T	ENSP00000323901:p.Asp68Tyr	255.0	0.0		349.0	22.0	NM_001466	Q0VG82	Missense_Mutation	SNP	ENST00000315323.3	37	CCDS11484.1	.	.	.	.	.	.	.	.	.	.	g	18.49	3.634772	0.67130	.	.	ENSG00000180340	ENST00000541149;ENST00000315323	T	0.80214	-1.35	4.14	4.14	0.48551	Frizzled domain (5);	0.050318	0.85682	D	0.000000	D	0.90126	0.6915	M	0.85777	2.775	0.80722	D	1	D	0.69078	0.997	D	0.72075	0.976	D	0.92264	0.5819	10	0.87932	D	0	.	16.0247	0.80536	0.0:0.0:1.0:0.0	.	68	Q14332	FZD2_HUMAN	Y	144;68	ENSP00000323901:D68Y	ENSP00000323901:D68Y	D	+	1	0	FZD2	39990784	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.534000	0.98061	1.848000	0.53677	0.462000	0.41574	GAC	.		0.617	FZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457806.1	NM_001466	
GLI2	2736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	121747764	121747764	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr2:121747764G>T	ENST00000452319.1	+	14	4334	c.4274G>T	c.(4273-4275)gGg>gTg	p.G1425V	GLI2_ENST00000314490.11_Intron|GLI2_ENST00000361492.4_Missense_Mutation_p.G1425V					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				GGCAACATGGGGTCGGTGCCT	0.652																																					p.G1425V		.											.	GLI2	954	0			c.G4274T						.						37.0	40.0	39.0					2																	121747764		2202	4300	6502	SO:0001583	missense	2736	exon13			ACATGGGGTCGGT		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.4274G>T	2.37:g.121747764G>T	ENSP00000390436:p.Gly1425Val	93.0	0.0		140.0	55.0	NM_005270		Missense_Mutation	SNP	ENST00000452319.1	37	CCDS33283.1	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.488371	0.01018	.	.	ENSG00000074047	ENST00000452319;ENST00000361492	T;T	0.12984	2.63;2.63	4.57	-6.78	0.01721	.	1.596530	0.04137	N	0.318884	T	0.08358	0.0208	L	0.27053	0.805	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.30563	-0.9974	9	.	.	.	.	7.4423	0.27190	0.0:0.2279:0.4972:0.2749	.	1425;1080	P10070;P10070-2	GLI2_HUMAN;.	V	1425	ENSP00000390436:G1425V;ENSP00000354586:G1425V	.	G	+	2	0	GLI2	121464234	0.397000	0.25270	0.000000	0.03702	0.020000	0.10135	-0.232000	0.09055	-1.610000	0.01583	-0.538000	0.04264	GGG	.		0.652	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
HPX	3263	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	6453126	6453127	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr11:6453126_6453127delAT	ENST00000265983.3	-	8	1056_1057	c.956_957delAT	c.(955-957)tatfs	p.Y319fs		NM_000613.2	NP_000604.1	P02790	HEMO_HUMAN	hemopexin	319					cellular iron ion homeostasis (GO:0006879)|heme metabolic process (GO:0042168)|heme transport (GO:0015886)|hemoglobin metabolic process (GO:0020027)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|viral process (GO:0016032)	blood microparticle (GO:0072562)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme transporter activity (GO:0015232)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(11)|prostate(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;5.46e-08)|BRCA - Breast invasive adenocarcinoma(625;0.19)		CCTGGACCAGATAGAGTTTTTC	0.54																																					p.319_319del		.											.	HPX	90	0			c.956_957del						.																																			SO:0001589	frameshift_variant	3263	exon8			GACCAGATAGAGT	J03048	CCDS7763.1	11p15.5-p15.4	2012-10-02			ENSG00000110169	ENSG00000110169			5171	protein-coding gene	gene with protein product		142290				2989777, 2842511	Standard	NM_000613		Approved		uc001mdg.2	P02790	OTTHUMG00000133399	ENST00000265983.3:c.956_957delAT	11.37:g.6453126_6453127delAT	ENSP00000265983:p.Tyr319fs	68.0	0.0		51.0	15.0	NM_000613	B2R957	Frame_Shift_Del	DEL	ENST00000265983.3	37	CCDS7763.1																																																																																			.		0.540	HPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257256.1	NM_000613	
HSP90AA1	3320	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	102551156	102551178	+	Frame_Shift_Del	DEL	CTTAATCTTCTTCTTCTTCTTCT	CTTAATCTTCTTCTTCTTCTTCT	-	rs371838714|rs372518751|rs55793809	byFrequency	TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	CTTAATCTTCTTCTTCTTCTTCT	CTTAATCTTCTTCTTCTTCTTCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr14:102551156_102551178delCTTAATCTTCTTCTTCTTCTTCT	ENST00000216281.8	-	5	1026_1048	c.821_843delAGAAGAAGAAGAAGAAGATTAAG	c.(820-843)aagaagaagaagaagaagattaagfs	p.KKKKKKIK274fs	HSP90AA1_ENST00000334701.7_Frame_Shift_Del_p.KKKKKKIK396fs|HSP90AA1_ENST00000441629.2_Frame_Shift_Del_p.KKKKKKIK95fs	NM_005348.3	NP_005339.3	P07900	HS90A_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 1	274					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone-mediated protein complex assembly (GO:0051131)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|mitochondrial transport (GO:0006839)|mitotic cell cycle (GO:0000278)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein import into mitochondrial outer membrane (GO:0045040)|protein refolding (GO:0042026)|regulation of nitric-oxide synthase activity (GO:0050999)|response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|identical protein binding (GO:0042802)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(6)|large_intestine(3)|liver(1)|lung(10)|ovary(2)|prostate(1)	28					Nedocromil(DB00716)|Rifabutin(DB00615)	TGTActtttccttaatcttcttcttcttcttcttgtcaccatc	0.372																																					p.396_403del		.											.	HSP90AA1	949	0			c.1187_1209del						.																																			SO:0001589	frameshift_variant	3320	exon6			CTTTTCCTTAATC	M27024	CCDS9967.1, CCDS32160.1	14q32.33	2011-09-02	2006-02-24	2006-02-24	ENSG00000080824	ENSG00000080824		"""Heat shock proteins / HSPC"""	5253	protein-coding gene	gene with protein product		140571	"""heat shock 90kD protein 1, alpha"", ""heat shock 90kDa protein 1, alpha"""	HSPC1, HSPCA		2527334, 16269234	Standard	NM_001017963		Approved	Hsp89, Hsp90, FLJ31884, HSP90N	uc001ykv.4	P07900		ENST00000216281.8:c.821_843delAGAAGAAGAAGAAGAAGATTAAG	14.37:g.102551156_102551178delCTTAATCTTCTTCTTCTTCTTCT	ENSP00000216281:p.Lys274fs	80.0	0.0		94.0	11.0	NM_001017963	A8K500|B3KPJ9|Q2PP14|Q5CAQ6|Q5CAQ7|Q9BVQ5	Frame_Shift_Del	DEL	ENST00000216281.8	37	CCDS9967.1																																																																																			.		0.372	HSP90AA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414952.2	NM_005348	
IL36B	27177	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	113786633	113786633	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr2:113786633A>T	ENST00000259213.4	-	4	251	c.144T>A	c.(142-144)tgT>tgA	p.C48*	IL36B_ENST00000327407.2_Nonsense_Mutation_p.C48*	NM_014438.3	NP_055253.2	Q9NZH7	IL36B_HUMAN	interleukin 36, beta	48					immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-1 receptor binding (GO:0005149)			kidney(1)|ovary(1)|pancreas(1)	3						CTGTGTCTCTACAGGCTATTA	0.433																																					p.C48X		.											.	IL36B	23	0			c.T144A						.						118.0	110.0	113.0					2																	113786633		2203	4300	6503	SO:0001587	stop_gained	27177	exon4			GTCTCTACAGGCT	AF201833	CCDS2109.1, CCDS2110.1	2q14	2011-07-14	2011-06-06	2011-06-06	ENSG00000136696	ENSG00000136696		"""Interleukins and interleukin receptors"""	15564	protein-coding gene	gene with protein product		605508	"""interleukin 1 family, member 8 (eta)"""	IL1F8		10625660, 10512743, 16646978	Standard	NM_173178		Approved	FIL1, IL-1H2, IL-1F8, FILI-(ETA), IL1-ETA, IL1H2, MGC126880, MGC126882	uc002tiq.1	Q9NZH7	OTTHUMG00000131338	ENST00000259213.4:c.144T>A	2.37:g.113786633A>T	ENSP00000259213:p.Cys48*	101.0	0.0		117.0	19.0	NM_173178	Q3MIH0|Q53SR6|Q7RTZ7|Q9UHA5	Nonsense_Mutation	SNP	ENST00000259213.4	37	CCDS2109.1	.	.	.	.	.	.	.	.	.	.	a	12.08	1.831231	0.32329	.	.	ENSG00000136696	ENST00000259213;ENST00000327407	.	.	.	3.75	-3.18	0.05186	.	0.377475	0.22942	N	0.053769	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.1773	0.42946	0.5189:0.0:0.4811:0.0	.	.	.	.	X	48	.	ENSP00000259213:C48X	C	-	3	2	IL36B	113503104	0.003000	0.15002	0.000000	0.03702	0.026000	0.11368	-0.660000	0.05317	-1.235000	0.02545	-1.470000	0.01010	TGT	.		0.433	IL36B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254110.1	NM_014438	
IQSEC3	440073	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	271125	271125	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr12:271125T>A	ENST00000538872.1	+	8	2595	c.2477T>A	c.(2476-2478)cTg>cAg	p.L826Q	RP11-598F7.5_ENST00000540136.1_RNA|IQSEC3_ENST00000326261.4_Missense_Mutation_p.L826Q|IQSEC3_ENST00000382841.2_Missense_Mutation_p.L523Q			Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	826	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		CCCAGGGAGCTGGTGGTAGGC	0.592																																					p.L826Q		.											.	IQSEC3	560	0			c.T2477A						.						96.0	68.0	78.0					12																	271125		2203	4299	6502	SO:0001583	missense	440073	exon8			GGGAGCTGGTGGT	AB029033	CCDS31725.1, CCDS53728.1	12p13.33	2014-03-18			ENSG00000120645	ENSG00000120645			29193	protein-coding gene	gene with protein product		612118				10470851	Standard	NM_001170738		Approved	KIAA1110, MGC30156	uc001qhw.2	Q9UPP2	OTTHUMG00000167975	ENST00000538872.1:c.2477T>A	12.37:g.271125T>A	ENSP00000437554:p.Leu826Gln	232.0	0.0		215.0	106.0	NM_001170738	A6NIF2|A6NKV9|Q8TB43	Missense_Mutation	SNP	ENST00000538872.1	37	CCDS53728.1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.811973	0.90707	.	.	ENSG00000120645	ENST00000538872;ENST00000326261;ENST00000382841	T;T;T	0.56103	0.48;0.48;0.48	5.54	5.54	0.83059	SEC7-like, alpha orthogonal bundle (1);SEC7-like (4);	0.100056	0.64402	D	0.000004	T	0.69468	0.3114	M	0.64997	1.995	0.58432	D	0.999995	P;D	0.63880	0.82;0.993	P;D	0.69479	0.465;0.964	T	0.72896	-0.4153	10	0.87932	D	0	.	15.6811	0.77371	0.0:0.0:0.0:1.0	.	826;523	Q9UPP2;Q9UPP2-2	IQEC3_HUMAN;.	Q	826;826;523	ENSP00000437554:L826Q;ENSP00000315662:L826Q;ENSP00000372292:L523Q	ENSP00000315662:L826Q	L	+	2	0	IQSEC3	141386	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.209000	0.72171	2.105000	0.64084	0.459000	0.35465	CTG	.		0.592	IQSEC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397382.3	XM_495902	
IRS4	8471	broad.mit.edu;mdanderson.org	37	X	107979138	107979138	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chrX:107979138C>T	ENST00000372129.2	-	1	513	c.437G>A	c.(436-438)cGc>cAc	p.R146H	RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	146	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GGTGATCACGCGCCGCGGTGG	0.632																																					p.R146H		.											.	IRS4	623	0			c.G437A						.						39.0	34.0	35.0					X																	107979138		2203	4299	6502	SO:0001583	missense	8471	exon1			ATCACGCGCCGCG	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.437G>A	X.37:g.107979138C>T	ENSP00000361202:p.Arg146His	70.0	0.0		93.0	17.0	NM_003604		Missense_Mutation	SNP	ENST00000372129.2	37	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	C	13.16	2.152823	0.38021	.	.	ENSG00000133124	ENST00000372129	T	0.72505	-0.66	4.02	4.02	0.46733	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.079563	0.48767	D	0.000173	D	0.83695	0.5310	M	0.77616	2.38	0.49798	D	0.999821	D	0.89917	1.0	D	0.85130	0.997	D	0.86491	0.1797	10	0.66056	D	0.02	-11.6968	15.7191	0.77694	0.0:1.0:0.0:0.0	.	146	O14654	IRS4_HUMAN	H	146	ENSP00000361202:R146H	ENSP00000361202:R146H	R	-	2	0	IRS4	107865794	0.994000	0.37717	0.970000	0.41538	0.019000	0.09904	5.626000	0.67777	1.866000	0.54105	0.529000	0.55759	CGC	.		0.632	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
IRX1	79192	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	3599429	3599429	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr5:3599429T>A	ENST00000302006.3	+	2	419	c.367T>A	c.(367-369)Ttc>Atc	p.F123I	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	123					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						CTACGGCCAGTTCCAATACGG	0.657																																					p.F123I		.											.	IRX1	228	0			c.T367A						.						45.0	49.0	47.0					5																	3599429		2203	4300	6503	SO:0001583	missense	79192	exon2			GGCCAGTTCCAAT	U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.367T>A	5.37:g.3599429T>A	ENSP00000305244:p.Phe123Ile	89.0	0.0		116.0	13.0	NM_024337	Q7Z2F8|Q8N312	Missense_Mutation	SNP	ENST00000302006.3	37	CCDS34132.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.305560	0.81247	.	.	ENSG00000170549	ENST00000302006	T	0.57907	0.37	4.83	4.83	0.62350	Homeodomain-like (1);	0.152306	0.64402	D	0.000014	T	0.62986	0.2473	L	0.40543	1.245	0.58432	D	0.999998	D	0.76494	0.999	D	0.70227	0.968	T	0.64554	-0.6380	10	0.51188	T	0.08	.	14.3661	0.66807	0.0:0.0:0.0:1.0	.	123	P78414	IRX1_HUMAN	I	123	ENSP00000305244:F123I	ENSP00000305244:F123I	F	+	1	0	IRX1	3652429	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.672000	0.83956	1.902000	0.55061	0.533000	0.62120	TTC	.		0.657	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	NM_024337	
KCNK13	56659	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	90651290	90651290	+	Silent	SNP	G	G	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr14:90651290G>T	ENST00000282146.4	+	2	1611	c.1170G>T	c.(1168-1170)ggG>ggT	p.G390G		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	390					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				TCTCAGGGGGGGTGGGAGCCT	0.592																																					p.G390G		.											.	KCNK13	91	0			c.G1170T						.						17.0	19.0	19.0					14																	90651290		2202	4296	6498	SO:0001819	synonymous_variant	56659	exon2			AGGGGGGGTGGGA	AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.1170G>T	14.37:g.90651290G>T		55.0	0.0		63.0	16.0	NM_022054	B5TJL8|Q96E79	Silent	SNP	ENST00000282146.4	37	CCDS9889.1																																																																																			.		0.592	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411251.1	NM_022054	
KCNMA1	3778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	78761222	78761222	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr10:78761222T>A	ENST00000286628.8	-	19	2208	c.2209A>T	c.(2209-2211)Aga>Tga	p.R737*	KCNMA1_ENST00000372440.1_Intron|KCNMA1_ENST00000404857.1_Intron|KCNMA1_ENST00000372443.1_Intron|KCNMA1_ENST00000404771.3_Nonsense_Mutation_p.R737*|KCNMA1_ENST00000406533.3_Nonsense_Mutation_p.R741*|KCNMA1_ENST00000354353.5_Intron|KCNMA1_ENST00000286627.5_Intron	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	737					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	GGGAAGGCTCTCTCAAGGGTG	0.498																																					p.R737X		.											.	KCNMA1	93	0			c.A2209T						.						159.0	131.0	140.0					10																	78761222		692	1591	2283	SO:0001587	stop_gained	3778	exon19			AGGCTCTCTCAAG	U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.2209A>T	10.37:g.78761222T>A	ENSP00000286628:p.Arg737*	228.0	0.0		302.0	39.0	NM_001161352	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Nonsense_Mutation	SNP	ENST00000286628.8	37		.	.	.	.	.	.	.	.	.	.	T	38	6.954715	0.97960	.	.	ENSG00000156113	ENST00000372437;ENST00000457953;ENST00000404771;ENST00000286628;ENST00000406533	.	.	.	5.93	3.51	0.40186	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-10.1658	12.7381	0.57236	0.0:0.0:0.398:0.602	.	.	.	.	X	672;711;674;711;741	.	ENSP00000286628:R711X	R	-	1	2	KCNMA1	78431228	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.717000	0.47227	0.447000	0.26695	0.533000	0.62120	AGA	.		0.498	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247	
KLHL33	123103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20897132	20897132	+	Missense_Mutation	SNP	C	C	A	rs372057023		TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr14:20897132C>A	ENST00000344581.4	-	4	1700	c.1478G>T	c.(1477-1479)cGa>cTa	p.R493L		NM_001109997.2	NP_001103467.2	A6NCF5	KLH33_HUMAN	kelch-like family member 33	493												all_cancers(95;0.00123)		Epithelial(56;7.57e-08)|all cancers(55;8.63e-07)	GBM - Glioblastoma multiforme(265;0.0223)|READ - Rectum adenocarcinoma(17;0.193)		GCAGAGCCATCGGCCCAGGCC	0.617																																					p.R493L		.											.	.	.	0			c.G1478T						.						56.0	59.0	58.0					14																	20897132		692	1591	2283	SO:0001583	missense	123103	exon4			AGCCATCGGCCCA		CCDS53882.1	14q11.2	2013-10-15	2013-02-22		ENSG00000185271	ENSG00000185271		"""Kelch-like"""	31952	protein-coding gene	gene with protein product			"""kelch-like 33 (Drosophila)"""				Standard	NM_001109997		Approved		uc010tli.2	A6NCF5	OTTHUMG00000170982	ENST00000344581.4:c.1478G>T	14.37:g.20897132C>A	ENSP00000341549:p.Arg493Leu	91.0	0.0		151.0	56.0	NM_001109997		Missense_Mutation	SNP	ENST00000344581.4	37	CCDS53882.1	.	.	.	.	.	.	.	.	.	.	C	19.00	3.742450	0.69418	.	.	ENSG00000185271	ENST00000344581	T	0.66815	-0.23	5.2	5.2	0.72013	Kelch-type beta propeller (1);	0.000000	0.64402	D	0.000002	T	0.76062	0.3935	L	0.52011	1.625	0.42050	D	0.991112	D	0.76494	0.999	D	0.65010	0.931	T	0.76865	-0.2801	10	0.54805	T	0.06	.	15.774	0.78193	0.0:1.0:0.0:0.0	.	493	A6NCF5	KLH33_HUMAN	L	493	ENSP00000341549:R493L	ENSP00000341549:R493L	R	-	2	0	KLHL33	19966972	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.825000	0.69286	2.722000	0.93159	0.655000	0.94253	CGA	.		0.617	KLHL33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411038.1	XM_063481	
KRT1	3848	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	53074087	53074087	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr12:53074087C>A	ENST00000252244.3	-	1	104	c.46G>T	c.(46-48)Ggc>Tgc	p.G16C		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	16	Gly/Phe/Ser-rich.|Head.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						GAGCTGAAGCCCCCTCCACTT	0.542																																					p.G16C		.											.	KRT1	92	0			c.G46T						.						73.0	81.0	78.0					12																	53074087		2203	4300	6503	SO:0001583	missense	3848	exon1			TGAAGCCCCCTCC	X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.46G>T	12.37:g.53074087C>A	ENSP00000252244:p.Gly16Cys	172.0	0.0		187.0	22.0	NM_006121	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Missense_Mutation	SNP	ENST00000252244.3	37	CCDS8836.1	.	.	.	.	.	.	.	.	.	.	C	10.79	1.450651	0.26074	.	.	ENSG00000167768	ENST00000252244	D	0.85773	-2.03	4.36	2.48	0.30137	.	.	.	.	.	D	0.89887	0.6845	M	0.91354	3.2	0.09310	N	1	D	0.59767	0.986	P	0.51487	0.671	T	0.81693	-0.0817	9	0.87932	D	0	.	8.0051	0.30321	0.0:0.7248:0.0:0.2752	.	16	P04264	K2C1_HUMAN	C	16	ENSP00000252244:G16C	ENSP00000252244:G16C	G	-	1	0	KRT1	51360354	0.000000	0.05858	0.034000	0.17996	0.900000	0.52787	0.042000	0.13949	0.402000	0.25451	0.491000	0.48974	GGC	.		0.542	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405706.1	NM_006121	
KRTAP5-7	440050	hgsc.bcm.edu;broad.mit.edu	37	11	71238649	71238675	+	In_Frame_Del	DEL	CTGCTGCTCCTCAGGCTGTGGGTCATC	CTGCTGCTCCTCAGGCTGTGGGTCATC	-	rs200832929|rs549981674		TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	CTGCTGCTCCTCAGGCTGTGGGTCATC	CTGCTGCTCCTCAGGCTGTGGGTCATC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr11:71238649_71238675delCTGCTGCTCCTCAGGCTGTGGGTCATC	ENST00000398536.4	+	1	337_363	c.303_329delCTGCTGCTCCTCAGGCTGTGGGTCATC	c.(301-330)tgctgctgctcctcaggctgtgggtcatcc>tgc	p.CCSSGCGSS102del		NM_001012503.1	NP_001012521.1	Q6L8G8	KRA57_HUMAN	keratin associated protein 5-7	102	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.G108W(1)		breast(1)|endometrium(1)|kidney(3)|lung(6)|ovary(1)	12						ataagccctgctgctgctcctcaggctgtgggtcatcctgctgccag	0.634																																					p.101_110del		.											.	KRTAP5-7	68	1	Substitution - Missense(1)	lung(1)	c.303_329del						.																																			SO:0001651	inframe_deletion	440050	exon1			GCCCTGCTGCTGC	AB126076	CCDS41682.1	11q13.4	2008-02-05			ENSG00000244411	ENSG00000244411		"""Keratin associated proteins"""	23602	protein-coding gene	gene with protein product						15144888	Standard	NM_001012503		Approved	KRTAP5.7, KRTAP5-3	uc001oqq.1	Q6L8G8	OTTHUMG00000057570	ENST00000398536.4:c.303_329delCTGCTGCTCCTCAGGCTGTGGGTCATC	11.37:g.71238649_71238675delCTGCTGCTCCTCAGGCTGTGGGTCATC	ENSP00000417330:p.Cys102_Ser110del	158.0	0.0		194.0	35.0	NM_001012503	B2RNM3|Q701N5	In_Frame_Del	DEL	ENST00000398536.4	37	CCDS41682.1																																																																																			.		0.634	KRTAP5-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127953.1		
LPIN3	64900	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	39985824	39985824	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr20:39985824A>G	ENST00000373257.3	+	15	2039	c.1948A>G	c.(1948-1950)Acc>Gcc	p.T650A		NM_022896.1	NP_075047.1	Q9BQK8	LPIN3_HUMAN	lipin 3	650	C-LIP.				fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(7)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Myeloproliferative disorder(115;0.000739)				CGGCACCATCACCAAGTGAGG	0.627																																					p.T650A		.											.	LPIN3	93	0			c.A1948G						.						74.0	60.0	65.0					20																	39985824		2203	4300	6503	SO:0001583	missense	64900	exon15			ACCATCACCAAGT	AL132654	CCDS33469.1	20q11.2-q12	2006-04-04	2002-05-23		ENSG00000132793	ENSG00000132793			14451	protein-coding gene	gene with protein product		605520	"""lipin 3-like"""	LIPN3L		11138012	Standard	XM_005260515		Approved	SMP2	uc002xjx.3	Q9BQK8	OTTHUMG00000033056	ENST00000373257.3:c.1948A>G	20.37:g.39985824A>G	ENSP00000362354:p.Thr650Ala	154.0	1.0		239.0	83.0	NM_022896	B2RTT5|Q5TDB9|Q9NPY8|Q9UJE5	Missense_Mutation	SNP	ENST00000373257.3	37	CCDS33469.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.207973	0.79240	.	.	ENSG00000132793	ENST00000373257;ENST00000373259	T	0.80566	-1.39	4.83	3.73	0.42828	HAD-like domain (2);LNS2, Lipin/Ned1/Smp2 (2);	0.000000	0.85682	D	0.000000	D	0.90099	0.6907	M	0.89840	3.065	0.58432	D	0.999999	D;D	0.89917	1.0;0.997	D;D	0.97110	1.0;0.992	D	0.89821	0.3989	9	.	.	.	-24.9637	10.0688	0.42319	0.9199:0.0:0.08:0.0	.	651;650	Q9BQK8-2;Q9BQK8	.;LPIN3_HUMAN	A	650;283	ENSP00000362354:T650A	.	T	+	1	0	LPIN3	39419238	1.000000	0.71417	0.997000	0.53966	0.918000	0.54935	8.962000	0.93254	0.703000	0.31848	0.379000	0.24179	ACC	.		0.627	LPIN3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080393.1	NM_022896	
MGAT4B	11282	ucsc.edu;mdanderson.org	37	5	179225329	179225329	+	Intron	SNP	C	C	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr5:179225329C>A	ENST00000292591.7	-	13	1861				MGAT4B_ENST00000521305.1_5'Flank|MGAT4B_ENST00000337755.5_Intron|MIR1229_ENST00000408467.1_RNA	NM_014275.4	NP_055090.1	Q9UQ53	MGT4B_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B						cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	13	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCACGCTCTCCCCCAAACCC	0.672																																					.	GBM(13;414 434 4098 22176 23230)	.											.	.	.	0			.						.						29.0	34.0	32.0					5																	179225329		2203	4299	6502	SO:0001627	intron_variant	100302156	.			CGCTCTCCCCCAA	AB000624	CCDS4448.1, CCDS4449.1	5q35	2013-02-25	2005-11-16		ENSG00000161013	ENSG00000161013	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7048	protein-coding gene	gene with protein product		604561	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B"""			10372966	Standard	NM_014275		Approved	GnT-Ivb	uc003mks.3	Q9UQ53	OTTHUMG00000130912	ENST00000292591.7:c.1510+17G>T	5.37:g.179225329C>A		87.0	1.0		126.0	28.0	.	A8MPR0|Q86TF1|Q96GH4|Q9NSK6	RNA	SNP	ENST00000292591.7	37	CCDS4448.1																																																																																			.		0.672	MGAT4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253503.3	NM_014275	
MS4A10	341116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	60561505	60561505	+	Missense_Mutation	SNP	G	G	A	rs200380093		TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr11:60561505G>A	ENST00000308287.1	+	5	517	c.421G>A	c.(421-423)Gtc>Atc	p.V141I		NM_206893.3	NP_996776.2	Q96PG2	M4A10_HUMAN	membrane-spanning 4-domains, subfamily A, member 10	141						integral component of membrane (GO:0016021)		p.V141I(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|skin(2)	21						TGGCCTCTTCGTCATCTCCAA	0.517																																					p.V141I		.											.	MS4A10	92	1	Substitution - Missense(1)	large_intestine(1)	c.G421A						.	G	ILE/VAL	0,4406		0,0,2203	142.0	127.0	132.0		421	2.0	0.0	11		132	1,8597	1.2+/-3.3	0,1,4298	yes	missense	MS4A10	NM_206893.3	29	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	141/268	60561505	1,13003	2203	4299	6502	SO:0001583	missense	341116	exon5			CTCTTCGTCATCT	AK122633	CCDS7992.1	11q12.2	2008-02-05				ENSG00000172689			13368	protein-coding gene	gene with protein product		608403				11486273, 11401424	Standard	NM_206893		Approved	CD20L7, MS4A9	uc001npz.1	Q96PG2		ENST00000308287.1:c.421G>A	11.37:g.60561505G>A	ENSP00000311862:p.Val141Ile	146.0	0.0		170.0	78.0	NM_206893	B2RP45|Q96PG3	Missense_Mutation	SNP	ENST00000308287.1	37	CCDS7992.1	.	.	.	.	.	.	.	.	.	.	G	7.886	0.731322	0.15507	0.0	1.16E-4	ENSG00000172689	ENST00000308287	T	0.02050	4.48	4.87	2.0	0.26442	.	0.463445	0.16144	N	0.227570	T	0.01092	0.0036	N	0.11870	0.19	0.09310	N	1	P	0.47253	0.892	B	0.37692	0.256	T	0.33777	-0.9855	10	0.02654	T	1	-18.0706	6.9355	0.24464	0.2928:0.0:0.7072:0.0	.	141	Q96PG2	M4A10_HUMAN	I	141	ENSP00000311862:V141I	ENSP00000311862:V141I	V	+	1	0	MS4A10	60318081	0.250000	0.23951	0.017000	0.16124	0.024000	0.10985	0.753000	0.26376	0.139000	0.18822	-0.140000	0.14226	GTC	.		0.517	MS4A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395619.1	NM_206893	
MTAP	4507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	21838002	21838002	+	Missense_Mutation	SNP	C	C	T	rs368718537		TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr9:21838002C>T	ENST00000460874.2	+	5	719	c.494C>T	c.(493-495)aCg>aTg	p.T165M	MTAP_ENST00000580900.1_Missense_Mutation_p.T148M|MTAP_ENST00000380172.4_Missense_Mutation_p.T148M|RP11-145E5.5_ENST00000404796.2_Intron					methylthioadenosine phosphorylase									p.0(1)|p.0?(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|lung(3)|pancreas(1)	10		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)		TGCCCCAAAACGAGAGAGGTG	0.498																																					p.T148M		.											.	MTAP	651	2	Whole gene deletion(2)	lung(2)	c.C443T						.						229.0	227.0	228.0					9																	21838002		2203	4300	6503	SO:0001583	missense	4507	exon5			CCAAAACGAGAGA	AB062485	CCDS6509.1	9p21	2013-05-29			ENSG00000099810	ENSG00000099810	2.4.2.28		7413	protein-coding gene	gene with protein product	"""S-methyl-5'-thioadenosine phosphorylase"""	156540				11126361	Standard	NM_002451		Approved	MSAP, c86fus	uc003zph.3	Q13126	OTTHUMG00000019690	ENST00000460874.2:c.494C>T	9.37:g.21838002C>T	ENSP00000461932:p.Thr165Met	109.0	0.0		152.0	61.0	NM_002451		Missense_Mutation	SNP	ENST00000460874.2	37		.	.	.	.	.	.	.	.	.	.	C	14.17	2.454968	0.43634	.	.	ENSG00000099810	ENST00000380172	D	0.86366	-2.11	5.54	5.54	0.83059	Nucleoside phosphorylase domain (1);	0.000000	0.85682	D	0.000000	D	0.90130	0.6916	L	0.39020	1.185	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.66716	0.946;0.921	D	0.89885	0.4033	10	0.46703	T	0.11	-22.4499	18.2739	0.90077	0.0:1.0:0.0:0.0	.	165;148	B4DUC8;Q13126	.;MTAP_HUMAN	M	148	ENSP00000369519:T148M	ENSP00000369519:T148M	T	+	2	0	MTAP	21828002	1.000000	0.71417	0.976000	0.42696	0.894000	0.52154	5.608000	0.67654	2.607000	0.88179	0.655000	0.94253	ACG	.		0.498	MTAP-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000051929.2	NM_002451	
NF1	4763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	29553694	29553694	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr17:29553694T>G	ENST00000358273.4	+	18	2626	c.2243T>G	c.(2242-2244)aTg>aGg	p.M748R	NF1_ENST00000356175.3_Missense_Mutation_p.M748R	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	748					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AGCAATATGATGTCAACAGGT	0.413			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.M748R		.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	3353	12	Whole gene deletion(8)|Unknown(4)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)	c.T2243G						.						124.0	111.0	115.0					17																	29553694		2203	4300	6503	SO:0001583	missense	4763	exon18	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	ATATGATGTCAAC		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.2243T>G	17.37:g.29553694T>G	ENSP00000351015:p.Met748Arg	65.0	0.0		91.0	40.0	NM_000267	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	T	15.68	2.905559	0.52333	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	T;T;T	0.07567	3.36;3.49;3.18	5.78	5.78	0.91487	Armadillo-type fold (1);	0.088921	0.85682	D	0.000000	T	0.05227	0.0139	N	0.04508	-0.205	0.80722	D	1	B;B;B	0.29716	0.004;0.255;0.0	B;B;B	0.28784	0.005;0.094;0.001	T	0.50767	-0.8789	10	0.38643	T	0.18	.	16.1254	0.81392	0.0:0.0:0.0:1.0	.	748;748;748	E1P657;P21359-2;P21359	.;.;NF1_HUMAN	R	748;748;414	ENSP00000351015:M748R;ENSP00000348498:M748R;ENSP00000389907:M414R	ENSP00000348498:M748R	M	+	2	0	NF1	26577820	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.828000	0.69307	2.195000	0.70347	0.528000	0.53228	ATG	.		0.413	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
NFRKB	4798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	129762747	129762747	+	5'UTR	SNP	T	T	C			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr11:129762747T>C	ENST00000446488.3	-	0	101				NFRKB_ENST00000524746.1_5'UTR|NFRKB_ENST00000526940.1_5'UTR|NFRKB_ENST00000524794.1_Missense_Mutation_p.T13A|NFRKB_ENST00000304521.5_5'UTR	NM_001143835.1	NP_001137307.1	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein						DNA recombination (GO:0006310)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protease binding (GO:0002020)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(13)|ovary(4)|skin(3)|urinary_tract(1)	32	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		GAATCCATTGTTTCTTCTCCA	0.493																																					p.T13A		.											.	NFRKB	93	0			c.A37G						.						180.0	153.0	162.0					11																	129762747		2201	4297	6498	SO:0001623	5_prime_UTR_variant	4798	exon1			CCATTGTTTCTTC		CCDS8483.1, CCDS44770.1	11q24-q25	2011-07-06			ENSG00000170322	ENSG00000170322		"""INO80 complex subunits"""	7802	protein-coding gene	gene with protein product	"""nuclear factor related to kappa B binding protein"", ""DNA-binding protein R kappa B"", ""INO80 complex subunit G"""	164013				1427843	Standard	NM_006165		Approved	DKFZp547B2013, INO80G	uc001qfg.3	Q6P4R8	OTTHUMG00000165761	ENST00000446488.3:c.-3A>G	11.37:g.129762747T>C		153.0	0.0		174.0	24.0	NM_006165	Q12869|Q15312|Q9H048	Missense_Mutation	SNP	ENST00000446488.3	37	CCDS44770.1	.	.	.	.	.	.	.	.	.	.	T	14.93	2.680946	0.47886	.	.	ENSG00000170322	ENST00000524794	.	.	.	4.66	-4.82	0.03171	.	.	.	.	.	T	0.22936	0.0554	.	.	.	0.18873	N	0.999987	B	0.02656	0.0	B	0.01281	0.0	T	0.19095	-1.0316	7	0.25106	T	0.35	1.0065	7.5933	0.28033	0.0:0.3595:0.1127:0.5278	.	13	Q6P4R8-2	.	A	13	.	ENSP00000436926:T13A	T	-	1	0	NFRKB	129267957	0.007000	0.16637	0.016000	0.15963	0.968000	0.65278	-0.148000	0.10219	-1.404000	0.02050	0.477000	0.44152	ACA	.		0.493	NFRKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386063.2	NM_006165	
NLGN4X	57502	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	5821238	5821238	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chrX:5821238G>T	ENST00000381095.3	-	5	2108	c.1481C>A	c.(1480-1482)cCc>cAc	p.P494H	NLGN4X_ENST00000538097.1_Missense_Mutation_p.P494H|NLGN4X_ENST00000381093.2_Missense_Mutation_p.P514H|NLGN4X_ENST00000275857.6_Missense_Mutation_p.P494H|NLGN4X_ENST00000381092.1_Missense_Mutation_p.P494H	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	494					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						GAAGACATAGGGGACCTCATC	0.557																																					p.P494H		.											.	NLGN4X	195	0			c.C1481A						.						97.0	81.0	86.0					X																	5821238		2203	4300	6503	SO:0001583	missense	57502	exon5			ACATAGGGGACCT	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.1481C>A	X.37:g.5821238G>T	ENSP00000370485:p.Pro494His	431.0	0.0		589.0	134.0	NM_181332	Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	37	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	G	13.98	2.398700	0.42512	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.35	3.93	3.93	0.45458	Carboxylesterase, type B (1);	.	.	.	.	D	0.84620	0.5512	M	0.91872	3.25	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.989;1.0;0.998	D	0.88636	0.3172	9	0.87932	D	0	.	14.4947	0.67678	0.0:0.0:1.0:0.0	.	551;494;514	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	H	494;514;494;494;494	ENSP00000370485:P494H;ENSP00000370483:P514H;ENSP00000275857:P494H;ENSP00000370482:P494H;ENSP00000439203:P494H	ENSP00000275857:P494H	P	-	2	0	NLGN4X	5831238	1.000000	0.71417	0.547000	0.28179	0.082000	0.17680	8.442000	0.90317	1.579000	0.49836	0.600000	0.82982	CCC	.		0.557	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742	
NLRP9	338321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	56244429	56244429	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr19:56244429G>C	ENST00000332836.2	-	2	795	c.768C>G	c.(766-768)atC>atG	p.I256M		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	256	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		AACTGCTCAGGATAATTGGCA	0.418																																					p.I256M		.											.	NLRP9	294	0			c.C768G						.						48.0	49.0	49.0					19																	56244429		2203	4300	6503	SO:0001583	missense	338321	exon2			GCTCAGGATAATT	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.768C>G	19.37:g.56244429G>C	ENSP00000331857:p.Ile256Met	48.0	0.0		49.0	13.0	NM_176820	B2RN12|Q86W27	Missense_Mutation	SNP	ENST00000332836.2	37	CCDS12934.1	.	.	.	.	.	.	.	.	.	.	G	15.64	2.894510	0.52121	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	T	0.79033	-1.23	2.46	2.46	0.29980	NACHT nucleoside triphosphatase (1);	.	.	.	.	T	0.80696	0.4672	L	0.53249	1.67	0.26881	N	0.967537	D	0.54397	0.966	P	0.61477	0.889	T	0.68655	-0.5351	9	0.72032	D	0.01	.	5.254	0.15537	0.1587:0.0:0.8413:0.0	.	256	Q7RTR0	NALP9_HUMAN	M	256	ENSP00000331857:I256M	ENSP00000331857:I256M	I	-	3	3	NLRP9	60936241	0.089000	0.21612	0.100000	0.21137	0.643000	0.38383	-0.143000	0.10296	1.731000	0.51592	0.644000	0.83932	ATC	.		0.418	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	NM_176820	
NRXN3	9369	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	79434590	79434590	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr14:79434590T>A	ENST00000554719.1	+	11	2415	c.1924T>A	c.(1924-1926)Ttt>Att	p.F642I	NRXN3_ENST00000335750.5_Missense_Mutation_p.F642I	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	248					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		TCGAGATGGCTTTCAGGGCTG	0.527																																					p.F642I		.											.	NRXN3	587	0			c.T1924A						.						134.0	117.0	123.0					14																	79434590		2203	4300	6503	SO:0001583	missense	9369	exon11			GATGGCTTTCAGG	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.1924T>A	14.37:g.79434590T>A	ENSP00000451648:p.Phe642Ile	169.0	0.0		196.0	49.0	NM_004796	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000554719.1	37	CCDS9870.1	.	.	.	.	.	.	.	.	.	.	T	36	5.777289	0.96929	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750	D;D	0.90620	-2.7;-2.7	6.03	6.03	0.97812	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.108331	0.64402	D	0.000006	D	0.94932	0.8361	.	.	.	0.58432	D	0.999999	D;D	0.69078	0.997;0.971	D;P	0.67548	0.952;0.774	D	0.94735	0.7913	8	.	.	.	.	16.5655	0.84588	0.0:0.0:0.0:1.0	.	1015;642	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	I	1015;1004;642;642	ENSP00000451648:F642I;ENSP00000338349:F642I	.	F	+	1	0	NRXN3	78504343	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	8.040000	0.89188	2.302000	0.77476	0.533000	0.62120	TTT	.		0.527	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250	
OR6C75	390323	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	55759405	55759405	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr12:55759405G>T	ENST00000343399.3	+	1	511	c.511G>T	c.(511-513)Gta>Tta	p.V171L		NM_001005497.1	NP_001005497.1	A6NL08	O6C75_HUMAN	olfactory receptor, family 6, subfamily C, member 75	171						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)	25						TGCCTCCAATGTAATTGATCA	0.428																																					p.V171L		.											.	OR6C75	70	0			c.G511T						.						170.0	144.0	153.0					12																	55759405		2203	4300	6503	SO:0001583	missense	390323	exon1			TCCAATGTAATTG		CCDS31820.1	12q13.2	2013-09-23			ENSG00000187857	ENSG00000187857		"""GPCR / Class A : Olfactory receptors"""	31304	protein-coding gene	gene with protein product							Standard	NM_001005497		Approved		uc010spk.2	A6NL08	OTTHUMG00000169886	ENST00000343399.3:c.511G>T	12.37:g.55759405G>T	ENSP00000368987:p.Val171Leu	106.0	0.0		117.0	42.0	NM_001005497		Missense_Mutation	SNP	ENST00000343399.3	37	CCDS31820.1	.	.	.	.	.	.	.	.	.	.	g	12.84	2.059306	0.36373	.	.	ENSG00000187857	ENST00000343399	T	0.00145	8.67	5.22	-7.39	0.01402	GPCR, rhodopsin-like superfamily (1);	0.248995	0.27056	N	0.021146	T	0.00144	0.0004	L	0.56340	1.77	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.49978	-0.8881	10	0.51188	T	0.08	.	15.0283	0.71687	0.1842:0.1111:0.7047:0.0	.	171	A6NL08	O6C75_HUMAN	L	171	ENSP00000368987:V171L	ENSP00000368987:V171L	V	+	1	0	OR6C75	54045672	0.000000	0.05858	0.618000	0.29105	0.952000	0.60782	-3.774000	0.00370	-1.261000	0.02462	-0.331000	0.08364	GTA	.		0.428	OR6C75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406418.1		
PAX2	5076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	102509535	102509535	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr10:102509535G>A	ENST00000428433.1	+	2	626	c.76G>A	c.(76-78)Gtg>Atg	p.V26M	PAX2_ENST00000361791.3_Missense_Mutation_p.V26M|PAX2_ENST00000355243.3_Missense_Mutation_p.V26M|PAX2_ENST00000370296.2_Missense_Mutation_p.V26M|PAX2_ENST00000553492.1_Intron|PAX2_ENST00000556085.1_Missense_Mutation_p.V25M	NM_003987.3|NM_003990.3	NP_003978|NP_003981.2	Q02962	PAX2_HUMAN	paired box 2	26	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				aging (GO:0007568)|axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cell fate determination (GO:0001709)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucose stimulus (GO:0071333)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|glial cell differentiation (GO:0010001)|inner ear morphogenesis (GO:0042472)|mesenchymal to epithelial transition (GO:0060231)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate specification (GO:0007501)|mesonephric duct development (GO:0072177)|mesonephric tubule formation (GO:0072172)|mesonephros development (GO:0001823)|metanephric collecting duct development (GO:0072205)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchyme development (GO:0072075)|metanephric nephron tubule formation (GO:0072289)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of cytolysis (GO:0045918)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of programmed cell death (GO:0043069)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|neural tube closure (GO:0001843)|optic chiasma development (GO:0061360)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|optic nerve development (GO:0021554)|optic nerve morphogenesis (GO:0021631)|optic nerve structural organization (GO:0021633)|pancreas development (GO:0031016)|paramesonephric duct development (GO:0061205)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of optic nerve formation (GO:2000597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|protein kinase B signaling (GO:0043491)|reactive oxygen species metabolic process (GO:0072593)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of metanephros size (GO:0035566)|response to nutrient levels (GO:0031667)|retinal pigment epithelium development (GO:0003406)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|ureter development (GO:0072189)|ureter maturation (GO:0035799)|ureter morphogenesis (GO:0072197)|urogenital system development (GO:0001655)|vestibulocochlear nerve formation (GO:0021650)|visual perception (GO:0007601)	centriolar satellite (GO:0034451)|lysosome (GO:0005764)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|protein complex (GO:0043234)|protein-DNA complex (GO:0032993)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|superoxide-generating NADPH oxidase activity (GO:0016175)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	18		Colorectal(252;0.234)		Epithelial(162;1.32e-08)|all cancers(201;7.32e-07)		GCTCGGGGGGGTGTTTGTGAA	0.657																																					p.V26M		.											.	PAX2	90	0			c.G76A						.						30.0	36.0	34.0					10																	102509535		2196	4294	6490	SO:0001583	missense	5076	exon2			GGGGGGGTGTTTG		CCDS7499.1, CCDS41561.1	10q24.31	2011-06-20	2007-07-12		ENSG00000075891	ENSG00000075891		"""Paired boxes"", ""Homeoboxes / PRD class"""	8616	protein-coding gene	gene with protein product		167409	"""paired box gene 2"""			8431641, 7981748	Standard	NM_003990		Approved		uc001krk.4	Q02962	OTTHUMG00000018913	ENST00000428433.1:c.76G>A	10.37:g.102509535G>A	ENSP00000396259:p.Val26Met	24.0	0.0		28.0	9.0	NM_003987	Q15105|Q15110|Q15837|Q5SZP2|Q5SZP3	Missense_Mutation	SNP	ENST00000428433.1	37	CCDS53569.1	.	.	.	.	.	.	.	.	.	.	G	35	5.561159	0.96527	.	.	ENSG00000075891	ENST00000370296;ENST00000428433;ENST00000361791;ENST00000355243;ENST00000556085;ENST00000427256;ENST00000554172	D;D;D;D;D;D;D	0.99656	-6.31;-6.31;-6.31;-6.31;-6.31;-6.31;-6.31	6.17	6.17	0.99709	Paired box protein, N-terminal (4);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99447	0.9804	L	0.48174	1.505	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;0.958;0.999;1.0;1.0;0.999;1.0	D;P;D;D;D;D;D	0.91635	0.988;0.726;0.995;0.999;0.999;0.998;0.999	D	0.99727	1.1011	10	0.51188	T	0.08	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	25;26;26;30;26;26;30	G3V5U4;Q02962-2;Q02962-3;Q6YFJ8;Q02962;Q02962-4;G3V5S4	.;.;.;.;PAX2_HUMAN;.;.	M	26;26;26;26;25;26;30	ENSP00000359319:V26M;ENSP00000396259:V26M;ENSP00000355069:V26M;ENSP00000347385:V26M;ENSP00000452527:V25M;ENSP00000398652:V26M;ENSP00000452489:V30M	ENSP00000347385:V26M	V	+	1	0	PAX2	102499525	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.862000	0.99564	2.941000	0.99782	0.655000	0.94253	GTG	.		0.657	PAX2-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
PCDH18	54510	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	138450774	138450774	+	Missense_Mutation	SNP	G	G	T	rs375416110		TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr4:138450774G>T	ENST00000344876.4	-	1	2855	c.2469C>A	c.(2467-2469)caC>caA	p.H823Q	PCDH18_ENST00000412923.2_Missense_Mutation_p.H823Q|PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000507846.1_Missense_Mutation_p.H603Q|PCDH18_ENST00000510305.1_Missense_Mutation_p.H34Q	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	823					brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					CAGGAGTGGCGTGGGTGAGTT	0.433																																					p.H823Q		.											.	PCDH18	185	0			c.C2469A						.						115.0	98.0	104.0					4																	138450774		2203	4300	6503	SO:0001583	missense	54510	exon1			AGTGGCGTGGGTG	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.2469C>A	4.37:g.138450774G>T	ENSP00000355082:p.His823Gln	180.0	0.0		170.0	56.0	NM_019035	A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	ENST00000344876.4	37	CCDS34064.1	.	.	.	.	.	.	.	.	.	.	G	3.416	-0.119248	0.06838	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846;ENST00000510305	T;T;T;T	0.53857	0.7;0.7;0.6;1.54	5.29	-3.59	0.04583	.	0.152169	0.30109	N	0.010383	T	0.41026	0.1141	L	0.57536	1.79	0.80722	D	1	P;B;P	0.43169	0.525;0.017;0.8	B;B;B	0.39503	0.117;0.017;0.301	T	0.48246	-0.9052	10	0.14252	T	0.57	.	12.94	0.58337	0.7311:0.0:0.2689:0.0	.	603;823;823	D6RIG4;Q9HCL0-2;Q9HCL0	.;.;PCD18_HUMAN	Q	823;823;603;34	ENSP00000355082:H823Q;ENSP00000390688:H823Q;ENSP00000425903:H603Q;ENSP00000424269:H34Q	ENSP00000355082:H823Q	H	-	3	2	PCDH18	138670224	0.046000	0.20272	0.922000	0.36590	0.997000	0.91878	-0.491000	0.06474	-0.906000	0.03866	-0.140000	0.14226	CAC	.		0.433	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
PCDHAC2	56134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140348025	140348025	+	Silent	SNP	A	A	G			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr5:140348025A>G	ENST00000289269.5	+	1	2206	c.1674A>G	c.(1672-1674)ccA>ccG	p.P558P	PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	558	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGCCCACCACTGAGCAGCA	0.527																																					p.P558P	Melanoma(190;638 2083 3390 11909 52360)	.											.	PCDHAC2	26	0			c.A1674G						.						107.0	98.0	101.0					5																	140348025		2203	4300	6503	SO:0001819	synonymous_variant	56134	exon1			CCCACCACTGAGC	AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.1674A>G	5.37:g.140348025A>G		129.0	0.0		160.0	55.0	NM_031883	Q2M3V1|Q9Y5F4	Silent	SNP	ENST00000289269.5	37	CCDS4242.1																																																																																			.		0.527	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251802.2	NM_018899	
PEG10	23089	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	94293118	94293118	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr7:94293118G>A	ENST00000482108.1	+	2	729	c.250G>A	c.(250-252)Gag>Aag	p.E84K	PEG10_ENST00000488574.1_Missense_Mutation_p.E84K	NM_001040152.1|NM_001172438.1|NM_001184962.1	NP_001035242.1|NP_001165909.1|NP_001171891.1	Q86TG7	PEG10_HUMAN	paternally expressed 10	84	Necessary for interaction with ALK1.				apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|placenta development (GO:0001890)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(9)|prostate(3)|skin(1)	21	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			AGACCTCCCAGAGAAGTTCGA	0.572																																					p.E160K		.											.	PEG10	23	0			c.G478A						.						56.0	60.0	59.0					7																	94293118		1991	4146	6137	SO:0001583	missense	23089	exon2			CTCCCAGAGAAGT	AB049834	CCDS55126.1, CCDS75636.1, CCDS75637.1	7q21	2007-12-07			ENSG00000242265	ENSG00000242265			14005	protein-coding gene	gene with protein product		609810				11318613, 15716091, 16093683	Standard	NM_001172437		Approved	KIAA1051, HB-1, MEF3L, RGAG3, Mar2, Mart2	uc011kie.2	Q86TG7	OTTHUMG00000155578	ENST00000482108.1:c.250G>A	7.37:g.94293118G>A	ENSP00000417587:p.Glu84Lys	116.0	0.0		173.0	37.0	NM_001172438	Q96A68|Q9UPV1	Missense_Mutation	SNP	ENST00000482108.1	37	CCDS55126.1	.	.	.	.	.	.	.	.	.	.	G	17.52	3.410267	0.62399	.	.	ENSG00000242265	ENST00000482108;ENST00000488574	T;T	0.12361	2.69;2.69	4.25	4.25	0.50352	.	.	.	.	.	T	0.17492	0.0420	N	0.24115	0.695	0.25870	N	0.983723	D;D	0.61080	0.989;0.989	P;P	0.57548	0.823;0.823	T	0.10800	-1.0614	9	0.21540	T	0.41	.	12.3761	0.55281	0.0:0.0:1.0:0.0	.	160;84	B4DSP0;Q86TG7	.;PEG10_HUMAN	K	84	ENSP00000417587:E84K;ENSP00000418944:E84K	ENSP00000417587:E84K	E	+	1	0	PEG10	94131054	1.000000	0.71417	0.938000	0.37757	0.757000	0.42996	4.022000	0.57203	2.382000	0.81193	0.555000	0.69702	GAG	.		0.572	PEG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340751.1	NM_015068	
PFKFB1	5207	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	54978366	54978366	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chrX:54978366T>G	ENST00000375006.3	-	8	888	c.818A>C	c.(817-819)gAc>gCc	p.D273A	PFKFB1_ENST00000545676.1_Missense_Mutation_p.D208A|PFKFB1_ENST00000374992.2_Intron	NM_002625.2	NP_002616.2	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1	273	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|intracellular signal transduction (GO:0035556)|organ regeneration (GO:0031100)|positive regulation of glucokinase activity (GO:0033133)|response to cAMP (GO:0051591)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase complex (GO:0043540)|cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|fructose-6-phosphate binding (GO:0070095)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)	24						GAGGCCAGAGTCACCTCCGAT	0.582																																					p.D273A		.											.	PFKFB1	131	0			c.A818C						.						102.0	65.0	78.0					X																	54978366		2202	4299	6501	SO:0001583	missense	5207	exon8			CCAGAGTCACCTC		CCDS14364.1, CCDS65273.1	Xp11.21	2012-07-13			ENSG00000158571	ENSG00000158571	2.7.1.105, 3.1.3.46		8872	protein-coding gene	gene with protein product		311790		PFRX		9119406	Standard	NM_002625		Approved		uc004dty.2	P16118	OTTHUMG00000021643	ENST00000375006.3:c.818A>C	X.37:g.54978366T>G	ENSP00000364145:p.Asp273Ala	206.0	0.0		235.0	70.0	NM_002625	B2RA88|B4DUN5|Q5JXS5|Q99951	Missense_Mutation	SNP	ENST00000375006.3	37	CCDS14364.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.257593	0.80246	.	.	ENSG00000158571	ENST00000375006;ENST00000545676	T;T	0.73152	-0.72;-0.72	4.53	4.53	0.55603	Histidine phosphatase superfamily, clade-1 (2);	0.000000	0.85682	D	0.000000	D	0.90827	0.7119	H	0.99642	4.675	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.93746	0.7054	10	0.87932	D	0	-23.1119	12.3464	0.55124	0.0:0.0:0.0:1.0	.	208;273	B4DUN5;P16118	.;F261_HUMAN	A	273;208	ENSP00000364145:D273A;ENSP00000444074:D208A	ENSP00000364145:D273A	D	-	2	0	PFKFB1	54995091	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.841000	0.86834	1.618000	0.50286	0.422000	0.28245	GAC	.		0.582	PFKFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056847.1		
PHACTR3	116154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	58416548	58416548	+	Silent	SNP	G	G	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr20:58416548G>A	ENST00000371015.1	+	11	2012	c.1545G>A	c.(1543-1545)agG>agA	p.R515R	PHACTR3_ENST00000355648.4_Silent_p.R474R|PHACTR3_ENST00000395636.2_Silent_p.R474R|PHACTR3_ENST00000359926.3_Silent_p.R512R|PHACTR3_ENST00000361300.4_Silent_p.R404R|PHACTR3_ENST00000395639.4_Silent_p.R404R|PHACTR3_ENST00000541461.1_Silent_p.R474R	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	515	Required for PP1CA binding and inhibition of PP1 activity.					nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			ACTATGACAGGAGGGCAGACA	0.448																																					p.R515R		.											.	PHACTR3	93	0			c.G1545A						.						91.0	81.0	84.0					20																	58416548		2203	4300	6503	SO:0001819	synonymous_variant	116154	exon11			TGACAGGAGGGCA	AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.1545G>A	20.37:g.58416548G>A		218.0	0.0		256.0	38.0	NM_080672	B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Silent	SNP	ENST00000371015.1	37	CCDS13480.1																																																																																			.		0.448	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	NM_080672	
PHF2	5253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	96435949	96435949	+	Silent	SNP	C	C	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr9:96435949C>T	ENST00000359246.4	+	18	2798	c.2431C>T	c.(2431-2433)Ctg>Ttg	p.L811L	PHF2_ENST00000375376.4_Intron	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	811					liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		CGACTCCTGCCTGCAGACCAC	0.667																																					p.L811L		.											.	PHF2	91	0			c.C2431T						.						34.0	37.0	36.0					9																	96435949		2203	4300	6503	SO:0001819	synonymous_variant	5253	exon18			TCCTGCCTGCAGA	AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.2431C>T	9.37:g.96435949C>T		182.0	0.0		233.0	78.0	NM_005392	Q4VXG0|Q8N3K2|Q9Y6N4	Silent	SNP	ENST00000359246.4	37	CCDS35069.1																																																																																			.		0.667	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053162.1	NM_005392	
PIK3CD	5293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	9777146	9777146	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr1:9777146C>T	ENST00000377346.4	+	7	1105	c.910C>T	c.(910-912)Cct>Tct	p.P304S	PIK3CD_ENST00000361110.2_Missense_Mutation_p.P269S|PIK3CD_ENST00000536656.1_Missense_Mutation_p.P269S|PIK3CD_ENST00000543390.1_5'Flank	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	304					adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	TGCCAAACCACCTCCCATTCC	0.622																																					p.P304S		.											.	PIK3CD	1311	0			c.C910T						.						125.0	113.0	117.0					1																	9777146		2203	4300	6503	SO:0001583	missense	5293	exon7			AAACCACCTCCCA		CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.910C>T	1.37:g.9777146C>T	ENSP00000366563:p.Pro304Ser	238.0	0.0		260.0	94.0	NM_005026	A6NCG0|G1FFP1|O15445|Q5SR49	Missense_Mutation	SNP	ENST00000377346.4	37	CCDS104.1	.	.	.	.	.	.	.	.	.	.	C	16.67	3.186683	0.57909	.	.	ENSG00000171608	ENST00000536656;ENST00000377346;ENST00000361110;ENST00000360563	T;T;T	0.66638	-0.22;-0.12;-0.22	5.16	5.16	0.70880	.	0.105658	0.64402	D	0.000003	T	0.67069	0.2854	N	0.19112	0.55	0.80722	D	1	B;D;P	0.76494	0.047;0.999;0.599	B;D;B	0.68765	0.024;0.96;0.356	T	0.60687	-0.7214	10	0.08837	T	0.75	-40.6061	16.807	0.85708	0.0:1.0:0.0:0.0	.	304;269;304	B7ZM44;Q5SR50;O00329	.;.;PK3CD_HUMAN	S	269;304;269;269	ENSP00000446444:P269S;ENSP00000366563:P304S;ENSP00000354410:P269S	ENSP00000353766:P269S	P	+	1	0	PIK3CD	9699733	1.000000	0.71417	0.971000	0.41717	0.009000	0.06853	7.264000	0.78432	2.415000	0.81967	0.491000	0.48974	CCT	.		0.622	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004235.1	NM_005026	
PLXNB3	5365	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	153034490	153034490	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chrX:153034490G>A	ENST00000361971.5	+	5	1468	c.1354G>A	c.(1354-1356)Gac>Aac	p.D452N	PLXNB3_ENST00000538282.1_Intron|PLXNB3_ENST00000538543.1_Intron|PLXNB3_ENST00000538776.1_Missense_Mutation_p.D105N|PLXNB3_ENST00000538966.1_Missense_Mutation_p.D475N|U52111.14_ENST00000416854.1_RNA|U52111.14_ENST00000434284.1_RNA	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	452	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CCTGCTGCTGGACAGCAGTGG	0.647																																					p.D475N		.											.	PLXNB3	130	0			c.G1423A						.						63.0	54.0	57.0					X																	153034490		2202	4300	6502	SO:0001583	missense	5365	exon6			CTGCTGGACAGCA	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.1354G>A	X.37:g.153034490G>A	ENSP00000355378:p.Asp452Asn	141.0	0.0		183.0	10.0	NM_001163257	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	37	CCDS14729.1	.	.	.	.	.	.	.	.	.	.	G	17.07	3.296121	0.60086	.	.	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776	T;T;T	0.05447	3.44;3.44;3.44	5.27	5.27	0.74061	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (3);	0.054815	0.64402	D	0.000001	T	0.16300	0.0392	M	0.85630	2.765	0.34413	D	0.696535	B;P;P;B	0.40578	0.237;0.722;0.474;0.108	B;B;B;B	0.42386	0.255;0.267;0.386;0.144	T	0.24012	-1.0172	10	0.59425	D	0.04	.	15.2028	0.73153	0.0:0.0:1.0:0.0	.	105;134;475;452	B7Z3H9;B7Z9A5;F5H773;Q9ULL4	.;.;.;PLXB3_HUMAN	N	475;452;105	ENSP00000442736:D475N;ENSP00000355378:D452N;ENSP00000445569:D105N	ENSP00000355378:D452N	D	+	1	0	PLXNB3	152687684	1.000000	0.71417	0.991000	0.47740	0.693000	0.40251	2.956000	0.49129	2.178000	0.69098	0.513000	0.50165	GAC	.		0.647	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
POC1B	282809	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	89891089	89891089	+	Missense_Mutation	SNP	A	A	G	rs111514387		TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr12:89891089A>G	ENST00000313546.3	-	3	259	c.131T>C	c.(130-132)cTa>cCa	p.L44P	POC1B_ENST00000393179.4_Intron|POC1B_ENST00000549504.1_Intron|POC1B_ENST00000549035.1_Missense_Mutation_p.L2P|POC1B_ENST00000541909.1_Intron|POC1B_ENST00000378528.2_5'Flank	NM_172240.2	NP_758440.1	Q8TC44	POC1B_HUMAN	POC1 centriolar protein B	44					cell proliferation (GO:0008283)|cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	14						GAAATTCCATAGCATGAGAAA	0.398																																					p.L44P		.											.	POC1B	92	0			c.T131C						.						117.0	104.0	108.0					12																	89891089		2203	4300	6503	SO:0001583	missense	282809	exon3			TTCCATAGCATGA	AL832918	CCDS31869.1, CCDS55859.1	12q21.33	2014-05-02	2013-08-21	2010-03-26	ENSG00000139323	ENSG00000139323		"""WD repeat domain containing"""	30836	protein-coding gene	gene with protein product		614784	"""WD repeat domain 51B"", ""POC1 centriolar protein homolog B (Chlamydomonas)"""	WDR51B		19109428	Standard	NM_172240		Approved	TUWD12, FLJ14923		Q8TC44	OTTHUMG00000169944	ENST00000313546.3:c.131T>C	12.37:g.89891089A>G	ENSP00000323302:p.Leu44Pro	87.0	1.0		157.0	22.0	NM_172240	G3V1X0	Missense_Mutation	SNP	ENST00000313546.3	37	CCDS31869.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.219348	0.79464	.	.	ENSG00000139323	ENST00000313546;ENST00000549035	T;D	0.82344	-0.26;-1.6	5.38	5.38	0.77491	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.056244	0.64402	D	0.000004	D	0.93452	0.7911	H	0.95294	3.65	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	D	0.95280	0.8385	10	0.87932	D	0	.	15.0498	0.71858	1.0:0.0:0.0:0.0	.	44	Q8TC44	POC1B_HUMAN	P	44;2	ENSP00000323302:L44P;ENSP00000447916:L2P	ENSP00000323302:L44P	L	-	2	0	POC1B	88415220	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.095000	0.94175	2.047000	0.60756	0.482000	0.46254	CTA	A|0.500;G|0.500		0.398	POC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406637.1	NM_172240	
PRELID1	27166	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	176732982	176732982	+	Silent	SNP	C	C	G			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr5:176732982C>G	ENST00000303204.4	+	3	641	c.429C>G	c.(427-429)gtC>gtG	p.V143V	RAB24_ENST00000303251.6_5'Flank|RAB24_ENST00000393611.2_5'Flank|MXD3_ENST00000427908.2_3'UTR|RAB24_ENST00000303270.6_5'Flank|PRELID1_ENST00000503216.1_Silent_p.V143V			Q9Y255	PRLD1_HUMAN	PRELI domain containing 1	143	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.				apoptotic process (GO:0006915)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mitochondrial membrane potential (GO:0010917)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of cellular respiration (GO:1901857)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of T cell apoptotic process (GO:0070234)|regulation of membrane lipid distribution (GO:0097035)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of T cell differentiation (GO:0045580)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(1)|kidney(2)|lung(2)|prostate(1)|stomach(1)	7	all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCAGAGCTGTCCAGGTGAGCA	0.567																																					p.V143V		.											.	PRELID1	90	0			c.C429G						.						54.0	51.0	52.0					5																	176732982		2203	4300	6503	SO:0001819	synonymous_variant	27166	exon3			AGCTGTCCAGGTG	BC013748	CCDS4415.1, CCDS64328.1	5q35.3	2010-01-18			ENSG00000169230	ENSG00000169230			30255	protein-coding gene	gene with protein product	"""protein of relevant evolutionary and lymphoid interest"", ""px19-like protein"""	605733				10784606, 14640972	Standard	NM_013237		Approved	CGI-106, PX19, PRELI	uc003mfx.4	Q9Y255	OTTHUMG00000130847	ENST00000303204.4:c.429C>G	5.37:g.176732982C>G		54.0	1.0		76.0	22.0	NM_013237	B2R5F7|D6RD25|Q549N2|Q9UI13|Q9UJS9	Silent	SNP	ENST00000303204.4	37	CCDS4415.1	.	.	.	.	.	.	.	.	.	.	C	9.498	1.102462	0.20632	.	.	ENSG00000169230	ENST00000503853	.	.	.	4.48	2.4	0.29515	.	.	.	.	.	T	0.52805	0.1757	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45862	-0.9232	4	.	.	.	-10.9821	5.8452	0.18661	0.1652:0.6429:0.0:0.1919	.	.	.	.	A	92	.	.	P	+	1	0	PRELID1	176665588	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	1.097000	0.30988	1.031000	0.39867	0.561000	0.74099	CCA	.		0.567	PRELID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253414.1	NM_013237	
PYHIN1	149628	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158906744	158906744	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr1:158906744A>G	ENST00000368140.1	+	2	289	c.44A>G	c.(43-45)gAg>gGg	p.E15G	PYHIN1_ENST00000368135.4_Missense_Mutation_p.E15G|PYHIN1_ENST00000392252.3_Missense_Mutation_p.E15G|PYHIN1_ENST00000392254.2_Missense_Mutation_p.E15G|PYHIN1_ENST00000368138.3_Missense_Mutation_p.E15G	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	15	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				cell cycle (GO:0007049)	nucleus (GO:0005634)				breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					AAAGGATTAGAGGTCATCAAT	0.294																																					p.E15G		.											.	PYHIN1	94	0			c.A44G						.						51.0	54.0	53.0					1																	158906744		2203	4300	6503	SO:0001583	missense	149628	exon2			GATTAGAGGTCAT	AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.44A>G	1.37:g.158906744A>G	ENSP00000357122:p.Glu15Gly	136.0	0.0		196.0	24.0	NM_152501	Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Missense_Mutation	SNP	ENST00000368140.1	37	CCDS1178.1	.	.	.	.	.	.	.	.	.	.	A	13.51	2.259972	0.39995	.	.	ENSG00000163564	ENST00000458222;ENST00000368140;ENST00000368138;ENST00000392254;ENST00000392252;ENST00000368135	T;T;T;T;T;T	0.57752	0.38;0.38;0.38;0.38;0.38;0.38	2.83	1.62	0.23740	Pyrin (2);	.	.	.	.	T	0.51041	0.1651	M	0.66297	2.02	0.09310	N	1	D;D;D;D;D	0.71674	0.998;0.998;0.998;0.998;0.978	D;D;D;D;P	0.76575	0.979;0.979;0.979;0.988;0.806	T	0.35351	-0.9792	9	0.87932	D	0	.	5.2315	0.15424	0.7443:0.0:0.0:0.2556	.	15;15;15;15;15	Q6K0P9-4;Q6K0P9-3;Q6K0P9-2;Q6K0P9;Q6K0P9-5	.;.;.;IFIX_HUMAN;.	G	15	ENSP00000407616:E15G;ENSP00000357122:E15G;ENSP00000357120:E15G;ENSP00000376083:E15G;ENSP00000376082:E15G;ENSP00000357117:E15G	ENSP00000357117:E15G	E	+	2	0	PYHIN1	157173368	0.003000	0.15002	0.000000	0.03702	0.004000	0.04260	2.003000	0.40844	0.262000	0.21774	0.460000	0.39030	GAG	.		0.294	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090110.1	NM_152501	
RB1	5925	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	48941636	48941636	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr13:48941636A>T	ENST00000267163.4	+	10	1084	c.946A>T	c.(946-948)Aat>Tat	p.N316Y		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	316					androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(7)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CAAGGTTGAAAATCTTTCTAA	0.289		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											p.N316Y		.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	.	RB1	3784	22	Whole gene deletion(15)|Unknown(7)	bone(11)|breast(5)|adrenal_gland(1)|eye(1)|soft_tissue(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	c.A946T						.						50.0	59.0	56.0					13																	48941636		2198	4287	6485	SO:0001583	missense	5925	exon10	Familial Cancer Database		GTTGAAAATCTTT	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.946A>T	13.37:g.48941636A>T	ENSP00000267163:p.Asn316Tyr	23.0	0.0		11.0	5.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Missense_Mutation	SNP	ENST00000267163.4	37	CCDS31973.1	.	.	.	.	.	.	.	.	.	.	A	13.57	2.276232	0.40294	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	D	0.92752	-3.1	5.43	5.43	0.79202	.	0.549651	0.21267	N	0.077382	D	0.84897	0.5574	N	0.22421	0.69	0.26717	N	0.970859	P	0.34837	0.472	B	0.31245	0.126	T	0.79257	-0.1878	10	0.48119	T	0.1	.	10.6562	0.45675	0.923:0.0:0.077:0.0	.	316	P06400	RB_HUMAN	Y	295;316	ENSP00000267163:N316Y	ENSP00000267163:N316Y	N	+	1	0	RB1	47839637	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	2.334000	0.43920	2.039000	0.60335	0.482000	0.46254	AAT	.		0.289	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		
RB1	5925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	48951170	48951170	+	Splice_Site	SNP	G	G	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr13:48951170G>A	ENST00000267163.4	+	13	1470	c.1332G>A	c.(1330-1332)caG>caA	p.Q444Q		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	444	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(9)|p.Q444H(2)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TTGGATCACAGGTAACTTGAA	0.328		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											p.Q444Q		.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	RB1,fibrous_tissue_and_uncertain_origin,malignant_fibrous_histiocytoma-pleomorphic_sarcoma,0	RB1	3784	26	Whole gene deletion(15)|Unknown(9)|Substitution - Missense(2)	bone(11)|breast(5)|central_nervous_system(3)|soft_tissue(2)|adrenal_gland(1)|eye(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|lung(1)	c.G1332A	GRCh37	CS004738|CS081960	RB1	S		.						102.0	110.0	107.0					13																	48951170		2203	4299	6502	SO:0001630	splice_region_variant	5925	exon13	Familial Cancer Database		ATCACAGGTAACT	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1332+1G>A	13.37:g.48951170G>A		47.0	0.0		43.0	21.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Silent	SNP	ENST00000267163.4	37	CCDS31973.1																																																																																			.		0.328	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		Silent
ROS1	6098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	117709158	117709158	+	Nonsense_Mutation	SNP	A	A	C			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr6:117709158A>C	ENST00000368508.3	-	13	1997	c.1799T>G	c.(1798-1800)tTa>tGa	p.L600*	ROS1_ENST00000368507.3_Intron|GOPC_ENST00000467125.1_Intron	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	600	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		AGAAGGGCCTAATTCAAAGAG	0.438			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																p.L600X		.		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	ROS1	1353	0			c.T1799G						.						100.0	101.0	101.0					6																	117709158		2203	4300	6503	SO:0001587	stop_gained	6098	exon13			GGGCCTAATTCAA	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.1799T>G	6.37:g.117709158A>C	ENSP00000357494:p.Leu600*	76.0	0.0		77.0	43.0	NM_002944	Q15368|Q5TDB5	Nonsense_Mutation	SNP	ENST00000368508.3	37	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	A	39	7.850165	0.98525	.	.	ENSG00000047936	ENST00000368508	.	.	.	4.56	0.781	0.18561	.	0.214637	0.23896	N	0.043500	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.5213	0.04681	0.4986:0.0:0.2954:0.206	.	.	.	.	X	600	.	ENSP00000357494:L600X	L	-	2	0	ROS1	117815851	0.846000	0.29590	0.978000	0.43139	0.960000	0.62799	0.993000	0.29680	0.224000	0.20940	0.459000	0.35465	TTA	.		0.438	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
RYR1	6261	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	39018424	39018424	+	Splice_Site	SNP	G	G	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr19:39018424G>T	ENST00000359596.3	+	73	10824	c.10824G>T	c.(10822-10824)caG>caT	p.Q3608H	AC067969.1_ENST00000597015.1_RNA|RYR1_ENST00000355481.4_Splice_Site_p.Q3603H|RYR1_ENST00000360985.3_Splice_Site_p.Q3608H			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3608					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	ACCTGGACCAGGTGGGTGGGG	0.642																																					p.Q3608H		.											.	RYR1	100	0			c.G10824T						.						35.0	38.0	37.0					19																	39018424		2202	4300	6502	SO:0001630	splice_region_variant	6261	exon73			GGACCAGGTGGGT	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.10824+1G>T	19.37:g.39018424G>T		113.0	0.0		120.0	29.0	NM_000540	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	12.37	1.916766	0.33815	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985;ENST00000538206	D;D;D	0.97066	-4.22;-4.22;-4.23	4.42	4.42	0.53409	.	0.228705	0.28790	U	0.014134	D	0.97408	0.9152	M	0.68593	2.085	0.58432	D	0.999998	D;D;D	0.59767	0.965;0.986;0.976	P;P;P	0.56216	0.723;0.794;0.628	D	0.97767	1.0224	10	0.59425	D	0.04	.	15.94	0.79747	0.0:0.0:1.0:0.0	.	3608;3603;3608	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	H	3608;3603;3608;528	ENSP00000352608:Q3608H;ENSP00000347667:Q3603H;ENSP00000354254:Q3608H	ENSP00000347667:Q3603H	Q	+	3	2	RYR1	43710264	1.000000	0.71417	1.000000	0.80357	0.425000	0.31504	7.338000	0.79269	2.289000	0.77006	0.313000	0.20887	CAG	.		0.642	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		Missense_Mutation
SHANK2	22941	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	70348970	70348970	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr11:70348970T>A	ENST00000423696.2	-	8	1027	c.991A>T	c.(991-993)Aat>Tat	p.N331Y	SHANK2_ENST00000357171.3_Missense_Mutation_p.N122Y|SHANK2_ENST00000409530.1_Missense_Mutation_p.N121Y|SHANK2_ENST00000338508.4_Missense_Mutation_p.N711Y|SHANK2_ENST00000409161.1_Missense_Mutation_p.N121Y|SHANK2_ENST00000449116.2_Missense_Mutation_p.N122Y|SHANK2_ENST00000449833.2_Missense_Mutation_p.N122Y			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	331	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			ACCAGGTGATTCCCTCCCTGC	0.572																																					p.N122Y		.											.	SHANK2	94	0			c.A364T						.						155.0	125.0	135.0					11																	70348970		2200	4294	6494	SO:0001583	missense	22941	exon3			GGTGATTCCCTCC	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.991A>T	11.37:g.70348970T>A	ENSP00000394536:p.Asn331Tyr	102.0	0.0		148.0	43.0	NM_133266	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	ENST00000423696.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.9|22.9	4.350054|4.350054	0.82132|0.82132	.|.	.|.	ENSG00000162105|ENSG00000162105	ENST00000412252|ENST00000449833;ENST00000409161;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018;ENST00000409530;ENST00000449116;ENST00000357171	.|T;T;T;T;T;T;T;T	.|0.27890	.|1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64	4.46|4.46	4.46|4.46	0.54185|0.54185	.|PDZ/DHR/GLGF (4);	.|0.136203	.|0.64402	.|D	.|0.000004	T|T	0.53158|0.53158	0.1779|0.1779	M|M	0.69185|0.69185	2.1|2.1	0.58432|0.58432	D|D	0.999995|0.999995	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|0.999;1.0;0.999;0.999	T|T	0.58312|0.58312	-0.7658|-0.7658	5|10	.|0.87932	.|D	.|0	.|.	14.0594|14.0594	0.64790|0.64790	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|122;331;710;122	.|B7ZKU9;Q9UPX8;Q9UPX8-3;Q9UPX8-4	.|.;SHAN2_HUMAN;.;.	V|Y	120|122;121;711;331;345;341;121;122;122	.|ENSP00000399423:N122Y;ENSP00000386491:N121Y;ENSP00000345193:N711Y;ENSP00000394536:N331Y;ENSP00000294018:N341Y;ENSP00000387324:N121Y;ENSP00000394939:N122Y;ENSP00000349694:N122Y	.|ENSP00000294018:N341Y	E|N	-|-	2|1	0|0	SHANK2|SHANK2	70026618|70026618	1.000000|1.000000	0.71417|0.71417	0.947000|0.947000	0.38551|0.38551	0.940000|0.940000	0.58332|0.58332	5.716000|5.716000	0.68437|0.68437	1.789000|1.789000	0.52484|0.52484	0.379000|0.379000	0.24179|0.24179	GAA|AAT	.		0.572	SHANK2-203	KNOWN	basic	protein_coding	protein_coding		NM_012309	
SLC20A1	6574	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	113416962	113416962	+	Silent	SNP	A	A	G			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr2:113416962A>G	ENST00000272542.3	+	8	1769	c.1230A>G	c.(1228-1230)aaA>aaG	p.K410K		NM_005415.4	NP_005406.3	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate transporter), member 1	410					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	high-affinity inorganic phosphate:sodium symporter activity (GO:0005316)|inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|sodium:phosphate symporter activity (GO:0005436)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|skin(1)|urinary_tract(3)	28						CCGGTGACAAACCCTTAAGGC	0.473																																					p.K410K		.											.	SLC20A1	92	0			c.A1230G						.						122.0	115.0	117.0					2																	113416962		2203	4300	6503	SO:0001819	synonymous_variant	6574	exon8			TGACAAACCCTTA		CCDS2099.1	2q13	2013-05-22			ENSG00000144136	ENSG00000144136		"""Solute carriers"""	10946	protein-coding gene	gene with protein product	"""gibbon ape leukemia virus receptor 1"""	137570		GLVR1		8041748	Standard	NM_005415		Approved	PiT-1, Glvr-1	uc002tib.3	Q8WUM9	OTTHUMG00000131317	ENST00000272542.3:c.1230A>G	2.37:g.113416962A>G		250.0	1.0		276.0	87.0	NM_005415	Q08344|Q6DHX8|Q9UQ82	Silent	SNP	ENST00000272542.3	37	CCDS2099.1	.	.	.	.	.	.	.	.	.	.	A	8.059	0.767784	0.15983	.	.	ENSG00000144136	ENST00000433924	.	.	.	5.33	1.81	0.25067	.	.	.	.	.	T	0.55768	0.1941	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47787	-0.9090	4	.	.	.	-21.8168	7.996	0.30269	0.4463:0.0:0.5537:0.0	.	.	.	.	A	194	.	.	T	+	1	0	SLC20A1	113133433	0.999000	0.42202	1.000000	0.80357	0.994000	0.84299	0.587000	0.23909	0.418000	0.25898	0.533000	0.62120	ACC	.		0.473	SLC20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254086.2	NM_005415	
SLC45A4	57210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	142231676	142231676	+	Splice_Site	SNP	C	C	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr8:142231676C>T	ENST00000024061.3	-	2	584	c.277G>A	c.(277-279)Ggt>Agt	p.G93S	SLC45A4_ENST00000519067.1_Splice_Site_p.G93S|SLC45A4_ENST00000433583.2_Splice_Site_p.G86S|SLC45A4_ENST00000517878.1_Splice_Site_p.G144S	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			AGAAACTTACCGATGGCAGAG	0.592																																					p.G93S		.											.	SLC45A4	70	0			c.G277A						.						55.0	62.0	60.0					8																	142231676		2203	4300	6503	SO:0001630	splice_region_variant	57210	exon2			ACTTACCGATGGC	AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.277+1G>A	8.37:g.142231676C>T		113.0	0.0		231.0	46.0	NM_001080431	Q6ZRI2|Q9ULU3	Missense_Mutation	SNP	ENST00000024061.3	37	CCDS34948.1	.	.	.	.	.	.	.	.	.	.	C	19.41	3.823106	0.71143	.	.	ENSG00000022567	ENST00000519067;ENST00000517878;ENST00000433583;ENST00000024061;ENST00000519986	D;D;D;D;D	0.96913	-4.17;-4.17;-4.17;-4.17;-4.17	5.46	4.59	0.56863	.	0.000000	0.85682	D	0.000000	D	0.95893	0.8663	M	0.67953	2.075	0.80722	D	1	D;D;P	0.58620	0.975;0.983;0.566	P;P;B	0.48368	0.518;0.575;0.127	D	0.94898	0.8054	9	.	.	.	-17.6448	14.4562	0.67418	0.0:0.9286:0.0:0.0714	.	144;93;93	E7EV90;Q5BKX6-3;Q5BKX6-2	.;.;.	S	93;144;86;93;75	ENSP00000429059:G93S;ENSP00000428137:G144S;ENSP00000400799:G86S;ENSP00000024061:G93S;ENSP00000429974:G75S	.	G	-	1	0	SLC45A4	142300858	1.000000	0.71417	0.998000	0.56505	0.807000	0.45602	5.877000	0.69675	1.308000	0.44962	-0.448000	0.05591	GGT	.		0.592	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378571.3	XM_050325	Missense_Mutation
SNW1	22938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	78202323	78202323	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr14:78202323G>C	ENST00000261531.7	-	7	727	c.665C>G	c.(664-666)cCa>cGa	p.P222R	SNW1_ENST00000555761.1_Missense_Mutation_p.P222R|SLIRP_ENST00000557431.1_Intron|SNW1_ENST00000554775.1_Missense_Mutation_p.P60R	NM_012245.2	NP_036377.1	Q13573	SNW1_HUMAN	SNW domain containing 1	222	Pro-rich.|SNW.				cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin D receptor signaling pathway (GO:0070562)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|chromatin (GO:0000785)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	Notch binding (GO:0005112)|nuclear hormone receptor binding (GO:0035257)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)|SMAD binding (GO:0046332)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|vitamin D receptor binding (GO:0042809)			NS(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		AGGAGAAGGTGGTCCCCGGGG	0.388																																					p.P222R		.											.	SNW1	187	0			c.C665G						.						55.0	66.0	62.0					14																	78202323		2203	4300	6503	SO:0001583	missense	22938	exon7			GAAGGTGGTCCCC	AF045184	CCDS9867.1	14q22.1-q22.3	2005-09-13	2005-09-13	2005-09-13		ENSG00000100603			16696	protein-coding gene	gene with protein product		603055	"""SKI interacting protein"""	SKIIP		8973337, 9632709	Standard	NM_012245		Approved	NCoA-62, SKIP, Prp45, PRPF45, Bx42	uc001xuf.3	Q13573		ENST00000261531.7:c.665C>G	14.37:g.78202323G>C	ENSP00000261531:p.Pro222Arg	35.0	0.0		30.0	9.0	NM_012245	A8K8A9|Q13483|Q32N03|Q5D0D6	Missense_Mutation	SNP	ENST00000261531.7	37	CCDS9867.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.945465	0.92593	.	.	ENSG00000100603	ENST00000261531;ENST00000554775;ENST00000555761;ENST00000416259	.	.	.	5.65	5.65	0.86999	SKI-interacting protein SKIP, SNW domain (1);	0.000000	0.85682	D	0.000000	D	0.87382	0.6163	M	0.93550	3.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.89682	0.3891	9	0.87932	D	0	.	20.1398	0.98056	0.0:0.0:1.0:0.0	.	222;222	G3V3A4;Q13573	.;SNW1_HUMAN	R	222;60;222;222	.	ENSP00000261531:P222R	P	-	2	0	SNW1	77272076	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.770000	0.98971	2.843000	0.97960	0.585000	0.79938	CCA	.		0.388	SNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413912.1	NM_012245	
SPEN	23013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	16261862	16261862	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr1:16261862A>G	ENST00000375759.3	+	11	9331	c.9127A>G	c.(9127-9129)Agc>Ggc	p.S3043G		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	3043					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		AAGCCACCCCAGCAGTACTGC	0.587																																					p.S3043G		.											.	SPEN	298	0			c.A9127G						.						125.0	111.0	116.0					1																	16261862		2203	4300	6503	SO:0001583	missense	23013	exon11			CACCCCAGCAGTA		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.9127A>G	1.37:g.16261862A>G	ENSP00000364912:p.Ser3043Gly	690.0	0.0		785.0	160.0	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	A	6.109	0.388362	0.11581	.	.	ENSG00000065526	ENST00000375759	T	0.10573	2.86	5.54	5.54	0.83059	.	.	.	.	.	T	0.10294	0.0252	L	0.38838	1.175	0.30659	N	0.754629	B	0.31599	0.33	B	0.34779	0.189	T	0.09292	-1.0681	9	0.33940	T	0.23	-8.8625	8.3787	0.32457	0.8834:0.0:0.1166:0.0	.	3043	Q96T58	MINT_HUMAN	G	3043	ENSP00000364912:S3043G	ENSP00000364912:S3043G	S	+	1	0	SPEN	16134449	1.000000	0.71417	1.000000	0.80357	0.229000	0.25112	5.693000	0.68264	2.113000	0.64589	0.454000	0.30748	AGC	.		0.587	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
STMN3	50861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	62275626	62275626	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr20:62275626G>A	ENST00000370053.1	-	2	137	c.56C>T	c.(55-57)tCg>tTg	p.S19L	STMN3_ENST00000540534.1_Missense_Mutation_p.S8L	NM_001276310.1|NM_015894.2	NP_001263239.1|NP_056978.2	Q9NZ72	STMN3_HUMAN	stathmin-like 3	19					cytoplasmic microtubule organization (GO:0031122)|negative regulation of Rac protein signal transduction (GO:0035021)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|regulation of cytoskeleton organization (GO:0051493)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of Rac GTPase activity (GO:0032314)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	protein domain specific binding (GO:0019904)			kidney(1)|large_intestine(1)|lung(5)|prostate(1)	8	all_cancers(38;2.31e-11)|all_epithelial(29;7.76e-13)		Epithelial(9;1.9e-09)|all cancers(9;1.22e-08)|BRCA - Breast invasive adenocarcinoma(10;8.86e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.00559)			GCAGATGAGCGACAGCACCGA	0.642																																					p.S19L		.											.	STMN3	90	0			c.C56T						.						186.0	143.0	157.0					20																	62275626		2203	4300	6503	SO:0001583	missense	50861	exon2			ATGAGCGACAGCA	AF069709	CCDS13529.1, CCDS63330.1	20q13.3	2007-01-22			ENSG00000197457	ENSG00000197457			15926	protein-coding gene	gene with protein product		608362				9603203, 10655513	Standard	NM_001276310		Approved	SCLIP	uc002yfr.2	Q9NZ72	OTTHUMG00000032985	ENST00000370053.1:c.56C>T	20.37:g.62275626G>A	ENSP00000359070:p.Ser19Leu	85.0	0.0		126.0	41.0	NM_015894	B3KSQ5|B7WP52|B7Z5G4|O75527|Q969Y4	Missense_Mutation	SNP	ENST00000370053.1	37	CCDS13529.1	.	.	.	.	.	.	.	.	.	.	G	19.37	3.813781	0.70912	.	.	ENSG00000197457	ENST00000370053;ENST00000540534	.	.	.	4.2	4.2	0.49525	.	0.229124	0.28036	U	0.016847	T	0.52224	0.1721	M	0.78456	2.415	0.43292	D	0.995278	P	0.43352	0.804	B	0.29942	0.109	T	0.64245	-0.6453	9	0.87932	D	0	-7.9244	11.7791	0.52003	0.0:0.0:0.8241:0.1759	.	19	Q9NZ72	STMN3_HUMAN	L	19;8	.	ENSP00000359070:S19L	S	-	2	0	STMN3	61746070	1.000000	0.71417	0.835000	0.33067	0.705000	0.40729	9.664000	0.98607	1.904000	0.55121	0.313000	0.20887	TCG	.		0.642	STMN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080163.1	NM_015894	
SUOX	6821	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56398608	56398608	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr12:56398608G>A	ENST00000394109.3	+	3	2159	c.1435G>A	c.(1435-1437)Gaa>Aaa	p.E479K	SUOX_ENST00000356124.4_Missense_Mutation_p.E479K|SUOX_ENST00000266971.3_Missense_Mutation_p.E479K|SUOX_ENST00000548274.1_Missense_Mutation_p.E479K|SUOX_ENST00000394115.2_Missense_Mutation_p.E479K|IKZF4_ENST00000262032.5_5'Flank			P51687	SUOX_HUMAN	sulfite oxidase	479	Homodimerization. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|sulfite oxidase activity (GO:0008482)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)	15			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.119)			GGATGGAGAGGAACAGCGCCC	0.587																																					p.E479K		.											.	SUOX	90	0			c.G1435A						.						191.0	170.0	177.0					12																	56398608		2203	4300	6503	SO:0001583	missense	6821	exon6			GGAGAGGAACAGC	BC065193	CCDS8901.2	12q13.13	2011-02-10			ENSG00000139531	ENSG00000139531	1.8.3.1		11460	protein-coding gene	gene with protein product		606887				7599189	Standard	XM_005269112		Approved		uc001siz.3	P51687	OTTHUMG00000128503	ENST00000394109.3:c.1435G>A	12.37:g.56398608G>A	ENSP00000377668:p.Glu479Lys	169.0	0.0		210.0	22.0	NM_000456		Missense_Mutation	SNP	ENST00000394109.3	37	CCDS8901.2	.	.	.	.	.	.	.	.	.	.	G	6.200	0.405137	0.11754	.	.	ENSG00000139531	ENST00000356124;ENST00000266971;ENST00000394115;ENST00000548274;ENST00000394109	D;D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83;-1.83	4.76	2.94	0.34122	Immunoglobulin E-set (1);Moybdenum cofactor oxidoreductase, dimerisation (2);	0.279645	0.32533	N	0.005965	T	0.72993	0.3530	N	0.25789	0.76	0.39350	D	0.965732	B	0.14012	0.009	B	0.14023	0.01	T	0.65026	-0.6268	10	0.38643	T	0.18	-24.5556	6.6168	0.22780	0.2885:0.0:0.7115:0.0	.	479	P51687	SUOX_HUMAN	K	479	ENSP00000348440:E479K;ENSP00000266971:E479K;ENSP00000377674:E479K;ENSP00000450245:E479K;ENSP00000377668:E479K	ENSP00000266971:E479K	E	+	1	0	SUOX	54684875	1.000000	0.71417	0.994000	0.49952	0.645000	0.38454	1.954000	0.40362	0.745000	0.32763	0.467000	0.42956	GAA	.		0.587	SUOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250309.1	NM_000456	
SYT5	6861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55687105	55687105	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr19:55687105G>C	ENST00000354308.3	-	5	881	c.512C>G	c.(511-513)cCt>cGt	p.P171R	SYT5_ENST00000537500.1_Missense_Mutation_p.P171R|CTD-2587H24.5_ENST00000591665.1_RNA|SYT5_ENST00000590851.1_Missense_Mutation_p.P168R|SYT5_ENST00000592935.1_5'Flank	NM_003180.2	NP_003171.2	O00445	SYT5_HUMAN	synaptotagmin V	171	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|dense core granule (GO:0031045)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CCCAAAGTGAGGGTTCAGCGT	0.617																																					p.P171R		.											.	SYT5	90	0			c.C512G						.						129.0	119.0	122.0					19																	55687105		2203	4300	6503	SO:0001583	missense	6861	exon5			AAGTGAGGGTTCA	X96783	CCDS12919.1, CCDS74455.1	19q13.42	2014-07-02			ENSG00000129990	ENSG00000129990		"""Synaptotagmins"""	11513	protein-coding gene	gene with protein product	"""synaptotagmin 5"""	600782				9177789	Standard	XM_006723338		Approved		uc002qjn.1	O00445	OTTHUMG00000180669	ENST00000354308.3:c.512C>G	19.37:g.55687105G>C	ENSP00000346265:p.Pro171Arg	273.0	0.0		351.0	67.0	NM_003180	B3KWJ8|B7Z300|Q86X72	Missense_Mutation	SNP	ENST00000354308.3	37	CCDS12919.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.534800	0.85812	.	.	ENSG00000129990	ENST00000537500;ENST00000354308;ENST00000543844	D;D	0.91407	-2.84;-2.84	4.54	4.54	0.55810	C2 membrane targeting protein (1);C2 region (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.97813	0.9282	H	0.99825	4.815	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99509	1.0955	10	0.87932	D	0	.	16.9441	0.86226	0.0:0.0:1.0:0.0	.	168;171;171	B7Z300;Q4FD32;O00445	.;.;SYT5_HUMAN	R	171;171;168	ENSP00000442896:P171R;ENSP00000346265:P171R	ENSP00000346265:P171R	P	-	2	0	SYT5	60378917	1.000000	0.71417	0.989000	0.46669	0.853000	0.48598	7.775000	0.85489	2.480000	0.83734	0.555000	0.69702	CCT	.		0.617	SYT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452501.1	NM_003180	
TACR3	6870	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	104640550	104640550	+	Missense_Mutation	SNP	C	C	A	rs139574028	byFrequency	TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr4:104640550C>A	ENST00000304883.2	-	1	423	c.283G>T	c.(283-285)Gtg>Ttg	p.V95L		NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	95					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		ACTGCCACCACCACACCATAC	0.612																																					p.V95L		.											.	TACR3	525	0			c.G283T						.	C	LEU/VAL	0,4406		0,0,2203	99.0	92.0	95.0		283	4.7	0.9	4	dbSNP_134	95	5,8595	4.3+/-15.6	0,5,4295	no	missense	TACR3	NM_001059.2	32	0,5,6498	AA,AC,CC		0.0581,0.0,0.0384	possibly-damaging	95/466	104640550	5,13001	2203	4300	6503	SO:0001583	missense	6870	exon1			CCACCACCACACC	M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.283G>T	4.37:g.104640550C>A	ENSP00000303325:p.Val95Leu	189.0	0.0		174.0	11.0	NM_001059	Q0P510	Missense_Mutation	SNP	ENST00000304883.2	37	CCDS3664.1	.	.	.	.	.	.	.	.	.	.	C	11.98	1.801281	0.31869	0.0	5.81E-4	ENSG00000169836	ENST00000304883	T	0.21734	1.99	4.74	4.74	0.60224	.	0.072404	0.56097	D	0.000029	T	0.12817	0.0311	N	0.20845	0.615	0.46317	D	0.998982	B	0.20550	0.046	B	0.14023	0.01	T	0.11084	-1.0602	10	0.25751	T	0.34	.	10.384	0.44129	0.0:0.91:0.0:0.09	.	95	P29371	NK3R_HUMAN	L	95	ENSP00000303325:V95L	ENSP00000303325:V95L	V	-	1	0	TACR3	104859999	0.976000	0.34144	0.903000	0.35520	0.977000	0.68977	2.357000	0.44125	2.149000	0.67028	0.467000	0.42956	GTG	C|0.999;A|0.001		0.612	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	NM_001059	
TCAIM	285343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	44442771	44442771	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr3:44442771T>A	ENST00000342649.4	+	10	1622	c.1195T>A	c.(1195-1197)Tgg>Agg	p.W399R	TCAIM_ENST00000417237.1_Missense_Mutation_p.W399R	NM_001282913.1|NM_173826.3	NP_001269842.1|NP_776187.2	Q8N3R3	TCAIM_HUMAN	T cell activation inhibitor, mitochondrial	399						mitochondrion (GO:0005739)											AAATCTCCAGTGGTTTATTCT	0.398																																					p.W399R		.											.	.	.	0			c.T1195A						.						128.0	120.0	122.0					3																	44442771		2203	4300	6503	SO:0001583	missense	285343	exon10			CTCCAGTGGTTTA		CCDS2712.1, CCDS43076.1	3p21.33-p21.32	2012-08-22	2012-08-22	2012-08-22	ENSG00000179152	ENSG00000179152			25241	protein-coding gene	gene with protein product	"""tolerance associated gene-1"""		"""chromosome 3 open reading frame 23"""	C3orf23		12477932	Standard	NM_001029840		Approved	DKFZp313N0621, TOAG-1	uc003cnd.4	Q8N3R3	OTTHUMG00000133049	ENST00000342649.4:c.1195T>A	3.37:g.44442771T>A	ENSP00000341539:p.Trp399Arg	49.0	0.0		83.0	29.0	NM_173826	A8K9P1|Q0P5T9|Q495R1|Q495R3|Q4G0M4|Q6GMU8	Missense_Mutation	SNP	ENST00000342649.4	37	CCDS2712.1	.	.	.	.	.	.	.	.	.	.	T	14.95	2.686955	0.48097	.	.	ENSG00000179152	ENST00000417237;ENST00000342649	T;T	0.40476	1.03;1.03	5.6	5.6	0.85130	.	0.201692	0.46145	D	0.000315	T	0.41119	0.1145	L	0.51422	1.61	0.33990	D	0.649012	P	0.42203	0.773	B	0.40009	0.316	T	0.57423	-0.7814	10	0.40728	T	0.16	.	15.7878	0.78322	0.0:0.0:0.0:1.0	.	399	Q8N3R3	CC023_HUMAN	R	399	ENSP00000402581:W399R;ENSP00000341539:W399R	ENSP00000341539:W399R	W	+	1	0	C3orf23	44417775	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	3.058000	0.49939	2.135000	0.66039	0.454000	0.30748	TGG	.		0.398	TCAIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256655.2	NM_173826	
THOP1	7064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	2794767	2794767	+	Silent	SNP	A	A	C			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr19:2794767A>C	ENST00000307741.6	+	3	438	c.235A>C	c.(235-237)Agg>Cgg	p.R79R	THOP1_ENST00000586677.1_5'Flank	NM_003249.3	NP_003240.1	P52888	THOP1_HUMAN	thimet oligopeptidase 1	79					intracellular signal transduction (GO:0035556)|peptide metabolic process (GO:0006518)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)			NS(1)|central_nervous_system(1)|endometrium(1)|lung(8)|ovary(2)|skin(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTTAGTTCAGAGGAATATCCT	0.577																																					p.R79R		.											.	THOP1	92	0			c.A235C						.						160.0	170.0	167.0					19																	2794767		2203	4300	6503	SO:0001819	synonymous_variant	7064	exon3			GTTCAGAGGAATA		CCDS12095.1	19p13.3	2008-02-05				ENSG00000172009	3.4.24.15		11793	protein-coding gene	gene with protein product		601117				9790774	Standard	NM_003249		Approved		uc002lwj.3	P52888		ENST00000307741.6:c.235A>C	19.37:g.2794767A>C		88.0	0.0		77.0	12.0	NM_003249	B3KSE2|Q9UCB3	Silent	SNP	ENST00000307741.6	37	CCDS12095.1																																																																																			.		0.577	THOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451587.2		
TMC2	117532	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	2591138	2591138	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr20:2591138A>T	ENST00000358864.1	+	12	1502	c.1487A>T	c.(1486-1488)tAc>tTc	p.Y496F	TMC2_ENST00000496948.1_3'UTR	NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	496					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						CTGGAGAATTACCACCCACGC	0.527																																					p.Y496F		.											.	TMC2	93	0			c.A1487T						.						258.0	214.0	229.0					20																	2591138		2203	4300	6503	SO:0001583	missense	117532	exon12			AGAATTACCACCC	AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.1487A>T	20.37:g.2591138A>T	ENSP00000351732:p.Tyr496Phe	224.0	0.0		259.0	34.0	NM_080751	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Missense_Mutation	SNP	ENST00000358864.1	37	CCDS13029.2	.	.	.	.	.	.	.	.	.	.	A	26.6	4.752008	0.89753	.	.	ENSG00000149488	ENST00000358864	D	0.87412	-2.25	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.93226	0.7842	M	0.83774	2.66	0.80722	D	1	D;D;D;D	0.89917	0.993;0.998;0.999;1.0	D;D;D;D	0.79784	0.926;0.993;0.977;0.968	D	0.93994	0.7269	10	0.72032	D	0.01	-14.4871	13.0887	0.59156	1.0:0.0:0.0:0.0	.	327;328;496;496	B4DFB3;B7ZAE6;Q8TDI7-3;Q8TDI7	.;.;.;TMC2_HUMAN	F	496	ENSP00000351732:Y496F	ENSP00000351732:Y496F	Y	+	2	0	TMC2	2539138	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.265000	0.95647	2.033000	0.60031	0.528000	0.53228	TAC	.		0.527	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077601.2		
TMEM232	642987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	109976647	109976647	+	Silent	SNP	A	A	T			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr5:109976647A>T	ENST00000455884.2	-	4	338	c.288T>A	c.(286-288)ccT>ccA	p.P96P	TMEM232_ENST00000515518.2_5'UTR|TMEM232_ENST00000429839.2_Silent_p.P96P			C9JQI7	TM232_HUMAN	transmembrane protein 232	96						integral component of membrane (GO:0016021)				breast(1)|kidney(2)	3						TCCATGCAGCAGGAAGATGCA	0.368																																					p.P96P		.											.	.	.	0			c.T288A						.						91.0	80.0	84.0					5																	109976647		692	1591	2283	SO:0001819	synonymous_variant	642987	exon4			TGCAGCAGGAAGA	AK125070	CCDS47253.1, CCDS47253.2	5q22.1	2014-02-12	2009-10-02		ENSG00000186952	ENSG00000186952			37270	protein-coding gene	gene with protein product							Standard	NM_001039763		Approved	FLJ43080	uc011cvh.2	C9JQI7	OTTHUMG00000163297	ENST00000455884.2:c.288T>A	5.37:g.109976647A>T		279.0	0.0		383.0	113.0	NM_001039763	B4DKF4	Silent	SNP	ENST00000455884.2	37	CCDS47253.2																																																																																			.		0.368	TMEM232-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372488.2	NM_001039763	
TMPRSS3	64699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	43808542	43808542	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr21:43808542T>C	ENST00000291532.3	-	5	1371	c.416A>G	c.(415-417)aAt>aGt	p.N139S	TMPRSS3_ENST00000474596.1_5'UTR|TMPRSS3_ENST00000380399.1_Missense_Mutation_p.N223S|TMPRSS3_ENST00000398397.3_Missense_Mutation_p.N139S|TMPRSS3_ENST00000433957.2_Missense_Mutation_p.N139S|TMPRSS3_ENST00000398405.1_Missense_Mutation_p.N137S	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3	139	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						ACAGGCAACATTTGCGTAGTG	0.517																																					p.N139S		.											.	TMPRSS3	155	0			c.A416G						.						152.0	135.0	141.0					21																	43808542		2203	4300	6503	SO:0001583	missense	64699	exon5			GCAACATTTGCGT	AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.416A>G	21.37:g.43808542T>C	ENSP00000291532:p.Asn139Ser	172.0	0.0		288.0	94.0	NM_001256317	D3DSJ6|Q5USC7|Q6ZMC3	Missense_Mutation	SNP	ENST00000291532.3	37	CCDS13686.1	.	.	.	.	.	.	.	.	.	.	T	5.536	0.283860	0.10458	.	.	ENSG00000160183	ENST00000291532;ENST00000433957;ENST00000398405;ENST00000380399;ENST00000398397	T;T;T;T;T	0.60171	0.21;0.21;0.21;0.21;0.21	4.94	-4.17	0.03857	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	1.597180	0.03547	N	0.224911	T	0.49830	0.1580	M	0.70595	2.14	0.09310	N	1	B;B;B	0.14012	0.009;0.0;0.0	B;B;B	0.11329	0.006;0.001;0.003	T	0.25537	-1.0129	9	.	.	.	.	1.7632	0.02996	0.1097:0.2292:0.2109:0.4502	.	139;139;139	P57727-3;P57727-5;P57727	.;.;TMPS3_HUMAN	S	139;139;137;223;139	ENSP00000291532:N139S;ENSP00000411013:N139S;ENSP00000381442:N137S;ENSP00000369762:N223S;ENSP00000381434:N139S	.	N	-	2	0	TMPRSS3	42681611	0.000000	0.05858	0.000000	0.03702	0.836000	0.47400	0.097000	0.15168	-0.391000	0.07763	0.402000	0.26972	AAT	.		0.517	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195347.1		
TREX1	11277	ucsc.edu;bcgsc.ca;mdanderson.org	37	3	48508185	48508185	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr3:48508185T>C	ENST00000422277.2	+	1	957	c.296T>C	c.(295-297)cTg>cCg	p.L99P	TREX1_ENST00000456089.1_Intron|TREX1_ENST00000296443.9_Missense_Mutation_p.L44P|SHISA5_ENST00000465449.1_5'Flank|TREX1_ENST00000433541.1_5'UTR|TREX1_ENST00000444177.1_Missense_Mutation_p.L34P|TREX1_ENST00000436480.2_Missense_Mutation_p.L44P|TREX1_ENST00000492235.1_3'UTR	NM_016381.4	NP_057465.1	Q9NSU2	TREX1_HUMAN	three prime repair exonuclease 1	99					cell death (GO:0008219)|cellular response to interferon-beta (GO:0035458)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|innate immune response (GO:0045087)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	endoplasmic reticulum membrane (GO:0005789)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|3'-5'-exodeoxyribonuclease activity (GO:0008296)|adenyl deoxyribonucleotide binding (GO:0032558)|double-stranded DNA binding (GO:0003690)|exodeoxyribonuclease III activity (GO:0008853)|metal ion binding (GO:0046872)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein homodimerization activity (GO:0042803)|single-stranded DNA binding (GO:0003697)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|skin(3)	9				BRCA - Breast invasive adenocarcinoma(193;0.000286)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		AGATGTGCCCTGGAGAGCCCC	0.637																																					p.L99P		.											.	TREX1	227	0			c.T296C						.						80.0	86.0	84.0					3																	48508185		2203	4300	6503	SO:0001583	missense	11277	exon1			GTGCCCTGGAGAG	AF151105	CCDS2769.1, CCDS59451.1	3p21.31	2014-09-17			ENSG00000213689	ENSG00000213689			12269	protein-coding gene	gene with protein product		606609	"""Aicardi-Goutieres syndrome 1"""	AGS1		10391904, 10393201, 16845398	Standard	NM_033629		Approved	DRN3	uc010hka.4	Q9NSU2	OTTHUMG00000156205	ENST00000422277.2:c.296T>C	3.37:g.48508185T>C	ENSP00000390478:p.Leu99Pro	172.0	2.0		210.0	69.0	NM_016381	B2RCN9|Q8TEU2|Q9BPW1|Q9Y4X2	Missense_Mutation	SNP	ENST00000422277.2	37	CCDS43086.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.112667	0.77210	.	.	ENSG00000213689	ENST00000296443;ENST00000436480;ENST00000422277;ENST00000444177	D;D;D;D	0.95821	-3.82;-3.82;-3.82;-3.82	4.99	4.99	0.66335	Ribonuclease H-like (1);	0.000000	0.37857	U	0.001919	D	0.96030	0.8707	L	0.41356	1.27	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96158	0.9113	10	0.59425	D	0.04	.	12.6519	0.56766	0.0:0.0:0.0:1.0	.	99	Q9NSU2	TREX1_HUMAN	P	44;44;99;34	ENSP00000296443:L44P;ENSP00000392569:L44P;ENSP00000390478:L99P;ENSP00000415972:L34P	ENSP00000296443:L44P	L	+	2	0	TREX1	48483189	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.168000	0.64978	1.866000	0.54105	0.533000	0.62120	CTG	.		0.637	TREX1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_016381	
TTC3	7267	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	38538717	38538717	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr21:38538717G>A	ENST00000399017.2	+	33	6948	c.4201G>A	c.(4201-4203)Gcc>Acc	p.A1401T	TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000355666.1_Missense_Mutation_p.A1401T|TTC3_ENST00000354749.2_Missense_Mutation_p.A1401T	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1401					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				TCACCAGATTGCCTCTGAAAC	0.453																																					p.A1401T	Ovarian(38;194 1649 35661)	.											.	TTC3	590	0			c.G4201A						.						124.0	115.0	118.0					21																	38538717		2203	4300	6503	SO:0001583	missense	7267	exon33			CAGATTGCCTCTG	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.4201G>A	21.37:g.38538717G>A	ENSP00000381981:p.Ala1401Thr	148.0	0.0		210.0	61.0	NM_001001894	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	ENST00000399017.2	37	CCDS13651.1	.	.	.	.	.	.	.	.	.	.	G	12.52	1.963456	0.34659	.	.	ENSG00000182670	ENST00000355666;ENST00000399017;ENST00000354749	T;T;T	0.08720	3.06;3.06;3.06	4.65	1.63	0.23807	.	0.921456	0.09160	N	0.840330	T	0.08802	0.0218	L	0.44542	1.39	0.09310	N	1	P;P	0.49559	0.925;0.914	B;B	0.44044	0.439;0.355	T	0.31475	-0.9942	9	.	.	.	-0.0035	5.1944	0.15227	0.2043:0.1747:0.621:0.0	.	459;1401	Q5GIT6;P53804	.;TTC3_HUMAN	T	1401	ENSP00000347889:A1401T;ENSP00000381981:A1401T;ENSP00000346791:A1401T	.	A	+	1	0	TTC3	37460587	0.000000	0.05858	0.001000	0.08648	0.109000	0.19521	-0.036000	0.12185	0.456000	0.26937	0.655000	0.94253	GCC	.		0.453	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1		
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179424403	179424403	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr2:179424403T>C	ENST00000591111.1	-	276	81757	c.81533A>G	c.(81532-81534)gAc>gGc	p.D27178G	TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.D19946G|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D19879G|TTN_ENST00000460472.2_Missense_Mutation_p.D19754G|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.D28819G|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D26251G|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000586831.1_RNA			Q8WZ42	TITIN_HUMAN	titin	27178	Ig-like 129.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTTCCAGAGTCATTTCTGTT	0.423																																					p.D28819G		.											.	TTN	636	0			c.A86456G						.						172.0	161.0	165.0					2																	179424403		1984	4173	6157	SO:0001583	missense	7273	exon326			CCAGAGTCATTTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.81533A>G	2.37:g.179424403T>C	ENSP00000465570:p.Asp27178Gly	164.0	0.0		134.0	22.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	14.50	2.552581	0.45487	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53	5.77	5.77	0.91146	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.93556	0.7943	H	0.97635	4.045	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.95666	0.8719	9	0.87932	D	0	.	16.383	0.83481	0.0:0.0:0.0:1.0	.	19754;19879;19946;27178	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	G	26251;19754;19946;19879;19751	ENSP00000343764:D26251G;ENSP00000434586:D19754G;ENSP00000340554:D19946G;ENSP00000352154:D19879G	ENSP00000340554:D19946G	D	-	2	0	TTN	179132649	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	8.040000	0.89188	2.326000	0.78906	0.533000	0.62120	GAC	.		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UBR5	51366	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	103324043	103324043	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr8:103324043G>C	ENST00000520539.1	-	19	2944	c.2338C>G	c.(2338-2340)Cag>Gag	p.Q780E	UBR5_ENST00000220959.4_Missense_Mutation_p.Q780E|UBR5_ENST00000521922.1_Missense_Mutation_p.Q774E	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	780				Q -> R (in Ref. 2; AAF88143). {ECO:0000305}.	cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			TTATTTTCCTGTTCTGCTTTT	0.403																																					p.Q780E	Ovarian(131;96 1741 5634 7352 27489)	.											.	UBR5	761	0			c.C2338G						.						99.0	96.0	97.0					8																	103324043		2203	4300	6503	SO:0001583	missense	51366	exon19			TTTCCTGTTCTGC	AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.2338C>G	8.37:g.103324043G>C	ENSP00000429084:p.Gln780Glu	195.0	0.0		386.0	58.0	NM_015902	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	ENST00000520539.1	37	CCDS34933.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.156767	0.78114	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922	T;T;T	0.49432	0.78;0.78;0.78	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.57829	0.2080	L	0.54323	1.7	0.80722	D	1	P;P	0.40332	0.713;0.713	P;P	0.48654	0.585;0.585	T	0.60105	-0.7328	10	0.72032	D	0.01	.	19.2083	0.93744	0.0:0.0:1.0:0.0	.	774;780	E7EMW7;O95071	.;UBR5_HUMAN	E	780;780;774	ENSP00000429084:Q780E;ENSP00000220959:Q780E;ENSP00000427819:Q774E	ENSP00000220959:Q780E	Q	-	1	0	UBR5	103393219	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.563000	0.86464	0.655000	0.94253	CAG	.		0.403	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902	
UEVLD	55293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	18579874	18579874	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr11:18579874T>G	ENST00000541984.1	-	5	378	c.316A>C	c.(316-318)Att>Ctt	p.I106L	UEVLD_ENST00000535484.1_Missense_Mutation_p.I168L|UEVLD_ENST00000320750.6_Missense_Mutation_p.I184L|UEVLD_ENST00000379387.4_Missense_Mutation_p.I184L|UEVLD_ENST00000396197.3_Missense_Mutation_p.I206L|UEVLD_ENST00000543987.1_Missense_Mutation_p.I206L|UEVLD_ENST00000540666.1_5'UTR	NM_001261386.1	NP_001248315.1			UEV and lactate/malate dehyrogenase domains											endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8						CTGTCTGCAATACCCTGTACA	0.428																																					p.I206L		.											.	UEVLD	226	0			c.A616C						.						95.0	77.0	83.0					11																	18579874		2199	4293	6492	SO:0001583	missense	55293	exon7			CTGCAATACCCTG	AF503350	CCDS7843.1, CCDS41624.1, CCDS58122.1, CCDS58123.1, CCDS58124.1, CCDS58125.1, CCDS73266.1	11p15.1	2006-07-14			ENSG00000151116	ENSG00000151116			30866	protein-coding gene	gene with protein product		610985				12427560	Standard	NM_001040697		Approved	Attp, UEV3	uc001mot.4	Q8IX04	OTTHUMG00000167729	ENST00000541984.1:c.316A>C	11.37:g.18579874T>G	ENSP00000437538:p.Ile106Leu	62.0	0.0		69.0	8.0	NM_018314		Missense_Mutation	SNP	ENST00000541984.1	37	CCDS58125.1	.	.	.	.	.	.	.	.	.	.	T	0.111	-1.138511	0.01742	.	.	ENSG00000151116	ENST00000543987;ENST00000535484;ENST00000396197;ENST00000320750;ENST00000379387;ENST00000541984	D;D;D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2;-2.2;-2.2	5.38	-0.809	0.10864	Lactate/malate dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.412612	0.27816	N	0.017728	T	0.66809	0.2827	N	0.11927	0.2	0.80722	D	1	B;B;B;B	0.18013	0.025;0.0;0.003;0.011	B;B;B;B	0.31442	0.13;0.003;0.025;0.13	T	0.55134	-0.8188	10	0.02654	T	1	-11.122	1.6526	0.02775	0.1295:0.2584:0.1333:0.4787	.	184;184;206;206	B4DL43;Q8IX04-3;Q8IX04-2;Q8IX04	.;.;.;UEVLD_HUMAN	L	206;168;206;184;184;106	ENSP00000442974:I206L;ENSP00000441092:I168L;ENSP00000379500:I206L;ENSP00000323353:I184L;ENSP00000368697:I184L;ENSP00000437538:I106L	ENSP00000323353:I184L	I	-	1	0	UEVLD	18536450	1.000000	0.71417	0.998000	0.56505	0.152000	0.21847	0.598000	0.24074	0.037000	0.15575	-0.332000	0.08345	ATT	.		0.428	UEVLD-015	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000395928.1	NM_018314	
ZBTB11	27107	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	3	101383939	101383939	+	Missense_Mutation	SNP	G	G	A	rs370264120		TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr3:101383939G>A	ENST00000312938.4	-	4	2072	c.1492C>T	c.(1492-1494)Cct>Tct	p.P498S	Y_RNA_ENST00000364251.1_RNA	NM_014415.3	NP_055230.2	O95625	ZBT11_HUMAN	zinc finger and BTB domain containing 11	498					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						TCATCATCAGGGCCAAAGTCT	0.408																																					p.P498S		.											.	ZBTB11	91	0			c.C1492T						.	G	SER/PRO	1,4405	2.1+/-5.4	0,1,2202	205.0	188.0	194.0		1492	4.2	0.0	3		194	0,8600		0,0,4300	no	missense	ZBTB11	NM_014415.3	74	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	498/1054	101383939	1,13005	2203	4300	6503	SO:0001583	missense	27107	exon4			CATCAGGGCCAAA	U69274	CCDS2943.1	3q12.3	2013-01-09			ENSG00000066422	ENSG00000066422		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16740	protein-coding gene	gene with protein product							Standard	NM_014415		Approved	ZNF-U69274, ZNF913	uc003dve.4	O95625	OTTHUMG00000159133	ENST00000312938.4:c.1492C>T	3.37:g.101383939G>A	ENSP00000326200:p.Pro498Ser	126.0	0.0		176.0	21.0	NM_014415	Q2NKP9	Missense_Mutation	SNP	ENST00000312938.4	37	CCDS2943.1	.	.	.	.	.	.	.	.	.	.	G	4.089	0.014463	0.07959	2.27E-4	0.0	ENSG00000066422	ENST00000312938	T	0.09630	2.96	6.03	4.24	0.50183	.	0.556311	0.21502	N	0.073515	T	0.06826	0.0174	N	0.14661	0.345	0.36524	D	0.870317	B	0.02656	0.0	B	0.04013	0.001	T	0.28235	-1.0050	10	0.26408	T	0.33	-2.6158	11.291	0.49250	0.0651:0.0:0.8069:0.128	.	498	O95625	ZBT11_HUMAN	S	498	ENSP00000326200:P498S	ENSP00000326200:P498S	P	-	1	0	ZBTB11	102866629	0.999000	0.42202	0.016000	0.15963	0.196000	0.23810	4.360000	0.59455	0.875000	0.35847	0.655000	0.94253	CCT	.		0.408	ZBTB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353441.2	NM_014415	
ZFYVE16	9765	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	79733987	79733987	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr5:79733987T>G	ENST00000338008.5	+	3	1663	c.1483T>G	c.(1483-1485)Tgt>Ggt	p.C495G	ZFYVE16_ENST00000510158.1_Missense_Mutation_p.C495G|ZFYVE16_ENST00000505560.1_Missense_Mutation_p.C495G	NM_001284236.1|NM_014733.3	NP_001271165.1|NP_055548	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	495					BMP signaling pathway (GO:0030509)|endosomal transport (GO:0016197)|protein targeting to lysosome (GO:0006622)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|intracellular membrane-bounded organelle (GO:0043231)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein transporter activity (GO:0008565)			breast(4)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|liver(1)|lung(6)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		GTCTTCTGATTGTTGTGAAGG	0.403																																					p.C495G	Melanoma(150;1452 1854 16018 17851 37292)	.											.	ZFYVE16	90	0			c.T1483G						.						77.0	79.0	78.0					5																	79733987		2182	4294	6476	SO:0001583	missense	9765	exon4			TCTGATTGTTGTG	AB002303	CCDS4050.1	5q14.1	2012-09-20			ENSG00000039319	ENSG00000039319		"""Zinc fingers, FYVE domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20756	protein-coding gene	gene with protein product	"""endofin"", ""protein phosphatase 1, regulatory subunit 69"""	608880				11546807	Standard	NM_014733		Approved	KIAA0305, PPP1R69	uc003kgq.4	Q7Z3T8	OTTHUMG00000108178	ENST00000338008.5:c.1483T>G	5.37:g.79733987T>G	ENSP00000337159:p.Cys495Gly	89.0	0.0		139.0	7.0	NM_001105251	O15023|Q5H9U2|Q7LAU7|Q86T69|Q8N5L3|Q8NEK3	Missense_Mutation	SNP	ENST00000338008.5	37	CCDS4050.1	.	.	.	.	.	.	.	.	.	.	T	0.029	-1.346999	0.01266	.	.	ENSG00000039319	ENST00000338008;ENST00000510158;ENST00000505560	T;T;T	0.37584	1.19;1.19;1.19	5.41	-10.8	0.00216	.	2.616210	0.00923	N	0.002609	T	0.15522	0.0374	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.11891	-1.0569	10	0.18710	T	0.47	23.4448	14.2774	0.66189	0.0:0.4891:0.4265:0.0845	.	495;495	Q7Z3T8-3;Q7Z3T8	.;ZFY16_HUMAN	G	495	ENSP00000337159:C495G;ENSP00000423663:C495G;ENSP00000426848:C495G	ENSP00000337159:C495G	C	+	1	0	ZFYVE16	79769743	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	-3.111000	0.00599	-1.981000	0.00989	0.533000	0.62120	TGT	.		0.403	ZFYVE16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226982.2	NM_014733	
ZMYM4	9202	broad.mit.edu;bcgsc.ca	37	1	35855617	35855617	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr1:35855617G>A	ENST00000314607.6	+	15	2585	c.2505G>A	c.(2503-2505)atG>atA	p.M835I	ZMYM4_ENST00000373297.2_Missense_Mutation_p.M746I	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	835					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GAGGGGAAATGAAACATTTCT	0.398																																					p.M835I		.											.	ZMYM4	291	0			c.G2505A						.						148.0	140.0	143.0					1																	35855617		2203	4300	6503	SO:0001583	missense	9202	exon15			GGAAATGAAACAT	AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.2505G>A	1.37:g.35855617G>A	ENSP00000322915:p.Met835Ile	140.0	1.0		136.0	6.0	NM_005095	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	ENST00000314607.6	37	CCDS389.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.515|3.515	-0.098950|-0.098950	0.07010|0.07010	.|.	.|.	ENSG00000146463|ENSG00000146463	ENST00000457946|ENST00000314607;ENST00000373297	.|T;T	.|0.20463	.|2.07;2.25	5.39|5.39	0.8|0.8	0.18672|0.18672	.|TRASH (1);	.|0.407398	.|0.27627	.|N	.|0.018529	T|T	0.04724|0.04724	0.0128|0.0128	N|N	0.02011|0.02011	-0.69|-0.69	0.22446|0.22446	N|N	0.999096|0.999096	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	T|T	0.34775|0.34775	-0.9815|-0.9815	5|10	.|0.06236	.|T	.|0.91	-0.0154|-0.0154	2.318|2.318	0.04203|0.04203	0.1872:0.146:0.4547:0.2121|0.1872:0.146:0.4547:0.2121	.|.	.|835	.|Q5VZL5	.|ZMYM4_HUMAN	K|I	495|835;746	.|ENSP00000322915:M835I;ENSP00000362394:M746I	.|ENSP00000322915:M835I	E|M	+|+	1|3	0|0	ZMYM4|ZMYM4	35628204|35628204	0.545000|0.545000	0.26449|0.26449	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	-0.351000|-0.351000	0.07711|0.07711	0.156000|0.156000	0.19299|0.19299	0.591000|0.591000	0.81541|0.81541	GAA|ATG	.		0.398	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012207.3	NM_005095	
KIF26A	26153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	104642627	104642628	+	Missense_Mutation	DNP	AG	AG	CT			TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr14:104642627_104642628AG>CT	ENST00000423312.2	+	12	3502_3503	c.3502_3503AG>CT	c.(3502-3504)AGt>CTt	p.S1168L	KIF26A_ENST00000315264.7_Missense_Mutation_p.S1029L	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1168					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		CAGACCTGACAGTCCTGGGCCA	0.728																																					p.S1168L		.											.	.	.	0			.						.																																			SO:0001583	missense	26153	.			CCTGACAGTCCTG	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	Exception_encountered	14.37:g.104642627_104642628delinsCT	ENSP00000388241:p.Ser1168Leu	20.0	0.0		41.0	7.0	.	Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	DNP	ENST00000423312.2	37	CCDS45171.1																																																																																			.		0.728	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
CAND2	23066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	12861637	12861638	+	Missense_Mutation	DNP	GG	GG	CT	rs145134860	byFrequency	TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr3:12861637_12861638GG>CT	ENST00000456430.2	+	11	3038_3039	c.2997_2998GG>CT	c.(2995-3000)tcGGac>tcCTac	p.D1000Y	CAND2_ENST00000295989.5_Missense_Mutation_p.D907Y	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	1000					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						TCCTTATCTCGGACCAGCCCCA	0.604																																					p.D1000Y	GBM(43;676 868 1633 6395 37496)	.											.	.	.	0			.						.																																			SO:0001583	missense	23066	.			TATCTCGGACCAG		CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	Exception_encountered	3.37:g.12861637_12861638delinsCT	ENSP00000387641:p.Asp1000Tyr	129.0	0.0		194.0	52.0	.	B9EGM9|E9KL24	Missense_Mutation	DNP	ENST00000456430.2	37	CCDS54554.1																																																																																			.		0.604	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339856.4	XM_371617	
HTR3C	170572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	183777775	183777776	+	Missense_Mutation	DNP	CC	CC	AA	rs556123764|rs575185101		TCGA-DD-A4NJ-01A-11D-A27I-10	TCGA-DD-A4NJ-10A-01D-A27I-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e0b2f481-ccfb-4dcb-a3a4-56eb06e6623e	5a036ee2-e439-437a-8708-f758a33834ac	g.chr3:183777775_183777776CC>AA	ENST00000318351.1	+	8	1119_1120	c.1085_1086CC>AA	c.(1084-1086)cCC>cAA	p.P362Q		NM_130770.2	NP_570126.2	Q8WXA8	5HT3C_HUMAN	5-hydroxytryptamine (serotonin) receptor 3C, ionotropic	362					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(2)	32	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Ergoloid mesylate(DB01049)	AGATGCTGTCCCACTGCGCCCC	0.639																																					p.P362Q		.											.	.	.	0			.						.																																			SO:0001583	missense	170572	.			GCTGTCCCACTGC	AF459285	CCDS3250.1	3q27	2012-05-22	2012-02-03		ENSG00000178084	ENSG00000178084		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24003	protein-coding gene	gene with protein product		610121	"""5-hydroxytryptamine (serotonin) receptor 3, family member C"""			12801637, 15157181	Standard	NM_130770		Approved		uc003fmk.3	Q8WXA8	OTTHUMG00000156862	Exception_encountered	3.37:g.183777775_183777776delinsAA	ENSP00000322617:p.Pro362Gln	66.0	0.0		65.0	26.0	.	A2RRR5	Missense_Mutation	DNP	ENST00000318351.1	37	CCDS3250.1																																																																																			.		0.639	HTR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346296.1	NM_130770	
