#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADAMDEC1	27299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	24254788	24254788	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr8:24254788A>G	ENST00000256412.4	+	6	666	c.446A>G	c.(445-447)tAc>tGc	p.Y149C	ADAMDEC1_ENST00000522298.1_Missense_Mutation_p.Y70C|ADAMDEC1_ENST00000538205.1_Missense_Mutation_p.Y70C|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA	NM_014479.3	NP_055294.1	O15204	ADEC1_HUMAN	ADAM-like, decysin 1	149					immune response (GO:0006955)|negative regulation of cell adhesion (GO:0007162)	extracellular region (GO:0005576)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|large_intestine(4)|skin(2)|stomach(1)	9		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		CCCAGAGGATACTTCACACAT	0.423																																					p.Y149C	Ovarian(147;687 1849 3699 25981 31337)	.											.	ADAMDEC1	228	0			c.A446G						.						95.0	94.0	94.0					8																	24254788		2203	4300	6503	SO:0001583	missense	27299	exon6			GAGGATACTTCAC	Y13323	CCDS6044.1, CCDS55212.1	8p12	2008-08-07			ENSG00000134028	ENSG00000134028			16299	protein-coding gene	gene with protein product		606393				9271581, 12037602	Standard	NM_001145271		Approved	M12.219	uc003xdz.2	O15204	OTTHUMG00000097858	ENST00000256412.4:c.446A>G	8.37:g.24254788A>G	ENSP00000256412:p.Tyr149Cys	87.0	0.0		38.0	22.0	NM_014479	B7ZAK5	Missense_Mutation	SNP	ENST00000256412.4	37	CCDS6044.1	.	.	.	.	.	.	.	.	.	.	A	14.16	2.451912	0.43531	.	.	ENSG00000134028	ENST00000256412;ENST00000538205;ENST00000522298	T;T;T	0.06068	3.35;3.35;3.35	5.56	2.83	0.33086	Peptidase M12B, propeptide (1);	0.467917	0.20238	N	0.096339	T	0.20618	0.0496	M	0.77616	2.38	0.28169	N	0.928638	D	0.71674	0.998	D	0.67231	0.95	T	0.01829	-1.1265	10	0.87932	D	0	-12.8218	8.698	0.34307	0.6808:0.0:0.0:0.3192	.	149	O15204	ADEC1_HUMAN	C	149;70;70	ENSP00000256412:Y149C;ENSP00000442592:Y70C;ENSP00000428993:Y70C	ENSP00000256412:Y149C	Y	+	2	0	ADAMDEC1	24310733	0.771000	0.28555	0.996000	0.52242	0.524000	0.34500	1.056000	0.30480	0.907000	0.36646	0.455000	0.32223	TAC	.		0.423	ADAMDEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215149.2	NM_014479	
AGBL1	123624	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	86807754	86807754	+	Missense_Mutation	SNP	C	C	A	rs79186009	byFrequency	TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr15:86807754C>A	ENST00000441037.2	+	10	1309	c.1214C>A	c.(1213-1215)tCt>tAt	p.S405Y	AGBL1_ENST00000389298.3_Missense_Mutation_p.S136Y|AGBL1_ENST00000421325.2_Missense_Mutation_p.S405Y	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	405					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						AGGAGAGATTCTTCTGAAAGT	0.468													C|||	18	0.00359425	0.0136	0.0	5008	,	,		20133	0.0		0.0	False		,,,				2504	0.0				p.S405Y		.											.	.	.	0			c.C1214A						.	C	TYR/SER	35,3777		0,35,1871	70.0	73.0	72.0		1214	5.7	0.0	15	dbSNP_131	72	0,8262		0,0,4131	yes	missense	AGBL1	NM_152336.2	144	0,35,6002	AA,AC,CC		0.0,0.9182,0.2899	probably-damaging	405/1067	86807754	35,12039	1906	4131	6037	SO:0001583	missense	123624	exon10			GAGATTCTTCTGA	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.1214C>A	15.37:g.86807754C>A	ENSP00000413001:p.Ser405Tyr	99.0	0.0		87.0	32.0	NM_152336	A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	ENST00000441037.2	37	CCDS58398.1	6	0.0027472527472527475	6	0.012195121951219513	0	0.0	0	0.0	0	0.0	C	21.8	4.207095	0.79127	0.009182	0.0	ENSG00000166748	ENST00000441037;ENST00000421325;ENST00000389298	T;T	0.10860	2.84;2.83	5.71	5.71	0.89125	Armadillo-type fold (1);	0.300493	0.29417	N	0.012209	T	0.17323	0.0416	M	0.66939	2.045	0.09310	N	1	D;D;D	0.56521	0.969;0.969;0.976	P;P;P	0.51016	0.655;0.558;0.656	T	0.02115	-1.1211	10	0.62326	D	0.03	-7.2386	17.3792	0.87400	0.0:1.0:0.0:0.0	.	104;136;405	Q96MI9-2;Q96MI9-3;Q96MI9	.;.;CBPC4_HUMAN	Y	434;405;136	ENSP00000397173:S405Y;ENSP00000373949:S136Y	ENSP00000373949:S136Y	S	+	2	0	AGBL1	84608758	0.040000	0.19996	0.022000	0.16811	0.470000	0.32858	2.556000	0.45862	2.861000	0.98227	0.650000	0.86243	TCT	C|0.997;A|0.003		0.468	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336	
AMOTL1	154810	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	94533439	94533439	+	Silent	SNP	C	C	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr11:94533439C>T	ENST00000433060.2	+	3	1224	c.1083C>T	c.(1081-1083)gtC>gtT	p.V361V	AMOTL1_ENST00000317829.8_Silent_p.V311V|AMOTL1_ENST00000317837.9_Silent_p.V361V	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	361					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				ATGTGGCCGTCCTGCGGTACC	0.527																																					p.V361V		.											.	AMOTL1	91	0			c.C1083T						.						89.0	91.0	90.0					11																	94533439		1985	4150	6135	SO:0001819	synonymous_variant	154810	exon3			GGCCGTCCTGCGG	AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.1083C>T	11.37:g.94533439C>T		63.0	0.0		51.0	13.0	NM_130847	Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Silent	SNP	ENST00000433060.2	37	CCDS44712.1																																																																																			.		0.527	AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396474.3	NM_130847	
AP3M1	26985	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	75896531	75896531	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr10:75896531T>C	ENST00000355264.4	-	3	615	c.304A>G	c.(304-306)Att>Gtt	p.I102V	AP3M1_ENST00000372745.1_Missense_Mutation_p.I102V|AP3M1_ENST00000487653.1_5'Flank	NM_012095.4	NP_036227.1	Q9Y2T2	AP3M1_HUMAN	adaptor-related protein complex 3, mu 1 subunit	102					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|protein targeting to lysosome (GO:0006622)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	Rab GTPase binding (GO:0017137)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	13	Prostate(51;0.0112)					TTATCCTTAATTGCAGCCTCT	0.348																																					p.I102V		.											.	AP3M1	90	0			c.A304G						.						105.0	97.0	100.0					10																	75896531		2203	4300	6503	SO:0001583	missense	26985	exon3			CCTTAATTGCAGC	AF092092	CCDS7342.1	10q22.1-q22.3	2008-07-07			ENSG00000185009	ENSG00000185009			569	protein-coding gene	gene with protein product		610366				10024875	Standard	NM_207012		Approved		uc001jwh.3	Q9Y2T2	OTTHUMG00000018497	ENST00000355264.4:c.304A>G	10.37:g.75896531T>C	ENSP00000347408:p.Ile102Val	118.0	0.0		108.0	39.0	NM_012095	Q5JQ12|Q9H5L2	Missense_Mutation	SNP	ENST00000355264.4	37	CCDS7342.1	.	.	.	.	.	.	.	.	.	.	T	16.48	3.134462	0.56828	.	.	ENSG00000185009	ENST00000355264;ENST00000372745	D;D	0.81739	-1.53;-1.53	5.88	4.75	0.60458	Longin-like (1);AP complex, mu/sigma subunit (1);	0.000000	0.85682	D	0.000000	T	0.77611	0.4156	L	0.52823	1.66	0.58432	D	0.999999	B	0.20550	0.046	B	0.30495	0.116	T	0.71859	-0.4465	10	0.36615	T	0.2	.	11.7276	0.51718	0.0:0.0685:0.0:0.9315	.	102	Q9Y2T2	AP3M1_HUMAN	V	102	ENSP00000347408:I102V;ENSP00000361831:I102V	ENSP00000347408:I102V	I	-	1	0	AP3M1	75566537	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.755000	0.62198	1.060000	0.40578	0.533000	0.62120	ATT	.		0.348	AP3M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048747.1		
ARID3A	1820	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	966608	966608	+	Missense_Mutation	SNP	G	G	T	rs368267576		TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr19:966608G>T	ENST00000263620.3	+	7	1562	c.1235G>T	c.(1234-1236)cGc>cTc	p.R412L		NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	412						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCCCTGGCCGCCTGCCTGTG	0.667																																					p.R412L	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A	90	0			c.G1235T						.						21.0	22.0	22.0					19																	966608		2176	4257	6433	SO:0001583	missense	1820	exon7			CTGGCCGCCTGCC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.1235G>T	19.37:g.966608G>T	ENSP00000263620:p.Arg412Leu	113.0	0.0		82.0	11.0	NM_005224	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Missense_Mutation	SNP	ENST00000263620.3	37	CCDS12050.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.849668	0.91277	.	.	ENSG00000116017	ENST00000263620	T	0.44083	0.93	4.99	4.99	0.66335	.	0.248604	0.32416	N	0.006128	T	0.64983	0.2648	M	0.80746	2.51	0.80722	D	1	D	0.61697	0.99	D	0.64506	0.926	T	0.67488	-0.5658	10	0.44086	T	0.13	-6.5768	16.8584	0.86011	0.0:0.0:1.0:0.0	.	412	Q99856	ARI3A_HUMAN	L	412	ENSP00000263620:R412L	ENSP00000263620:R412L	R	+	2	0	ARID3A	917608	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	3.559000	0.53756	2.321000	0.78463	0.609000	0.83330	CGC	.		0.667	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
ARL9	132946	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	57384922	57384922	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr4:57384922C>A	ENST00000360096.2	+	3	409	c.95C>A	c.(94-96)tCa>tAa	p.S32*		NM_206919.1	NP_996802.1	Q6T311	ARL9_HUMAN	ADP-ribosylation factor-like 9	96					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			lung(2)	2	Glioma(25;0.08)|all_neural(26;0.101)					GTGGTGGATTCAGCAGATCAC	0.448																																					p.S32X		.											.	ARL9	22	0			c.C95A						.						172.0	157.0	162.0					4																	57384922		1908	4153	6061	SO:0001587	stop_gained	132946	exon3			TGGATTCAGCAGA	AY439003	CCDS59474.1	4q12	2014-05-09				ENSG00000196503		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	23592	protein-coding gene	gene with protein product		612405					Standard	NM_206919		Approved		uc003hby.1	Q6T311		ENST00000360096.2:c.95C>A	4.37:g.57384922C>A	ENSP00000353210:p.Ser32*	130.0	0.0		91.0	27.0	NM_206919		Nonsense_Mutation	SNP	ENST00000360096.2	37	CCDS59474.1	.	.	.	.	.	.	.	.	.	.	C	38	6.696940	0.97772	.	.	ENSG00000196503	ENST00000360096	.	.	.	5.3	5.3	0.74995	.	0.193072	0.46442	D	0.000284	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.7391	16.462	0.84059	0.0:1.0:0.0:0.0	.	.	.	.	X	96	.	ENSP00000353210:S96X	S	+	2	0	ARL9	57079679	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.008000	0.76341	2.483000	0.83821	0.462000	0.41574	TCA	.		0.448	ARL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467724.1	NM_206919	
ATG2B	55102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	96779439	96779439	+	Missense_Mutation	SNP	T	T	G	rs529500826		TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr14:96779439T>G	ENST00000359933.4	-	25	4698	c.3805A>C	c.(3805-3807)Agt>Cgt	p.S1269R	ATG2B_ENST00000261834.5_5'Flank	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	1269					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		GCAACGCTACTGGAAACACTG	0.383													T|||	1	0.000199681	0.0	0.0	5008	,	,		16900	0.001		0.0	False		,,,				2504	0.0				p.S1269R		.											.	ATG2B	93	0			c.A3805C						.						116.0	113.0	114.0					14																	96779439		2203	4300	6503	SO:0001583	missense	55102	exon25			CGCTACTGGAAAC	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.3805A>C	14.37:g.96779439T>G	ENSP00000353010:p.Ser1269Arg	71.0	0.0		67.0	11.0	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	37	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	T	19.51	3.840463	0.71488	.	.	ENSG00000066739	ENST00000359933	T	0.34472	1.36	6.01	6.01	0.97437	.	0.122489	0.85682	N	0.000000	T	0.53094	0.1775	M	0.75615	2.305	0.80722	D	1	D	0.54397	0.966	P	0.52109	0.69	T	0.58555	-0.7616	10	0.87932	D	0	.	16.5237	0.84324	0.0:0.0:0.0:1.0	.	1269	Q96BY7	ATG2B_HUMAN	R	1269	ENSP00000353010:S1269R	ENSP00000353010:S1269R	S	-	1	0	ATG2B	95849192	1.000000	0.71417	0.977000	0.42913	0.110000	0.19582	5.595000	0.67563	2.306000	0.77630	0.533000	0.62120	AGT	.		0.383	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
ATP12A	479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	25284610	25284610	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr13:25284610A>G	ENST00000381946.3	+	20	2943	c.2776A>G	c.(2776-2778)Agg>Ggg	p.R926G	ATP12A_ENST00000218548.6_Missense_Mutation_p.R932G			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	926					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		AAGGTACCAGAGGGAATACCT	0.453																																					p.R932G	Pancreas(156;1582 1935 18898 22665 26498)	.											.	ATP12A	137	0			c.A2794G						.						91.0	89.0	89.0					13																	25284610		2203	4300	6503	SO:0001583	missense	479	exon20			TACCAGAGGGAAT	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.2776A>G	13.37:g.25284610A>G	ENSP00000371372:p.Arg926Gly	162.0	0.0		153.0	45.0	NM_001185085	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	37	CCDS31948.1	.	.	.	.	.	.	.	.	.	.	A	12.73	2.025129	0.35701	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	D;D	0.89343	-2.5;-2.5	5.19	-0.836	0.10770	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.95245	0.8458	H	0.94771	3.58	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.95409	0.8496	10	0.87932	D	0	.	14.2889	0.66263	0.3179:0.6821:0.0:0.0	.	932;926	P54707-2;P54707	.;AT12A_HUMAN	G	932;926	ENSP00000218548:R932G;ENSP00000371372:R926G	ENSP00000218548:R932G	R	+	1	2	ATP12A	24182610	0.997000	0.39634	0.971000	0.41717	0.029000	0.11900	0.614000	0.24314	0.027000	0.15297	-0.316000	0.08728	AGG	.		0.453	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676	
SUGCT	79783	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	40535937	40535937	+	Silent	SNP	C	C	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr7:40535937C>A	ENST00000335693.4	+	12	1085	c.1062C>A	c.(1060-1062)gtC>gtA	p.V354V	C7orf10_ENST00000309930.5_Silent_p.V354V|C7orf10_ENST00000401647.2_Silent_p.V306V	NM_001193313.1	NP_001180242.1	Q9HAC7	SUCHY_HUMAN		354					metabolic process (GO:0008152)	mitochondrion (GO:0005739)	succinate-hydroxymethylglutarate CoA-transferase activity (GO:0047369)			endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)	18						GCAGTGGAGTCCCGTATGGCC	0.378																																					p.V354V		.											.	C7orf10	24	0			c.C1062A						.						113.0	108.0	110.0					7																	40535937		1860	4105	5965	SO:0001819	synonymous_variant	79783	exon12			TGGAGTCCCGTAT																												ENST00000335693.4:c.1062C>A	7.37:g.40535937C>A		78.0	0.0		76.0	24.0	NM_001193313	A4D1W5|B4DR73|Q4KMW4|Q4KMW8|Q4KMZ0|Q8TE00|Q8TEY1	Silent	SNP	ENST00000335693.4	37	CCDS55105.1	.	.	.	.	.	.	.	.	.	.	C	5.016	0.188720	0.09547	.	.	ENSG00000175600	ENST00000416370	.	.	.	5.42	1.31	0.21738	.	.	.	.	.	T	0.41396	0.1157	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.25363	-1.0134	4	.	.	.	-5.3029	0.3937	0.00415	0.185:0.2925:0.1825:0.3399	.	.	.	.	Y	349	.	.	S	+	2	0	C7orf10	40502462	0.904000	0.30761	0.176000	0.23000	0.620000	0.37586	-0.217000	0.09253	0.183000	0.20059	-0.175000	0.13238	TCC	.		0.378	C7orf10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000338388.1		
CAAP1	79886	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	26892425	26892425	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr9:26892425C>G	ENST00000333916.5	-	1	377	c.289G>C	c.(289-291)Ggc>Cgc	p.G97R	CAAP1_ENST00000535437.1_5'Flank|CAAP1_ENST00000495958.1_5'UTR|CAAP1_ENST00000520187.1_Missense_Mutation_p.G97R	NM_001167575.1|NM_024828.3	NP_001161047.1|NP_079104.3	Q9H8G2	CAAP1_HUMAN	caspase activity and apoptosis inhibitor 1	97					apoptotic process (GO:0006915)												TGCAAGGAGCCCGAGACGCTG	0.697																																					p.G97R		.											.	.	.	0			c.G289C						.						6.0	8.0	8.0					9																	26892425		1960	3959	5919	SO:0001583	missense	79886	exon1			AGGAGCCCGAGAC	BC014658	CCDS6516.1	9p21.2	2012-04-20	2012-04-20	2012-04-20	ENSG00000120159	ENSG00000120159			25834	protein-coding gene	gene with protein product	"""conserved anti-apoptotic protein"""		"""chromosome 9 open reading frame 82"""	C9orf82		21980415	Standard	NM_024828		Approved	FLJ13657, CAAP	uc003zqc.3	Q9H8G2	OTTHUMG00000019706	ENST00000333916.5:c.289G>C	9.37:g.26892425C>G	ENSP00000369431:p.Gly97Arg	27.0	0.0		26.0	6.0	NM_024828	B4DWT4|D3DRK4|Q5VY32|Q6IPE6|Q96C59	Missense_Mutation	SNP	ENST00000333916.5	37	CCDS6516.1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.327142	0.60743	.	.	ENSG00000120159	ENST00000333916;ENST00000520187	T	0.44881	0.91	5.21	3.25	0.37280	.	0.750513	0.12505	N	0.462959	T	0.34716	0.0907	N	0.14661	0.345	0.27417	N	0.954398	D	0.55385	0.971	P	0.56042	0.79	T	0.06862	-1.0803	10	0.20046	T	0.44	-6.06	7.5215	0.27631	0.1857:0.6348:0.1795:0.0	.	97	Q9H8G2	CI082_HUMAN	R	97	ENSP00000369431:G97R	ENSP00000369431:G97R	G	-	1	0	C9orf82	26882425	0.092000	0.21681	0.987000	0.45799	0.959000	0.62525	1.164000	0.31810	2.580000	0.87095	0.549000	0.68633	GGC	.		0.697	CAAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051954.1	NM_024828	
C9orf84	158401	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	114469021	114469021	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr9:114469021C>G	ENST00000318737.4	-	18	2500	c.2372G>C	c.(2371-2373)aGt>aCt	p.S791T	C9orf84_ENST00000394777.4_Missense_Mutation_p.S717T|C9orf84_ENST00000394779.3_Missense_Mutation_p.S752T|C9orf84_ENST00000374287.3_Missense_Mutation_p.S791T	NM_173521.3	NP_775792.3	Q5VXU9	CI084_HUMAN	chromosome 9 open reading frame 84	791										breast(1)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(10)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TACACAGGAACTTGTACTAAA	0.348																																					p.S791T		.											.	C9orf84	92	0			c.G2372C						.						98.0	109.0	105.0					9																	114469021		2203	4299	6502	SO:0001583	missense	158401	exon18			CAGGAACTTGTAC	AL833535	CCDS6781.3, CCDS43863.1	9q32	2012-03-16			ENSG00000165181	ENSG00000165181			26535	protein-coding gene	gene with protein product							Standard	XM_005251738		Approved	FLJ32779	uc004bfr.3	Q5VXU9	OTTHUMG00000020495	ENST00000318737.4:c.2372G>C	9.37:g.114469021C>G	ENSP00000322108:p.Ser791Thr	52.0	0.0		39.0	11.0	NM_173521	A2A2V3|Q2M1H8|Q96M73	Missense_Mutation	SNP	ENST00000318737.4	37	CCDS6781.3	.	.	.	.	.	.	.	.	.	.	C	11.75	1.732339	0.30684	.	.	ENSG00000165181	ENST00000394779;ENST00000394777;ENST00000394778;ENST00000374287;ENST00000318737	T;T;T;T	0.04502	3.61;3.61;3.61;3.61	4.84	1.9	0.25705	.	0.462533	0.20560	N	0.089936	T	0.03827	0.0108	L	0.27053	0.805	0.09310	N	0.999998	B;P;P	0.41848	0.358;0.763;0.557	B;B;B	0.42282	0.152;0.382;0.366	T	0.38929	-0.9638	10	0.40728	T	0.16	0.0914	4.3985	0.11374	0.1508:0.5227:0.0:0.3265	.	717;791;752	A6PVK7;Q5VXU9;A2A2V3	.;CI084_HUMAN;.	T	752;717;405;791;791	ENSP00000378259:S752T;ENSP00000378257:S717T;ENSP00000363405:S791T;ENSP00000322108:S791T	ENSP00000322108:S791T	S	-	2	0	C9orf84	113508842	0.968000	0.33430	0.231000	0.23993	0.883000	0.51084	0.719000	0.25881	0.093000	0.17368	-0.518000	0.04402	AGT	.		0.348	C9orf84-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053656.2	NM_173521	
CABS1	85438	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	71201468	71201468	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr4:71201468delA	ENST00000273936.5	+	1	786	c.712delA	c.(712-714)aaafs	p.K238fs		NM_033122.3	NP_149113.3	Q96KC9	CABS1_HUMAN	calcium-binding protein, spermatid-specific 1	238					spermatogenesis (GO:0007283)	mitochondrial inner membrane (GO:0005743)|motile cilium (GO:0031514)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(4)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TGAAGAAGAGAAAATAACCGA	0.423																																					p.K238fs		.											.	CABS1	93	0			c.712delA						.						104.0	104.0	104.0					4																	71201468		2203	4300	6503	SO:0001589	frameshift_variant	85438	exon1			GAAGAGAAAATAA	AF380838	CCDS3539.1	4q13.3	2013-10-11	2011-01-25	2011-01-25	ENSG00000145309	ENSG00000145309			30710	protein-coding gene	gene with protein product	"""casein-like phosphoprotein"""		"""chromosome 4 open reading frame 35"""	C4orf35		19208547, 19271754	Standard	NM_033122		Approved	NYD-SP26, FLJ32897, CLPH	uc003hff.3	Q96KC9	OTTHUMG00000129405	ENST00000273936.5:c.712delA	4.37:g.71201468delA	ENSP00000273936:p.Lys238fs	75.0	0.0		67.0	26.0	NM_033122	B2RCB5|Q86UE0|Q96M17	Frame_Shift_Del	DEL	ENST00000273936.5	37	CCDS3539.1																																																																																			.		0.423	CABS1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251561.3	NM_033122	
CADM1	23705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	115111039	115111039	+	Silent	SNP	G	G	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr11:115111039G>A	ENST00000452722.3	-	2	246	c.226C>T	c.(226-228)Cta>Tta	p.L76L	CADM1_ENST00000537058.1_Silent_p.L76L|CADM1_ENST00000536727.1_Silent_p.L76L|CADM1_ENST00000542447.2_Silent_p.L76L|CADM1_ENST00000537140.1_5'UTR|CADM1_ENST00000331581.6_Silent_p.L76L	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		GGATTCAGTAGCTGAATCACA	0.443																																					p.L76L		.											.	CADM1	92	0			c.C226T						.						98.0	90.0	93.0					11																	115111039		2201	4296	6497	SO:0001819	synonymous_variant	23705	exon2			TCAGTAGCTGAAT	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.226C>T	11.37:g.115111039G>A		119.0	0.0		88.0	20.0	NM_014333		Silent	SNP	ENST00000452722.3	37	CCDS8373.1	.	.	.	.	.	.	.	.	.	.	G	9.794	1.178632	0.21787	.	.	ENSG00000182985	ENST00000545380	.	.	.	5.97	5.97	0.96955	.	.	.	.	.	T	0.77018	0.4069	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73936	-0.3825	4	.	.	.	.	20.4238	0.99064	0.0:0.0:1.0:0.0	.	.	.	.	V	74	.	.	A	-	2	0	CADM1	114616249	1.000000	0.71417	0.807000	0.32361	0.993000	0.82548	7.650000	0.83521	2.834000	0.97654	0.650000	0.86243	GCT	.		0.443	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333	
CC2D2A	57545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	15516353	15516353	+	Silent	SNP	T	T	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr4:15516353T>A	ENST00000503292.1	+	10	921	c.741T>A	c.(739-741)ggT>ggA	p.G247G	CC2D2A_ENST00000389652.5_Silent_p.G198G|CC2D2A_ENST00000424120.1_Silent_p.G247G|CC2D2A_ENST00000413206.1_Silent_p.G247G|CC2D2A_ENST00000513811.1_3'UTR	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	247					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						TGCTTAATGGTGATGATGCCG	0.388																																					p.G247G		.											.	CC2D2A	25	0			c.T741A						.						115.0	112.0	113.0					4																	15516353		1953	4155	6108	SO:0001819	synonymous_variant	57545	exon10			TAATGGTGATGAT	AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.741T>A	4.37:g.15516353T>A		58.0	0.0		51.0	19.0	NM_001080522	A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Silent	SNP	ENST00000503292.1	37	CCDS47026.1																																																																																			.		0.388	CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359906.2	NM_001080522	
CCT8	10694	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	30439333	30439333	+	Silent	SNP	T	T	C			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr21:30439333T>C	ENST00000286788.4	-	5	647	c.441A>G	c.(439-441)gtA>gtG	p.V147V	CCT8_ENST00000470450.1_5'UTR|CCT8_ENST00000540844.1_Silent_p.V74V|CCT8_ENST00000542732.1_Silent_p.V128V	NM_006585.2	NP_006576.2	P50990	TCPQ_HUMAN	chaperonin containing TCP1, subunit 8 (theta)	147					'de novo' posttranslational protein folding (GO:0051084)|ATP catabolic process (GO:0006200)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	aggresome (GO:0016235)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|prostate(3)	14						CAGAACAACATACCAAATTAG	0.343																																					p.V147V		.											.	CCT8	90	0			c.A441G						.						78.0	74.0	75.0					21																	30439333		2203	4300	6503	SO:0001819	synonymous_variant	10694	exon5			ACAACATACCAAA	Z37163	CCDS33528.1, CCDS68180.1	21q21.3	2011-09-02			ENSG00000156261	ENSG00000156261		"""Heat Shock Proteins / Chaperonins"""	1623	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 112"""	C21orf112		7890169	Standard	NM_006585		Approved	Cctq, PRED71	uc002ynb.3	P50990	OTTHUMG00000044595	ENST00000286788.4:c.441A>G	21.37:g.30439333T>C		212.0	1.0		157.0	46.0	NM_006585	A6NN54|B4DEM7|B4DQH4|Q4VBP8	Silent	SNP	ENST00000286788.4	37	CCDS33528.1	.	.	.	.	.	.	.	.	.	.	T	9.677	1.148281	0.21288	.	.	ENSG00000156261	ENST00000431234	.	.	.	5.72	-5.89	0.02282	.	.	.	.	.	T	0.53997	0.1831	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57329	-0.7830	4	.	.	.	-21.2351	11.4751	0.50293	0.1033:0.5681:0.0:0.3286	.	.	.	.	C	139	.	.	Y	-	2	0	CCT8	29361204	0.000000	0.05858	0.911000	0.35937	0.996000	0.88848	-2.279000	0.01159	-1.037000	0.03283	0.528000	0.53228	TAT	.		0.343	CCT8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171822.1		
CDCA7	83879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	174224163	174224163	+	Intron	SNP	G	G	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr2:174224163G>T	ENST00000347703.3	+	2	291				CDCA7_ENST00000392567.2_Intron|CDCA7_ENST00000306721.3_Missense_Mutation_p.D110Y|CDCA7_ENST00000410101.3_Missense_Mutation_p.D66Y|CDCA7_ENST00000410019.3_Intron	NM_145810.2	NP_665809.1	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7						apoptotic process (GO:0006915)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.116)			TTTTCATGCCGACTCTGACGA	0.403																																					p.D110Y		.											.	CDCA7	91	0			c.G328T						.						105.0	102.0	103.0					2																	174224163		2203	4300	6503	SO:0001627	intron_variant	83879	exon3			CATGCCGACTCTG	BG354580	CCDS2252.1, CCDS2253.1	2q31.1	2008-02-05			ENSG00000144354	ENSG00000144354			14628	protein-coding gene	gene with protein product		609937				11598121, 12188893	Standard	NM_145810		Approved	FLJ14736, JPO1	uc002uic.1	Q9BWT1	OTTHUMG00000132296	ENST00000347703.3:c.147+598G>T	2.37:g.174224163G>T		129.0	0.0		106.0	38.0	NM_031942	B4DLP8|B4DV66|Q53EW5|Q580W9|Q658K4|Q658N4|Q8NBY9|Q96BV8|Q96SP5	Missense_Mutation	SNP	ENST00000347703.3	37	CCDS2253.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.307892	0.60305	.	.	ENSG00000144354	ENST00000306721;ENST00000410101	T;T	0.55588	0.51;0.74	5.87	4.98	0.66077	.	0.145934	0.47093	D	0.000255	T	0.66557	0.2801	L	0.61218	1.895	0.80722	D	1	D;D	0.67145	0.992;0.996	P;P	0.62491	0.73;0.903	T	0.70339	-0.4899	10	0.87932	D	0	-22.5441	13.3614	0.60659	0.0745:0.0:0.9255:0.0	.	66;110	B4DV66;Q9BWT1-2	.;.	Y	110;66	ENSP00000306968:D110Y;ENSP00000386656:D66Y	ENSP00000306968:D110Y	D	+	1	0	CDCA7	173932409	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.129000	0.50500	1.456000	0.47831	0.650000	0.86243	GAC	.		0.403	CDCA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255400.1	NM_031942	
CEP350	9857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	180080224	180080224	+	Missense_Mutation	SNP	G	G	T	rs201090590		TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr1:180080224G>T	ENST00000367607.3	+	38	9700	c.9282G>T	c.(9280-9282)gaG>gaT	p.E3094D	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	3094					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						GGATCTTTGAGACCCTGATCA	0.453																																					p.E3094D		.											.	CEP350	26	0			c.G9282T						.						129.0	110.0	116.0					1																	180080224		2203	4300	6503	SO:0001583	missense	9857	exon38			CTTTGAGACCCTG	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.9282G>T	1.37:g.180080224G>T	ENSP00000356579:p.Glu3094Asp	108.0	0.0		71.0	19.0	NM_014810	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	37	CCDS1336.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.768|9.768	1.171906|1.171906	0.21704|0.21704	.|.	.|.	ENSG00000135837|ENSG00000135837	ENST00000429851|ENST00000367607;ENST00000417046	.|T	.|0.55760	.|0.5	6.05|6.05	3.18|3.18	0.36537|0.36537	.|.	.|0.000000	.|0.49305	.|D	.|0.000146	T|T	0.37461|0.37461	0.1004|0.1004	L|L	0.41236|0.41236	1.265|1.265	0.43145|0.43145	D|D	0.9949|0.9949	.|B;P	.|0.39116	.|0.355;0.66	.|B;B	.|0.30716	.|0.057;0.119	T|T	0.10132|0.10132	-1.0643|-1.0643	5|9	.|.	.|.	.|.	.|.	11.5353|11.5353	0.50634|0.50634	0.1936:0.0:0.8064:0.0|0.1936:0.0:0.8064:0.0	.|.	.|3094;3094	.|E7EU22;Q5VT06	.|.;CE350_HUMAN	Y|D	1269|3094;558	.|ENSP00000356579:E3094D	.|.	D|E	+|+	1|3	0|2	CEP350|CEP350	178346847|178346847	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.879000|0.879000	0.50718|0.50718	0.804000|0.804000	0.27098|0.27098	0.446000|0.446000	0.26666|0.26666	0.650000|0.650000	0.86243|0.86243	GAC|GAG	G|0.999;C|0.000		0.453	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
CILP	8483	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	65489133	65489133	+	Missense_Mutation	SNP	C	C	A	rs377269093		TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr15:65489133C>A	ENST00000261883.4	-	9	3657	c.3491G>T	c.(3490-3492)cGc>cTc	p.R1164L		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	1164					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						TCCACCCTGGCGCTGGCCACC	0.592																																					p.R1164L		.											.	CILP	97	0			c.G3491T						.						39.0	39.0	39.0					15																	65489133		2202	4299	6501	SO:0001583	missense	8483	exon9			CCCTGGCGCTGGC	AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.3491G>T	15.37:g.65489133C>A	ENSP00000261883:p.Arg1164Leu	65.0	0.0		51.0	18.0	NM_003613	B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	ENST00000261883.4	37	CCDS10203.1	.	.	.	.	.	.	.	.	.	.	C	11.89	1.772308	0.31411	.	.	ENSG00000138615	ENST00000261883	T	0.38887	1.11	5.44	4.51	0.55191	.	0.306943	0.29355	N	0.012392	T	0.32882	0.0844	L	0.46157	1.445	0.09310	N	1	B	0.28082	0.2	B	0.25987	0.065	T	0.24083	-1.0170	10	0.54805	T	0.06	-0.7745	6.7476	0.23470	0.0:0.6988:0.1519:0.1492	.	1164	O75339	CILP1_HUMAN	L	1164	ENSP00000261883:R1164L	ENSP00000261883:R1164L	R	-	2	0	CILP	63276186	0.000000	0.05858	0.795000	0.32087	0.170000	0.22686	0.762000	0.26503	2.541000	0.85698	0.561000	0.74099	CGC	.		0.592	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613	
CNKSR2	22866	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	21515935	21515935	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chrX:21515935C>A	ENST00000379510.3	+	7	748	c.712C>A	c.(712-714)Ctc>Atc	p.L238I	CNKSR2_ENST00000279451.4_Missense_Mutation_p.L238I|CNKSR2_ENST00000425654.2_Missense_Mutation_p.L238I|CNKSR2_ENST00000543067.1_Missense_Mutation_p.L238I	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	238	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						ATATGATGGCCTCCATGTAAT	0.313																																					p.L238I		.											.	CNKSR2	625	0			c.C712A						.						109.0	99.0	102.0					X																	21515935		2203	4296	6499	SO:0001583	missense	22866	exon7			GATGGCCTCCATG	AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.712C>A	X.37:g.21515935C>A	ENSP00000368824:p.Leu238Ile	312.0	1.0		283.0	16.0	NM_001168647	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	ENST00000379510.3	37	CCDS14198.1	.	.	.	.	.	.	.	.	.	.	c	21.1	4.099126	0.76983	.	.	ENSG00000149970	ENST00000425654;ENST00000543067;ENST00000279451;ENST00000379510	T;T;T;T	0.26957	1.7;1.7;1.7;1.7	5.46	5.46	0.80206	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.46870	0.1415	L	0.50993	1.605	0.44789	D	0.99779	D;D;P	0.89917	1.0;1.0;0.763	D;D;D	0.91635	0.999;0.999;0.922	T	0.24548	-1.0157	10	0.35671	T	0.21	-0.3486	18.3788	0.90443	0.0:1.0:0.0:0.0	.	238;238;238	B7ZLJ1;B4DGR4;Q8WXI2	.;.;CNKR2_HUMAN	I	238	ENSP00000397906:L238I;ENSP00000444633:L238I;ENSP00000279451:L238I;ENSP00000368824:L238I	ENSP00000279451:L238I	L	+	1	0	CNKSR2	21425856	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.479000	0.53165	2.280000	0.76307	0.591000	0.81541	CTC	.		0.313	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927	
CNOT10	25904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	32801028	32801028	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr3:32801028A>C	ENST00000328834.5	+	14	1990	c.1674A>C	c.(1672-1674)aaA>aaC	p.K558N	CNOT10_ENST00000454516.2_Missense_Mutation_p.K618N|CNOT10_ENST00000538368.1_Missense_Mutation_p.K330N|CNOT10_ENST00000331889.6_Missense_Mutation_p.K531N	NM_015442.2	NP_056257.1	Q9H9A5	CNO10_HUMAN	CCR4-NOT transcription complex, subunit 10	558					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(3)	23						ATGCAGATAAACTTCTTCAGC	0.473																																					p.K618N		.											.	CNOT10	91	0			c.A1854C						.						362.0	349.0	353.0					3																	32801028		2203	4300	6503	SO:0001583	missense	25904	exon14			AGATAAACTTCTT	BC002928	CCDS2655.1, CCDS58821.1, CCDS58822.1	3p23	2013-01-10			ENSG00000182973	ENSG00000182973		"""Tetratricopeptide (TTC) repeat domain containing"""	23817	protein-coding gene	gene with protein product							Standard	NR_046352		Approved	FLJ12890, FLJ13165	uc011axj.2	Q9H9A5	OTTHUMG00000130748	ENST00000328834.5:c.1674A>C	3.37:g.32801028A>C	ENSP00000330060:p.Lys558Asn	87.0	0.0		71.0	9.0	NM_001256742	B7Z7L1|F8WAF2|Q9BU30|Q9H5J7|Q9H8X1|Q9H9W0|Q9HAH3|Q9UFJ2	Missense_Mutation	SNP	ENST00000328834.5	37	CCDS2655.1	.	.	.	.	.	.	.	.	.	.	A	11.34	1.611047	0.28712	.	.	ENSG00000182973	ENST00000331889;ENST00000328834;ENST00000538368;ENST00000454516;ENST00000430408	T;T;T;T;T	0.43294	1.25;1.25;0.95;1.25;0.95	5.81	3.45	0.39498	Tetratricopeptide-like helical (1);	0.042023	0.85682	D	0.000000	T	0.24661	0.0598	N	0.17082	0.46	0.58432	D	0.99999	B;B;B;B	0.20459	0.001;0.045;0.005;0.001	B;B;B;B	0.21360	0.004;0.034;0.004;0.001	T	0.04347	-1.0958	10	0.21540	T	0.41	-16.9714	9.4295	0.38601	0.7896:0.0:0.2104:0.0	.	618;531;557;558	F8WAF2;Q9H9A5-3;Q9H9A5-2;Q9H9A5	.;.;.;CNOTA_HUMAN	N	531;558;330;618;105	ENSP00000329376:K531N;ENSP00000330060:K558N;ENSP00000442552:K330N;ENSP00000399862:K618N;ENSP00000395385:K105N	ENSP00000330060:K558N	K	+	3	2	CNOT10	32776032	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.591000	0.36665	0.477000	0.27464	0.482000	0.46254	AAA	.		0.473	CNOT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253248.2	NM_015442	
CPS1	1373	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	211512674	211512674	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr2:211512674G>C	ENST00000233072.5	+	26	3425	c.3229G>C	c.(3229-3231)Ggc>Cgc	p.G1077R	CPS1_ENST00000451903.2_Missense_Mutation_p.G626R|CPS1_ENST00000430249.2_Missense_Mutation_p.G1083R	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1077					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	CAAGATCATGGGCACAAGCCC	0.512																																					p.G1083R		.											.	CPS1	162	0			c.G3247C						.						113.0	105.0	108.0					2																	211512674		2203	4300	6503	SO:0001583	missense	1373	exon27			ATCATGGGCACAA	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.3229G>C	2.37:g.211512674G>C	ENSP00000233072:p.Gly1077Arg	245.0	0.0		219.0	56.0	NM_001122633	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.926450	0.92319	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.99685	-6.4;-6.4;-6.4	5.99	5.99	0.97316	PreATP-grasp-like fold (1);Carbamoyl-phosphate synthase, large subunit, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99900	0.9952	H	0.99825	4.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96165	0.9118	10	0.87932	D	0	-8.9006	20.4777	0.99188	0.0:0.0:1.0:0.0	.	1087;1077	Q59HF8;P31327	.;CPSM_HUMAN	R	1083;1085;1077;626	ENSP00000402608:G1083R;ENSP00000233072:G1077R;ENSP00000406136:G626R	ENSP00000233072:G1077R	G	+	1	0	CPS1	211220919	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.476000	0.97823	2.840000	0.97914	0.655000	0.94253	GGC	.		0.512	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5		
CRYZL1	9946	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	35003837	35003837	+	Silent	SNP	T	T	C			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr21:35003837T>C	ENST00000381554.3	-	2	106	c.21A>G	c.(19-21)caA>caG	p.Q7Q	CRYZL1_ENST00000445393.1_Silent_p.Q7Q|CRYZL1_ENST00000290244.5_Silent_p.Q7Q|AP000304.12_ENST00000429238.1_Intron|CRYZL1_ENST00000381540.3_Silent_p.Q7Q|CRYZL1_ENST00000361534.2_Silent_p.Q31Q|CRYZL1_ENST00000413017.2_Silent_p.Q7Q	NM_145858.2	NP_665857.2	O95825	QORL1_HUMAN	crystallin, zeta (quinone reductase)-like 1	7					quinone metabolic process (GO:1901661)	cytosol (GO:0005829)	NADP binding (GO:0050661)|NADPH:quinone reductase activity (GO:0003960)|zinc ion binding (GO:0008270)			lung(1)|prostate(1)|urinary_tract(1)	3						TGGAACTCTGTTGGAAATATA	0.244																																					p.Q7Q		.											.	CRYZL1	90	0			c.A21G						.						46.0	51.0	49.0					21																	35003837		2189	4268	6457	SO:0001819	synonymous_variant	9946	exon2			ACTCTGTTGGAAA	AF029689	CCDS13633.2	21q22.1	2008-07-31			ENSG00000205758	ENSG00000205758			2420	protein-coding gene	gene with protein product	"""quinone reductase-like 1"""	603920				10191096	Standard	NM_145858		Approved	QOH-1, 4P11	uc021wio.1	O95825	OTTHUMG00000065954	ENST00000381554.3:c.21A>G	21.37:g.35003837T>C		319.0	0.0		257.0	92.0	NM_145858	B2RDX1|B3KQ77|Q96DY0|Q9NVY7	Silent	SNP	ENST00000381554.3	37	CCDS13633.2																																																																																			.		0.244	CRYZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141282.2	NM_145858	
CUL5	8065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	107923507	107923507	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr11:107923507A>G	ENST00000393094.2	+	5	1148	c.532A>G	c.(532-534)Att>Gtt	p.I178V		NM_003478.3	NP_003469.2	Q93034	CUL5_HUMAN	cullin 5	178					calcium ion transmembrane transport (GO:0070588)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cytosolic calcium ion homeostasis (GO:0051480)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|response to osmotic stress (GO:0006970)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul5-RING ubiquitin ligase complex (GO:0031466)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|receptor activity (GO:0004872)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		TCAGCTGGTTATTGGAGTAAG	0.343																																					p.I178V		.											.	CUL5	227	0			c.A532G						.						107.0	104.0	105.0					11																	107923507		2201	4298	6499	SO:0001583	missense	8065	exon5			CTGGTTATTGGAG	X81882	CCDS31668.1	11q22.3	2011-05-24			ENSG00000166266	ENSG00000166266			2556	protein-coding gene	gene with protein product		601741				8681378, 9037604	Standard	XM_005271682		Approved	VACM-1	uc001pjv.3	Q93034	OTTHUMG00000166369	ENST00000393094.2:c.532A>G	11.37:g.107923507A>G	ENSP00000376808:p.Ile178Val	74.0	0.0		53.0	20.0	NM_003478	A8K960|O14766|Q9BZC6	Missense_Mutation	SNP	ENST00000393094.2	37	CCDS31668.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.13|14.13	2.444077|2.444077	0.43429|0.43429	.|.	.|.	ENSG00000166266|ENSG00000166266	ENST00000393094|ENST00000532782	T|.	0.29397|.	1.57|.	5.76|5.76	5.76|5.76	0.90799|0.90799	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);|.	0.093539|.	0.64402|.	D|.	0.000001|.	T|T	0.60521|0.60521	0.2275|0.2275	L|L	0.39397|0.39397	1.21|1.21	0.80722|0.80722	D|D	1|1	B|.	0.22683|.	0.073|.	B|.	0.24269|.	0.052|.	T|T	0.56823|0.56823	-0.7915|-0.7915	10|5	0.02654|.	T|.	1|.	-15.8856|-15.8856	16.0653|16.0653	0.80867|0.80867	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	178|.	Q93034|.	CUL5_HUMAN|.	V|C	178|74	ENSP00000376808:I178V|.	ENSP00000376808:I178V|.	I|Y	+|+	1|2	0|0	CUL5|CUL5	107428717|107428717	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	9.300000|9.300000	0.96151|0.96151	2.196000|2.196000	0.70406|0.70406	0.523000|0.523000	0.50628|0.50628	ATT|TAT	.		0.343	CUL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389429.1		
DHX57	90957	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	39041005	39041005	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr2:39041005T>C	ENST00000295373.6	-	21	3765	c.3639A>G	c.(3637-3639)atA>atG	p.I1213M		NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	1213							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				GCATTGCTGATATCAGCTTGG	0.353																																					p.I1213M	Melanoma(191;1090 2095 4375 23729 47341)	.											.	DHX57	228	0			c.A3639G						.						132.0	125.0	127.0					2																	39041005		2203	4300	6503	SO:0001583	missense	90957	exon21			TGCTGATATCAGC	AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.3639A>G	2.37:g.39041005T>C	ENSP00000295373:p.Ile1213Met	288.0	0.0		215.0	11.0	NM_198963	A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Missense_Mutation	SNP	ENST00000295373.6	37	CCDS1800.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.63|12.63	1.995640|1.995640	0.35226|0.35226	.|.	.|.	ENSG00000163214|ENSG00000163214	ENST00000295373|ENST00000452978	T|T	0.02944|0.03889	4.1|3.77	5.65|5.65	4.46|4.46	0.54185|0.54185	Domain of unknown function DUF1605 (1);|.	0.000000|0.000000	0.64402|0.64402	D|D	0.000009|0.000009	T|T	0.04182|0.04182	0.0116|0.0116	L|L	0.28054|0.28054	0.825|0.825	0.39016|0.39016	D|D	0.959652|0.959652	B;P|.	0.36837|.	0.277;0.571|.	B;B|.	0.42163|.	0.145;0.378|.	T|T	0.47812|0.47812	-0.9088|-0.9088	10|8	0.51188|0.09843	T|T	0.08|0.71	.|.	7.466|7.466	0.27322|0.27322	0.134:0.0:0.1586:0.7074|0.134:0.0:0.1586:0.7074	.|.	1213;605|.	Q6P158;Q59G60|.	DHX57_HUMAN;.|.	M|V	1213|537	ENSP00000295373:I1213M|ENSP00000397841:I537V	ENSP00000295373:I1213M|ENSP00000397841:I537V	I|I	-|-	3|1	3|0	DHX57|DHX57	38894509|38894509	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	3.543000|3.543000	0.53633|0.53633	0.924000|0.924000	0.37069|0.37069	0.383000|0.383000	0.25322|0.25322	ATA|ATC	.		0.353	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219940.2	NM_145646	
DMBT1	1755	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	124352076	124352076	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr10:124352076G>C	ENST00000338354.3	+	20	2571	c.2465G>C	c.(2464-2466)tGt>tCt	p.C822S	DMBT1_ENST00000330163.4_Intron|DMBT1_ENST00000344338.3_Missense_Mutation_p.C812S|DMBT1_ENST00000368909.3_Missense_Mutation_p.C822S|DMBT1_ENST00000368956.2_Intron|DMBT1_ENST00000368955.3_Missense_Mutation_p.C812S|DMBT1_ENST00000359586.6_Intron			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	822	SRCR 6. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TCCCACAACTGTGGCCATCAT	0.567																																					p.C822S	Ovarian(182;93 2026 18125 22222 38972)	.											.	DMBT1	494	0			c.G2465C						.						109.0	80.0	89.0					10																	124352076		1957	4088	6045	SO:0001583	missense	1755	exon20			ACAACTGTGGCCA		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.2465G>C	10.37:g.124352076G>C	ENSP00000342210:p.Cys822Ser	57.0	0.0		61.0	21.0	NM_007329	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37		.	.	.	.	.	.	.	.	.	.	G	11.54	1.669804	0.29693	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000344338;ENST00000368909;ENST00000368955	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	3.49	3.49	0.39957	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.81307	0.4795	H	0.99347	4.525	0.80722	D	1	D;P;D;D	0.89917	1.0;0.907;1.0;1.0	D;B;D;D	0.91635	0.999;0.395;0.999;0.999	D	0.89689	0.3896	9	0.66056	D	0.02	.	15.3348	0.74244	0.0:0.0:1.0:0.0	.	583;822;812;822	Q9UGM3-4;Q9UGM3-6;Q9UGM3-3;Q9UGM3	.;.;.;DMBT1_HUMAN	S	822;822;822;822;822;822;812;822;812	ENSP00000342210:C822S;ENSP00000343175:C812S;ENSP00000357905:C822S;ENSP00000357951:C812S	ENSP00000342210:C822S	C	+	2	0	DMBT1	124342066	1.000000	0.71417	0.764000	0.31436	0.012000	0.07955	7.487000	0.81328	1.660000	0.50760	0.655000	0.94253	TGT	.		0.567	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
DNAH5	1767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	13830842	13830842	+	Silent	SNP	C	C	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr5:13830842C>T	ENST00000265104.4	-	36	6029	c.5925G>A	c.(5923-5925)ggG>ggA	p.G1975G		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1975	AAA 1. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G1975G(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CAGGGGCTCCCCCCATGCTCA	0.517									Kartagener syndrome																												p.G1975G		.											.	DNAH5	182	1	Substitution - coding silent(1)	lung(1)	c.G5925A						.						115.0	111.0	112.0					5																	13830842		2203	4300	6503	SO:0001819	synonymous_variant	1767	exon36	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	GGCTCCCCCCATG	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.5925G>A	5.37:g.13830842C>T		50.0	0.0		56.0	19.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	CCDS3882.1																																																																																			.		0.517	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
EAF1	85403	broad.mit.edu;bcgsc.ca	37	3	15480644	15480645	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	CA	CA	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr3:15480644_15480645delCA	ENST00000396842.2	+	6	1214_1215	c.789_790delCA	c.(787-792)ggcagtfs	p.S264fs	EAF1-AS1_ENST00000595975.1_RNA|EAF1-AS1_ENST00000610011.1_RNA|EAF1-AS1_ENST00000599742.1_RNA|EAF1-AS1_ENST00000608780.1_RNA|EAF1-AS1_ENST00000609310.1_RNA|EAF1-AS1_ENST00000595627.1_RNA|EAF1_ENST00000432764.2_Frame_Shift_Del_p.S163fs|EAF1-AS1_ENST00000494875.3_RNA|EAF1-AS1_ENST00000594820.1_RNA|EAF1-AS1_ENST00000597949.1_RNA|EAF1-AS1_ENST00000596371.1_RNA|EAF1-AS1_ENST00000593876.1_RNA	NM_033083.6	NP_149074.3	Q96JC9	EAF1_HUMAN	ELL associated factor 1	264					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ELL-EAF complex (GO:0032783)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	7						GTGAGTCTGGCAGTGACAGTGA	0.376																																					p.263_264del		.											.	EAF1	90	0			c.789_790del						.																																			SO:0001589	frameshift_variant	85403	exon6			GTCTGGCAGTGAC	AF272973	CCDS2626.1	3p25.1	2011-06-10			ENSG00000144597	ENSG00000144597			20907	protein-coding gene	gene with protein product		608315				11418481	Standard	NM_033083		Approved		uc003bzu.3	Q96JC9	OTTHUMG00000162544	ENST00000396842.2:c.789_790delCA	3.37:g.15480644_15480645delCA	ENSP00000380054:p.Ser264fs	45.0	0.0		36.0	8.0	NM_033083	B4E3F5|Q8IW10	Frame_Shift_Del	DEL	ENST00000396842.2	37	CCDS2626.1																																																																																			.		0.376	EAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252100.4	NM_033083	
EAF1	85403	broad.mit.edu;bcgsc.ca	37	3	15480647	15480647	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr3:15480647delT	ENST00000396842.2	+	6	1217	c.792delT	c.(790-792)agtfs	p.S264fs	EAF1-AS1_ENST00000595975.1_RNA|EAF1-AS1_ENST00000610011.1_RNA|EAF1-AS1_ENST00000599742.1_RNA|EAF1-AS1_ENST00000608780.1_RNA|EAF1-AS1_ENST00000609310.1_RNA|EAF1-AS1_ENST00000595627.1_RNA|EAF1_ENST00000432764.2_Frame_Shift_Del_p.S163fs|EAF1-AS1_ENST00000494875.3_RNA|EAF1-AS1_ENST00000594820.1_RNA|EAF1-AS1_ENST00000597949.1_RNA|EAF1-AS1_ENST00000596371.1_RNA|EAF1-AS1_ENST00000593876.1_RNA	NM_033083.6	NP_149074.3	Q96JC9	EAF1_HUMAN	ELL associated factor 1	264					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ELL-EAF complex (GO:0032783)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	7						AGTCTGGCAGTGACAGTGATG	0.378																																					p.S264fs		.											.	EAF1	90	0			c.792delT						.						180.0	160.0	167.0					3																	15480647		2203	4300	6503	SO:0001589	frameshift_variant	85403	exon6			TGGCAGTGACAGT	AF272973	CCDS2626.1	3p25.1	2011-06-10			ENSG00000144597	ENSG00000144597			20907	protein-coding gene	gene with protein product		608315				11418481	Standard	NM_033083		Approved		uc003bzu.3	Q96JC9	OTTHUMG00000162544	ENST00000396842.2:c.792delT	3.37:g.15480647delT	ENSP00000380054:p.Ser264fs	46.0	0.0		36.0	8.0	NM_033083	B4E3F5|Q8IW10	Frame_Shift_Del	DEL	ENST00000396842.2	37	CCDS2626.1																																																																																			.		0.378	EAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252100.4	NM_033083	
EFCAB13	124989	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	45421602	45421602	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr17:45421602T>A	ENST00000331493.2	+	7	789	c.378T>A	c.(376-378)aaT>aaA	p.N126K	ITGB3_ENST00000560629.1_3'UTR|EFCAB13_ENST00000517484.1_Missense_Mutation_p.N126K|ITGB3_ENST00000435993.2_3'UTR	NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	126						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)										AGTTGCCGAATCAGTACAGCG	0.383																																					p.N126K		.											.	.	.	0			c.T378A						.						222.0	205.0	211.0					17																	45421602		2203	4300	6503	SO:0001583	missense	124989	exon7			GCCGAATCAGTAC	BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.378T>A	17.37:g.45421602T>A	ENSP00000332111:p.Asn126Lys	99.0	0.0		89.0	20.0	NM_152347	G3V128|Q49AG9	Missense_Mutation	SNP	ENST00000331493.2	37	CCDS11512.1	.	.	.	.	.	.	.	.	.	.	T	0.776	-0.763931	0.02996	.	.	ENSG00000178852	ENST00000331493;ENST00000517484;ENST00000344176	T;T	0.64085	0.41;-0.08	3.19	3.19	0.36642	.	1.650740	0.03078	N	0.158121	T	0.58708	0.2141	L	0.44542	1.39	0.09310	N	1	P;P;P	0.46512	0.782;0.763;0.879	B;B;B	0.42030	0.189;0.205;0.373	T	0.53542	-0.8424	10	0.87932	D	0	-0.2434	8.1554	0.31165	0.0:0.0:0.0:1.0	.	126;126;126	Q8N7U2;Q8IY85;G3V128	.;CQ057_HUMAN;.	K	126	ENSP00000332111:N126K;ENSP00000430048:N126K	ENSP00000332111:N126K	N	+	3	2	C17orf57	42776601	0.001000	0.12720	0.027000	0.17364	0.003000	0.03518	0.050000	0.14120	1.694000	0.51137	0.477000	0.44152	AAT	.		0.383	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380147.4	NM_152347	
EHMT2	10919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	31860513	31860513	+	Splice_Site	SNP	T	T	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr6:31860513T>A	ENST00000375537.4	-	6	674		c.e6-2		EHMT2_ENST00000375530.4_Splice_Site|EHMT2_ENST00000480912.1_Splice_Site|EHMT2_ENST00000395728.3_Splice_Site|EHMT2_ENST00000375528.4_Splice_Site	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2						DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						TGGCCAGATCTGGAAGAAGAG	0.597																																					.		.											.	EHMT2	91	0			c.668-2A>T						.						83.0	93.0	90.0					6																	31860513		1507	2708	4215	SO:0001630	splice_region_variant	10919	exon7			CAGATCTGGAAGA	AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.668-2A>T	6.37:g.31860513T>A		99.0	0.0		66.0	13.0	NM_006709	B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Splice_Site	SNP	ENST00000375537.4	37	CCDS4725.1	.	.	.	.	.	.	.	.	.	.	T	11.65	1.701718	0.30142	.	.	ENSG00000204371	ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537;ENST00000442298	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1741	0.48588	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	EHMT2	31968492	1.000000	0.71417	0.990000	0.47175	0.226000	0.24999	2.258000	0.43249	2.202000	0.70862	0.533000	0.62120	.	.		0.597	EHMT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076355.5	NM_006709	Intron
EZH1	2145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	40872423	40872423	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr17:40872423C>G	ENST00000428826.2	-	7	653	c.532G>C	c.(532-534)Gag>Cag	p.E178Q	EZH1_ENST00000585893.1_Missense_Mutation_p.E138Q|EZH1_ENST00000592743.1_Missense_Mutation_p.E178Q|EZH1_ENST00000415827.2_Missense_Mutation_p.E169Q|EZH1_ENST00000435174.1_Missense_Mutation_p.E39Q|EZH1_ENST00000590078.1_Missense_Mutation_p.E108Q			Q92800	EZH1_HUMAN	enhancer of zeste 1 polycomb repressive complex 2 subunit	178					anatomical structure morphogenesis (GO:0009653)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)			breast(1)|endometrium(4)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	27		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)		TCGACCAACTCCAGAAAAACA	0.468																																					p.E178Q		.											.	EZH1	229	0			c.G532C						.						159.0	125.0	136.0					17																	40872423		2203	4300	6503	SO:0001583	missense	2145	exon7			CCAACTCCAGAAA		CCDS32659.1	17q21.1-q21.3	2014-05-28	2014-05-28			ENSG00000108799		"""Chromatin-modifying enzymes / K-methyltransferases"""	3526	protein-coding gene	gene with protein product		601674	"""enhancer of zeste (Drosophila) homolog 1"", ""enhancer of zeste homolog 1 (Drosophila)"""			8921387	Standard	NM_001991		Approved	KIAA0388, KMT6B	uc002iaz.3	Q92800		ENST00000428826.2:c.532G>C	17.37:g.40872423C>G	ENSP00000404658:p.Glu178Gln	84.0	0.0		81.0	28.0	NM_001991	A6NCH6|B4DIJ1|B4DIZ7|B4DSS2|B4E3R7|O43287|Q14459|Q53XP3	Missense_Mutation	SNP	ENST00000428826.2	37	CCDS32659.1	.	.	.	.	.	.	.	.	.	.	C	32	5.106427	0.94292	.	.	ENSG00000108799	ENST00000264646;ENST00000428826;ENST00000415827;ENST00000435174	D;D	0.95377	-2.08;-3.69	5.32	5.32	0.75619	SANT domain, DNA binding (1);	0.042919	0.85682	D	0.000000	D	0.96673	0.8914	L	0.59912	1.85	0.80722	D	1	D;D;D;D	0.62365	0.97;0.987;0.987;0.991	P;P;P;P	0.59487	0.721;0.858;0.858;0.725	D	0.96651	0.9481	10	0.56958	D	0.05	.	18.9557	0.92658	0.0:1.0:0.0:0.0	.	39;138;184;178	Q92800-5;Q92800-3;Q92800-2;Q92800	.;.;.;EZH1_HUMAN	Q	181;178;138;39	ENSP00000404658:E178Q;ENSP00000404071:E39Q	ENSP00000264646:E181Q	E	-	1	0	EZH1	38125949	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.163000	0.77524	2.667000	0.90743	0.561000	0.74099	GAG	.		0.468	EZH1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452347.1	NM_001991	
FAM46D	169966	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	79698133	79698133	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chrX:79698133A>T	ENST00000308293.5	+	3	334	c.95A>T	c.(94-96)aAt>aTt	p.N32I	FAM46D_ENST00000538312.1_Missense_Mutation_p.N32I	NM_152630.4	NP_689843.1	Q8NEK8	FA46D_HUMAN	family with sequence similarity 46, member D	32										kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23						GGAAAGGGGAATTTCCCCACA	0.368																																					p.N32I		.											.	FAM46D	130	0			c.A95T						.						98.0	83.0	88.0					X																	79698133		2203	4299	6502	SO:0001583	missense	169966	exon5			AGGGGAATTTCCC	BX537938	CCDS14446.1	Xq21.1	2009-08-18			ENSG00000174016	ENSG00000174016			28399	protein-coding gene	gene with protein product	"""cancer/testis antigen 112"""					12477932	Standard	NM_152630		Approved	MGC26999, CT1.26, CT112	uc004edl.1	Q8NEK8	OTTHUMG00000021902	ENST00000308293.5:c.95A>T	X.37:g.79698133A>T	ENSP00000308575:p.Asn32Ile	191.0	0.0		135.0	52.0	NM_001170574	B2R9Q6|Q7Z3F6|Q8NHU1	Missense_Mutation	SNP	ENST00000308293.5	37	CCDS14446.1	.	.	.	.	.	.	.	.	.	.	A	16.40	3.113279	0.56398	.	.	ENSG00000174016	ENST00000538312;ENST00000308293	T;T	0.26660	1.72;1.72	4.41	4.41	0.53225	Domain of unknown function DUF1693 (1);	0.000000	0.85682	D	0.000000	T	0.55289	0.1911	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63844	-0.6545	10	0.87932	D	0	-13.5436	11.6886	0.51501	1.0:0.0:0.0:0.0	.	32	Q8NEK8	FA46D_HUMAN	I	32	ENSP00000443410:N32I;ENSP00000308575:N32I	ENSP00000308575:N32I	N	+	2	0	FAM46D	79584789	1.000000	0.71417	0.996000	0.52242	0.807000	0.45602	8.363000	0.90103	1.632000	0.50472	0.345000	0.21793	AAT	.		0.368	FAM46D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057338.1	NM_152630	
FAT1	2195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	187557324	187557324	+	Silent	SNP	G	G	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr4:187557324G>T	ENST00000441802.2	-	6	4247	c.4038C>A	c.(4036-4038)atC>atA	p.I1346I		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1346	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TGGGCTTGGAGATCCATTCAA	0.438										HNSCC(5;0.00058)																											p.I1346I	Colon(197;1040 2055 4143 4984 49344)	.											.	FAT1	34	0			c.C4038A						.						81.0	79.0	80.0					4																	187557324		1926	4138	6064	SO:0001819	synonymous_variant	2195	exon6			CTTGGAGATCCAT	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.4038C>A	4.37:g.187557324G>T		86.0	0.0		87.0	28.0	NM_005245		Silent	SNP	ENST00000441802.2	37	CCDS47177.1																																																																																			.		0.438	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
FBN2	2201	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	127622452	127622452	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr5:127622452G>A	ENST00000508053.1	-	61	7944	c.6970C>T	c.(6970-6972)Cct>Tct	p.P2324S	FBN2_ENST00000262464.4_Missense_Mutation_p.P2324S			P35556	FBN2_HUMAN	fibrillin 2	2324	EGF-like 39; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ATTCCAGGAGGGCAGATGCAC	0.493																																					p.P2324S		.											.	FBN2	146	0			c.C6970T						.						148.0	125.0	133.0					5																	127622452		2203	4300	6503	SO:0001583	missense	2201	exon55			CAGGAGGGCAGAT	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.6970C>T	5.37:g.127622452G>A	ENSP00000424571:p.Pro2324Ser	188.0	1.0		157.0	65.0	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	G	18.80	3.701045	0.68501	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.89123	-2.47;-2.47	5.34	5.34	0.76211	EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000005	D	0.87641	0.6228	L	0.43757	1.38	0.58432	D	0.999999	B	0.32409	0.37	B	0.38921	0.285	D	0.83848	0.0261	10	0.27785	T	0.31	.	19.5946	0.95530	0.0:0.0:1.0:0.0	.	2324	P35556	FBN2_HUMAN	S	2324	ENSP00000262464:P2324S;ENSP00000424571:P2324S	ENSP00000262464:P2324S	P	-	1	0	FBN2	127650351	1.000000	0.71417	0.997000	0.53966	0.948000	0.59901	3.291000	0.51764	2.937000	0.99478	0.650000	0.86243	CCT	.		0.493	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
FCRL1	115350	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	157771365	157771365	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr1:157771365G>A	ENST00000368176.3	-	6	956	c.889C>T	c.(889-891)Cct>Tct	p.P297S	FCRL1_ENST00000358292.3_Intron|FCRL1_ENST00000489998.1_Intron|FCRL1_ENST00000491942.1_Missense_Mutation_p.P297S	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	297						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GCCCCAGTAGGCACTAGAGGG	0.557																																					p.P297S	GBM(54;482 1003 11223 30131 35730)	.											.	FCRL1	153	0			c.C889T						.						68.0	69.0	69.0					1																	157771365		2203	4300	6503	SO:0001583	missense	115350	exon6			CAGTAGGCACTAG	BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.889C>T	1.37:g.157771365G>A	ENSP00000357158:p.Pro297Ser	128.0	0.0		132.0	52.0	NM_001159398	B2RE05|Q8N759|Q8NDI0|Q96PJ6	Missense_Mutation	SNP	ENST00000368176.3	37	CCDS1170.1	.	.	.	.	.	.	.	.	.	.	G	11.93	1.785102	0.31593	.	.	ENSG00000163534	ENST00000368176;ENST00000491942	T;T	0.49139	0.79;0.79	5.25	4.33	0.51752	Immunoglobulin-like fold (1);	0.957579	0.08730	N	0.902182	T	0.49355	0.1552	M	0.65975	2.015	0.34465	D	0.702158	D;D	0.56968	0.972;0.978	P;P	0.57846	0.828;0.539	T	0.44174	-0.9345	10	0.45353	T	0.12	.	9.8543	0.41077	0.0926:0.0:0.9074:0.0	.	297;297	Q96LA6-2;Q96LA6	.;FCRL1_HUMAN	S	297	ENSP00000357158:P297S;ENSP00000418130:P297S	ENSP00000357158:P297S	P	-	1	0	FCRL1	156037989	1.000000	0.71417	0.992000	0.48379	0.044000	0.14063	2.449000	0.44935	1.580000	0.49851	0.655000	0.94253	CCT	.		0.557	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051401.1	NM_052938	
FYB	2533	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	39137761	39137761	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr5:39137761C>A	ENST00000351578.6	-	7	1646	c.1456G>T	c.(1456-1458)Gag>Tag	p.E486*	FYB_ENST00000540520.1_Nonsense_Mutation_p.E496*|FYB_ENST00000515010.1_Nonsense_Mutation_p.E486*|FYB_ENST00000505428.1_Nonsense_Mutation_p.E486*|FYB_ENST00000512982.1_Nonsense_Mutation_p.E486*	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	486					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			tcctttttctccagctctaac	0.338																																					p.E496X		.											.	FYB	24	0			c.G1486T						.						267.0	219.0	234.0					5																	39137761		934	2082	3016	SO:0001587	stop_gained	2533	exon7			TTTTCTCCAGCTC	U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.1456G>T	5.37:g.39137761C>A	ENSP00000316460:p.Glu486*	124.0	0.0		90.0	37.0	NM_001243093	A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Nonsense_Mutation	SNP	ENST00000351578.6	37	CCDS47200.1	.	.	.	.	.	.	.	.	.	.	C	37	6.248166	0.97412	.	.	ENSG00000082074	ENST00000351578;ENST00000515010;ENST00000512982;ENST00000505428;ENST00000540520;ENST00000542542	.	.	.	4.48	4.48	0.54585	.	0.314836	0.30538	N	0.009409	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-11.5646	12.9708	0.58511	0.0:1.0:0.0:0.0	.	.	.	.	X	486;486;486;486;496;486	.	ENSP00000316460:E486X	E	-	1	0	FYB	39173518	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.758000	0.47565	2.776000	0.95493	0.655000	0.94253	GAG	.		0.338	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367098.1	NM_001465	
GOLGB1	2804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	121410667	121410667	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr3:121410667T>A	ENST00000340645.5	-	14	7654	c.7529A>T	c.(7528-7530)gAa>gTa	p.E2510V	GOLGB1_ENST00000393667.3_Missense_Mutation_p.E2515V	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2510					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TCGTATTTCTTCTTTAAGCTT	0.418																																					p.E2515V		.											.	GOLGB1	161	0			c.A7544T						.						159.0	166.0	163.0					3																	121410667		2203	4300	6503	SO:0001583	missense	2804	exon14			ATTTCTTCTTTAA	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.7529A>T	3.37:g.121410667T>A	ENSP00000341848:p.Glu2510Val	67.0	0.0		59.0	11.0	NM_001256486	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	37	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	T	14.61	2.586347	0.46110	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.18960	2.18;2.18	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000005	T	0.46698	0.1406	M	0.74881	2.28	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.997	T	0.47209	-0.9135	10	0.62326	D	0.03	.	13.648	0.62292	0.0:0.0:0.0:1.0	.	2515;2515;2510	E7EP74;B2ZZ91;Q14789	.;.;GOGB1_HUMAN	V	2510;2515	ENSP00000341848:E2510V;ENSP00000377275:E2515V	ENSP00000341848:E2510V	E	-	2	0	GOLGB1	122893357	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.065000	0.64344	2.102000	0.63906	0.460000	0.39030	GAA	.		0.418	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
GPC3	2719	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	132887923	132887923	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chrX:132887923T>G	ENST00000370818.3	-	3	1063	c.618A>C	c.(616-618)aaA>aaC	p.K206N	GPC3_ENST00000543339.1_Missense_Mutation_p.K152N|GPC3_ENST00000394299.2_Missense_Mutation_p.K206N	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	206					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)			breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					TCCCAAATACTTTCAGGTCAC	0.478			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																												p.K206N		.	yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	glypican 3		O	.	GPC3	847	0			c.A618C						.						381.0	287.0	319.0					X																	132887923		2203	4300	6503	SO:0001583	missense	2719	exon3	Familial Cancer Database	SGBS	AAATACTTTCAGG	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.618A>C	X.37:g.132887923T>G	ENSP00000359854:p.Lys206Asn	199.0	0.0		199.0	11.0	NM_001164617	C9JLE3|G3V1R0|Q2L880|Q2L882	Missense_Mutation	SNP	ENST00000370818.3	37	CCDS14638.1	.	.	.	.	.	.	.	.	.	.	T	5.641	0.302961	0.10678	.	.	ENSG00000147257	ENST00000370818;ENST00000394299;ENST00000543339	T;T;T	0.54479	0.57;0.57;0.57	5.48	5.48	0.80851	.	0.344031	0.34853	N	0.003623	T	0.33644	0.0870	N	0.21545	0.675	0.32844	D	0.505762	B;B;B;B	0.18310	0.027;0.022;0.013;0.027	B;B;B;B	0.22152	0.038;0.01;0.038;0.038	T	0.39482	-0.9612	10	0.19590	T	0.45	.	5.3954	0.16266	0.1575:0.0853:0.0:0.7572	.	190;152;206;206	B4DTD8;G3V1R0;C9JLE3;P51654	.;.;.;GPC3_HUMAN	N	206;206;152	ENSP00000359854:K206N;ENSP00000377836:K206N;ENSP00000444222:K152N	ENSP00000359854:K206N	K	-	3	2	GPC3	132715589	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	0.542000	0.23222	1.829000	0.53265	0.481000	0.45027	AAA	.		0.478	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058356.1	NM_004484	
GRAMD1A	57655	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	35501096	35501096	+	Silent	SNP	C	C	G			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr19:35501096C>G	ENST00000317991.5	+	5	618	c.426C>G	c.(424-426)acC>acG	p.T142T	GRAMD1A_ENST00000411896.2_Silent_p.T135T|GRAMD1A_ENST00000599564.1_Silent_p.T229T|GRAMD1A_ENST00000424536.2_Silent_p.T142T|GRAMD1A_ENST00000504615.2_5'UTR|GRAMD1A_ENST00000598073.1_3'UTR	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A	142	GRAM.					integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			GCTGGGAGACCACGGTGAGCC	0.647																																					p.T142T		.											.	GRAMD1A	90	0			c.C426G						.						68.0	71.0	70.0					19																	35501096		1928	4128	6056	SO:0001819	synonymous_variant	57655	exon5			GGAGACCACGGTG	AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		ENST00000317991.5:c.426C>G	19.37:g.35501096C>G		84.0	0.0		53.0	19.0	NM_020895	A6NKY7|Q8NC77|Q9P1Z5	Silent	SNP	ENST00000317991.5	37	CCDS42546.1																																																																																			.		0.647	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461557.1	NM_020895	
GRIN2A	2903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	9862753	9862753	+	Silent	SNP	C	C	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr16:9862753C>T	ENST00000396573.2	-	13	2859	c.2550G>A	c.(2548-2550)acG>acA	p.T850T	GRIN2A_ENST00000562109.1_Silent_p.T850T|GRIN2A_ENST00000330684.3_Silent_p.T850T|GRIN2A_ENST00000396575.2_Silent_p.T850T|GRIN2A_ENST00000535259.1_Silent_p.T693T|GRIN2A_ENST00000404927.2_Silent_p.T850T	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	850					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.T850T(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AGCACACGCCCGTGAAACAGA	0.577																																					p.T850T		.											.	GRIN2A	349	1	Substitution - coding silent(1)	prostate(1)	c.G2550A						.						86.0	85.0	86.0					16																	9862753		2197	4300	6497	SO:0001819	synonymous_variant	2903	exon13			CACGCCCGTGAAA		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.2550G>A	16.37:g.9862753C>T		44.0	0.0		39.0	13.0	NM_000833	O00669|Q17RZ6	Silent	SNP	ENST00000396573.2	37	CCDS10539.1																																																																																			.		0.577	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
GYLTL1B	120071	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	45948990	45948990	+	Missense_Mutation	SNP	C	C	T	rs148997856		TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr11:45948990C>T	ENST00000531526.1	+	11	1561	c.1450C>T	c.(1450-1452)Cgg>Tgg	p.R484W	GYLTL1B_ENST00000325468.5_Missense_Mutation_p.R484W|GYLTL1B_ENST00000529052.1_Missense_Mutation_p.R453W|GYLTL1B_ENST00000401752.1_Missense_Mutation_p.R484W|GYLTL1B_ENST00000536139.1_Missense_Mutation_p.R453W|GYLTL1B_ENST00000389968.3_Missense_Mutation_p.R211W	NM_152312.3	NP_689525.3	Q8N3Y3	LARG2_HUMAN	glycosyltransferase-like 1B	484					muscle cell cellular homeostasis (GO:0046716)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(2)|endometrium(6)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(35;0.226)		GCTTGCTGCCCGGCAGGACGT	0.637																																					p.R484W		.											.	GYLTL1B	92	0			c.C1450T						.	C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	101.0	87.0	92.0		1450	4.8	1.0	11	dbSNP_134	92	0,8598		0,0,4299	no	missense	GYLTL1B	NM_152312.3	101	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	484/722	45948990	1,13003	2203	4299	6502	SO:0001583	missense	120071	exon11			GCTGCCCGGCAGG		CCDS31473.1	11p11.12	2013-02-22			ENSG00000165905	ENSG00000165905		"""Glycosyltransferase family 8 domain containing"""	16522	protein-coding gene	gene with protein product		609709				15661757, 15958417	Standard	XM_005252785		Approved	PP5656, FLJ35207, LARGE2	uc001nbv.1	Q8N3Y3	OTTHUMG00000167037	ENST00000531526.1:c.1450C>T	11.37:g.45948990C>T	ENSP00000432869:p.Arg484Trp	105.0	0.0		102.0	6.0	NM_152312	A6NN75|Q8N8Y6|Q8NAK3|Q8WY62	Missense_Mutation	SNP	ENST00000531526.1	37	CCDS31473.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.888973	0.91814	2.27E-4	0.0	ENSG00000165905	ENST00000529052;ENST00000531526;ENST00000401752;ENST00000389968;ENST00000325468;ENST00000536139	T;T;T;T;T;T	0.26810	1.71;1.71;1.71;1.71;1.71;1.71	5.76	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.59280	0.2182	M	0.90814	3.15	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.998	T	0.70059	-0.4976	10	0.87932	D	0	-35.7757	15.7478	0.77958	0.1415:0.8585:0.0:0.0	.	453;453;484	B3KP69;E9PIZ2;Q8N3Y3	.;.;LARG2_HUMAN	W	453;484;484;211;484;453	ENSP00000431932:R453W;ENSP00000432869:R484W;ENSP00000385235:R484W;ENSP00000374618:R211W;ENSP00000324570:R484W;ENSP00000445044:R453W	ENSP00000324570:R484W	R	+	1	2	GYLTL1B	45905566	1.000000	0.71417	0.984000	0.44739	0.918000	0.54935	4.574000	0.60900	1.378000	0.46305	0.563000	0.77884	CGG	C|1.000;T|0.000		0.637	GYLTL1B-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392572.1	NM_152312	
HEATR4	399671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	73964942	73964942	+	Silent	SNP	G	G	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr14:73964942G>T	ENST00000553558.1	-	14	2784	c.2463C>A	c.(2461-2463)atC>atA	p.I821I	HEATR4_ENST00000334988.2_Silent_p.I821I|HEATR4_ENST00000560393.1_Silent_p.I774I	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4	821										breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		TCAGGGCTAGGATGCTACGGC	0.537																																					p.I821I		.											.	HEATR4	91	0			c.C2463A						.						119.0	98.0	105.0					14																	73964942		2203	4300	6503	SO:0001819	synonymous_variant	399671	exon13			GGCTAGGATGCTA	BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.2463C>A	14.37:g.73964942G>T		102.0	0.0		102.0	41.0	NM_203309	B7Z7V9|E9KL41	Silent	SNP	ENST00000553558.1	37	CCDS9815.2																																																																																			.		0.537	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414422.2	NM_203309	
HEATR6	63897	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	58121003	58121003	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr17:58121003C>A	ENST00000184956.6	-	20	3483	c.3467G>T	c.(3466-3468)gGc>gTc	p.G1156V	AC005702.3_ENST00000582298.1_RNA|MIR4737_ENST00000583979.1_RNA|AC005702.1_ENST00000581326.1_RNA|AC005702.2_ENST00000577558.1_RNA|HEATR6_ENST00000585976.1_Missense_Mutation_p.G1044V|AC005702.4_ENST00000583144.1_RNA	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	1156							poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			TTCTAAAAAGCCCATGATGGC	0.507																																					p.G1156V		.											.	HEATR6	227	0			c.G3467T						.						116.0	114.0	115.0					17																	58121003		2203	4300	6503	SO:0001583	missense	63897	exon20			AAAAAGCCCATGA	BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.3467G>T	17.37:g.58121003C>A	ENSP00000184956:p.Gly1156Val	134.0	1.0		105.0	46.0	NM_022070	B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Missense_Mutation	SNP	ENST00000184956.6	37	CCDS11623.1	.	.	.	.	.	.	.	.	.	.	C	9.840	1.190718	0.21954	.	.	ENSG00000068097	ENST00000184956;ENST00000393017	T	0.67523	-0.27	4.96	-9.07	0.00724	Armadillo-type fold (1);	0.955798	0.08808	N	0.890773	T	0.38134	0.1029	N	0.19112	0.55	0.09310	N	1	B;B	0.22683	0.073;0.0	B;B	0.15870	0.014;0.0	T	0.14172	-1.0482	10	0.30854	T	0.27	-0.002	3.6789	0.08302	0.1013:0.1518:0.2266:0.5202	.	891;1156	E7ESB9;Q6AI08	.;HEAT6_HUMAN	V	1156;891	ENSP00000184956:G1156V	ENSP00000184956:G1156V	G	-	2	0	HEATR6	55475785	0.000000	0.05858	0.017000	0.16124	0.729000	0.41735	-1.928000	0.01560	-1.289000	0.02375	0.650000	0.86243	GGC	.		0.507	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449165.1	NM_022070	
HNF1A	6927	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	121416899	121416899	+	Splice_Site	SNP	T	T	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr12:121416899T>A	ENST00000257555.6	+	1	552		c.e1+2		HNF1A_ENST00000538626.1_Intron|HNF1A-AS1_ENST00000537361.1_RNA|HNF1A_ENST00000544413.1_Splice_Site|HNF1A-AS1_ENST00000433033.2_RNA|HNF1A_ENST00000543427.1_Splice_Site|HNF1A_ENST00000402929.1_Splice_Site|HNF1A-AS1_ENST00000535301.1_RNA|HNF1A_ENST00000541395.1_Splice_Site|HNF1A_ENST00000400024.2_Splice_Site			P20823	HNF1A_HUMAN	HNF1 homeobox A						glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.?(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CCTTCTGCAGTAAGGAGCCCT	0.642									Hepatic Adenoma, Familial Clustering of																												.		.											.	HNF1A	1745	1	Unknown(1)	liver(1)	c.326+2T>A						.						23.0	30.0	28.0					12																	121416899		2180	4255	6435	SO:0001630	splice_region_variant	6927	exon1	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	CTGCAGTAAGGAG	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.326+2T>A	12.37:g.121416899T>A		66.0	0.0		68.0	13.0	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Splice_Site	SNP	ENST00000257555.6	37	CCDS9209.1	.	.	.	.	.	.	.	.	.	.	T	17.68	3.449297	0.63178	.	.	ENSG00000135100	ENST00000257555;ENST00000535125;ENST00000543536;ENST00000544680;ENST00000537424;ENST00000543027;ENST00000545458;ENST00000541395;ENST00000340577;ENST00000344370;ENST00000544413	.	.	.	4.52	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0315	0.58845	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	HNF1A	119901282	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	6.952000	0.75989	1.674000	0.50907	0.482000	0.46254	.	.		0.642	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	Intron
IFNE	338376	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	21481103	21481103	+	Silent	SNP	C	C	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr9:21481103C>T	ENST00000448696.3	-	1	1209	c.591G>A	c.(589-591)aaG>aaA	p.K197K	MIR31HG_ENST00000304425.3_RNA	NM_176891.4	NP_795372.1	Q86WN2	IFNE_HUMAN	interferon, epsilon	197					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			large_intestine(2)|lung(1)|skin(1)	4						TAAGCTCTTGCTTCATGTCGT	0.438																																					p.K197K		.											.	IFNE	492	0			c.G591A						.						105.0	107.0	107.0					9																	21481103		2203	4300	6503	SO:0001819	synonymous_variant	338376	exon1			CTCTTGCTTCATG	AY190045	CCDS34997.1	9p21.1	2008-12-12			ENSG00000184995	ENSG00000184995			18163	protein-coding gene	gene with protein product		615223				15546383, 17287131	Standard	NM_176891		Approved	IFNE1	uc003zpg.3	Q86WN2	OTTHUMG00000019672	ENST00000448696.3:c.591G>A	9.37:g.21481103C>T		110.0	0.0		77.0	25.0	NM_176891		Silent	SNP	ENST00000448696.3	37	CCDS34997.1																																																																																			.		0.438	IFNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051901.2	NM_176891	
INSRR	3645	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	156815015	156815015	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr1:156815015C>T	ENST00000368195.3	-	12	2686	c.2290G>A	c.(2290-2292)Gag>Aag	p.E764K	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	764					actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					ACCTTGTCCTCCTGGATCTCG	0.687																																					p.E764K		.											.	INSRR	1403	0			c.G2290A						.						22.0	20.0	21.0					1																	156815015		2201	4299	6500	SO:0001583	missense	3645	exon12			TGTCCTCCTGGAT	J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.2290G>A	1.37:g.156815015C>T	ENSP00000357178:p.Glu764Lys	67.0	0.0		87.0	23.0	NM_014215	O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	37	CCDS1160.1	.	.	.	.	.	.	.	.	.	.	C	14.59	2.579539	0.46006	.	.	ENSG00000027644	ENST00000368195	T	0.78126	-1.15	3.39	3.39	0.38822	Fibronectin, type III (2);	0.000000	0.40064	N	0.001187	T	0.47135	0.1429	.	.	.	0.32675	N	0.516305	B	0.15141	0.012	B	0.12837	0.008	T	0.36504	-0.9745	9	0.29301	T	0.29	.	8.5071	0.33195	0.0:0.8877:0.0:0.1123	.	764	P14616	INSRR_HUMAN	K	764	ENSP00000357178:E764K	ENSP00000357178:E764K	E	-	1	0	INSRR	155081639	0.983000	0.35010	0.993000	0.49108	0.986000	0.74619	2.526000	0.45607	2.193000	0.70182	0.561000	0.74099	GAG	.		0.687	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215	
IRF3	3661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50167999	50167999	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr19:50167999G>A	ENST00000597198.1	-	2	478	c.97C>T	c.(97-99)Cgc>Tgc	p.R33C	BCL2L12_ENST00000246785.3_5'Flank|IRF3_ENST00000596765.1_Intron|IRF3_ENST00000442265.2_Missense_Mutation_p.R33C|IRF3_ENST00000309877.7_Missense_Mutation_p.R33C|IRF3_ENST00000596822.1_Intron|IRF3_ENST00000593922.1_Intron|IRF3_ENST00000599144.1_Intron|IRF3_ENST00000598808.1_Intron|BCL2L12_ENST00000246784.3_5'Flank|IRF3_ENST00000599223.1_Missense_Mutation_p.R33C|IRF3_ENST00000601291.1_Missense_Mutation_p.R33C|BCL2L12_ENST00000441864.2_5'Flank|IRF3_ENST00000600911.1_Missense_Mutation_p.R33C|IRF3_ENST00000377135.4_Missense_Mutation_p.R33C|IRF3_ENST00000377139.3_Missense_Mutation_p.R33C|IRF3_ENST00000600022.1_Intron			Q14653	IRF3_HUMAN	interferon regulatory factor 3	33					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dsRNA (GO:0071359)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage apoptotic process (GO:0071888)|MDA-5 signaling pathway (GO:0039530)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of defense response to virus by host (GO:0050689)|negative regulation of interferon-beta biosynthetic process (GO:0045358)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|programmed necrotic cell death (GO:0097300)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(2)|lung(4)|ovary(2)|stomach(1)	10		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.02)		ATGCGGAAGCGCGTGCGGCTC	0.647																																					p.R33C		.											.	IRF3	92	0			c.C97T						.						98.0	91.0	93.0					19																	50167999		2203	4300	6503	SO:0001583	missense	3661	exon2			GGAAGCGCGTGCG		CCDS12775.1, CCDS56099.1, CCDS59407.1, CCDS59408.1, CCDS59409.1	19q13.3-q13.4	2008-07-16				ENSG00000126456			6118	protein-coding gene	gene with protein product		603734				8524823	Standard	NM_001571		Approved		uc002pow.3	Q14653		ENST00000597198.1:c.97C>T	19.37:g.50167999G>A	ENSP00000469113:p.Arg33Cys	67.0	0.0		63.0	12.0	NM_001197122	A8K7L2|B2RAZ3|Q5FBY1|Q5FBY2|Q5FBY4|Q7Z5G6	Missense_Mutation	SNP	ENST00000597198.1	37	CCDS12775.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.028032	0.75390	.	.	ENSG00000126456	ENST00000377139;ENST00000309877;ENST00000377135;ENST00000442265	D;D;D;D	0.97752	-4.52;-4.52;-4.52;-4.52	4.63	3.56	0.40772	Interferon regulatory factor, conserved site (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.238872	0.30109	U	0.010399	D	0.97742	0.9259	L	0.52905	1.665	0.49798	D	0.999825	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;1.0	D;D;D;D;P;D	0.76575	0.972;0.93;0.966;0.966;0.803;0.988	D	0.97222	0.9878	10	0.62326	D	0.03	-8.6232	9.6869	0.40105	0.0:0.0:0.6083:0.3917	.	33;33;33;33;33;33	Q5FBY4;B2RAZ3;Q96GL3;Q7Z5G6;Q14653;Q5FBY1	.;.;.;.;IRF3_HUMAN;.	C	33	ENSP00000366344:R33C;ENSP00000310127:R33C;ENSP00000366339:R33C;ENSP00000400378:R33C	ENSP00000310127:R33C	R	-	1	0	IRF3	54859811	0.834000	0.29399	0.850000	0.33497	0.972000	0.66771	1.515000	0.35845	0.866000	0.35629	0.591000	0.81541	CGC	.		0.647	IRF3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465962.1	NM_001571	
ITGA7	3679	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	56081838	56081841	+	Frame_Shift_Del	DEL	CTGC	CTGC	-			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	CTGC	CTGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr12:56081838_56081841delCTGC	ENST00000555728.1	-	25	3257_3260	c.3229_3232delGCAG	c.(3229-3234)gcagaafs	p.AE1077fs	ITGA7_ENST00000452168.2_Frame_Shift_Del_p.AE940fs|ITGA7_ENST00000553804.1_Frame_Shift_Del_p.AE1037fs|ITGA7_ENST00000394230.2_Frame_Shift_Del_p.AE1037fs|ITGA7_ENST00000394229.2_Frame_Shift_Del_p.AE1033fs|ITGA7_ENST00000257879.6_Frame_Shift_Del_p.AE1033fs|ITGA7_ENST00000347027.6_Frame_Shift_Del_p.AE1027fs|ITGA7_ENST00000257880.7_Frame_Shift_Del_p.AE1077fs			Q13683	ITA7_HUMAN	integrin, alpha 7	1077					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						GGCACTCCTTCTGCCACCACAGCC	0.593																																					p.1037_1038del		.											.	ITGA7	229	0			c.3109_3112del						.																																			SO:0001589	frameshift_variant	3679	exon24			CTCCTTCTGCCAC		CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.3229_3232delGCAG	12.37:g.56081838_56081841delCTGC	ENSP00000452387:p.Ala1077fs	139.0	0.0		97.0	26.0	NM_001144996	B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Frame_Shift_Del	DEL	ENST00000555728.1	37																																																																																				.		0.593	ITGA7-014	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000410138.1	NM_002206	
KATNAL2	83473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	44593424	44593424	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr18:44593424G>T	ENST00000245121.5	+	8	737	c.543G>T	c.(541-543)tgG>tgT	p.W181C	KATNAL2_ENST00000356157.7_Missense_Mutation_p.W253C|KATNAL2_ENST00000592005.1_Intron	NM_031303.2	NP_112593.2			katanin p60 subunit A-like 2											central_nervous_system(2)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	27						ACATAAAGTGGAATGACATTA	0.388																																					p.W181C		.											.	KATNAL2	93	0			c.G543T						.						106.0	96.0	100.0					18																	44593424		2203	4300	6503	SO:0001583	missense	83473	exon8			AAAGTGGAATGAC	BC034999	CCDS32828.1	18q21.1	2010-04-21			ENSG00000167216	ENSG00000167216		"""ATPases / AAA-type"""	25387	protein-coding gene	gene with protein product		614697				12477932	Standard	NM_031303		Approved	MGC33211, DKFZP667C165	uc002lco.3	Q8IYT4		ENST00000245121.5:c.543G>T	18.37:g.44593424G>T	ENSP00000245121:p.Trp181Cys	69.0	0.0		58.0	19.0	NM_031303		Missense_Mutation	SNP	ENST00000245121.5	37	CCDS32828.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.192716	0.78902	.	.	ENSG00000167216	ENST00000356157;ENST00000245121;ENST00000454462	D;D	0.95001	-3.58;-3.58	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.98391	0.9465	H	0.96269	3.795	0.80722	D	1	.	.	.	.	.	.	D	0.98826	1.0749	8	0.87932	D	0	-1.4157	20.3539	0.98825	0.0:0.0:1.0:0.0	.	.	.	.	C	253;181;21	ENSP00000348478:W253C;ENSP00000245121:W181C	ENSP00000245121:W181C	W	+	3	0	KATNAL2	42847422	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	9.014000	0.93635	2.826000	0.97356	0.655000	0.94253	TGG	.		0.388	KATNAL2-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446138.2	NM_031303	
KLHL33	123103	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	20898166	20898166	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr14:20898166C>T	ENST00000344581.4	-	2	891	c.669G>A	c.(667-669)atG>atA	p.M223I		NM_001109997.2	NP_001103467.2	A6NCF5	KLH33_HUMAN	kelch-like family member 33	223												all_cancers(95;0.00123)		Epithelial(56;7.57e-08)|all cancers(55;8.63e-07)	GBM - Glioblastoma multiforme(265;0.0223)|READ - Rectum adenocarcinoma(17;0.193)		GTCTTAGGGCCATGTCTGGTC	0.637																																					p.M223I		.											.	.	.	0			c.G669A						.						61.0	74.0	70.0					14																	20898166		692	1591	2283	SO:0001583	missense	123103	exon2			TAGGGCCATGTCT		CCDS53882.1	14q11.2	2013-10-15	2013-02-22		ENSG00000185271	ENSG00000185271		"""Kelch-like"""	31952	protein-coding gene	gene with protein product			"""kelch-like 33 (Drosophila)"""				Standard	NM_001109997		Approved		uc010tli.2	A6NCF5	OTTHUMG00000170982	ENST00000344581.4:c.669G>A	14.37:g.20898166C>T	ENSP00000341549:p.Met223Ile	86.0	0.0		66.0	5.0	NM_001109997		Missense_Mutation	SNP	ENST00000344581.4	37	CCDS53882.1	.	.	.	.	.	.	.	.	.	.	C	10.63	1.403702	0.25291	.	.	ENSG00000185271	ENST00000344581	T	0.71817	-0.6	4.69	3.71	0.42584	.	0.531580	0.20456	N	0.091992	T	0.45776	0.1359	N	0.14661	0.345	0.28863	N	0.895387	B	0.20164	0.042	B	0.16289	0.015	T	0.31558	-0.9939	10	0.02654	T	1	.	9.5947	0.39567	0.0:0.8882:0.0:0.1118	.	223	A6NCF5	KLH33_HUMAN	I	223	ENSP00000341549:M223I	ENSP00000341549:M223I	M	-	3	0	KLHL33	19968006	1.000000	0.71417	0.999000	0.59377	0.884000	0.51177	0.862000	0.27899	2.414000	0.81942	0.655000	0.94253	ATG	.		0.637	KLHL33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411038.1	XM_063481	
KPTN	11133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	47984228	47984228	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr19:47984228T>C	ENST00000338134.3	-	5	619	c.512A>G	c.(511-513)cAt>cGt	p.H171R	KPTN_ENST00000595484.1_5'UTR|KPTN_ENST00000536339.1_5'UTR	NM_007059.2	NP_008990.2	Q9Y664	KPTN_HUMAN	kaptin (actin binding protein)	171					actin filament organization (GO:0007015)|cellular component movement (GO:0006928)|sensory perception of sound (GO:0007605)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(1)|lung(3)|ovary(2)|pancreas(2)	8		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000428)|all cancers(93;0.000631)|Epithelial(262;0.0153)|GBM - Glioblastoma multiforme(486;0.0694)		CTTGTAGAGATGAATGGCCGG	0.567																																					p.H171R		.											.	KPTN	91	0			c.A512G						.						41.0	43.0	43.0					19																	47984228		1963	4153	6116	SO:0001583	missense	11133	exon5			TAGAGATGAATGG	AF105369	CCDS42583.1	19q13.32	2014-08-13	2001-11-28		ENSG00000118162	ENSG00000118162			6404	protein-coding gene	gene with protein product		615620	"""kaptin (actin-binding protein)"""			10099934	Standard	XM_005258467		Approved	2E4	uc002pgy.3	Q9Y664	OTTHUMG00000183443	ENST00000338134.3:c.512A>G	19.37:g.47984228T>C	ENSP00000337850:p.His171Arg	81.0	0.0		90.0	21.0	NM_007059	B3KN86|B4DQ76|Q96GT1	Missense_Mutation	SNP	ENST00000338134.3	37	CCDS42583.1	.	.	.	.	.	.	.	.	.	.	T	19.97	3.924398	0.73213	.	.	ENSG00000118162	ENST00000338134	T	0.42900	0.96	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.68439	0.3001	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74386	-0.3682	10	0.87932	D	0	.	14.8738	0.70481	0.0:0.0:0.0:1.0	.	171	Q9Y664	KPTN_HUMAN	R	171	ENSP00000337850:H171R	ENSP00000337850:H171R	H	-	2	0	KPTN	52676040	1.000000	0.71417	1.000000	0.80357	0.428000	0.31595	6.512000	0.73737	2.153000	0.67306	0.374000	0.22700	CAT	.		0.567	KPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466672.2		
L3MBTL1	26013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	42159524	42159524	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr20:42159524A>T	ENST00000427442.2	+	11	1372	c.1213A>T	c.(1213-1215)Agc>Tgc	p.S405C	L3MBTL1_ENST00000444063.1_Missense_Mutation_p.S337C|L3MBTL1_ENST00000418998.1_Missense_Mutation_p.S405C|L3MBTL1_ENST00000373135.3_Missense_Mutation_p.S337C|L3MBTL1_ENST00000373134.1_Missense_Mutation_p.S337C			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	337					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						TGTGAGCCAGAGCCACGTGAG	0.592																																					p.S405C		.											.	L3MBTL1	227	0			c.A1213T						.						60.0	51.0	54.0					20																	42159524		2203	4300	6503	SO:0001583	missense	26013	exon11			AGCCAGAGCCACG	U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.1213A>T	20.37:g.42159524A>T	ENSP00000402107:p.Ser405Cys	155.0	0.0		124.0	38.0	NM_032107	B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Missense_Mutation	SNP	ENST00000427442.2	37	CCDS46602.2	.	.	.	.	.	.	.	.	.	.	A	19.15	3.771998	0.69992	.	.	ENSG00000185513	ENST00000427442;ENST00000418998;ENST00000373135;ENST00000444063;ENST00000373134;ENST00000422861	D;D;D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83;-1.83;-1.83	5.06	5.06	0.68205	.	0.291907	0.43747	D	0.000536	D	0.86661	0.5986	M	0.69523	2.12	0.27485	N	0.952468	D;D;D	0.65815	0.995;0.985;0.989	P;B;P	0.50617	0.646;0.441;0.646	T	0.82721	-0.0317	10	0.72032	D	0.01	.	9.2855	0.37755	0.9141:0.0:0.0859:0.0	.	405;337;337	Q9Y468-5;Q9Y468-2;Q9Y468-1	.;.;.	C	405;405;337;337;337;123	ENSP00000402107:S405C;ENSP00000398516:S405C;ENSP00000362227:S337C;ENSP00000403316:S337C;ENSP00000362226:S337C;ENSP00000410139:S123C	ENSP00000362226:S337C	S	+	1	0	L3MBTL1	41592938	0.581000	0.26741	1.000000	0.80357	0.999000	0.98932	3.107000	0.50329	2.042000	0.60477	0.533000	0.62120	AGC	.		0.592	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079300.3	NM_032107	
L3MBTL1	26013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	42159526	42159526	+	Silent	SNP	C	C	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr20:42159526C>T	ENST00000427442.2	+	11	1374	c.1215C>T	c.(1213-1215)agC>agT	p.S405S	L3MBTL1_ENST00000444063.1_Silent_p.S337S|L3MBTL1_ENST00000418998.1_Silent_p.S405S|L3MBTL1_ENST00000373135.3_Silent_p.S337S|L3MBTL1_ENST00000373134.1_Silent_p.S337S			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	337					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						TGAGCCAGAGCCACGTGAGTG	0.592																																					p.S405S		.											.	L3MBTL1	227	0			c.C1215T						.						60.0	50.0	54.0					20																	42159526		2203	4300	6503	SO:0001819	synonymous_variant	26013	exon11			CCAGAGCCACGTG	U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.1215C>T	20.37:g.42159526C>T		150.0	0.0		120.0	37.0	NM_032107	B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Silent	SNP	ENST00000427442.2	37	CCDS46602.2																																																																																			.		0.592	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079300.3	NM_032107	
LHFPL2	10184	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	77805629	77805629	+	Silent	SNP	A	A	G			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr5:77805629A>G	ENST00000515007.2	-	2	718	c.408T>C	c.(406-408)tgT>tgC	p.C136C	LHFPL2_ENST00000380345.2_Silent_p.C136C			Q6ZUX7	LHPL2_HUMAN	lipoma HMGIC fusion partner-like 2	136						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	6		all_lung(232;0.000409)|Lung NSC(167;0.00108)|Ovarian(174;0.0107)|Prostate(461;0.218)		OV - Ovarian serous cystadenocarcinoma(54;6.48e-46)|Epithelial(54;8.43e-42)|all cancers(79;1.42e-36)		GCAACAGCCCACAGACATTGA	0.547																																					p.C136C		.											.	LHFPL2	90	0			c.T408C						.						111.0	115.0	113.0					5																	77805629		2203	4300	6503	SO:0001819	synonymous_variant	10184	exon4			CAGCCCACAGACA	D86961	CCDS4042.1	5q13	2008-02-05			ENSG00000145685	ENSG00000145685			6588	protein-coding gene	gene with protein product		609718				10329012	Standard	NM_005779		Approved	KIAA0206	uc003kfo.3	Q6ZUX7	OTTHUMG00000107579	ENST00000515007.2:c.408T>C	5.37:g.77805629A>G		57.0	0.0		45.0	18.0	NM_005779	B2RMQ6|Q7Z5P0|Q92605	Silent	SNP	ENST00000515007.2	37	CCDS4042.1																																																																																			.		0.547	LHFPL2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369098.2	NM_005779	
LRP4	4038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	11	46880821	46880821	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr11:46880821C>A	ENST00000378623.1	-	38	5673	c.5431G>T	c.(5431-5433)Gag>Tag	p.E1811*	LRP4-AS1_ENST00000531719.1_RNA|LRP4-AS1_ENST00000502049.2_RNA	NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	1811					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		CAGATTCCCTCTACGATCTTG	0.547																																					p.E1811X		.											.	LRP4	94	0			c.G5431T						.						152.0	142.0	145.0					11																	46880821		2201	4299	6500	SO:0001587	stop_gained	4038	exon38			TTCCCTCTACGAT	AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.5431G>T	11.37:g.46880821C>A	ENSP00000367888:p.Glu1811*	88.0	0.0		82.0	25.0	NM_002334	B2RN39|Q4AC85|Q5KTZ5	Nonsense_Mutation	SNP	ENST00000378623.1	37	CCDS31478.1	.	.	.	.	.	.	.	.	.	.	C	47	13.226188	0.99728	.	.	ENSG00000134569	ENST00000378623	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.0953	0.97838	0.0:1.0:0.0:0.0	.	.	.	.	X	1811	.	ENSP00000367888:E1811X	E	-	1	0	LRP4	46837397	1.000000	0.71417	0.994000	0.49952	0.862000	0.49288	7.461000	0.80834	2.767000	0.95098	0.655000	0.94253	GAG	.		0.547	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391133.1	NM_002334	
LRRN1	57633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	3887625	3887625	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr3:3887625C>T	ENST00000319331.3	+	2	2061	c.1300C>T	c.(1300-1302)Cgt>Tgt	p.R434C	SUMF1_ENST00000534863.1_Intron	NM_020873.5	NP_065924.3	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1	434	Ig-like C2-type.					integral component of membrane (GO:0016021)				NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	26				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		CTTCCCAAATCGTTTAAACGT	0.478																																					p.R434C		.											.	LRRN1	90	0			c.C1300T						.						90.0	92.0	91.0					3																	3887625		2203	4300	6503	SO:0001583	missense	57633	exon2			CCAAATCGTTTAA	AB040930	CCDS33685.1	3p26.2	2013-01-11			ENSG00000175928	ENSG00000175928		"""Immunoglobulin superfamily / I-set domain containing"""	20980	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 3"""					10819331	Standard	NM_020873		Approved	FIGLER3	uc003bpt.4	Q6UXK5	OTTHUMG00000154934	ENST00000319331.3:c.1300C>T	3.37:g.3887625C>T	ENSP00000314901:p.Arg434Cys	150.0	0.0		109.0	10.0	NM_020873	Q3LID5|Q8IYV5|Q9H8V1|Q9P231	Missense_Mutation	SNP	ENST00000319331.3	37	CCDS33685.1	.	.	.	.	.	.	.	.	.	.	C	12.86	2.063475	0.36373	.	.	ENSG00000175928	ENST00000319331	T	0.68331	-0.32	5.65	5.65	0.86999	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.138414	0.64402	D	0.000003	T	0.68842	0.3045	L	0.47716	1.5	0.45747	D	0.998646	P	0.49253	0.921	P	0.46975	0.533	T	0.70934	-0.4737	10	0.56958	D	0.05	.	19.7243	0.96157	0.0:1.0:0.0:0.0	.	434	Q6UXK5	LRRN1_HUMAN	C	434	ENSP00000314901:R434C	ENSP00000314901:R434C	R	+	1	0	LRRN1	3862625	1.000000	0.71417	0.077000	0.20336	0.864000	0.49448	6.030000	0.70903	2.665000	0.90641	0.650000	0.86243	CGT	.		0.478	LRRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337704.2	NM_020873	
MARCH4	57574	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	217124227	217124227	+	Silent	SNP	C	C	T	rs139359941	byFrequency	TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr2:217124227C>T	ENST00000273067.4	-	4	2807	c.1041G>A	c.(1039-1041)tcG>tcA	p.S347S	AC012513.6_ENST00000417481.1_RNA	NM_020814.2	NP_065865.1	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase	347						Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(1)	20		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		TCTCCTCTTCCGAGGAGGGGA	0.622													C|||	4	0.000798722	0.0	0.0	5008	,	,		18850	0.0		0.0	False		,,,				2504	0.0041				p.S347S		.											.	MARCH4	69	0			c.G1041A						.	C		0,4406		0,0,2203	55.0	55.0	55.0		1041	-11.2	0.0	2	dbSNP_134	55	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MARCH4	NM_020814.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		347/411	217124227	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57574	exon4			CTCTTCCGAGGAG	AB037820	CCDS33376.1	2q35	2013-01-09	2012-02-23		ENSG00000144583	ENSG00000144583		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	29269	protein-coding gene	gene with protein product		608208	"""membrane-associated ring finger (C3HC4) 4"""			10718198, 14722266	Standard	NM_020814		Approved	KIAA1399, MARCH-IV, RNF174	uc002vgb.3	Q9P2E8	OTTHUMG00000154824	ENST00000273067.4:c.1041G>A	2.37:g.217124227C>T		118.0	0.0		88.0	32.0	NM_020814	Q4KMN7|Q86WR8	Silent	SNP	ENST00000273067.4	37	CCDS33376.1																																																																																			C|1.000;T|0.000		0.622	MARCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337272.2	NM_020814	
MCM10	55388	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	13234349	13234349	+	Silent	SNP	C	C	G			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr10:13234349C>G	ENST00000484800.2	+	12	1717	c.1614C>G	c.(1612-1614)gcC>gcG	p.A538A	MCM10_ENST00000378694.1_Silent_p.A537A|MCM10_ENST00000378714.3_Silent_p.A537A			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	538					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						AACATTTAGCCAAAGCCACAG	0.552																																					p.A538A		.											.	MCM10	653	0			c.C1614G						.						147.0	116.0	127.0					10																	13234349		2203	4300	6503	SO:0001819	synonymous_variant	55388	exon12			TTTAGCCAAAGCC	AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.1614C>G	10.37:g.13234349C>G		75.0	0.0		77.0	24.0	NM_182751	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Silent	SNP	ENST00000484800.2	37	CCDS7096.1																																																																																			.		0.552	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356853.1	NM_182751	
MFSD8	256471	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	128851953	128851953	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr4:128851953T>C	ENST00000296468.3	-	10	1010	c.883A>G	c.(883-885)Atg>Gtg	p.M295V	MFSD8_ENST00000513559.1_Missense_Mutation_p.M250V|MFSD8_ENST00000515130.1_5'UTR|MFSD8_ENST00000541133.1_3'UTR	NM_152778.2	NP_689991.1	Q8NHS3	MFSD8_HUMAN	major facilitator superfamily domain containing 8	295					cell death (GO:0008219)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)				cervix(2)|endometrium(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)	23						TACATATCCATTGTTAATGGA	0.303																																					p.M295V		.											.	MFSD8	92	0			c.A883G						.						92.0	96.0	95.0					4																	128851953		2203	4298	6501	SO:0001583	missense	256471	exon10			TATCCATTGTTAA	AK074564	CCDS3736.1	4q28.2	2014-09-17			ENSG00000164073	ENSG00000164073			28486	protein-coding gene	gene with protein product		611124	"""ceroid-lipofuscinosis, neuronal 7, late infantile, variant"""	CLN7		17564970	Standard	NM_152778		Approved	MGC33302	uc003ifp.3	Q8NHS3	OTTHUMG00000133303	ENST00000296468.3:c.883A>G	4.37:g.128851953T>C	ENSP00000296468:p.Met295Val	293.0	0.0		233.0	13.0	NM_152778	B2RDM1|B7Z205|Q8N2P3	Missense_Mutation	SNP	ENST00000296468.3	37	CCDS3736.1	.	.	.	.	.	.	.	.	.	.	T	11.61	1.690288	0.29962	.	.	ENSG00000164073	ENST00000296468;ENST00000513559	T;T	0.79845	-1.31;-1.31	4.65	3.44	0.39384	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.086307	0.85682	D	0.000000	T	0.81955	0.4932	M	0.79123	2.44	0.80722	D	1	P;P	0.36483	0.518;0.555	B;B	0.43508	0.08;0.422	T	0.77512	-0.2560	10	0.25751	T	0.34	-19.7122	11.6783	0.51442	0.0:0.0:0.1479:0.8521	.	257;295	B7Z280;Q8NHS3	.;MFSD8_HUMAN	V	295;250	ENSP00000296468:M295V;ENSP00000425000:M250V	ENSP00000296468:M295V	M	-	1	0	MFSD8	129071403	1.000000	0.71417	0.979000	0.43373	0.089000	0.18198	5.160000	0.64929	0.780000	0.33566	0.383000	0.25322	ATG	.		0.303	MFSD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257097.1	NM_152778	
KMT2E	55904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	104753453	104753453	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr7:104753453T>G	ENST00000311117.3	+	27	5795	c.5250T>G	c.(5248-5250)ttT>ttG	p.F1750L	KMT2E_ENST00000257745.4_Missense_Mutation_p.F1750L|SRPK2_ENST00000493638.1_Intron|KMT2E_ENST00000334877.4_Missense_Mutation_p.F1708L	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1750	Pro-rich. {ECO:0000255}.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										CTCCACTTTTTCCTTCGAGTG	0.562																																					p.F1750L		.											.	MLL5	93	0			c.T5250G						.						277.0	217.0	237.0					7																	104753453		2203	4300	6503	SO:0001583	missense	55904	exon26			ACTTTTTCCTTCG	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.5250T>G	7.37:g.104753453T>G	ENSP00000312379:p.Phe1750Leu	229.0	0.0		264.0	72.0	NM_018682	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	37	CCDS34723.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	10.31|10.31	1.315469|1.315469	0.23908|0.23908	.|.	.|.	ENSG00000005483|ENSG00000005483	ENST00000393656|ENST00000311117;ENST00000334877;ENST00000351043;ENST00000257745	.|D;D;D	.|0.94046	.|-3.34;-3.32;-3.34	3.94|3.94	-3.09|-3.09	0.05331|0.05331	.|.	0.000000|0.000000	0.45126|0.45126	D|D	0.000398|0.000398	D|D	0.90407|0.90407	0.6997|0.6997	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	.|D;P	.|0.67145	.|0.996;0.956	.|D;D	.|0.70935	.|0.971;0.931	D|D	0.85509|0.85509	0.1196|0.1196	7|10	0.87932|0.12103	D|T	0|0.63	.|.	11.913|11.913	0.52749|0.52749	0.0:0.5905:0.0:0.4095|0.0:0.5905:0.0:0.4095	.|.	.|1670;1750	.|F8W6H1;Q8IZD2	.|.;MLL5_HUMAN	C|L	1533|1750;1708;1670;1750	.|ENSP00000312379:F1750L;ENSP00000335599:F1708L;ENSP00000257745:F1750L	ENSP00000377266:F1533C|ENSP00000257745:F1750L	F|F	+|+	2|3	0|2	MLL5|MLL5	104540689|104540689	0.388000|0.388000	0.25197|0.25197	0.779000|0.779000	0.31741|0.31741	0.695000|0.695000	0.40330|0.40330	-0.688000|-0.688000	0.05150|0.05150	-0.551000|-0.551000	0.06175|0.06175	0.373000|0.373000	0.22412|0.22412	TTC|TTT	.		0.562	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
MYBBP1A	10514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	4442761	4442761	+	Silent	SNP	A	A	C			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr17:4442761A>C	ENST00000254718.4	-	26	4242	c.3936T>G	c.(3934-3936)ctT>ctG	p.L1312L	MYBBP1A_ENST00000381556.2_Silent_p.L1312L			Q9BQG0	MBB1A_HUMAN	MYB binding protein (P160) 1a	1312	Required for nuclear and nucleolar localization. {ECO:0000250}.				cellular response to glucose starvation (GO:0042149)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|osteoblast differentiation (GO:0001649)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|NLS-dependent protein nuclear import complex (GO:0042564)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)	24						CCCCACTCTGAAGCAGGCTGG	0.607																																					p.L1312L		.											.	MYBBP1A	92	0			c.T3936G						.						128.0	133.0	131.0					17																	4442761		2203	4300	6503	SO:0001819	synonymous_variant	10514	exon26			ACTCTGAAGCAGG	AF147709	CCDS11046.1, CCDS42238.1	17p13.3	2008-07-18			ENSG00000132382	ENSG00000132382			7546	protein-coding gene	gene with protein product	"""p53-activated protein-2"""	604885				10644447	Standard	NM_014520		Approved	P160, PAP2, FLJ37886	uc002fxz.4	Q9BQG0	OTTHUMG00000090747	ENST00000254718.4:c.3936T>G	17.37:g.4442761A>C		65.0	0.0		68.0	24.0	NM_014520	Q86VM3|Q9BW49|Q9P0V5|Q9UF99	Silent	SNP	ENST00000254718.4	37	CCDS11046.1																																																																																			.		0.607	MYBBP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207488.2	NM_014520	
NHS	4810	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	17746802	17746802	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chrX:17746802C>T	ENST00000380060.3	+	7	4531	c.4193C>T	c.(4192-4194)cCa>cTa	p.P1398L	NHS_ENST00000398097.3_Missense_Mutation_p.P1242L	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	1419					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					ATCATTTCACCACTTAGTGAA	0.438																																					p.P1398L		.											.	NHS	197	0			c.C4193T						.						105.0	95.0	99.0					X																	17746802		2203	4300	6503	SO:0001583	missense	4810	exon7			TTTCACCACTTAG		CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.4193C>T	X.37:g.17746802C>T	ENSP00000369400:p.Pro1398Leu	233.0	0.0		243.0	96.0	NM_198270	B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	ENST00000380060.3	37	CCDS14181.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.654102	0.88056	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.48522	0.81;0.81	6.06	6.06	0.98353	.	0.052914	0.85682	D	0.000000	T	0.61949	0.2388	L	0.54323	1.7	0.80722	D	1	P;P;P;P	0.51933	0.859;0.859;0.859;0.949	B;B;B;P	0.56278	0.435;0.435;0.435;0.795	T	0.60306	-0.7289	10	0.52906	T	0.07	-14.6648	19.5104	0.95139	0.0:1.0:0.0:0.0	.	1419;1240;1242;1398	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	L	1398;1242;1240	ENSP00000369400:P1398L;ENSP00000381170:P1242L	ENSP00000369397:P1240L	P	+	2	0	NHS	17656723	0.998000	0.40836	0.997000	0.53966	0.991000	0.79684	5.288000	0.65651	2.562000	0.86427	0.600000	0.82982	CCA	.		0.438	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059120.1	NM_198270	
NRXN2	9379	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	64434903	64434903	+	Silent	SNP	C	C	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr11:64434903C>T	ENST00000377551.1	-	8	1828	c.1617G>A	c.(1615-1617)ggG>ggA	p.G539G	NRXN2_ENST00000265459.6_Silent_p.G539G|NRXN2_ENST00000409571.1_Silent_p.G532G|NRXN2_ENST00000377559.3_Silent_p.G508G			Q9P2S2	NRX2A_HUMAN	neurexin 2	539	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						CAGCTCCACCCCCAGCCCGCC	0.652																																					p.G539G		.											.	NRXN2	232	0			c.G1617A						.						47.0	51.0	50.0					11																	64434903		2201	4297	6498	SO:0001819	synonymous_variant	9379	exon9			TCCACCCCCAGCC		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.1617G>A	11.37:g.64434903C>T		71.0	0.0		70.0	6.0	NM_015080	A7E2C1|Q9Y2D6	Silent	SNP	ENST00000377551.1	37	CCDS8077.1																																																																																			.		0.652	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080	
NT5C1B	93034	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	2	18765784	18765784	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr2:18765784C>T	ENST00000359846.2	-	5	976	c.899G>A	c.(898-900)tGg>tAg	p.W300*	NT5C1B_ENST00000460052.1_5'Flank|NT5C1B_ENST00000600945.1_Nonsense_Mutation_p.W300*|RNU6-1215P_ENST00000384441.1_RNA|NT5C1B-RDH14_ENST00000532967.1_Nonsense_Mutation_p.W300*|NT5C1B_ENST00000304081.4_Nonsense_Mutation_p.W240*	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	300					nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				GCTCACCGGCCAGGGGCGCGA	0.697																																					p.W317X		.											.	NT5C1B	47	0			c.G950A						.						8.0	9.0	9.0					2																	18765784		2151	4216	6367	SO:0001587	stop_gained	93034	exon5			ACCGGCCAGGGGC	AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.899G>A	2.37:g.18765784C>T	ENSP00000352904:p.Trp300*	40.0	0.0		57.0	13.0	NM_001199087	B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Nonsense_Mutation	SNP	ENST00000359846.2	37	CCDS33150.1	.	.	.	.	.	.	.	.	.	.	C	19.74	3.884710	0.72410	.	.	ENSG00000250741;ENSG00000250741;ENSG00000185013;ENSG00000185013	ENST00000532967;ENST00000444297;ENST00000304081;ENST00000359846	.	.	.	4.59	3.71	0.42584	.	0.177705	0.47852	D	0.000215	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-1.5138	4.4181	0.11466	0.1537:0.6075:0.1497:0.0891	.	.	.	.	X	300;242;240;300	.	ENSP00000305979:W240X	W	-	2	0	NT5C1B-RDH14;NT5C1B	18629265	0.851000	0.29673	0.957000	0.39632	0.296000	0.27459	0.781000	0.26774	1.241000	0.43820	0.462000	0.41574	TGG	.		0.697	NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323822.1		
OR1G1	8390	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	3030650	3030650	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr17:3030650G>A	ENST00000328890.2	-	1	225	c.196C>T	c.(196-198)Ctc>Ttc	p.L66F		NM_003555.1	NP_003546.1	P47890	OR1G1_HUMAN	olfactory receptor, family 1, subfamily G, member 1	66					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(3)|skin(3)	11						GCAAGGGAGAGGTTGGCTAGA	0.498																																					p.L66F	Colon(127;1481 1654 8243 19426 50557)	.											.	OR1G1	68	0			c.C196T						.						106.0	93.0	97.0					17																	3030650		2203	4300	6503	SO:0001583	missense	8390	exon1			GGGAGAGGTTGGC	U04689	CCDS11020.1	17p13.3	2012-08-09			ENSG00000183024	ENSG00000183024		"""GPCR / Class A : Olfactory receptors"""	8204	protein-coding gene	gene with protein product				OR1G2		8004088, 9500546	Standard	NM_003555		Approved	OR17-209	uc002fvc.1	P47890	OTTHUMG00000090618	ENST00000328890.2:c.196C>T	17.37:g.3030650G>A	ENSP00000331545:p.Leu66Phe	81.0	0.0		71.0	20.0	NM_003555	Q4VBM1|Q6IFL9|Q9UM76	Missense_Mutation	SNP	ENST00000328890.2	37	CCDS11020.1	.	.	.	.	.	.	.	.	.	.	G	14.81	2.647856	0.47258	.	.	ENSG00000183024	ENST00000328890	T	0.00354	7.93	4.4	2.29	0.28610	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00580	0.0019	M	0.73598	2.24	0.09310	N	0.999995	D	0.69078	0.997	D	0.66196	0.942	T	0.50906	-0.8772	9	0.87932	D	0	.	5.5367	0.17016	0.1792:0.0:0.6642:0.1565	.	66	P47890	OR1G1_HUMAN	F	66	ENSP00000331545:L66F	ENSP00000331545:L66F	L	-	1	0	OR1G1	2977400	0.011000	0.17503	0.295000	0.24960	0.948000	0.59901	-0.157000	0.10085	1.062000	0.40625	0.530000	0.56133	CTC	.		0.498	OR1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207206.2		
ORMDL2	29095	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	56214115	56214116	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr12:56214115_56214116delGT	ENST00000243045.5	+	4	593_594	c.398_399delGT	c.(397-399)agtfs	p.S133fs	ORMDL2_ENST00000548974.1_Frame_Shift_Del_p.S133fs|ORMDL2_ENST00000552672.1_Frame_Shift_Del_p.S99fs|ORMDL2_ENST00000550836.1_Frame_Shift_Del_p.S45fs|SARNP_ENST00000444631.2_5'Flank|RP11-762I7.5_ENST00000552719.1_Intron|RP11-762I7.5_ENST00000546837.1_Intron|SARNP_ENST00000336133.3_5'Flank|SARNP_ENST00000552080.1_5'Flank	NM_014182.4	NP_054901.1	Q53FV1	ORML2_HUMAN	ORMDL sphingolipid biosynthesis regulator 2	133					ceramide metabolic process (GO:0006672)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(1)|lung(3)	4						TCATTGCTAAGTGTACTGCTGC	0.505																																					p.133_133del		.											.	ORMDL2	68	0			c.398_399del						.																																			SO:0001589	frameshift_variant	29095	exon4			TGCTAAGTGTACT	AF395707	CCDS8893.1	12q13.2	2014-06-16	2014-06-16			ENSG00000123353			16037	protein-coding gene	gene with protein product		610074	"""ORM1 (S. cerevisiae)-like 2"", ""ORM1-like 2 (S. cerevisiae)"""			12093374, 23066021	Standard	NM_014182		Approved	HSPC160, adoplin-2, MST095, MSTP095	uc001shw.1	Q53FV1		ENST00000243045.5:c.398_399delGT	12.37:g.56214117_56214118delGT	ENSP00000243045:p.Ser133fs	179.0	0.0		142.0	36.0	NM_014182	B2RA58|Q7Z4E5|Q8NFX0|Q9P004	Frame_Shift_Del	DEL	ENST00000243045.5	37	CCDS8893.1																																																																																			.		0.505	ORMDL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407934.1	NM_014182	
OXSR1	9943	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	38263170	38263170	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr3:38263170A>G	ENST00000446845.1	+	6	964	c.592A>G	c.(592-594)Atg>Gtg	p.M198V	OXSR1_ENST00000311806.3_Missense_Mutation_p.M198V					oxidative stress responsive 1											skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		ACCTGAAGTTATGGAACAGGT	0.398																																					p.M198V		.											.	OXSR1	311	0			c.A592G						.						171.0	170.0	170.0					3																	38263170		2203	4300	6503	SO:0001583	missense	9943	exon6			GAAGTTATGGAAC	AB017642	CCDS2675.1	3p22.2	2013-05-17	2013-05-17	2004-11-26	ENSG00000172939	ENSG00000172939			8508	protein-coding gene	gene with protein product		604046	"""oxidative-stress responsive 1"""	OSR1		10083736	Standard	XM_005265638		Approved	KIAA1101	uc003chy.3	O95747	OTTHUMG00000131084	ENST00000446845.1:c.592A>G	3.37:g.38263170A>G	ENSP00000415851:p.Met198Val	102.0	0.0		91.0	7.0	NM_005109		Missense_Mutation	SNP	ENST00000446845.1	37		.	.	.	.	.	.	.	.	.	.	A	21.9	4.222953	0.79464	.	.	ENSG00000172939	ENST00000446845;ENST00000311806	T;T	0.63255	-0.03;-0.03	5.26	5.26	0.73747	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.63082	0.2481	N	0.11892	0.195	0.80722	D	1	D;D	0.62365	0.991;0.991	D;D	0.67382	0.934;0.951	T	0.69487	-0.5132	10	0.59425	D	0.04	-19.2781	14.6683	0.68924	1.0:0.0:0.0:0.0	.	198;198	C9JIG9;O95747	.;OXSR1_HUMAN	V	198	ENSP00000415851:M198V;ENSP00000311713:M198V	ENSP00000311713:M198V	M	+	1	0	OXSR1	38238174	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.240000	0.95396	2.134000	0.65973	0.460000	0.39030	ATG	.		0.398	OXSR1-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000342708.1	NM_005109	
PCDHB2	56133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140475012	140475012	+	Missense_Mutation	SNP	C	C	A	rs376693798		TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr5:140475012C>A	ENST00000194155.4	+	1	786	c.638C>A	c.(637-639)aCc>aAc	p.T213N		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	213	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATCAGGTTAACCCTCACAGCG	0.522																																					p.T213N		.											.	PCDHB2	96	0			c.C638A						.						41.0	43.0	43.0					5																	140475012		2203	4300	6503	SO:0001583	missense	56133	exon1			GGTTAACCCTCAC	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.638C>A	5.37:g.140475012C>A	ENSP00000194155:p.Thr213Asn	64.0	0.0		46.0	15.0	NM_018936	Q4KMU1	Missense_Mutation	SNP	ENST00000194155.4	37	CCDS4244.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.848603	0.51164	.	.	ENSG00000112852	ENST00000194155	T	0.55052	0.54	5.42	0.512	0.16994	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.66742	0.2820	M	0.75085	2.285	0.09310	N	1	D	0.58970	0.984	D	0.63283	0.913	T	0.57888	-0.7733	9	0.87932	D	0	.	10.0225	0.42053	0.0:0.4781:0.0:0.5219	.	213	Q9Y5E7	PCDB2_HUMAN	N	213	ENSP00000194155:T213N	ENSP00000194155:T213N	T	+	2	0	PCDHB2	140455196	0.000000	0.05858	0.787000	0.31911	0.959000	0.62525	-0.903000	0.04084	-0.127000	0.11661	0.655000	0.94253	ACC	.		0.522	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
PDK4	5166	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	95216812	95216812	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr7:95216812A>C	ENST00000005178.5	-	9	1096	c.899T>G	c.(898-900)cTg>cGg	p.L300R		NM_002612.3	NP_002603.1	Q16654	PDK4_HUMAN	pyruvate dehydrogenase kinase, isozyme 4	300	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|negative regulation of anoikis (GO:2000811)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|reactive oxygen species metabolic process (GO:0072593)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of bone resorption (GO:0045124)|regulation of cellular ketone metabolic process (GO:0010565)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose metabolic process (GO:0010906)|regulation of pH (GO:0006885)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0151)			AATAATTCTCAGGGGAACACC	0.388																																					p.L300R		.											.	PDK4	358	0			c.T899G						.						77.0	79.0	78.0					7																	95216812		2203	4300	6503	SO:0001583	missense	5166	exon9			ATTCTCAGGGGAA	U54617	CCDS5643.1	7q21.3-q22.1	2008-07-18	2005-11-16		ENSG00000004799	ENSG00000004799			8812	protein-coding gene	gene with protein product		602527	"""pyruvate dehydrogenase kinase, isoenzyme 4"""			7499431	Standard	NM_002612		Approved		uc003uoa.3	Q16654	OTTHUMG00000153977	ENST00000005178.5:c.899T>G	7.37:g.95216812A>C	ENSP00000005178:p.Leu300Arg	117.0	0.0		126.0	32.0	NM_002612		Missense_Mutation	SNP	ENST00000005178.5	37	CCDS5643.1	.	.	.	.	.	.	.	.	.	.	A	15.48	2.847315	0.51164	.	.	ENSG00000004799	ENST00000005178;ENST00000542888	T	0.54279	0.58	5.61	5.61	0.85477	Signal transduction histidine kinase, core (1);ATPase-like, ATP-binding domain (4);	0.066915	0.64402	D	0.000010	T	0.28366	0.0701	N	0.02225	-0.63	0.80722	D	1	B	0.12630	0.006	B	0.17979	0.02	T	0.19321	-1.0309	10	0.13470	T	0.59	.	16.1127	0.81273	1.0:0.0:0.0:0.0	.	300	Q16654	PDK4_HUMAN	R	300;264	ENSP00000005178:L300R	ENSP00000005178:L300R	L	-	2	0	PDK4	95054748	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.332000	0.96446	2.270000	0.75569	0.482000	0.46254	CTG	.		0.388	PDK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333298.1	NM_002612	
PTBP1	5725	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	804341	804341	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr19:804341A>G	ENST00000349038.4	+	5	411	c.338A>G	c.(337-339)tAc>tGc	p.Y113C	PTBP1_ENST00000350092.4_Intron|PTBP1_ENST00000356948.6_Missense_Mutation_p.Y113C|MIR4745_ENST00000577608.1_RNA|PTBP1_ENST00000394601.4_Missense_Mutation_p.Y113C	NM_031991.3	NP_114368.1	P26599	PTBP1_HUMAN	polypyrimidine tract binding protein 1	113	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of muscle cell differentiation (GO:0051148)|negative regulation of RNA splicing (GO:0033119)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly-pyrimidine tract binding (GO:0008187)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(4)	19		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGGTGAACTACTACACCTCG	0.627																																					p.Y113C		.											.	PTBP1	227	0			c.A338G						.						85.0	72.0	76.0					19																	804341		2203	4300	6503	SO:0001583	missense	5725	exon5			TGAACTACTACAC	X60648	CCDS32859.1, CCDS42456.1, CCDS45892.1	19p13.3	2013-07-16	2002-01-25	2002-01-25	ENSG00000011304	ENSG00000011304		"""RNA binding motif (RRM) containing"""	9583	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein I"""	600693	"""polypyrimidine tract binding protein (heterogeneous nuclear ribonucleoprotein I)"""	PTB		1906036, 11024286	Standard	NM_002819		Approved	HNRPI, HNRNP-I, PTB2, PTB3, PTB-1, PTB4, pPTB	uc002lpp.2	P26599		ENST00000349038.4:c.338A>G	19.37:g.804341A>G	ENSP00000014112:p.Tyr113Cys	36.0	0.0		44.0	15.0	NM_031990	Q9BUQ0	Missense_Mutation	SNP	ENST00000349038.4	37	CCDS32859.1	.	.	.	.	.	.	.	.	.	.	A	12.69	2.014178	0.35511	.	.	ENSG00000011304	ENST00000356948;ENST00000394601;ENST00000349038	T;T;T	0.53640	0.61;0.61;0.92	4.57	3.55	0.40652	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.216549	0.41001	D	0.000971	T	0.68229	0.2978	M	0.87269	2.87	0.80722	D	1	B;B;D	0.71674	0.229;0.102;0.998	B;B;D	0.73708	0.213;0.18;0.981	T	0.68273	-0.5452	10	0.48119	T	0.1	-57.0102	9.2933	0.37800	0.9142:0.0:0.0858:0.0	.	113;113;113	P26599;P26599-2;Q9BUQ0	PTBP1_HUMAN;.;.	C	113	ENSP00000349428:Y113C;ENSP00000408096:Y113C;ENSP00000014112:Y113C	ENSP00000014112:Y113C	Y	+	2	0	PTBP1	755341	1.000000	0.71417	0.995000	0.50966	0.774000	0.43823	7.175000	0.77632	0.625000	0.30304	0.533000	0.62120	TAC	.		0.627	PTBP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457605.1		
PTPRE	5791	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	129854474	129854474	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr10:129854474C>A	ENST00000254667.3	+	7	787	c.508C>A	c.(508-510)Ccc>Acc	p.P170T	PTPRE_ENST00000419012.2_Missense_Mutation_p.P170T|PTPRE_ENST00000430713.2_Intron|PTPRE_ENST00000306042.5_Missense_Mutation_p.P112T	NM_006504.4	NP_006495.1	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E	170	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of insulin receptor signaling pathway (GO:0046627)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of mast cell activation (GO:0033003)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	22		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)			Alendronate(DB00630)	CAACATCCTTCCCAGTAAGAT	0.408																																					p.P170T	Colon(52;977 1184 20575 41685)	.											.	PTPRE	227	0			c.C508A						.						90.0	97.0	95.0					10																	129854474		2203	4299	6502	SO:0001583	missense	5791	exon7			ATCCTTCCCAGTA	AF406557	CCDS7657.1, CCDS7658.1	10q26	2011-06-09			ENSG00000132334	ENSG00000132334		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9669	protein-coding gene	gene with protein product		600926				8595895	Standard	NM_130435		Approved	PTPE	uc001lkb.3	P23469	OTTHUMG00000019254	ENST00000254667.3:c.508C>A	10.37:g.129854474C>A	ENSP00000254667:p.Pro170Thr	46.0	0.0		37.0	5.0	NM_006504	Q13345|Q5VWH3|Q5VWH4|Q96KQ6	Missense_Mutation	SNP	ENST00000254667.3	37	CCDS7657.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.301581	0.81136	.	.	ENSG00000132334	ENST00000254667;ENST00000439034;ENST00000419012;ENST00000306042	T;T;T	0.15603	2.41;2.41;2.41	4.62	4.62	0.57501	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	T	0.45716	0.1356	M	0.82056	2.57	0.80722	D	1	D;P;P;P	0.89917	1.0;0.889;0.865;0.889	D;P;B;P	0.97110	1.0;0.57;0.434;0.57	T	0.48833	-0.9000	10	0.52906	T	0.07	.	17.7472	0.88424	0.0:1.0:0.0:0.0	.	148;170;112;170	F5H0X4;Q5VWH4;P23469-2;P23469	.;.;.;PTPRE_HUMAN	T	170;148;170;112	ENSP00000254667:P170T;ENSP00000402337:P170T;ENSP00000303350:P112T	ENSP00000254667:P170T	P	+	1	0	PTPRE	129744464	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.941000	0.75922	2.411000	0.81874	0.558000	0.71614	CCC	.		0.408	PTPRE-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050990.1		
PTRF	284119	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	40556905	40556905	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr17:40556905C>T	ENST00000357037.5	-	2	1392	c.973G>A	c.(973-975)Gtc>Atc	p.V325I		NM_012232.5	NP_036364.2			polymerase I and transcript release factor											breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		ATCTTCTTGACGTGGAAGGTG	0.672																																					p.V325I		.											.	PTRF	153	0			c.G973A						.						86.0	76.0	79.0					17																	40556905		2203	4300	6503	SO:0001583	missense	284119	exon2			TCTTGACGTGGAA	AF000421	CCDS11425.1	17q21.31	2011-04-20				ENSG00000177469			9688	protein-coding gene	gene with protein product		603198				9582279	Standard	NM_012232		Approved	cavin-1, CAVIN1	uc002hzo.3	Q6NZI2		ENST00000357037.5:c.973G>A	17.37:g.40556905C>T	ENSP00000349541:p.Val325Ile	107.0	0.0		101.0	35.0	NM_012232		Missense_Mutation	SNP	ENST00000357037.5	37	CCDS11425.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.592674	0.86953	.	.	ENSG00000177469	ENST00000357037;ENST00000357684	T	0.61742	0.08	4.73	4.73	0.59995	.	0.000000	0.64402	D	0.000001	T	0.65933	0.2739	L	0.38531	1.155	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.59215	-0.7496	10	0.15952	T	0.53	-38.3733	17.8979	0.88895	0.0:1.0:0.0:0.0	.	307;325	B4DNU9;Q6NZI2	.;PTRF_HUMAN	I	325;280	ENSP00000349541:V325I	ENSP00000349541:V325I	V	-	1	0	PTRF	37810431	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.604000	0.82830	2.445000	0.82738	0.557000	0.71058	GTC	.		0.672	PTRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449938.1	NM_012232	
RAD54B	25788	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	95404076	95404077	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr8:95404076_95404077delCA	ENST00000336148.5	-	10	1693_1694	c.1569_1570delTG	c.(1567-1572)actggafs	p.G524fs		NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	524					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			ATAAAGAGTCCAGTGAGGCAAG	0.361								Direct reversal of damage;Homologous recombination																													p.523_524del		.											.	RAD54B	539	0			c.1569_1570del						.																																			SO:0001589	frameshift_variant	25788	exon10			AGAGTCCAGTGAG	AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.1569_1570delTG	8.37:g.95404076_95404077delCA	ENSP00000336606:p.Gly524fs	72.0	0.0		48.0	19.0	NM_012415	F6WBS8	Frame_Shift_Del	DEL	ENST00000336148.5	37	CCDS6262.1																																																																																			.		0.361	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257806.3	NM_012415	
RECQL	5965	broad.mit.edu;bcgsc.ca	37	12	21630878	21630878	+	Silent	SNP	C	C	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr12:21630878C>T	ENST00000444129.2	-	7	1194	c.726G>A	c.(724-726)aaG>aaA	p.K242K	RECQL_ENST00000421138.2_Silent_p.K242K	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	242	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						GGAACTGCCGCTTTAAGATAC	0.353								Other identified genes with known or suspected DNA repair function																													p.K242K		.											.	RECQL	228	0			c.G726A						.						91.0	91.0	91.0					12																	21630878		2203	4300	6503	SO:0001819	synonymous_variant	5965	exon8			CTGCCGCTTTAAG	D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.726G>A	12.37:g.21630878C>T		92.0	1.0		119.0	7.0	NM_032941	A8K6G2	Silent	SNP	ENST00000444129.2	37	CCDS31756.1																																																																																			.		0.353	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402371.1	NM_002907	
RELA	5970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	65423177	65423177	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr11:65423177C>T	ENST00000406246.3	-	10	1276	c.1015G>A	c.(1015-1017)Gct>Act	p.A339T	RELA_ENST00000308639.9_Missense_Mutation_p.A336T|RELA_ENST00000525693.1_Missense_Mutation_p.A339T	NM_001243984.1|NM_001243985.1|NM_021975.3	NP_001230913.1|NP_001230914.1|NP_068810.3	Q04206	TF65_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog A	339					acetaldehyde metabolic process (GO:0006117)|aging (GO:0007568)|cellular defense response (GO:0006968)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|Fc-epsilon receptor signaling pathway (GO:0038095)|hair follicle development (GO:0001942)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|liver development (GO:0001889)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of Schwann cell differentiation (GO:0014040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to amino acid (GO:0043200)|response to cAMP (GO:0051591)|response to cobalamin (GO:0033590)|response to drug (GO:0042493)|response to insulin (GO:0032868)|response to interleukin-1 (GO:0070555)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to muramyl dipeptide (GO:0032495)|response to organic substance (GO:0010033)|response to progesterone (GO:0032570)|response to UV-B (GO:0010224)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phosphate ion binding (GO:0042301)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(11)|ovary(1)|urinary_tract(1)	19						GGGACAGAAGCTGAGCTGCGG	0.607																																					p.A339T		.											.	RELA	872	0			c.G1015A						.						80.0	76.0	77.0					11																	65423177		2201	4297	6498	SO:0001583	missense	5970	exon10			CAGAAGCTGAGCT	Z22951	CCDS31609.1, CCDS44651.1, CCDS73322.1	11q13	2013-07-09	2013-07-09		ENSG00000173039	ENSG00000173039			9955	protein-coding gene	gene with protein product		164014	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells 3"""	NFKB3		2001591	Standard	NM_021975		Approved	p65	uc001ofg.3	Q04206	OTTHUMG00000166566	ENST00000406246.3:c.1015G>A	11.37:g.65423177C>T	ENSP00000384273:p.Ala339Thr	55.0	0.0		42.0	14.0	NM_021975	Q6GTV1|Q6SLK1	Missense_Mutation	SNP	ENST00000406246.3	37	CCDS31609.1	.	.	.	.	.	.	.	.	.	.	C	1.246	-0.619830	0.03636	.	.	ENSG00000173039	ENST00000406246;ENST00000525693;ENST00000308639;ENST00000545816;ENST00000532999	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	4.46	-8.92	0.00774	.	1.628790	0.03553	N	0.225728	T	0.25457	0.0619	L	0.29908	0.895	0.09310	N	1	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.04013	0.0;0.0;0.0;0.0;0.001;0.0	T	0.18935	-1.0321	10	0.10111	T	0.7	1.385	10.8329	0.46671	0.0:0.6324:0.2313:0.1363	.	329;326;336;339;350;339	Q04206-3;Q04206-2;Q04206-4;Q04206;B4E082;Q2TAM5	.;.;.;TF65_HUMAN;.;.	T	339;339;336;350;350	ENSP00000384273:A339T;ENSP00000432537:A339T;ENSP00000311508:A336T;ENSP00000433526:A350T	ENSP00000311508:A336T	A	-	1	0	RELA	65179753	0.000000	0.05858	0.001000	0.08648	0.248000	0.25809	-5.225000	0.00140	-2.123000	0.00823	-0.378000	0.06908	GCT	.		0.607	RELA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390457.2	NM_021975	
RNF123	63891	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	49749928	49749930	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	TCT	TCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr3:49749928_49749930delTCT	ENST00000327697.6	+	27	2657_2659	c.2513_2515delTCT	c.(2512-2517)atctac>aac	p.838_839IY>N	RNF123_ENST00000433785.1_5'Flank|RNF123_ENST00000432042.1_In_Frame_Del_p.692_693IY>N	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	838					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		ATGCTGGACATCTACTGGCTGCT	0.621																																					p.838_839del		.											.	RNF123	584	0			c.2513_2515del						.																																			SO:0001651	inframe_deletion	63891	exon27			TGGACATCTACTG	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.2513_2515delTCT	3.37:g.49749928_49749930delTCT	ENSP00000328287:p.Ile838_Tyr839delinsAsn	55.0	0.0		48.0	12.0	NM_022064	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	In_Frame_Del	DEL	ENST00000327697.6	37	CCDS33758.1																																																																																			.		0.621	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
SAMD11	148398	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	878691	878691	+	Silent	SNP	C	C	G			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr1:878691C>G	ENST00000342066.3	+	12	1706	c.1623C>G	c.(1621-1623)acC>acG	p.T541T		NM_152486.2	NP_689699	Q96NU1	SAM11_HUMAN	sterile alpha motif domain containing 11	541					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.74e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000472)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)		AGGACGTCACCAAGTGGACCG	0.667																																					p.T541T		.											.	SAMD11	90	0			c.C1623G						.						30.0	32.0	32.0					1																	878691		2202	4300	6502	SO:0001819	synonymous_variant	148398	exon12			CGTCACCAAGTGG	BC024295	CCDS2.2	1p36.33	2013-01-10			ENSG00000187634	ENSG00000187634		"""Sterile alpha motif (SAM) domain containing"""	28706	protein-coding gene	gene with protein product						12477932	Standard	NM_152486		Approved	MGC45873	uc001abw.1	Q96NU1	OTTHUMG00000040719	ENST00000342066.3:c.1623C>G	1.37:g.878691C>G		116.0	1.0		106.0	36.0	NM_152486	A2AA76|I7FV78|I7FV81|I7G0Z6|Q5SV96|Q5SV99|Q5SVA0|Q8N195|Q8TB59	Silent	SNP	ENST00000342066.3	37	CCDS2.2	.	.	.	.	.	.	.	.	.	.	C	2.451	-0.326421	0.05350	.	.	ENSG00000187634	ENST00000341065;ENST00000455979	.	.	.	5.3	5.3	0.74995	.	.	.	.	.	T	0.73760	0.3628	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72636	-0.4233	4	.	.	.	-17.0152	17.5533	0.87882	0.0:1.0:0.0:0.0	.	.	.	.	R	449;368	.	.	P	+	2	0	SAMD11	868554	1.000000	0.71417	1.000000	0.80357	0.298000	0.27526	2.188000	0.42612	2.498000	0.84270	0.456000	0.33151	CCA	.		0.667	SAMD11-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276866.2	NM_152486	
SETD2	29072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	47163059	47163059	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr3:47163059T>C	ENST00000409792.3	-	3	3109	c.3067A>G	c.(3067-3069)Agt>Ggt	p.S1023G		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1023					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TGACCACTACTGTCACACTTT	0.363			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.S1023G		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	1273	0			c.A3067G						.						86.0	83.0	84.0					3																	47163059		2203	4300	6503	SO:0001583	missense	29072	exon3			CACTACTGTCACA	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.3067A>G	3.37:g.47163059T>C	ENSP00000386759:p.Ser1023Gly	206.0	0.0		172.0	57.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	T	17.70	3.455384	0.63401	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792;ENST00000412450	D;T	0.91894	-2.93;0.75	5.03	5.03	0.67393	.	0.000000	0.64402	D	0.000003	D	0.92195	0.7525	N	0.24115	0.695	0.36064	D	0.841632	D;D	0.63880	0.993;0.993	D;D	0.68192	0.956;0.956	D	0.94846	0.8009	10	0.72032	D	0.01	.	13.5012	0.61457	0.0:0.0:0.0:1.0	.	1023;1023	F2Z317;Q9BYW2	.;SETD2_HUMAN	G	1023;1023;1023;979	ENSP00000386759:S1023G;ENSP00000416401:S979G	ENSP00000386759:S1023G	S	-	1	0	SETD2	47138063	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	3.315000	0.51951	2.115000	0.64714	0.528000	0.53228	AGT	.		0.363	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
SLC9A9	285195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	143271227	143271227	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr3:143271227C>A	ENST00000316549.6	-	9	1274	c.1066G>T	c.(1066-1068)Gat>Tat	p.D356Y		NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9	356					ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)			breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						ATTTTGGAATCCGAAGACAGA	0.348																																					p.D356Y		.											.	SLC9A9	229	0			c.G1066T						.						114.0	107.0	109.0					3																	143271227		2203	4300	6503	SO:0001583	missense	285195	exon9			TGGAATCCGAAGA	AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.1066G>T	3.37:g.143271227C>A	ENSP00000320246:p.Asp356Tyr	75.0	0.0		43.0	19.0	NM_173653	A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	Missense_Mutation	SNP	ENST00000316549.6	37	CCDS33872.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.374759	0.82573	.	.	ENSG00000181804	ENST00000316549;ENST00000450105	T	0.15952	2.38	5.6	5.6	0.85130	Cation/H+ exchanger (1);	0.146970	0.47455	D	0.000240	T	0.24470	0.0593	N	0.20685	0.6	0.58432	D	0.999998	P	0.47484	0.896	P	0.53450	0.726	T	0.01512	-1.1336	10	0.87932	D	0	.	19.9801	0.97322	0.0:1.0:0.0:0.0	.	356	Q8IVB4	SL9A9_HUMAN	Y	356;239	ENSP00000320246:D356Y	ENSP00000320246:D356Y	D	-	1	0	SLC9A9	144753917	1.000000	0.71417	0.956000	0.39512	0.903000	0.53119	6.861000	0.75478	2.808000	0.96608	0.650000	0.86243	GAT	.		0.348	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354994.1	NM_173653	
SKIL	6498	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	170110171	170110171	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr3:170110171A>T	ENST00000458537.3	+	6	2730	c.2021A>T	c.(2020-2022)cAa>cTa	p.Q674L	SKIL_ENST00000259119.4_Missense_Mutation_p.Q674L|SKIL_ENST00000426052.2_Missense_Mutation_p.Q654L|SKIL_ENST00000413427.2_Missense_Mutation_p.Q628L	NM_001145097.2|NM_001248008.1|NM_005414.4	NP_001138569.1|NP_001234937.1|NP_005405.2	P12757	SKIL_HUMAN	SKI-like proto-oncogene	674					blastocyst formation (GO:0001825)|cell cycle arrest (GO:0007050)|gene expression (GO:0010467)|lens fiber cell differentiation (GO:0070306)|lymphocyte homeostasis (GO:0002260)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of axonogenesis (GO:0050772)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|protein heterotrimerization (GO:0070208)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|response to antibiotic (GO:0046677)|response to cytokine (GO:0034097)|response to growth factor (GO:0070848)|skeletal muscle tissue development (GO:0007519)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	25	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			CTAAAGCTGCAAATTCTGAAA	0.388																																					p.Q674L		.											.	SKIL	228	0			c.A2021T						.						94.0	103.0	100.0					3																	170110171		2203	4300	6503	SO:0001583	missense	6498	exon6			AGCTGCAAATTCT	X15217	CCDS33890.1, CCDS46953.1, CCDS46954.1	3q26	2014-06-25	2014-06-25		ENSG00000136603	ENSG00000136603		"""SKI transcriptional corepressors"""	10897	protein-coding gene	gene with protein product		165340	"""SKI-like oncogene"""			2762147	Standard	NM_005414		Approved	SNO, SnoN, SnoA	uc003fgw.3	P12757	OTTHUMG00000158831	ENST00000458537.3:c.2021A>T	3.37:g.170110171A>T	ENSP00000415243:p.Gln674Leu	260.0	0.0		239.0	78.0	NM_001248008	A6NGT1|B4DT50|O00464|P12756|Q07501	Missense_Mutation	SNP	ENST00000458537.3	37	CCDS33890.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.418393	0.83559	.	.	ENSG00000136603	ENST00000259119;ENST00000426052;ENST00000413427;ENST00000458537	D;D;D;D	0.95853	-3.83;-3.8;-3.81;-3.83	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.97182	0.9079	M	0.62723	1.935	0.45580	D	0.99852	D;D	0.89917	0.997;1.0	D;D	0.83275	0.993;0.996	D	0.97388	0.9987	10	0.54805	T	0.06	-16.4945	16.6438	0.85155	1.0:0.0:0.0:0.0	.	628;674	P12757-3;P12757	.;SKIL_HUMAN	L	674;654;628;674	ENSP00000259119:Q674L;ENSP00000406520:Q654L;ENSP00000400193:Q628L;ENSP00000415243:Q674L	ENSP00000259119:Q674L	Q	+	2	0	SKIL	171592865	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	6.754000	0.74909	2.333000	0.79357	0.533000	0.62120	CAA	.		0.388	SKIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352351.4	NM_005414	
SMPD2	6610	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	109762571	109762571	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr6:109762571A>T	ENST00000258052.3	+	2	421	c.62A>T	c.(61-63)tAc>tTc	p.Y21F	PPIL6_ENST00000521072.2_5'Flank|PPIL6_ENST00000424445.2_5'Flank|PPIL6_ENST00000440797.2_5'Flank	NM_003080.2	NP_003071.2	O60906	NSMA_HUMAN	sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase)	21					apoptotic signaling pathway (GO:0097190)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|neurotrophin TRK receptor signaling pathway (GO:0048011)|response to mechanical stimulus (GO:0009612)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin metabolic process (GO:0006684)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			endometrium(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.0137)|all cancers(137;0.0188)|OV - Ovarian serous cystadenocarcinoma(136;0.0228)|BRCA - Breast invasive adenocarcinoma(108;0.0566)		GGCATTCCGTACTTGAGCAAG	0.627																																					p.Y21F		.											.	SMPD2	90	0			c.A62T						.						53.0	61.0	58.0					6																	109762571		2203	4300	6503	SO:0001583	missense	6610	exon2			TTCCGTACTTGAG	AJ222801	CCDS5075.1	6q21	2009-10-23			ENSG00000135587	ENSG00000135587	3.1.4.12		11121	protein-coding gene	gene with protein product		603498				9520418	Standard	XM_005267109		Approved	nSMase, ISC1	uc003pti.3	O60906	OTTHUMG00000015348	ENST00000258052.3:c.62A>T	6.37:g.109762571A>T	ENSP00000258052:p.Tyr21Phe	68.0	0.0		52.0	20.0	NM_003080	Q5TED1|Q9BWR3	Missense_Mutation	SNP	ENST00000258052.3	37	CCDS5075.1	.	.	.	.	.	.	.	.	.	.	A	15.02	2.710207	0.48517	.	.	ENSG00000135587	ENST00000258052	T	0.29917	1.55	5.76	5.76	0.90799	Endonuclease/exonuclease/phosphatase (2);	0.057454	0.64402	D	0.000001	T	0.22975	0.0555	N	0.16743	0.435	0.52099	D	0.999945	B;D	0.76494	0.001;0.999	B;D	0.85130	0.013;0.997	T	0.11446	-1.0587	10	0.14656	T	0.56	-17.0373	12.4555	0.55702	1.0:0.0:0.0:0.0	.	21;21	B2R8U8;O60906	.;NSMA_HUMAN	F	21	ENSP00000258052:Y21F	ENSP00000258052:Y21F	Y	+	2	0	SMPD2	109869264	0.992000	0.36948	0.959000	0.39883	0.373000	0.29922	1.815000	0.38981	2.197000	0.70478	0.533000	0.62120	TAC	.		0.627	SMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041755.1		
SNW1	22938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	78184553	78184553	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr14:78184553C>A	ENST00000261531.7	-	14	1551	c.1489G>T	c.(1489-1491)Gat>Tat	p.D497Y	SNW1_ENST00000554775.1_Missense_Mutation_p.D335Y|SNW1_ENST00000555761.1_Missense_Mutation_p.K523N|SLIRP_ENST00000557623.1_Intron|SLIRP_ENST00000557431.1_Intron	NM_012245.2	NP_036377.1	Q13573	SNW1_HUMAN	SNW domain containing 1	497					cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin D receptor signaling pathway (GO:0070562)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|chromatin (GO:0000785)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	Notch binding (GO:0005112)|nuclear hormone receptor binding (GO:0035257)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)|SMAD binding (GO:0046332)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|vitamin D receptor binding (GO:0042809)			NS(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		CCAAAAGGATCTTCCTCAAAC	0.473																																					p.D497Y		.											.	SNW1	187	0			c.G1489T						.						171.0	178.0	176.0					14																	78184553		2203	4300	6503	SO:0001583	missense	22938	exon14			AAGGATCTTCCTC	AF045184	CCDS9867.1	14q22.1-q22.3	2005-09-13	2005-09-13	2005-09-13		ENSG00000100603			16696	protein-coding gene	gene with protein product		603055	"""SKI interacting protein"""	SKIIP		8973337, 9632709	Standard	NM_012245		Approved	NCoA-62, SKIP, Prp45, PRPF45, Bx42	uc001xuf.3	Q13573		ENST00000261531.7:c.1489G>T	14.37:g.78184553C>A	ENSP00000261531:p.Asp497Tyr	134.0	0.0		108.0	35.0	NM_012245	A8K8A9|Q13483|Q32N03|Q5D0D6	Missense_Mutation	SNP	ENST00000261531.7	37	CCDS9867.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.1|23.1	4.379096|4.379096	0.82682|0.82682	.|.	.|.	ENSG00000100603|ENSG00000100603	ENST00000261531;ENST00000554775|ENST00000555761	.|.	.|.	.|.	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.80281|0.80281	0.4594|0.4594	M|M	0.92169|0.92169	3.28|3.28	0.40444|0.40444	D|D	0.980071|0.980071	D|B	0.76494|0.19817	0.999|0.039	D|B	0.79784|0.26517	0.993|0.07	T|T	0.78298|0.78298	-0.2258|-0.2258	9|7	0.87932|.	D|.	0|.	.|.	19.7701|19.7701	0.96359|0.96359	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	497|523	Q13573|G3V3A4	SNW1_HUMAN|.	Y|N	497;335|523	.|.	ENSP00000261531:D497Y|.	D|K	-|-	1|3	0|2	SNW1|SNW1	77254306|77254306	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	7.228000|7.228000	0.78079|0.78079	2.690000|2.690000	0.91761|0.91761	0.460000|0.460000	0.39030|0.39030	GAT|AAG	.		0.473	SNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413912.1	NM_012245	
SPATA18	132671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	52938154	52938154	+	Missense_Mutation	SNP	G	G	T	rs376481625		TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr4:52938154G>T	ENST00000295213.4	+	6	964	c.590G>T	c.(589-591)cGg>cTg	p.R197L	SPATA18_ENST00000506829.1_3'UTR|SPATA18_ENST00000419395.2_Missense_Mutation_p.R165L	NM_145263.2	NP_660306.1	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18	197					cellular response to DNA damage stimulus (GO:0006974)|mitochondrial protein catabolic process (GO:0035694)|mitochondrion degradation by induced vacuole formation (GO:0035695)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial outer membrane (GO:0005741)				breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			GAGAATAGGCGGTCAGAGCCT	0.527																																					p.R197L		.											.	SPATA18	72	0			c.G590T						.						73.0	68.0	70.0					4																	52938154		2203	4300	6503	SO:0001583	missense	132671	exon6			ATAGGCGGTCAGA	BC025396	CCDS3489.1, CCDS75124.1	4q11	2012-01-23	2012-01-23		ENSG00000163071	ENSG00000163071			29579	protein-coding gene	gene with protein product		612814	"""spermatogenesis associated 18 homolog (rat)"""			21300779	Standard	XR_245253		Approved	FLJ32906	uc003gzl.3	Q8TC71	OTTHUMG00000128698	ENST00000295213.4:c.590G>T	4.37:g.52938154G>T	ENSP00000295213:p.Arg197Leu	115.0	0.0		106.0	25.0	NM_145263	B4E2R0|E5RLK1|Q8IY48|Q8N7D7	Missense_Mutation	SNP	ENST00000295213.4	37	CCDS3489.1	.	.	.	.	.	.	.	.	.	.	G	5.932	0.355943	0.11239	.	.	ENSG00000163071	ENST00000295213;ENST00000419395	D;D	0.87491	-2.25;-2.26	2.68	0.739	0.18324	.	2.273110	0.01545	N	0.019384	T	0.81754	0.4889	L	0.34521	1.04	0.09310	N	1	B;B;B	0.28400	0.034;0.034;0.21	B;B;B	0.26094	0.031;0.019;0.066	T	0.65952	-0.6043	10	0.34782	T	0.22	-0.001	9.0017	0.36085	0.0:0.5765:0.4235:0.0	.	165;197;197	Q8TC71-2;Q8TC71;Q96M13	.;MIEAP_HUMAN;.	L	197;165	ENSP00000295213:R197L;ENSP00000415309:R165L	ENSP00000295213:R197L	R	+	2	0	SPATA18	52632911	.	.	0.000000	0.03702	0.001000	0.01503	.	.	0.119000	0.18210	-0.156000	0.13503	CGG	.		0.527	SPATA18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250597.2	NM_145263	
STAG2	10735	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	123176443	123176451	+	In_Frame_Del	DEL	GACATATGC	GACATATGC	-			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	GACATATGC	GACATATGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chrX:123176443_123176451delGACATATGC	ENST00000371160.1	+	7	700_708	c.410_418delGACATATGC	c.(409-420)agacatatgcag>aag	p.137_140RHMQ>K	STAG2_ENST00000371144.3_In_Frame_Del_p.137_140RHMQ>K|STAG2_ENST00000354548.5_In_Frame_Del_p.68_71RHMQ>K|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_In_Frame_Del_p.137_140RHMQ>K|STAG2_ENST00000371145.3_In_Frame_Del_p.137_140RHMQ>K|STAG2_ENST00000371157.3_In_Frame_Del_p.137_140RHMQ>K	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	137					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)	p.R137I(1)		breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						GAAATGTTTAGACATATGCAGAACTCTGA	0.306																																					p.137_140del		.											.	STAG2	134	1	Substitution - Missense(1)	large_intestine(1)	c.410_418del						.																																			SO:0001651	inframe_deletion	10735	exon7			TGTTTAGACATAT	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.410_418delGACATATGC	X.37:g.123176443_123176451delGACATATGC	ENSP00000360202:p.Arg137_Gln140delinsLys	448.0	0.0		347.0	79.0	NM_001042749	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	In_Frame_Del	DEL	ENST00000371160.1	37	CCDS14607.1																																																																																			.		0.306	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
SYT9	143425	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	7335070	7335070	+	Silent	SNP	T	T	C			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr11:7335070T>C	ENST00000318881.6	+	3	1179	c.942T>C	c.(940-942)tcT>tcC	p.S314S	SYT9_ENST00000396716.2_Silent_p.S282S	NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	314	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		ACAGGTTCTCTCGTCATGACT	0.463																																					p.S314S		.											.	SYT9	155	0			c.T942C						.						190.0	189.0	189.0					11																	7335070		2201	4296	6497	SO:0001819	synonymous_variant	143425	exon3			GTTCTCTCGTCAT	AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.942T>C	11.37:g.7335070T>C		84.0	0.0		77.0	30.0	NM_175733		Silent	SNP	ENST00000318881.6	37	CCDS7778.1																																																																																			.		0.463	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384483.1	NM_175733	
TAAR2	9287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	132938436	132938436	+	Silent	SNP	A	A	G			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr6:132938436A>G	ENST00000367931.1	-	2	908	c.909T>C	c.(907-909)ttT>ttC	p.F303F	TAAR2_ENST00000537809.1_Silent_p.F258F|TAAR2_ENST00000275191.2_Silent_p.F258F			Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2	303					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)	23	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)		TAAAATAGCCAAACCATGTCA	0.348																																					p.F303F		.											.	TAAR2	91	0			c.T909C						.						67.0	61.0	63.0					6																	132938436		2203	4300	6503	SO:0001819	synonymous_variant	9287	exon2			ATAGCCAAACCAT	AF112460	CCDS34541.1, CCDS5157.1	6q24	2012-08-08	2005-02-23	2005-02-24	ENSG00000146378	ENSG00000146378		"""GPCR / Class A : Trace amine associated receptors"""	4514	protein-coding gene	gene with protein product		604849	"""G protein-coupled receptor 58"""	GPR58		10684976, 15718104	Standard	NM_014626		Approved		uc003qdl.1	Q9P1P5	OTTHUMG00000015585	ENST00000367931.1:c.909T>C	6.37:g.132938436A>G		203.0	0.0		136.0	46.0	NM_001033080	Q5QD02|Q6NWS1|Q6NWS2|Q6NWS3	Silent	SNP	ENST00000367931.1	37	CCDS34541.1																																																																																			.		0.348	TAAR2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390735.1	NM_014626	
HIRIP3	8479	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30002417	30002417	+	IGR	SNP	G	G	A	rs138889090		TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr16:30002417G>A	ENST00000279392.3	-	0	3385				TAOK2_ENST00000279394.3_Missense_Mutation_p.R893H	NM_003609.4	NP_003600.2	Q9BW71	HIRP3_HUMAN	HIRA interacting protein 3						chromatin assembly or disassembly (GO:0006333)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(9)	17						GAGCGAATCCGCAGTCTGCTT	0.657																																					p.R893H		.											.	TAOK2	521	0			c.G2678A						.	G	HIS/ARG	2,4390		0,2,2194	48.0	51.0	50.0		2678	5.2	1.0	16	dbSNP_134	50	0,8596		0,0,4298	no	missense	TAOK2	NM_004783.2	29	0,2,6492	AA,AG,GG		0.0,0.0455,0.0154		893/1050	30002417	2,12986	2196	4298	6494	SO:0001628	intergenic_variant	9344	exon19			GAATCCGCAGTCT	AJ223351	CCDS10664.1, CCDS58449.1	16p12.1	2008-02-05	2001-11-29		ENSG00000149929	ENSG00000149929			4917	protein-coding gene	gene with protein product		603365	"""HIRA-interacting protein 3"""			9710638	Standard	NM_003609		Approved		uc002dve.3	Q9BW71	OTTHUMG00000132118		16.37:g.30002417G>A		31.0	0.0		30.0	4.0	NM_004783	H3BSR3|O75707|O75708	Missense_Mutation	SNP	ENST00000279392.3	37	CCDS10664.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.364191	0.82353	4.55E-4	0.0	ENSG00000149930	ENST00000279394	T	0.61392	0.11	5.17	5.17	0.71159	.	.	.	.	.	T	0.77164	0.4090	M	0.81341	2.54	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	T	0.78986	-0.1987	8	.	.	.	.	17.4278	0.87531	0.0:0.0:1.0:0.0	.	893	Q9UL54-2	.	H	893	ENSP00000279394:R893H	.	R	+	2	0	TAOK2	29909918	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	9.819000	0.99357	2.405000	0.81733	0.650000	0.86243	CGC	G|1.000;A|0.000		0.657	HIRIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255160.2	NM_003609	
TIPRL	261726	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	168165787	168165787	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr1:168165787A>C	ENST00000367833.2	+	5	664	c.519A>C	c.(517-519)agA>agC	p.R173S		NM_152902.3	NP_690866.1	O75663	TIPRL_HUMAN	TOR signaling pathway regulator	173	Interaction with PPP2CA.				DNA damage checkpoint (GO:0000077)|negative regulation of protein phosphatase type 2A activity (GO:0034048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				breast(1)|kidney(1)|large_intestine(1)|ovary(2)|skin(1)	6	all_hematologic(923;0.215)					TTTTCCAGAGAGTAATGCCTT	0.284																																					p.R173S		.											.	TIPRL	91	0			c.A519C						.						86.0	85.0	85.0					1																	168165787		2203	4300	6503	SO:0001583	missense	261726	exon5			CCAGAGAGTAATG	AB097034	CCDS1270.1, CCDS30935.1	1q23.2	2014-03-07	2014-03-07		ENSG00000143155	ENSG00000143155			30231	protein-coding gene	gene with protein product		611807	"""TIP41, TOR signaling pathway regulator-like (S. cerevisiae)"""			12761501	Standard	NM_001031800		Approved	MGC3794, dJ69E11.3, TIP41	uc001gfg.3	O75663	OTTHUMG00000034646	ENST00000367833.2:c.519A>C	1.37:g.168165787A>C	ENSP00000356807:p.Arg173Ser	44.0	0.0		25.0	10.0	NM_152902	B2R8V3|Q5HYB2|Q8IZ86	Missense_Mutation	SNP	ENST00000367833.2	37	CCDS1270.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.216046	0.79352	.	.	ENSG00000143155	ENST00000367833	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.83431	0.5253	M	0.93328	3.405	0.46279	D	0.998965	D	0.89917	1.0	D	0.91635	0.999	D	0.88415	0.3024	8	0.87932	D	0	-15.878	14.0998	0.65046	1.0:0.0:0.0:0.0	.	173	O75663	TIPRL_HUMAN	S	173	.	ENSP00000356807:R173S	R	+	3	2	TIPRL	166432411	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.542000	0.53625	2.145000	0.66743	0.533000	0.62120	AGA	.		0.284	TIPRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083822.1	NM_152902	
TMEM184A	202915	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	1589783	1589783	+	Silent	SNP	G	G	T	rs139449337	byFrequency	TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr7:1589783G>T	ENST00000297477.5	-	5	844	c.528C>A	c.(526-528)atC>atA	p.I176I		NM_001097620.1	NP_001091089.1	Q6ZMB5	T184A_HUMAN	transmembrane protein 184A	176					germ-line sex determination (GO:0018992)|regulation of protein localization (GO:0032880)|regulation of secretion (GO:0051046)	early endosome membrane (GO:0031901)|integral component of membrane (GO:0016021)		p.I176I(1)		endometrium(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	12		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.88e-15)		GCAGGAACCCGATGGAGTAGG	0.721																																					p.I176I		.											.	TMEM184A	90	1	Substitution - coding silent(1)	lung(1)	c.C528A						.						12.0	15.0	14.0					7																	1589783		2098	4238	6336	SO:0001819	synonymous_variant	202915	exon5			GAACCCGATGGAG		CCDS43537.1	7p22.3	2008-05-02			ENSG00000164855	ENSG00000164855			28797	protein-coding gene	gene with protein product						12477932	Standard	NM_001097620		Approved	MGC9712	uc003skv.4	Q6ZMB5	OTTHUMG00000119025	ENST00000297477.5:c.528C>A	7.37:g.1589783G>T		38.0	0.0		29.0	12.0	NM_001097620	Q8TBQ6	Silent	SNP	ENST00000297477.5	37	CCDS43537.1																																																																																			G|0.997;A|0.003		0.721	TMEM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239229.4	NM_152689	
TOPORS	10210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	9	32543942	32543942	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr9:32543942G>C	ENST00000360538.2	-	3	697	c.581C>G	c.(580-582)tCa>tGa	p.S194*	TOPORS_ENST00000379858.1_Nonsense_Mutation_p.S129*	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	194	E3 ubiquitin-protein ligase activity.|Required for DNA-binding.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		ACCACTAGGTGAATACACAGA	0.438																																					p.S194X		.											.	TOPORS	230	0			c.C581G						.						124.0	109.0	114.0					9																	32543942		2203	4300	6503	SO:0001587	stop_gained	10210	exon3			CTAGGTGAATACA	AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.581C>G	9.37:g.32543942G>C	ENSP00000353735:p.Ser194*	102.0	0.0		106.0	32.0	NM_005802	O43273|Q6P987|Q9NS55|Q9UNR9	Nonsense_Mutation	SNP	ENST00000360538.2	37	CCDS6527.1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.628081	0.46944	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	.	.	.	5.6	3.65	0.41850	.	0.364657	0.20326	N	0.094535	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-1.2053	10.3422	0.43884	0.0753:0.1356:0.789:0.0	.	.	.	.	X	194;129	.	ENSP00000353735:S194X	S	-	2	0	TOPORS	32533942	0.965000	0.33210	0.999000	0.59377	0.015000	0.08874	4.413000	0.59795	1.515000	0.48885	-0.140000	0.14226	TCA	.		0.438	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052007.1	NM_005802	
TPRG1L	127262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	3544159	3544159	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr1:3544159C>G	ENST00000378344.2	+	4	637	c.566C>G	c.(565-567)gCc>gGc	p.A189G	TPRG1L_ENST00000344579.5_Missense_Mutation_p.A130G|RP11-46F15.2_ENST00000435049.1_RNA	NM_182752.3	NP_877429.2	Q5T0D9	TPRGL_HUMAN	tumor protein p63 regulated 1-like	189						cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(1)	8	all_cancers(77;0.0119)|all_epithelial(69;0.00481)|Ovarian(185;0.0634)|Lung NSC(156;0.162)|all_lung(157;0.172)	all_epithelial(116;7.37e-22)|all_lung(118;8.23e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.41e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.83e-22)|GBM - Glioblastoma multiforme(42;4.77e-14)|Colorectal(212;1.12e-05)|COAD - Colon adenocarcinoma(227;5.61e-05)|Kidney(185;0.000351)|BRCA - Breast invasive adenocarcinoma(365;0.000688)|KIRC - Kidney renal clear cell carcinoma(229;0.00553)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.201)		GTGCCCTATGCCACTTTCACA	0.517																																					p.A189G		.											.	TPRG1L	68	0			c.C566G						.						155.0	154.0	155.0					1																	3544159		2203	4300	6503	SO:0001583	missense	127262	exon4			CCTATGCCACTTT	BC019034	CCDS47.1	1p36.32	2008-02-05	2008-01-16	2008-01-16	ENSG00000158109	ENSG00000158109			27007	protein-coding gene	gene with protein product		611460	"""family with sequence similarity 79, member A"""	FAM79A		12477932	Standard	NM_182752		Approved	RP11-46F15.3, FLJ21811	uc001akm.3	Q5T0D9	OTTHUMG00000000609	ENST00000378344.2:c.566C>G	1.37:g.3544159C>G	ENSP00000367595:p.Ala189Gly	99.0	0.0		75.0	25.0	NM_182752	A8K1K4|Q8WV04	Missense_Mutation	SNP	ENST00000378344.2	37	CCDS47.1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.693960	0.68386	.	.	ENSG00000158109	ENST00000378344;ENST00000456805;ENST00000344579	.	.	.	4.93	4.93	0.64822	.	0.210172	0.48767	D	0.000171	T	0.60170	0.2248	M	0.74258	2.255	0.58432	D	0.999997	P;B	0.41848	0.763;0.321	B;B	0.41510	0.359;0.056	T	0.67612	-0.5626	9	0.87932	D	0	9.2791	12.5961	0.56470	0.0:0.9169:0.0:0.0831	.	130;189	Q5T0D9-2;Q5T0D9	.;TPRGL_HUMAN	G	189;146;130	.	ENSP00000339714:A130G	A	+	2	0	TPRG1L	3534019	0.980000	0.34600	0.846000	0.33378	0.885000	0.51271	4.567000	0.60850	2.282000	0.76494	0.563000	0.77884	GCC	.		0.517	TPRG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001466.1	NM_182752	
TRIM41	90933	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	180661549	180661549	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr5:180661549G>A	ENST00000315073.5	+	6	2377	c.1667G>A	c.(1666-1668)gGc>gAc	p.G556D	TRIM41_ENST00000351937.5_Intron|TRIM41_ENST00000510072.1_3'UTR	NM_033549.4	NP_291027.3	Q8WV44	TRI41_HUMAN	tripartite motif containing 41	556	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(3)|prostate(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCACCAACGGCAAACGCTAT	0.657																																					p.G556D		.											.	TRIM41	226	0			c.G1667A						.						72.0	75.0	74.0					5																	180661549		2203	4300	6503	SO:0001583	missense	90933	exon6			CCAACGGCAAACG	AF258579	CCDS4465.1, CCDS4466.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146063	ENSG00000146063		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19013	protein-coding gene	gene with protein product	"""RING-finger protein that interacts with C kinase"""	610530	"""tripartite motif-containing 41"""			16022281	Standard	NM_033549		Approved	MGC1127, RINCK	uc003mne.2	Q8WV44	OTTHUMG00000130965	ENST00000315073.5:c.1667G>A	5.37:g.180661549G>A	ENSP00000320869:p.Gly556Asp	137.0	0.0		113.0	45.0	NM_033549	B3KNJ6|D3DWR9|Q5BKT0|Q7L484|Q96Q10|Q9BSL8	Missense_Mutation	SNP	ENST00000315073.5	37	CCDS4466.1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.626993	0.28978	.	.	ENSG00000146063	ENST00000315073;ENST00000438174	T	0.61158	0.13	4.87	4.0	0.46444	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	D	0.000013	T	0.47469	0.1447	L	0.31804	0.96	0.38827	D	0.95576	B	0.33883	0.43	B	0.39771	0.309	T	0.51980	-0.8636	10	0.49607	T	0.09	.	9.1647	0.37043	0.0996:0.0:0.9004:0.0	.	556	Q8WV44	TRI41_HUMAN	D	556;241	ENSP00000320869:G556D	ENSP00000320869:G556D	G	+	2	0	TRIM41	180594155	1.000000	0.71417	0.970000	0.41538	0.014000	0.08584	4.931000	0.63469	1.410000	0.46936	0.455000	0.32223	GGC	.		0.657	TRIM41-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253574.3	NM_201627	
TRPV6	55503	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	142574898	142574899	+	Frame_Shift_Del	DEL	AG	AG	-	rs200244204	byFrequency	TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr7:142574898_142574899delAG	ENST00000359396.3	-	4	728_729	c.483_484delCT	c.(481-486)tactttfs	p.F162fs	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	162					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					ctctCACCAAAGTAGATGAGGT	0.624																																					p.161_162del		.											.	TRPV6	92	0			c.483_484del						.																																			SO:0001589	frameshift_variant	55503	exon4			CACCAAAGTAGAT	AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.483_484delCT	7.37:g.142574898_142574899delAG	ENSP00000352358:p.Phe162fs	78.0	0.0		75.0	39.0	NM_018646	A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Frame_Shift_Del	DEL	ENST00000359396.3	37	CCDS5874.1																																																																																			.		0.624	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347662.1	NM_014274	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179435859	179435859	+	Silent	SNP	A	A	G			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr2:179435859A>G	ENST00000591111.1	-	276	70301	c.70077T>C	c.(70075-70077)tgT>tgC	p.C23359C	TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Silent_p.C25000C|TTN_ENST00000342992.6_Silent_p.C22432C|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000460472.2_Silent_p.C15935C|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Silent_p.C16060C|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Silent_p.C16127C|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	23359	Fibronectin type-III 69. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGCCACATAACATTCTGATA	0.463																																					p.C25000C		.											.	TTN	636	0			c.T75000C						.						119.0	121.0	121.0					2																	179435859		1991	4169	6160	SO:0001819	synonymous_variant	7273	exon326			CACATAACATTCT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.70077T>C	2.37:g.179435859A>G		49.0	0.0		41.0	16.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																				.		0.463	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UBR4	23352	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	19525340	19525340	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr1:19525340A>T	ENST00000375254.3	-	4	488	c.461T>A	c.(460-462)aTg>aAg	p.M154K	UBR4_ENST00000375226.2_Missense_Mutation_p.M154K|UBR4_ENST00000375217.2_Missense_Mutation_p.M154K|UBR4_ENST00000375267.2_Missense_Mutation_p.M154K	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	154					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GGATTTCATCATTGCTGTAAA	0.448																																					p.M154K		.											.	UBR4	612	0			c.T461A						.						142.0	139.0	140.0					1																	19525340		2203	4300	6503	SO:0001583	missense	23352	exon4			TTCATCATTGCTG	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.461T>A	1.37:g.19525340A>T	ENSP00000364403:p.Met154Lys	158.0	0.0		128.0	42.0	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	A	18.11	3.550609	0.65311	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.24538	1.86;1.86;1.86;1.85	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.24774	0.0601	N	0.12182	0.205	0.80722	D	1	P	0.40431	0.717	P	0.49047	0.599	T	0.11299	-1.0593	10	0.56958	D	0.05	.	14.2818	0.66219	1.0:0.0:0.0:0.0	.	154	Q5T4S7	UBR4_HUMAN	K	154	ENSP00000364403:M154K;ENSP00000364416:M154K;ENSP00000364365:M154K;ENSP00000364374:M154K	ENSP00000364365:M154K	M	-	2	0	UBR4	19397927	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.281000	0.95811	2.053000	0.61076	0.460000	0.39030	ATG	.		0.448	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
WDR45	11152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	48933031	48933031	+	Silent	SNP	G	G	A			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chrX:48933031G>A	ENST00000376372.3	-	9	1000	c.819C>T	c.(817-819)cgC>cgT	p.R273R	WDR45_ENST00000322995.8_Silent_p.R284R|WDR45_ENST00000465431.1_5'Flank|PRAF2_ENST00000491199.1_5'Flank|PRAF2_ENST00000376390.4_5'Flank|AF196779.12_ENST00000376358.3_Silent_p.R171R|WDR45_ENST00000473974.1_Intron|WDR45_ENST00000485908.1_Silent_p.R238R|WDR45_ENST00000376368.2_Silent_p.R274R|PRAF2_ENST00000376386.3_5'Flank|WDR45_ENST00000356463.3_Silent_p.R274R|WDR45_ENST00000396681.4_Silent_p.R259R|WDR45_ENST00000553851.1_Silent_p.R171R	NM_001029896.1	NP_001025067.1	Q9Y484	WIPI4_HUMAN	WD repeat domain 45	273					autophagy (GO:0006914)|cell death (GO:0008219)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	19						ACGCGGAGCGGCGGTTGAGGC	0.592																																					p.R274R		.											.	WDR45	131	0			c.C822T						.						22.0	22.0	22.0					X																	48933031		2203	4296	6499	SO:0001819	synonymous_variant	11152	exon10			GGAGCGGCGGTTG	BC003037	CCDS14318.1, CCDS35250.1	Xp11.23	2013-06-06	2004-09-02	2004-09-03	ENSG00000196998	ENSG00000196998		"""WD repeat domain containing"""	28912	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 5"""	300526	"""WD repeat domain, X-linked 1"""	WDRX1		12477932	Standard	NM_007075		Approved	JM5, WIPI4, NBIA5	uc004dmk.1	Q9Y484	OTTHUMG00000034500	ENST00000376372.3:c.819C>T	X.37:g.48933031G>A		146.0	0.0		118.0	35.0	NM_007075	A6NGH5|B7WPI2|Q5MNZ5|Q6IBS7|Q6NT94|Q96H03	Silent	SNP	ENST00000376372.3	37	CCDS35250.1	.	.	.	.	.	.	.	.	.	.	G	10.34	1.323237	0.24080	.	.	ENSG00000196998	ENST00000367375	.	.	.	4.09	-0.028	0.13924	.	.	.	.	.	T	0.43233	0.1238	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21314	-1.0249	4	.	.	.	-12.4629	3.2163	0.06700	0.287:0.0:0.3869:0.3262	.	.	.	.	S	200	.	.	P	-	1	0	WDR45	48819975	0.817000	0.29147	0.999000	0.59377	0.937000	0.57800	-0.281000	0.08456	-0.036000	0.13669	-0.578000	0.04140	CCG	.		0.592	WDR45-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083418.2	NM_007075	
WDR59	79726	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	74919609	74919609	+	Silent	SNP	C	C	T			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr16:74919609C>T	ENST00000262144.6	-	25	2761	c.2631G>A	c.(2629-2631)gaG>gaA	p.E877E		NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	877										breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27						CAGCTCGCTTCTCTCTCAGAC	0.463																																					p.E877E		.											.	WDR59	92	0			c.G2631A						.						118.0	106.0	110.0					16																	74919609		2198	4300	6498	SO:0001819	synonymous_variant	79726	exon25			TCGCTTCTCTCTC	AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091		"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product						11572484	Standard	XM_005256146		Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.2631G>A	16.37:g.74919609C>T		99.0	0.0		113.0	39.0	NM_030581	B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	Silent	SNP	ENST00000262144.6	37	CCDS32488.1																																																																																			.		0.463	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410601.3	NM_030581	
WWC1	23286	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	167857166	167857182	+	Frame_Shift_Del	DEL	TGCAATATTAATCATCC	TGCAATATTAATCATCC	-	rs149629970		TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	TGCAATATTAATCATCC	TGCAATATTAATCATCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr5:167857166_167857182delTGCAATATTAATCATCC	ENST00000265293.4	+	14	2527_2543	c.2025_2041delTGCAATATTAATCATCC	c.(2023-2043)tttgcaatattaatcatccagfs	p.FAILIIQ675fs	WWC1_ENST00000521089.1_Frame_Shift_Del_p.FAILIIQ675fs	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	675	C2.				cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		ATAAGCAATTTGCAATATTAATCATCCAGCTGAGTAA	0.401																																					p.675_681del		.											.	WWC1	157	0			c.2025_2041del						.																																			SO:0001589	frameshift_variant	23286	exon14			GCAATTTGCAATA	AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.2025_2041delTGCAATATTAATCATCC	5.37:g.167857166_167857182delTGCAATATTAATCATCC	ENSP00000265293:p.Phe675fs	61.0	0.0		42.0	10.0	NM_015238	B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Frame_Shift_Del	DEL	ENST00000265293.4	37	CCDS4366.1																																																																																			.		0.401	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252791.2	NM_015238	
WWC2	80014	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	184182412	184182412	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr4:184182412C>G	ENST00000403733.3	+	11	1835	c.1636C>G	c.(1636-1638)Ctg>Gtg	p.L546V	WWC2_ENST00000378925.3_Missense_Mutation_p.L448V|WWC2_ENST00000504005.1_Missense_Mutation_p.L228V|WWC2_ENST00000448232.2_Missense_Mutation_p.L546V|WWC2_ENST00000513834.1_Missense_Mutation_p.L546V	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	546					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		TGTGGCCTCCCTGTCCTCGAG	0.602																																					p.L546V		.											.	WWC2	93	0			c.C1636G						.						89.0	68.0	75.0					4																	184182412		2203	4300	6503	SO:0001583	missense	80014	exon11			GCCTCCCTGTCCT	BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685	ENST00000403733.3:c.1636C>G	4.37:g.184182412C>G	ENSP00000384222:p.Leu546Val	47.0	0.0		48.0	18.0	NM_024949	Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	Missense_Mutation	SNP	ENST00000403733.3	37	CCDS34109.2	.	.	.	.	.	.	.	.	.	.	C	17.45	3.393906	0.62066	.	.	ENSG00000151718	ENST00000403733;ENST00000378925;ENST00000513834;ENST00000448232;ENST00000504005	T;T;T;T;T	0.28666	2.38;1.6;2.46;2.2;2.18	4.97	4.14	0.48551	.	0.105348	0.41500	D	0.000878	T	0.56485	0.1988	M	0.86268	2.805	0.47214	D	0.999358	D;D	0.89917	0.999;1.0	D;D	0.83275	0.918;0.996	T	0.58819	-0.7569	10	0.23891	T	0.37	-9.4531	13.3408	0.60542	0.0:0.9244:0.0:0.0756	.	546;546	Q6AWC2;Q6AWC2-4	WWC2_HUMAN;.	V	546;448;546;546;228	ENSP00000384222:L546V;ENSP00000368205:L448V;ENSP00000425054:L546V;ENSP00000398577:L546V;ENSP00000427569:L228V	ENSP00000368205:L448V	L	+	1	2	WWC2	184419406	0.998000	0.40836	1.000000	0.80357	0.946000	0.59487	3.571000	0.53841	1.336000	0.45506	-0.225000	0.12378	CTG	.		0.602	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319608.1	NM_024949	
POTEH	23784	broad.mit.edu;bcgsc.ca	37	22	16267054	16267055	+	Missense_Mutation	DNP	TC	TC	GT			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	TC	TC	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr22:16267054_16267055TC>GT	ENST00000343518.6	-	9	1445_1446	c.1394_1395GA>AC	c.(1393-1395)gGA>gAC	p.G465D		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	465										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						TTTCTGGGAATCCCATATGAGT	0.386																																					p.G465D		.											.	.	.	0			.						.																																			SO:0001583	missense	23784	.			TGGGAATCCCATA	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.1394_1395delinsGT	22.37:g.16267054_16267055delinsGT	ENSP00000340610:p.Gly465Asp	978.0	1.0		920.0	58.0	.	A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	DNP	ENST00000343518.6	37	CCDS46658.1																																																																																			.		0.386	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213	
OPRM1	4988	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	154360707	154360708	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-DD-A73C-01A-12D-A33K-10	TCGA-DD-A73C-10A-01D-A33K-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ffe9f06b-c676-4f9f-8bc5-cd6a3db3f2ca	27060b4f-ef3b-4437-90c3-99ef91ddbc47	g.chr6:154360707_154360708GC>TT	ENST00000330432.7	+	1	265_266	c.28_29GC>TT	c.(28-30)GCc>TTc	p.A10F	OPRM1_ENST00000452687.2_Missense_Mutation_p.A10F|OPRM1_ENST00000337049.4_Missense_Mutation_p.A10F|OPRM1_ENST00000518759.1_Intron|OPRM1_ENST00000523520.1_3'UTR|OPRM1_ENST00000419506.2_Missense_Mutation_p.A10F|OPRM1_ENST00000435918.2_Missense_Mutation_p.A10F|OPRM1_ENST00000524163.1_Missense_Mutation_p.A10F|OPRM1_ENST00000434900.2_Missense_Mutation_p.A103F|OPRM1_ENST00000520708.1_Intron|OPRM1_ENST00000414028.2_Missense_Mutation_p.A10F|OPRM1_ENST00000360422.4_Missense_Mutation_p.A10F|OPRM1_ENST00000428397.2_Missense_Mutation_p.A10F|OPRM1_ENST00000229768.5_Missense_Mutation_p.A10F	NM_000914.3	NP_000905.3	P35372	OPRM_HUMAN	opioid receptor, mu 1	10					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCCCACGAACGCCAGCAATTGC	0.634																																					p.A103F		.											.	.	.	0			.						.																																			SO:0001583	missense	4988	.			ACGAACGCCAGCA	L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870	Exception_encountered	6.37:g.154360707_154360708delinsTT	ENSP00000328264:p.Ala10Phe	83.0	0.0		103.0	38.0	.	B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Missense_Mutation	DNP	ENST00000330432.7	37	CCDS55070.1																																																																																			.		0.634	OPRM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042786.2	NM_000914	
